#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PPRC1	23082	broad.mit.edu	37	10	103901280	103901280	+	Silent	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr10:103901280C>A	ENST00000278070.2	+	5	3054	c.3015C>A	c.(3013-3015)gcC>gcA	p.A1005A	PPRC1_ENST00000413464.2_Silent_p.A1005A|PPRC1_ENST00000370012.1_5'UTR	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1005	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A1005A(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TGCCTCCAGCCTCCATTGGGA	0.567																																					p.A1005A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3015A	10						.						48.0	49.0	49.0					10																	103901280		2203	4300	6503	103891270	SO:0001819	synonymous_variant	23082	exon5			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.3015C>A	10.37:g.103901280C>A		Somatic		Capture	Illumina HiSeq	Phase_I	103891270	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Silent	SNP	ENST00000278070.2	37	CCDS7529.1																																																																																				0.567	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
CUBN	8029	broad.mit.edu	37	10	16967417	16967417	+	Missense_Mutation	SNP	T	T	A	rs144360241	byFrequency	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr10:16967417T>A	ENST00000377833.4	-	43	6534	c.6469A>T	c.(6469-6471)Aat>Tat	p.N2157Y		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2157	CUB 15. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.N2157Y(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCAGGACCATTTCTTAGCTGG	0.403																																					p.N2157Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6469T	10						.						43.0	44.0	44.0					10																	16967417		2203	4300	6503	17007423	SO:0001583	missense	8029	exon43			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6469A>T	10.37:g.16967417T>A	ENSP00000367064:p.Asn2157Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	17007423	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.554611	0.65425	.	.	ENSG00000107611	ENST00000377833	T	0.30714	1.52	5.32	5.32	0.75619	CUB (5);	0.000000	0.50627	D	0.000117	T	0.61451	0.2348	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68819	-0.5308	10	0.72032	D	0.01	.	15.4412	0.75184	0.0:0.0:0.0:1.0	.	2157	O60494	CUBN_HUMAN	Y	2157	ENSP00000367064:N2157Y	ENSP00000367064:N2157Y	N	-	1	0	CUBN	17007423	1.000000	0.71417	0.997000	0.53966	0.553000	0.35397	7.281000	0.78621	2.241000	0.73720	0.533000	0.62120	AAT		0.403	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
GPR158	57512	broad.mit.edu	37	10	25510086	25510086	+	Splice_Site	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr10:25510086G>A	ENST00000376351.3	+	2	1367	c.1008G>A	c.(1006-1008)gaG>gaA	p.E336E		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	336					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.E336E(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						ACAATTCAGAGGTAAGAAGAT	0.353																																					p.E336E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1008A	10						.						82.0	82.0	82.0					10																	25510086		2203	4300	6503	25550092	SO:0001630	splice_region_variant	57512	exon2			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1008+1G>A	10.37:g.25510086G>A		Somatic		Capture	Illumina HiSeq	Phase_I	25550092	NM_020752	Q6QR81|Q9ULT3	Silent	SNP	ENST00000376351.3	37	CCDS31166.1																																																																																				0.353	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	Silent
PSAP	5660	broad.mit.edu	37	10	73579613	73579613	+	Silent	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr10:73579613C>A	ENST00000394936.3	-	10	1197	c.1050G>T	c.(1048-1050)ccG>ccT	p.P350P	PSAP_ENST00000394934.1_Silent_p.P352P			P07602	SAP_HUMAN	prosaposin	350	Saposin B-type 3. {ECO:0000255|PROSITE- ProRule:PRU00415}.				blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)	p.P350P(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						ACAGGGACTTCGGCAGCTTCG	0.577																																					p.P353P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1059T	10						.						40.0	41.0	40.0					10																	73579613		2203	4300	6503	73249619	SO:0001819	synonymous_variant	5660	exon11			BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.1050G>T	10.37:g.73579613C>A		Somatic		Capture	Illumina HiSeq	Phase_I	73249619	NM_001042465	P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Silent	SNP	ENST00000394936.3	37	CCDS7311.1																																																																																				0.577	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778	
SLIT1	6585	broad.mit.edu	37	10	98807456	98807456	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr10:98807456G>A	ENST00000266058.4	-	16	1870	c.1625C>T	c.(1624-1626)aCg>aTg	p.T542M	SLIT1_ENST00000371070.4_Missense_Mutation_p.T542M|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	542					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.T542M(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CAGTTCTGCCGTGGACTGGGG	0.632																																					p.T542M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1625T	10						.						76.0	82.0	80.0					10																	98807456		2203	4300	6503	98797446	SO:0001583	missense	6585	exon16			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1625C>T	10.37:g.98807456G>A	ENSP00000266058:p.Thr542Met	Somatic		Capture	Illumina HiSeq	Phase_I	98797446	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.572060	0.65765	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	T;T;T	0.23754	3.57;3.57;1.89	4.54	4.54	0.55810	Leucine-rich repeat-containing N-terminal (1);	0.104226	0.64402	D	0.000004	T	0.53318	0.1789	M	0.79805	2.47	0.80722	D	1	D;D	0.76494	0.999;0.997	D;P	0.66979	0.948;0.555	T	0.61058	-0.7139	10	0.87932	D	0	.	17.8601	0.88778	0.0:0.0:1.0:0.0	.	552;542	E7EWQ8;O75093	.;SLIT1_HUMAN	M	542;552;542;535	ENSP00000266058:T542M;ENSP00000360109:T542M;ENSP00000315005:T535M	ENSP00000266058:T542M	T	-	2	0	SLIT1	98797446	1.000000	0.71417	0.987000	0.45799	0.413000	0.31143	8.996000	0.93539	2.517000	0.84864	0.563000	0.77884	ACG		0.632	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
HTRA1	5654	broad.mit.edu	37	10	124249108	124249108	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr10:124249108A>C	ENST00000368984.3	+	3	871	c.743A>C	c.(742-744)aAa>aCa	p.K248T		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	248	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.K248T(1)		endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				GTGGATGAGAAAGCAGACATC	0.522																																					p.K248T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A743C	10						.						129.0	99.0	109.0					10																	124249108		2203	4300	6503	124239098	SO:0001583	missense	5654	exon3			AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.743A>C	10.37:g.124249108A>C	ENSP00000357980:p.Lys248Thr	Somatic		Capture	Illumina HiSeq	Phase_I	124239098	NM_002775	D3DRE4|Q9UNS5	Missense_Mutation	SNP	ENST00000368984.3	37	CCDS7630.1	.	.	.	.	.	.	.	.	.	.	A	18.99	3.739126	0.69304	.	.	ENSG00000166033	ENST00000368984;ENST00000435263	D	0.88431	-2.38	5.13	5.13	0.70059	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.000000	0.85682	D	0.000000	T	0.81470	0.4829	N	0.04705	-0.18	0.80722	D	1	P	0.39624	0.681	P	0.44422	0.449	T	0.82600	-0.0377	10	0.34782	T	0.22	-22.666	14.9758	0.71269	1.0:0.0:0.0:0.0	.	248	Q92743	HTRA1_HUMAN	T	248;215	ENSP00000357980:K248T	ENSP00000357980:K248T	K	+	2	0	HTRA1	124239098	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.345000	0.79337	1.935000	0.56089	0.528000	0.53228	AAA		0.522	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128327.1	NM_002775	
ATM	472	broad.mit.edu	37	11	108199963	108199963	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:108199963C>G	ENST00000452508.2	+	50	7494	c.7305C>G	c.(7303-7305)aaC>aaG	p.N2435K	ATM_ENST00000278616.4_Missense_Mutation_p.N2435K|C11orf65_ENST00000525729.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2435	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.N2435K(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTCAGACAAACAGGTAACTAG	0.358			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.N2435K		yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7305G	11						.						52.0	51.0	52.0					11																	108199963		2201	4298	6499	107705173	SO:0001583	missense	472	exon49	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.7305C>G	11.37:g.108199963C>G	ENSP00000388058:p.Asn2435Lys	Somatic		Capture	Illumina HiSeq	Phase_I	107705173	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.394868	0.62066	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.76709	-1.04;-1.04	5.32	5.32	0.75619	PIK-related kinase (1);PIK-related kinase, FAT (1);Armadillo-type fold (1);	0.179966	0.64402	D	0.000019	T	0.73087	0.3542	M	0.62723	1.935	0.80722	D	1	P	0.48998	0.918	B	0.43990	0.438	T	0.69555	-0.5114	10	0.12103	T	0.63	.	10.6397	0.45586	0.0:0.8511:0.0:0.1489	.	2435	Q13315	ATM_HUMAN	K	2435	ENSP00000278616:N2435K;ENSP00000388058:N2435K	ENSP00000278616:N2435K	N	+	3	2	ATM	107705173	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	2.453000	0.44970	2.493000	0.84123	0.650000	0.86243	AAC		0.358	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
TMPRSS13	84000	broad.mit.edu	37	11	117774810	117774810	+	Missense_Mutation	SNP	G	G	A	rs563252646	byFrequency	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:117774810G>A	ENST00000430170.2	-	11	1475	c.1388C>T	c.(1387-1389)aCa>aTa	p.T463I	TMPRSS13_ENST00000524993.1_Missense_Mutation_p.T463I|TMPRSS13_ENST00000445164.2_Missense_Mutation_p.T463I|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.T428I	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	463	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.T463I(1)		endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		GAAGGGGGATGTCTTGTCTTC	0.522																																					p.T463I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1388T	11						.						58.0	66.0	63.0					11																	117774810		2041	4176	6217	117280020	SO:0001583	missense	84000	exon11			AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.1388C>T	11.37:g.117774810G>A	ENSP00000387702:p.Thr463Ile	Somatic		Capture	Illumina HiSeq	Phase_I	117280020	NM_001077263	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686235	0.88639	.	.	ENSG00000137747	ENST00000528626;ENST00000336500;ENST00000524993;ENST00000430170;ENST00000445164	D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41	4.98	4.98	0.66077	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.183250	0.37906	N	0.001896	D	0.89378	0.6698	N	0.14661	0.345	0.80722	D	1	P;D;D	0.89917	0.86;1.0;0.963	P;D;P	0.77557	0.572;0.99;0.758	D	0.91220	0.5006	10	0.62326	D	0.03	.	16.4305	0.83840	0.0:0.0:1.0:0.0	.	458;458;463	E9PHM4;Q9BYE2;E9PRA0	.;TMPSD_HUMAN;.	I	428;458;463;463;463	ENSP00000435813:T428I;ENSP00000434279:T463I;ENSP00000387702:T463I;ENSP00000394114:T463I	ENSP00000337113:T458I	T	-	2	0	TMPRSS13	117280020	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.315000	0.65810	2.489000	0.83994	0.551000	0.68910	ACA		0.522	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
TALDO1	6888	broad.mit.edu	37	11	763910	763910	+	Silent	SNP	C	C	T	rs142263629	byFrequency	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:763910C>T	ENST00000319006.3	+	6	954	c.801C>T	c.(799-801)aaC>aaT	p.N267N	TALDO1_ENST00000528097.1_Silent_p.N267N			P37837	TALDO_HUMAN	transaldolase 1	267					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glyceraldehyde-3-phosphate metabolic process (GO:0019682)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	monosaccharide binding (GO:0048029)|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity (GO:0004801)	p.N267N(1)		breast(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(2)	14		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)		TGCAGGACAACGCCAAGCTGG	0.667													C|||	32	0.00638978	0.0219	0.0043	5008	,	,		17889	0.0		0.0	False		,,,				2504	0.0				p.N267N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C801T	11						.	C		73,4333	65.3+/-102.7	0,73,2130	62.0	62.0	62.0		801	0.8	0.0	11	dbSNP_134	62	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TALDO1	NM_006755.1		0,74,6429	TT,TC,CC		0.0116,1.6568,0.569		267/338	763910	74,12932	2203	4300	6503	753910	SO:0001819	synonymous_variant	6888	exon6				CCDS7712.1	11p15.5-p15.4	2009-12-02			ENSG00000177156	ENSG00000177156	2.2.1.2		11559	protein-coding gene	gene with protein product		602063				9339383	Standard	NM_006755		Approved		uc001lqz.3	P37837	OTTHUMG00000133318	ENST00000319006.3:c.801C>T	11.37:g.763910C>T		Somatic		Capture	Illumina HiSeq	Phase_I	753910	NM_006755	B2R8M2|O00751|Q8WV32|Q8WZ45	Silent	SNP	ENST00000319006.3	37	CCDS7712.1																																																																																				0.667	TALDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257116.1	NM_006755	
PGAP2	27315	broad.mit.edu	37	11	3838752	3838752	+	Intron	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:3838752C>T	ENST00000463452.2	+	2	248				PGAP2_ENST00000396991.2_Missense_Mutation_p.A112V|PGAP2_ENST00000396986.2_Intron|PGAP2_ENST00000396993.4_Intron|PGAP2_ENST00000278243.4_Missense_Mutation_p.A112V|PGAP2_ENST00000496834.2_Intron|PGAP2_ENST00000479072.1_Intron|PGAP2_ENST00000493547.2_Intron|AC090587.2_ENST00000507938.1_RNA|PGAP2_ENST00000300730.6_Intron|PGAP2_ENST00000465307.2_Intron|PGAP2_ENST00000532017.1_Intron	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2						GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)	p.A112V(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						TACACGGTGGCCACTGACTGT	0.572																																					p.A112V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C335T	11						.						100.0	90.0	93.0					11																	3838752		2201	4298	6499	3795328	SO:0001627	intron_variant	27315	exon3			AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.165+6098C>T	11.37:g.3838752C>T		Somatic		Capture	Illumina HiSeq	Phase_I	3795328	NM_014489	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Missense_Mutation	SNP	ENST00000463452.2	37	CCDS58112.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.30|17.30	3.354379|3.354379	0.61293|0.61293	.|.	.|.	ENSG00000148985|ENSG00000148985	ENST00000396991;ENST00000278243;ENST00000502872|ENST00000532535;ENST00000464906	T;T|.	0.42900|.	0.96;0.96|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.000000|.	0.48767|.	D|.	0.000164|.	T|T	0.64170|0.64170	0.2574|0.2574	M|M	0.67397|0.67397	2.05|2.05	0.32675|0.32675	N|N	0.516273|0.516273	P|.	0.51791|.	0.948|.	P|.	0.51229|.	0.663|.	T|T	0.71344|0.71344	-0.4621|-0.4621	10|5	0.17369|.	T|.	0.5|.	-15.8275|-15.8275	14.9723|14.9723	0.71243|0.71243	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	112|.	Q9UHJ9|.	PGAP2_HUMAN|.	V|S	112;112;52|125;142	ENSP00000380188:A112V;ENSP00000278243:A112V|.	ENSP00000278243:A112V|.	A|P	+|+	2|1	0|0	PGAP2|PGAP2	3795328|3795328	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.601000|4.601000	0.61090|0.61090	2.584000|2.584000	0.87258|0.87258	0.650000|0.650000	0.86243|0.86243	GCC|CCA		0.572	PGAP2-049	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000383260.1		
TRIM51	84767	broad.mit.edu	37	11	55658833	55658833	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:55658833T>C	ENST00000449290.2	+	7	1176	c.1084T>C	c.(1084-1086)Tgg>Cgg	p.W362R	TRIM51_ENST00000244891.3_Missense_Mutation_p.W219R	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	362	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.W362R(1)|p.W203R(1)									TAACAATTATTGGAAAGAGAA	0.448																																					p.W362R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1084C	11						.						40.0	44.0	43.0					11																	55658833		2084	3996	6080	55415409	SO:0001583	missense	84767	exon7			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.1084T>C	11.37:g.55658833T>C	ENSP00000395086:p.Trp362Arg	Somatic		Capture	Illumina HiSeq	Phase_I	55415409	NM_032681	A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	37		.	.	.	.	.	.	.	.	.	.	.	8.517	0.867973	0.17250	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.60548	0.18;0.18	1.36	-2.72	0.05968	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.48059	0.1479	L	0.36672	1.1	0.09310	N	1	B	0.34399	0.452	B	0.43575	0.424	T	0.50372	-0.8836	9	0.46703	T	0.11	.	5.1239	0.14875	0.0:0.0:0.6253:0.3747	.	362	Q9BSJ1	SPRY5_HUMAN	R	362;219	ENSP00000395086:W362R;ENSP00000244891:W219R	ENSP00000244891:W219R	W	+	1	0	SPRYD5	55415409	0.000000	0.05858	0.001000	0.08648	0.543000	0.35085	-0.747000	0.04823	-0.454000	0.07066	0.136000	0.15936	TGG		0.448	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
OR5AP2	338675	broad.mit.edu	37	11	56408997	56408997	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:56408997G>T	ENST00000302981.1	-	1	918	c.919C>A	c.(919-921)Cta>Ata	p.L307I	OR5AP2_ENST00000544374.1_Missense_Mutation_p.L308I	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L307I(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						ATCTTCTTTAGGGCCTTTTTT	0.338																																					p.L307I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C919A	11						.						79.0	77.0	78.0					11																	56408997		2201	4296	6497	56165573	SO:0001583	missense	338675	exon1			AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.919C>A	11.37:g.56408997G>T	ENSP00000303111:p.Leu307Ile	Somatic		Capture	Illumina HiSeq	Phase_I	56165573	NM_001002925	B2RNM8	Missense_Mutation	SNP	ENST00000302981.1	37	CCDS31534.1	.	.	.	.	.	.	.	.	.	.	G	4.032	0.003537	0.07866	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.42900	0.96;0.96	4.94	-9.01	0.00744	.	0.393075	0.18469	N	0.140271	T	0.22475	0.0542	L	0.52759	1.655	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.09596	-1.0667	10	0.42905	T	0.14	.	0.8614	0.01194	0.3038:0.2739:0.2435:0.1788	.	307	Q8NGF4	O5AP2_HUMAN	I	308;307	ENSP00000442701:L308I;ENSP00000303111:L307I	ENSP00000303111:L307I	L	-	1	2	OR5AP2	56165573	0.000000	0.05858	0.000000	0.03702	0.177000	0.22998	-2.499000	0.00968	-1.897000	0.01101	-0.196000	0.12772	CTA		0.338	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391613.1	NM_001002925	
OR1S2	219958	broad.mit.edu	37	11	57971512	57971512	+	Missense_Mutation	SNP	A	A	G	rs147374552		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:57971512A>G	ENST00000302592.6	-	1	141	c.142T>C	c.(142-144)Tat>Cat	p.Y48H		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y48H(1)		endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				GTGACCACATACATACTCAGG	0.463													A|||	1	0.000199681	0.0	0.0	5008	,	,		21327	0.0		0.001	False		,,,				2504	0.0				p.Y48H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T142C	11						.	A	HIS/TYR	0,4402		0,0,2201	188.0	177.0	181.0		142	4.2	1.0	11	dbSNP_134	181	3,8589	3.0+/-9.4	0,3,4293	yes	missense	OR1S2	NM_001004459.1	83	0,3,6494	GG,GA,AA		0.0349,0.0,0.0231	probably-damaging	48/326	57971512	3,12991	2201	4296	6497	57728088	SO:0001583	missense	219958	exon1			BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.142T>C	11.37:g.57971512A>G	ENSP00000305469:p.Tyr48His	Somatic		Capture	Illumina HiSeq	Phase_I	57728088	NM_001004459	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	12.12	1.843403	0.32606	0.0	3.49E-4	ENSG00000197887	ENST00000302592	T	0.04654	3.58	4.25	4.25	0.50352	.	0.000000	0.44483	D	0.000453	T	0.28433	0.0703	M	0.93808	3.46	0.31272	N	0.691609	D	0.89917	1.0	D	0.91635	0.999	T	0.48592	-0.9022	10	0.72032	D	0.01	.	12.6357	0.56683	1.0:0.0:0.0:0.0	.	48	Q8NGQ3	OR1S2_HUMAN	H	48	ENSP00000305469:Y48H	ENSP00000305469:Y48H	Y	-	1	0	OR1S2	57728088	0.998000	0.40836	1.000000	0.80357	0.735000	0.41995	4.424000	0.59868	1.918000	0.55548	0.528000	0.53228	TAT		0.463	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
FCHSD2	9873	broad.mit.edu	37	11	72553807	72553807	+	Silent	SNP	A	A	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:72553807A>G	ENST00000409418.4	-	17	2168	c.1785T>C	c.(1783-1785)cgT>cgC	p.R595R	FCHSD2_ENST00000458644.2_Silent_p.R459R|ATG16L2_ENST00000534905.1_3'UTR|FCHSD2_ENST00000311172.7_Silent_p.R539R|FCHSD2_ENST00000409314.1_Silent_p.R619R|FCHSD2_ENST00000409263.1_Intron	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	595	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.							p.R595R(1)|p.R539R(1)		endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			TGTTCAAGATACGGATTATTG	0.418																																					p.R595R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1785C	11						.						127.0	125.0	126.0					11																	72553807		2200	4293	6493	72231455	SO:0001819	synonymous_variant	9873	exon17			AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.1785T>C	11.37:g.72553807A>G		Somatic		Capture	Illumina HiSeq	Phase_I	72231455	NM_014824	B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Silent	SNP	ENST00000409418.4	37	CCDS8218.2																																																																																				0.418	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329429.2	NM_014824	
USP35	57558	broad.mit.edu	37	11	77909004	77909004	+	Silent	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:77909004C>A	ENST00000529308.1	+	3	957	c.696C>A	c.(694-696)gcC>gcA	p.A232A	USP35_ENST00000530267.1_Intron|USP35_ENST00000530535.1_Intron|USP35_ENST00000526425.1_5'Flank|USP35_ENST00000441408.2_De_novo_Start_InFrame	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	232					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.A232A(1)		endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CATCTAGCGCCCTGGCCAGCG	0.622																																					p.A232A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C696A	11						.						55.0	60.0	58.0					11																	77909004		2148	4249	6397	77586652	SO:0001819	synonymous_variant	57558	exon3			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.696C>A	11.37:g.77909004C>A		Somatic		Capture	Illumina HiSeq	Phase_I	77586652	NM_020798		Silent	SNP	ENST00000529308.1	37	CCDS41693.1																																																																																				0.622	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	XM_290527	
ME3	10873	broad.mit.edu	37	11	86267616	86267616	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:86267616C>T	ENST00000393324.3	-	3	699	c.446G>A	c.(445-447)gGc>gAc	p.G149D	ME3_ENST00000543262.1_Missense_Mutation_p.G149D|ME3_ENST00000359636.2_Missense_Mutation_p.G149D|ME3_ENST00000323418.6_Missense_Mutation_p.G87D|RP11-317J19.1_ENST00000524610.1_RNA	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	149					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.G149D(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				GAAAGTCAGGCCATAGTGCTG	0.587																																					p.G149D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G446A	11						.						61.0	50.0	54.0					11																	86267616		2202	4299	6501	85945264	SO:0001583	missense	10873	exon4			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.446G>A	11.37:g.86267616C>T	ENSP00000376998:p.Gly149Asp	Somatic		Capture	Illumina HiSeq	Phase_I	85945264	NM_001161586	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	35	5.442108	0.96187	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826;ENST00000545395;ENST00000323418;ENST00000530335	T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54	5.7	5.7	0.88788	Malic enzyme, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.60805	0.2297	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.60692	-0.7213	9	.	.	.	-1.117	19.8411	0.96685	0.0:1.0:0.0:0.0	.	149	Q16798	MAON_HUMAN	D	149;149;149;149;87;87;149	ENSP00000352657:G149D;ENSP00000440246:G149D;ENSP00000376998:G149D;ENSP00000431182:G149D;ENSP00000315255:G87D;ENSP00000434690:G149D	.	G	-	2	0	ME3	85945264	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.619000	0.83057	2.683000	0.91414	0.655000	0.94253	GGC		0.587	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2		
SESN3	143686	broad.mit.edu	37	11	94917655	94917655	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:94917655C>T	ENST00000536441.1	-	6	1202	c.866G>A	c.(865-867)cGt>cAt	p.R289H	RP11-712B9.2_ENST00000534891.1_RNA|RP11-712B9.2_ENST00000534864.1_RNA|SESN3_ENST00000416495.2_Missense_Mutation_p.R289H|SESN3_ENST00000393234.1_Missense_Mutation_p.R289H|SESN3_ENST00000278499.2_Missense_Mutation_p.R150H	NM_001271594.1|NM_144665.2	NP_001258523.1|NP_653266.2	P58005	SESN3_HUMAN	sestrin 3	289					glucose homeostasis (GO:0042593)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)|response to insulin (GO:0032868)	nucleus (GO:0005634)		p.R289H(1)		endometrium(5)|large_intestine(6)|lung(3)|skin(1)|stomach(1)	16		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.234)		CTTTTCAAAACGAGTGCTCAT	0.388																																					p.R289H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G866A	11						.						144.0	139.0	141.0					11																	94917655		2201	4298	6499	94557303	SO:0001583	missense	143686	exon6			AK096300	CCDS8303.1, CCDS60938.1	11q21	2005-09-18			ENSG00000149212	ENSG00000149212			23060	protein-coding gene	gene with protein product		607768				12607115	Standard	NM_144665		Approved	SEST3, MGC29667	uc001pfj.4	P58005	OTTHUMG00000167829	ENST00000536441.1:c.866G>A	11.37:g.94917655C>T	ENSP00000441927:p.Arg289His	Somatic		Capture	Illumina HiSeq	Phase_I	94557303	NM_144665	B7Z7P9|Q96AD1	Missense_Mutation	SNP	ENST00000536441.1	37	CCDS8303.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.011868	0.54468	.	.	ENSG00000149212	ENST00000536441;ENST00000278499;ENST00000393234;ENST00000416495	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	5.34	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.34571	0.0902	M	0.79123	2.44	0.80722	D	1	B;B;B	0.33379	0.056;0.357;0.41	B;B;B	0.26693	0.018;0.072;0.071	T	0.30357	-0.9981	10	0.59425	D	0.04	-18.0279	13.9603	0.64175	0.0:0.9268:0.0:0.0732	.	150;289;289	B7Z7P9;P58005-3;P58005	.;.;SESN3_HUMAN	H	289;150;289;289	ENSP00000441927:R289H;ENSP00000278499:R150H;ENSP00000376926:R289H;ENSP00000407008:R289H	ENSP00000278499:R150H	R	-	2	0	SESN3	94557303	1.000000	0.71417	0.982000	0.44146	0.911000	0.54048	7.020000	0.76419	1.273000	0.44346	-0.229000	0.12294	CGT		0.388	SESN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396475.3	NM_144665	
SORL1	6653	broad.mit.edu	37	11	121458806	121458806	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr11:121458806G>A	ENST00000260197.7	+	28	4021	c.3892G>A	c.(3892-3894)Gga>Aga	p.G1298R	SORL1_ENST00000532694.1_Missense_Mutation_p.G144R|SORL1_ENST00000527934.1_5'Flank|SORL1_ENST00000534286.1_Missense_Mutation_p.G208R|SORL1_ENST00000525532.1_Missense_Mutation_p.G242R	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1298	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.G1298R(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GGTCTGTGACGGAATCATCCA	0.572																																					p.G1298R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3892A	11						.						127.0	103.0	111.0					11																	121458806		2203	4299	6502	120964016	SO:0001583	missense	6653	exon28			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.3892G>A	11.37:g.121458806G>A	ENSP00000260197:p.Gly1298Arg	Somatic		Capture	Illumina HiSeq	Phase_I	120964016	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007704	0.75046	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286	D;D;D;D	0.96587	-4.06;-4.06;-4.06;-4.06	5.52	5.52	0.82312	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97726	0.9254	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97693	1.0180	10	0.48119	T	0.1	.	19.4741	0.94979	0.0:0.0:1.0:0.0	.	1298	Q92673	SORL_HUMAN	R	1298;242;144;208	ENSP00000260197:G1298R;ENSP00000434634:G242R;ENSP00000432131:G144R;ENSP00000436447:G208R	ENSP00000260197:G1298R	G	+	1	0	SORL1	120964016	1.000000	0.71417	0.561000	0.28357	0.840000	0.47671	9.434000	0.97515	2.595000	0.87683	0.655000	0.94253	GGA		0.572	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
PIK3C2G	5288	broad.mit.edu	37	12	18800927	18800927	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr12:18800927G>T	ENST00000266497.5	+	31	4341	c.4303G>T	c.(4303-4305)Gaa>Taa	p.E1435*	PIK3C2G_ENST00000433979.1_Nonsense_Mutation_p.E1435*|PIK3C2G_ENST00000538779.1_Nonsense_Mutation_p.E1476*			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1435					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)	p.E1435*(1)		breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				ACTCGATAAAGAAAAATGGTA	0.363																																					p.E1435X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G4303T	12						.						93.0	89.0	90.0					12																	18800927		1852	4094	5946	18692194	SO:0001587	stop_gained	5288	exon32			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.4303G>T	12.37:g.18800927G>T	ENSP00000266497:p.Glu1435*	Somatic		Capture	Illumina HiSeq	Phase_I	18692194	NM_004570	A1L3U0	Nonsense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	G	41	8.717332	0.98927	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	.	.	.	4.06	4.06	0.47325	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-7.823	14.5669	0.68182	0.0:0.0:1.0:0.0	.	.	.	.	X	1435;1435;1476	.	ENSP00000266497:E1435X	E	+	1	0	PIK3C2G	18692194	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.579000	0.67457	2.553000	0.86117	0.563000	0.77884	GAA		0.363	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
COL2A1	1280	broad.mit.edu	37	12	48393708	48393708	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr12:48393708C>T	ENST00000380518.3	-	2	450	c.286G>A	c.(286-288)Gcc>Acc	p.A96T	COL2A1_ENST00000337299.6_Intron	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	96					axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.A96T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CAACCACTGGCAGTGGCGAGG	0.493																																					p.A96T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G286A	12						.						65.0	70.0	69.0					12																	48393708		2034	4197	6231	46679975	SO:0001583	missense	1280	exon2			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.286G>A	12.37:g.48393708C>T	ENSP00000369889:p.Ala96Thr	Somatic		Capture	Illumina HiSeq	Phase_I	46679975	NM_001844	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	C	9.118	1.008224	0.19199	.	.	ENSG00000139219	ENST00000380518	D	0.89746	-2.56	4.66	3.78	0.43462	.	0.386128	0.26096	N	0.026366	T	0.79644	0.4481	L	0.38692	1.165	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.69569	-0.5110	10	0.21014	T	0.42	.	4.4218	0.11484	0.18:0.637:0.0:0.183	.	96	P02458	CO2A1_HUMAN	T	96	ENSP00000369889:A96T	ENSP00000369889:A96T	A	-	1	0	COL2A1	46679975	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.006000	0.29847	1.333000	0.45449	0.563000	0.77884	GCC		0.493	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
HOXC13	3229	broad.mit.edu	37	12	54338891	54338891	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr12:54338891A>C	ENST00000243056.3	+	2	1000	c.844A>C	c.(844-846)Agc>Cgc	p.S282R		NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	282					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.S282G(2)|p.S282R(1)		breast(1)|large_intestine(1)|skin(1)	3						ATACGCGGCTAGCAAGTTCAT	0.607			T	NUP98	AML																																p.S282R			Dom	yes		12	12q13.3	3229	homeo box C13		L	.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.A844C	12						.						72.0	79.0	76.0					12																	54338891		2203	4300	6503	52625158	SO:0001583	missense	3229	exon2				CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.844A>C	12.37:g.54338891A>C	ENSP00000243056:p.Ser282Arg	Somatic		Capture	Illumina HiSeq	Phase_I	52625158	NM_017410	Q5BL02|Q96J32|Q9NR24|Q9NYD5	Missense_Mutation	SNP	ENST00000243056.3	37	CCDS8865.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.868868	0.91587	.	.	ENSG00000123364	ENST00000243056	D	0.95853	-3.83	4.95	4.95	0.65309	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97170	0.9075	M	0.77103	2.36	0.80722	D	1	D	0.63046	0.992	D	0.64506	0.926	D	0.97718	1.0195	10	0.87932	D	0	.	14.0373	0.64654	1.0:0.0:0.0:0.0	.	282	P31276	HXC13_HUMAN	R	282	ENSP00000243056:S282R	ENSP00000243056:S282R	S	+	1	0	HOXC13	52625158	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.065000	0.93941	2.224000	0.72417	0.533000	0.62120	AGC		0.607	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358865.2		
ERBB3	2065	broad.mit.edu	37	12	56478922	56478922	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr12:56478922C>G	ENST00000267101.3	+	3	818	c.378C>G	c.(376-378)aaC>aaG	p.N126K	ERBB3_ENST00000411731.2_Missense_Mutation_p.N126K|ERBB3_ENST00000415288.2_Missense_Mutation_p.N67K|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	126					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.N126K(1)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			ATAACACCAACTCCAGCCACG	0.572																																					p.N126K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C378G	12						.						183.0	159.0	167.0					12																	56478922		2203	4300	6503	54765189	SO:0001583	missense	2065	exon3			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.378C>G	12.37:g.56478922C>G	ENSP00000267101:p.Asn126Lys	Somatic		Capture	Illumina HiSeq	Phase_I	54765189	NM_001005915	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442909	0.43326	.	.	ENSG00000065361	ENST00000549282;ENST00000549061;ENST00000267101;ENST00000394099;ENST00000411731;ENST00000549672;ENST00000415288	T;T;T;T;T;T	0.76448	1.32;-0.63;-1.02;1.49;-0.63;-1.02	5.6	3.8	0.43715	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000001	T	0.77212	0.4097	M	0.81179	2.53	0.80722	D	1	B;B	0.30455	0.141;0.28	B;B	0.33620	0.093;0.167	T	0.73107	-0.4087	10	0.42905	T	0.14	.	8.9477	0.35769	0.0:0.7686:0.0:0.2314	.	126;126	P21860;P21860-2	ERBB3_HUMAN;.	K	126;67;126;126;126;67;67	ENSP00000448636:N126K;ENSP00000449138:N67K;ENSP00000267101:N126K;ENSP00000415753:N126K;ENSP00000449713:N67K;ENSP00000408340:N67K	ENSP00000267101:N126K	N	+	3	2	ERBB3	54765189	0.932000	0.31603	1.000000	0.80357	0.732000	0.41865	0.037000	0.13840	0.733000	0.32492	-0.812000	0.03155	AAC		0.572	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
VWF	7450	broad.mit.edu	37	12	6128294	6128294	+	Silent	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr12:6128294C>T	ENST00000261405.5	-	28	4544	c.4290G>A	c.(4288-4290)aaG>aaA	p.K1430K		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1430	VWFA 1; binding site for platelet glycoprotein Ib. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.K1430K(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CAGGGGCCTGCTTCTCGATGA	0.577																																					p.K1430K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4290A	12						.						75.0	75.0	75.0					12																	6128294		2203	4300	6503	5998555	SO:0001819	synonymous_variant	7450	exon28				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.4290G>A	12.37:g.6128294C>T		Somatic		Capture	Illumina HiSeq	Phase_I	5998555	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	CCDS8539.1																																																																																				0.577	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
R3HDM2	22864	broad.mit.edu	37	12	57651897	57651897	+	Silent	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr12:57651897G>A	ENST00000347140.3	-	21	2673	c.2283C>T	c.(2281-2283)agC>agT	p.S761S	R3HDM2_ENST00000403821.2_Silent_p.S795S|R3HDM2_ENST00000413953.2_Silent_p.S488S|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000402412.1_Silent_p.S775S|R3HDM2_ENST00000441731.2_Silent_p.S456S|R3HDM2_ENST00000358907.2_Silent_p.S761S|R3HDM2_ENST00000546843.1_5'UTR			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	761						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S422S(1)|p.S761S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						ATGTGACAGGGCTGCTGCTCA	0.517																																					p.S761S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2283T	12						.						101.0	52.0	69.0					12																	57651897		2203	4299	6502	55938164	SO:0001819	synonymous_variant	22864	exon19			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2283C>T	12.37:g.57651897G>A		Somatic		Capture	Illumina HiSeq	Phase_I	55938164	NM_014925	Q2M1T9|Q3ZCT5	Silent	SNP	ENST00000347140.3	37	CCDS8937.2																																																																																				0.517	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
