#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CNNM1	26507	broad.mit.edu	37	10	101090480	101090480	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:101090480G>A	ENST00000356713.4	+	1	1625	c.1336G>A	c.(1336-1338)Gcg>Acg	p.A446T	CNNM1_ENST00000446890.1_Missense_Mutation_p.A375T|CNNM1_ENST00000370534.4_Missense_Mutation_p.A81T|CNNM1_ENST00000370528.3_Missense_Mutation_p.A375T	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	446	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.A81T(1)|p.A446T(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		GCGCTCAGACGCGGTGCTCGA	0.602																																					p.A446T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1336A	10						.						79.0	66.0	70.0					10																	101090480		2203	4300	6503	101080470	SO:0001583	missense	26507	exon1			AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.1336G>A	10.37:g.101090480G>A	ENSP00000349147:p.Ala446Thr	Somatic		Capture	Illumina HiSeq	Phase_I	101080470	NM_020348	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	37	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	G	16.94	3.259495	0.59321	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528;ENST00000370534	T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97	4.83	4.83	0.62350	Cystathionine beta-synthase, core (1);	0.121840	0.53938	D	0.000050	T	0.72510	0.3469	L	0.33624	1.015	0.80722	D	1	B;P;B;B	0.50819	0.192;0.939;0.248;0.448	B;P;B;B	0.50314	0.082;0.637;0.169;0.026	T	0.69957	-0.5004	10	0.27082	T	0.32	-21.9989	17.7065	0.88310	0.0:0.0:1.0:0.0	.	81;446;81;446	F5H5J0;Q9NRU3-2;B7Z5S3;Q9NRU3	.;.;.;CNNM1_HUMAN	T	446;375;375;81	ENSP00000349147:A446T;ENSP00000406492:A375T;ENSP00000359559:A375T;ENSP00000359565:A81T	ENSP00000349147:A446T	A	+	1	0	CNNM1	101080470	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	9.651000	0.98493	2.517000	0.84864	0.462000	0.41574	GCG		0.602	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348	
DNMBP	23268	broad.mit.edu	37	10	101715699	101715699	+	Missense_Mutation	SNP	G	G	A	rs199965546		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:101715699G>A	ENST00000324109.4	-	4	1623	c.1532C>T	c.(1531-1533)aCg>aTg	p.T511M	DNMBP-AS1_ENST00000434409.1_RNA|DNMBP_ENST00000342239.3_Missense_Mutation_p.T511M	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	511					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T511M(1)		central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		AACACTGGACGTGTGGTGCTT	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18601	0.0		0.0	False		,,,				2504	0.0				p.T511M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1532T	10						.						107.0	108.0	108.0					10																	101715699		2203	4300	6503	101705689	SO:0001583	missense	23268	exon4			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.1532C>T	10.37:g.101715699G>A	ENSP00000315659:p.Thr511Met	Somatic		Capture	Illumina HiSeq	Phase_I	101705689	NM_015221	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	37	CCDS7485.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	10.56	1.383611	0.25031	.	.	ENSG00000107554	ENST00000342239;ENST00000324109	T;T	0.12774	2.71;2.65	5.92	0.77	0.18497	.	1.325690	0.05101	N	0.487230	T	0.11239	0.0274	L	0.50919	1.6	0.09310	N	1	P	0.44309	0.832	B	0.36504	0.226	T	0.25467	-1.0131	10	0.37606	T	0.19	2.3394	1.8902	0.03246	0.36:0.1212:0.3943:0.1245	.	511	Q6XZF7	DNMBP_HUMAN	M	511	ENSP00000344914:T511M;ENSP00000315659:T511M	ENSP00000315659:T511M	T	-	2	0	DNMBP	101705689	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.781000	0.26774	0.139000	0.18822	-1.077000	0.02231	ACG		0.493	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
PDZD7	79955	broad.mit.edu	37	10	102789821	102789821	+	Silent	SNP	G	G	A	rs150917752	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:102789821G>A	ENST00000370215.3	-	2	381	c.156C>T	c.(154-156)aaC>aaT	p.N52N	SFXN3_ENST00000393459.1_5'Flank|PDZD7_ENST00000470414.1_Silent_p.N52N|SFXN3_ENST00000224807.5_5'Flank	NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	52						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.N52N(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		GGGGGGGCCCGTTCAGCAGCC	0.667													G|||	10	0.00199681	0.0	0.0	5008	,	,		12945	0.0079		0.001	False		,,,				2504	0.001				p.N52N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C156T	10						.	G	,	0,4406		0,0,2203	51.0	59.0	56.0		156,156	0.2	1.0	10	dbSNP_134	56	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	PDZD7	NM_001195263.1,NM_024895.4	,	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	,	52/1034,52/518	102789821	3,13003	2203	4300	6503	102779811	SO:0001819	synonymous_variant	79955	exon2			AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.156C>T	10.37:g.102789821G>A		Somatic		Capture	Illumina HiSeq	Phase_I	102779811	NM_001195263	D5FJ77|Q8N321	Silent	SNP	ENST00000370215.3	37	CCDS31269.1																																																																																				0.667	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895	
ATRNL1	26033	broad.mit.edu	37	10	117059606	117059606	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:117059606G>A	ENST00000355044.3	+	16	2604	c.2478G>A	c.(2476-2478)atG>atA	p.M826I	ATRNL1_ENST00000423111.2_5'Flank|ATRNL1_ENST00000303745.7_5'Flank	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	826	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.M826I(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		GGGAAGACATGTCTCCTTTTA	0.443																																					p.M826I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2478A	10						.						134.0	123.0	126.0					10																	117059606		2203	4300	6503	117049596	SO:0001583	missense	26033	exon16			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2478G>A	10.37:g.117059606G>A	ENSP00000347152:p.Met826Ile	Somatic		Capture	Illumina HiSeq	Phase_I	117049596	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.855357	0.71719	.	.	ENSG00000107518	ENST00000355044	T	0.16897	2.31	5.54	5.54	0.83059	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.070420	0.85682	D	0.000000	T	0.23532	0.0569	M	0.72118	2.19	0.80722	D	1	B	0.29716	0.255	B	0.26614	0.071	T	0.03597	-1.1021	10	0.23302	T	0.38	-7.6185	19.8603	0.96781	0.0:0.0:1.0:0.0	.	826	Q5VV63	ATRN1_HUMAN	I	826	ENSP00000347152:M826I	ENSP00000347152:M826I	M	+	3	0	ATRNL1	117049596	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.539000	0.73856	2.768000	0.95171	0.650000	0.86243	ATG		0.443	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
GFRA1	2674	broad.mit.edu	37	10	118030444	118030444	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:118030444G>A	ENST00000355422.6	-	3	774	c.224C>T	c.(223-225)gCc>gTc	p.A75V	GFRA1_ENST00000490345.1_5'Flank|GFRA1_ENST00000369236.1_Missense_Mutation_p.A75V|GFRA1_ENST00000439649.3_Missense_Mutation_p.A75V	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	75					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)	p.A75V(1)		endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		GGCCTCCATGGCGCTGCGGCA	0.602																																					p.A75V	Ovarian(128;329 1725 45498 46808 50759)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C224T	10						.						72.0	68.0	69.0					10																	118030444		2203	4300	6503	118020434	SO:0001583	missense	2674	exon3			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.224C>T	10.37:g.118030444G>A	ENSP00000347591:p.Ala75Val	Somatic		Capture	Illumina HiSeq	Phase_I	118020434	NM_001145453	A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	G	19.63	3.863005	0.71949	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000369234	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	4.01	4.01	0.46588	GDNF/GAS1 (2);	0.057382	0.64402	D	0.000002	T	0.62901	0.2466	L	0.52206	1.635	0.80722	D	1	B;B	0.25441	0.126;0.121	B;B	0.27170	0.077;0.046	T	0.65001	-0.6274	10	0.49607	T	0.09	-15.4887	16.3922	0.83543	0.0:0.0:1.0:0.0	.	75;75	P56159;P56159-2	GFRA1_HUMAN;.	V	75	ENSP00000393725:A75V;ENSP00000358239:A75V;ENSP00000347591:A75V;ENSP00000358237:A75V	ENSP00000347591:A75V	A	-	2	0	GFRA1	118020434	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.500000	0.73687	2.081000	0.62600	0.549000	0.68633	GCC		0.602	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	
EIF3A	8661	broad.mit.edu	37	10	120802033	120802033	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:120802033C>T	ENST00000369144.3	-	19	3126	c.2999G>A	c.(2998-3000)cGa>cAa	p.R1000Q	EIF3A_ENST00000541549.1_Missense_Mutation_p.R966Q	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)	p.R1000Q(1)		endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		ATCGGCAATTCGTCTGGGAGG	0.572																																					p.R1000Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2999A	10						.						231.0	185.0	200.0					10																	120802033		2203	4300	6503	120792023	SO:0001583	missense	8661	exon19			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.2999G>A	10.37:g.120802033C>T	ENSP00000358140:p.Arg1000Gln	Somatic		Capture	Illumina HiSeq	Phase_I	120792023	NM_003750	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	37	CCDS7608.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.508856	0.85282	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.25085	1.86;1.82	6.17	6.17	0.99709	.	0.000000	0.33364	N	0.004995	T	0.57257	0.2041	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.978	T	0.48692	-0.9013	10	0.30854	T	0.27	-11.9842	20.8794	0.99867	0.0:1.0:0.0:0.0	.	966;1000	F5H335;Q14152	.;EIF3A_HUMAN	Q	1000;966	ENSP00000358140:R1000Q;ENSP00000438178:R966Q	ENSP00000358140:R1000Q	R	-	2	0	EIF3A	120792023	0.995000	0.38212	0.260000	0.24451	0.470000	0.32858	6.629000	0.74267	2.941000	0.99782	0.655000	0.94253	CGA		0.572	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750	
PPAPDC1A	196051	broad.mit.edu	37	10	122334705	122334705	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:122334705G>A	ENST00000398250.1	+	6	860	c.508G>A	c.(508-510)Gag>Aag	p.E170K	PPAPDC1A_ENST00000541332.1_Missense_Mutation_p.E170K|PPAPDC1A_ENST00000496437.1_3'UTR|PPAPDC1A_ENST00000398248.1_Intron|PPAPDC1A_ENST00000439221.1_Missense_Mutation_p.E107K|PPAPDC1A_ENST00000369073.3_Missense_Mutation_p.E160K	NM_001030059.1	NP_001025230.1	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain containing 1A	170					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phospholipid dephosphorylation (GO:0046839)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)	p.E170K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	20		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		CTGCTTCACCGAGAGTGGGCG	0.577																																					p.E170K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G508A	10						.																																			122324695	SO:0001583	missense	196051	exon6			AK098668	CCDS41573.1	10q26.13	2008-02-05		2005-07-15	ENSG00000203805	ENSG00000203805			23531	protein-coding gene	gene with protein product			"""phosphatidic acid phosphatase type 2 domain containing 1"""	PPAPDC1			Standard	XM_005269592		Approved		uc001lev.1	Q5VZY2	OTTHUMG00000019168	ENST00000398250.1:c.508G>A	10.37:g.122334705G>A	ENSP00000381302:p.Glu170Lys	Somatic		Capture	Illumina HiSeq	Phase_I	122324695	NM_001030059	A2RU82|Q08EQ2|Q0IIP2|Q495B4|Q5VZY1	Missense_Mutation	SNP	ENST00000398250.1	37	CCDS41573.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572924	0.45798	.	.	ENSG00000203805	ENST00000439221;ENST00000398250;ENST00000427079;ENST00000541332;ENST00000369073	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.52	5.52	0.82312	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.092240	0.64402	D	0.000001	T	0.28732	0.0712	N	0.24115	0.695	0.80722	D	1	P;D;B	0.57899	0.676;0.981;0.023	B;B;B	0.39738	0.294;0.308;0.005	T	0.09840	-1.0656	10	0.08179	T	0.78	-6.7691	19.441	0.94821	0.0:0.0:1.0:0.0	.	170;107;170	B7Z3R3;Q5VZY2-2;Q5VZY2	.;.;PPC1A_HUMAN	K	107;170;170;170;160	ENSP00000381302:E170K;ENSP00000407979:E170K;ENSP00000440493:E170K;ENSP00000358069:E160K	ENSP00000358069:E160K	E	+	1	0	PPAPDC1A	122324695	1.000000	0.71417	0.967000	0.41034	0.997000	0.91878	9.785000	0.99042	2.603000	0.88011	0.655000	0.94253	GAG		0.577	PPAPDC1A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_113641	