NAV3	89795	broad.mit.edu	37	12	78415571	78415571	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr12:78415571C>T	ENST00000397909.2	+	9	2125	c.1952C>T	c.(1951-1953)tCc>tTc	p.S651F	NAV3_ENST00000266692.7_Missense_Mutation_p.S651F|NAV3_ENST00000228327.6_Missense_Mutation_p.S651F|NAV3_ENST00000536525.2_Missense_Mutation_p.S651F			Q8IVL0	NAV3_HUMAN	neuron navigator 3	651						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.S651F(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCGGCTGACTCCTGTACCAGT	0.413										HNSCC(70;0.22)																											p.S651F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1952T	12						.						111.0	112.0	112.0					12																	78415571		2026	4204	6230	76939702	SO:0001583	missense	89795	exon9			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.1952C>T	12.37:g.78415571C>T	ENSP00000381007:p.Ser651Phe	Somatic		Capture	Illumina HiSeq	Phase_I	76939702	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	C	19.58	3.854918	0.71719	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.12255	2.7;2.7;2.7;2.7;2.7	5.46	5.46	0.80206	.	0.000000	0.40064	U	0.001195	T	0.14830	0.0358	L	0.48642	1.525	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.01753	-1.1281	10	0.54805	T	0.06	-2.7366	13.5975	0.61998	0.0:0.9259:0.0:0.0741	.	651;651	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	F	651	ENSP00000446628:S651F;ENSP00000446132:S651F;ENSP00000381007:S651F;ENSP00000228327:S651F;ENSP00000266692:S651F	ENSP00000228327:S651F	S	+	2	0	NAV3	76939702	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.813000	0.62620	2.576000	0.86940	0.655000	0.94253	TCC		0.413	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
ACSS3	79611	broad.mit.edu	37	12	81528764	81528764	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr12:81528764G>T	ENST00000548058.1	+	3	1536	c.626G>T	c.(625-627)aGt>aTt	p.S209I	ACSS3_ENST00000261206.3_Missense_Mutation_p.S208I			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	209						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)	p.S209I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						GAACTAAGTAGTCGCATTGAT	0.383																																					p.S209I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G626T	12						.						150.0	132.0	138.0					12																	81528764		2203	4300	6503	80052895	SO:0001583	missense	79611	exon3				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.626G>T	12.37:g.81528764G>T	ENSP00000449535:p.Ser209Ile	Somatic		Capture	Illumina HiSeq	Phase_I	80052895	NM_024560	Q8NC66	Missense_Mutation	SNP	ENST00000548058.1	37	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.731071	0.30684	.	.	ENSG00000111058	ENST00000548058;ENST00000261206	T;T	0.40756	1.02;1.02	5.83	-3.81	0.04294	AMP-dependent synthetase/ligase (1);	0.612141	0.18917	N	0.127588	T	0.27731	0.0682	L	0.40543	1.245	0.19300	N	0.99997	B	0.20164	0.042	B	0.18561	0.022	T	0.23762	-1.0179	10	0.31617	T	0.26	-4.9123	10.5958	0.45336	0.0639:0.6027:0.1833:0.1501	.	209	Q9H6R3	ACSS3_HUMAN	I	209;208	ENSP00000449535:S209I;ENSP00000261206:S208I	ENSP00000261206:S208I	S	+	2	0	ACSS3	80052895	0.403000	0.25319	0.551000	0.28230	0.977000	0.68977	0.520000	0.22878	-0.243000	0.09653	0.563000	0.77884	AGT		0.383	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
GOLGA3	2802	broad.mit.edu	37	12	133393260	133393260	+	Frame_Shift_Del	DEL	G	G	-	rs371677235		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr12:133393260delG	ENST00000450791.2	-	2	455	c.272delC	c.(271-273)cctfs	p.P91fs	GOLGA3_ENST00000204726.3_Frame_Shift_Del_p.P91fs|GOLGA3_ENST00000456883.2_Frame_Shift_Del_p.P91fs|GOLGA3_ENST00000537452.1_Frame_Shift_Del_p.P91fs|GOLGA3_ENST00000545875.1_Frame_Shift_Del_p.P91fs			Q08378	GOGA3_HUMAN	golgin A3	91	Pro-rich.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.P91fs*14(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		AGAGGCATCAGGGCCCACTGG	0.592																																					p.P91fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.272delC	12						.						103.0	102.0	102.0					12																	133393260		2203	4300	6503	131903333	SO:0001589	frameshift_variant	2802	exon3			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.272delC	12.37:g.133393260delG	ENSP00000410378:p.Pro91fs	Somatic		Capture	Illumina HiSeq	Phase_I	131903333	NM_001172557	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Frame_Shift_Del	DEL	ENST00000450791.2	37	CCDS9281.1																																																																																				0.592	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895	
DIS3	22894	broad.mit.edu	37	13	73335947	73335947	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr13:73335947G>A	ENST00000377767.4	-	18	2448	c.2348C>T	c.(2347-2349)gCa>gTa	p.A783V	DIS3_ENST00000545453.1_Missense_Mutation_p.A621V|DIS3_ENST00000377780.4_Missense_Mutation_p.A753V	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	783					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)	p.A783V(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		AATGACATCTGCGTATCTAGA	0.343										Multiple Myeloma(4;0.011)																											p.A753V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2258T	13						.						87.0	81.0	83.0					13																	73335947		2203	4300	6503	72233948	SO:0001583	missense	22894	exon18			AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.2348C>T	13.37:g.73335947G>A	ENSP00000366997:p.Ala783Val	Somatic		Capture	Illumina HiSeq	Phase_I	72233948	NM_001128226	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.467378	0.63625	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.37752	1.18;1.18;1.18	5.82	4.97	0.65823	Ribonuclease II/R, conserved site (1);Ribonuclease II/R (2);	0.142202	0.64402	D	0.000005	T	0.55369	0.1916	M	0.90483	3.12	0.80722	D	1	B;B	0.26602	0.127;0.154	B;B	0.39419	0.299;0.247	T	0.61987	-0.6949	10	0.72032	D	0.01	.	14.3347	0.66581	0.0705:0.0:0.9295:0.0	.	753;783	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	V	783;753;621	ENSP00000366997:A783V;ENSP00000367011:A753V;ENSP00000440058:A621V	ENSP00000366997:A783V	A	-	2	0	DIS3	72233948	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	7.732000	0.84908	2.745000	0.94114	0.655000	0.94253	GCA		0.343	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953	
RNASE11	122651	broad.mit.edu	37	14	21052371	21052371	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr14:21052371C>T	ENST00000610205.1	-	3	446	c.263G>A	c.(262-264)gGa>gAa	p.G88E	RNASE11_ENST00000553849.1_Missense_Mutation_p.G88E|RNASE11_ENST00000398008.2_Missense_Mutation_p.G88E|RNASE11_ENST00000398009.2_Missense_Mutation_p.G88E|RNASE11_ENST00000432835.2_Missense_Mutation_p.G88E|RNASE11_ENST00000555841.1_Missense_Mutation_p.G88E	NM_145250.3	NP_660293.1	Q8TAA1	RNS11_HUMAN	ribonuclease, RNase A family, 11 (non-active)	88						extracellular region (GO:0005576)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)	p.G88E(1)		endometrium(1)|large_intestine(6)|lung(7)|ovary(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	21	all_cancers(95;0.00238)	all_lung(585;0.235)	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)		CGAACTGTTTCCCTTGGGGTC	0.413																																					p.G88E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G263A	14						.						177.0	166.0	169.0					14																	21052371		2203	4300	6503	20122211	SO:0001583	missense	122651	exon3			BC025410	CCDS9553.1	14q11.1	2013-08-05	2004-11-18	2004-11-18	ENSG00000173464	ENSG00000173464		"""Ribonucleases, RNase A"""	19269	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 6"""	C14orf6			Standard	NM_145250		Approved		uc001vxs.3	Q8TAA1	OTTHUMG00000170990	ENST00000610205.1:c.263G>A	14.37:g.21052371C>T	ENSP00000476537:p.Gly88Glu	Somatic		Capture	Illumina HiSeq	Phase_I	20122211	NM_145250		Missense_Mutation	SNP	ENST00000610205.1	37	CCDS9553.1	.	.	.	.	.	.	.	.	.	.	C	1.858	-0.463250	0.04476	.	.	ENSG00000173464	ENST00000335950;ENST00000553849;ENST00000555841;ENST00000398009;ENST00000398008;ENST00000432835;ENST00000443456;ENST00000557503;ENST00000557105;ENST00000413502;ENST00000554842	T;T;T;T;T;T;T;T;T;T;T	0.33865	1.58;1.58;1.58;1.58;1.58;1.58;1.57;1.57;1.58;1.39;1.39	3.94	-1.67	0.08238	Ribonuclease A, domain (3);	1.206950	0.05889	N	0.627982	T	0.20210	0.0486	N	0.24115	0.695	0.09310	N	1	B	0.17852	0.024	B	0.19391	0.025	T	0.21314	-1.0249	10	0.31617	T	0.26	-10.6752	0.6592	0.00840	0.17:0.3356:0.1662:0.3282	.	88	Q8TAA1	RNS11_HUMAN	E	88	ENSP00000338288:G88E;ENSP00000451318:G88E;ENSP00000451563:G88E;ENSP00000381093:G88E;ENSP00000381092:G88E;ENSP00000395210:G88E;ENSP00000401398:G88E;ENSP00000451839:G88E;ENSP00000452412:G88E;ENSP00000415954:G88E;ENSP00000451466:G88E	ENSP00000338288:G88E	G	-	2	0	RNASE11	20122211	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.597000	0.05713	-0.313000	0.08728	0.511000	0.50034	GGA		0.413	RNASE11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073662.3	NM_145250	
RALGAPA1	253959	broad.mit.edu	37	14	36097083	36097083	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr14:36097083C>A	ENST00000389698.3	-	33	4942	c.4552G>T	c.(4552-4554)Ggc>Tgc	p.G1518C	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.G1531C|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.G1565C|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.G1518C	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1518	Minimal domain that binds to TCF3/E12. {ECO:0000250}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.G1518C(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GGATAATGGCCCAGGTGATTT	0.393																																					p.G1518C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4552T	14						.						43.0	47.0	45.0					14																	36097083		2195	4277	6472	35166834	SO:0001583	missense	253959	exon33			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.4552G>T	14.37:g.36097083C>A	ENSP00000374348:p.Gly1518Cys	Somatic		Capture	Illumina HiSeq	Phase_I	35166834	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166045	0.78339	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	T;T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32;1.32	5.37	5.37	0.77165	.	0.091863	0.85682	D	0.000000	T	0.65080	0.2657	M	0.80183	2.485	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.995;0.998;0.998	T	0.69026	-0.5254	10	0.87932	D	0	-7.7933	19.4725	0.94969	0.0:1.0:0.0:0.0	.	1565;1531;1518;1518	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	C	1518;1518;1518;1565;156;1531;1565	ENSP00000374348:G1518C;ENSP00000302647:G1518C;ENSP00000258840:G1565C;ENSP00000451133:G156C;ENSP00000371803:G1531C;ENSP00000451877:G1565C	ENSP00000258840:G1565C	G	-	1	0	RALGAPA1	35166834	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.723000	0.84788	2.659000	0.90383	0.655000	0.94253	GGC		0.393	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
HEATR4	399671	broad.mit.edu	37	14	73989632	73989632	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr14:73989632C>G	ENST00000553558.1	-	3	546	c.225G>C	c.(223-225)caG>caC	p.Q75H	RP3-414A15.2_ENST00000555972.2_RNA|RP3-414A15.11_ENST00000553394.1_RNA|HEATR4_ENST00000334988.2_Missense_Mutation_p.Q75H|HEATR4_ENST00000560393.1_Missense_Mutation_p.Q28H	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	75								p.Q28H(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		ACACCACCTCCTGAGAGAAGG	0.502																																					p.Q28H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G84C	14						.						64.0	68.0	66.0					14																	73989632		2203	4300	6503	73059385	SO:0001583	missense	399671	exon2			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.225G>C	14.37:g.73989632C>G	ENSP00000450444:p.Gln75His	Somatic		Capture	Illumina HiSeq	Phase_I	73059385	NM_203309	B7Z7V9|E9KL41	Missense_Mutation	SNP	ENST00000553558.1	37	CCDS9815.2	.	.	.	.	.	.	.	.	.	.	C	12.00	1.805706	0.31961	.	.	ENSG00000187105	ENST00000553558;ENST00000334988;ENST00000556455	T;T	0.16897	2.31;2.31	5.6	-0.211	0.13172	.	0.406912	0.21310	N	0.076655	T	0.13114	0.0318	L	0.36672	1.1	0.09310	N	0.999997	P	0.44578	0.838	B	0.43916	0.436	T	0.12372	-1.0550	10	0.87932	D	0	0.2297	5.2817	0.15678	0.0:0.4711:0.1483:0.3807	.	75	Q86WZ0	HEAT4_HUMAN	H	75;28;75	ENSP00000450444:Q75H;ENSP00000452407:Q75H	ENSP00000335447:Q28H	Q	-	3	2	HEATR4	73059385	0.994000	0.37717	0.160000	0.22671	0.114000	0.19823	0.267000	0.18552	0.025000	0.15241	-0.251000	0.11542	CAG		0.502	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309	
TCL1A	8115	broad.mit.edu	37	14	96178112	96178112	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr14:96178112C>G	ENST00000402399.1	-	3	454	c.325G>C	c.(325-327)Gag>Cag	p.E109Q	RP11-164H13.1_ENST00000547644.2_RNA|TCL1A_ENST00000555202.1_Missense_Mutation_p.E109Q|RP11-164H13.1_ENST00000553445.1_RNA|TCL1A_ENST00000554012.1_Missense_Mutation_p.E109Q|TCL1A_ENST00000556450.1_Missense_Mutation_p.E109Q	NM_021966.2	NP_068801.1	P56279	TCL1A_HUMAN	T-cell leukemia/lymphoma 1A	109					multicellular organismal development (GO:0007275)|stem cell maintenance (GO:0019827)	cell cortex (GO:0005938)|endoplasmic reticulum (GO:0005783)|pronucleus (GO:0045120)		p.E109Q(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		GGCAGCAGCTCGAGAAGCATG	0.562			T	TRA@	T-CLL																																p.E109Q	Ovarian(96;1068 2019 35393 39316)		Dom	yes		14	14q32.1	8115	T-cell leukemia/lymphoma 1A		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G325C	14						.						116.0	82.0	93.0					14																	96178112		2203	4300	6503	95247865	SO:0001583	missense	8115	exon3			X82240	CCDS9941.1	14q32.1	2008-07-03				ENSG00000100721			11648	protein-coding gene	gene with protein product		186960				2783489, 7809072	Standard	NM_021966		Approved	TCL1	uc001yfb.4	P56279		ENST00000402399.1:c.325G>C	14.37:g.96178112C>G	ENSP00000385036:p.Glu109Gln	Somatic		Capture	Illumina HiSeq	Phase_I	95247865	NM_021966	Q6IBK7	Missense_Mutation	SNP	ENST00000402399.1	37	CCDS9941.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.74|15.74	2.923541|2.923541	0.52653|0.52653	.|.	.|.	ENSG00000100721|ENSG00000100721	ENST00000554012;ENST00000402399;ENST00000556450;ENST00000555202|ENST00000557043	T;T;T;T|.	0.32023|.	1.47;1.47;1.47;1.47|.	3.36|3.36	3.36|3.36	0.38483|0.38483	.|.	0.275715|.	0.25222|.	N|.	0.032238|.	T|T	0.45617|0.45617	0.1351|0.1351	L|L	0.55103|0.55103	1.725|1.725	0.09310|0.09310	N|N	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.28933|0.28933	-1.0028|-1.0028	10|5	0.40728|.	T|.	0.16|.	-32.7617|-32.7617	10.5256|10.5256	0.44945|0.44945	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	109|.	P56279|.	TCL1A_HUMAN|.	Q|P	109|83	ENSP00000451506:E109Q;ENSP00000385036:E109Q;ENSP00000450701:E109Q;ENSP00000450496:E109Q|.	ENSP00000385036:E109Q|.	E|R	-|-	1|2	0|0	TCL1A|TCL1A	95247865|95247865	0.008000|0.008000	0.16893|0.16893	0.086000|0.086000	0.20670|0.20670	0.041000|0.041000	0.13682|0.13682	0.421000|0.421000	0.21280|0.21280	2.191000|2.191000	0.70037|0.70037	0.563000|0.563000	0.77884|0.77884	GAG|CGA		0.562	TCL1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413246.1		
ATG2B	55102	broad.mit.edu	37	14	96781803	96781803	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr14:96781803G>T	ENST00000359933.4	-	22	4372	c.3479C>A	c.(3478-3480)tCa>tAa	p.S1160*		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1160					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)		p.S1160*(1)		breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AACTCCATCTGAAGAAGTTTT	0.418																																					p.S1160X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3479A	14						.						58.0	56.0	57.0					14																	96781803		2203	4300	6503	95851556	SO:0001587	stop_gained	55102	exon22			AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.3479C>A	14.37:g.96781803G>T	ENSP00000353010:p.Ser1160*	Somatic		Capture	Illumina HiSeq	Phase_I	95851556	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Nonsense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	G	49	15.698129	0.99842	.	.	ENSG00000066739	ENST00000359933	.	.	.	5.61	5.61	0.85477	.	0.422095	0.21298	U	0.076841	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6312	0.95704	0.0:0.0:1.0:0.0	.	.	.	.	X	1160	.	ENSP00000353010:S1160X	S	-	2	0	ATG2B	95851556	1.000000	0.71417	0.938000	0.37757	0.913000	0.54294	6.755000	0.74914	2.654000	0.90174	0.591000	0.81541	TCA		0.418	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
C15orf52	388115	broad.mit.edu	37	15	40627527	40627527	+	Silent	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr15:40627527C>T	ENST00000559313.1	-	11	1452	c.1437G>A	c.(1435-1437)caG>caA	p.Q479Q	C15orf52_ENST00000397536.2_Silent_p.Q269Q	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	479							poly(A) RNA binding (GO:0044822)	p.Q479Q(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		CTGCTCCTCTCTGTGGCTCAG	0.662																																					p.Q479Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1437A	15						.						46.0	51.0	49.0					15																	40627527		2201	4300	6501	38414819	SO:0001819	synonymous_variant	388115	exon11			AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.1437G>A	15.37:g.40627527C>T		Somatic		Capture	Illumina HiSeq	Phase_I	38414819	NM_207380	B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Silent	SNP	ENST00000559313.1	37	CCDS10055.2																																																																																				0.662	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319567.2	NM_207380	
EXD1	161829	broad.mit.edu	37	15	41476544	41476544	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr15:41476544A>T	ENST00000314992.5	-	10	1320	c.1130T>A	c.(1129-1131)gTg>gAg	p.V377E	EXD1_ENST00000458580.2_Missense_Mutation_p.V435E	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	377							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)	p.V377E(1)		large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						CAGTAAATTCACATCCCCGTG	0.383																																					p.V377E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1130A	15						.						119.0	125.0	123.0					15																	41476544		2203	4300	6503	39263836	SO:0001583	missense	161829	exon10			BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.1130T>A	15.37:g.41476544A>T	ENSP00000321029:p.Val377Glu	Somatic		Capture	Illumina HiSeq	Phase_I	39263836	NM_152596	A8K909|B7Z839|Q6ZW94	Missense_Mutation	SNP	ENST00000314992.5	37	CCDS10072.1	.	.	.	.	.	.	.	.	.	.	A	13.88	2.369421	0.42003	.	.	ENSG00000178997	ENST00000314992;ENST00000458580	T;T	0.39997	1.05;1.06	5.35	-3.29	0.05017	.	1.225760	0.05631	N	0.581747	T	0.23410	0.0566	L	0.45137	1.4	0.09310	N	1	B;B;B	0.20052	0.001;0.001;0.041	B;B;B	0.14578	0.002;0.002;0.011	T	0.22695	-1.0209	10	0.02654	T	1	-14.5129	0.2409	0.00192	0.2709:0.275:0.1698:0.2843	.	435;377;175	B7Z839;Q8NHP7;Q8NHP7-2	.;EXD1_HUMAN;.	E	377;435	ENSP00000321029:V377E;ENSP00000415056:V435E	ENSP00000321029:V377E	V	-	2	0	EXD1	39263836	0.000000	0.05858	0.000000	0.03702	0.636000	0.38137	-0.206000	0.09398	-0.310000	0.08766	0.533000	0.62120	GTG		0.383	EXD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252553.2	NM_152596	
FAM227B	196951	broad.mit.edu	37	15	49867238	49867238	+	Silent	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr15:49867238G>T	ENST00000299338.6	-	8	918	c.615C>A	c.(613-615)tcC>tcA	p.S205S	FAM227B_ENST00000561064.1_Silent_p.S205S	NM_152647.2	NP_689860.2	Q96M60	F227B_HUMAN	family with sequence similarity 227, member B	205								p.S205S(1)									ACCACCAAAAGGAGTCATGCA	0.308																																					p.S205S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C615A	15						.						57.0	63.0	61.0					15																	49867238		2196	4295	6491	47654530	SO:0001819	synonymous_variant	196951	exon8				CCDS32237.1	15q21.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000166262	ENSG00000166262			26543	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 33"""	C15orf33			Standard	NM_152647		Approved	FLJ32800	uc001zxl.2	Q96M60	OTTHUMG00000172328	ENST00000299338.6:c.615C>A	15.37:g.49867238G>T		Somatic		Capture	Illumina HiSeq	Phase_I	47654530	NM_152647	Q86WS2	Silent	SNP	ENST00000299338.6	37	CCDS32237.1																																																																																				0.308	FAM227B-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417872.1	NM_152647	
MTFMT	123263	broad.mit.edu	37	15	65313912	65313912	+	Silent	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr15:65313912C>A	ENST00000220058.4	-	4	598	c.585G>T	c.(583-585)gtG>gtT	p.V195V	MTFMT_ENST00000561025.1_5'UTR	NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	195						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)	p.V195V(2)		endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	TCTTGGGTGGCACAGGAACAG	0.388																																					p.V195V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G585T	15						.						157.0	151.0	153.0					15																	65313912		1888	4118	6006	63100965	SO:0001819	synonymous_variant	123263	exon4			AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.585G>T	15.37:g.65313912C>A		Somatic		Capture	Illumina HiSeq	Phase_I	63100965	NM_139242	B7Z734	Silent	SNP	ENST00000220058.4	37	CCDS45280.1																																																																																				0.388	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418155.1	NM_139242	
AKAP13	11214	broad.mit.edu	37	15	86273922	86273922	+	Silent	SNP	A	A	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr15:86273922A>G	ENST00000394518.2	+	30	7361	c.7266A>G	c.(7264-7266)aaA>aaG	p.K2422K	AKAP13_ENST00000361243.2_Silent_p.K2426K|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000394510.2_Silent_p.K667K	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2422	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.K2426K(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CTTTAATGAAAAGTGCAATAA	0.453											OREG0023425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K2426K	Melanoma(94;603 1453 3280 32295 32951)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A7278G	15						.						82.0	77.0	79.0					15																	86273922		2202	4299	6501	84074926	SO:0001819	synonymous_variant	11214	exon30			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.7266A>G	15.37:g.86273922A>G		Somatic	1243	Capture	Illumina HiSeq	Phase_I	84074926	NM_006738	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	ENST00000394518.2	37	CCDS32319.1																																																																																				0.453	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
CLEC16A	23274	broad.mit.edu	37	16	11056399	11056399	+	Silent	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr16:11056399G>A	ENST00000409790.1	+	3	527	c.297G>A	c.(295-297)caG>caA	p.Q99Q	CLEC16A_ENST00000409552.3_Silent_p.Q99Q	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.Q99Q(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						AGCTGCTGCAGACCTTGAACA	0.478																																					p.Q99Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G297A	16						.						247.0	230.0	236.0					16																	11056399		2099	4234	6333	10963900	SO:0001819	synonymous_variant	23274	exon3			AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.297G>A	16.37:g.11056399G>A		Somatic		Capture	Illumina HiSeq	Phase_I	10963900	NM_015226		Silent	SNP	ENST00000409790.1	37	CCDS45409.1																																																																																				0.478	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226	
UBN1	29855	broad.mit.edu	37	16	4920852	4920852	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr16:4920852G>T	ENST00000396658.4	+	10	2141	c.1438G>T	c.(1438-1440)Gaa>Taa	p.E480*	UBN1_ENST00000545171.1_Nonsense_Mutation_p.E480*|UBN1_ENST00000590769.1_Nonsense_Mutation_p.E480*|UBN1_ENST00000262376.6_Nonsense_Mutation_p.E480*	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	480					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E480*(1)		NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						TAGGATGCTGGAAGAGGAGAA	0.537																																					p.E480X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1438T	16						.						51.0	50.0	50.0					16																	4920852		2197	4300	6497	4860853	SO:0001587	stop_gained	29855	exon10			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.1438G>T	16.37:g.4920852G>T	ENSP00000379894:p.Glu480*	Somatic		Capture	Illumina HiSeq	Phase_I	4860853	NM_016936	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Nonsense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	G	41	8.862782	0.98982	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	.	.	.	5.4	5.4	0.78164	.	0.259745	0.36555	N	0.002535	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-3.7942	19.1777	0.93609	0.0:0.0:1.0:0.0	.	.	.	.	X	480	.	ENSP00000262376:E480X	E	+	1	0	UBN1	4860853	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.528000	0.90598	2.527000	0.85204	0.650000	0.86243	GAA		0.537	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936	
PALB2	79728	broad.mit.edu	37	16	23619200	23619200	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr16:23619200G>A	ENST00000261584.4	-	12	3487	c.3335C>T	c.(3334-3336)cCa>cTa	p.P1112L	CTD-2196E14.3_ENST00000561764.1_RNA	NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	1112	Interaction with RAD51, BRCA2 and POLH.|Required for interaction with POLH and POLH DNA synthesis stimulation.				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P1112L(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		AGCCTGCCCTGGAGGAAGACA	0.488			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.P1112L		yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3335T	16						.						132.0	104.0	114.0					16																	23619200		2197	4300	6497	23526701	SO:0001583	missense	79728	exon12				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.3335C>T	16.37:g.23619200G>A	ENSP00000261584:p.Pro1112Leu	Somatic		Capture	Illumina HiSeq	Phase_I	23526701	NM_024675	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	37	CCDS32406.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209810	0.39003	.	.	ENSG00000083093	ENST00000261584	T	0.15017	2.46	6.14	2.67	0.31697	WD40 repeat-like-containing domain (1);	0.523159	0.19557	N	0.111419	T	0.11623	0.0283	L	0.29908	0.895	0.28042	N	0.933699	B	0.16166	0.016	B	0.12837	0.008	T	0.17289	-1.0374	10	0.62326	D	0.03	-0.3294	6.2091	0.20619	0.0:0.1446:0.1387:0.7167	.	1112	Q86YC2	PALB2_HUMAN	L	1112	ENSP00000261584:P1112L	ENSP00000261584:P1112L	P	-	2	0	PALB2	23526701	0.012000	0.17670	0.386000	0.26170	0.996000	0.88848	-0.174000	0.09839	0.205000	0.20568	-0.276000	0.10085	CCA		0.488	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675	
IRX5	10265	broad.mit.edu	37	16	54966430	54966430	+	Silent	SNP	A	A	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr16:54966430A>G	ENST00000394636.4	+	2	607	c.270A>G	c.(268-270)acA>acG	p.T90T	IRX5_ENST00000558597.1_Silent_p.T24T|CTD-3032H12.2_ENST00000560487.1_lincRNA|IRX5_ENST00000560154.1_Intron|IRX5_ENST00000320990.5_Silent_p.T90T			P78411	IRX5_HUMAN	iroquois homeobox 5	90					embryonic cranial skeleton morphogenesis (GO:0048701)|gonad development (GO:0008406)|neuron maturation (GO:0042551)|regulation of heart rate (GO:0002027)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|vitamin D binding (GO:0005499)	p.T90T(1)		kidney(3)|large_intestine(6)|lung(4)|prostate(1)	14						ACGACCACACACCCGGCATGG	0.652																																					p.T90T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A270G	16						.						43.0	49.0	47.0					16																	54966430		2198	4300	6498	53523931	SO:0001819	synonymous_variant	10265	exon2			U90309	CCDS10751.1, CCDS58462.1	16q12.2	2011-06-20	2007-07-13		ENSG00000176842	ENSG00000176842		"""Homeoboxes / TALE class"""	14361	protein-coding gene	gene with protein product		606195					Standard	NM_005853		Approved	IRX-2a	uc002ehv.3	P78411	OTTHUMG00000133201	ENST00000394636.4:c.270A>G	16.37:g.54966430A>G		Somatic		Capture	Illumina HiSeq	Phase_I	53523931	NM_005853	H0YMS7|P78416|Q7Z2E1	Silent	SNP	ENST00000394636.4	37	CCDS10751.1																																																																																				0.652	IRX5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256911.2		
FAM65A	79567	broad.mit.edu	37	16	67576748	67576748	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr16:67576748C>G	ENST00000379312.3	+	13	2192	c.2071C>G	c.(2071-2073)Ctc>Gtc	p.L691V	FAM65A_ENST00000540839.3_Missense_Mutation_p.L707V|CTD-2012K14.2_ENST00000567122.1_RNA|CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.L687V|FAM65A_ENST00000428437.2_Missense_Mutation_p.L701V|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000422602.2_Missense_Mutation_p.L707V	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	691	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.L687V(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		ACTTGCTACCCTCTCCAGCCC	0.562																																					p.L691V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2071G	16						.						207.0	212.0	211.0					16																	67576748		2198	4300	6498	66134249	SO:0001583	missense	79567	exon13			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.2071C>G	16.37:g.67576748C>G	ENSP00000368614:p.Leu691Val	Somatic		Capture	Illumina HiSeq	Phase_I	66134249	NM_001193522	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.69|10.69	1.421048|1.421048	0.25639|0.25639	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839|ENST00000428437	T;T;T|T	0.15834|0.12774	2.4;2.39;2.39|2.65	4.52|4.52	-0.309|-0.309	0.12769|0.12769	.|.	0.352176|.	0.23300|.	N|.	0.049693|.	T|T	0.05181|0.05181	0.0138|0.0138	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.12630|.	0.001;0.001;0.001;0.006|.	B;B;B;B|.	0.08055|.	0.001;0.001;0.001;0.003|.	T|T	0.42120|0.42120	-0.9470|-0.9470	10|6	0.23302|.	T|.	0.38|.	-8.3515|-8.3515	3.1631|3.1631	0.06527|0.06527	0.3105:0.4534:0.1429:0.0932|0.3105:0.4534:0.1429:0.0932	.|.	701;707;691;707|.	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9|.	.;.;FA65A_HUMAN;.|.	V|R	691;687;707;701|681	ENSP00000368614:L691V;ENSP00000042381:L687V;ENSP00000400099:L707V|ENSP00000389456:P681R	ENSP00000042381:L687V|.	L|P	+|+	1|2	0|0	FAM65A|FAM65A	66134249|66134249	0.000000|0.000000	0.05858|0.05858	0.004000|0.004000	0.12327|0.12327	0.369000|0.369000	0.29798|0.29798	0.255000|0.255000	0.18333|0.18333	0.182000|0.182000	0.20032|0.20032	0.455000|0.455000	0.32223|0.32223	CTC|CCT		0.562	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
CHST5	23563	broad.mit.edu	37	16	75564062	75564062	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr16:75564062C>A	ENST00000336257.3	-	3	1615	c.221G>T	c.(220-222)gGc>gTc	p.G74V	RP11-77K12.7_ENST00000460606.1_3'UTR|CHST5_ENST00000541075.1_Missense_Mutation_p.G80V	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	74					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.G74V(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						GAAGGATGAGCCCGAGCGCCA	0.672																																					p.G74V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G221T	16						.						45.0	40.0	41.0					16																	75564062		2198	4300	6498	74121563	SO:0001583	missense	23563	exon3			AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.221G>T	16.37:g.75564062C>A	ENSP00000338783:p.Gly74Val	Somatic		Capture	Illumina HiSeq	Phase_I	74121563	NM_024533	B2RV23|Q7LCN3|Q9UBY3	Missense_Mutation	SNP	ENST00000336257.3	37	CCDS10919.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.387906	0.42308	.	.	ENSG00000135702	ENST00000336257;ENST00000541075	D;D	0.99683	-6.39;-6.39	2.73	2.73	0.32206	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.99677	0.9879	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97504	1.0062	10	0.87932	D	0	.	12.3965	0.55389	0.0:1.0:0.0:0.0	.	80;74	Q9GZS9-2;Q9GZS9	.;CHST5_HUMAN	V	74;80	ENSP00000338783:G74V;ENSP00000441220:G80V	ENSP00000338783:G74V	G	-	2	0	CHST5	74121563	1.000000	0.71417	0.993000	0.49108	0.012000	0.07955	7.349000	0.79376	1.514000	0.48869	0.313000	0.20887	GGC		0.672	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2	NM_012126	
CNTNAP4	85445	broad.mit.edu	37	16	76501360	76501360	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr16:76501360A>T	ENST00000476707.1	+	9	1743	c.1604A>T	c.(1603-1605)cAg>cTg	p.Q535L	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.Q483L|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.Q459L|SNORD33_ENST00000516213.1_RNA|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.Q531L			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	532	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.Q507L(1)|p.Q459L(1)|p.Q531L(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						ATTTCAGTTCAGCAGGGGTCC	0.443																																					p.S532C												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A1594T	16						.						113.0	105.0	107.0					16																	76501360		2198	4300	6498	75058861	SO:0001583	missense	85445	exon10			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1604A>T	16.37:g.76501360A>T	ENSP00000417628:p.Gln535Leu	Somatic		Capture	Illumina HiSeq	Phase_I	75058861	NM_033401	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	A	18.92	3.725059	0.68959	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96	5.42	5.42	0.78866	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.39475	N	0.001344	D	0.85982	0.5824	.	.	.	0.53688	D	0.999978	D;P;D;D	0.89917	1.0;0.944;0.997;0.999	D;D;D;D	0.97110	1.0;0.935;0.98;0.998	D	0.87153	0.2210	9	0.56958	D	0.05	.	15.2786	0.73764	1.0:0.0:0.0:0.0	.	459;535;507;532	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	L	531;483;459;535	ENSP00000306893:Q531L;ENSP00000439733:Q483L;ENSP00000418741:Q459L;ENSP00000417628:Q535L	ENSP00000306893:Q531L	Q	+	2	0	CNTNAP4	75058861	1.000000	0.71417	1.000000	0.80357	0.325000	0.28411	8.577000	0.90773	2.274000	0.75844	0.528000	0.53228	CAG		0.443	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
KIF1C	10749	broad.mit.edu	37	17	4925991	4925992	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr17:4925991_4925992insC	ENST00000320785.5	+	22	2972_2973	c.2615_2616insC	c.(2614-2619)atccccfs	p.IP872fs	AC109333.10_ENST00000438266.1_RNA	NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	872					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)	p.L874fs*6(1)		NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						GAGAGGGTCATCCCCCTGGCCC	0.614																																					p.I872fs	Melanoma(96;1023 1447 10250 19259 33730)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2615_2616insC	17						.																																			4866716	SO:0001589	frameshift_variant	10749	exon22			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2620dupC	17.37:g.4925996_4925996dupC	ENSP00000320821:p.Ile872fs	Somatic		Capture	Illumina HiSeq	Phase_I	4866715	NM_006612	D3DTL6|O75186|Q5U618	Frame_Shift_Ins	INS	ENST00000320785.5	37	CCDS11065.1																																																																																				0.614	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216916.1		