WDR11	55717	broad.mit.edu	37	10	122664840	122664840	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:122664840A>G	ENST00000263461.6	+	26	3449	c.3203A>G	c.(3202-3204)cAg>cGg	p.Q1068R	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0	Mediates interaction with IRS1. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.Q1068R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GAGGGCGTTCAGTTGCTCTGC	0.498																																					p.Q1068R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3203G	10						.						90.0	84.0	86.0					10																	122664840		2203	4300	6503	122654830	SO:0001583	missense	55717	exon26			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.3203A>G	10.37:g.122664840A>G	ENSP00000263461:p.Gln1068Arg	Somatic		Capture	Illumina HiSeq	Phase_I	122654830	NM_018117	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000263461.6	37	CCDS7619.1	.	.	.	.	.	.	.	.	.	.	A	18.00	3.524679	0.64747	.	.	ENSG00000120008	ENST00000263461	D	0.92397	-3.03	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.95736	0.8613	M	0.76574	2.34	0.80722	D	1	D;D;D;P	0.89917	0.987;0.987;1.0;0.956	D;D;D;B	0.74348	0.953;0.953;0.983;0.444	D	0.96035	0.9020	10	0.72032	D	0.01	-19.149	16.3756	0.83387	1.0:0.0:0.0:0.0	.	1068;1068;359;597	Q9BZH6;B2RCJ6;Q9NWV7;Q659C9	WDR11_HUMAN;.;.;.	R	1068	ENSP00000263461:Q1068R	ENSP00000263461:Q1068R	Q	+	2	0	WDR11	122654830	1.000000	0.71417	0.970000	0.41538	0.052000	0.14988	8.873000	0.92357	2.270000	0.75569	0.460000	0.39030	CAG		0.498	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2		
CHST15	51363	broad.mit.edu	37	10	125805353	125805353	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:125805353C>T	ENST00000346248.5	-	2	1018	c.376G>A	c.(376-378)Gaa>Aaa	p.E126K	CHST15_ENST00000435907.1_Missense_Mutation_p.E126K|CHST15_ENST00000421115.1_Missense_Mutation_p.E126K|CHST15_ENST00000462406.1_5'Flank	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	126					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)	p.E126K(1)		endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						CTTGGGTTTTCGCTGTCCATC	0.438																																					p.E126K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G376A	10						.						151.0	164.0	159.0					10																	125805353		2203	4300	6503	125795343	SO:0001583	missense	51363	exon2			AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.376G>A	10.37:g.125805353C>T	ENSP00000333947:p.Glu126Lys	Somatic		Capture	Illumina HiSeq	Phase_I	125795343	NM_015892	O60338|O60474|Q86VM4	Missense_Mutation	SNP	ENST00000346248.5	37	CCDS7638.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.689948	0.68271	.	.	ENSG00000182022	ENST00000346248;ENST00000435907;ENST00000434607;ENST00000546346;ENST00000421115	.	.	.	5.66	5.66	0.87406	.	0.092187	0.47093	D	0.000248	T	0.23965	0.0580	N	0.24115	0.695	0.09310	N	0.999999	P;B	0.38745	0.645;0.152	B;B	0.29598	0.104;0.011	T	0.29212	-1.0019	9	0.59425	D	0.04	-27.3415	15.2568	0.73591	0.0:0.8602:0.1398:0.0	.	126;126	Q7LFX5-2;Q7LFX5	.;CHSTF_HUMAN	K	126	.	ENSP00000333947:E126K	E	-	1	0	CHST15	125795343	0.340000	0.24792	0.075000	0.20258	0.906000	0.53458	1.880000	0.39628	2.671000	0.90904	0.555000	0.69702	GAA		0.438	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1	NM_015892	
CTBP2	1488	broad.mit.edu	37	10	126681868	126681868	+	Silent	SNP	C	C	T	rs74769610		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:126681868C>T	ENST00000337195.5	-	9	1341	c.942G>A	c.(940-942)ccG>ccA	p.P314P	CTBP2_ENST00000494626.2_Silent_p.P314P|CTBP2_ENST00000531469.1_Silent_p.P314P|CTBP2_ENST00000334808.6_Silent_p.P382P|CTBP2_ENST00000309035.6_Silent_p.P854P|CTBP2_ENST00000411419.2_Silent_p.P314P	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2	314					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)	p.P854P(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		AGATGAGATTCGGGGCATCTT	0.552																																					p.P314P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G942A	10						.						36.0	33.0	34.0					10																	126681868		2203	4300	6503	126671858	SO:0001819	synonymous_variant	1488	exon9			AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.942G>A	10.37:g.126681868C>T		Somatic		Capture	Illumina HiSeq	Phase_I	126671858	NM_001329	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	ENST00000337195.5	37	CCDS7643.1																																																																																				0.552	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
MKI67	4288	broad.mit.edu	37	10	129906252	129906252	+	Silent	SNP	C	C	T	rs141076241	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:129906252C>T	ENST00000368654.3	-	13	4227	c.3852G>A	c.(3850-3852)gcG>gcA	p.A1284A	MKI67_ENST00000368653.3_Silent_p.A924A	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1284	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.A1284A(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GATTCCTGCACGCTAAGAGTT	0.498													T|||	2	0.000399361	0.0	0.0	5008	,	,		21875	0.0		0.0	False		,,,				2504	0.002				p.A924A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2772A	10						.	T	,	0,4406		0,0,2203	263.0	247.0	253.0		2772,3852	-2.8	0.0	10	dbSNP_134	253	2,8598	819.2+/-406.8	0,2,4298	no	coding-synonymous,coding-synonymous	MKI67	NM_001145966.1,NM_002417.4	,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,	924/2897,1284/3257	129906252	2,13004	2203	4300	6503	129796242	SO:0001819	synonymous_variant	4288	exon12			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.3852G>A	10.37:g.129906252C>T		Somatic		Capture	Illumina HiSeq	Phase_I	129796242	NM_001145966	Q5VWH2	Silent	SNP	ENST00000368654.3	37	CCDS7659.1																																																																																				0.498	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
THNSL1	79896	broad.mit.edu	37	10	25313351	25313351	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:25313351G>T	ENST00000524413.1	+	3	1546	c.1199G>T	c.(1198-1200)aGg>aTg	p.R400M	THNSL1_ENST00000376356.4_Missense_Mutation_p.R400M			Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1 (S. cerevisiae)	400						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.R400M(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(5)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28					L-Threonine(DB00156)	GATAAGCAAAGGATAGCTGTG	0.388																																					p.R400M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1199T	10						.						124.0	121.0	122.0					10																	25313351		2203	4300	6503	25353357	SO:0001583	missense	79896	exon3			AK025655	CCDS7147.1	10p12.31	2008-02-05	2007-06-20		ENSG00000185875	ENSG00000185875			26160	protein-coding gene	gene with protein product		611260	"""threonine synthase-like 1 (bacterial)"""			12477932	Standard	NM_024838		Approved	FLJ22002	uc001isi.4	Q8IYQ7	OTTHUMG00000017828	ENST00000524413.1:c.1199G>T	10.37:g.25313351G>T	ENSP00000434887:p.Arg400Met	Somatic		Capture	Illumina HiSeq	Phase_I	25353357	NM_024838	B3KWL1|D3DRV3|Q5VV21	Missense_Mutation	SNP	ENST00000524413.1	37	CCDS7147.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.602825	0.46423	.	.	ENSG00000185875	ENST00000524413;ENST00000376356	T;T	0.08720	3.06;3.06	5.61	4.71	0.59529	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.054372	0.64402	D	0.000001	T	0.29093	0.0723	M	0.86651	2.83	0.38743	D	0.953932	D	0.76494	0.999	D	0.66196	0.942	T	0.15867	-1.0422	10	0.54805	T	0.06	-27.6472	9.8942	0.41309	0.0728:0.139:0.7881:0.0	.	400	Q8IYQ7	THNS1_HUMAN	M	400	ENSP00000434887:R400M;ENSP00000365534:R400M	ENSP00000365534:R400M	R	+	2	0	THNSL1	25353357	1.000000	0.71417	0.963000	0.40424	0.984000	0.73092	6.095000	0.71439	1.376000	0.46267	0.650000	0.86243	AGG		0.388	THNSL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394913.1	NM_024838	
PDSS1	23590	broad.mit.edu	37	10	27013022	27013022	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:27013022C>T	ENST00000376215.5	+	8	854	c.801C>T	c.(799-801)acC>acT	p.T267T	PDSS1_ENST00000376203.5_Silent_p.T267T	NM_014317.3	NP_055132.2	Q5T2R2	DPS1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 1	267					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)	p.T267T(1)		autonomic_ganglia(1)|endometrium(1)|kidney(7)|large_intestine(6)|lung(5)|prostate(1)	21						TCAAGAAGACCGCCAGCCTGA	0.393																																					p.T267T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C801T	10						.						84.0	77.0	80.0					10																	27013022		2203	4300	6503	27053028	SO:0001819	synonymous_variant	23590	exon8			AF118395	CCDS31168.1	10p12.2	2006-04-12	2006-02-14	2006-02-14	ENSG00000148459	ENSG00000148459			17759	protein-coding gene	gene with protein product	"""coenzyme Q1 homolog (yeast)"""	607429	"""trans-prenyltransferase"""	TPRT		10972372	Standard	NM_014317		Approved	TPT, COQ1	uc001isv.3	Q5T2R2	OTTHUMG00000017844	ENST00000376215.5:c.801C>T	10.37:g.27013022C>T		Somatic		Capture	Illumina HiSeq	Phase_I	27053028	NM_014317	Q53F75|Q6P473|Q86WQ8|Q9Y2W5	Silent	SNP	ENST00000376215.5	37	CCDS31168.1																																																																																				0.393	PDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047276.1		
LYZL2	119180	broad.mit.edu	37	10	30915162	30915162	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:30915162T>C	ENST00000375318.2	-	3	364	c.308A>G	c.(307-309)tAc>tGc	p.Y103C		NM_183058.2	NP_898881.2	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2	57					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)	p.Y103C(1)		NS(2)|central_nervous_system(1)|large_intestine(1)|lung(14)|prostate(1)	19		Prostate(175;0.151)				TGTGGTGTTGTAGCCGCTCTC	0.567																																					p.Y103C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A308G	10						.						133.0	102.0	113.0					10																	30915162		2203	4300	6503	30955168	SO:0001583	missense	119180	exon3			AF139543	CCDS7167.2	10p11.23	2009-12-04			ENSG00000151033	ENSG00000151033			29613	protein-coding gene	gene with protein product		612748					Standard	NM_183058		Approved		uc001ivk.3	Q7Z4W2	OTTHUMG00000017898	ENST00000375318.2:c.308A>G	10.37:g.30915162T>C	ENSP00000364467:p.Tyr103Cys	Somatic		Capture	Illumina HiSeq	Phase_I	30955168	NM_183058	Q6NZ69	Missense_Mutation	SNP	ENST00000375318.2	37	CCDS7167.2	.	.	.	.	.	.	.	.	.	.	T	10.52	1.374430	0.24857	.	.	ENSG00000151033	ENST00000375318	T	0.73258	-0.73	2.27	1.07	0.20283	.	0.164448	0.41194	D	0.000932	T	0.78362	0.4271	M	0.73753	2.245	0.26919	N	0.966715	D	0.76494	0.999	D	0.76071	0.987	T	0.67039	-0.5771	10	0.87932	D	0	-16.7616	4.5165	0.11937	0.2892:0.0:0.0:0.7108	.	103	Q7Z4W2-2	.	C	103	ENSP00000364467:Y103C	ENSP00000364467:Y103C	Y	-	2	0	LYZL2	30955168	1.000000	0.71417	0.478000	0.27316	0.422000	0.31414	1.264000	0.33015	0.287000	0.22375	0.254000	0.18369	TAC		0.567	LYZL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047434.1	NM_183058	