SPECC1	92521	broad.mit.edu	37	17	20108061	20108061	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr17:20108061C>A	ENST00000261503.5	+	4	750	c.699C>A	c.(697-699)aaC>aaA	p.N233K	SPECC1_ENST00000395525.3_Missense_Mutation_p.N152K|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000472876.1_Intron|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395529.3_Missense_Mutation_p.N233K|SPECC1_ENST00000395530.2_Missense_Mutation_p.N152K|SPECC1_ENST00000395522.2_Missense_Mutation_p.N152K|SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395527.4_Missense_Mutation_p.N233K	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	233					cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.N233K(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		AGGAGAAGAACAAGAACTTTC	0.488																																					p.N152K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C456A	17						.						127.0	141.0	136.0					17																	20108061		2203	4300	6503	20048653	SO:0001583	missense	92521	exon2			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.699C>A	17.37:g.20108061C>A	ENSP00000261503:p.Asn233Lys	Somatic		Capture	Illumina HiSeq	Phase_I	20048653	NM_001033555	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527323	0.64860	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.80994	-1.44;1.55;1.64;1.62	5.28	3.26	0.37387	.	0.077827	0.85682	D	0.000000	D	0.86944	0.6055	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.99;0.999;0.999;0.999;0.994	D	0.86178	0.1604	10	0.87932	D	0	-25.9443	9.0423	0.36325	0.0:0.768:0.1494:0.0826	.	233;152;152;233;233	A8MV89;Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;.;CYTSB_HUMAN	K	233;233;233;152;152;152	ENSP00000261503:N233K;ENSP00000378900:N233K;ENSP00000378893:N152K;ENSP00000378896:N152K	ENSP00000261503:N233K	N	+	3	2	SPECC1	20048653	1.000000	0.71417	0.983000	0.44433	0.993000	0.82548	1.655000	0.37345	0.714000	0.32081	0.655000	0.94253	AAC		0.488	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
HNF1B	6928	broad.mit.edu	37	17	36093584	36093584	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr17:36093584C>G	ENST00000225893.4	-	3	1136	c.775G>C	c.(775-777)Gaa>Caa	p.E259Q	HNF1B_ENST00000560016.1_Missense_Mutation_p.E259Q|HNF1B_ENST00000561193.1_Missense_Mutation_p.E233Q|HNF1B_ENST00000427275.2_Missense_Mutation_p.E233Q	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	259					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.E259Q(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			TCTCTCTCTTCCTTGCTGGGG	0.587																																					p.E233Q	Colon(71;102 1179 9001 27917 43397)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G697C	17						.						174.0	161.0	166.0					17																	36093584		2203	4300	6503	33167697	SO:0001583	missense	6928	exon3			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.775G>C	17.37:g.36093584C>G	ENSP00000225893:p.Glu259Gln	Somatic		Capture	Illumina HiSeq	Phase_I	33167697	NM_001165923	B4DKM3|E0YMJ9	Missense_Mutation	SNP	ENST00000225893.4	37	CCDS11324.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559450	0.65538	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	D;D	0.96459	-4.02;-4.02	4.76	4.76	0.60689	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.218057	0.48767	D	0.000174	D	0.94092	0.8106	L	0.52266	1.64	0.80722	D	1	B;P;B	0.36789	0.119;0.57;0.097	B;B;B	0.35413	0.048;0.202;0.084	D	0.93276	0.6656	10	0.31617	T	0.26	-2.5036	17.2715	0.87103	0.0:1.0:0.0:0.0	.	233;259;259	E0YMJ6;P35680-3;P35680	.;.;HNF1B_HUMAN	Q	259;233;259;147	ENSP00000225893:E259Q;ENSP00000412212:E233Q	ENSP00000225893:E259Q	E	-	1	0	HNF1B	33167697	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.236000	0.78154	2.624000	0.88883	0.591000	0.81541	GAA		0.587	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256807.3	NM_000458	
BPTF	2186	broad.mit.edu	37	17	65900888	65900888	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr17:65900888A>T	ENST00000321892.4	+	11	3183	c.3122A>T	c.(3121-3123)cAt>cTt	p.H1041L	BPTF_ENST00000424123.3_Missense_Mutation_p.H902L|BPTF_ENST00000306378.6_Missense_Mutation_p.H915L|BPTF_ENST00000335221.5_Missense_Mutation_p.H1041L			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1041					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.H915L(1)|p.H1041L(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGTAAAACTCATGTTTATAGG	0.338																																					p.H915L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2744T	17						.						150.0	150.0	150.0					17																	65900888		2203	4300	6503	63331350	SO:0001583	missense	2186	exon9			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.3122A>T	17.37:g.65900888A>T	ENSP00000315454:p.His1041Leu	Somatic		Capture	Illumina HiSeq	Phase_I	63331350	NM_182641	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37		.	.	.	.	.	.	.	.	.	.	A	15.37	2.812092	0.50527	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.62364	0.04;0.03;0.04	5.78	5.78	0.91487	.	.	.	.	.	T	0.67297	0.2878	L	0.34521	1.04	0.49798	D	0.999828	P;D;D	0.69078	0.842;0.997;0.993	B;P;P	0.61940	0.138;0.896;0.89	T	0.63686	-0.6581	9	0.25106	T	0.35	-14.3948	16.1676	0.81782	1.0:0.0:0.0:0.0	.	1041;915;1041	Q12830;Q12830-2;Q12830-4	BPTF_HUMAN;.;.	L	915;1041;1041	ENSP00000307208:H915L;ENSP00000334351:H1041L;ENSP00000315454:H1041L	ENSP00000307208:H915L	H	+	2	0	BPTF	63331350	0.999000	0.42202	0.995000	0.50966	0.836000	0.47400	6.176000	0.71955	2.218000	0.71995	0.529000	0.55759	CAT		0.338	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
SOX9	6662	broad.mit.edu	37	17	70118865	70118865	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr17:70118865delT	ENST00000245479.2	+	2	809	c.437delT	c.(436-438)ctgfs	p.L146fs		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	146					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L146fs*37(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			AGCAGACTTCTGAACGAGAGC	0.667																																					p.L146fs	Pancreas(42;83 1041 2320 35205 39456)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.437delT	17						.						20.0	23.0	22.0					17																	70118865		2200	4296	6496	67630460	SO:0001589	frameshift_variant	6662	exon2			S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.437delT	17.37:g.70118865delT	ENSP00000245479:p.Leu146fs	Somatic		Capture	Illumina HiSeq	Phase_I	67630460	NM_000346	Q53Y80	Frame_Shift_Del	DEL	ENST00000245479.2	37	CCDS11689.1																																																																																				0.667	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
ANKRD29	147463	broad.mit.edu	37	18	21214096	21214097	+	Missense_Mutation	DNP	CA	CA	AC			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr18:21214096_21214097CA>AC	ENST00000592179.1	-	5	501_502	c.347_348TG>GT	c.(346-348)cTG>cGT	p.L116R	ANKRD29_ENST00000322980.9_Missense_Mutation_p.L116R|ANKRD29_ENST00000284207.7_Missense_Mutation_p.L116R	NM_173505.2	NP_775776.2	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29	116								p.L116>?(1)		breast(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)	13	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TGGCAGCCAACAGGGCGGTGCC	0.51																																					.												.	.	1	Complex(1)	large_intestine(1)	c.347_348GT	18						.																																			19468095	SO:0001583	missense	147463	exon5			AK057782	CCDS11879.1	18q11.2	2013-01-10			ENSG00000154065	ENSG00000154065		"""Ankyrin repeat domain containing"""	27110	protein-coding gene	gene with protein product							Standard	NM_173505		Approved	FLJ25053	uc002kun.3	Q8N6D5	OTTHUMG00000131875	ENST00000592179.1:c.347_348delinsAC	18.37:g.21214096_21214097delinsAC	ENSP00000468354:p.Leu116Arg	Somatic		Capture	Illumina HiSeq	Phase_I	19468094	NM_173505	B2R972|Q6ZWE8|Q96LU9	Missense_Mutation	DNP	ENST00000592179.1	37	CCDS11879.1																																																																																				0.510	ANKRD29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254825.1	NM_173505	
CELF4	56853	broad.mit.edu	37	18	34853094	34853094	+	Silent	SNP	T	T	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr18:34853094T>A	ENST00000591282.1	-	7	833	c.834A>T	c.(832-834)tcA>tcT	p.S278S	CELF4_ENST00000591287.1_Silent_p.S277S|CELF4_ENST00000603232.1_Silent_p.S277S|RP11-797E24.3_ENST00000588766.1_RNA|CELF4_ENST00000334919.5_Silent_p.S268S|CELF4_ENST00000420428.2_Silent_p.S278S|CELF4_ENST00000361795.5_Silent_p.S276S|CELF4_ENST00000601019.1_Silent_p.S276S|CELF4_ENST00000588597.1_Silent_p.S267S|CELF4_ENST00000412753.1_Silent_p.S277S|RP11-797E24.3_ENST00000586610.1_RNA			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	278	Ala-rich.|Sufficient for RNA-binding and MSE- dependent splicing activity.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.S278S(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						CCTGCGCGACTGATGCCATCA	0.647																																					p.S268S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A804T	18						.						39.0	42.0	41.0					18																	34853094		2203	4300	6503	33107092	SO:0001819	synonymous_variant	56853	exon7			AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.834A>T	18.37:g.34853094T>A		Somatic		Capture	Illumina HiSeq	Phase_I	33107092	NM_001025089	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Missense_Mutation	SNP	ENST00000591282.1	37	CCDS32818.1																																																																																				0.647	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440892.1	NM_020180	
YES1	7525	broad.mit.edu	37	18	742951	742951	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr18:742951G>A	ENST00000584307.1	-	8	1197	c.1027C>T	c.(1027-1029)Cca>Tca	p.P343S	YES1_ENST00000577961.1_Missense_Mutation_p.P348S|YES1_ENST00000314574.4_Missense_Mutation_p.P343S			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	343	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.P343S(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	ATGTAAATTGGTTCTTCAGAA	0.313																																					p.P343S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1027T	18						.						86.0	86.0	86.0					18																	742951		2202	4300	6502	732951	SO:0001583	missense	7525	exon8			M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.1027C>T	18.37:g.742951G>A	ENSP00000462468:p.Pro343Ser	Somatic		Capture	Illumina HiSeq	Phase_I	732951	NM_005433	A6NLB3|D3DUH1	Missense_Mutation	SNP	ENST00000584307.1	37	CCDS11824.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.709640	0.89018	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	D	0.83591	-1.74	5.78	5.78	0.91487	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89319	0.6681	M	0.69463	2.115	0.80722	D	1	D	0.61697	0.99	P	0.57720	0.826	D	0.89732	0.3927	10	0.87932	D	0	.	20.0215	0.97504	0.0:0.0:1.0:0.0	.	343	P07947	YES_HUMAN	S	343	ENSP00000324740:P343S	ENSP00000324740:P343S	P	-	1	0	YES1	732951	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.634000	0.98435	2.735000	0.93741	0.650000	0.86243	CCA		0.313	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433	
EPB41L3	23136	broad.mit.edu	37	18	5433506	5433506	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr18:5433506T>C	ENST00000341928.2	-	8	1214	c.874A>G	c.(874-876)Aaa>Gaa	p.K292E	EPB41L3_ENST00000400111.3_Missense_Mutation_p.K292E|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000540638.2_Missense_Mutation_p.K292E|EPB41L3_ENST00000342933.3_Missense_Mutation_p.K292E|EPB41L3_ENST00000544123.1_Missense_Mutation_p.K292E	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	292	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.K292E(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						ATTGATAATTTTTTGGCATTT	0.338																																					p.K292E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A874G	18						.						162.0	154.0	157.0					18																	5433506		2203	4300	6503	5423506	SO:0001583	missense	23136	exon8			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.874A>G	18.37:g.5433506T>C	ENSP00000343158:p.Lys292Glu	Somatic		Capture	Illumina HiSeq	Phase_I	5423506	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	T	32	5.145321	0.94603	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.9	5.9	0.94986	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	D	0.88220	0.6378	M	0.79475	2.455	0.80722	D	1	D;P;D;D;P	0.65815	0.986;0.767;0.995;0.994;0.467	D;B;D;D;P	0.75484	0.964;0.352;0.986;0.977;0.535	D	0.89393	0.3690	10	0.72032	D	0.01	.	16.3076	0.82855	0.0:0.0:0.0:1.0	.	292;292;183;292;292	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	E	292;183;292;183;292;292	ENSP00000343158:K292E;ENSP00000441174:K292E;ENSP00000341138:K292E;ENSP00000382981:K292E	ENSP00000343158:K292E	K	-	1	0	EPB41L3	5423506	1.000000	0.71417	0.997000	0.53966	0.957000	0.61999	8.037000	0.88933	2.252000	0.74401	0.533000	0.62120	AAA		0.338	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
CELF4	56853	broad.mit.edu	37	18	35145329	35145329	+	Silent	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr18:35145329G>T	ENST00000591282.1	-	1	275	c.276C>A	c.(274-276)ggC>ggA	p.G92G	CELF4_ENST00000591287.1_Silent_p.G92G|CELF4_ENST00000603232.1_Silent_p.G92G|CELF4_ENST00000334919.5_Silent_p.G92G|CELF4_ENST00000420428.2_Silent_p.G92G|CELF4_ENST00000361795.5_Silent_p.G92G|CELF4_ENST00000601019.1_Silent_p.G92G|CELF4_ENST00000588597.1_Silent_p.G92G|CELF4_ENST00000412753.1_Silent_p.G92G			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	92	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.|Sufficient for RNA-binding and MSE- dependent splicing activity.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.G92G(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						CTTTGTGCATGCCTGTGAACC	0.622																																					p.G92G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C276A	18						.						126.0	115.0	119.0					18																	35145329		2203	4300	6503	33399327	SO:0001819	synonymous_variant	56853	exon1			AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.276C>A	18.37:g.35145329G>T		Somatic		Capture	Illumina HiSeq	Phase_I	33399327	NM_001025089	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Silent	SNP	ENST00000591282.1	37	CCDS32818.1																																																																																				0.622	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440892.1	NM_020180	
ATG4D	84971	broad.mit.edu	37	19	10659690	10659690	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:10659690G>A	ENST00000309469.4	+	6	1119	c.946G>A	c.(946-948)Gtg>Atg	p.V316M	RNU7-140P_ENST00000459546.1_RNA|ATG4D_ENST00000540862.1_Intron	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	316					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)	p.V316M(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TCTCAACCCCGTGTATGTGCC	0.592																																					p.V316M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G946A	19						.						122.0	92.0	102.0					19																	10659690		2203	4300	6503	10520690	SO:0001583	missense	84971	exon6			AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.946G>A	19.37:g.10659690G>A	ENSP00000311318:p.Val316Met	Somatic		Capture	Illumina HiSeq	Phase_I	10520690	NM_032885	Q969K0	Missense_Mutation	SNP	ENST00000309469.4	37	CCDS12241.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717042	0.68844	.	.	ENSG00000130734	ENST00000309469	T	0.46819	0.86	5.56	4.52	0.55395	.	0.243917	0.42294	N	0.000739	T	0.65333	0.2681	M	0.74389	2.26	0.80722	D	1	P;D	0.89917	0.918;1.0	B;D	0.67725	0.34;0.953	T	0.65957	-0.6042	10	0.38643	T	0.18	-26.0548	13.2164	0.59863	0.0786:0.0:0.9214:0.0	.	253;316	B4DGM8;Q86TL0	.;ATG4D_HUMAN	M	316	ENSP00000311318:V316M	ENSP00000311318:V316M	V	+	1	0	ATG4D	10520690	1.000000	0.71417	0.899000	0.35326	0.799000	0.45148	4.400000	0.59709	1.345000	0.45676	0.549000	0.68633	GTG		0.592	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452022.1	NM_032885	
RAB3D	9545	broad.mit.edu	37	19	11446168	11446168	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:11446168G>A	ENST00000222120.3	-	4	687	c.427C>T	c.(427-429)Cgt>Tgt	p.R143C	RAB3D_ENST00000589655.1_Missense_Mutation_p.R143C	NM_004283.3	NP_004274.1	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family	143					exocytosis (GO:0006887)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)|zymogen granule (GO:0042588)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.R143C(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|ovary(2)	14						GGCACAACACGTTCGTCCTCC	0.612																																					p.R143C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C427T	19						.						91.0	74.0	80.0					19																	11446168		2203	4300	6503	11307168	SO:0001583	missense	9545	exon4			AF081353	CCDS12257.1	19p13.2	2012-10-02			ENSG00000105514	ENSG00000105514		"""RAB, member RAS oncogene"""	9779	protein-coding gene	gene with protein product	"""Rab3D upregulated with myeloid differentiation"", ""glioblastoma overexpressed"""	604350		GOV		10023084, 10072586	Standard	NM_004283		Approved	RAB16, D2-2, RAD3D	uc002mqx.3	O95716	OTTHUMG00000180835	ENST00000222120.3:c.427C>T	19.37:g.11446168G>A	ENSP00000222120:p.Arg143Cys	Somatic		Capture	Illumina HiSeq	Phase_I	11307168	NM_004283		Missense_Mutation	SNP	ENST00000222120.3	37	CCDS12257.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986364	0.74589	.	.	ENSG00000105514	ENST00000222120	T	0.80653	-1.4	4.62	4.62	0.57501	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.93154	0.7820	H	0.98388	4.22	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.94729	0.7908	10	0.87932	D	0	.	12.4356	0.55598	0.0:0.0:0.8315:0.1685	.	143	O95716	RAB3D_HUMAN	C	143	ENSP00000222120:R143C	ENSP00000222120:R143C	R	-	1	0	RAB3D	11307168	1.000000	0.71417	0.981000	0.43875	0.861000	0.49209	2.992000	0.49417	2.575000	0.86900	0.448000	0.29417	CGT		0.612	RAB3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453211.1	NM_004283	
ZNF700	90592	broad.mit.edu	37	19	12059831	12059831	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:12059831A>G	ENST00000254321.5	+	4	1135	c.992A>G	c.(991-993)aAa>aGa	p.K331R	ZNF763_ENST00000538752.1_Intron|ZNF763_ENST00000591944.1_Intron|ZNF700_ENST00000482090.1_Missense_Mutation_p.K313R|ZNF763_ENST00000590798.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	331					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K331R(1)	ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						CACTCTGGGAAAAAACCGTAT	0.378																																					p.K331R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A992G	19						.						75.0	82.0	80.0					19																	12059831		2203	4300	6503	11920831	SO:0001583	missense	90592	exon4			AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.992A>G	19.37:g.12059831A>G	ENSP00000254321:p.Lys331Arg	Somatic		Capture	Illumina HiSeq	Phase_I	11920831	NM_144566	B9EGU4	Missense_Mutation	SNP	ENST00000254321.5	37	CCDS32915.1	.	.	.	.	.	.	.	.	.	.	a	15.62	2.888034	0.52014	.	.	ENSG00000196757	ENST00000254321	T	0.20463	2.07	0.768	0.768	0.18487	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25195	0.0612	L	0.41027	1.25	0.21719	N	0.999578	P	0.51653	0.947	P	0.53450	0.726	T	0.10989	-1.0606	9	0.87932	D	0	.	7.0638	0.25141	1.0:0.0:0.0:0.0	.	331	Q9H0M5	ZN700_HUMAN	R	331	ENSP00000254321:K331R	ENSP00000254321:K331R	K	+	2	0	ZNF700	11920831	0.004000	0.15560	0.004000	0.12327	0.117000	0.20001	1.842000	0.39250	0.576000	0.29452	0.254000	0.18369	AAA		0.378	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344126.2	NM_144566	
CIB3	117286	broad.mit.edu	37	19	16284243	16284243	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:16284243G>A	ENST00000269878.4	-	1	93	c.44C>T	c.(43-45)gCg>gTg	p.A15V	CIB3_ENST00000379859.3_Missense_Mutation_p.A15V|CIB3_ENST00000541493.1_5'UTR	NM_054113.2	NP_473454.1	Q96Q77	CIB3_HUMAN	calcium and integrin binding family member 3	15							calcium ion binding (GO:0005509)	p.A15V(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16						TACCTGATACGCTTCCAGCTG	0.567																																					p.A15V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C44T	19						.						231.0	158.0	183.0					19																	16284243		2203	4300	6503	16145243	SO:0001583	missense	117286	exon1			AB050868	CCDS12340.1, CCDS74305.1	19p13.12	2013-01-10						"""EF-hand domain containing"""	24580	protein-coding gene	gene with protein product		610645					Standard	XM_005259728		Approved	KIP3	uc002nds.3	Q96Q77		ENST00000269878.4:c.44C>T	19.37:g.16284243G>A	ENSP00000269878:p.Ala15Val	Somatic		Capture	Illumina HiSeq	Phase_I	16145243	NM_054113	E7EUX1|Q2M1W0|Q6ISP1	Missense_Mutation	SNP	ENST00000269878.4	37	CCDS12340.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378290	0.42207	.	.	ENSG00000141977	ENST00000269878;ENST00000379859;ENST00000541493	T;T	0.66638	-0.22;3.0	4.68	2.27	0.28462	EF-hand-like domain (1);	0.201647	0.42172	D	0.000760	T	0.57814	0.2079	L	0.55481	1.735	0.21499	N	0.999666	B;B	0.25486	0.127;0.026	B;B	0.17098	0.014;0.017	T	0.50259	-0.8849	10	0.41790	T	0.15	-5.9534	11.1537	0.48476	0.0:0.0:0.5582:0.4418	.	15;15	E7EUX1;Q96Q77	.;CIB3_HUMAN	V	15	ENSP00000269878:A15V;ENSP00000369188:A15V	ENSP00000269878:A15V	A	-	2	0	CIB3	16145243	0.993000	0.37304	0.288000	0.24862	0.718000	0.41266	2.143000	0.42187	0.452000	0.26830	0.561000	0.74099	GCG		0.567	CIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460351.1	NM_054113	
AP1M1	8907	broad.mit.edu	37	19	16319905	16319905	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:16319905A>T	ENST00000291439.3	+	5	912	c.463A>T	c.(463-465)Aac>Tac	p.N155Y	AP1M1_ENST00000444449.2_Missense_Mutation_p.N155Y|AP1M1_ENST00000541844.1_Missense_Mutation_p.N83Y|AP1M1_ENST00000429941.2_Missense_Mutation_p.N155Y|AP1M1_ENST00000590756.1_Missense_Mutation_p.N83Y	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	155					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)		p.N155Y(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						CACCGTCACCAACGCGGTGTC	0.577																																					p.N155Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A463T	19						.						128.0	115.0	119.0					19																	16319905		2203	4300	6503	16180905	SO:0001583	missense	8907	exon5				CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.463A>T	19.37:g.16319905A>T	ENSP00000291439:p.Asn155Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	16180905	NM_001130524	Q4TTY5	Missense_Mutation	SNP	ENST00000291439.3	37	CCDS12342.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.176814	0.78564	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000541844;ENST00000429941	T;T;T;T	0.66280	0.4;0.38;0.41;-0.2	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	D	0.82559	0.5063	M	0.92077	3.27	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	P;D;D	0.91635	0.827;0.986;0.999	D	0.86669	0.1909	10	0.72032	D	0.01	-39.3831	12.9082	0.58164	1.0:0.0:0.0:0.0	.	155;155;155	E7ENJ6;Q4TTY5;Q9BXS5	.;.;AP1M1_HUMAN	Y	155;155;83;155	ENSP00000388996:N155Y;ENSP00000291439:N155Y;ENSP00000445682:N83Y;ENSP00000411498:N155Y	ENSP00000291439:N155Y	N	+	1	0	AP1M1	16180905	1.000000	0.71417	0.977000	0.42913	0.873000	0.50193	8.897000	0.92532	1.826000	0.53198	0.460000	0.39030	AAC		0.577	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460492.1	NM_032493	
PIAS4	51588	broad.mit.edu	37	19	4013016	4013016	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:4013016G>T	ENST00000262971.2	+	2	238	c.123G>T	c.(121-123)agG>agT	p.R41S		NM_015897.2	NP_056981.2	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	41	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186, ECO:0000305}.				negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R41S(1)|p.R41R(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(3)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGTCACCAGGGCCCTCCAGC	0.567																																					p.R41S												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.G123T	19						.						83.0	79.0	80.0					19																	4013016		2203	4300	6503	3964016	SO:0001583	missense	51588	exon2			AF077952	CCDS12118.1	19p13.3	2011-10-11						"""Zinc fingers, MIZ-type"""	17002	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 6"""	605989				9724754	Standard	NM_015897		Approved	Piasg, PIASY, FLJ12419, ZMIZ6	uc002lzg.3	Q8N2W9		ENST00000262971.2:c.123G>T	19.37:g.4013016G>T	ENSP00000262971:p.Arg41Ser	Somatic		Capture	Illumina HiSeq	Phase_I	3964016	NM_015897	O75926|Q96G19|Q9UN16	Missense_Mutation	SNP	ENST00000262971.2	37	CCDS12118.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.547568	0.65311	.	.	ENSG00000105229	ENST00000262971	T	0.56275	0.47	5.14	0.407	0.16371	DNA-binding SAP (3);	0.000000	0.85682	D	0.000000	T	0.59797	0.2220	L	0.56199	1.76	0.54753	D	0.999989	D	0.89917	1.0	D	0.79108	0.992	T	0.57619	-0.7780	10	0.87932	D	0	-38.3019	5.2411	0.15471	0.3245:0.1473:0.5282:0.0	.	41	Q8N2W9	PIAS4_HUMAN	S	41	ENSP00000262971:R41S	ENSP00000262971:R41S	R	+	3	2	PIAS4	3964016	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	0.869000	0.27996	0.154000	0.19237	-0.254000	0.11334	AGG		0.567	PIAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457496.1	NM_015897	
SHD	56961	broad.mit.edu	37	19	4284815	4284815	+	Silent	SNP	C	C	T	rs189700031		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:4284815C>T	ENST00000543264.2	+	4	2093	c.630C>T	c.(628-630)ggC>ggT	p.G210G	SHD_ENST00000600475.1_3'UTR|SHD_ENST00000599689.1_Silent_p.G210G	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	210								p.G210G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACTCCAGGCTCAGCCAAGG	0.637																																					p.G210G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C630T	19						.						46.0	52.0	50.0					19																	4284815		2203	4300	6503	4235815	SO:0001819	synonymous_variant	56961	exon4			BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.630C>T	19.37:g.4284815C>T		Somatic		Capture	Illumina HiSeq	Phase_I	4235815	NM_020209	Q96NC2	Silent	SNP	ENST00000543264.2	37	CCDS12125.1																																																																																				0.637	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458082.1	NM_020209	
NWD1	284434	broad.mit.edu	37	19	16918880	16918880	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:16918880C>T	ENST00000552788.1	+	16	4220	c.4220C>T	c.(4219-4221)tCt>tTt	p.S1407F	NWD1_ENST00000379808.3_Missense_Mutation_p.S1407F|NWD1_ENST00000524140.2_Missense_Mutation_p.S1407F|NWD1_ENST00000523826.1_Missense_Mutation_p.S1201F|NWD1_ENST00000339803.6_Missense_Mutation_p.S1272F|NWD1_ENST00000549814.1_Missense_Mutation_p.S1365F			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1407							ATP binding (GO:0005524)	p.S1407F(1)|p.S1272F(1)		NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GTCAGCGGGTCTGAGGATGCC	0.592																																					p.S1407F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C4220T	19						.						91.0	89.0	90.0					19																	16918880		2203	4300	6503	16779880	SO:0001583	missense	284434	exon18			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.4220C>T	19.37:g.16918880C>T	ENSP00000447224:p.Ser1407Phe	Somatic		Capture	Illumina HiSeq	Phase_I	16779880	NM_001007525	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	C	14.30	2.493193	0.44352	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85;-0.85;-0.85	4.95	3.9	0.45041	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.414698	0.24301	N	0.039725	D	0.89248	0.6661	H	0.97874	4.095	0.21697	N	0.999588	D;D;D	0.58970	0.984;0.963;0.97	P;P;P	0.59424	0.857;0.777;0.857	D	0.83549	0.0100	10	0.87932	D	0	-8.5323	11.8398	0.52346	0.0:0.6589:0.3411:0.0	.	1407;1407;1272	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	F	1272;1407;1365;1407;1201;1407;1272	ENSP00000428579:S1407F;ENSP00000447548:S1365F;ENSP00000369136:S1407F;ENSP00000428955:S1201F;ENSP00000447224:S1407F;ENSP00000340159:S1272F	ENSP00000340159:S1272F	S	+	2	0	NWD1	16779880	0.003000	0.15002	0.022000	0.16811	0.325000	0.28411	1.243000	0.32767	1.058000	0.40530	0.655000	0.94253	TCT		0.592	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
EMR1	2015	broad.mit.edu	37	19	6897477	6897477	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:6897477C>A	ENST00000312053.4	+	5	470	c.433C>A	c.(433-435)Cat>Aat	p.H145N	AC020895.1_ENST00000580648.1_RNA|EMR1_ENST00000381407.5_Intron|EMR1_ENST00000381404.4_Missense_Mutation_p.H93N|EMR1_ENST00000450315.3_Intron|EMR1_ENST00000601198.1_3'UTR|EMR1_ENST00000250572.8_Missense_Mutation_p.H145N	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	145	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.H145N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					CTGCCCTGAGCATTCTGACTG	0.473																																					p.H145N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C433A	19						.						97.0	80.0	86.0					19																	6897477		2203	4300	6503	6848477	SO:0001583	missense	2015	exon5			X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.433C>A	19.37:g.6897477C>A	ENSP00000311545:p.His145Asn	Somatic		Capture	Illumina HiSeq	Phase_I	6848477	NM_001974	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	37	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	C	5.210	0.224192	0.09863	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572	D;T;D	0.91180	-2.8;-1.02;-2.8	4.12	-0.0918	0.13659	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.67581	0.2908	N	0.00771	-1.2	0.80722	D	1	B;B;B	0.15930	0.001;0.015;0.015	B;B;B	0.18561	0.002;0.022;0.022	T	0.60772	-0.7197	9	0.06891	T	0.86	.	9.4335	0.38624	0.5869:0.4131:0.0:0.0	.	145;93;145	Q14246-2;E9PD45;Q14246	.;.;EMR1_HUMAN	N	145;145;93;145	ENSP00000311545:H145N;ENSP00000370811:H93N;ENSP00000250572:H145N	ENSP00000250572:H145N	H	+	1	0	EMR1	6848477	0.000000	0.05858	0.973000	0.42090	0.642000	0.38348	-0.652000	0.05366	0.589000	0.29677	0.563000	0.77884	CAT		0.473	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1		
MUC16	94025	broad.mit.edu	37	19	9047677	9047677	+	Silent	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:9047677C>T	ENST00000397910.4	-	5	34157	c.33954G>A	c.(33952-33954)gtG>gtA	p.V11318V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11320	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.V6951V(1)|p.V11318V(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGATGTCAGCACACCTGGTA	0.493																																					p.V11318V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G33954A	19						.						108.0	102.0	104.0					19																	9047677		2060	4197	6257	8908677	SO:0001819	synonymous_variant	94025	exon5			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33954G>A	19.37:g.9047677C>T		Somatic		Capture	Illumina HiSeq	Phase_I	8908677	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	broad.mit.edu	37	19	9059941	9059941	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:9059941A>T	ENST00000397910.4	-	3	27708	c.27505T>A	c.(27505-27507)Tct>Act	p.S9169T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9171	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S4802T(1)|p.S9169T(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCGAAGAAGAGTGGATGCTG	0.517																																					p.S9169T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T27505A	19						.						88.0	84.0	85.0					19																	9059941		2046	4210	6256	8920941	SO:0001583	missense	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27505T>A	19.37:g.9059941A>T	ENSP00000381008:p.Ser9169Thr	Somatic		Capture	Illumina HiSeq	Phase_I	8920941	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	6.539	0.467663	0.12402	.	.	ENSG00000181143	ENST00000397910	T	0.28666	1.6	2.23	2.23	0.28157	.	.	.	.	.	T	0.36496	0.0969	L	0.27053	0.805	.	.	.	D	0.64830	0.994	D	0.73708	0.981	T	0.45542	-0.9254	8	0.87932	D	0	.	6.4467	0.21879	1.0:0.0:0.0:0.0	.	9169	B5ME49	.	T	9169	ENSP00000381008:S9169T	ENSP00000381008:S9169T	S	-	1	0	MUC16	8920941	0.046000	0.20272	0.003000	0.11579	0.004000	0.04260	0.422000	0.21296	1.287000	0.44583	0.248000	0.18094	TCT		0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	broad.mit.edu	37	19	9073176	9073176	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:9073176G>C	ENST00000397910.4	-	3	14473	c.14270C>G	c.(14269-14271)cCt>cGt	p.P4757R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4759	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P4757L(2)|p.P4757R(2)|p.P390R(1)|p.P390L(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AACAGAAGAAGGTAAGGTTGT	0.488																																					p.P4757R												.	.	6	Substitution - Missense(6)	large_intestine(3)|endometrium(3)	c.C14270G	19						.						111.0	106.0	108.0					19																	9073176		2090	4211	6301	8934176	SO:0001583	missense	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14270C>G	19.37:g.9073176G>C	ENSP00000381008:p.Pro4757Arg	Somatic		Capture	Illumina HiSeq	Phase_I	8934176	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.399	-0.338072	0.05278	.	.	ENSG00000181143	ENST00000397910	T	0.25250	1.81	1.48	1.48	0.22813	.	.	.	.	.	T	0.14830	0.0358	L	0.29908	0.895	.	.	.	P	0.47484	0.896	B	0.36808	0.233	T	0.18618	-1.0331	8	0.87932	D	0	.	6.3871	0.21566	0.0:0.0:1.0:0.0	.	4757	B5ME49	.	R	4757	ENSP00000381008:P4757R	ENSP00000381008:P4757R	P	-	2	0	MUC16	8934176	0.001000	0.12720	0.003000	0.11579	0.030000	0.12068	0.512000	0.22755	1.120000	0.41904	0.306000	0.20318	CCT		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CCDC8	83987	broad.mit.edu	37	19	46914491	46914491	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr19:46914491C>G	ENST00000307522.3	-	1	2350	c.1577G>C	c.(1576-1578)aGa>aCa	p.R526T		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	526					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.R526T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		AGCTTCTGCTCTGGCCTCGGC	0.647																																					p.R526T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1577C	19						.						79.0	70.0	73.0					19																	46914491		2203	4300	6503	51606331	SO:0001583	missense	83987	exon1			BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.1577G>C	19.37:g.46914491C>G	ENSP00000303158:p.Arg526Thr	Somatic		Capture	Illumina HiSeq	Phase_I	51606331	NM_032040	Q8TB26	Missense_Mutation	SNP	ENST00000307522.3	37	CCDS12685.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809802	0.31961	.	.	ENSG00000169515	ENST00000307522	T	0.21734	1.99	4.31	4.31	0.51392	.	0.193492	0.25200	N	0.032400	T	0.33760	0.0874	M	0.62723	1.935	0.26704	N	0.97111	D	0.54207	0.965	P	0.53146	0.719	T	0.10847	-1.0612	10	0.72032	D	0.01	-3.613	12.5925	0.56451	0.0:1.0:0.0:0.0	.	526	Q9H0W5	CCDC8_HUMAN	T	526	ENSP00000303158:R526T	ENSP00000303158:R526T	R	-	2	0	CCDC8	51606331	0.367000	0.25023	0.967000	0.41034	0.026000	0.11368	1.960000	0.40422	2.695000	0.91970	0.455000	0.32223	AGA		0.647	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	NM_032040	
CASZ1	54897	broad.mit.edu	37	1	10706237	10706237	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:10706237T>C	ENST00000377022.3	-	17	3961	c.3644A>G	c.(3643-3645)aAc>aGc	p.N1215S	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1215					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N1215S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GTCTCGCACGTTCACCAGGTT	0.572																																					p.N1215S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3644G	1						.						218.0	256.0	243.0					1																	10706237		2146	4239	6385	10628824	SO:0001583	missense	54897	exon17			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3644A>G	1.37:g.10706237T>C	ENSP00000366221:p.Asn1215Ser	Somatic		Capture	Illumina HiSeq	Phase_I	10628824	NM_001079843	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.253622	0.80135	.	.	ENSG00000130940	ENST00000377022	.	.	.	4.94	4.94	0.65067	.	0.000000	0.48767	U	0.000172	T	0.54095	0.1837	L	0.40543	1.245	0.80722	D	1	P	0.46784	0.884	P	0.46510	0.519	T	0.51108	-0.8747	9	0.27082	T	0.32	-28.7853	14.6461	0.68762	0.0:0.0:0.0:1.0	.	1215	Q86V15	CASZ1_HUMAN	S	1215	.	ENSP00000366221:N1215S	N	-	2	0	CASZ1	10628824	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.099000	0.71466	1.863000	0.54032	0.374000	0.22700	AAC		0.572	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
S1PR1	1901	broad.mit.edu	37	1	101705120	101705120	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:101705120G>A	ENST00000305352.6	+	2	955	c.580G>A	c.(580-582)Gtg>Atg	p.V194M		NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	194					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.V194M(1)		NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						CTGCTCCACCGTGCTGCCGCT	0.557											OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V194M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G580A	1						.						131.0	121.0	124.0					1																	101705120		2203	4300	6503	101477708	SO:0001583	missense	1901	exon2			M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.580G>A	1.37:g.101705120G>A	ENSP00000305416:p.Val194Met	Somatic	1360	Capture	Illumina HiSeq	Phase_I	101477708	NM_001400	D3DT66|Q9BYY4|Q9NYN8	Missense_Mutation	SNP	ENST00000305352.6	37	CCDS777.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932080	0.73442	.	.	ENSG00000170989	ENST00000305352;ENST00000424264	T	0.37584	1.19	5.32	4.41	0.53225	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.45034	0.1322	L	0.53780	1.695	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.50923	-0.8770	10	0.87932	D	0	.	13.8986	0.63787	0.0736:0.0:0.9264:0.0	.	194	P21453	S1PR1_HUMAN	M	194	ENSP00000305416:V194M	ENSP00000305416:V194M	V	+	1	0	S1PR1	101477708	1.000000	0.71417	0.825000	0.32803	0.962000	0.63368	9.869000	0.99810	1.239000	0.43787	0.455000	0.32223	GTG		0.557	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029908.1	NM_001400	
NRAS	4893	broad.mit.edu	37	1	115256529	115256529	+	Missense_Mutation	SNP	T	T	A	rs11554290	byFrequency	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:115256529T>A	ENST00000369535.4	-	3	435	c.182A>T	c.(181-183)cAa>cTa	p.Q61L		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61R(817)|p.Q61L(175)|p.Q61P(23)|p.Q61K(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCTTCTTGTCCAGCTGT	0.458	Q61L(C3A_LIVER)|Q61L(HEPG2_LIVER)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MELJUSO_SKIN)|Q61L(MHHES1_BONE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(HT1197_URINARY_TRACT)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(KU1919_URINARY_TRACT)|Q61R(NCIH2347_LUNG)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(SKMEL2_SKIN)|Q61R(SW1271_LUNG)|Q61R(TT2609C02_THYROID)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61L			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,-1 	.	1016	Substitution - Missense(1016)	skin(466)|thyroid(279)|haematopoietic_and_lymphoid_tissue(124)|NS(50)|large_intestine(27)|lung(17)|urinary_tract(11)|adrenal_gland(7)|liver(7)|breast(7)|soft_tissue(4)|testis(3)|endometrium(3)|ovary(3)|central_nervous_system(2)|pancreas(2)|eye(1)|prostate(1)|meninges(1)|autonomic_ganglia(1)	c.A182T	1						.						180.0	156.0	164.0					1																	115256529		2203	4300	6503	115058052	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.182A>T	1.37:g.115256529T>A	ENSP00000358548:p.Gln61Leu	Somatic		Capture	Illumina HiSeq	Phase_I	115058052	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.844732	0.91197	.	.	ENSG00000213281	ENST00000369535	D	0.83992	-1.79	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.92446	0.7602	H	0.96748	3.875	0.80722	D	1	D	0.55800	0.973	P	0.61533	0.89	D	0.94664	0.7851	10	0.72032	D	0.01	.	15.0132	0.71565	0.0:0.0:0.0:1.0	.	61	P01111	RASN_HUMAN	L	61	ENSP00000358548:Q61L	ENSP00000358548:Q61L	Q	-	2	0	NRAS	115058052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.761000	0.85260	2.120000	0.65058	0.533000	0.62120	CAA		0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
SLC22A15	55356	broad.mit.edu	37	1	116607092	116607092	+	Missense_Mutation	SNP	G	G	A	rs375814433		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:116607092G>A	ENST00000369503.4	+	10	1458	c.1328G>A	c.(1327-1329)cGa>cAa	p.R443Q		NM_018420.2	NP_060890.2	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	443					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.R443Q(1)		endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|urinary_tract(1)	17	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		ATGTTCTCCCGAGTTGGTGGG	0.423																																					p.R443Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1328A	1						.	G	GLN/ARG	1,3721		0,1,1860	204.0	183.0	190.0		1328	4.9	1.0	1		190	0,8202		0,0,4101	no	missense	SLC22A15	NM_018420.2	43	0,1,5961	AA,AG,GG		0.0,0.0269,0.0084	probably-damaging	443/548	116607092	1,11923	1861	4101	5962	116408615	SO:0001583	missense	55356	exon10			AY145501	CCDS44198.1	1p12	2013-05-22	2008-01-11		ENSG00000163393	ENSG00000163393		"""Solute carriers"""	20301	protein-coding gene	gene with protein product		608275	"""solute carrier family 22 (organic cation transporter), member 15"""			12372408	Standard	NM_018420		Approved	FLIPT1	uc001egb.4	Q8IZD6	OTTHUMG00000012008	ENST00000369503.4:c.1328G>A	1.37:g.116607092G>A	ENSP00000358515:p.Arg443Gln	Somatic		Capture	Illumina HiSeq	Phase_I	116408615	NM_018420	A8MUR3|Q6UXP5|Q8TAL9|Q9NSH5	Missense_Mutation	SNP	ENST00000369503.4	37	CCDS44198.1	.	.	.	.	.	.	.	.	.	.	G	32	5.145548	0.94603	2.69E-4	0.0	ENSG00000163393	ENST00000369503	T	0.74002	-0.8	4.93	4.93	0.64822	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.84297	0.5441	M	0.83953	2.67	0.80722	D	1	D	0.67145	0.996	D	0.63192	0.912	D	0.86486	0.1794	10	0.72032	D	0.01	.	18.331	0.90268	0.0:0.0:1.0:0.0	.	443	Q8IZD6	S22AF_HUMAN	Q	443	ENSP00000358515:R443Q	ENSP00000358515:R443Q	R	+	2	0	SLC22A15	116408615	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.272000	0.78516	2.558000	0.86282	0.561000	0.74099	CGA		0.423	SLC22A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033220.2	NM_018420	
TDRKH	11022	broad.mit.edu	37	1	151751672	151751672	+	Silent	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:151751672G>A	ENST00000368822.1	-	5	1101	c.468C>T	c.(466-468)gcC>gcT	p.A156A	TDRKH_ENST00000458431.2_Silent_p.A156A|TDRKH_ENST00000484421.1_5'UTR|TDRKH_ENST00000368824.3_Silent_p.A156A|TDRKH_ENST00000440583.2_5'UTR|TDRKH_ENST00000368827.6_Silent_p.A156A|TDRKH_ENST00000368823.1_Silent_p.A152A|TDRKH_ENST00000368825.3_Silent_p.A111A			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	156	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)	p.A156A(1)		breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGGTAATTTTGGCTCCAGATG	0.433																																					p.A156A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C468T	1						.						151.0	138.0	142.0					1																	151751672		1868	4096	5964	150018296	SO:0001819	synonymous_variant	11022	exon5			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.468C>T	1.37:g.151751672G>A		Somatic		Capture	Illumina HiSeq	Phase_I	150018296	NM_001083965	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Silent	SNP	ENST00000368822.1	37	CCDS41394.1																																																																																				0.433	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000036648.2	NM_006862	
DDR2	4921	broad.mit.edu	37	1	162741944	162741944	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:162741944G>T	ENST00000367922.3	+	14	2073	c.1635G>T	c.(1633-1635)atG>atT	p.M545I	DDR2_ENST00000367921.3_Missense_Mutation_p.M545I	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	545					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.M545I(1)		central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	CCGTCACCATGGACCTGCTCT	0.552																																					p.M545I	NSCLC(161;314 2006 8283 19651 23192)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1635T	1						.						78.0	70.0	73.0					1																	162741944		2203	4300	6503	161008568	SO:0001583	missense	4921	exon14			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1635G>T	1.37:g.162741944G>T	ENSP00000356899:p.Met545Ile	Somatic		Capture	Illumina HiSeq	Phase_I	161008568	NM_001014796	Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	37	CCDS1241.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.30|18.30	3.593352|3.593352	0.66219|0.66219	.|.	.|.	ENSG00000162733|ENSG00000162733	ENST00000433757|ENST00000367922;ENST00000367921	.|D;D	.|0.83163	.|-1.69;-1.69	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Protein kinase-like domain (1);	.|0.037398	.|0.85682	.|D	.|0.000000	.|T	.|0.58680	.|0.2139	N|N	0.14661|0.14661	0.345|0.345	.|.	.|.	.|.	.|B	.|0.19331	.|0.035	.|B	.|0.17098	.|0.017	.|T	.|0.56589	.|-0.7954	.|9	.|0.18276	.|T	.|0.48	.|.	17.7947|17.7947	0.88566|0.88566	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|545	.|Q16832	.|DDR2_HUMAN	X|I	138|545	.|ENSP00000356899:M545I;ENSP00000356898:M545I	.|ENSP00000356898:M545I	G|M	+|+	1|3	0|0	DDR2|DDR2	161008568|161008568	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.338000|9.338000	0.96553|0.96553	2.536000|2.536000	0.85505|0.85505	0.655000|0.655000	0.94253|0.94253	GGA|ATG		0.552	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182	
SEC16B	89866	broad.mit.edu	37	1	177909778	177909778	+	Silent	SNP	T	T	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:177909778T>A	ENST00000308284.6	-	17	2183	c.2094A>T	c.(2092-2094)ccA>ccT	p.P698P	RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	698					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)		p.P699P(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						CTAGCCAATCTGGCTCCAGGT	0.572																																					p.P698P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2094T	1						.						44.0	55.0	51.0					1																	177909778		2138	4247	6385	176176401	SO:0001819	synonymous_variant	89866	exon17			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2094A>T	1.37:g.177909778T>A		Somatic		Capture	Illumina HiSeq	Phase_I	176176401	NM_033127	A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Silent	SNP	ENST00000308284.6	37	CCDS44281.1																																																																																				0.572	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127	
TAS1R2	80834	broad.mit.edu	37	1	19181357	19181357	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:19181357A>T	ENST00000375371.3	-	3	628	c.607T>A	c.(607-609)Tgg>Agg	p.W203R	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	203					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.W203R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	ATCCAGTTCCAGCGGAAGTGC	0.637																																					p.W203R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T607A	1						.						39.0	36.0	37.0					1																	19181357		2203	4300	6503	19053944	SO:0001583	missense	80834	exon3				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.607T>A	1.37:g.19181357A>T	ENSP00000364520:p.Trp203Arg	Somatic		Capture	Illumina HiSeq	Phase_I	19053944	NM_152232	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	.	.	.	.	.	.	.	.	.	.	A	16.28	3.079727	0.55753	.	.	ENSG00000179002	ENST00000375371	D	0.91686	-2.89	4.99	3.86	0.44501	Extracellular ligand-binding receptor (1);	0.163476	0.29537	N	0.011865	D	0.96194	0.8759	M	0.91818	3.245	0.52099	D	0.999946	D	0.89917	1.0	D	0.97110	1.0	D	0.95549	0.8619	10	0.87932	D	0	.	8.9523	0.35796	0.9114:0.0:0.0886:0.0	.	203	Q8TE23	TS1R2_HUMAN	R	203	ENSP00000364520:W203R	ENSP00000364520:W203R	W	-	1	0	TAS1R2	19053944	1.000000	0.71417	0.833000	0.33012	0.261000	0.26267	7.165000	0.77544	0.927000	0.37143	0.459000	0.35465	TGG		0.637	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
ECE1	1889	broad.mit.edu	37	1	21585326	21585326	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:21585326C>A	ENST00000374893.6	-	6	696	c.622G>T	c.(622-624)Ggc>Tgc	p.G208C	ECE1_ENST00000357071.4_Missense_Mutation_p.G196C|ECE1_ENST00000528294.1_5'Flank|ECE1_ENST00000415912.2_Missense_Mutation_p.G192C|ECE1_ENST00000436918.2_Missense_Mutation_p.G208C|ECE1_ENST00000264205.6_Missense_Mutation_p.G205C	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	208					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)	p.G208C(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		ATGTTCCAGCCCCCGAGCTGT	0.612																																					p.G192C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G574T	1						.						113.0	87.0	96.0					1																	21585326		2203	4300	6503	21457913	SO:0001583	missense	1889	exon6			D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.622G>T	1.37:g.21585326C>A	ENSP00000364028:p.Gly208Cys	Somatic		Capture	Illumina HiSeq	Phase_I	21457913	NM_001113348	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Missense_Mutation	SNP	ENST00000374893.6	37	CCDS215.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530443	0.85706	.	.	ENSG00000117298	ENST00000415912;ENST00000357071;ENST00000374893;ENST00000436918;ENST00000264205	D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94	5.1	5.1	0.69264	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	D	0.94178	0.8132	M	0.92738	3.34	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.99;1.0;1.0;1.0;1.0	D	0.95502	0.8578	10	0.87932	D	0	-33.5254	17.1128	0.86680	0.0:1.0:0.0:0.0	.	208;192;208;196;205	B4DKB2;Q2Z2K8;P42892;P42892-2;P42892-4	.;.;ECE1_HUMAN;.;.	C	192;196;208;208;205	ENSP00000405088:G192C;ENSP00000349581:G196C;ENSP00000364028:G208C;ENSP00000388439:G208C;ENSP00000264205:G205C	ENSP00000264205:G205C	G	-	1	0	ECE1	21457913	1.000000	0.71417	0.999000	0.59377	0.841000	0.47740	7.456000	0.80751	2.381000	0.81170	0.591000	0.81541	GGC		0.612	ECE1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007470.2	NM_001397	
CACNA1E	777	broad.mit.edu	37	1	181620505	181620505	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:181620505G>T	ENST00000367573.2	+	7	983	c.983G>T	c.(982-984)tGg>tTg	p.W328L	CACNA1E_ENST00000526775.1_Missense_Mutation_p.W328L|CACNA1E_ENST00000367570.1_Missense_Mutation_p.W328L|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000360108.3_Missense_Mutation_p.W328L|CACNA1E_ENST00000358338.5_Missense_Mutation_p.W279L|CACNA1E_ENST00000357570.5_Missense_Mutation_p.W279L	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	328					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.W328L(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ACCTGGAATTGGCTGTACTTC	0.428																																					p.W328L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G983T	1						.						181.0	172.0	175.0					1																	181620505		1920	4136	6056	179887128	SO:0001583	missense	777	exon7			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.983G>T	1.37:g.181620505G>T	ENSP00000356545:p.Trp328Leu	Somatic		Capture	Illumina HiSeq	Phase_I	179887128	NM_000721	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	33	5.225678	0.95173	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97352	-4.35;-4.35;-4.35;-4.35;-4.35;-4.35;-4.35	5.12	5.12	0.69794	.	0.132558	0.64402	D	0.000015	D	0.98482	0.9494	M	0.83312	2.635	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.78314	0.991;0.991	D	0.99501	1.0953	10	0.72032	D	0.01	.	18.5282	0.90981	0.0:0.0:1.0:0.0	.	328;328	Q15878-2;Q15878-3	.;.	L	328;328;328;279;279;328;328	ENSP00000432038:W328L;ENSP00000356542:W328L;ENSP00000434814:W328L;ENSP00000350183:W279L;ENSP00000351101:W279L;ENSP00000353222:W328L;ENSP00000356545:W328L	ENSP00000350183:W279L	W	+	2	0	CACNA1E	179887128	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.248000	0.95456	2.549000	0.85964	0.563000	0.77884	TGG		0.428	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
SPATA17	128153	broad.mit.edu	37	1	217947845	217947845	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:217947845A>T	ENST00000366933.4	+	7	744	c.689A>T	c.(688-690)gAa>gTa	p.E230V		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	230						cytoplasm (GO:0005737)		p.E230V(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		CCTCGGTCTGAAATTCTACCA	0.378																																					p.E230V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A689T	1						.						58.0	56.0	57.0					1																	217947845		2203	4300	6503	216014468	SO:0001583	missense	128153	exon7			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.689A>T	1.37:g.217947845A>T	ENSP00000355900:p.Glu230Val	Somatic		Capture	Illumina HiSeq	Phase_I	216014468	NM_138796	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	A	16.50	3.141246	0.57044	.	.	ENSG00000162814	ENST00000366933	T	0.47528	0.84	5.45	1.42	0.22433	.	1.155410	0.06172	N	0.677874	T	0.41488	0.1161	L	0.59436	1.845	0.09310	N	1	B	0.18461	0.028	B	0.21151	0.033	T	0.31223	-0.9951	10	0.36615	T	0.2	-3.8244	2.5977	0.04858	0.4911:0.2238:0.0683:0.2168	.	230	Q96L03	SPT17_HUMAN	V	230	ENSP00000355900:E230V	ENSP00000355900:E230V	E	+	2	0	SPATA17	216014468	0.000000	0.05858	0.000000	0.03702	0.797000	0.45037	0.847000	0.27696	0.027000	0.15297	0.460000	0.39030	GAA		0.378	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796	
NID1	4811	broad.mit.edu	37	1	236189440	236189440	+	Splice_Site	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:236189440C>T	ENST00000264187.6	-	8	1822	c.1740G>A	c.(1738-1740)gtG>gtA	p.V580V	NID1_ENST00000366595.3_Splice_Site_p.V580V	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	580	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.V580V(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	AGGAAGTGATCACTGCAGAGT	0.567																																					p.V580V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1740A	1						.						61.0	60.0	61.0					1																	236189440		2203	4300	6503	234256063	SO:0001630	splice_region_variant	4811	exon8			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1739-1G>A	1.37:g.236189440C>T		Somatic		Capture	Illumina HiSeq	Phase_I	234256063	NM_002508	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Silent	SNP	ENST00000264187.6	37	CCDS1608.1																																																																																				0.567	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	Silent
SLC2A7	155184	broad.mit.edu	37	1	9083116	9083116	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:9083116C>T	ENST00000400906.1	-	3	171	c.172G>A	c.(172-174)Gaa>Aaa	p.E58K		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	58					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.E58K(2)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		AAGTAGGTTTCGTTGTAAAAT	0.483																																					p.E58K												.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.G172A	1						.						154.0	143.0	147.0					1																	9083116		2203	4300	6503	9005703	SO:0001583	missense	155184	exon3			AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.172G>A	1.37:g.9083116C>T	ENSP00000383698:p.Glu58Lys	Somatic		Capture	Illumina HiSeq	Phase_I	9005703	NM_207420	A2A333	Missense_Mutation	SNP	ENST00000400906.1	37	CCDS98.2	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309446	0.40895	.	.	ENSG00000197241	ENST00000400906	T	0.74947	-0.89	4.68	0.335	0.15953	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.525630	0.19105	N	0.122619	T	0.62660	0.2446	L	0.52206	1.635	0.09310	N	1	P	0.38617	0.64	B	0.38106	0.265	T	0.52472	-0.8571	10	0.37606	T	0.19	.	5.5601	0.17140	0.0:0.3138:0.3874:0.2988	.	58	Q6PXP3	GTR7_HUMAN	K	58	ENSP00000383698:E58K	ENSP00000383698:E58K	E	-	1	0	SLC2A7	9005703	0.000000	0.05858	0.652000	0.29579	0.816000	0.46133	-0.360000	0.07622	0.191000	0.20236	0.556000	0.70494	GAA		0.483	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127768.3	NM_207420	
GJA4	2701	broad.mit.edu	37	1	35260315	35260315	+	Silent	SNP	A	A	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:35260315A>C	ENST00000342280.4	+	2	589	c.501A>C	c.(499-501)gcA>gcC	p.A167A		NM_002060.2	NP_002051.2	P35212	CXA4_HUMAN	gap junction protein, alpha 4, 37kDa	167					blood vessel development (GO:0001568)|calcium ion transport (GO:0006816)|cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|endothelium development (GO:0003158)|response to pain (GO:0048265)|transport (GO:0006810)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)		p.A167A(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(4)|stomach(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				TGCTAGAGGCAGGCTTCCTCT	0.617																																					p.A167A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A501C	1						.						49.0	46.0	47.0					1																	35260315		2203	4300	6503	35032902	SO:0001819	synonymous_variant	2701	exon2			M96789	CCDS30669.1	1p35.1	2008-02-05	2007-01-16		ENSG00000187513	ENSG00000187513		"""Ion channels / Gap junction proteins (connexins)"""	4278	protein-coding gene	gene with protein product	"""connexin 37"""	121012	"""gap junction protein, alpha 4, 37kD (connexin 37)"", ""gap junction protein, alpha 4, 37kDa (connexin 37)"""			9843209, 7680674	Standard	XM_005270750		Approved	CX37	uc001bya.3	P35212	OTTHUMG00000004050	ENST00000342280.4:c.501A>C	1.37:g.35260315A>C		Somatic		Capture	Illumina HiSeq	Phase_I	35032902	NM_002060	A8K698|D3DPR4|Q9P106|Q9UBL1|Q9UNA9|Q9UNB0|Q9UNB1|Q9Y5N7	Silent	SNP	ENST00000342280.4	37	CCDS30669.1																																																																																				0.617	GJA4-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011556.1	NM_002060	
KIAA0319L	79932	broad.mit.edu	37	1	35925963	35925963	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:35925963G>A	ENST00000325722.3	-	9	1604	c.1370C>T	c.(1369-1371)tCt>tTt	p.S457F	KIAA0319L_ENST00000485551.1_5'UTR	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	457	PKD 2. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S457F(2)		breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TGTATCTTCAGAAATCTTCTC	0.368																																					p.S457F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1370T	1						.						150.0	154.0	153.0					1																	35925963		2203	4300	6503	35698550	SO:0001583	missense	79932	exon9			AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.1370C>T	1.37:g.35925963G>A	ENSP00000318406:p.Ser457Phe	Somatic		Capture	Illumina HiSeq	Phase_I	35698550	NM_024874	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	ENST00000325722.3	37	CCDS390.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385142	0.82792	.	.	ENSG00000142687	ENST00000325722;ENST00000426982;ENST00000440579	T;T;T	0.14516	2.5;2.5;2.5	5.46	5.46	0.80206	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD/REJ-like protein (1);PKD domain (1);	0.129057	0.56097	D	0.000036	T	0.44030	0.1274	M	0.86573	2.825	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.69479	0.958;0.964	T	0.46789	-0.9166	10	0.54805	T	0.06	-11.5061	18.2845	0.90110	0.0:0.0:1.0:0.0	.	457;457	Q8IZA0-2;Q8IZA0	.;K319L_HUMAN	F	457	ENSP00000318406:S457F;ENSP00000395883:S457F;ENSP00000407576:S457F	ENSP00000318406:S457F	S	-	2	0	KIAA0319L	35698550	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.580000	0.82523	2.562000	0.86427	0.655000	0.94253	TCT		0.368	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012684.2	NM_024874	
AGO4	192670	broad.mit.edu	37	1	36297440	36297440	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:36297440T>A	ENST00000373210.3	+	9	1269	c.1024T>A	c.(1024-1026)Tgt>Agt	p.C342S		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	342					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)	p.C342S(1)									AGGACAGCGATGTATCAAGAA	0.423																																					p.C342S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1024A	1						.						81.0	81.0	81.0					1																	36297440		2203	4300	6503	36070027	SO:0001583	missense	192670	exon9			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.1024T>A	1.37:g.36297440T>A	ENSP00000362306:p.Cys342Ser	Somatic		Capture	Illumina HiSeq	Phase_I	36070027	NM_017629	A7MD27	Missense_Mutation	SNP	ENST00000373210.3	37	CCDS397.1	.	.	.	.	.	.	.	.	.	.	T	19.37	3.813858	0.70912	.	.	ENSG00000134698	ENST00000373210	T	0.11712	2.75	5.1	3.96	0.45880	Argonaute/Dicer protein, PAZ (3);	0.000000	0.85682	D	0.000000	T	0.29556	0.0737	M	0.79011	2.435	0.80722	D	1	D	0.56746	0.977	D	0.67900	0.954	T	0.01537	-1.1330	10	0.36615	T	0.2	-11.5466	11.0204	0.47715	0.0:0.0737:0.0:0.9263	.	342	Q9HCK5	AGO4_HUMAN	S	342	ENSP00000362306:C342S	ENSP00000362306:C342S	C	+	1	0	EIF2C4	36070027	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.240000	0.72363	0.884000	0.36064	0.533000	0.62120	TGT		0.423	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012213.3	NM_017629	
RLF	6018	broad.mit.edu	37	1	40703842	40703842	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:40703842A>T	ENST00000372771.4	+	8	3495	c.3468A>T	c.(3466-3468)aaA>aaT	p.K1156N		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1156					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K1156N(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			ATTATTCAAAAGAAAAAGTCC	0.368																																					p.K1156N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3468T	1						.						72.0	77.0	75.0					1																	40703842		2203	4300	6503	40476429	SO:0001583	missense	6018	exon8				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.3468A>T	1.37:g.40703842A>T	ENSP00000361857:p.Lys1156Asn	Somatic		Capture	Illumina HiSeq	Phase_I	40476429	NM_012421	Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	37	CCDS448.1	.	.	.	.	.	.	.	.	.	.	A	8.503	0.864777	0.17250	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.14893	2.47	6.07	4.96	0.65561	.	0.300656	0.41194	D	0.000926	T	0.12689	0.0308	L	0.36672	1.1	0.38535	D	0.94906	P;B	0.37276	0.589;0.201	B;B	0.35413	0.202;0.109	T	0.06058	-1.0848	10	0.51188	T	0.08	-19.9051	7.2099	0.25927	0.8:0.0:0.2:0.0	.	849;1156	F5H2M5;Q13129	.;RLF_HUMAN	N	1156;849	ENSP00000361857:K1156N	ENSP00000361857:K1156N	K	+	3	2	RLF	40476429	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	1.102000	0.31050	2.326000	0.78906	0.533000	0.62120	AAA		0.368	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421	
USP24	23358	broad.mit.edu	37	1	55563298	55563298	+	Silent	SNP	G	G	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:55563298G>C	ENST00000294383.6	-	48	5687	c.5688C>G	c.(5686-5688)cgC>cgG	p.R1896R	USP24_ENST00000407756.1_Silent_p.R1736R	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1896	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.R1896R(1)|p.R1813R(1)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						ATTTAATGGAGCGTCCGCTTT	0.338																																					p.R1896R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C5688G	1						.						35.0	33.0	33.0					1																	55563298		1814	4061	5875	55335886	SO:0001819	synonymous_variant	23358	exon48			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.5688C>G	1.37:g.55563298G>C		Somatic		Capture	Illumina HiSeq	Phase_I	55335886	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	ENST00000294383.6	37	CCDS44154.2																																																																																				0.338	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
LRRC8D	55144	broad.mit.edu	37	1	90398820	90398820	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:90398820A>T	ENST00000337338.5	+	3	600	c.193A>T	c.(193-195)Aag>Tag	p.K65*	LRRC8D_ENST00000394593.3_Nonsense_Mutation_p.K65*	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	65					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.K65*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		TGTAAATTCAAAGGCACATAC	0.473																																					p.K65X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A193T	1						.						154.0	132.0	139.0					1																	90398820		2203	4300	6503	90171408	SO:0001587	stop_gained	55144	exon3			AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.193A>T	1.37:g.90398820A>T	ENSP00000338887:p.Lys65*	Somatic		Capture	Illumina HiSeq	Phase_I	90171408	NM_001134479	D3DT29|Q6UWB2|Q9NVW3	Nonsense_Mutation	SNP	ENST00000337338.5	37	CCDS726.1	.	.	.	.	.	.	.	.	.	.	A	19.84	3.902759	0.72754	.	.	ENSG00000171492	ENST00000337338;ENST00000394593;ENST00000532201;ENST00000414841;ENST00000527156;ENST00000441269	.	.	.	6.07	6.07	0.98685	.	0.404895	0.25030	N	0.033684	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	.	.	.	X	65	.	.	K	+	1	0	LRRC8D	90171408	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.730000	0.55006	2.326000	0.78906	0.533000	0.62120	AAG		0.473	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
TGFBR3	7049	broad.mit.edu	37	1	92174338	92174338	+	Silent	SNP	A	A	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:92174338A>G	ENST00000525962.1	-	13	2230	c.2169T>C	c.(2167-2169)tgT>tgC	p.C723C	TGFBR3_ENST00000212355.4_Silent_p.C723C|TGFBR3_ENST00000370399.2_Silent_p.C722C			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	723	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.C723C(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		CAGGAGGCACACACTGCAGAC	0.542																																					p.C722C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2166C	1						.						68.0	58.0	61.0					1																	92174338		2203	4300	6503	91946926	SO:0001819	synonymous_variant	7049	exon14			L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.2169T>C	1.37:g.92174338A>G		Somatic		Capture	Illumina HiSeq	Phase_I	91946926	NM_001195683	A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Silent	SNP	ENST00000525962.1	37	CCDS30770.1																																																																																				0.542	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243	
EVI5	7813	broad.mit.edu	37	1	93089761	93089761	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:93089761T>A	ENST00000370331.1	-	14	1760	c.1751A>T	c.(1750-1752)aAa>aTa	p.K584I	EVI5_ENST00000491940.1_5'UTR|EVI5_ENST00000540033.1_Missense_Mutation_p.K584I|EVI5_ENST00000543509.1_Missense_Mutation_p.K595I	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	584	Dimerization.|Interaction with AURKB and INCENP.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.K584I(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		CATCCTTTGTTTTATTTCTCT	0.368																																					p.K584I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1751T	1						.						266.0	228.0	241.0					1																	93089761		2203	4300	6503	92862349	SO:0001583	missense	7813	exon14			AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1751A>T	1.37:g.93089761T>A	ENSP00000359356:p.Lys584Ile	Somatic		Capture	Illumina HiSeq	Phase_I	92862349	NM_005665	A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	ENST00000370331.1	37	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.279031	0.80692	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509;ENST00000338689	T;T;T	0.35421	1.31;1.31;1.31	5.54	5.54	0.83059	.	0.056332	0.64402	D	0.000002	T	0.32675	0.0837	L	0.52573	1.65	0.36708	D	0.880502	P;B	0.36048	0.534;0.399	P;B	0.49799	0.622;0.418	T	0.32348	-0.9910	10	0.49607	T	0.09	-13.1925	10.0831	0.42401	0.0:0.0752:0.0:0.9248	.	595;584	F5H4R0;O60447	.;EVI5_HUMAN	I	584;584;595;283	ENSP00000359356:K584I;ENSP00000440826:K584I;ENSP00000445019:K595I	ENSP00000345500:K283I	K	-	2	0	EVI5	92862349	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.517000	0.60503	2.096000	0.63516	0.533000	0.62120	AAA		0.368	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665	
CD1E	913	broad.mit.edu	37	1	158326301	158326301	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:158326301delC	ENST00000368167.3	+	5	1157	c.918delC	c.(916-918)atcfs	p.I306fs	CD1E_ENST00000368166.3_Frame_Shift_Del_p.I117fs|CD1E_ENST00000444681.2_Frame_Shift_Del_p.I207fs|CD1E_ENST00000452291.2_Frame_Shift_Del_p.I117fs|CD1E_ENST00000368155.3_Frame_Shift_Del_p.I161fs|CD1E_ENST00000368163.3_Frame_Shift_Del_p.I251fs|CD1E_ENST00000368164.3_Frame_Shift_Del_p.L83fs|CD1E_ENST00000368160.3_Frame_Shift_Del_p.I306fs|CD1E_ENST00000368154.1_Frame_Shift_Del_p.I62fs|CD1E_ENST00000368161.3_Frame_Shift_Del_p.L272fs|CD1E_ENST00000368157.1_Frame_Shift_Del_p.I62fs|CD1E_ENST00000368156.1_Frame_Shift_Del_p.I216fs|CD1E_ENST00000368165.3_Frame_Shift_Del_p.I216fs|CD1E_ENST00000434258.1_3'UTR	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	306					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.L308fs*3(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					GATATTCCATCTTTCTCATCC	0.408																																					p.I216fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.648delC	1						.						92.0	83.0	86.0					1																	158326301		1850	4095	5945	156592925	SO:0001589	frameshift_variant	913	exon4			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.918delC	1.37:g.158326301delC	ENSP00000357149:p.Ile306fs	Somatic		Capture	Illumina HiSeq	Phase_I	156592925	NM_001185107	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Frame_Shift_Del	DEL	ENST00000368167.3	37	CCDS41417.1																																																																																				0.408	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	
LGALS8	3964	broad.mit.edu	37	1	236706918	236706918	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:236706918delT	ENST00000366584.4	+	8	1174	c.608delT	c.(607-609)gttfs	p.V203fs	LGALS8_ENST00000323938.6_Frame_Shift_Del_p.V176fs|LGALS8_ENST00000341872.6_Frame_Shift_Del_p.V203fs|LGALS8_ENST00000526634.1_Frame_Shift_Del_p.V203fs|RP11-385F5.4_ENST00000433131.1_RNA|LGALS8_ENST00000352231.2_Frame_Shift_Del_p.V245fs|LGALS8_ENST00000526589.1_Frame_Shift_Del_p.V245fs|LGALS8_ENST00000525042.1_Frame_Shift_Del_p.V186fs|LGALS8_ENST00000450372.2_Frame_Shift_Del_p.V245fs|LGALS8_ENST00000416919.2_Frame_Shift_Del_p.V186fs|LGALS8_ENST00000527974.1_Frame_Shift_Del_p.V245fs	NM_201544.2	NP_963838.1	O00214	LEG8_HUMAN	lectin, galactoside-binding, soluble, 8	203	Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.				plasma cell differentiation (GO:0002317)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.G247fs*3(1)		kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(5)	20	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACTGTCGTCGTTAAAGGAGAA	0.537																																					p.V203fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.608delT	1						.						113.0	97.0	102.0					1																	236706918		2203	4300	6503	234773541	SO:0001589	frameshift_variant	3964	exon8			X91790	CCDS1611.1, CCDS1612.1	1q43	2011-08-04	2008-07-25		ENSG00000116977	ENSG00000116977		"""Lectins, galactoside-binding"""	6569	protein-coding gene	gene with protein product	"""galectin 8"""	606099				7852431, 8692978	Standard	NM_201545		Approved	PCTA-1	uc001hxy.2	O00214	OTTHUMG00000039953	ENST00000366584.4:c.608delT	1.37:g.236706918delT	ENSP00000355543:p.Val203fs	Somatic		Capture	Illumina HiSeq	Phase_I	234773541	NM_201544	O15215|Q5T3P5|Q5T3Q4|Q8TEV1|Q96B92|Q9BXC8|Q9H584|Q9H585|Q9UEZ6|Q9UP32|Q9UP33|Q9UP34	Frame_Shift_Del	DEL	ENST00000366584.4	37	CCDS1612.1																																																																																				0.537	LGALS8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000096365.2	NM_006499	
OR2T27	403239	broad.mit.edu	37	1	248813352	248813352	+	Nonsense_Mutation	SNP	G	G	T	rs147773385	byFrequency	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr1:248813352G>T	ENST00000344889.3	-	1	833	c.834C>A	c.(832-834)taC>taA	p.Y278*		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y278*(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TAAGGATGGTGTAGAAGGCAG	0.522																																					p.Y278X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C834A	1						.						78.0	73.0	74.0					1																	248813352		2177	4274	6451	246879975	SO:0001587	stop_gained	403239	exon1				CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.834C>A	1.37:g.248813352G>T	ENSP00000342008:p.Tyr278*	Somatic		Capture	Illumina HiSeq	Phase_I	246879975	NM_001001824		Nonsense_Mutation	SNP	ENST00000344889.3	37	CCDS31124.1	.	.	.	.	.	.	.	.	.	.	.	8.161	0.789561	0.16258	.	.	ENSG00000187701	ENST00000344889	.	.	.	3.46	0.446	0.16602	.	0.000000	0.36002	N	0.002857	.	.	.	.	.	.	0.48830	D	0.999714	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.876	0.35345	0.2925:0.0:0.7075:0.0	.	.	.	.	X	278	.	ENSP00000342008:Y278X	Y	-	3	2	OR2T27	246879975	0.929000	0.31497	0.975000	0.42487	0.043000	0.13939	0.050000	0.14120	0.268000	0.21939	-0.501000	0.04562	TAC		0.522	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1	NM_001001824	