ARHGAP22	58504	broad.mit.edu	37	10	49667830	49667830	+	Missense_Mutation	SNP	G	G	A	rs372857506		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:49667830G>A	ENST00000249601.4	-	5	852	c.556C>T	c.(556-558)Cgc>Tgc	p.R186C	ARHGAP22_ENST00000417912.2_Missense_Mutation_p.R202C|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.R77C|ARHGAP22_ENST00000374170.1_Missense_Mutation_p.R96C|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.R192C|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.R96C	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	186	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.R186C(1)		endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GTGAGCCCGCGCTCCCGGATG	0.642																																					p.R186C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C556T	10						.	G	CYS/ARG	0,4406		0,0,2203	90.0	86.0	87.0		556	4.9	1.0	10		87	2,8598	2.2+/-6.3	0,2,4298	no	missense	ARHGAP22	NM_021226.2	180	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	186/699	49667830	2,13004	2203	4300	6503	49337836	SO:0001583	missense	58504	exon5			AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.556C>T	10.37:g.49667830G>A	ENSP00000249601:p.Arg186Cys	Somatic		Capture	Illumina HiSeq	Phase_I	49337836	NM_021226	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	37	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.895834	0.72639	0.0	2.33E-4	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0;2.0	4.9	4.9	0.64082	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.197876	0.43919	D	0.000508	T	0.42086	0.1187	M	0.73319	2.225	0.54753	D	0.999981	P;D;D;D;P	0.89917	0.844;1.0;1.0;1.0;0.812	P;D;D;D;B	0.71414	0.49;0.973;0.966;0.973;0.357	T	0.10730	-1.0617	10	0.33940	T	0.23	.	12.3526	0.55157	0.0:0.0:0.8316:0.1684	.	192;186;202;186;96	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3	.;.;.;RHG22_HUMAN;.	C	186;77;96;96;192;202	ENSP00000249601:R186C;ENSP00000363287:R77C;ENSP00000363285:R96C;ENSP00000410054:R96C;ENSP00000416701:R192C;ENSP00000412461:R202C	ENSP00000249601:R186C	R	-	1	0	ARHGAP22	49337836	0.993000	0.37304	0.960000	0.40013	0.679000	0.39708	3.268000	0.51585	2.565000	0.86533	0.313000	0.20887	CGC		0.642	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
TFAM	7019	broad.mit.edu	37	10	60148452	60148452	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:60148452C>T	ENST00000487519.1	+	4	840	c.314C>T	c.(313-315)gCg>gTg	p.A105V	TFAM_ENST00000373895.3_Missense_Mutation_p.A105V|TFAM_ENST00000373899.3_3'UTR	NM_001270782.1|NM_003201.2	NP_001257711.1|NP_003192.1	Q00059	TFAM_HUMAN	transcription factor A, mitochondrial	105					DNA-dependent DNA replication (GO:0006261)|gene expression (GO:0010467)|mitochondrial respiratory chain complex assembly (GO:0033108)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|mitochondrial light strand promoter sense binding (GO:0070363)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A105V(1)		kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						GCTTATAGGGCGGAGTGGCAG	0.358																																					p.A105V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C314T	10						.						104.0	122.0	116.0					10																	60148452		2203	4300	6503	59818458	SO:0001583	missense	7019	exon4			BC018628	CCDS7253.1, CCDS59217.1	10q21	2010-09-24			ENSG00000108064	ENSG00000108064			11741	protein-coding gene	gene with protein product		600438		TCF6, TCF6L2		7789991	Standard	NM_003201		Approved		uc001jkf.4	Q00059	OTTHUMG00000018270	ENST00000487519.1:c.314C>T	10.37:g.60148452C>T	ENSP00000420588:p.Ala105Val	Somatic		Capture	Illumina HiSeq	Phase_I	59818458	NM_003201	A8MRB2|A9QXC6|B5BU05|Q5U0C6	Missense_Mutation	SNP	ENST00000487519.1	37	CCDS7253.1	.	.	.	.	.	.	.	.	.	.	C	8.322	0.824579	0.16678	.	.	ENSG00000108064	ENST00000487519;ENST00000373895	D;D	0.98150	-4.75;-4.75	5.93	2.76	0.32466	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.514401	0.22641	N	0.057442	D	0.93729	0.7996	L	0.60957	1.885	0.34386	D	0.693616	P;P	0.48640	0.884;0.913	B;B	0.34652	0.187;0.068	D	0.91743	0.5406	10	0.27785	T	0.31	.	5.3218	0.15885	0.3547:0.5469:0.0:0.0984	.	105;105	A8MRB2;Q00059	.;TFAM_HUMAN	V	105	ENSP00000420588:A105V;ENSP00000363002:A105V	ENSP00000363002:A105V	A	+	2	0	TFAM	59818458	0.006000	0.16342	0.835000	0.33067	0.005000	0.04900	-0.096000	0.11059	0.749000	0.32854	0.655000	0.94253	GCG		0.358	TFAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048146.1	NM_003201	
PSAP	5660	broad.mit.edu	37	10	73574872	73574872	+	IGR	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:73574872C>A	ENST00000394936.3	-	0	2866				CDH23_ENST00000398788.3_Missense_Mutation_p.P1061H|CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000224721.6_Missense_Mutation_p.P3306H			P07602	SAP_HUMAN	prosaposin						blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)	p.P3306H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						AACAGCCTGCCCGAGGAAGAC	0.677																																					p.P1061H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3182A	10						.						16.0	24.0	22.0					10																	73574872		2148	4248	6396	73244878	SO:0001628	intergenic_variant	64072	exon23			BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429		10.37:g.73574872C>A		Somatic		Capture	Illumina HiSeq	Phase_I	73244878	NM_001171933	P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Missense_Mutation	SNP	ENST00000394936.3	37	CCDS7311.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.603364	0.87157	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	D	0.84223	-1.82	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.90345	0.6979	L	0.47716	1.5	0.80722	D	1	D;D;D;D	0.89917	0.976;1.0;1.0;1.0	P;D;D;D	0.91635	0.629;0.999;0.998;0.998	D	0.91364	0.5114	10	0.87932	D	0	.	18.6266	0.91342	0.0:1.0:0.0:0.0	.	163;198;3266;3301	Q5QGS5;Q5QGS6;E9PEX1;Q9H251	.;.;.;CAD23_HUMAN	H	3306;3266;3304;1061	ENSP00000381768:P1061H	ENSP00000224721:P3306H	P	+	2	0	CDH23	73244878	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	7.367000	0.79558	2.412000	0.81896	0.655000	0.94253	CCC		0.677	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778	
USP54	159195	broad.mit.edu	37	10	75276643	75276643	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:75276643A>G	ENST00000339859.4	-	19	3641	c.3541T>C	c.(3541-3543)Tgg>Cgg	p.W1181R	RP11-137L10.6_ENST00000595069.1_RNA|USP54_ENST00000422491.2_Missense_Mutation_p.W363R|USP54_ENST00000428547.1_Missense_Mutation_p.W1031R|USP54_ENST00000408019.1_Missense_Mutation_p.W1181R|RP11-137L10.6_ENST00000597958.1_RNA|RP11-137L10.6_ENST00000600206.1_RNA|RP11-137L10.6_ENST00000593790.1_RNA|USP54_ENST00000394811.2_Missense_Mutation_p.W269R|USP54_ENST00000497106.1_5'UTR			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1181					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)	p.W269R(1)|p.W1181R(1)		breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					GCCCATGGCCAGTGGCCTTTC	0.483																																					p.W1181R	Colon(195;880 2046 8854 25025 38456)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T3541C	10						.						151.0	157.0	155.0					10																	75276643		2203	4300	6503	74946649	SO:0001583	missense	159195	exon18			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.3541T>C	10.37:g.75276643A>G	ENSP00000345216:p.Trp1181Arg	Somatic		Capture	Illumina HiSeq	Phase_I	74946649	NM_152586	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	ENST00000339859.4	37	CCDS7329.2	.	.	.	.	.	.	.	.	.	.	A	1.295	-0.606474	0.03717	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547;ENST00000394811;ENST00000422491	T;T;T;T;T	0.24151	1.94;1.94;1.93;1.87;1.88	5.83	3.31	0.37934	.	.	.	.	.	T	0.15652	0.0377	N	0.24115	0.695	0.09310	N	0.999998	B;B	0.11235	0.004;0.001	B;B	0.12156	0.007;0.0	T	0.19418	-1.0306	9	0.59425	D	0.04	0.0542	3.7098	0.08416	0.6546:0.1373:0.0761:0.132	.	363;1181	E7EW90;Q70EL1	.;UBP54_HUMAN	R	1181;1181;1031;269;363	ENSP00000345216:W1181R;ENSP00000386080:W1181R;ENSP00000408714:W1031R;ENSP00000378290:W269R;ENSP00000407368:W363R	ENSP00000345216:W1181R	W	-	1	0	USP54	74946649	0.422000	0.25473	0.481000	0.27354	0.761000	0.43186	1.121000	0.31283	0.993000	0.38866	0.533000	0.62120	TGG		0.483	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
GRID1	2894	broad.mit.edu	37	10	87628873	87628873	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:87628873C>T	ENST00000327946.7	-	6	930	c.845G>A	c.(844-846)cGg>cAg	p.R282Q		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	282					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.R282Q(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						AAAGATTTGCCGGACCACGGT	0.537										Multiple Myeloma(13;0.14)																											p.R282Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G845A	10						.						185.0	152.0	163.0					10																	87628873		2203	4300	6503	87618853	SO:0001583	missense	2894	exon6			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.845G>A	10.37:g.87628873C>T	ENSP00000330148:p.Arg282Gln	Somatic		Capture	Illumina HiSeq	Phase_I	87618853	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	C	36	5.673254	0.96754	.	.	ENSG00000182771	ENST00000327946	D	0.83673	-1.75	5.82	5.82	0.92795	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.90038	0.6889	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.87010	0.2122	10	0.27082	T	0.32	.	19.0974	0.93258	0.0:1.0:0.0:0.0	.	282	Q9ULK0	GRID1_HUMAN	Q	282	ENSP00000330148:R282Q	ENSP00000330148:R282Q	R	-	2	0	GRID1	87618853	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.802000	0.85969	2.745000	0.94114	0.655000	0.94253	CGG		0.537	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
BMPR1A	657	broad.mit.edu	37	10	88676949	88676949	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:88676949A>G	ENST00000372037.3	+	9	1271	c.734A>G	c.(733-735)tAt>tGt	p.Y245C		NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	245	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.Y245C(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						AAAGGCCGATATGGAGAAGTA	0.428			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2																												p.Y245C	Ovarian(190;603 2086 22044 30335 47971)	yes	Rec		Juvenile polyposis	10	10q22.3	657	"""bone morphogenetic protein receptor, type IA"""		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A734G	10						.						46.0	44.0	45.0					10																	88676949		2203	4297	6500	88666929	SO:0001583	missense	657	exon9	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.734A>G	10.37:g.88676949A>G	ENSP00000361107:p.Tyr245Cys	Somatic		Capture	Illumina HiSeq	Phase_I	88666929	NM_004329	A8K6U9|Q8NEN8	Missense_Mutation	SNP	ENST00000372037.3	37	CCDS7378.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.169048	0.78339	.	.	ENSG00000107779	ENST00000224764;ENST00000372037	D	0.94138	-3.36	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96250	0.8777	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.96723	0.9534	10	0.87932	D	0	.	16.1307	0.81436	1.0:0.0:0.0:0.0	.	245	P36894	BMR1A_HUMAN	C	245	ENSP00000361107:Y245C	ENSP00000224764:Y245C	Y	+	2	0	BMPR1A	88666929	1.000000	0.71417	0.959000	0.39883	0.995000	0.86356	7.327000	0.79147	2.263000	0.75096	0.533000	0.62120	TAT		0.428	BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049170.3	NM_004329	