CST5	1473	broad.mit.edu	37	20	23860273	23860273	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr20:23860273G>A	ENST00000304710.4	-	1	114	c.41C>T	c.(40-42)gCc>gTc	p.A14V		NM_001900.4	NP_001891.2	P28325	CYTD_HUMAN	cystatin D	14					negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.A14V(1)		breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11						CACCATCAAGGCAGTCAGCAG	0.592																																					p.A14V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C41T	20						.						64.0	59.0	61.0					20																	23860273		2203	4300	6503	23808273	SO:0001583	missense	1473	exon1				CCDS13162.1	20p11.21	2008-04-15			ENSG00000170367	ENSG00000170367			2477	protein-coding gene	gene with protein product		123858				1939105	Standard	NM_001900		Approved		uc002wtr.1	P28325	OTTHUMG00000032089	ENST00000304710.4:c.41C>T	20.37:g.23860273G>A	ENSP00000307132:p.Ala14Val	Somatic		Capture	Illumina HiSeq	Phase_I	23808273	NM_001900	Q5JRF5|Q9UCA0	Missense_Mutation	SNP	ENST00000304710.4	37	CCDS13162.1	.	.	.	.	.	.	.	.	.	.	g	6.534	0.466774	0.12402	.	.	ENSG00000170367	ENST00000304710	T	0.10192	2.9	1.47	-2.94	0.05581	.	0.384377	0.25561	N	0.029840	T	0.03608	0.0103	N	0.08118	0	0.09310	N	1	B	0.20671	0.047	B	0.10450	0.005	T	0.38693	-0.9649	10	0.18276	T	0.48	.	6.04	0.19728	0.5124:0.0:0.4876:0.0	.	14	P28325	CYTD_HUMAN	V	14	ENSP00000307132:A14V	ENSP00000307132:A14V	A	-	2	0	CST5	23808273	0.004000	0.15560	0.000000	0.03702	0.005000	0.04900	-0.286000	0.08399	-1.049000	0.03234	-0.414000	0.06135	GCC		0.592	CST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078355.2	NM_001900	
BPIFB4	149954	broad.mit.edu	37	20	31695576	31695576	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr20:31695576C>T	ENST00000375483.3	+	15	1771	c.1771C>T	c.(1771-1773)Ccc>Tcc	p.P591S	BPIFB4_ENST00000494121.1_3'UTR	NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	591						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.P552S(1)									CGTCCCTCTCCCCAAAATCCT	0.493																																					p.P591S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1771T	20						.						157.0	122.0	133.0					20																	31695576		2203	4300	6503	31159237	SO:0001583	missense	149954	exon15			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1771C>T	20.37:g.31695576C>T	ENSP00000364632:p.Pro591Ser	Somatic		Capture	Illumina HiSeq	Phase_I	31159237	NM_182519	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	37	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	C	24.1	4.492919	0.84962	.	.	ENSG00000186191	ENST00000375483	T	0.27402	1.67	6.01	6.01	0.97437	.	0.000000	0.64402	D	0.000001	T	0.58250	0.2109	M	0.78456	2.415	0.50313	D	0.99986	D	0.89917	1.0	D	0.91635	0.999	T	0.59936	-0.7360	10	0.87932	D	0	-28.9068	16.0184	0.80460	0.0:1.0:0.0:0.0	.	591	P59827	BPIB4_HUMAN	S	591	ENSP00000364632:P591S	ENSP00000364632:P591S	P	+	1	0	BPIFB4	31159237	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.147000	0.58078	2.860000	0.98153	0.655000	0.94253	CCC		0.493	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
PTPRT	11122	broad.mit.edu	37	20	41306584	41306584	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr20:41306584G>A	ENST00000373187.1	-	7	1074	c.1075C>T	c.(1075-1077)Cga>Tga	p.R359*	PTPRT_ENST00000373193.3_Nonsense_Mutation_p.R359*|PTPRT_ENST00000373198.4_Nonsense_Mutation_p.R359*|PTPRT_ENST00000373201.1_Nonsense_Mutation_p.R359*|PTPRT_ENST00000356100.2_Nonsense_Mutation_p.R359*|PTPRT_ENST00000373190.1_Nonsense_Mutation_p.R359*|PTPRT_ENST00000373184.1_Nonsense_Mutation_p.R359*			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	359	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.R359*(2)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGGAGCACTCGGATCTCATAC	0.567																																					p.R359X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|lung(1)	c.C1075T	20						.						117.0	117.0	117.0					20																	41306584		1966	4169	6135	40739998	SO:0001587	stop_gained	11122	exon7			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1075C>T	20.37:g.41306584G>A	ENSP00000362283:p.Arg359*	Somatic		Capture	Illumina HiSeq	Phase_I	40739998	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Nonsense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	G	40	8.324907	0.98759	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	.	.	.	5.42	5.42	0.78866	.	0.066160	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	14.1077	0.65101	0.0:0.0:0.8122:0.1878	.	.	.	.	X	359	.	ENSP00000348408:R359X	R	-	1	2	PTPRT	40739998	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	3.162000	0.50755	2.705000	0.92388	0.655000	0.94253	CGA		0.567	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
MMP9	4318	broad.mit.edu	37	20	44639205	44639205	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr20:44639205C>T	ENST00000372330.3	+	3	474	c.455C>T	c.(454-456)aCg>aTg	p.T152M	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	152					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T152M(1)		breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	AGCGCGGTGACGCCGCTCACC	0.602																																					p.T152M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C455T	20						.						42.0	38.0	39.0					20																	44639205		2203	4300	6503	44072612	SO:0001583	missense	4318	exon3				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.455C>T	20.37:g.44639205C>T	ENSP00000361405:p.Thr152Met	Somatic		Capture	Illumina HiSeq	Phase_I	44072612	NM_004994	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	ENST00000372330.3	37	CCDS13390.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.941685	0.92526	.	.	ENSG00000100985	ENST00000372330	T	0.25414	1.8	4.72	4.72	0.59763	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.047074	0.85682	D	0.000000	T	0.59321	0.2185	M	0.90309	3.105	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.69030	-0.5253	10	0.87932	D	0	.	17.1981	0.86899	0.0:1.0:0.0:0.0	.	152	P14780	MMP9_HUMAN	M	152	ENSP00000361405:T152M	ENSP00000361405:T152M	T	+	2	0	MMP9	44072612	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	7.386000	0.79775	2.597000	0.87782	0.555000	0.69702	ACG		0.602	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1		
SLC35C2	51006	broad.mit.edu	37	20	44980718	44980718	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr20:44980718A>T	ENST00000372227.1	-	8	1349	c.809T>A	c.(808-810)cTc>cAc	p.L270H	SLC35C2_ENST00000243896.2_Missense_Mutation_p.L270H|SLC35C2_ENST00000493599.1_5'UTR|SLC35C2_ENST00000543605.1_Missense_Mutation_p.L299H|SLC35C2_ENST00000372230.5_Missense_Mutation_p.L270H|SLC35C2_ENST00000372229.1_Missense_Mutation_p.L137H|SLC35C2_ENST00000317734.8_Missense_Mutation_p.L249H	NM_001281458.1|NM_001281460.1	NP_001268387.1|NP_001268389.1	Q9NQQ7	S35C2_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C2	270					negative regulation of gene expression (GO:0010629)|positive regulation of Notch signaling pathway (GO:0045747)|protein O-linked fucosylation (GO:0036066)|transport (GO:0006810)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.L270H(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	16		Myeloproliferative disorder(115;0.0122)				GGAGAGAGTGAGGCTGGAGGT	0.582																																					p.L249H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T746A	20						.						70.0	67.0	68.0					20																	44980718		2203	4300	6503	44414125	SO:0001583	missense	51006	exon8				CCDS13396.1, CCDS13397.1, CCDS63292.1	20q13.12	2013-07-17	2013-07-17	2003-10-10	ENSG00000080189	ENSG00000080189		"""Solute carriers"""	17117	protein-coding gene	gene with protein product			"""ovarian cancer overexpressed 1"", ""solute carrier family 35, member C2"""	C20orf5, OVCOV1		10810093, 11549316	Standard	NM_173179		Approved	CGI-15, bA394O2.1	uc002xrq.3	Q9NQQ7	OTTHUMG00000033050	ENST00000372227.1:c.809T>A	20.37:g.44980718A>T	ENSP00000361301:p.Leu270His	Somatic		Capture	Illumina HiSeq	Phase_I	44414125	NM_173073	B7Z6V6|E1P5T0|Q53GK3|Q5JW05|Q96CJ8|Q9Y304	Missense_Mutation	SNP	ENST00000372227.1	37	CCDS13396.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.611691	0.87258	.	.	ENSG00000080189	ENST00000317734;ENST00000243896;ENST00000372227;ENST00000372229;ENST00000372230;ENST00000372225;ENST00000543605	T;T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.85	4.85	0.62838	Domain of unknown function DUF250 (1);	0.000000	0.64402	D	0.000001	D	0.87649	0.6230	M	0.89287	3.02	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.999;1.0;0.999	D	0.90031	0.4135	10	0.87932	D	0	-23.1066	13.7882	0.63123	1.0:0.0:0.0:0.0	.	299;135;249;270	F5H4T9;B7Z6R4;Q9NQQ7-2;Q9NQQ7	.;.;.;S35C2_HUMAN	H	249;270;270;137;270;138;299	ENSP00000318960:L249H;ENSP00000243896:L270H;ENSP00000361301:L270H;ENSP00000361303:L137H;ENSP00000361304:L270H;ENSP00000439974:L299H	ENSP00000243896:L270H	L	-	2	0	SLC35C2	44414125	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.057000	0.76669	2.028000	0.59812	0.533000	0.62120	CTC		0.582	SLC35C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080363.1	NM_015945	
C20orf85	128602	broad.mit.edu	37	20	56735774	56735774	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr20:56735774G>T	ENST00000371168.3	+	4	371	c.310G>T	c.(310-312)Gca>Tca	p.A104S		NM_178456.2	NP_848551.1	Q9H1P6	CT085_HUMAN	chromosome 20 open reading frame 85	104								p.A104S(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	13	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			CTGGAGATCTGCAGTGCCAGG	0.577																																					p.A104S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G310T	20						.						52.0	43.0	46.0					20																	56735774		2203	4300	6503	56169180	SO:0001583	missense	128602	exon4			AL354776	CCDS13465.1	20q13.32	2012-10-29			ENSG00000124237	ENSG00000124237			16216	protein-coding gene	gene with protein product	"""Low in Lung Cancer 1"""						Standard	NM_178456		Approved	bA196N14.1, LLC1	uc002xyv.3	Q9H1P6	OTTHUMG00000032836	ENST00000371168.3:c.310G>T	20.37:g.56735774G>T	ENSP00000360210:p.Ala104Ser	Somatic		Capture	Illumina HiSeq	Phase_I	56169180	NM_178456		Missense_Mutation	SNP	ENST00000371168.3	37	CCDS13465.1	.	.	.	.	.	.	.	.	.	.	G	5.978	0.364425	0.11296	.	.	ENSG00000124237	ENST00000371168	T	0.21734	1.99	5.43	0.662	0.17880	.	0.857359	0.10316	N	0.689370	T	0.10766	0.0263	N	0.20685	0.6	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.37572	-0.9700	10	0.20046	T	0.44	-10.2951	4.1755	0.10349	0.364:0.0:0.4752:0.1608	.	104	Q9H1P6	CT085_HUMAN	S	104	ENSP00000360210:A104S	ENSP00000360210:A104S	A	+	1	0	C20orf85	56169180	0.000000	0.05858	0.000000	0.03702	0.805000	0.45488	0.125000	0.15749	0.254000	0.21573	-0.254000	0.11334	GCA		0.577	C20orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079866.2	NM_178456	
APCDD1L	164284	broad.mit.edu	37	20	57036067	57036067	+	Missense_Mutation	SNP	C	C	T	rs371147444		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr20:57036067C>T	ENST00000371149.3	-	4	1515	c.1285G>A	c.(1285-1287)Gga>Aga	p.G429R	APCDD1L_ENST00000491015.1_5'Flank|APCDD1L_ENST00000439429.1_Missense_Mutation_p.G440R	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	429						integral component of membrane (GO:0016021)		p.G429R(1)		large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			GGCCTTTGTCCGATGAAGAGC	0.612																																					p.G429R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1285A	20						.	C	ARG/GLY	0,4406		0,0,2203	101.0	98.0	99.0		1285	4.2	0.9	20		99	1,8599		0,1,4299	no	missense	APCDD1L	NM_153360.1	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	429/502	57036067	1,13005	2203	4300	6503	56469473	SO:0001583	missense	164284	exon4			AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.1285G>A	20.37:g.57036067C>T	ENSP00000360191:p.Gly429Arg	Somatic		Capture	Illumina HiSeq	Phase_I	56469473	NM_153360		Missense_Mutation	SNP	ENST00000371149.3	37	CCDS13467.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.173876	0.57692	0.0	1.16E-4	ENSG00000198768	ENST00000371149;ENST00000439429	T;T	0.27557	1.66;1.66	4.22	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.62454	0.2429	M	0.89095	3.005	0.53005	D	0.999962	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73100	-0.4089	10	0.87932	D	0	.	16.615	0.84904	0.0:1.0:0.0:0.0	.	440;429	F5H6V6;Q8NCL9	.;APCDL_HUMAN	R	429;440	ENSP00000360191:G429R;ENSP00000413261:G440R	ENSP00000360191:G429R	G	-	1	0	APCDD1L	56469473	1.000000	0.71417	0.872000	0.34217	0.105000	0.19272	7.028000	0.76470	1.926000	0.55796	0.460000	0.39030	GGA		0.612	APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000079881.2	NM_153360	
PAXBP1	94104	broad.mit.edu	37	21	34134464	34134464	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr21:34134464G>A	ENST00000331923.4	-	4	1003	c.814C>T	c.(814-816)Cgg>Tgg	p.R272W	PAXBP1_ENST00000290178.4_Missense_Mutation_p.R272W|PAXBP1_ENST00000472588.1_5'UTR	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	272					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R272W(1)									AAAACTATCCGGCGTTTCTCA	0.388																																					p.R272W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C814T	21						.						125.0	126.0	126.0					21																	34134464		2203	4300	6503	33056335	SO:0001583	missense	94104	exon4			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.814C>T	21.37:g.34134464G>A	ENSP00000328992:p.Arg272Trp	Somatic		Capture	Illumina HiSeq	Phase_I	33056335	NM_013329	D3DSE7|Q96DU8|Q9NYQ0	Missense_Mutation	SNP	ENST00000331923.4	37	CCDS13619.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122121	0.77436	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	T;T	0.38240	1.55;1.15	5.85	5.85	0.93711	.	0.060187	0.64402	D	0.000001	T	0.61035	0.2315	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;P	0.67382	0.951;0.895	T	0.64058	-0.6496	10	0.66056	D	0.02	-12.9313	14.5843	0.68312	0.0:0.0:0.8179:0.1821	.	272;272	Q9Y5B6-2;Q9Y5B6	.;GCFC1_HUMAN	W	272	ENSP00000328992:R272W;ENSP00000290178:R272W	ENSP00000290178:R272W	R	-	1	2	GCFC1	33056335	0.990000	0.36364	0.984000	0.44739	0.927000	0.56198	2.737000	0.47393	2.767000	0.95098	0.557000	0.71058	CGG		0.388	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139563.1	NM_013329	
ITSN1	6453	broad.mit.edu	37	21	35237633	35237633	+	Missense_Mutation	SNP	G	G	T	rs185389697		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr21:35237633G>T	ENST00000381318.3	+	32	4357	c.4069G>T	c.(4069-4071)Gtc>Ttc	p.V1357F	ITSN1_ENST00000399367.3_Missense_Mutation_p.V1352F|ITSN1_ENST00000437442.2_Missense_Mutation_p.V1352F|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000381285.4_Missense_Mutation_p.V1357F|ITSN1_ENST00000399326.3_3'UTR	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1357	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V1357F(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CAAGGAGTTCGTCAAAGTAAG	0.587																																					p.V1357F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4069T	21						.						15.0	16.0	16.0					21																	35237633		2196	4292	6488	34159503	SO:0001583	missense	6453	exon32			AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.4069G>T	21.37:g.35237633G>T	ENSP00000370719:p.Val1357Phe	Somatic		Capture	Illumina HiSeq	Phase_I	34159503	NM_003024	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	CCDS33545.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.181028|4.181028	0.78677|0.78677	.|.	.|.	ENSG00000205726|ENSG00000205726	ENST00000381284|ENST00000381318;ENST00000381285;ENST00000381288;ENST00000399367;ENST00000437442	.|T;T;T;T	.|0.63913	.|-0.07;-0.07;-0.07;-0.07	5.76|5.76	5.76|5.76	0.90799|0.90799	.|Dbl homology (DH) domain (5);	.|0.076374	.|0.52532	.|D	.|0.000071	T|T	0.72028|0.72028	0.3410|0.3410	L|L	0.31804|0.31804	0.96|0.96	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.999;0.999	.|D;D;D	.|0.79108	.|0.992;0.952;0.952	T|T	0.73795|0.73795	-0.3870|-0.3870	5|10	.|0.66056	.|D	.|0.02	.|.	19.964|19.964	0.97260|0.97260	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1352;1352;1357	.|A8CTY3;A8CTX8;Q15811	.|.;.;ITSN1_HUMAN	L|F	92|1357;1357;1286;1352;1352	.|ENSP00000370719:V1357F;ENSP00000370685:V1357F;ENSP00000382301:V1352F;ENSP00000387377:V1352F	.|ENSP00000370685:V1357F	R|V	+|+	2|1	0|0	ITSN1|ITSN1	34159503|34159503	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.706000|0.706000	0.40770|0.40770	4.723000|4.723000	0.61965|0.61965	2.721000|2.721000	0.93114|0.93114	0.650000|0.650000	0.86243|0.86243	CGT|GTC		0.587	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
PCNT	5116	broad.mit.edu	37	21	47786937	47786937	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr21:47786937G>T	ENST00000359568.5	+	15	3155	c.3048G>T	c.(3046-3048)ttG>ttT	p.L1016F	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1016					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CTCAAGAGTTGGAGAAACTGA	0.547																																					p.L1016F												.	.	0			c.G3048T	21						.						91.0	101.0	97.0					21																	47786937		2203	4300	6503	46611365	SO:0001583	missense	5116	exon15			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.3048G>T	21.37:g.47786937G>T	ENSP00000352572:p.Leu1016Phe	None		Capture	Illumina HiSeq	Phase_I	46611365	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.052572	0.55218	.	.	ENSG00000160299	ENST00000359568	T	0.26957	1.7	5.35	-2.08	0.07254	.	0.456226	0.13801	N	0.361797	T	0.20981	0.0505	M	0.62723	1.935	0.18873	N	0.999982	P;P	0.42941	0.794;0.69	B;B	0.39805	0.31;0.164	T	0.10314	-1.0635	10	0.44086	T	0.13	.	5.0235	0.14372	0.1953:0.1308:0.544:0.13	.	898;1016	O95613-2;O95613	.;PCNT_HUMAN	F	1016	ENSP00000352572:L1016F	ENSP00000352572:L1016F	L	+	3	2	PCNT	46611365	0.001000	0.12720	0.002000	0.10522	0.091000	0.18340	-0.261000	0.08694	-0.370000	0.08016	0.555000	0.69702	TTG		0.547	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
PIWIL3	440822	broad.mit.edu	37	22	25151800	25151800	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr22:25151800T>A	ENST00000332271.5	-	6	1059	c.643A>T	c.(643-645)Acg>Tcg	p.T215S	PIWIL3_ENST00000527701.1_Missense_Mutation_p.T106S|PIWIL3_ENST00000533313.1_Missense_Mutation_p.T106S|PIWIL3_ENST00000532537.2_5'UTR	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	215					cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)	p.T215S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GACGTGGGCGTGAGTTCTTTG	0.378																																					p.T215S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A643T	22						.						156.0	147.0	150.0					22																	25151800		2203	4300	6503	23481800	SO:0001583	missense	440822	exon6			AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.643A>T	22.37:g.25151800T>A	ENSP00000330031:p.Thr215Ser	Somatic		Capture	Illumina HiSeq	Phase_I	23481800	NM_001008496		Missense_Mutation	SNP	ENST00000332271.5	37	CCDS33623.1	.	.	.	.	.	.	.	.	.	.	T	2.007	-0.428062	0.04701	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	T;T;T	0.08896	3.04;3.04;3.04	2.52	-5.05	0.02955	Argonaute/Dicer protein, PAZ (1);	0.588333	0.17634	N	0.167280	T	0.01320	0.0043	N	0.00621	-1.32	0.09310	N	1	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.20806	-1.0264	10	0.02654	T	1	6.0589	2.0768	0.03626	0.1918:0.2645:0.4057:0.138	.	106;215;215	E9PIP6;B4DYF7;Q7Z3Z3	.;.;PIWL3_HUMAN	S	215;106;106	ENSP00000330031:T215S;ENSP00000431843:T106S;ENSP00000435718:T106S	ENSP00000330031:T215S	T	-	1	0	PIWIL3	23481800	0.004000	0.15560	0.000000	0.03702	0.018000	0.09664	0.110000	0.15437	-3.952000	0.00088	-0.624000	0.04008	ACG		0.378	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496	
AP1B1	162	broad.mit.edu	37	22	29747802	29747802	+	Silent	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr22:29747802C>T	ENST00000405198.1	-	7	982	c.951G>A	c.(949-951)ctG>ctA	p.L317L	AP1B1_ENST00000415447.1_Silent_p.L317L|AP1B1_ENST00000356015.2_Silent_p.L317L|AP1B1_ENST00000357586.2_Silent_p.L317L|AP1B1_ENST00000317368.7_Silent_p.L317L|AP1B1_ENST00000402502.1_Silent_p.L317L|AP1B1_ENST00000432560.2_Silent_p.L317L			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	317					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.L317L(1)		endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TCTCATGCTTCAGGATCTCAG	0.527																																					p.L317L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G951A	22						.						130.0	107.0	114.0					22																	29747802		2203	4300	6503	28077802	SO:0001819	synonymous_variant	162	exon8			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.951G>A	22.37:g.29747802C>T		Somatic		Capture	Illumina HiSeq	Phase_I	28077802	NM_001166019	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Silent	SNP	ENST00000405198.1	37	CCDS13855.1																																																																																				0.527	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127	
DEPDC5	9681	broad.mit.edu	37	22	32156683	32156683	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr22:32156683A>G	ENST00000382112.3	+	3	258	c.188A>G	c.(187-189)cAg>cGg	p.Q63R	DEPDC5_ENST00000400248.2_Missense_Mutation_p.Q63R|DEPDC5_ENST00000382105.2_Missense_Mutation_p.Q63R|DEPDC5_ENST00000400242.3_Missense_Mutation_p.Q63R|DEPDC5_ENST00000536766.1_Missense_Mutation_p.Q63R|DEPDC5_ENST00000535622.1_Missense_Mutation_p.Q63R|DEPDC5_ENST00000266091.3_Missense_Mutation_p.Q63R|DEPDC5_ENST00000400249.2_Missense_Mutation_p.Q63R|DEPDC5_ENST00000382111.2_Missense_Mutation_p.Q63R|DEPDC5_ENST00000400246.1_Missense_Mutation_p.Q63R	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	63					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.Q63R(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GAAGATTTACAGAAGGGTAAG	0.383																																					p.Q63R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A188G	22						.						139.0	122.0	127.0					22																	32156683		1824	4077	5901	30486683	SO:0001583	missense	9681	exon4			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.188A>G	22.37:g.32156683A>G	ENSP00000371546:p.Gln63Arg	Somatic		Capture	Illumina HiSeq	Phase_I	30486683	NM_014662	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	A	17.39	3.378154	0.61735	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T;T;T	0.45668	1.45;1.38;0.89;1.84;1.85;1.82;1.45;1.85;1.82;1.85	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.54727	0.1876	L	0.52573	1.65	0.80722	D	1	D;D;D;D;D;P	0.67145	0.994;0.996;0.985;0.964;0.993;0.928	D;D;P;P;D;P	0.75484	0.977;0.986;0.834;0.504;0.968;0.676	T	0.49214	-0.8963	10	0.22109	T	0.4	.	12.5135	0.56019	1.0:0.0:0.0:0.0	.	63;63;63;63;63;63	B9EGN9;F5GYZ8;B4DH93;A8MPX9;O75140;O75140-2	.;.;.;.;DEPD5_HUMAN;.	R	63	ENSP00000440210:Q63R;ENSP00000441358:Q63R;ENSP00000383101:Q63R;ENSP00000266091:Q63R;ENSP00000383108:Q63R;ENSP00000383105:Q63R;ENSP00000371539:Q63R;ENSP00000371546:Q63R;ENSP00000371545:Q63R;ENSP00000383107:Q63R	ENSP00000266091:Q63R	Q	+	2	0	DEPDC5	30486683	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.379000	0.79691	1.848000	0.53677	0.454000	0.30748	CAG		0.383	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
APOL1	8542	broad.mit.edu	37	22	36650996	36650996	+	5'UTR	SNP	A	A	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr22:36650996A>C	ENST00000397278.3	+	0	224				APOL1_ENST00000397279.4_5'UTR|APOL1_ENST00000347595.7_Intron|APOL1_ENST00000422706.1_5'UTR|APOL1_ENST00000319136.4_Missense_Mutation_p.S15R|APOL1_ENST00000426053.1_5'UTR|APOL1_ENST00000440669.2_5'UTR	NM_003661.3	NP_003652.2	O14791	APOL1_HUMAN	apolipoprotein L, 1						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cholesterol metabolic process (GO:0008203)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|intrinsic component of membrane (GO:0031224)|very-low-density lipoprotein particle (GO:0034361)	chloride channel activity (GO:0005254)|lipid binding (GO:0008289)	p.S15R(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	14						GAGGCCCTGCAGCGACATGGA	0.542																																					p.S15R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A43C	22						.						73.0	69.0	70.0					22																	36650996		2203	4300	6503	34980942	SO:0001623	5_prime_UTR_variant	8542	exon3			AF019225	CCDS13925.1, CCDS13926.1, CCDS46702.1	22q13.1	2014-09-17			ENSG00000100342	ENSG00000100342		"""Apolipoproteins"""	618	protein-coding gene	gene with protein product		603743		APOL		9325276, 11374903, 16020735	Standard	NM_003661		Approved		uc011amp.2	O14791	OTTHUMG00000030427	ENST00000397278.3:c.-6A>C	22.37:g.36650996A>C		Somatic		Capture	Illumina HiSeq	Phase_I	34980942	NM_145343	A5PLQ4|B4DU12|E9PF24|O60804|Q5R3P7|Q5R3P8|Q96AB8|Q96PM4|Q9BQ03	Missense_Mutation	SNP	ENST00000397278.3	37	CCDS13926.1	.	.	.	.	.	.	.	.	.	.	a	9.147	1.015298	0.19355	.	.	ENSG00000100342	ENST00000319136;ENST00000438034	T	0.04603	3.59	1.31	1.31	0.21738	.	0.660669	0.11063	U	0.603796	T	0.02119	0.0066	N	0.08118	0	0.20403	N	0.999906	P	0.34587	0.458	B	0.21708	0.036	T	0.44667	-0.9313	10	0.49607	T	0.09	.	4.7969	0.13277	1.0:0.0:0.0:0.0	.	15	O14791-2	.	R	15;28	ENSP00000317674:S15R	ENSP00000317674:S15R	S	+	1	0	APOL1	34980942	0.001000	0.12720	0.003000	0.11579	0.114000	0.19823	0.038000	0.13862	0.849000	0.35215	0.155000	0.16302	AGC		0.542	APOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319100.4	NM_145343	
BIK	638	broad.mit.edu	37	22	43525254	43525255	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	GC	GC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr22:43525254_43525255GC>AA	ENST00000216115.2	+	5	489_490	c.426_427GC>AA	c.(424-429)ctGCtg>ctAAtg	p.L143M		NM_001197.4	NP_001188.1	Q13323	BIK_HUMAN	BCL2-interacting killer (apoptosis-inducing)	143	Leucine-zipper. {ECO:0000255}.				apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|male gonad development (GO:0008584)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)		p.L142>?(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|urinary_tract(1)	5		Ovarian(80;0.0694)				cgctgctgctgctgctggcgct	0.718																																					.												.	.	1	Complex(1)	large_intestine(1)	c.426_427AA	22						.																																			41855199	SO:0001583	missense	638	exon5			U34584	CCDS14044.1	22q13.31	2014-03-07			ENSG00000100290	ENSG00000100290			1051	protein-coding gene	gene with protein product		603392				7478623, 10591208	Standard	NM_001197		Approved	NBK	uc003bdk.3	Q13323	OTTHUMG00000150703	Exception_encountered	22.37:g.43525254_43525255delinsAA	ENSP00000216115:p.Leu143Met	Somatic		Capture	Illumina HiSeq	Phase_I	41855198	NM_001197	Q16582|Q6FH93	Missense_Mutation	DNP	ENST00000216115.2	37	CCDS14044.1																																																																																				0.718	BIK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319676.1	NM_001197	
CELSR1	9620	broad.mit.edu	37	22	46792587	46792587	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr22:46792587C>A	ENST00000262738.3	-	13	5757	c.5758G>T	c.(5758-5760)Ggg>Tgg	p.G1920W		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1920	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)	p.G1920W(1)		breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		ACGCAGGCCCCCATGTTCTCG	0.612																																					p.G1920W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5758T	22						.						46.0	39.0	41.0					22																	46792587		2203	4300	6503	45171251	SO:0001583	missense	9620	exon13			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5758G>T	22.37:g.46792587C>A	ENSP00000262738:p.Gly1920Trp	Somatic		Capture	Illumina HiSeq	Phase_I	45171251	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.221612	0.39300	.	.	ENSG00000075275	ENST00000262738	D	0.97016	-4.21	4.45	0.442	0.16582	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.257316	0.31636	U	0.007311	D	0.98115	0.9378	H	0.97390	3.995	0.48571	D	0.999677	D;D	0.69078	0.997;0.996	P;D	0.63283	0.883;0.913	D	0.96446	0.9330	10	0.87932	D	0	.	6.4155	0.21714	0.5825:0.3171:0.0:0.1004	.	241;1920	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	W	1920	ENSP00000262738:G1920W	ENSP00000262738:G1920W	G	-	1	0	CELSR1	45171251	0.983000	0.35010	0.005000	0.12908	0.186000	0.23388	2.687000	0.46976	0.428000	0.26173	0.561000	0.74099	GGG		0.612	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
MAP2	4133	broad.mit.edu	37	2	210590502	210590502	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr2:210590502C>T	ENST00000360351.4	+	13	5649	c.5143C>T	c.(5143-5145)Cgc>Tgc	p.R1715C	MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000392194.1_Missense_Mutation_p.R359C|MAP2_ENST00000199940.6_Missense_Mutation_p.R447C|MAP2_ENST00000447185.1_Missense_Mutation_p.R1711C|MAP2_ENST00000361559.4_Missense_Mutation_p.R359C	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1715				RH -> D (in Ref. 1; AAA03354). {ECO:0000305}.	axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.R1715C(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GAAGAACATCCGCCACAGGCC	0.333																																					p.R390C	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1168T	2						.						61.0	58.0	59.0					2																	210590502		2203	4300	6503	210298747	SO:0001583	missense	4133	exon11				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.5143C>T	2.37:g.210590502C>T	ENSP00000353508:p.Arg1715Cys	Somatic		Capture	Illumina HiSeq	Phase_I	210298747	NM_031847	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.664915	0.88251	.	.	ENSG00000078018	ENST00000199940;ENST00000360351;ENST00000361559;ENST00000392194;ENST00000447185	D;D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39;-3.39	5.84	5.84	0.93424	.	0.103621	0.43747	D	0.000531	D	0.95490	0.8535	L	0.43152	1.355	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;0.998;0.995;1.0;0.995	D;P;P;D;P	0.72075	0.939;0.809;0.817;0.976;0.849	D	0.95418	0.8504	10	0.66056	D	0.02	-1.6866	20.1511	0.98086	0.0:1.0:0.0:0.0	.	1711;359;360;1715;447	P11137-3;P11137-2;Q59FX9;P11137;Q8IUX2	.;.;.;MAP2_HUMAN;.	C	447;1715;359;359;1711	ENSP00000199940:R447C;ENSP00000353508:R1715C;ENSP00000355290:R359C;ENSP00000376032:R359C;ENSP00000392164:R1711C	ENSP00000199940:R447C	R	+	1	0	MAP2	210298747	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.880000	0.69698	2.778000	0.95560	0.655000	0.94253	CGC		0.333	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
PROKR1	10887	broad.mit.edu	37	2	68873092	68873092	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr2:68873092G>T	ENST00000303786.3	+	2	559	c.139G>T	c.(139-141)Gat>Tat	p.D47Y	PROKR1_ENST00000394342.2_Missense_Mutation_p.D47Y			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	47					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.D47Y(1)		endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TATGCCTTTGGATGAAGATGA	0.507																																					p.D47Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G139T	2						.						253.0	224.0	234.0					2																	68873092		2203	4300	6503	68726596	SO:0001583	missense	10887	exon1			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.139G>T	2.37:g.68873092G>T	ENSP00000303775:p.Asp47Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	68726596	NM_138964	A5JUU2|Q53QT9|Q8NFJ7	Missense_Mutation	SNP	ENST00000303786.3	37	CCDS1889.1	.	.	.	.	.	.	.	.	.	.	G	7.629	0.678394	0.14841	.	.	ENSG00000169618	ENST00000303786;ENST00000394342	T;T	0.73789	-0.78;-0.78	5.03	4.13	0.48395	.	0.152087	0.64402	N	0.000019	T	0.65657	0.2712	L	0.57536	1.79	0.44175	D	0.996988	B	0.19073	0.033	B	0.20577	0.03	T	0.57254	-0.7843	10	0.07813	T	0.8	.	10.6129	0.45432	0.0:0.0:0.6509:0.349	.	47	Q8TCW9	PKR1_HUMAN	Y	47	ENSP00000303775:D47Y;ENSP00000377874:D47Y	ENSP00000303775:D47Y	D	+	1	0	PROKR1	68726596	1.000000	0.71417	0.998000	0.56505	0.500000	0.33767	5.447000	0.66606	1.444000	0.47605	0.650000	0.86243	GAT		0.507	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251760.2		
NGEF	25791	broad.mit.edu	37	2	233750020	233750020	+	Silent	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr2:233750020G>A	ENST00000264051.3	-	10	1685	c.1407C>T	c.(1405-1407)agC>agT	p.S469S	NGEF_ENST00000539537.1_Silent_p.S192S|NGEF_ENST00000373552.4_Silent_p.S377S	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	469					apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S469S(1)		central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		TCTTCTGAATGCTGATCATCT	0.587																																					p.S377S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1131T	2						.						303.0	253.0	270.0					2																	233750020		2203	4300	6503	233458264	SO:0001819	synonymous_variant	25791	exon8			AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.1407C>T	2.37:g.233750020G>A		Somatic		Capture	Illumina HiSeq	Phase_I	233458264	NM_001114090	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Silent	SNP	ENST00000264051.3	37	CCDS2500.1	.	.	.	.	.	.	.	.	.	.	G	8.121	0.781003	0.16120	.	.	ENSG00000066248	ENST00000424488	.	.	.	4.59	2.43	0.29744	.	.	.	.	.	T	0.56717	0.2004	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51957	-0.8639	4	.	.	.	-22.3068	8.6824	0.34216	0.3082:0.0:0.6918:0.0	.	.	.	.	V	61	.	.	A	-	2	0	NGEF	233458264	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	1.566000	0.36396	0.935000	0.37341	0.455000	0.32223	GCA		0.587	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257051.2	XM_044799	
IMPG2	50939	broad.mit.edu	37	3	100962466	100962466	+	Silent	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr3:100962466G>A	ENST00000193391.7	-	13	2896	c.2709C>T	c.(2707-2709)ttC>ttT	p.F903F		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	903	SEA 2. {ECO:0000255|PROSITE- ProRule:PRU00188}.				visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)	p.F903F(1)		NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	CTCGGAGGCTGAAGAAAACCA	0.433																																					p.F903F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2709T	3						.						107.0	99.0	102.0					3																	100962466		2203	4300	6503	102445156	SO:0001819	synonymous_variant	50939	exon13			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.2709C>T	3.37:g.100962466G>A		Somatic		Capture	Illumina HiSeq	Phase_I	102445156	NM_016247	A8MWT5|Q9UKD4|Q9UKK5	Silent	SNP	ENST00000193391.7	37	CCDS2940.1																																																																																				0.433	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3		
PHLDB2	90102	broad.mit.edu	37	3	111680972	111680972	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr3:111680972A>T	ENST00000431670.2	+	13	3301	c.2890A>T	c.(2890-2892)Atg>Ttg	p.M964L	PHLDB2_ENST00000393923.3_Missense_Mutation_p.M948L|PHLDB2_ENST00000470699.2_3'UTR|PHLDB2_ENST00000495180.1_Missense_Mutation_p.M455L|PHLDB2_ENST00000481953.1_Missense_Mutation_p.M921L|PHLDB2_ENST00000412622.1_Missense_Mutation_p.M921L|PHLDB2_ENST00000393925.3_Missense_Mutation_p.M964L	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	964						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.M921L(1)|p.M964L(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TCACCAACAGATGAGTGAAGG	0.373																																					p.M964L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2890T	3						.						93.0	92.0	92.0					3																	111680972		2203	4300	6503	113163662	SO:0001583	missense	90102	exon13				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.2890A>T	3.37:g.111680972A>T	ENSP00000405405:p.Met964Leu	Somatic		Capture	Illumina HiSeq	Phase_I	113163662	NM_001134439	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	37	CCDS46886.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.802189	0.31869	.	.	ENSG00000144824	ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.40476	1.69;1.66;1.69;1.69;1.66;1.69;1.03	5.99	4.85	0.62838	.	0.317722	0.39475	N	0.001359	T	0.28797	0.0714	L	0.31664	0.95	0.25380	N	0.988629	B;B;B;B;B	0.12013	0.0;0.005;0.004;0.003;0.003	B;B;B;B;B	0.10450	0.0;0.005;0.004;0.003;0.003	T	0.09729	-1.0661	10	0.27082	T	0.32	.	9.2962	0.37817	0.9189:0.0:0.0811:0.0	.	83;455;964;921;948	Q658P8;E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;.;PHLB2_HUMAN;.;.	L	948;964;921;921;964;921;455	ENSP00000377500:M948L;ENSP00000405405:M964L;ENSP00000405292:M921L;ENSP00000418296:M921L;ENSP00000377502:M964L;ENSP00000418319:M921L;ENSP00000420303:M455L	ENSP00000377500:M948L	M	+	1	0	PHLDB2	113163662	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.818000	0.39012	2.291000	0.77112	0.533000	0.62120	ATG		0.373	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
BOC	91653	broad.mit.edu	37	3	112991266	112991266	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr3:112991266C>T	ENST00000495514.1	+	7	1381	c.677C>T	c.(676-678)gCt>gTt	p.A226V	BOC_ENST00000273395.4_Missense_Mutation_p.A226V|BOC_ENST00000355385.3_Missense_Mutation_p.A226V			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	226					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.A226V(2)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GGCTCCACCGCTGAGGCTGCC	0.612																																					p.A226V												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C677T	3						.						124.0	121.0	122.0					3																	112991266		2203	4300	6503	114473956	SO:0001583	missense	91653	exon7			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.677C>T	3.37:g.112991266C>T	ENSP00000418663:p.Ala226Val	Somatic		Capture	Illumina HiSeq	Phase_I	114473956	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.786267	0.70337	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.60299	0.2;0.21;0.2	5.93	5.93	0.95920	Immunoglobulin-like fold (1);	0.054062	0.85682	D	0.000000	T	0.54631	0.1870	N	0.04297	-0.235	0.58432	D	0.999998	D;D	0.55605	0.967;0.972	P;P	0.60789	0.879;0.76	T	0.57659	-0.7773	10	0.23891	T	0.37	.	20.3409	0.98764	0.0:1.0:0.0:0.0	.	226;226	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	V	226	ENSP00000418663:A226V;ENSP00000273395:A226V;ENSP00000347546:A226V	ENSP00000273395:A226V	A	+	2	0	BOC	114473956	1.000000	0.71417	0.200000	0.23457	0.358000	0.29455	7.347000	0.79356	2.814000	0.96858	0.655000	0.94253	GCT		0.612	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
KALRN	8997	broad.mit.edu	37	3	124149556	124149556	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr3:124149556T>G	ENST00000240874.3	+	16	2914	c.2757T>G	c.(2755-2757)aaT>aaG	p.N919K	KALRN_ENST00000460856.1_Missense_Mutation_p.N919K|KALRN_ENST00000360013.3_Missense_Mutation_p.N919K	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	919					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N919K(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GCCTGGTCAATGCCAGCTCTT	0.567																																					p.N919K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2757G	3						.						104.0	81.0	89.0					3																	124149556		2203	4300	6503	125632246	SO:0001583	missense	8997	exon16			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.2757T>G	3.37:g.124149556T>G	ENSP00000240874:p.Asn919Lys	Somatic		Capture	Illumina HiSeq	Phase_I	125632246	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.85|10.85	1.466906|1.466906	0.26335|0.26335	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000460856;ENST00000240874;ENST00000360013	.|T;T;T	.|0.41065	.|1.01;1.01;1.01	4.77|4.77	-0.44|-0.44	0.12261|0.12261	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.30603|0.30603	0.0770|0.0770	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|P;B;P;P	.|0.51449	.|0.741;0.409;0.945;0.696	.|B;B;P;B	.|0.55055	.|0.403;0.216;0.767;0.281	T|T	0.06607|0.06607	-1.0817|-1.0817	5|10	.|0.40728	.|T	.|0.16	.|.	8.7821|8.7821	0.34798|0.34798	0.0:0.3174:0.0:0.6826|0.0:0.3174:0.0:0.6826	.|.	.|919;265;919;919	.|C9IZQ6;F2Z3Q6;O60229;O60229-2	.|.;.;KALRN_HUMAN;.	R|K	897|919	.|ENSP00000418611:N919K;ENSP00000240874:N919K;ENSP00000353109:N919K	.|ENSP00000240874:N919K	M|N	+|+	2|3	0|2	KALRN|KALRN	125632246|125632246	0.810000|0.810000	0.29049|0.29049	0.997000|0.997000	0.53966|0.53966	0.998000|0.998000	0.95712|0.95712	-0.143000|-0.143000	0.10296|0.10296	-0.216000|-0.216000	0.10048|0.10048	0.533000|0.533000	0.62120|0.62120	ATG|AAT		0.567	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
COPB2	9276	broad.mit.edu	37	3	139079943	139079943	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr3:139079943C>G	ENST00000333188.5	-	17	2371	c.2190G>C	c.(2188-2190)atG>atC	p.M730I	COPB2_ENST00000507777.1_Missense_Mutation_p.M701I	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	730					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)	p.M730I(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						AAAAGTAGCTCATGAATGCCA	0.433																																					p.M730I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2190C	3						.						160.0	154.0	156.0					3																	139079943		2203	4300	6503	140562633	SO:0001583	missense	9276	exon17			BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.2190G>C	3.37:g.139079943C>G	ENSP00000329419:p.Met730Ile	Somatic		Capture	Illumina HiSeq	Phase_I	140562633	NM_004766	B4DZI8	Missense_Mutation	SNP	ENST00000333188.5	37	CCDS3108.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547729	0.27652	.	.	ENSG00000184432	ENST00000333188;ENST00000507777	T;T	0.61859	0.07;0.18	5.39	5.39	0.77823	Coatomer, WD associated region (1);	0.078975	0.85682	D	0.000000	T	0.35364	0.0929	N	0.05199	-0.095	0.58432	D	0.99999	B	0.02656	0.0	B	0.06405	0.002	T	0.18272	-1.0342	10	0.29301	T	0.29	-16.1357	12.4983	0.55942	0.0:0.9234:0.0:0.0766	.	730	P35606	COPB2_HUMAN	I	730;701	ENSP00000329419:M730I;ENSP00000422295:M701I	ENSP00000329419:M730I	M	-	3	0	COPB2	140562633	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	2.453000	0.44970	2.495000	0.84180	0.650000	0.86243	ATG		0.433	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766	
PXYLP1	92370	broad.mit.edu	37	3	140998267	140998267	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr3:140998267C>T	ENST00000286353.4	+	4	423	c.286C>T	c.(286-288)Cgc>Tgc	p.R96C	RP11-438D8.2_ENST00000507698.1_RNA|ACPL2_ENST00000504264.1_Missense_Mutation_p.R79C|ACPL2_ENST00000508812.1_Missense_Mutation_p.R87C|ACPL2_ENST00000393007.1_Missense_Mutation_p.R80C|ACPL2_ENST00000393010.2_Missense_Mutation_p.R96C|ACPL2_ENST00000502783.1_Missense_Mutation_p.R58C	NM_001037172.1|NM_001282728.1	NP_001032249.1|NP_001269657.1	Q8TE99	PXYP1_HUMAN		96						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)	p.R96C(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(2)	23						TGTGTTCATTCGCCACGGAGA	0.458											OREG0015847	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R96C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C286T	3						.						165.0	141.0	149.0					3																	140998267		2203	4300	6503	142480957	SO:0001583	missense	92370	exon6																														ENST00000286353.4:c.286C>T	3.37:g.140998267C>T	ENSP00000286353:p.Arg96Cys	Somatic	1660	Capture	Illumina HiSeq	Phase_I	142480957	NM_152282	D3DNF5|Q49AJ2|W0TR04	Missense_Mutation	SNP	ENST00000286353.4	37	CCDS3116.1	.	.	.	.	.	.	.	.	.	.	C	30	5.055755	0.93793	.	.	ENSG00000155893	ENST00000505013;ENST00000286353;ENST00000502783;ENST00000393010;ENST00000512457;ENST00000504264;ENST00000508812;ENST00000393007	D;D;D;D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.97081	0.9046	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97637	1.0146	10	0.87932	D	0	.	16.9448	0.86228	0.0:1.0:0.0:0.0	.	79;96	B7Z3R9;Q8TE99	.;ACPL2_HUMAN	C	96;96;58;96;58;79;87;80	ENSP00000421271:R96C;ENSP00000286353:R96C;ENSP00000422558:R58C;ENSP00000376733:R96C;ENSP00000423702:R58C;ENSP00000426877:R79C;ENSP00000422901:R87C;ENSP00000376731:R80C	ENSP00000286353:R96C	R	+	1	0	ACPL2	142480957	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.392000	0.73213	2.593000	0.87608	0.655000	0.94253	CGC		0.458	ACPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359533.2		
ARPP21	10777	broad.mit.edu	37	3	35785414	35785414	+	Silent	SNP	C	C	T	rs550779254		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr3:35785414C>T	ENST00000187397.4	+	18	2445	c.1989C>T	c.(1987-1989)aaC>aaT	p.N663N	ARPP21_ENST00000417925.1_Silent_p.N664N|ARPP21_ENST00000444190.1_Silent_p.N644N|ARPP21_ENST00000458225.1_Silent_p.N664N|ARPP21_ENST00000337271.5_Silent_p.N644N|MIR128-2_ENST00000384893.1_RNA	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	663	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)	p.N663N(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TTCAGTACAACGCTCAGAGGA	0.502																																					p.N663N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1989T	3						.						120.0	114.0	116.0					3																	35785414		2203	4300	6503	35760418	SO:0001819	synonymous_variant	10777	exon18			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1989C>T	3.37:g.35785414C>T		Somatic		Capture	Illumina HiSeq	Phase_I	35760418	NM_016300	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Silent	SNP	ENST00000187397.4	37	CCDS2661.1																																																																																				0.502	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399	
CCDC13	152206	broad.mit.edu	37	3	42781234	42781234	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr3:42781234C>T	ENST00000310232.6	-	9	1139	c.1056G>A	c.(1054-1056)atG>atA	p.M352I	CCDC13-AS1_ENST00000446950.1_RNA|CCDC13-AS1_ENST00000418161.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	352								p.M352I(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						TCCGAGACCTCATGCCCTCGA	0.522																																					p.M352I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1056A	3						.						192.0	165.0	174.0					3																	42781234		2203	4300	6503	42756238	SO:0001583	missense	152206	exon9			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1056G>A	3.37:g.42781234C>T	ENSP00000309836:p.Met352Ile	Somatic		Capture	Illumina HiSeq	Phase_I	42756238	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	37	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	5.410	0.260771	0.10239	.	.	ENSG00000244607	ENST00000310232	T	0.21031	2.03	5.42	2.15	0.27550	.	0.839331	0.10558	N	0.660608	T	0.16171	0.0389	L	0.51422	1.61	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35871	-0.9771	10	0.16896	T	0.51	.	4.3445	0.11126	0.1297:0.5791:0.1269:0.1643	.	352	Q8IYE1	CCD13_HUMAN	I	352	ENSP00000309836:M352I	ENSP00000309836:M352I	M	-	3	0	CCDC13	42756238	0.004000	0.15560	0.002000	0.10522	0.730000	0.41778	-0.329000	0.07935	0.652000	0.30806	0.561000	0.74099	ATG		0.522	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
ALS2CL	259173	broad.mit.edu	37	3	46723030	46723030	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr3:46723030G>T	ENST00000318962.4	-	12	1317	c.1234C>A	c.(1234-1236)Cac>Aac	p.H412N	ALS2CL_ENST00000415953.1_Missense_Mutation_p.H412N	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	412					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H412N(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		TCTCGCCAGTGACACTTGTAA	0.612																																					p.H412N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1234A	3						.						137.0	122.0	127.0					3																	46723030		2203	4300	6503	46698034	SO:0001583	missense	259173	exon12			AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.1234C>A	3.37:g.46723030G>T	ENSP00000313670:p.His412Asn	Somatic		Capture	Illumina HiSeq	Phase_I	46698034	NM_001190707	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	ENST00000318962.4	37	CCDS2743.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518585	0.64634	.	.	ENSG00000178038	ENST00000318962;ENST00000415953	T;T	0.39997	1.05;1.05	3.94	3.94	0.45596	.	0.294126	0.28595	N	0.014786	T	0.37100	0.0991	N	0.17723	0.515	0.80722	D	1	P	0.40578	0.722	P	0.47941	0.562	T	0.20538	-1.0272	10	0.38643	T	0.18	.	13.503	0.61469	0.0:0.0:1.0:0.0	.	412	Q60I27	AL2CL_HUMAN	N	412	ENSP00000313670:H412N;ENSP00000413223:H412N	ENSP00000313670:H412N	H	-	1	0	ALS2CL	46698034	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	7.433000	0.80362	2.031000	0.59945	0.455000	0.32223	CAC		0.612	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129	
TNIK	23043	broad.mit.edu	37	3	170800132	170800132	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr3:170800132C>G	ENST00000436636.2	-	27	3565	c.3221G>C	c.(3220-3222)aGt>aCt	p.S1074T	TNIK_ENST00000538048.1_Missense_Mutation_p.S1026T|TNIK_ENST00000460047.1_Missense_Mutation_p.S1011T|TNIK_ENST00000488470.1_Missense_Mutation_p.S1019T|TNIK_ENST00000470834.1_Missense_Mutation_p.S1037T|TNIK_ENST00000475336.1_Missense_Mutation_p.S982T|TNIK_ENST00000341852.6_Missense_Mutation_p.S990T|TNIK_ENST00000284483.8_Missense_Mutation_p.S1066T|TNIK_ENST00000357327.5_Missense_Mutation_p.S1045T|TNIK_ENST00000369326.5_Missense_Mutation_p.S1052T	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	1074	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.S1074T(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			GCCTTGCCCACTTCGGTCCAA	0.433																																					p.S990T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2969C	3						.						96.0	92.0	93.0					3																	170800132		1930	4155	6085	172282826	SO:0001583	missense	23043	exon25			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.3221G>C	3.37:g.170800132C>G	ENSP00000399511:p.Ser1074Thr	Somatic		Capture	Illumina HiSeq	Phase_I	172282826	NM_001161565	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	ENST00000436636.2	37	CCDS46956.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002135	0.93227	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	T;T;T;T;T;T;T;T;T;T	0.05382	3.45;3.45;3.45;3.45;3.45;3.45;3.45;3.45;3.45;3.45	5.79	5.79	0.91817	Citron-like (3);	0.000000	0.85682	D	0.000000	T	0.33235	0.0856	M	0.86420	2.815	0.80722	D	1	D;P;D;P;P;D;D;P;D	0.89917	1.0;0.954;0.999;0.954;0.954;1.0;0.999;0.954;1.0	D;D;D;D;D;D;D;D;D	0.83275	0.996;0.943;0.977;0.943;0.943;0.991;0.966;0.943;0.992	T	0.08973	-1.0696	10	0.87932	D	0	.	20.035	0.97554	0.0:1.0:0.0:0.0	.	1026;982;1037;1011;990;1066;1045;1019;1074	F5H5M9;Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;.;TNIK_HUMAN	T	1074;1052;1026;990;1066;982;1045;1011;1019;1037	ENSP00000399511:S1074T;ENSP00000358332:S1052T;ENSP00000443278:S1026T;ENSP00000345352:S990T;ENSP00000284483:S1066T;ENSP00000418156:S982T;ENSP00000349880:S1045T;ENSP00000418916:S1011T;ENSP00000418378:S1019T;ENSP00000419990:S1037T	ENSP00000284483:S1066T	S	-	2	0	TNIK	172282826	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.757000	0.85209	2.742000	0.94016	0.655000	0.94253	AGT		0.433	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	XM_039796	
PCDH18	54510	broad.mit.edu	37	4	138450823	138450823	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr4:138450823G>C	ENST00000344876.4	-	1	2806	c.2420C>G	c.(2419-2421)aCa>aGa	p.T807R	PCDH18_ENST00000507846.1_Missense_Mutation_p.T587R|PCDH18_ENST00000412923.2_Missense_Mutation_p.T807R|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000510305.1_Missense_Mutation_p.T18R	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	807					brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T807R(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TGATGAGATTGTCACCAAACT	0.473																																					p.T807R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2420G	4						.						135.0	115.0	122.0					4																	138450823		2203	4300	6503	138670273	SO:0001583	missense	54510	exon1			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.2420C>G	4.37:g.138450823G>C	ENSP00000355082:p.Thr807Arg	Somatic		Capture	Illumina HiSeq	Phase_I	138670273	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.691588	0.68271	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846;ENST00000510305	T;T;T;T	0.52295	0.77;0.78;0.67;1.54	5.53	5.53	0.82687	.	0.000000	0.44483	D	0.000442	T	0.56108	0.1963	N	0.22421	0.69	0.80722	D	1	D;P;D	0.76494	0.997;0.627;0.999	D;B;D	0.66196	0.916;0.219;0.942	T	0.55774	-0.8088	10	0.48119	T	0.1	.	19.663	0.95879	0.0:0.0:1.0:0.0	.	587;807;807	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	R	807;807;587;18	ENSP00000355082:T807R;ENSP00000390688:T807R;ENSP00000425903:T587R;ENSP00000424269:T18R	ENSP00000355082:T807R	T	-	2	0	PCDH18	138670273	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.197000	0.94985	2.871000	0.98454	0.655000	0.94253	ACA		0.473	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
CEP44	80817	broad.mit.edu	37	4	175231064	175231064	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr4:175231064C>G	ENST00000503780.1	+	8	1156	c.742C>G	c.(742-744)Ctt>Gtt	p.L248V	CEP44_ENST00000457424.2_Missense_Mutation_p.L248V|CEP44_ENST00000296519.4_Missense_Mutation_p.L248V|CEP44_ENST00000426172.1_Missense_Mutation_p.L248V	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	248						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)		p.L248V(1)		endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						CCAAGAAAATCTTAAGAAACT	0.318																																					p.L248V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C742G	4						.						62.0	67.0	65.0					4																	175231064		2203	4300	6503	175467639	SO:0001583	missense	80817	exon8			AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.742C>G	4.37:g.175231064C>G	ENSP00000423153:p.Leu248Val	Somatic		Capture	Illumina HiSeq	Phase_I	175467639	NM_001040157	A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Missense_Mutation	SNP	ENST00000503780.1	37	CCDS34106.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901206	0.52227	.	.	ENSG00000164118	ENST00000503780;ENST00000457424;ENST00000426172;ENST00000296519	T;T;T;T	0.66815	-0.14;-0.23;-0.23;-0.14	5.71	5.71	0.89125	.	0.000000	0.56097	D	0.000034	D	0.82318	0.5011	M	0.72894	2.215	0.45183	D	0.998197	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.83115	-0.0121	10	0.72032	D	0.01	.	19.8516	0.96743	0.0:1.0:0.0:0.0	.	248;248	Q9C0F1-2;Q9C0F1	.;CEP44_HUMAN	V	248	ENSP00000423153:L248V;ENSP00000389427:L248V;ENSP00000408221:L248V;ENSP00000296519:L248V	ENSP00000296519:L248V	L	+	1	0	CEP44	175467639	1.000000	0.71417	0.622000	0.29159	0.165000	0.22458	5.311000	0.65786	2.685000	0.91497	0.585000	0.79938	CTT		0.318	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362109.2	NM_030633	
MAN2B2	23324	broad.mit.edu	37	4	6607029	6607029	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr4:6607029C>A	ENST00000285599.3	+	11	1823	c.1787C>A	c.(1786-1788)aCc>aAc	p.T596N	MAN2B2_ENST00000504248.1_Missense_Mutation_p.T545N|MAN2B2_ENST00000504960.1_3'UTR	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	596					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.T596N(1)		breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						GACCAGGATACCAACCTGATG	0.592																																					p.T596N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1787A	4						.						60.0	55.0	57.0					4																	6607029		2203	4300	6503	6657930	SO:0001583	missense	23324	exon11			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.1787C>A	4.37:g.6607029C>A	ENSP00000285599:p.Thr596Asn	Somatic		Capture	Illumina HiSeq	Phase_I	6657930	NM_015274	Q66MP2|Q86T67	Missense_Mutation	SNP	ENST00000285599.3	37	CCDS33951.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.32|17.32	3.360540|3.360540	0.61403|0.61403	.|.	.|.	ENSG00000013288|ENSG00000013288	ENST00000505907|ENST00000285599;ENST00000504248	.|D;D	.|0.81996	.|-1.56;-1.56	4.46|4.46	4.46|4.46	0.54185|0.54185	.|Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	.|0.054326	.|0.64402	.|D	.|0.000001	D|D	0.83686|0.83686	0.5308|0.5308	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	.|P;B;B	.|0.35844	.|0.524;0.372;0.007	.|B;B;B	.|0.41466	.|0.358;0.358;0.008	D|D	0.84685|0.84685	0.0719|0.0719	5|10	.|0.48119	.|T	.|0.1	-37.4418|-37.4418	16.0416|16.0416	0.80687|0.80687	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|545;596;596	.|E9PCD7;Q9Y2E5;Q9Y2E5-2	.|.;MA2B2_HUMAN;.	T|N	595|596;545	.|ENSP00000285599:T596N;ENSP00000423129:T545N	.|ENSP00000285599:T596N	P|T	+|+	1|2	0|0	MAN2B2|MAN2B2	6657930|6657930	0.995000|0.995000	0.38212|0.38212	0.999000|0.999000	0.59377|0.59377	0.662000|0.662000	0.39071|0.39071	2.725000|2.725000	0.47294|0.47294	2.021000|2.021000	0.59480|0.59480	0.491000|0.491000	0.48974|0.48974	CCA|ACC		0.592	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274	
SLIT2	9353	broad.mit.edu	37	4	20544218	20544219	+	Missense_Mutation	DNP	CC	CC	AT	rs376329517		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr4:20544218_20544219CC>AT	ENST00000504154.1	+	21	2497_2498	c.2245_2246CC>AT	c.(2245-2247)CCg>ATg	p.P749M	SLIT2_ENST00000273739.5_Missense_Mutation_p.P753M|SLIT2_ENST00000503823.1_Missense_Mutation_p.P741M|SLIT2_ENST00000503837.1_Missense_Mutation_p.P745M|SLIT2_ENST00000509394.2_3'UTR	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	749	LRRNT 4.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.P749>?(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GAAGGTCTTGCCGAAAGGTATT	0.406																																					.												.	.	1	Complex(1)	large_intestine(1)	c.2245_2246AT	4						.																																			20153317	SO:0001583	missense	9353	exon21			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	Exception_encountered	4.37:g.20544218_20544219delinsAT	ENSP00000422591:p.Pro749Met	Somatic		Capture	Illumina HiSeq	Phase_I	20153316	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	DNP	ENST00000504154.1	37	CCDS3426.1																																																																																				0.406	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
N4BP2	55728	broad.mit.edu	37	4	40103824	40103824	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr4:40103824G>A	ENST00000261435.6	+	4	775	c.359G>A	c.(358-360)cGt>cAt	p.R120H		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	120					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)	p.R120H(1)		breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						ATGGAAAAACGTCCTGAAGAA	0.368																																					p.R120H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G359A	4						.						95.0	92.0	93.0					4																	40103824		2203	4300	6503	39780219	SO:0001583	missense	55728	exon4			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.359G>A	4.37:g.40103824G>A	ENSP00000261435:p.Arg120His	Somatic		Capture	Illumina HiSeq	Phase_I	39780219	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	G	0.319	-0.962912	0.02249	.	.	ENSG00000078177	ENST00000261435;ENST00000381804;ENST00000515550	T;T	0.79247	-1.25;-1.25	6.08	-2.34	0.06704	.	1.482570	0.04027	N	0.300714	T	0.59004	0.2162	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.04013	0.001;0.0	T	0.44802	-0.9304	10	0.14252	T	0.57	0.3554	12.9621	0.58464	0.6339:0.0:0.3661:0.0	.	120;120	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	H	120;40;40	ENSP00000261435:R120H;ENSP00000422057:R40H	ENSP00000261435:R120H	R	+	2	0	N4BP2	39780219	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	-0.099000	0.11007	-0.314000	0.08716	-0.867000	0.03001	CGT		0.368	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
PDGFRA	5156	broad.mit.edu	37	4	55155245	55155245	+	Silent	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr4:55155245G>A	ENST00000257290.5	+	21	3175	c.2844G>A	c.(2842-2844)gaG>gaA	p.E948E	FIP1L1_ENST00000507166.1_Silent_p.E708E	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	948	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.E948E(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	ACCTGAGTGAGATTGTGGAGA	0.493			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											p.E948E	Pancreas(151;208 1913 7310 23853 37092)		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2844A	4						.						165.0	157.0	160.0					4																	55155245		2203	4300	6503	54850002	SO:0001819	synonymous_variant	5156	exon21	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.2844G>A	4.37:g.55155245G>A		Somatic		Capture	Illumina HiSeq	Phase_I	54850002	NM_006206	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Silent	SNP	ENST00000257290.5	37	CCDS3495.1																																																																																				0.493	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206	
SOWAHB	345079	broad.mit.edu	37	4	77817457	77817457	+	Missense_Mutation	SNP	C	C	T	rs150658509	byFrequency	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr4:77817457C>T	ENST00000334306.2	-	1	1545	c.1546G>A	c.(1546-1548)Gat>Aat	p.D516N		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	516								p.D516N(1)									AAGCCCTCATCGAGGTACTCC	0.567													C|||	6	0.00119808	0.0	0.0	5008	,	,		18794	0.005		0.0	False		,,,				2504	0.001				p.D516N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1546A	4						.	C	ASN/ASP	5,4401	8.1+/-20.4	0,5,2198	37.0	40.0	39.0		1546	3.3	0.0	4	dbSNP_134	39	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ANKRD56	NM_001029870.1	23	0,6,6497	TT,TC,CC		0.0116,0.1135,0.0461	possibly-damaging	516/794	77817457	6,13000	2203	4300	6503	78036481	SO:0001583	missense	345079	exon1				CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.1546G>A	4.37:g.77817457C>T	ENSP00000334879:p.Asp516Asn	Somatic		Capture	Illumina HiSeq	Phase_I	78036481	NM_001029870	B2RP29	Missense_Mutation	SNP	ENST00000334306.2	37	CCDS34017.1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.561249	0.27915	0.001135	1.16E-4	ENSG00000186212	ENST00000334306	T	0.06608	3.28	5.04	3.28	0.37604	.	0.907071	0.08896	U	0.877888	T	0.04497	0.0123	N	0.24115	0.695	0.09310	N	0.999993	P	0.38745	0.645	B	0.28011	0.085	T	0.40850	-0.9541	10	0.56958	D	0.05	-0.1623	8.6915	0.34269	0.0:0.6266:0.2938:0.0796	.	516	A6NEL2	ANR56_HUMAN	N	516	ENSP00000334879:D516N	ENSP00000334879:D516N	D	-	1	0	ANKRD56	78036481	0.929000	0.31497	0.005000	0.12908	0.063000	0.16089	1.636000	0.37144	0.684000	0.31448	-0.181000	0.13052	GAT		0.567	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
PRKG2	5593	broad.mit.edu	37	4	82125932	82125932	+	Silent	SNP	T	T	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr4:82125932T>A	ENST00000395578.1	-	2	386	c.270A>T	c.(268-270)ggA>ggT	p.G90G	PRKG2_ENST00000418486.2_Silent_p.G90G|PRKG2_ENST00000264399.1_Silent_p.G90G			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	90					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)	p.G90G(2)		NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						GCGGGCTTCCTCCCTGCATAT	0.557																																					p.G90G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A270T	4						.						110.0	115.0	114.0					4																	82125932		2203	4300	6503	82344956	SO:0001819	synonymous_variant	5593	exon1			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.270A>T	4.37:g.82125932T>A		Somatic		Capture	Illumina HiSeq	Phase_I	82344956	NM_006259	B4DMX3|E7EPE6|O00125|O60916	Silent	SNP	ENST00000395578.1	37	CCDS3589.1																																																																																				0.557	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
SEC31A	22872	broad.mit.edu	37	4	83763338	83763338	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr4:83763338C>G	ENST00000395310.2	-	22	3105	c.2923G>C	c.(2923-2925)Ggt>Cgt	p.G975R	SEC31A_ENST00000326950.5_Missense_Mutation_p.G936R|SEC31A_ENST00000432794.1_Missense_Mutation_p.G975R|SEC31A_ENST00000264405.5_Splice_Site_p.G739R|SEC31A_ENST00000505472.1_Missense_Mutation_p.G1006R|SEC31A_ENST00000505984.1_Splice_Site_p.G936R|SEC31A_ENST00000509142.1_Intron|SEC31A_ENST00000348405.4_Missense_Mutation_p.G936R|SEC31A_ENST00000443462.2_Splice_Site_p.G970R|SEC31A_ENST00000355196.2_Missense_Mutation_p.G975R|SEC31A_ENST00000500777.2_Intron|SEC31A_ENST00000448323.1_Missense_Mutation_p.G975R|SEC31A_ENST00000513858.1_Intron|SEC31A_ENST00000508502.1_Splice_Site_p.G975R|SEC31A_ENST00000311785.7_Intron	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	975	Interaction with PDCD6.|Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)	p.G975R(2)	SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				GGCAGTGTACCTGTTGTTCCA	0.542																																					p.G970R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2908C	4						.						67.0	65.0	65.0					4																	83763338		2203	4300	6503	83982362	SO:0001583	missense	22872	exon21			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.2923G>C	4.37:g.83763338C>G	ENSP00000378721:p.Gly975Arg	Somatic		Capture	Illumina HiSeq	Phase_I	83982362	NM_001191049	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	ENST00000395310.2	37	CCDS3596.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.9|26.9	4.784222|4.784222	0.90282|0.90282	.|.	.|.	ENSG00000138674|ENSG00000138674	ENST00000348405;ENST00000395310;ENST00000443462;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000505472;ENST00000508502;ENST00000355196;ENST00000264405;ENST00000505984|ENST00000503937	T;T;T;T;T;T;T;T;T;T;T|.	0.39997|.	1.21;2.33;2.33;2.11;2.33;1.21;1.05;2.34;2.33;3.19;2.26|.	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77611|0.77611	0.4156|0.4156	M|M	0.76328|0.76328	2.33|2.33	0.80722|0.80722	D|D	1|1	D;D;B;D;P;D;P|.	0.89917|.	1.0;1.0;0.413;1.0;0.79;1.0;0.934|.	D;D;B;D;B;D;P|.	0.97110|.	1.0;0.999;0.413;1.0;0.417;1.0;0.718|.	T|T	0.76691|0.76691	-0.2866|-0.2866	10|5	0.62326|.	D|.	0.03|.	-18.7832|-18.7832	19.5565|19.5565	0.95351|0.95351	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	970;936;936;975;975;739;975|.	B4DIW6;B7ZL00;O94979-4;O94979-2;O94979;O94979-7;O94979-8|.	.;.;.;.;SC31A_HUMAN;.;.|.	R|H	936;975;970;975;975;936;1006;975;975;739;936|124	ENSP00000337602:G936R;ENSP00000378721:G975R;ENSP00000408027:G970R;ENSP00000407944:G975R;ENSP00000400926:G975R;ENSP00000325087:G936R;ENSP00000421633:G1006R;ENSP00000424635:G975R;ENSP00000347329:G975R;ENSP00000264405:G739R;ENSP00000424451:G936R|.	ENSP00000264405:G739R|.	G|Q	-|-	1|3	0|2	SEC31A|SEC31A	83982362|83982362	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	7.116000|7.116000	0.77119|0.77119	2.614000|2.614000	0.88457|0.88457	0.563000|0.563000	0.77884|0.77884	GGT|CAG		0.542	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1	NM_016211	
FAT1	2195	broad.mit.edu	37	4	187524478	187524478	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr4:187524478G>C	ENST00000441802.2	-	19	11411	c.11202C>G	c.(11200-11202)ttC>ttG	p.F3734L		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3734					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F3734L(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AGAGTTTCTGGAATACATTCA	0.463										HNSCC(5;0.00058)																											p.F3734L	Colon(197;1040 2055 4143 4984 49344)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C11202G	4						.						73.0	69.0	70.0					4																	187524478		1921	4138	6059	187761472	SO:0001583	missense	2195	exon19			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.11202C>G	4.37:g.187524478G>C	ENSP00000406229:p.Phe3734Leu	Somatic		Capture	Illumina HiSeq	Phase_I	187761472	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	G	0.052	-1.246836	0.01481	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.19806	2.12	4.38	2.65	0.31530	.	0.129644	0.56097	D	0.000022	T	0.09862	0.0242	N	0.12887	0.27	0.42680	D	0.993544	B	0.09022	0.002	B	0.09377	0.004	T	0.17018	-1.0383	10	0.10902	T	0.67	.	9.7474	0.40455	0.2354:0.0:0.7646:0.0	.	3734	Q14517	FAT1_HUMAN	L	3734;3736	ENSP00000406229:F3734L	ENSP00000260147:F3736L	F	-	3	2	FAT1	187761472	0.996000	0.38824	0.645000	0.29479	0.358000	0.29455	1.020000	0.30027	0.600000	0.29862	0.563000	0.77884	TTC		0.463	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
TRPC7	57113	broad.mit.edu	37	5	135651372	135651372	+	Silent	SNP	G	G	A	rs574852917		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr5:135651372G>A	ENST00000513104.1	-	3	1158	c.876C>T	c.(874-876)aaC>aaT	p.N292N	TRPC7-AS2_ENST00000513958.1_RNA|TRPC7_ENST00000426057.2_Intron|TRPC7_ENST00000355180.3_Intron	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	292					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.N292N(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCACATCACCGTTTAAAATTG	0.478													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20443	0.0		0.0	False		,,,				2504	0.0				p.N292N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C876T	5						.						107.0	110.0	109.0					5																	135651372		2047	4212	6259	135679271	SO:0001819	synonymous_variant	57113	exon3			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.876C>T	5.37:g.135651372G>A		Somatic		Capture	Illumina HiSeq	Phase_I	135679271	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Silent	SNP	ENST00000513104.1	37	CCDS47267.2	.	.	.	.	.	.	.	.	.	.	G	8.906	0.957441	0.18507	.	.	ENSG00000069018	ENST00000502753	.	.	.	5.64	4.48	0.54585	.	.	.	.	.	T	0.62829	0.2460	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60622	-0.7227	4	.	.	.	-18.4766	11.6064	0.51035	0.931:0.0:0.069:0.0	.	.	.	.	W	292	.	.	R	-	1	2	TRPC7	135679271	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.223000	0.32527	1.159000	0.42565	-0.247000	0.11927	CGG		0.478	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
PCDHA13	56136	broad.mit.edu	37	5	140263885	140263885	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr5:140263885G>A	ENST00000289272.2	+	1	2032	c.2032G>A	c.(2032-2034)Gct>Act	p.A678T	PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.A678T|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	678	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A678T(1)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCGCCACAGGCTTCGTCGAG	0.647																																					p.A678T	Melanoma(147;1739 1852 5500 27947 37288)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2032A	5						.						56.0	51.0	53.0					5																	140263885		2203	4300	6503	140244069	SO:0001583	missense	56136	exon1			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.2032G>A	5.37:g.140263885G>A	ENSP00000289272:p.Ala678Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140244069	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	37	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	G	1.344	-0.593303	0.03771	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.49720	0.77;0.83	4.08	-0.17	0.13335	Cadherin (1);	.	.	.	.	T	0.30916	0.0780	L	0.35644	1.08	0.09310	N	1	B;B;B	0.09022	0.0;0.0;0.002	B;B;B	0.12156	0.003;0.002;0.007	T	0.23261	-1.0193	9	0.21014	T	0.42	.	4.4235	0.11492	0.2871:0.3113:0.4016:0.0	.	678;678;678	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	T	678	ENSP00000386821:A678T;ENSP00000289272:A678T	ENSP00000289272:A678T	A	+	1	0	PCDHA13	140244069	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.405000	0.07196	-0.282000	0.09128	0.655000	0.94253	GCT		0.647	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
LPCAT1	79888	broad.mit.edu	37	5	1494916	1494916	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr5:1494916G>A	ENST00000283415.3	-	3	524	c.392C>T	c.(391-393)aCg>aTg	p.T131M		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	131					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)	p.T131M(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		AGGCGCGAGCGTGAGGATGGC	0.652																																					p.T131M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C392T	5						.						70.0	63.0	66.0					5																	1494916		2203	4300	6503	1547916	SO:0001583	missense	79888	exon3			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.392C>T	5.37:g.1494916G>A	ENSP00000283415:p.Thr131Met	Somatic		Capture	Illumina HiSeq	Phase_I	1547916	NM_024830	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	ENST00000283415.3	37	CCDS3864.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716705	0.89205	.	.	ENSG00000153395	ENST00000283415	D	0.93019	-3.15	4.99	4.99	0.66335	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.93703	0.7988	L	0.33485	1.01	0.80722	D	1	D	0.61080	0.989	P	0.57911	0.829	D	0.94599	0.7794	10	0.66056	D	0.02	-25.5172	18.2548	0.90016	0.0:0.0:1.0:0.0	.	131	Q8NF37	PCAT1_HUMAN	M	131	ENSP00000283415:T131M	ENSP00000283415:T131M	T	-	2	0	LPCAT1	1547916	1.000000	0.71417	0.998000	0.56505	0.829000	0.46940	9.073000	0.93992	2.297000	0.77311	0.563000	0.77884	ACG		0.652	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304032.1	NM_024830	