TUBGCP2	10844	broad.mit.edu	37	10	135102414	135102414	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr10:135102414C>T	ENST00000252936.3	-	9	1510	c.1471G>A	c.(1471-1473)Gcg>Acg	p.A491T	TUBGCP2_ENST00000417178.2_Missense_Mutation_p.A361T|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.A519T|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.A491T|TUBGCP2_ENST00000368562.1_Missense_Mutation_p.A84T			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	491					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)		p.A491T(1)		breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		TAGTTAAACGCCTTCTCGATC	0.562																																					p.A491T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1471A	10						.						188.0	143.0	158.0					10																	135102414		2203	4300	6503	134952404	SO:0001583	missense	10844	exon10			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1471G>A	10.37:g.135102414C>T	ENSP00000252936:p.Ala491Thr	Somatic		Capture	Illumina HiSeq	Phase_I	134952404	NM_006659	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	ENST00000252936.3	37	CCDS7676.1	.	.	.	.	.	.	.	.	.	.	C	31	5.067809	0.93950	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.08984	3.03;3.03;3.03;3.03;3.03	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.39809	0.1092	M	0.92122	3.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.50668	-0.8801	10	0.62326	D	0.03	-29.2335	17.6603	0.88191	0.0:1.0:0.0:0.0	.	519;519;491	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	T	491;361;491;84;519	ENSP00000252936:A491T;ENSP00000395666:A361T;ENSP00000357551:A491T;ENSP00000357550:A84T;ENSP00000446093:A519T	ENSP00000252936:A491T	A	-	1	0	TUBGCP2	134952404	1.000000	0.71417	0.986000	0.45419	0.648000	0.38561	5.679000	0.68160	2.595000	0.87683	0.561000	0.74099	GCG		0.562	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
KIAA1377	57562	broad.mit.edu	37	11	101834474	101834474	+	Missense_Mutation	SNP	C	C	T	rs142635256		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:101834474C>T	ENST00000263468.8	+	6	2978	c.2708C>T	c.(2707-2709)gCg>gTg	p.A903V	KIAA1377_ENST00000537689.1_Missense_Mutation_p.A704V	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	903								p.A903V(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		CGGCAAGATGCGACATTATAT	0.408													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18042	0.0		0.0	False		,,,				2504	0.0				p.A903V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2708T	11						.	C	VAL/ALA	8,4398	14.3+/-33.2	0,8,2195	90.0	92.0	91.0		2708	0.4	0.0	11	dbSNP_134	91	0,8598		0,0,4299	yes	missense	KIAA1377	NM_020802.2	64	0,8,6494	TT,TC,CC		0.0,0.1816,0.0615	benign	903/1118	101834474	8,12996	2203	4299	6502	101339684	SO:0001583	missense	57562	exon6			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.2708C>T	11.37:g.101834474C>T	ENSP00000263468:p.Ala903Val	Somatic		Capture	Illumina HiSeq	Phase_I	101339684	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.296031	0.40594	0.001816	0.0	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.07327	3.2;3.2	5.77	0.422	0.16457	.	0.392126	0.24213	N	0.040513	T	0.05044	0.0135	N	0.19112	0.55	0.09310	N	1	B	0.21753	0.06	B	0.20184	0.028	T	0.35400	-0.9790	10	0.42905	T	0.14	-0.6897	8.0153	0.30376	0.1813:0.3145:0.5042:0.0	.	903	Q9P2H0	K1377_HUMAN	V	903;704	ENSP00000263468:A903V;ENSP00000443184:A704V	ENSP00000263468:A903V	A	+	2	0	KIAA1377	101339684	0.007000	0.16637	0.049000	0.19019	0.106000	0.19336	0.845000	0.27668	0.162000	0.19483	-0.128000	0.14901	GCG		0.408	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
CASP5	838	broad.mit.edu	37	11	104871117	104871117	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:104871117C>T	ENST00000260315.3	-	6	822	c.823G>A	c.(823-825)Gga>Aga	p.G275R	CASP5_ENST00000526056.1_Missense_Mutation_p.G288R|CASP5_ENST00000531367.1_Missense_Mutation_p.G133R|CASP5_ENST00000393139.2_3'UTR|CASP5_ENST00000418434.1_Missense_Mutation_p.G133R|CASP5_ENST00000444749.2_Missense_Mutation_p.G217R|CASP5_ENST00000393141.2_Missense_Mutation_p.G288R			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	275					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.G259R(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		TGCGCAGTTCCGCAGATTCCC	0.488																																					p.G288R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G862A	11						.						159.0	144.0	149.0					11																	104871117		2202	4299	6501	104376327	SO:0001583	missense	838	exon6				CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.823G>A	11.37:g.104871117C>T	ENSP00000260315:p.Gly275Arg	Somatic		Capture	Illumina HiSeq	Phase_I	104376327	NM_001136112	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	ENST00000260315.3	37	CCDS8328.2	.	.	.	.	.	.	.	.	.	.	.	13.38	2.220324	0.39201	.	.	ENSG00000137757	ENST00000393141;ENST00000418434;ENST00000260315;ENST00000444749;ENST00000526056;ENST00000531367	T;T;T;T;T;T	0.03920	3.76;3.76;3.76;3.76;3.76;3.76	4.21	3.27	0.37495	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.000000	0.85682	D	0.000000	T	0.29190	0.0726	H	0.95504	3.68	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.29731	-1.0002	10	0.87932	D	0	.	11.1095	0.48223	0.1867:0.8133:0.0:0.0	.	133;217;275;288	P51878-3;P51878-2;P51878;P51878-5	.;.;CASP5_HUMAN;.	R	288;133;275;217;288;133	ENSP00000376849:G288R;ENSP00000398130:G133R;ENSP00000260315:G275R;ENSP00000388365:G217R;ENSP00000436877:G288R;ENSP00000434471:G133R	ENSP00000260315:G275R	G	-	1	0	CASP5	104376327	0.999000	0.42202	0.285000	0.24819	0.038000	0.13279	4.583000	0.60964	0.856000	0.35383	0.205000	0.17691	GGA		0.488	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347	
HSPB2	3316	broad.mit.edu	37	11	111784519	111784519	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:111784519G>A	ENST00000304298.3	+	2	1037	c.449G>A	c.(448-450)gGc>gAc	p.G150D	CRYAB_ENST00000531198.1_5'Flank|CRYAB_ENST00000527950.1_Intron|CRYAB_ENST00000525823.1_5'Flank|CRYAB_ENST00000533971.1_5'Flank|CRYAB_ENST00000533475.1_5'UTR|CRYAB_ENST00000227251.3_5'Flank|HSPB2-C11orf52_ENST00000534100.1_Intron|CRYAB_ENST00000526180.1_5'Flank|HSPB2_ENST00000537382.1_Missense_Mutation_p.G150D	NM_001541.3	NP_001532.1	Q16082	HSPB2_HUMAN	heat shock 27kDa protein 2	150					positive regulation of catalytic activity (GO:0043085)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)	p.G150D(1)		large_intestine(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(61;3.75e-11)|all_epithelial(67;2.33e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;3.57e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.57e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.051)		CCTCGGGGTGGCCGACATTTG	0.587																																					p.G150D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G449A	11						.						54.0	52.0	52.0					11																	111784519		2201	4297	6498	111289729	SO:0001583	missense	3316	exon2			U75898	CCDS8352.1	11q22-q23	2011-09-02	2002-08-29			ENSG00000170276		"""Heat shock proteins / HSPB"""	5247	protein-coding gene	gene with protein product		602179	"""heat shock 27kD protein 2"""			9344664, 9490724	Standard	NM_001541		Approved	Hs.78846, MKBP	uc001pmg.2	Q16082		ENST00000304298.3:c.449G>A	11.37:g.111784519G>A	ENSP00000302476:p.Gly150Asp	Somatic		Capture	Illumina HiSeq	Phase_I	111289729	NM_001541	Q6I9U7	Missense_Mutation	SNP	ENST00000304298.3	37	CCDS8352.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723771	0.48728	.	.	ENSG00000170276	ENST00000304298;ENST00000537382	D;D	0.92099	-2.97;-2.97	5.22	5.22	0.72569	Heat shock protein Hsp20 (1);HSP20-like chaperone (1);	0.155857	0.45126	D	0.000390	D	0.92446	0.7602	L	0.28054	0.825	0.38071	D	0.936373	D	0.76494	0.999	D	0.69824	0.966	D	0.89634	0.3857	10	0.12430	T	0.62	-23.5198	19.1381	0.93436	0.0:0.0:1.0:0.0	.	150	Q16082	HSPB2_HUMAN	D	150	ENSP00000302476:G150D;ENSP00000445585:G150D	ENSP00000302476:G150D	G	+	2	0	HSPB2	111289729	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.550000	0.53691	2.607000	0.88179	0.650000	0.86243	GGC		0.587	HSPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391669.1		
CEP164	22897	broad.mit.edu	37	11	117280456	117280456	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:117280456C>T	ENST00000278935.3	+	30	4018	c.3871C>T	c.(3871-3873)Ccg>Tcg	p.P1291S	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1291					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.P1291S(1)		breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		TCAGTCGCCGCCGCCGCTCCT	0.667																																					p.P1291S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3871T	11						.						99.0	109.0	106.0					11																	117280456		2201	4296	6497	116785666	SO:0001583	missense	22897	exon30			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.3871C>T	11.37:g.117280456C>T	ENSP00000278935:p.Pro1291Ser	Somatic		Capture	Illumina HiSeq	Phase_I	116785666	NM_014956	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	C	7.440	0.640600	0.14386	.	.	ENSG00000110274	ENST00000278935	T	0.23754	1.89	4.11	4.11	0.48088	.	0.531595	0.14257	N	0.331051	T	0.28366	0.0701	N	0.25380	0.74	0.09310	N	1	D;D	0.61080	0.989;0.989	P;P	0.55923	0.787;0.787	T	0.05533	-1.0879	10	0.35671	T	0.21	-1.6138	9.3988	0.38420	0.0:0.8977:0.0:0.1023	.	1291;1286	Q9UPV0;Q9UPV0-2	CE164_HUMAN;.	S	1291	ENSP00000278935:P1291S	ENSP00000278935:P1291S	P	+	1	0	CEP164	116785666	0.000000	0.05858	0.004000	0.12327	0.016000	0.09150	0.308000	0.19314	2.012000	0.59069	0.491000	0.48974	CCG		0.667	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
BCL9L	283149	broad.mit.edu	37	11	118778291	118778291	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:118778291G>A	ENST00000334801.3	-	3	1397	c.433C>T	c.(433-435)Cgg>Tgg	p.R145W	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	145					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.R145W(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		ACACAGCGCCGCTTACTCCGC	0.642											OREG0021388	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R145W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C433T	11						.						96.0	82.0	87.0					11																	118778291		2200	4295	6495	118283501	SO:0001583	missense	283149	exon3			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.433C>T	11.37:g.118778291G>A	ENSP00000335320:p.Arg145Trp	Somatic	1491	Capture	Illumina HiSeq	Phase_I	118283501	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.851659	0.91355	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000392849;ENST00000431085	T	0.64260	-0.09	5.4	5.4	0.78164	.	0.000000	0.43110	D	0.000619	T	0.74015	0.3661	L	0.39898	1.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.75803	-0.3189	10	0.66056	D	0.02	-26.2533	19.1798	0.93619	0.0:0.0:1.0:0.0	.	140;145	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	W	145;108;145;145	ENSP00000335320:R145W	ENSP00000335320:R145W	R	-	1	2	BCL9L	118283501	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.886000	0.87288	2.537000	0.85549	0.561000	0.74099	CGG		0.642	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