PCDHB7	56129	broad.mit.edu	37	5	140553938	140553938	+	Missense_Mutation	SNP	G	G	A	rs201278205|rs17844457	byFrequency	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr5:140553938G>A	ENST00000231137.3	+	1	1696	c.1522G>A	c.(1522-1524)Gcg>Acg	p.A508T		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	508	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A508T(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCCATCAACGCGGACAACGG	0.692													G|||	13	0.00259585	0.0	0.0086	5008	,	,		17095	0.0069		0.0	False		,,,				2504	0.0				p.A508T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1522A	5						.	G	THR/ALA	0,4406		0,0,2203	87.0	91.0	90.0		1522	2.1	0.7	5	dbSNP_123	90	1,8593	1.2+/-3.3	0,1,4296	no	missense	PCDHB7	NM_018940.2	58	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	benign	508/794	140553938	1,12999	2203	4297	6500	140534122	SO:0001583	missense	56129	exon1			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1522G>A	5.37:g.140553938G>A	ENSP00000231137:p.Ala508Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140534122	NM_018940	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	g	8.643	0.896512	0.17686	0.0	1.16E-4	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.47869	0.83	4.34	2.1	0.27182	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.22085	0.0532	N	0.16037	0.36	0.25952	N	0.982733	P	0.45672	0.864	B	0.35413	0.202	T	0.10965	-1.0607	9	0.46703	T	0.11	.	2.0213	0.03509	0.112:0.1447:0.4306:0.3127	rs17844457	508	Q9Y5E2	PCDB7_HUMAN	T	508;291	ENSP00000231137:A508T	ENSP00000231137:A508T	A	+	1	0	PCDHB7	140534122	0.001000	0.12720	0.732000	0.30844	0.033000	0.12548	-0.119000	0.10676	0.920000	0.36970	0.552000	0.68991	GCG		0.692	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
RXFP3	51289	broad.mit.edu	37	5	33937024	33937024	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr5:33937024C>T	ENST00000330120.3	+	1	534	c.179C>T	c.(178-180)gCg>gTg	p.A60V		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	60					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)	p.A60V(1)		endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						CCGGACGGCGCGCCGCCAGGA	0.701																																					p.A60V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C179T	5						.						49.0	62.0	58.0					5																	33937024		2202	4299	6501	33972781	SO:0001583	missense	51289	exon1			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.179C>T	5.37:g.33937024C>T	ENSP00000328708:p.Ala60Val	Somatic		Capture	Illumina HiSeq	Phase_I	33972781	NM_016568	Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.651648	0.47362	.	.	ENSG00000182631	ENST00000330120	T	0.70164	-0.46	4.84	3.95	0.45737	.	1.112030	0.06780	N	0.785045	T	0.48447	0.1500	N	0.24115	0.695	0.32646	N	0.519992	P	0.35844	0.524	B	0.20184	0.028	T	0.50857	-0.8778	10	0.33141	T	0.24	-13.0119	9.5668	0.39402	0.0:0.8956:0.0:0.1044	.	60	Q9NSD7	RL3R1_HUMAN	V	60	ENSP00000328708:A60V	ENSP00000328708:A60V	A	+	2	0	RXFP3	33972781	0.000000	0.05858	0.996000	0.52242	0.599000	0.36880	-0.671000	0.05250	2.408000	0.81797	0.655000	0.94253	GCG		0.701	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
CMYA5	202333	broad.mit.edu	37	5	79033165	79033165	+	Silent	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr5:79033165C>T	ENST00000446378.2	+	2	8608	c.8577C>T	c.(8575-8577)tcC>tcT	p.S2859S		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2859					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.S2859S(2)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATGACACATCCGATGTGCCTA	0.413																																					p.S2859S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C8577T	5						.						100.0	95.0	96.0					5																	79033165		1932	4141	6073	79068921	SO:0001819	synonymous_variant	202333	exon2			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.8577C>T	5.37:g.79033165C>T		Somatic		Capture	Illumina HiSeq	Phase_I	79068921	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	37	CCDS47238.1																																																																																				0.413	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
HAPLN1	1404	broad.mit.edu	37	5	82969271	82969271	+	Silent	SNP	C	C	T	rs202185751	byFrequency	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr5:82969271C>T	ENST00000274341.4	-	2	922	c.72G>A	c.(70-72)ctG>ctA	p.L24L	HAPLN1_ENST00000514416.1_Silent_p.L24L	NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	24					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.L24L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	TGTCATGATCCAGAGTATAGT	0.393													C|||	7	0.00139776	0.0	0.0	5008	,	,		19788	0.0		0.0	False		,,,				2504	0.0072				p.L24L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G72A	5						.						160.0	161.0	161.0					5																	82969271		2203	4300	6503	83005027	SO:0001819	synonymous_variant	1404	exon2				CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.72G>A	5.37:g.82969271C>T		Somatic		Capture	Illumina HiSeq	Phase_I	83005027	NM_001884	B2R9A9	Silent	SNP	ENST00000274341.4	37	CCDS4061.1																																																																																				0.393	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884	
GPR98	84059	broad.mit.edu	37	5	90059257	90059257	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr5:90059257C>T	ENST00000405460.2	+	59	12352	c.12256C>T	c.(12256-12258)Cct>Tct	p.P4086S		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4086	Calx-beta 27. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.P4086S(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAACCTTAGTCCTTTGAATGG	0.408																																					p.P4086S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C12256T	5						.						71.0	69.0	70.0					5																	90059257		1858	4102	5960	90095013	SO:0001583	missense	84059	exon59			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.12256C>T	5.37:g.90059257C>T	ENSP00000384582:p.Pro4086Ser	Somatic		Capture	Illumina HiSeq	Phase_I	90095013	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109847	0.77096	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.28895	1.59	5.21	5.21	0.72293	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.55986	0.1955	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.58335	-0.7654	10	0.72032	D	0.01	.	19.1127	0.93323	0.0:1.0:0.0:0.0	.	4086	Q8WXG9	GPR98_HUMAN	S	4086	ENSP00000384582:P4086S	ENSP00000296619:P4086S	P	+	1	0	GPR98	90095013	1.000000	0.71417	0.996000	0.52242	0.576000	0.36127	6.431000	0.73395	2.591000	0.87537	0.563000	0.77884	CCT		0.408	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
SQSTM1	8878	broad.mit.edu	37	5	179251037	179251037	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr5:179251037C>T	ENST00000389805.4	+	3	659	c.481C>T	c.(481-483)Cgg>Tgg	p.R161W	SQSTM1_ENST00000376929.3_Missense_Mutation_p.R77W|SQSTM1_ENST00000510187.1_Missense_Mutation_p.R161W|SQSTM1_ENST00000402874.3_Missense_Mutation_p.R77W|SQSTM1_ENST00000360718.5_Missense_Mutation_p.R77W	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	161	Interaction with GABRR3. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.R161W(1)	SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGCTTGCACCGGGGGCACAC	0.647																																					p.R77W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C229T	5						.						65.0	60.0	62.0					5																	179251037		2203	4300	6503	179183643	SO:0001583	missense	8878	exon4			U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.481C>T	5.37:g.179251037C>T	ENSP00000374455:p.Arg161Trp	Somatic		Capture	Illumina HiSeq	Phase_I	179183643	NM_001142299	A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Missense_Mutation	SNP	ENST00000389805.4	37	CCDS34317.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.726535	0.48833	.	.	ENSG00000161011	ENST00000376929;ENST00000514093;ENST00000422245;ENST00000389805;ENST00000504627;ENST00000402874;ENST00000510187;ENST00000360718	D;D;D;D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28	5.44	-10.9	0.00192	Zinc finger, ZZ-type (2);	0.365990	0.28082	N	0.016663	D	0.83686	0.5308	L	0.56769	1.78	0.19775	N	0.99995	P;D	0.67145	0.922;0.996	P;P	0.51453	0.67;0.545	D	0.84016	0.0351	10	0.66056	D	0.02	-3.6506	12.7944	0.57551	0.2625:0.6156:0.1219:0.0	.	161;161	Q13501;E7EMC7	SQSTM_HUMAN;.	W	77;77;77;161;184;77;161;77	ENSP00000366128:R77W;ENSP00000427308:R77W;ENSP00000394534:R77W;ENSP00000374455:R161W;ENSP00000425957:R184W;ENSP00000385553:R77W;ENSP00000424477:R161W;ENSP00000353944:R77W	ENSP00000353944:R77W	R	+	1	2	SQSTM1	179183643	0.702000	0.27816	0.000000	0.03702	0.002000	0.02628	0.813000	0.27225	-2.271000	0.00683	-1.083000	0.02208	CGG		0.647	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319344.1		
REV3L	5980	broad.mit.edu	37	6	111694381	111694381	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:111694381T>A	ENST00000358835.3	-	14	5631	c.5177A>T	c.(5176-5178)gAa>gTa	p.E1726V	REV3L_ENST00000435970.1_Missense_Mutation_p.E1648V|REV3L_ENST00000368802.3_Missense_Mutation_p.E1726V|REV3L_ENST00000368805.1_Missense_Mutation_p.E1726V			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1726					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.E1648V(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CTCAAAAATTTCAGGACTTAA	0.378								DNA polymerases (catalytic subunits)																													p.E1726V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5177T	6						.						157.0	153.0	154.0					6																	111694381		2203	4300	6503	111801074	SO:0001583	missense	5980	exon13			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.5177A>T	6.37:g.111694381T>A	ENSP00000351697:p.Glu1726Val	Somatic		Capture	Illumina HiSeq	Phase_I	111801074	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	T	16.17	3.048405	0.55110	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.02032	4.59;4.59;4.59;4.49	6.03	6.03	0.97812	Ribonuclease H-like (1);	0.065198	0.64402	D	0.000016	T	0.03783	0.0107	L	0.59436	1.845	0.42217	D	0.991838	D	0.60575	0.988	P	0.51657	0.676	T	0.39881	-0.9592	10	0.87932	D	0	-7.1373	16.5582	0.84512	0.0:0.0:0.0:1.0	.	1726	O60673	DPOLZ_HUMAN	V	1726;1726;1726;1648	ENSP00000357792:E1726V;ENSP00000357795:E1726V;ENSP00000351697:E1726V;ENSP00000402003:E1648V	ENSP00000351697:E1726V	E	-	2	0	REV3L	111801074	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.396000	0.79891	2.308000	0.77769	0.533000	0.62120	GAA		0.378	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
TRDN	10345	broad.mit.edu	37	6	123892252	123892252	+	Silent	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:123892252C>A	ENST00000398178.3	-	2	69	c.48G>T	c.(46-48)gtG>gtT	p.V16V	TRDN_ENST00000546248.1_Silent_p.V16V|TRDN_ENST00000334268.4_Silent_p.V16V|TRDN_ENST00000542443.1_Silent_p.V16V	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	16					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)	p.V16V(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		TGCTGTCTATCACAGTTGTGG	0.408																																					p.V16V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G48T	6						.						87.0	86.0	86.0					6																	123892252		1916	4136	6052	123933951	SO:0001819	synonymous_variant	10345	exon2			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.48G>T	6.37:g.123892252C>A		Somatic		Capture	Illumina HiSeq	Phase_I	123933951	NM_006073	A5D6W5|F5H2W7|Q6NSB8	Silent	SNP	ENST00000398178.3	37	CCDS55053.1																																																																																				0.408	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
EPB41L2	2037	broad.mit.edu	37	6	131277244	131277244	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:131277244C>A	ENST00000337057.3	-	2	563	c.382G>T	c.(382-384)Gat>Tat	p.D128Y	EPB41L2_ENST00000527659.1_Missense_Mutation_p.D128Y|EPB41L2_ENST00000530148.1_Intron|EPB41L2_ENST00000530481.1_Missense_Mutation_p.D128Y|EPB41L2_ENST00000445890.2_Missense_Mutation_p.D128Y|EPB41L2_ENST00000527411.1_Missense_Mutation_p.D128Y|EPB41L2_ENST00000525271.1_Missense_Mutation_p.D128Y|EPB41L2_ENST00000525193.1_Missense_Mutation_p.D128Y|EPB41L2_ENST00000529208.1_Missense_Mutation_p.D128Y|EPB41L2_ENST00000368128.2_Missense_Mutation_p.D128Y|EPB41L2_ENST00000392427.3_Missense_Mutation_p.D128Y|EPB41L2_ENST00000528282.1_Missense_Mutation_p.D128Y	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	128					cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)	p.D128Y(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		TCTTCAGCATCACCCTTAGCC	0.428																																					p.D128Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G382T	6						.						258.0	257.0	258.0					6																	131277244		2203	4300	6503	131318937	SO:0001583	missense	2037	exon2			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.382G>T	6.37:g.131277244C>A	ENSP00000338481:p.Asp128Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	131318937	NM_001135555	B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	ENST00000337057.3	37	CCDS5141.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.172372	0.57584	.	.	ENSG00000079819	ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000392427;ENST00000425439;ENST00000368128;ENST00000527411;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208;ENST00000529709;ENST00000532499;ENST00000526983	D;D;D;D;D;D;D;D;D;D;D;T;T;T	0.83250	-1.7;-1.68;-1.7;-1.68;-1.68;-1.68;-1.68;-1.68;-1.67;-1.68;-1.68;0.62;0.63;0.64	5.99	4.23	0.50019	.	0.910104	0.09490	N	0.795128	T	0.69540	0.3122	L	0.29908	0.895	0.09310	N	0.999999	P;P;P;P;P	0.52061	0.924;0.924;0.924;0.95;0.828	P;B;B;P;B	0.50617	0.459;0.347;0.259;0.646;0.347	T	0.62599	-0.6820	10	0.72032	D	0.01	.	7.6408	0.28292	0.0:0.7109:0.0:0.2891	.	128;128;128;128;128	E9PHY5;B4DHI8;E9PPD9;O43491;Q68DV2	.;.;.;E41L2_HUMAN;.	Y	128	ENSP00000434308:D128Y;ENSP00000434576:D128Y;ENSP00000402041:D128Y;ENSP00000338481:D128Y;ENSP00000376222:D128Y;ENSP00000357110:D128Y;ENSP00000436348:D128Y;ENSP00000432803:D128Y;ENSP00000431988:D128Y;ENSP00000431647:D128Y;ENSP00000436641:D128Y;ENSP00000436871:D128Y;ENSP00000432013:D128Y;ENSP00000432329:D128Y	ENSP00000338481:D128Y	D	-	1	0	EPB41L2	131318937	0.002000	0.14202	0.969000	0.41365	0.932000	0.56968	1.150000	0.31639	0.884000	0.36064	0.655000	0.94253	GAT		0.428	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042204.3		
DSP	1832	broad.mit.edu	37	6	7580220	7580220	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:7580220A>T	ENST00000379802.3	+	23	4138	c.3797A>T	c.(3796-3798)cAg>cTg	p.Q1266L	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1266	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.Q1266L(1)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GCCACTGAGCAGCGAAGGCGA	0.463																																					p.Q1266L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3797T	6						.						58.0	59.0	59.0					6																	7580220		2202	4299	6501	7525219	SO:0001583	missense	1832	exon23			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.3797A>T	6.37:g.7580220A>T	ENSP00000369129:p.Gln1266Leu	Somatic		Capture	Illumina HiSeq	Phase_I	7525219	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	A	12.77	2.037799	0.35989	.	.	ENSG00000096696	ENST00000379802	D	0.91843	-2.92	5.17	5.17	0.71159	.	0.000000	0.56097	D	0.000039	T	0.78220	0.4249	L	0.29908	0.895	0.80722	D	1	P	0.43477	0.808	B	0.30855	0.121	T	0.80957	-0.1150	10	0.33141	T	0.24	.	14.666	0.68907	1.0:0.0:0.0:0.0	.	1266	P15924	DESP_HUMAN	L	1266	ENSP00000369129:Q1266L	ENSP00000369129:Q1266L	Q	+	2	0	DSP	7525219	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.871000	0.63042	1.952000	0.56665	0.455000	0.32223	CAG		0.463	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
HIST1H2BE	8344	broad.mit.edu	37	6	26184080	26184080	+	Silent	SNP	G	G	A	rs529756458		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:26184080G>A	ENST00000356530.3	+	1	123	c.57G>A	c.(55-57)gtG>gtA	p.V19V		NM_003523.2	NP_003514.2	P62807	H2B1C_HUMAN	histone cluster 1, H2be	19					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V19V(1)		endometrium(1)|large_intestine(2)|lung(1)	4						AGAAGGCCGTGACCAAGGCGC	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18962	0.0		0.0	False		,,,				2504	0.0				p.V19V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G57A	6						.						120.0	111.0	114.0					6																	26184080		2203	4300	6503	26292059	SO:0001819	synonymous_variant	8344	exon1			Z80780	CCDS4588.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197697	ENSG00000274290		"""Histones / Replication-dependent"""	4753	protein-coding gene	gene with protein product		602805	"""H2B histone family, member H"", ""histone 1, H2be"""	H2BFH		9119399, 12408966	Standard	NM_003523		Approved	H2B/h, H2B.h	uc003ngt.3	P62807	OTTHUMG00000014427	ENST00000356530.3:c.57G>A	6.37:g.26184080G>A		Somatic		Capture	Illumina HiSeq	Phase_I	26292059	NM_003523	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000356530.3	37	CCDS4588.1																																																																																				0.552	HIST1H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040090.1	NM_003523	
UHRF1BP1	54887	broad.mit.edu	37	6	34826295	34826295	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:34826295C>T	ENST00000192788.5	+	14	2333	c.2162C>T	c.(2161-2163)cCc>cTc	p.P721L	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.P721L	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	721							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)	p.P721L(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						TTTGTAGCCCCCTTCCCCCTG	0.552																																					p.P721L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2162T	6						.						64.0	67.0	66.0					6																	34826295		1892	4103	5995	34934273	SO:0001583	missense	54887	exon14			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.2162C>T	6.37:g.34826295C>T	ENSP00000192788:p.Pro721Leu	Somatic		Capture	Illumina HiSeq	Phase_I	34934273	NM_017754	Q9NXE0	Missense_Mutation	SNP	ENST00000192788.5	37	CCDS43455.1	.	.	.	.	.	.	.	.	.	.	C	17.92	3.506921	0.64410	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.08807	3.05;3.05	5.55	5.55	0.83447	.	0.124289	0.56097	D	0.000039	T	0.06234	0.0161	L	0.46157	1.445	0.80722	D	1	P	0.42785	0.79	B	0.37650	0.255	T	0.13469	-1.0508	10	0.87932	D	0	-11.7106	19.5532	0.95330	0.0:1.0:0.0:0.0	.	721	Q6BDS2	URFB1_HUMAN	L	721	ENSP00000192788:P721L;ENSP00000400628:P721L	ENSP00000192788:P721L	P	+	2	0	UHRF1BP1	34934273	0.922000	0.31269	1.000000	0.80357	0.994000	0.84299	5.753000	0.68736	2.624000	0.88883	0.585000	0.79938	CCC		0.552	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754	
FGD2	221472	broad.mit.edu	37	6	36976669	36976669	+	Missense_Mutation	SNP	G	G	T	rs565025526		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:36976669G>T	ENST00000274963.8	+	2	299	c.128G>T	c.(127-129)tGc>tTc	p.C43F		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	43					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.C43F(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						CGCCCTGAGTGCAGGCCTCCC	0.642																																					p.C43F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G128T	6						.						55.0	59.0	58.0					6																	36976669		2203	4300	6503	37084647	SO:0001583	missense	221472	exon2			AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.128G>T	6.37:g.36976669G>T	ENSP00000274963:p.Cys43Phe	Somatic		Capture	Illumina HiSeq	Phase_I	37084647	NM_173558	Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	ENST00000274963.8	37	CCDS4829.1	.	.	.	.	.	.	.	.	.	.	G	9.555	1.116927	0.20795	.	.	ENSG00000146192	ENST00000274963	T	0.57752	0.38	4.79	-0.669	0.11388	.	1.214320	0.06066	N	0.659257	T	0.17916	0.0430	L	0.27053	0.805	0.09310	N	1	B;B;B	0.28324	0.207;0.08;0.207	B;B;B	0.33690	0.074;0.011;0.168	T	0.36792	-0.9733	10	0.54805	T	0.06	-0.3954	1.738	0.02946	0.284:0.1381:0.4376:0.1402	.	43;43;43	B4DV77;Q7Z6J4;F8WEZ2	.;FGD2_HUMAN;.	F	43	ENSP00000274963:C43F	ENSP00000274963:C43F	C	+	2	0	FGD2	37084647	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-1.201000	0.03026	0.099000	0.17552	-0.671000	0.03813	TGC		0.642	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040398.2	NM_173558	
TMEM217	221468	broad.mit.edu	37	6	37186734	37186734	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:37186734C>A	ENST00000336655.2	-	2	112	c.73G>T	c.(73-75)Gcc>Tcc	p.A25S	TMEM217_ENST00000356757.2_Missense_Mutation_p.A25S|TMEM217_ENST00000497775.1_Intron	NM_145316.3	NP_660359.2	Q8N7C4	TM217_HUMAN	transmembrane protein 217	25						integral component of membrane (GO:0016021)		p.A25S(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(1)	9						ATGTCTACGGCCATGATGGTG	0.478																																					p.A25S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G73T	6						.						205.0	172.0	184.0					6																	37186734		2203	4300	6503	37294712	SO:0001583	missense	221468	exon2				CCDS4831.1, CCDS69102.1	6p21.31-p21.2	2008-10-20	2008-07-07	2008-07-07	ENSG00000172738	ENSG00000172738			21238	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 128"""	C6orf128			Standard	NM_001162900		Approved	dJ355M6.2	uc010jws.3	Q8N7C4	OTTHUMG00000014618	ENST00000336655.2:c.73G>T	6.37:g.37186734C>A	ENSP00000338164:p.Ala25Ser	Somatic		Capture	Illumina HiSeq	Phase_I	37294712	NM_145316	Q8TC54	Missense_Mutation	SNP	ENST00000336655.2	37	CCDS4831.1	.	.	.	.	.	.	.	.	.	.	C	6.332	0.429318	0.11987	.	.	ENSG00000172738	ENST00000356757;ENST00000336655	.	.	.	4.81	0.79	0.18613	.	.	.	.	.	T	0.10465	0.0256	L	0.50333	1.59	0.09310	N	1	P;P	0.42203	0.773;0.713	B;B	0.38428	0.273;0.225	T	0.18304	-1.0341	8	0.14656	T	0.56	-35.2087	5.732	0.18045	0.5065:0.4001:0.0:0.0934	.	25;25	Q8N7C4-2;Q8N7C4	.;TM217_HUMAN	S	25	.	ENSP00000338164:A25S	A	-	1	0	TMEM217	37294712	0.000000	0.05858	0.002000	0.10522	0.114000	0.19823	-0.268000	0.08607	0.265000	0.21872	0.609000	0.83330	GCC		0.478	TMEM217-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357542.1	NM_145316	
BTBD9	114781	broad.mit.edu	37	6	38565796	38565796	+	Silent	SNP	A	A	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:38565796A>G	ENST00000481247.1	-	2	226	c.75T>C	c.(73-75)caT>caC	p.H25H	BTBD9_ENST00000403056.1_Silent_p.H25H|BTBD9_ENST00000419706.2_5'Flank|BTBD9_ENST00000314100.6_5'Flank	NM_001099272.1|NM_052893.1	NP_001092742.1|NP_443125.1	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9	25					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|circadian sleep/wake cycle, non-REM sleep (GO:0042748)|long-term memory (GO:0007616)|multicellular organismal iron ion homeostasis (GO:0060586)|regulation of synaptic vesicle endocytosis (GO:1900242)|sensory perception of temperature stimulus (GO:0050951)|serotonin metabolic process (GO:0042428)			p.H25H(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	12						AGGCACCAATATGTTCAGACA	0.473																																					p.H25H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T75C	6						.						134.0	130.0	131.0					6																	38565796		1981	4159	6140	38673774	SO:0001819	synonymous_variant	114781	exon2				CCDS43458.1, CCDS47418.1, CCDS54998.1	6p21	2014-01-28			ENSG00000183826	ENSG00000183826		"""BTB/POZ domain containing"""	21228	protein-coding gene	gene with protein product		611237				11572484	Standard	NM_052893		Approved	KIAA1880, dJ322I12.1	uc010jwx.3	Q96Q07	OTTHUMG00000014634	ENST00000481247.1:c.75T>C	6.37:g.38565796A>G		Somatic		Capture	Illumina HiSeq	Phase_I	38673774	NM_001099272	Q494V9|Q494W1|Q96M00	Silent	SNP	ENST00000481247.1	37	CCDS47418.1																																																																																				0.473	BTBD9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040433.2	NM_152733	
SLC22A7	10864	broad.mit.edu	37	6	43268994	43268994	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:43268994G>C	ENST00000372585.5	+	6	1044	c.949G>C	c.(949-951)Gag>Cag	p.E317Q	SLC22A7_ENST00000372589.3_Missense_Mutation_p.E315Q|SLC22A7_ENST00000372574.3_Missense_Mutation_p.E315Q|SLC22A7_ENST00000487175.1_3'UTR	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	317					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.E317Q(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	CTTCAGCCAGGAGGTGAGGGT	0.582																																					p.E315Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G943C	6						.						186.0	171.0	176.0					6																	43268994		2203	4300	6503	43376972	SO:0001583	missense	10864	exon5			AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.949G>C	6.37:g.43268994G>C	ENSP00000361666:p.Glu317Gln	Somatic		Capture	Illumina HiSeq	Phase_I	43376972	NM_006672	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	ENST00000372585.5	37	CCDS4893.2	.	.	.	.	.	.	.	.	.	.	G	19.26	3.792623	0.70452	.	.	ENSG00000137204	ENST00000372589;ENST00000372585;ENST00000372574	T;T;T	0.74947	-0.89;-0.88;-0.87	4.99	4.99	0.66335	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.233450	0.05509	N	0.559844	T	0.82098	0.4963	M	0.70842	2.15	0.80722	D	1	D;D;D	0.56746	0.977;0.972;0.972	P;P;P	0.61722	0.893;0.828;0.828	T	0.73861	-0.3849	10	0.52906	T	0.07	.	15.1745	0.72901	0.0:0.0:1.0:0.0	.	317;315;315	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	Q	315;317;315	ENSP00000361670:E315Q;ENSP00000361666:E317Q;ENSP00000361655:E315Q	ENSP00000361655:E315Q	E	+	1	0	SLC22A7	43376972	1.000000	0.71417	0.966000	0.40874	0.566000	0.35808	6.585000	0.74062	2.313000	0.78055	0.462000	0.41574	GAG		0.582	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1		
TAAR6	319100	broad.mit.edu	37	6	132891605	132891605	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr6:132891605G>C	ENST00000275198.1	+	1	145	c.145G>C	c.(145-147)Gga>Cga	p.G49R		NM_175067.1	NP_778237.1	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	49					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.G49R(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(19)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		GGCTGTGTTTGGAAACCTCCT	0.532																																					p.G49R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G145C	6						.						186.0	164.0	171.0					6																	132891605		2203	4300	6503	132933298	SO:0001583	missense	319100	exon1			AF380192	CCDS5155.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146383	ENSG00000146383		"""GPCR / Class A : Trace amine associated receptors"""	20978	protein-coding gene	gene with protein product		608923	"""trace amine receptor 4"""	TRAR4		11459929, 15718104	Standard	NM_175067		Approved	TA4	uc011eck.2	Q96RI8	OTTHUMG00000015579	ENST00000275198.1:c.145G>C	6.37:g.132891605G>C	ENSP00000275198:p.Gly49Arg	Somatic		Capture	Illumina HiSeq	Phase_I	132933298	NM_175067	Q5VUQ4	Missense_Mutation	SNP	ENST00000275198.1	37	CCDS5155.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.331954	0.60853	.	.	ENSG00000146383	ENST00000275198;ENST00000539228	T	0.56941	0.43	4.99	3.23	0.37069	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000116	T	0.79845	0.4516	H	0.99726	4.73	0.43485	D	0.995713	D	0.76494	0.999	D	0.80764	0.994	D	0.85878	0.1420	10	0.87932	D	0	-7.0911	11.4455	0.50120	0.1461:0.0:0.8539:0.0	.	49	Q96RI8	TAAR6_HUMAN	R	49;32	ENSP00000275198:G49R	ENSP00000275198:G49R	G	+	1	0	TAAR6	132933298	1.000000	0.71417	0.990000	0.47175	0.794000	0.44872	4.363000	0.59473	0.702000	0.31825	-0.222000	0.12452	GGA		0.532	TAAR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042255.1	NM_175067	
ZAN	7455	broad.mit.edu	37	7	100391524	100391524	+	RNA	SNP	G	G	T	rs368754870		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr7:100391524G>T	ENST00000348028.3	+	0	8016				ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G2644G(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CAGACCCCGGGGACTGCGAGG	0.637																																					p.G2623G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G7869T	7						.						58.0	63.0	61.0					7																	100391524		2036	4196	6232	100229460			7455	exon43			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100391524G>T		Somatic		Capture	Illumina HiSeq	Phase_I	100229460	NM_003386	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Nonsense_Mutation	SNP	ENST00000348028.3	37																																																																																					0.637	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
AASS	10157	broad.mit.edu	37	7	121766440	121766440	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr7:121766440G>T	ENST00000393376.1	-	3	556	c.461C>A	c.(460-462)gCt>gAt	p.A154D	AASS_ENST00000473553.1_Intron|AASS_ENST00000417368.2_Missense_Mutation_p.A154D			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	154	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)	p.A154D(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						TGCCACACCAGCCCACTGTCC	0.443																																					p.A154D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C461A	7						.						265.0	256.0	259.0					7																	121766440		2203	4300	6503	121553676	SO:0001583	missense	10157	exon4			AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.461C>A	7.37:g.121766440G>T	ENSP00000377040:p.Ala154Asp	Somatic		Capture	Illumina HiSeq	Phase_I	121553676	NM_005763	O95462	Missense_Mutation	SNP	ENST00000393376.1	37	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	.	29.9	5.042256	0.93685	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	D;D	0.81659	-1.52;-1.52	5.5	5.5	0.81552	Alanine dehydrogenase/PNT, N-terminal (1);	0.098275	0.64402	D	0.000001	D	0.93301	0.7865	H	0.96970	3.915	0.80722	D	1	D	0.59767	0.986	D	0.66351	0.943	D	0.95203	0.8318	10	0.87932	D	0	-9.0347	19.4392	0.94811	0.0:0.0:1.0:0.0	.	154	Q9UDR5	AASS_HUMAN	D	154	ENSP00000377040:A154D;ENSP00000403768:A154D	ENSP00000351834:A154D	A	-	2	0	AASS	121553676	1.000000	0.71417	0.996000	0.52242	0.951000	0.60555	9.818000	0.99354	2.604000	0.88044	0.644000	0.83932	GCT		0.443	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
RNF133	168433	broad.mit.edu	37	7	122338267	122338267	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr7:122338267G>T	ENST00000340112.2	-	1	943	c.706C>A	c.(706-708)Caa>Aaa	p.Q236K	CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000449022.2_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	236					protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.Q236K(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						AGTTGGAGTTGTCCAAATGTG	0.383																																					p.Q236K	Colon(198;1778 2057 7449 19869 45985)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C706A	7						.						157.0	150.0	153.0					7																	122338267		2203	4300	6503	122125503	SO:0001583	missense	168433	exon1			AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.706C>A	7.37:g.122338267G>T	ENSP00000344489:p.Gln236Lys	Somatic		Capture	Illumina HiSeq	Phase_I	122125503	NM_139175	A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	37	CCDS5784.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.515188	0.00975	.	.	ENSG00000188050	ENST00000340112	T	0.12255	2.7	5.53	5.53	0.82687	.	0.303746	0.29225	U	0.012766	T	0.12050	0.0293	L	0.39245	1.2	0.80722	D	1	B	0.22480	0.07	B	0.22753	0.041	T	0.04565	-1.0942	10	0.02654	T	1	.	17.2415	0.87014	0.0:0.0:1.0:0.0	.	236	Q8WVZ7	RN133_HUMAN	K	236	ENSP00000344489:Q236K	ENSP00000344489:Q236K	Q	-	1	0	RNF133	122125503	0.960000	0.32886	0.767000	0.31495	0.041000	0.13682	3.677000	0.54619	2.596000	0.87737	0.491000	0.48974	CAA		0.383	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175	
KIAA1549	57670	broad.mit.edu	37	7	138583738	138583738	+	Silent	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr7:138583738G>T	ENST00000422774.1	-	9	3858	c.3810C>A	c.(3808-3810)atC>atA	p.I1270I	KIAA1549_ENST00000440172.1_Silent_p.I1270I|KIAA1549_ENST00000242365.4_Silent_p.I1220I			Q9HCM3	K1549_HUMAN	KIAA1549	1270						integral component of membrane (GO:0016021)		p.I1270I(1)|p.I1220I(1)	KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						AACCCAAGATGATGGCTGCTC	0.507			O	BRAF	pilocytic astrocytoma																																p.I1270I	NSCLC(119;1534 1718 44213 46230 50068)		Dom	yes		7	7q34	57670	KIAA1549		O	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3810A	7						.						176.0	172.0	173.0					7																	138583738		2121	4230	6351	138234278	SO:0001819	synonymous_variant	57670	exon9				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.3810C>A	7.37:g.138583738G>T		Somatic		Capture	Illumina HiSeq	Phase_I	138234278	NM_001164665	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Silent	SNP	ENST00000422774.1	37	CCDS56513.1																																																																																				0.507	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
OR2A12	346525	broad.mit.edu	37	7	143793030	143793030	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr7:143793030A>T	ENST00000408949.2	+	1	890	c.830A>T	c.(829-831)tAc>tTc	p.Y277F		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y277F(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					TCCCTGTTTTACAGCCTTTTC	0.502																																					p.Y277F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A830T	7						.						222.0	213.0	216.0					7																	143793030		1901	4140	6041	143423963	SO:0001583	missense	346525	exon1				CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.830A>T	7.37:g.143793030A>T	ENSP00000386174:p.Tyr277Phe	Somatic		Capture	Illumina HiSeq	Phase_I	143423963	NM_001004135	Q6IF43	Missense_Mutation	SNP	ENST00000408949.2	37	CCDS43670.1	.	.	.	.	.	.	.	.	.	.	A	15.91	2.973646	0.53720	.	.	ENSG00000221858	ENST00000408949	T	0.00305	8.18	4.33	3.18	0.36537	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00552	0.0018	M	0.76727	2.345	0.19775	N	0.99995	D	0.67145	0.996	D	0.69479	0.964	T	0.49214	-0.8963	9	0.87932	D	0	-23.5591	7.9057	0.29761	0.8993:0.0:0.1007:0.0	.	277	Q8NGT7	O2A12_HUMAN	F	277	ENSP00000386174:Y277F	ENSP00000386174:Y277F	Y	+	2	0	OR2A12	143423963	0.475000	0.25894	0.898000	0.35279	0.789000	0.44602	2.687000	0.46976	0.707000	0.31934	0.413000	0.27773	TAC		0.502	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1		
DPP6	1804	broad.mit.edu	37	7	154595606	154595606	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr7:154595606C>G	ENST00000377770.3	+	14	1581	c.1440C>G	c.(1438-1440)atC>atG	p.I480M	DPP6_ENST00000332007.3_Missense_Mutation_p.I418M|DPP6_ENST00000404039.1_Missense_Mutation_p.I416M|DPP6_ENST00000427557.1_Missense_Mutation_p.I373M			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	480					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)	p.I416M(1)		NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TCCAGTCCATCACCTCCGGGG	0.567																																					p.I416M	NSCLC(125;1384 1783 2490 7422 34254)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1248G	7						.						72.0	77.0	75.0					7																	154595606		2079	4208	6287	154226539	SO:0001583	missense	1804	exon14			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1440C>G	7.37:g.154595606C>G	ENSP00000367001:p.Ile480Met	Somatic		Capture	Illumina HiSeq	Phase_I	154226539	NM_001039350		Missense_Mutation	SNP	ENST00000377770.3	37		.	.	.	.	.	.	.	.	.	.	C	15.13	2.741460	0.49151	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.29	3.47	0.39725	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.361435	0.32041	N	0.006670	T	0.53802	0.1819	M	0.81341	2.54	0.34887	D	0.745174	P;P;D;D	0.55800	0.91;0.955;0.973;0.964	P;P;D;D	0.65233	0.873;0.864;0.933;0.916	T	0.63743	-0.6568	10	0.87932	D	0	-26.74	4.883	0.13688	0.0:0.5579:0.151:0.2911	.	373;418;480;416	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	M	416;480;418;373	ENSP00000385578:I416M;ENSP00000367001:I480M;ENSP00000328226:I418M;ENSP00000397303:I373M	ENSP00000328226:I418M	I	+	3	3	DPP6	154226539	0.983000	0.35010	1.000000	0.80357	0.964000	0.63967	0.184000	0.16939	0.592000	0.29728	-0.140000	0.14226	ATC		0.567	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