MUC5B	727897	broad.mit.edu	37	11	1264896	1264896	+	Silent	SNP	C	C	T	rs186592494	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:1264896C>T	ENST00000529681.1	+	31	6844	c.6786C>T	c.(6784-6786)acC>acT	p.T2262T	MUC5B_ENST00000447027.1_Silent_p.T2265T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2262	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.T2265T(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCAGAACCACCGAGTCACCCC	0.667													c|||	5	0.000998403	0.0	0.0058	5008	,	,		16937	0.0		0.001	False		,,,				2504	0.0				p.T2262T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6786T	11						.	C		1,4339		0,1,2169	151.0	178.0	169.0		6786	-4.0	0.0	11		169	3,8489		0,3,4243	no	coding-synonymous	MUC5B	NM_002458.2		0,4,6412	TT,TC,CC		0.0353,0.023,0.0312		2262/5763	1264896	4,12828	2170	4246	6416	1221472	SO:0001819	synonymous_variant	727897	exon31			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.6786C>T	11.37:g.1264896C>T		Somatic		Capture	Illumina HiSeq	Phase_I	1221472	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				0.667	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MFRP	83552	broad.mit.edu	37	11	119216197	119216197	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:119216197C>A	ENST00000530681.1	-	5	718	c.574G>T	c.(574-576)Gag>Tag	p.E192*	MFRP_ENST00000529147.1_5'UTR|MFRP_ENST00000360167.4_Nonsense_Mutation_p.E192*|MFRP_ENST00000555262.1_Nonsense_Mutation_p.E192*|C1QTNF5_ENST00000445041.2_5'UTR|MFRP_ENST00000449574.2_Nonsense_Mutation_p.E192*	NM_001278431.1	NP_001265360.1	Q9BY79	MFRP_HUMAN	membrane frizzled-related protein	192	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				embryo development (GO:0009790)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E192*(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|urinary_tract(1)	18		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		GCCACACTCTCTATGCTGAGG	0.577																																					p.E192X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G574T	11						.						69.0	67.0	68.0					11																	119216197		2199	4295	6494	118721407	SO:0001587	stop_gained	83552	exon5			AB055505	CCDS8421.1	11q23.3	2014-01-28			ENSG00000235718	ENSG00000235718			18121	protein-coding gene	gene with protein product	"""membrane-type frizzled-related protein"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 1"""	606227				11263980	Standard	NM_031433		Approved	FLJ30570, rd6, NNO2, C1QTNF5	uc001pwj.2	Q9BY79		ENST00000530681.1:c.574G>T	11.37:g.119216197C>A	ENSP00000456533:p.Glu192*	Somatic		Capture	Illumina HiSeq	Phase_I	118721407	NM_031433	B0YJ36|B0YJ37|B4DHN8|Q335M3|Q96DQ9	Nonsense_Mutation	SNP	ENST00000530681.1	37	CCDS8421.1	.	.	.	.	.	.	.	.	.	.	C	36	5.822488	0.96989	.	.	ENSG00000235718	ENST00000555262;ENST00000449574;ENST00000360167	.	.	.	4.15	4.15	0.48705	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-19.4589	17.0062	0.86393	0.0:1.0:0.0:0.0	.	.	.	.	X	192	.	ENSP00000353291:E192X	E	-	1	0	MFRP	118721407	1.000000	0.71417	0.815000	0.32552	0.919000	0.55068	4.605000	0.61119	2.312000	0.78011	0.561000	0.74099	GAG		0.577	MFRP-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000415179.1	NM_031433	
OR10S1	219873	broad.mit.edu	37	11	123847767	123847767	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:123847767A>G	ENST00000531945.1	-	1	721	c.632T>C	c.(631-633)cTa>cCa	p.L211P		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L211P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		AAGCATGACTAGCTCATTAAT	0.537																																					p.L211P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T632C	11						.						72.0	60.0	64.0					11																	123847767		2202	4299	6501	123352977	SO:0001583	missense	219873	exon1			BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.632T>C	11.37:g.123847767A>G	ENSP00000431914:p.Leu211Pro	Somatic		Capture	Illumina HiSeq	Phase_I	123352977	NM_001004474	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	37	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.614597	0.46631	.	.	ENSG00000196248	ENST00000531945	T	0.00227	8.5	4.85	3.72	0.42706	GPCR, rhodopsin-like superfamily (1);	0.221873	0.22550	U	0.058602	T	0.00300	0.0009	M	0.87180	2.865	0.44677	D	0.997666	B	0.25206	0.12	B	0.29663	0.105	T	0.63337	-0.6660	10	0.87932	D	0	-6.0015	9.6938	0.40145	0.9161:0.0:0.0839:0.0	.	211	Q8NGN2	O10S1_HUMAN	P	211	ENSP00000431914:L211P	ENSP00000431914:L211P	L	-	2	0	OR10S1	123352977	0.009000	0.17119	0.417000	0.26559	0.373000	0.29922	2.610000	0.46325	0.874000	0.35823	0.533000	0.62120	CTA		0.537	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2	NM_001004474	
OR10G4	390264	broad.mit.edu	37	11	123886569	123886569	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:123886569C>T	ENST00000320891.4	+	1	288	c.288C>T	c.(286-288)tgC>tgT	p.C96C		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C96C(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TCCACAGCTGCGTGGCTCAGC	0.532																																					p.C96C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C288T	11						.						27.0	26.0	26.0					11																	123886569		2199	4277	6476	123391779	SO:0001819	synonymous_variant	390264	exon1			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.288C>T	11.37:g.123886569C>T		Somatic		Capture	Illumina HiSeq	Phase_I	123391779	NM_001004462	Q6IEW0	Silent	SNP	ENST00000320891.4	37	CCDS31702.1																																																																																				0.532	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462	
ACRV1	56	broad.mit.edu	37	11	125547744	125547744	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:125547744C>T	ENST00000533904.1	-	2	843	c.501G>A	c.(499-501)gaG>gaA	p.E167E	ACRV1_ENST00000353070.1_Intron|ACRV1_ENST00000348856.3_Silent_p.E67E|ACRV1_ENST00000527795.1_Silent_p.E97E|ACRV1_ENST00000425431.1_Intron|ACRV1_ENST00000315608.3_Intron|ACRV1_ENST00000445562.1_Silent_p.E72E|ACRV1_ENST00000453509.1_Intron|ACRV1_ENST00000530048.1_Silent_p.E112E|ACRV1_ENST00000345274.1_Silent_p.E97E			P26436	ASPX_HUMAN	acrosomal vesicle protein 1	167	4 X 4 AA repeats of S-G-E-H.|9 X 5 AA repeats of [SV]-G-E-Q-[PSA].				multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)		p.E167E(1)		kidney(1)|large_intestine(3)|lung(2)	6	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0179)|Lung NSC(97;0.0185)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0713)		CTGAAGCGTGCTCACCTGAAG	0.537																																					p.E167E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G501A	11						.						151.0	131.0	138.0					11																	125547744		2201	4299	6500	125052954	SO:0001819	synonymous_variant	56	exon2			AK223335	CCDS8460.1, CCDS8461.1, CCDS44759.1, CCDS44761.1	11q24.2	2012-05-16			ENSG00000134940	ENSG00000134940			127	protein-coding gene	gene with protein product	"""sperm protein 10"""	102525				1693291, 8288254	Standard	NM_001612		Approved	SPACA2, SP-10, D11S4365	uc001qcs.3	P26436	OTTHUMG00000165854	ENST00000533904.1:c.501G>A	11.37:g.125547744C>T		Somatic		Capture	Illumina HiSeq	Phase_I	125052954	NM_001612	Q53FF4	Silent	SNP	ENST00000533904.1	37	CCDS8460.1																																																																																				0.537	ACRV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386722.1	NM_001612	
OR52N2	390077	broad.mit.edu	37	11	5841731	5841731	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:5841731G>A	ENST00000317037.2	+	1	188	c.166G>A	c.(166-168)Gcc>Acc	p.A56T	TRIM5_ENST00000380027.1_Intron	NM_001005174.1	NP_001005174.1	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N, member 2	56						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H53_F64del(1)|p.A56T(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|urinary_tract(1)	32		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCATGAGGAGGCCCTGCACCG	0.532																																					p.A56T												.	.	2	Substitution - Missense(1)|Deletion - In frame(1)	ovary(1)|large_intestine(1)	c.G166A	11						.						137.0	117.0	124.0					11																	5841731		2201	4296	6497	5798307	SO:0001583	missense	390077	exon1			AB065816	CCDS31399.1	11p15.4	2012-08-09			ENSG00000180988	ENSG00000180988		"""GPCR / Class A : Olfactory receptors"""	15228	protein-coding gene	gene with protein product							Standard	NM_001005174		Approved		uc010qzp.2	Q8NGI0	OTTHUMG00000168801	ENST00000317037.2:c.166G>A	11.37:g.5841731G>A	ENSP00000322801:p.Ala56Thr	Somatic		Capture	Illumina HiSeq	Phase_I	5798307	NM_001005174	Q6IFF9	Missense_Mutation	SNP	ENST00000317037.2	37	CCDS31399.1	.	.	.	.	.	.	.	.	.	.	G	10.18	1.278662	0.23307	.	.	ENSG00000180988	ENST00000317037	T	0.00330	8.08	5.91	-0.15	0.13416	GPCR, rhodopsin-like superfamily (1);	0.215520	0.32357	N	0.006207	T	0.00144	0.0004	N	0.16098	0.37	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.31194	-0.9952	10	0.33141	T	0.24	.	5.6778	0.17759	0.1933:0.0:0.3152:0.4914	.	56	Q8NGI0	O52N2_HUMAN	T	56	ENSP00000322801:A56T	ENSP00000322801:A56T	A	+	1	0	OR52N2	5798307	0.000000	0.05858	0.612000	0.29024	0.722000	0.41435	0.051000	0.14141	0.073000	0.16731	0.655000	0.94253	GCC		0.532	OR52N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401143.1	NM_001005174	
OR52L1	338751	broad.mit.edu	37	11	6007522	6007522	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:6007522A>G	ENST00000332249.4	-	1	693	c.639T>C	c.(637-639)aaT>aaC	p.N213N		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N198N(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CATAAGCTCGATTGACTGTGG	0.493																																					p.N213N	Melanoma(121;653 1666 10547 22796 51255)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T639C	11						.						127.0	117.0	120.0					11																	6007522		2008	4183	6191	5964098	SO:0001819	synonymous_variant	338751	exon1			AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.639T>C	11.37:g.6007522A>G		Somatic		Capture	Illumina HiSeq	Phase_I	5964098	NM_001005173	B2RPA6|Q6IFK9	Silent	SNP	ENST00000332249.4	37	CCDS44529.1																																																																																				0.493	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173	