DFNA5	1687	broad.mit.edu	37	7	24738730	24738730	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr7:24738730A>T	ENST00000342947.3	-	10	1831	c.1406T>A	c.(1405-1407)gTc>gAc	p.V469D	DFNA5_ENST00000419307.1_Missense_Mutation_p.V305D|DFNA5_ENST00000409970.1_Missense_Mutation_p.V305D|DFNA5_ENST00000409775.3_Missense_Mutation_p.V469D|DFNA5_ENST00000545231.1_Missense_Mutation_p.V305D	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	469					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)		p.V469D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						CTTCAGAATGACAGCTTTCAC	0.438																																					p.V469D	GBM(78;184 1250 20134 20900 23600)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1406A	7						.						105.0	97.0	100.0					7																	24738730		2203	4300	6503	24705255	SO:0001583	missense	1687	exon10			AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.1406T>A	7.37:g.24738730A>T	ENSP00000339587:p.Val469Asp	Somatic		Capture	Illumina HiSeq	Phase_I	24705255	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	37	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.601581	0.87055	.	.	ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775	T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87	5.44	-6.83	0.01693	.	1.337930	0.04380	N	0.360665	T	0.24431	0.0592	L	0.57536	1.79	0.09310	N	0.999997	P	0.39352	0.669	B	0.40636	0.335	T	0.44802	-0.9304	10	0.48119	T	0.1	0.1281	6.7949	0.23719	0.3105:0.3444:0.3451:0.0	.	469	O60443	DFNA5_HUMAN	D	469;305;305;305;469	ENSP00000339587:V469D;ENSP00000401332:V305D;ENSP00000442661:V305D;ENSP00000387119:V305D;ENSP00000386670:V469D	ENSP00000339587:V469D	V	-	2	0	DFNA5	24705255	0.000000	0.05858	0.000000	0.03702	0.738000	0.42128	-0.499000	0.06413	-0.807000	0.04393	0.528000	0.53228	GTC		0.438	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
ZP3	7784	broad.mit.edu	37	7	76054410	76054411	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr7:76054410_76054411GG>TT	ENST00000394857.3	+	1	187_188	c.129_130GG>TT	c.(127-132)ctGGtg>ctTTtg	p.V44L	ZP3_ENST00000336517.4_5'UTR	NM_001110354.1	NP_001103824.1	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 (sperm receptor)	44					binding of sperm to zona pellucida (GO:0007339)|blastocyst formation (GO:0001825)|calcium ion transmembrane transport (GO:0070588)|egg coat formation (GO:0035803)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|negative regulation of transcription, DNA-templated (GO:0045892)|oocyte development (GO:0048599)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of acrosomal vesicle exocytosis (GO:2000368)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of antral ovarian follicle growth (GO:2000388)|positive regulation of calcium ion import (GO:0090280)|positive regulation of humoral immune response (GO:0002922)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of ovarian follicle development (GO:2000386)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type IV hypersensitivity (GO:0001809)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|outer acrosomal membrane (GO:0002081)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|carbohydrate binding (GO:0030246)|manganese ion transmembrane transporter activity (GO:0005384)|signal transducer activity (GO:0004871)|store-operated calcium channel activity (GO:0015279)	p.L43>?(1)		endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7						AGCCCGTACTGGTGGAGTGTCA	0.614																																					.												.	.	1	Complex(1)	large_intestine(1)	c.129_130TT	7						.																																			75892347	SO:0001583	missense	7784	exon1			M60504	CCDS5586.1, CCDS47618.1	7q11.23	2014-07-04	2002-09-17	2002-09-20	ENSG00000188372	ENSG00000188372		"""Zona pellucida glycoproteins"""	13189	protein-coding gene	gene with protein product		182889	"""zona pellucida glycoprotein 3A (sperm receptor)"""	ZP3A, ZP3B		1478648	Standard	NM_007155		Approved	ZP3-424, ZP3-372, ZPC	uc003ufd.4	P21754	OTTHUMG00000130575	Exception_encountered	7.37:g.76054410_76054411delinsTT	ENSP00000378326:p.Val44Leu	Somatic		Capture	Illumina HiSeq	Phase_I	75892346	NM_001110354	Q06633|Q29RW0	Missense_Mutation	DNP	ENST00000394857.3	37	CCDS47618.1																																																																																				0.614	ZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253004.1		
C7orf62	219557	broad.mit.edu	37	7	88423875	88423875	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr7:88423875G>A	ENST00000297203.2	-	2	567	c.382C>T	c.(382-384)Caa>Taa	p.Q128*	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	128								p.Q128*(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						ATTTTCATTTGTTGAATAAAA	0.343																																					p.Q128X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C382T	7						.						50.0	52.0	51.0					7																	88423875		2203	4300	6503	88261811	SO:0001587	stop_gained	219557	exon2			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.382C>T	7.37:g.88423875G>A	ENSP00000297203:p.Gln128*	Somatic		Capture	Illumina HiSeq	Phase_I	88261811	NM_152706		Nonsense_Mutation	SNP	ENST00000297203.2	37	CCDS34678.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872326	0.51695	.	.	ENSG00000164645	ENST00000297203	.	.	.	6.06	-0.432	0.12291	.	1.102130	0.06786	N	0.786227	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-14.2566	4.6879	0.12767	0.0:0.3244:0.2938:0.3818	.	.	.	.	X	128	.	ENSP00000297203:Q128X	Q	-	1	0	C7orf62	88261811	0.020000	0.18652	0.003000	0.11579	0.284000	0.27059	0.247000	0.18179	-0.382000	0.07870	-0.841000	0.03054	CAA		0.343	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332714.1	NM_152706	
UBE3C	9690	broad.mit.edu	37	7	157000105	157000105	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr7:157000105T>G	ENST00000348165.5	+	12	1792	c.1432T>G	c.(1432-1434)Ttg>Gtg	p.L478V		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	478					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.L478V(1)		central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TATGGTACCGTTGCTTCAGGT	0.333																																					p.L478V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1432G	7						.						163.0	160.0	161.0					7																	157000105		2203	4300	6503	156692866	SO:0001583	missense	9690	exon12			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.1432T>G	7.37:g.157000105T>G	ENSP00000309198:p.Leu478Val	Somatic		Capture	Illumina HiSeq	Phase_I	156692866	NM_014671	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	37	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	T	12.13	1.846112	0.32606	.	.	ENSG00000009335	ENST00000348165	T	0.52754	0.65	5.26	-3.15	0.05233	.	0.000000	0.85682	D	0.000000	T	0.58481	0.2125	M	0.71581	2.175	0.80722	D	1	D;D	0.71674	0.973;0.998	P;D	0.65233	0.729;0.933	T	0.59883	-0.7370	10	0.25751	T	0.34	.	14.0526	0.64747	0.0:0.7089:0.0:0.2911	.	478;478	Q15386;Q15386-2	UBE3C_HUMAN;.	V	478	ENSP00000309198:L478V	ENSP00000309198:L478V	L	+	1	2	UBE3C	156692866	0.068000	0.21057	0.027000	0.17364	0.200000	0.23975	0.450000	0.21762	-0.567000	0.06046	-0.290000	0.09829	TTG		0.333	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671	
RIMS2	9699	broad.mit.edu	37	8	104948865	104948865	+	Missense_Mutation	SNP	G	G	A	rs538104363		TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr8:104948865G>A	ENST00000436393.2	+	11	2037	c.1796G>A	c.(1795-1797)cGa>cAa	p.R599Q	RIMS2_ENST00000507740.1_Missense_Mutation_p.R613Q|RIMS2_ENST00000262231.10_Missense_Mutation_p.R660Q|RIMS2_ENST00000406091.3_Missense_Mutation_p.R821Q			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	883					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.R613Q(3)|p.R888Q(3)|p.R599Q(3)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCAGTCCACCGAAGAGAATTT	0.388										HNSCC(12;0.0054)			G|||	1	0.000199681	0.0	0.0014	5008	,	,		14846	0.0		0.0	False		,,,				2504	0.0				p.R821Q												.	.	9	Substitution - Missense(9)	large_intestine(6)|central_nervous_system(3)	c.G2462A	8						.						125.0	117.0	120.0					8																	104948865		1848	4088	5936	105018041	SO:0001583	missense	9699	exon13			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1796G>A	8.37:g.104948865G>A	ENSP00000390665:p.Arg599Gln	Somatic		Capture	Illumina HiSeq	Phase_I	105018041	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	G	24.1	4.489179	0.84962	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	4.69	4.69	0.59074	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	D	0.83820	0.5337	L	0.41492	1.28	0.80722	D	1	P;P;D;B;B;B	0.69078	0.506;0.672;0.997;0.282;0.155;0.428	B;B;D;B;B;B	0.78314	0.115;0.13;0.991;0.07;0.07;0.07	D	0.85442	0.1155	9	0.59425	D	0.04	.	17.9807	0.89140	0.0:0.0:1.0:0.0	.	883;883;599;660;613;821	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	Q	821;836;821;883;613;660;613;613;599	ENSP00000427018:R821Q;ENSP00000384892:R821Q;ENSP00000425205:R613Q;ENSP00000262231:R660Q;ENSP00000423559:R613Q;ENSP00000386228:R613Q;ENSP00000390665:R599Q	ENSP00000262231:R660Q	R	+	2	0	RIMS2	105018041	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.751000	0.98889	2.309000	0.77851	0.467000	0.42956	CGA		0.388	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
OXR1	55074	broad.mit.edu	37	8	107752641	107752641	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr8:107752641G>C	ENST00000442977.2	+	13	2336	c.2237G>C	c.(2236-2238)gGc>gCc	p.G746A	OXR1_ENST00000297447.6_Missense_Mutation_p.G115A|OXR1_ENST00000452423.2_Missense_Mutation_p.G166A|OXR1_ENST00000312046.6_Missense_Mutation_p.G711A|OXR1_ENST00000449762.2_Missense_Mutation_p.G88A|OXR1_ENST00000445937.1_Missense_Mutation_p.G718A|OXR1_ENST00000521592.1_5'UTR|OXR1_ENST00000531443.1_Missense_Mutation_p.G718A|OXR1_ENST00000517566.2_Missense_Mutation_p.G745A	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	746	TLD.				adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)	p.G746A(1)|p.G115A(1)|p.G630A(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			GGAAAACATGGCACAAGCTTG	0.398																																					p.G88A												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G263C	8						.						146.0	131.0	136.0					8																	107752641		2203	4300	6503	107821817	SO:0001583	missense	55074	exon3			AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.2237G>C	8.37:g.107752641G>C	ENSP00000405424:p.Gly746Ala	Somatic		Capture	Illumina HiSeq	Phase_I	107821817	NM_001198535	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	ENST00000442977.2	37	CCDS56548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.856812|4.856812	0.91433|0.91433	.|.	.|.	ENSG00000164830|ENSG00000164830	ENST00000519415|ENST00000445937;ENST00000531443;ENST00000517566;ENST00000452423;ENST00000442977;ENST00000312046;ENST00000449762;ENST00000297447	.|T;T;T;T;T;T;T;T	.|0.60672	.|0.17;0.17;0.17;0.17;0.17;0.17;0.17;0.17	5.48|5.48	5.48|5.48	0.80851|0.80851	.|TLDc (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.86372|0.86372	0.5917|0.5917	H|H	0.98577|0.98577	4.27|4.27	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0;0.999;1.0	D|D	0.91661|0.91661	0.5342|0.5342	5|10	.|0.87932	.|D	.|0	-9.9325|-9.9325	19.3542|19.3542	0.94404|0.94404	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|711;746;745;88;115;718	.|Q8N573-2;Q8N573;D3HIS6;B7Z8N5;Q8N573-4;Q8N573-5	.|.;OXR1_HUMAN;.;.;.;.	P|A	390|718;718;745;166;746;711;88;115	.|ENSP00000402918:G718A;ENSP00000431966:G718A;ENSP00000429205:G745A;ENSP00000395032:G166A;ENSP00000405424:G746A;ENSP00000311026:G711A;ENSP00000408659:G88A;ENSP00000297447:G115A	.|ENSP00000297447:G115A	A|G	+|+	1|2	0|0	OXR1|OXR1	107821817|107821817	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.869000|9.869000	0.99810|0.99810	2.554000|2.554000	0.86153|0.86153	0.655000|0.655000	0.94253|0.94253	GCA|GGC		0.398	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
ZFHX4	79776	broad.mit.edu	37	8	77690619	77690619	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr8:77690619A>G	ENST00000521891.2	+	4	3717	c.3269A>G	c.(3268-3270)gAg>gGg	p.E1090G	ZFHX4_ENST00000518282.1_Missense_Mutation_p.E1064G|ZFHX4_ENST00000517683.1_3'UTR|ZFHX4_ENST00000050961.6_Missense_Mutation_p.E1064G|ZFHX4_ENST00000455469.2_Missense_Mutation_p.E1064G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1064					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.E1090G(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTGGCACCAGAGGAGGACAAC	0.527										HNSCC(33;0.089)																											p.E1090G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3269G	8						.						135.0	144.0	141.0					8																	77690619		2039	4187	6226	77853174	SO:0001583	missense	79776	exon4				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3269A>G	8.37:g.77690619A>G	ENSP00000430497:p.Glu1090Gly	Somatic		Capture	Illumina HiSeq	Phase_I	77853174	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	12.67	2.007099	0.35415	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.22	5.22	0.72569	.	0.000000	0.44902	U	0.000420	T	0.47619	0.1455	L	0.54323	1.7	0.58432	D	0.999996	P;P;P	0.38504	0.501;0.634;0.634	B;B;B	0.39379	0.156;0.23;0.298	T	0.51180	-0.8738	10	0.52906	T	0.07	.	15.5609	0.76244	1.0:0.0:0.0:0.0	.	1064;1064;1090	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	G	1090;1090;1064;1064;1064	ENSP00000430497:E1090G;ENSP00000399605:E1064G;ENSP00000050961:E1064G;ENSP00000430848:E1064G	ENSP00000050961:E1064G	E	+	2	0	ZFHX4	77853174	1.000000	0.71417	0.990000	0.47175	0.923000	0.55619	7.086000	0.76885	2.320000	0.78422	0.528000	0.53228	GAG		0.527	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
COL22A1	169044	broad.mit.edu	37	8	139890171	139890171	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr8:139890171G>T	ENST00000303045.6	-	3	926	c.480C>A	c.(478-480)gaC>gaA	p.D160E	COL22A1_ENST00000435777.1_Missense_Mutation_p.D160E	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	160	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.D160E(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCGCCGCGGCGTCCAGCACCA	0.716										HNSCC(7;0.00092)																											p.D160E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C480A	8						.						9.0	11.0	11.0					8																	139890171		2172	4240	6412	139959353	SO:0001583	missense	169044	exon3			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.480C>A	8.37:g.139890171G>T	ENSP00000303153:p.Asp160Glu	Somatic		Capture	Illumina HiSeq	Phase_I	139959353	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.672679	0.47781	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.82803	-1.65;-1.65	5.3	-5.08	0.02929	von Willebrand factor, type A (3);	1.018610	0.07877	N	0.968898	T	0.57242	0.2040	N	0.05592	-0.015	0.27613	N	0.948608	B	0.11235	0.004	B	0.15052	0.012	T	0.44772	-0.9306	9	.	.	.	.	1.4837	0.02442	0.4368:0.1064:0.1375:0.3193	.	160	Q8NFW1	COMA1_HUMAN	E	160	ENSP00000303153:D160E;ENSP00000387655:D160E	.	D	-	3	2	COL22A1	139959353	0.309000	0.24518	0.876000	0.34364	0.893000	0.52053	-0.289000	0.08365	-0.630000	0.05567	-0.137000	0.14449	GAC		0.716	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
KIAA2026	158358	broad.mit.edu	37	9	5929076	5929076	+	Silent	SNP	T	T	C			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr9:5929076T>C	ENST00000399933.3	-	6	2465	c.2466A>G	c.(2464-2466)gaA>gaG	p.E822E	KIAA2026_ENST00000381461.2_Silent_p.E792E	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	822								p.E822E(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TTAACTTTGGTTCCCATGGCA	0.303																																					p.E822E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2466G	9						.						89.0	87.0	88.0					9																	5929076		1818	4083	5901	5919076	SO:0001819	synonymous_variant	158358	exon6			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2466A>G	9.37:g.5929076T>C		Somatic		Capture	Illumina HiSeq	Phase_I	5919076	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37																																																																																					0.303	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
KIAA1045	23349	broad.mit.edu	37	9	34972435	34972435	+	Silent	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr9:34972435C>T	ENST00000242315.3	+	3	553	c.471C>T	c.(469-471)ggC>ggT	p.G157G	KIAA1045_ENST00000544237.1_Silent_p.G157G|KIAA1045_ENST00000476115.2_3'UTR	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	157							metal ion binding (GO:0046872)	p.G157G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			TCCATGATGGCTGCCTGCGCC	0.567																																					p.G157G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C471T	9						.						116.0	124.0	121.0					9																	34972435		2067	4223	6290	34962435	SO:0001819	synonymous_variant	23349	exon3			AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.471C>T	9.37:g.34972435C>T		Somatic		Capture	Illumina HiSeq	Phase_I	34962435	NM_015297	B7Z253|Q58FE9|Q5T662	Silent	SNP	ENST00000242315.3	37	CCDS43796.1																																																																																				0.567	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	XM_048592	
RUSC2	9853	broad.mit.edu	37	9	35555083	35555083	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr9:35555083C>G	ENST00000455600.1	+	3	2610	c.2041C>G	c.(2041-2043)Ctt>Gtt	p.L681V		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	681						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)	p.L681V(1)		NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CCGACCAGTCCTTCGCTACAG	0.577																																					p.L681V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2041G	9						.						90.0	90.0	90.0					9																	35555083		2203	4300	6503	35545083	SO:0001583	missense	9853	exon3			AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.2041C>G	9.37:g.35555083C>G	ENSP00000393922:p.Leu681Val	Somatic		Capture	Illumina HiSeq	Phase_I	35545083	NM_014806	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	37	CCDS35008.1	.	.	.	.	.	.	.	.	.	.	C	5.691	0.312012	0.10789	.	.	ENSG00000198853	ENST00000361226;ENST00000455600;ENST00000543478	T;T	0.20332	2.08;2.08	4.72	3.74	0.42951	.	0.072513	0.52532	D	0.000061	T	0.07954	0.0199	N	0.08118	0	0.33839	D	0.631238	B	0.06786	0.001	B	0.04013	0.001	T	0.23013	-1.0200	10	0.06891	T	0.86	-11.1843	6.9705	0.24646	0.0:0.6241:0.2762:0.0996	.	681	Q8N2Y8	RUSC2_HUMAN	V	681	ENSP00000355177:L681V;ENSP00000393922:L681V	ENSP00000355177:L681V	L	+	1	0	RUSC2	35545083	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.202000	0.42743	2.317000	0.78254	0.563000	0.77884	CTT		0.577	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
CORO2A	7464	broad.mit.edu	37	9	100894538	100894538	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr9:100894538C>G	ENST00000343933.5	-	6	951	c.694G>C	c.(694-696)Ggg>Cgg	p.G232R	CORO2A_ENST00000375077.4_Missense_Mutation_p.G232R	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	232					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)	p.G232R(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				TTCAGGTTCCCCAGAAACAGC	0.617																																					p.G232R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G694C	9						.						107.0	91.0	97.0					9																	100894538		2203	4300	6503	99934359	SO:0001583	missense	7464	exon6			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.694G>C	9.37:g.100894538C>G	ENSP00000343746:p.Gly232Arg	Somatic		Capture	Illumina HiSeq	Phase_I	99934359	NM_003389	Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	ENST00000343933.5	37	CCDS6735.1	.	.	.	.	.	.	.	.	.	.	C	19.01	3.743482	0.69418	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	T;T	0.06687	3.27;3.27	4.92	4.03	0.46877	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.26702	0.0653	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.01456	-1.1350	10	0.46703	T	0.11	-32.9304	12.6933	0.56988	0.0:0.9182:0.0:0.0818	.	232	Q92828	COR2A_HUMAN	R	232	ENSP00000343746:G232R;ENSP00000364218:G232R	ENSP00000343746:G232R	G	-	1	0	CORO2A	99934359	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.835000	0.69368	1.432000	0.47375	0.655000	0.94253	GGG		0.617	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053357.1	NM_003389	
SMC2	10592	broad.mit.edu	37	9	106892090	106892090	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr9:106892090G>A	ENST00000286398.7	+	21	3243	c.2955G>A	c.(2953-2955)atG>atA	p.M985I	SMC2_ENST00000374793.3_Missense_Mutation_p.M985I|SMC2_ENST00000303219.8_Missense_Mutation_p.M985I|SMC2_ENST00000374787.3_Missense_Mutation_p.M985I	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	985					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.M985I(1)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						ATGTCAATATGAGAGCTATGA	0.378																																					p.M985I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2955A	9						.						81.0	78.0	79.0					9																	106892090		2203	4300	6503	105931911	SO:0001583	missense	10592	exon21			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.2955G>A	9.37:g.106892090G>A	ENSP00000286398:p.Met985Ile	Somatic		Capture	Illumina HiSeq	Phase_I	105931911	NM_006444	Q6IEE0|Q9P1P2	Missense_Mutation	SNP	ENST00000286398.7	37	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930236	0.52866	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000374787	T;T;T;T	0.06218	3.33;3.33;3.33;3.33	6.06	6.06	0.98353	RecF/RecN/SMC (1);	0.226624	0.50627	D	0.000107	T	0.09468	0.0233	L	0.59912	1.85	0.40662	D	0.982134	B	0.16603	0.018	B	0.19946	0.027	T	0.18116	-1.0347	10	0.19590	T	0.45	-12.2097	15.5697	0.76323	0.0:0.1381:0.8619:0.0	.	985	O95347	SMC2_HUMAN	I	985	ENSP00000286398:M985I;ENSP00000363925:M985I;ENSP00000306152:M985I;ENSP00000363919:M985I	ENSP00000286398:M985I	M	+	3	0	SMC2	105931911	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.126000	0.64721	2.882000	0.98803	0.655000	0.94253	ATG		0.378	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1		
ZBTB26	57684	broad.mit.edu	37	9	125681542	125681542	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr9:125681542delA	ENST00000373656.3	-	2	745	c.672delT	c.(670-672)actfs	p.T224fs	ZBTB26_ENST00000373654.1_Frame_Shift_Del_p.T224fs	NM_020924.2	NP_065975.1	Q9HCK0	ZBT26_HUMAN	zinc finger and BTB domain containing 26	224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V225fs*5(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)	11						TGTTTTCCACAGTTGAATTTA	0.383																																					p.T224fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.672delT	9						.						142.0	125.0	131.0					9																	125681542		2203	4300	6503	124721363	SO:0001589	frameshift_variant	57684	exon2			AB046792	CCDS6847.1	9q34.11	2013-01-08	2004-04-15	2004-04-16	ENSG00000171448	ENSG00000171448		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23383	protein-coding gene	gene with protein product			"""zinc finger protein 481"""	ZNF481			Standard	NM_020924		Approved		uc004bnk.3	Q9HCK0	OTTHUMG00000020627	ENST00000373656.3:c.672delT	9.37:g.125681542delA	ENSP00000362760:p.Thr224fs	Somatic		Capture	Illumina HiSeq	Phase_I	124721363	NM_020924	B3KQ53|Q8WTR1	Frame_Shift_Del	DEL	ENST00000373656.3	37	CCDS6847.1																																																																																				0.383	ZBTB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053960.1	NM_020924	
CTSL3P	392360	broad.mit.edu	37	9	90388431	90388431	+	RNA	SNP	G	G	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chr9:90388431G>A	ENST00000354530.2	+	0	297					NR_027917.1		Q5NE16	CATL3_HUMAN	cathepsin L family member 3, pseudogene								cysteine-type peptidase activity (GO:0008234)	p.Q99Q(1)									TGAGTGTGCAGACCTGGTGGA	0.458																																					.												.	.	1	Substitution - coding silent(1)	large_intestine(1)	.	9						.						146.0	136.0	139.0					9																	90388431		2203	4300	6503	89578251			392360	.			AJ851862		9q21.33	2013-01-07	2013-01-07	2013-01-07	ENSG00000188029	ENSG00000188029		"""Cathepsins"""	33132	pseudogene	pseudogene			"""cathepsin L family member 3"""	CTSL3		19663681	Standard	NR_027917		Approved	HCTSL-s	uc004apm.1	Q5NE16	OTTHUMG00000020152		9.37:g.90388431G>A		Somatic		Capture	Illumina HiSeq	Phase_I	89578251	.		Silent	SNP	ENST00000354530.2	37																																																																																					0.458	CTSL3P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000356542.1	NR_027917	
ACSL4	2182	broad.mit.edu	37	X	108902682	108902682	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chrX:108902682C>T	ENST00000469796.2	-	15	2275	c.1879G>A	c.(1879-1881)Gca>Aca	p.A627T	ACSL4_ENST00000340800.2_Missense_Mutation_p.A627T|ACSL4_ENST00000348502.6_Missense_Mutation_p.A586T			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	627					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.A627T(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	TTCTGTTGTGCCAAAAGTGTC	0.368																																					p.A586T	Pancreas(188;358 2127 38547 41466 45492)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1756A	X						.						139.0	125.0	130.0					X																	108902682		2203	4300	6503	108789338	SO:0001583	missense	2182	exon15			BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.1879G>A	X.37:g.108902682C>T	ENSP00000419171:p.Ala627Thr	Somatic		Capture	Illumina HiSeq	Phase_I	108789338	NM_004458	D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	ENST00000469796.2	37	CCDS14548.1	.	.	.	.	.	.	.	.	.	.	C	32	5.181657	0.94885	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.25749	1.78;1.78;1.78	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.60702	0.2289	M	0.93808	3.46	0.80722	D	1	D	0.64830	0.994	P	0.62435	0.902	T	0.73251	-0.4042	10	0.72032	D	0.01	-15.4228	18.1689	0.89737	0.0:1.0:0.0:0.0	.	627	O60488	ACSL4_HUMAN	T	586;627;627	ENSP00000262835:A586T;ENSP00000419171:A627T;ENSP00000339787:A627T	ENSP00000339787:A627T	A	-	1	0	ACSL4	108789338	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.776000	0.85560	2.314000	0.78098	0.523000	0.50628	GCA		0.368	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2	NM_004458	
SLC6A14	11254	broad.mit.edu	37	X	115578013	115578013	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chrX:115578013C>A	ENST00000371900.4	+	7	984	c.896C>A	c.(895-897)gCc>gAc	p.A299D		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	299					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)	p.A299D(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TATATTGGAGCCCAGTCAAAT	0.378																																					p.A299D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C896A	X						.						85.0	84.0	84.0					X																	115578013		2203	4300	6503	115492041	SO:0001583	missense	11254	exon7			AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.896C>A	X.37:g.115578013C>A	ENSP00000360967:p.Ala299Asp	Somatic		Capture	Illumina HiSeq	Phase_I	115492041	NM_007231	Q5H942	Missense_Mutation	SNP	ENST00000371900.4	37	CCDS14570.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.881016	0.33255	.	.	ENSG00000087916	ENST00000371900	T	0.73258	-0.73	5.62	3.63	0.41609	.	0.631991	0.16700	N	0.203152	T	0.59032	0.2164	L	0.34521	1.04	0.09310	N	0.999997	B	0.24675	0.109	B	0.27380	0.079	T	0.55496	-0.8132	10	0.72032	D	0.01	.	8.3859	0.32499	0.21:0.6531:0.1369:0.0	.	299	Q9UN76	S6A14_HUMAN	D	299	ENSP00000360967:A299D	ENSP00000360967:A299D	A	+	2	0	SLC6A14	115492041	0.024000	0.19004	0.798000	0.32154	0.581000	0.36288	0.892000	0.28322	1.096000	0.41439	0.544000	0.68410	GCC		0.378	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		
ZBED1	9189	broad.mit.edu	37	X	2408076	2408076	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chrX:2408076C>A	ENST00000381223.4	-	2	888	c.685G>T	c.(685-687)Ggc>Tgc	p.G229C	ZBED1_ENST00000381218.3_Missense_Mutation_p.G229C|DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000515319.1_5'Flank|ZBED1_ENST00000381222.2_Missense_Mutation_p.G229C	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	229					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)	p.G229C(1)		endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAGCGGGAGCCCATGGACAGG	0.637																																					p.G229C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G685T	X						.						89.0	96.0	94.0					X																	2408076		2203	4296	6499	2418076	SO:0001583	missense	9189	exon2			AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.685G>T	X.37:g.2408076C>A	ENSP00000370621:p.Gly229Cys	Somatic		Capture	Illumina HiSeq	Phase_I	2418076	NM_004729	Q96BY4	Missense_Mutation	SNP	ENST00000381223.4	37	CCDS14118.1	.	.	.	.	.	.	.	.	.	.	C	0.914	-0.718188	0.03182	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218;ENST00000461691	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	3.21	0.783	0.18572	Ribonuclease H-like (1);	4.111700	0.01743	U	0.029507	T	0.12902	0.0313	.	.	.	0.09310	N	1	P	0.40619	0.724	B	0.30943	0.122	T	0.22208	-1.0223	9	0.39692	T	0.17	-26.1706	6.0323	0.19686	0.0:0.3969:0.0:0.6031	.	229	O96006	ZBED1_HUMAN	C	229	ENSP00000370621:G229C;ENSP00000370620:G229C;ENSP00000370616:G229C;ENSP00000419148:G229C	ENSP00000370616:G229C	G	-	1	0	ZBED1	2418076	0.004000	0.15560	0.000000	0.03702	0.064000	0.16182	0.220000	0.17660	0.263000	0.21812	0.519000	0.50382	GGC		0.637	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144310.3	NM_004729	
AP1S2	8905	broad.mit.edu	37	X	15845474	15845474	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chrX:15845474C>T	ENST00000329235.2	-	5	691	c.448G>A	c.(448-450)Gtt>Att	p.V150I		NM_001272071.1|NM_003916.3	NP_001259000.1|NP_003907.3	P56377	AP1S2_HUMAN	adaptor-related protein complex 1, sigma 2 subunit	150					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|coated pit (GO:0005905)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein transporter activity (GO:0008565)	p.V150I(1)		large_intestine(1)	1	Hepatocellular(33;0.183)					TCTTCAAGAACACTACGTGGG	0.443																																					p.V150I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G448A	X						.						221.0	161.0	181.0					X																	15845474		2203	4300	6503	15755395	SO:0001583	missense	8905	exon5			AB015320	CCDS14173.1, CCDS75958.1	Xp22	2014-01-31			ENSG00000182287	ENSG00000182287			560	protein-coding gene	gene with protein product		300629	"""mental retardation, X-linked 59"", ""mental retardation, X-linked, syndromic 5"", ""Pettigrew X-linked mental retardation syndrome"""	MRX59, MRXS5, PGS		9733768, 17186471, 23756445	Standard	NM_003916		Approved	SIGMA1B	uc010nex.4	P56377	OTTHUMG00000021186	ENST00000329235.2:c.448G>A	X.37:g.15845474C>T	ENSP00000328789:p.Val150Ile	Somatic		Capture	Illumina HiSeq	Phase_I	15755395	NM_003916	B4DSU4|O95326|Q9H2N6	Missense_Mutation	SNP	ENST00000329235.2	37	CCDS14173.1	.	.	.	.	.	.	.	.	.	.	C	11.58	1.682105	0.29872	.	.	ENSG00000182287	ENST00000329235	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	T	0.40956	0.1138	N	0.11064	0.09	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.21211	-1.0252	8	0.22109	T	0.4	.	18.6226	0.91326	0.0:1.0:0.0:0.0	.	150;150	Q549M9;P56377	.;AP1S2_HUMAN	I	150	.	ENSP00000328789:V150I	V	-	1	0	AP1S2	15755395	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.294000	0.78760	2.342000	0.79632	0.600000	0.82982	GTT		0.443	AP1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055893.1	NM_003916	
FAM155B	27112	broad.mit.edu	37	X	68749443	68749443	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chrX:68749443G>T	ENST00000252338.4	+	3	1105	c.1063G>T	c.(1063-1065)Gaa>Taa	p.E355*		NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	355						integral component of membrane (GO:0016021)		p.E355*(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						AAAGCGTCTGGAAACCAAGTG	0.547																																					p.E355X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1063T	X						.						106.0	81.0	89.0					X																	68749443		2203	4300	6503	68666168	SO:0001587	stop_gained	27112	exon3			AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.1063G>T	X.37:g.68749443G>T	ENSP00000252338:p.Glu355*	Somatic		Capture	Illumina HiSeq	Phase_I	68666168	NM_015686	B1ALV6|B9EGK1|D3DVU1	Nonsense_Mutation	SNP	ENST00000252338.4	37	CCDS35317.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.842098	0.91197	.	.	ENSG00000130054	ENST00000252338	.	.	.	3.66	3.66	0.41972	.	0.089946	0.45867	D	0.000324	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-5.1092	12.0918	0.53730	0.0:0.0:1.0:0.0	.	.	.	.	X	355	.	ENSP00000252338:E355X	E	+	1	0	FAM155B	68666168	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.887000	0.75616	1.685000	0.51034	0.523000	0.50628	GAA		0.547	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057037.1	NM_015686	
MED12	9968	broad.mit.edu	37	X	70355013	70355013	+	Silent	SNP	C	C	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chrX:70355013C>A	ENST00000374080.3	+	36	4967	c.4935C>A	c.(4933-4935)acC>acA	p.T1645T	MED12_ENST00000333646.6_Silent_p.T1645T|MED12_ENST00000374102.1_Silent_p.T1645T			Q93074	MED12_HUMAN	mediator complex subunit 12	1645	Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.T1645T(2)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CCAAGCAGACCCGAGATGTCA	0.552			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																														p.T1645T			Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C4935A	X						.						69.0	68.0	69.0					X																	70355013		2094	4209	6303	70271738	SO:0001819	synonymous_variant	9968	exon36			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4935C>A	X.37:g.70355013C>A		Somatic		Capture	Illumina HiSeq	Phase_I	70271738	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	ENST00000374080.3	37	CCDS43970.1																																																																																				0.552	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
CUL4B	8450	broad.mit.edu	37	X	119670835	119670835	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3819-01A-01W-0900-09	TCGA-AA-3819-10A-01W-0900-09	g.chrX:119670835T>A	ENST00000404115.3	-	17	2448	c.2047A>T	c.(2047-2049)Aca>Tca	p.T683S	CUL4B_ENST00000371322.5_Missense_Mutation_p.T665S|CUL4B_ENST00000336592.6_Missense_Mutation_p.T670S	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	683					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T683S(1)|p.T665S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TAGCCCATTGTCAGGATATTC	0.373																																					p.T665S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1993T	X						.						137.0	118.0	124.0					X																	119670835		2203	4300	6503	119554863	SO:0001583	missense	8450	exon15			U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.2047A>T	X.37:g.119670835T>A	ENSP00000384109:p.Thr683Ser	Somatic		Capture	Illumina HiSeq	Phase_I	119554863	NM_001079872	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	ENST00000404115.3	37	CCDS35379.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.620658	0.87460	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115	T;T;T	0.71341	-0.56;-0.56;-0.56	5.84	5.84	0.93424	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	T	0.81202	0.4773	M	0.65975	2.015	0.80722	D	1	B;P;P	0.52692	0.204;0.955;0.944	B;D;P	0.63793	0.338;0.918;0.867	T	0.81070	-0.1099	9	.	.	.	-12.811	14.2676	0.66129	0.0:0.0:0.0:1.0	.	487;683;665	Q13620-3;Q13620;Q13620-1	.;CUL4B_HUMAN;.	S	665;670;683	ENSP00000360373:T665S;ENSP00000338919:T670S;ENSP00000384109:T683S	.	T	-	1	0	CUL4B	119554863	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.940000	0.87693	1.968000	0.57251	0.481000	0.45027	ACA		0.373	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058103.1	NM_003588	