TPP1	1200	broad.mit.edu	37	11	6637258	6637258	+	Missense_Mutation	SNP	G	G	A	rs368914445		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:6637258G>A	ENST00000299427.6	-	9	1183	c.1123C>T	c.(1123-1125)Cgc>Tgc	p.R375C	TPP1_ENST00000533371.1_Missense_Mutation_p.R132C|TPP1_ENST00000534644.1_5'Flank|RP11-732A19.9_ENST00000545572.1_RNA	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0					embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)	p.R375C(2)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	AAGGTAGGGCGGAACTGGTGT	0.488																																					p.R375C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C1123T	11						.	G	CYS/ARG	1,4401	2.1+/-5.4	0,1,2200	112.0	97.0	102.0		1123	5.6	1.0	11		102	0,8592		0,0,4296	no	missense	TPP1	NM_000391.3	180	0,1,6496	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	375/564	6637258	1,12993	2201	4296	6497	6593834	SO:0001583	missense	1200	exon9			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.1123C>T	11.37:g.6637258G>A	ENSP00000299427:p.Arg375Cys	Somatic		Capture	Illumina HiSeq	Phase_I	6593834	NM_000391	Q71V64	Missense_Mutation	SNP	ENST00000299427.6	37	CCDS7770.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732140	0.69189	2.27E-4	0.0	ENSG00000166340	ENST00000299427;ENST00000533371	D;D	0.92348	-3.02;-3.02	5.56	5.56	0.83823	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.95887	0.8661	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.95707	0.8754	10	0.56958	D	0.05	-10.1855	18.5131	0.90925	0.0:0.0:1.0:0.0	.	375	O14773	TPP1_HUMAN	C	375;132	ENSP00000299427:R375C;ENSP00000437066:R132C	ENSP00000299427:R375C	R	-	1	0	TPP1	6593834	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	4.587000	0.60991	2.623000	0.88846	0.561000	0.74099	CGC		0.488	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257261.2		
OR10A3	26496	broad.mit.edu	37	11	7960899	7960899	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:7960899C>T	ENST00000360759.3	-	1	242	c.169G>A	c.(169-171)Gtt>Att	p.V57I		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	57					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V57I(1)|p.V57F(1)		endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TACATGGGAACGTGGAGGCTC	0.483																																					p.V57I												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G169A	11						.						128.0	117.0	120.0					11																	7960899		2201	4296	6497	7917475	SO:0001583	missense	26496	exon1			BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.169G>A	11.37:g.7960899C>T	ENSP00000353988:p.Val57Ile	Somatic		Capture	Illumina HiSeq	Phase_I	7917475	NM_001003745	B9EH39|Q6IF58|Q96R11	Missense_Mutation	SNP	ENST00000360759.3	37	CCDS31421.1	.	.	.	.	.	.	.	.	.	.	C	5.616	0.298302	0.10622	.	.	ENSG00000170683	ENST00000360759	T	0.00402	7.56	4.95	-3.29	0.05017	GPCR, rhodopsin-like superfamily (1);	0.891913	0.09206	N	0.833956	T	0.00178	0.0005	N	0.01789	-0.72	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.36553	-0.9743	10	0.54805	T	0.06	.	12.4532	0.55688	0.0:0.2205:0.0:0.7795	.	57	P58181	O10A3_HUMAN	I	57	ENSP00000353988:V57I	ENSP00000353988:V57I	V	-	1	0	OR10A3	7917475	0.000000	0.05858	0.001000	0.08648	0.199000	0.23934	-0.096000	0.11059	-0.468000	0.06922	-0.133000	0.14855	GTT		0.483	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385704.1	NM_001003745	
KCNA4	3739	broad.mit.edu	37	11	30034023	30034023	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:30034023C>T	ENST00000328224.6	-	2	1436	c.203G>A	c.(202-204)cGc>cAc	p.R68H	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	68					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)	p.R68H(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	ACAGGCCCCGCGTGACTGGTG	0.662																																					p.R68H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G203A	11						.						37.0	39.0	39.0					11																	30034023		1947	4132	6079	29990599	SO:0001583	missense	3739	exon2			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.203G>A	11.37:g.30034023C>T	ENSP00000328511:p.Arg68His	Somatic		Capture	Illumina HiSeq	Phase_I	29990599	NM_002233		Missense_Mutation	SNP	ENST00000328224.6	37	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675508	0.67928	.	.	ENSG00000182255	ENST00000328224	D	0.97378	-4.36	4.75	4.75	0.60458	Potassium channel, voltage dependent, Kv1.4, tandem inactivation (2);	841.166000	0.00166	N	0.000000	D	0.97436	0.9161	N	0.14661	0.345	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89535	0.3788	10	0.56958	D	0.05	.	17.7598	0.88461	0.0:1.0:0.0:0.0	.	68	P22459	KCNA4_HUMAN	H	68	ENSP00000328511:R68H	ENSP00000328511:R68H	R	-	2	0	KCNA4	29990599	0.989000	0.36119	0.100000	0.21137	0.371000	0.29859	2.970000	0.49240	2.191000	0.70037	0.491000	0.48974	CGC		0.662	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
DCDC1	341019	broad.mit.edu	37	11	31327910	31327910	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:31327910A>G	ENST00000452803.1	-	5	661	c.460T>C	c.(460-462)Ttt>Ctt	p.F154L	DCDC1_ENST00000597505.1_Missense_Mutation_p.F154L|RP1-296L11.1_ENST00000528872.1_RNA	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	154					intracellular signal transduction (GO:0035556)			p.F154L(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GCTGACTGAAATTTTAAAGAA	0.328																																					p.F154L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T460C	11						.						70.0	70.0	70.0					11																	31327910		2202	4298	6500	31284486	SO:0001583	missense	341019	exon5			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.460T>C	11.37:g.31327910A>G	ENSP00000389792:p.Phe154Leu	Somatic		Capture	Illumina HiSeq	Phase_I	31284486	NM_181807	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000452803.1	37	CCDS7872.1	.	.	.	.	.	.	.	.	.	.	A	12.53	1.965372	0.34659	.	.	ENSG00000188682	ENST00000452803	T	0.29142	1.58	5.95	5.95	0.96441	.	0.222920	0.32015	N	0.006710	T	0.18509	0.0444	L	0.31294	0.92	0.26555	N	0.973835	B	0.15141	0.012	B	0.16289	0.015	T	0.31308	-0.9948	10	0.02654	T	1	-0.9301	9.6352	0.39804	0.9162:0.0:0.0838:0.0	.	154	P59894	DCDC1_HUMAN	L	154	ENSP00000389792:F154L	ENSP00000343496:F154L	F	-	1	0	DCDC1	31284486	0.999000	0.42202	1.000000	0.80357	0.687000	0.40016	1.964000	0.40462	2.267000	0.75376	0.528000	0.53228	TTT		0.328	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1	NM_181807	
CHST1	8534	broad.mit.edu	37	11	45671720	45671720	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:45671720G>A	ENST00000308064.2	-	4	1424	c.754C>T	c.(754-756)Cgg>Tgg	p.R252W	CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	252					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)	p.R252W(1)		breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		CGCCAGAGCCGGTACGTGTCG	0.637																																					p.R252W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C754T	11						.						67.0	60.0	62.0					11																	45671720		2203	4299	6502	45628296	SO:0001583	missense	8534	exon4			U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.754C>T	11.37:g.45671720G>A	ENSP00000309270:p.Arg252Trp	Somatic		Capture	Illumina HiSeq	Phase_I	45628296	NM_003654	D3DQP2	Missense_Mutation	SNP	ENST00000308064.2	37	CCDS7913.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101045	0.56183	.	.	ENSG00000175264	ENST00000308064	D	0.96745	-4.11	4.89	4.89	0.63831	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.98150	0.9389	M	0.88570	2.965	0.52099	D	0.999946	D	0.89917	1.0	D	0.97110	1.0	D	0.98883	1.0770	10	0.87932	D	0	-18.1049	12.7877	0.57516	0.0:0.0:0.6873:0.3127	.	252	O43916	CHST1_HUMAN	W	252	ENSP00000309270:R252W	ENSP00000309270:R252W	R	-	1	2	CHST1	45628296	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.798000	0.47884	2.252000	0.74401	0.462000	0.41574	CGG		0.637	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390127.1	NM_003654	
ZNF408	79797	broad.mit.edu	37	11	46726049	46726049	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:46726049G>A	ENST00000311764.2	+	5	1029	c.799G>A	c.(799-801)Gcc>Acc	p.A267T		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	267					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.A267T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGAATGCCCGGCCCAGGCACA	0.582																																					p.A267T	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G799A	11						.						76.0	62.0	67.0					11																	46726049		2201	4299	6500	46682625	SO:0001583	missense	79797	exon5			AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.799G>A	11.37:g.46726049G>A	ENSP00000309606:p.Ala267Thr	Somatic		Capture	Illumina HiSeq	Phase_I	46682625	NM_024741		Missense_Mutation	SNP	ENST00000311764.2	37	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.501117	0.44455	.	.	ENSG00000175213	ENST00000311764	T	0.10477	2.87	5.16	0.982	0.19762	.	3.671990	0.00897	N	0.002311	T	0.08133	0.0203	N	0.14661	0.345	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.14023	0.01;0.01	T	0.36040	-0.9764	10	0.18710	T	0.47	-0.3901	10.2322	0.43262	0.0:0.5368:0.3863:0.077	.	259;267	B4DXY4;Q9H9D4	.;ZN408_HUMAN	T	267	ENSP00000309606:A267T	ENSP00000309606:A267T	A	+	1	0	ZNF408	46682625	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	0.717000	0.25851	0.247000	0.21414	-0.378000	0.06908	GCC		0.582	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741	
FNBP4	23360	broad.mit.edu	37	11	47741615	47741615	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:47741615C>T	ENST00000263773.5	-	16	2841	c.2829G>A	c.(2827-2829)atG>atA	p.M943I		NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	943						nucleus (GO:0005634)		p.M943I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						CCAAAGATGGCATTTTGGTCT	0.408																																					p.M943I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2829A	11						.						75.0	65.0	68.0					11																	47741615		1863	4107	5970	47698191	SO:0001583	missense	23360	exon16			BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2829G>A	11.37:g.47741615C>T	ENSP00000263773:p.Met943Ile	Somatic		Capture	Illumina HiSeq	Phase_I	47698191	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.834715	0.71373	.	.	ENSG00000109920	ENST00000263773	T	0.35605	1.3	5.51	5.51	0.81932	.	0.041428	0.85682	D	0.000000	T	0.37652	0.1011	L	0.48642	1.525	0.58432	D	0.999999	B	0.17465	0.022	B	0.15870	0.014	T	0.15665	-1.0429	10	0.66056	D	0.02	-9.1316	19.4718	0.94966	0.0:1.0:0.0:0.0	.	943	Q8N3X1	FNBP4_HUMAN	I	943	ENSP00000263773:M943I	ENSP00000263773:M943I	M	-	3	0	FNBP4	47698191	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.448000	0.80631	2.592000	0.87571	0.650000	0.86243	ATG		0.408	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
OR5D16	390144	broad.mit.edu	37	11	55606629	55606629	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:55606629C>T	ENST00000378396.1	+	1	402	c.402C>T	c.(400-402)taC>taT	p.Y134Y		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y134Y(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				CTCTGCTCTACACAGTTGCCA	0.458																																					p.Y134Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C402T	11						.						127.0	114.0	119.0					11																	55606629		2201	4296	6497	55363205	SO:0001819	synonymous_variant	390144	exon1			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.402C>T	11.37:g.55606629C>T		Somatic		Capture	Illumina HiSeq	Phase_I	55363205	NM_001005496	Q6IF65|Q96RB4	Silent	SNP	ENST00000378396.1	37	CCDS31512.1																																																																																				0.458	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496	
MARK2	2011	broad.mit.edu	37	11	63668288	63668288	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:63668288G>A	ENST00000509502.2	+	10	1289	c.826G>A	c.(826-828)Gaa>Aaa	p.E276K	MARK2_ENST00000502399.3_Missense_Mutation_p.E309K|MARK2_ENST00000315032.8_Missense_Mutation_p.E309K|MARK2_ENST00000425897.2_Missense_Mutation_p.E276K|MARK2_ENST00000408948.3_Missense_Mutation_p.E276K|MARK2_ENST00000413835.2_Missense_Mutation_p.E309K|MARK2_ENST00000377810.3_Missense_Mutation_p.E276K|MARK2_ENST00000350490.7_Missense_Mutation_p.E309K|MARK2_ENST00000513765.2_Missense_Mutation_p.E276K|MARK2_ENST00000508192.1_Missense_Mutation_p.E309K|MARK2_ENST00000402010.2_Missense_Mutation_p.E309K|MARK2_ENST00000377809.4_Missense_Mutation_p.E309K|MARK2_ENST00000361128.5_Missense_Mutation_p.E309K	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2									p.E276K(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						TGTGGGTCACGAAGATGATGA	0.537																																					p.E276K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G826A	11						.						153.0	158.0	156.0					11																	63668288		2201	4297	6498	63424864	SO:0001583	missense	2011	exon10			BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.826G>A	11.37:g.63668288G>A	ENSP00000423974:p.Glu276Lys	Somatic		Capture	Illumina HiSeq	Phase_I	63424864	NM_017490		Missense_Mutation	SNP	ENST00000509502.2	37	CCDS41665.1	.	.	.	.	.	.	.	.	.	.	G	32	5.112674	0.94339	.	.	ENSG00000072518	ENST00000402010;ENST00000315032;ENST00000377809;ENST00000413835;ENST00000377810;ENST00000508192;ENST00000361128;ENST00000350490;ENST00000502399;ENST00000509502;ENST00000513765;ENST00000408948;ENST00000425897	T;T;T;T;T;T;T;T;T;T;T;T	0.72835	-0.69;-0.68;-0.68;-0.66;-0.64;-0.63;1.86;-0.62;-0.69;-0.68;-0.64;-0.64	4.88	3.96	0.45880	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.82337	0.5015	M	0.87827	2.91	0.80722	D	1	D;D;D;D;D;D	0.69078	0.996;0.997;0.977;0.996;0.997;0.997	P;B;B;P;P;P	0.56474	0.753;0.378;0.258;0.63;0.654;0.799	D	0.86042	0.1520	10	0.72032	D	0.01	.	14.1205	0.65184	0.0:0.152:0.848:0.0	.	276;276;309;309;309;309	E7ETY4;Q7KZI7-14;Q7KZI7-15;Q7KZI7-5;Q7KZI7;Q7KZI7-16	.;.;.;.;MARK2_HUMAN;.	K	309;309;309;309;276;309;309;309;309;276;276;276;276	ENSP00000385751:E309K;ENSP00000326632:E309K;ENSP00000367040:E309K;ENSP00000389184:E309K;ENSP00000367041:E276K;ENSP00000425765:E309K;ENSP00000355091:E309K;ENSP00000294247:E309K;ENSP00000423974:E276K;ENSP00000421075:E276K;ENSP00000386128:E276K;ENSP00000415494:E276K	ENSP00000326632:E309K	E	+	1	0	MARK2	63424864	1.000000	0.71417	0.982000	0.44146	0.989000	0.77384	9.553000	0.98118	1.253000	0.44018	0.557000	0.71058	GAA		0.537	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360862.2	NM_017490	
CFL1	1072	broad.mit.edu	37	11	65623543	65623543	+	Silent	SNP	G	G	A	rs117076705	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:65623543G>A	ENST00000525451.2	-	3	889	c.174C>T	c.(172-174)ggC>ggT	p.G58G	CFL1_ENST00000534769.1_Silent_p.G96G|CFL1_ENST00000531413.1_Silent_p.G41G|CFL1_ENST00000524553.1_Silent_p.G41G|CFL1_ENST00000527344.1_Silent_p.G41G|CFL1_ENST00000531407.1_Silent_p.G41G|CFL1_ENST00000308162.5_Silent_p.G58G			P23528	COF1_HUMAN	cofilin 1 (non-muscle)	58	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin cytoskeleton organization (GO:0030036)|actin filament depolymerization (GO:0030042)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytoskeleton organization (GO:0007010)|establishment of cell polarity (GO:0030010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|mitotic cytokinesis (GO:0000281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell size (GO:0045792)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of actin filament depolymerization (GO:0030836)|protein import into nucleus (GO:0006606)|protein phosphorylation (GO:0006468)|regulation of cell morphogenesis (GO:0022604)|response to amino acid (GO:0043200)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.G58G(1)		breast(1)|kidney(1)|large_intestine(2)|lung(2)	6				READ - Rectum adenocarcinoma(159;0.169)		GGCCCACATCGCCCACCAGGA	0.567													G|||	29	0.00579073	0.0	0.0	5008	,	,		20588	0.0179		0.0	False		,,,				2504	0.0112				p.G58G	Esophageal Squamous(90;820 1366 3932 32351 42291)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C174T	11						.	G		0,4402		0,0,2201	135.0	120.0	125.0		174	-1.5	1.0	11	dbSNP_132	125	2,8592	2.2+/-6.3	0,2,4295	no	coding-synonymous	CFL1	NM_005507.2		0,2,6496	AA,AG,GG		0.0233,0.0,0.0154		58/167	65623543	2,12994	2201	4297	6498	65380119	SO:0001819	synonymous_variant	1072	exon2			X95404	CCDS8114.1	11q13.1	2010-12-03			ENSG00000172757	ENSG00000172757			1874	protein-coding gene	gene with protein product		601442		CFL		8800436	Standard	NM_005507		Approved		uc001ofs.3	P23528		ENST00000525451.2:c.174C>T	11.37:g.65623543G>A		Somatic		Capture	Illumina HiSeq	Phase_I	65380119	NM_005507	B3KUQ1|Q53Y87|Q9UCA2	Silent	SNP	ENST00000525451.2	37	CCDS8114.1																																																																																				0.567	CFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390701.3	NM_005507	
RNF121	55298	broad.mit.edu	37	11	71671827	71671827	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:71671827C>T	ENST00000361756.3	+	3	494	c.133C>T	c.(133-135)Cgt>Tgt	p.R45C	RNF121_ENST00000545854.1_5'UTR|RNF121_ENST00000533380.1_Missense_Mutation_p.R13C|RNF121_ENST00000530137.1_Missense_Mutation_p.R13C|RNF121_ENST00000393713.3_Missense_Mutation_p.R13C|RNF121_ENST00000490867.1_3'UTR	NM_018320.4	NP_060790.2	Q9H920	RN121_HUMAN	ring finger protein 121	45						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.R45C(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|urinary_tract(1)	13						TGCCAAGCACCGTGGCCATGA	0.562																																					p.R45C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C133T	11						.						130.0	94.0	106.0					11																	71671827		2200	4293	6493	71349475	SO:0001583	missense	55298	exon3			AK001961	CCDS8203.1, CCDS73343.1	11q13.3	2008-02-05			ENSG00000137522	ENSG00000137522		"""RING-type (C3HC4) zinc fingers"""	21070	protein-coding gene	gene with protein product							Standard	NM_018320		Approved	FLJ11099	uc001ora.3	Q9H920	OTTHUMG00000157023	ENST00000361756.3:c.133C>T	11.37:g.71671827C>T	ENSP00000354571:p.Arg45Cys	Somatic		Capture	Illumina HiSeq	Phase_I	71349475	NM_018320	B3KSW8|Q6IA57|Q6P449|Q96DB4	Missense_Mutation	SNP	ENST00000361756.3	37	CCDS8203.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470573	0.84533	.	.	ENSG00000137522	ENST00000361756;ENST00000533380;ENST00000393713;ENST00000530137	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.73	4.82	0.62117	.	0.111307	0.64402	D	0.000011	T	0.64494	0.2603	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;0.992;0.998	D;P;P	0.64237	0.923;0.599;0.739	T	0.68700	-0.5339	10	0.87932	D	0	.	12.6882	0.56960	0.0:0.92:0.0:0.08	.	13;13;45	C9JQY5;G3V148;Q9H920	.;.;RN121_HUMAN	C	45;13;13;13	ENSP00000354571:R45C;ENSP00000433574:R13C;ENSP00000377316:R13C;ENSP00000431286:R13C	ENSP00000354571:R45C	R	+	1	0	RNF121	71349475	1.000000	0.71417	0.996000	0.52242	0.956000	0.61745	5.686000	0.68211	1.420000	0.47138	0.655000	0.94253	CGT		0.562	RNF121-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347132.1	NM_018320	
FOLR1	2348	broad.mit.edu	37	11	71906671	71906671	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:71906671C>T	ENST00000393679.1	+	4	809	c.373C>T	c.(373-375)Cgc>Tgc	p.R125C	FOLR1_ENST00000312293.4_Missense_Mutation_p.R125C|FOLR1_ENST00000393676.3_Missense_Mutation_p.R125C|FOLR1_ENST00000393681.2_Missense_Mutation_p.R125C|RP11-807H22.7_ENST00000378140.3_RNA			P15328	FOLR1_HUMAN	folate receptor 1 (adult)	125	Folate binding.				cell death (GO:0008219)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|receptor-mediated endocytosis (GO:0006898)	anchored component of external side of plasma membrane (GO:0031362)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|receptor activity (GO:0004872)	p.R125C(1)		cervix(2)|endometrium(1)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	14					Methotrexate(DB00563)	TCAGAGCTGGCGCAAAGAGCG	0.537																																					p.R125C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C373T	11						.						68.0	62.0	64.0					11																	71906671		2200	4293	6493	71584319	SO:0001583	missense	2348	exon5			J05013	CCDS8211.1	11q13.3-q14.1	2010-04-09			ENSG00000110195	ENSG00000110195			3791	protein-coding gene	gene with protein product		136430		FOLR		1717147	Standard	NM_000802		Approved		uc001osa.2	P15328		ENST00000393679.1:c.373C>T	11.37:g.71906671C>T	ENSP00000377284:p.Arg125Cys	Somatic		Capture	Illumina HiSeq	Phase_I	71584319	NM_016724	Q53EW2|Q6FGT8|Q6LC90|Q9UCT2	Missense_Mutation	SNP	ENST00000393679.1	37	CCDS8211.1	.	.	.	.	.	.	.	.	.	.	c	15.41	2.826771	0.50739	.	.	ENSG00000110195	ENST00000312293;ENST00000393681;ENST00000393679;ENST00000393676	T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15	5.45	4.49	0.54785	Folate receptor-like (1);	0.000000	0.85682	D	0.000000	D	0.89389	0.6701	M	0.92555	3.32	0.80722	D	1	D	0.76494	0.999	D	0.67725	0.953	D	0.91123	0.4931	10	0.72032	D	0.01	-17.1837	13.0556	0.58977	0.2615:0.7385:0.0:0.0	.	125	P15328	FOLR1_HUMAN	C	125	ENSP00000308137:R125C;ENSP00000377286:R125C;ENSP00000377284:R125C;ENSP00000377281:R125C	ENSP00000308137:R125C	R	+	1	0	FOLR1	71584319	1.000000	0.71417	1.000000	0.80357	0.339000	0.28857	1.557000	0.36299	2.700000	0.92200	0.563000	0.77884	CGC		0.537	FOLR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396773.1	NM_016725	
FOLR2	2350	broad.mit.edu	37	11	71932686	71932686	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:71932686C>T	ENST00000298223.6	+	5	835	c.648C>T	c.(646-648)aaC>aaT	p.N216N	FOLR2_ENST00000449475.2_Silent_p.N212N|FOLR2_ENST00000454954.2_Silent_p.N175N	NM_000803.4|NM_001113534.1|NM_001113535.1|NM_001113536.1	NP_000794.3|NP_001107006.1|NP_001107007.1|NP_001107008.1	P14207	FOLR2_HUMAN	folate receptor 2 (fetal)	216					folic acid transport (GO:0015884)	anchored component of external side of plasma membrane (GO:0031362)|extracellular region (GO:0005576)|membrane (GO:0016020)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)	p.N216N(1)		breast(3)|large_intestine(3)|ovary(1)|skin(1)	8					Folic Acid(DB00158)	GCAACCCCAACGAGGAAGTGG	0.582																																					p.N216N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C648T	11						.						96.0	93.0	94.0					11																	71932686		2200	4293	6493	71610334	SO:0001819	synonymous_variant	2350	exon5			AK222539	CCDS8212.1	11q13.3-q14.1	2010-04-08			ENSG00000165457	ENSG00000165457			3793	protein-coding gene	gene with protein product		136425				1133088, 7698003	Standard	NM_000803		Approved		uc009ytf.3	P14207	OTTHUMG00000150394	ENST00000298223.6:c.648C>T	11.37:g.71932686C>T		Somatic		Capture	Illumina HiSeq	Phase_I	71610334	NM_001113536	Q05CA5|Q6GTE8	Silent	SNP	ENST00000298223.6	37	CCDS8212.1	.	.	.	.	.	.	.	.	.	.	N	6.328	0.428569	0.11987	.	.	ENSG00000165457	ENST00000413873	.	.	.	4.43	-8.12	0.01078	.	.	.	.	.	T	0.75057	0.3798	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.82092	-0.0628	5	0.87932	D	0	.	17.9663	0.89100	0.0:0.7585:0.0:0.2415	.	.	.	.	M	230	.	ENSP00000412980:T230M	T	+	2	0	FOLR2	71610334	0.000000	0.05858	0.439000	0.26833	0.724000	0.41520	-3.059000	0.00624	-1.708000	0.01401	-0.487000	0.04747	ACG		0.582	FOLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317923.2	NM_000803	
STARD10	10809	broad.mit.edu	37	11	72470294	72470294	+	Missense_Mutation	SNP	C	C	T	rs202222156		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:72470294C>T	ENST00000334805.6	-	3	1259	c.340G>A	c.(340-342)Gtg>Atg	p.V114M	ARAP1_ENST00000359373.5_Intron|STARD10_ENST00000543304.1_Missense_Mutation_p.V114M|STARD10_ENST00000545082.1_Missense_Mutation_p.V85M|STARD10_ENST00000538437.1_5'UTR|STARD10_ENST00000538536.1_Missense_Mutation_p.V68M	NM_006645.2	NP_006636.2	Q9Y365	PCTL_HUMAN	StAR-related lipid transfer (START) domain containing 10	114	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid secretion (GO:0032782)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)	cytosol (GO:0005829)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|microvillus (GO:0005902)	lipid binding (GO:0008289)	p.V114M(1)		endometrium(4)|large_intestine(1)|lung(2)|prostate(1)	8			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)			TAATAGCCCACGTCAGCGTTG	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		21224	0.0		0.001	False		,,,				2504	0.0				p.V114M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G340A	11						.	C	MET/VAL	0,4382		0,0,2191	103.0	109.0	107.0		340	5.9	1.0	11		107	3,8567	3.0+/-9.4	0,3,4282	yes	missense	STARD10	NM_006645.2	21	0,3,6473	TT,TC,CC		0.035,0.0,0.0232	probably-damaging	114/292	72470294	3,12949	2191	4285	6476	72147942	SO:0001583	missense	10809	exon3			AF039696	CCDS41688.1	11q13	2011-09-12	2007-08-16	2003-02-07		ENSG00000214530		"""StAR-related lipid transfer (START) domain containing"""	10666	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 28"", ""START domain containing 10"""	SDCCAG28		9610721	Standard	NM_006645		Approved	NY-CO-28, CGI-52, PCTP2	uc001otb.3	Q9Y365		ENST00000334805.6:c.340G>A	11.37:g.72470294C>T	ENSP00000335247:p.Val114Met	Somatic		Capture	Illumina HiSeq	Phase_I	72147942	NM_006645	O60532	Missense_Mutation	SNP	ENST00000334805.6	37	CCDS41688.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849766	0.91277	0.0	3.5E-4	ENSG00000214530	ENST00000537351;ENST00000543304;ENST00000334805;ENST00000538536;ENST00000545082;ENST00000544767;ENST00000537947;ENST00000536728;ENST00000542989;ENST00000546314	D;D;D;D;D;D;D;D;D;T	0.82433	-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;1.29	5.94	5.94	0.96194	Lipid-binding START (3);START-like domain (1);	0.077002	0.52532	U	0.000076	D	0.91074	0.7191	M	0.87758	2.905	0.53688	D	0.999977	D;D	0.89917	1.0;0.999	D;D	0.71870	0.958;0.975	D	0.91760	0.5419	10	0.87932	D	0	-21.5734	11.17	0.48567	0.0:0.9171:0.0:0.0829	.	68;114	F5GY11;Q9Y365	.;PCTL_HUMAN	M	21;114;114;68;85;45;114;45;114;114	ENSP00000445708:V21M;ENSP00000438792:V114M;ENSP00000335247:V114M;ENSP00000440016:V68M;ENSP00000443548:V85M;ENSP00000438357:V45M;ENSP00000445657:V114M;ENSP00000442414:V45M;ENSP00000443597:V114M;ENSP00000445886:V114M	ENSP00000335247:V114M	V	-	1	0	STARD10	72147942	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.931000	0.63469	2.820000	0.97059	0.650000	0.86243	GTG		0.577	STARD10-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397254.1		
LRRC32	2615	broad.mit.edu	37	11	76371707	76371707	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:76371707G>A	ENST00000407242.2	-	3	1172	c.930C>T	c.(928-930)agC>agT	p.S310S	LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000260061.5_Silent_p.S310S|LRRC32_ENST00000404995.1_Silent_p.S310S|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	310					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)		p.S310S(1)		endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GGGGGCGGCCGCTGGCATTCC	0.632																																					p.S310S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C930T	11						.						19.0	24.0	22.0					11																	76371707		2200	4291	6491	76049355	SO:0001819	synonymous_variant	2615	exon3			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.930C>T	11.37:g.76371707G>A		Somatic		Capture	Illumina HiSeq	Phase_I	76049355	NM_001128922	Q86V06	Silent	SNP	ENST00000407242.2	37	CCDS8245.1																																																																																				0.632	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512	
TSKU	25987	broad.mit.edu	37	11	76507575	76507575	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:76507575G>A	ENST00000527881.1	+	2	1941	c.915G>A	c.(913-915)ctG>ctA	p.L305L	TSKU_ENST00000333090.4_Silent_p.L305L			Q8WUA8	TSK_HUMAN	tsukushi, small leucine rich proteoglycan	305					anterior commissure morphogenesis (GO:0021960)|ciliary body morphogenesis (GO:0061073)|corpus callosum morphogenesis (GO:0021540)|lateral ventricle development (GO:0021670)|negative regulation of Wnt signaling pathway (GO:0030178)|regulation of gene expression (GO:0010468)	extracellular space (GO:0005615)		p.L305L(1)		NS(1)|large_intestine(4)|lung(6)|urinary_tract(1)	12	Ovarian(111;0.112)					TCCCGGCACTGCAGAGCGTCA	0.701																																					p.L305L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G915A	11						.						22.0	24.0	23.0					11																	76507575		2198	4288	6486	76185223	SO:0001819	synonymous_variant	25987	exon2			AK075476	CCDS8246.1	11q13.5	2012-12-05	2012-12-05	2006-11-21	ENSG00000182704	ENSG00000182704			28850	protein-coding gene	gene with protein product		608015	"""leucine rich repeat containing 54"", ""tsukushin"", ""tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)"""	LRRC54		11085516, 19710929, 22880013	Standard	NM_001258210		Approved	E2IG4, TSK	uc031qcw.1	Q8WUA8		ENST00000527881.1:c.915G>A	11.37:g.76507575G>A		Somatic		Capture	Illumina HiSeq	Phase_I	76185223	NM_015516	B3KQT7|Q6UXK1|Q9UG10|Q9UJX9	Silent	SNP	ENST00000527881.1	37	CCDS8246.1																																																																																				0.701	TSKU-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382871.1	NM_015516	
TENM4	26011	broad.mit.edu	37	11	78399262	78399262	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:78399262G>A	ENST00000278550.7	-	29	5559	c.5097C>T	c.(5095-5097)agC>agT	p.S1699S		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1699					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.S1699S(2)									GGCGGCCAAAGCTGTCGTACC	0.507																																					p.S1699S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C5097T	11						.						170.0	171.0	171.0					11																	78399262		2059	4190	6249	78076910	SO:0001819	synonymous_variant	26011	exon29			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5097C>T	11.37:g.78399262G>A		Somatic		Capture	Illumina HiSeq	Phase_I	78076910	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	CCDS44688.1																																																																																				0.507	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
PCF11	51585	broad.mit.edu	37	11	82895752	82895752	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:82895752G>A	ENST00000298281.4	+	16	4936	c.4484G>A	c.(4483-4485)aGc>aAc	p.S1495N	RP11-727A23.4_ENST00000528133.1_RNA|RP11-727A23.11_ENST00000602322.1_lincRNA	NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	1495					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)		p.S1495N(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						CCATCTCCCAGCAAGACACCA	0.363																																					p.S1495N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4484A	11						.						92.0	87.0	89.0					11																	82895752		1879	4124	6003	82573400	SO:0001583	missense	51585	exon16			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.4484G>A	11.37:g.82895752G>A	ENSP00000298281:p.Ser1495Asn	Somatic		Capture	Illumina HiSeq	Phase_I	82573400	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033078	0.54896	.	.	ENSG00000165494	ENST00000298281	T	0.26660	1.72	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000001	T	0.18130	0.0435	N	0.11427	0.14	0.46078	D	0.998853	P	0.47762	0.9	B	0.41440	0.357	T	0.03651	-1.1016	9	.	.	.	-3.7762	20.6397	0.99537	0.0:0.0:1.0:0.0	.	1495	O94913	PCF11_HUMAN	N	1495	ENSP00000298281:S1495N	.	S	+	2	0	PCF11	82573400	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.284000	0.65627	2.880000	0.98712	0.650000	0.86243	AGC		0.363	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
MAML2	84441	broad.mit.edu	37	11	95825260	95825260	+	Silent	SNP	T	T	C	rs537179849	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:95825260T>C	ENST00000524717.1	-	2	3219	c.1935A>G	c.(1933-1935)caA>caG	p.Q645Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	645					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q645Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgttgttgctgctgct	0.517			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q645Q			Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1935G	11						.						39.0	43.0	42.0					11																	95825260		2089	4107	6196	95464908	SO:0001819	synonymous_variant	84441	exon2			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1935A>G	11.37:g.95825260T>C		Somatic		Capture	Illumina HiSeq	Phase_I	95464908	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																				0.517	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
ARHGAP32	9743	broad.mit.edu	37	11	128838886	128838886	+	Silent	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr11:128838886G>T	ENST00000310343.9	-	22	6179	c.6180C>A	c.(6178-6180)acC>acA	p.T2060T	ARHGAP32_ENST00000527272.1_Silent_p.T1711T|ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000392657.3_Silent_p.T1711T	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	2060	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)	p.T2060T(1)|p.T1711T(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CTGTAGCATAGGTCCTGCTCT	0.587																																					p.T1711T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C5133A	11						.						41.0	35.0	37.0					11																	128838886		2201	4297	6498	128344096	SO:0001819	synonymous_variant	9743	exon13			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.6180C>A	11.37:g.128838886G>T		Somatic		Capture	Illumina HiSeq	Phase_I	128344096	NM_014715	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	37	CCDS44769.1																																																																																				0.587	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
ALDH1L2	160428	broad.mit.edu	37	12	105418218	105418218	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:105418218A>G	ENST00000258494.9	-	23	2896	c.2756T>C	c.(2755-2757)gTg>gCg	p.V919A	C12orf45_ENST00000548583.1_Intron	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	919	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.V919A(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						TTCCAGTGTCACCGTCTTGGT	0.448																																					p.V919A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2756C	12						.						239.0	195.0	210.0					12																	105418218		2203	4300	6503	103942348	SO:0001583	missense	160428	exon23			AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.2756T>C	12.37:g.105418218A>G	ENSP00000258494:p.Val919Ala	Somatic		Capture	Illumina HiSeq	Phase_I	103942348	NM_001034173	Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	ENST00000258494.9	37	CCDS31891.1	.	.	.	.	.	.	.	.	.	.	A	31	5.070489	0.93950	.	.	ENSG00000136010	ENST00000258494	T	0.80566	-1.39	5.84	5.84	0.93424	Aldehyde dehydrogenase domain (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.91630	0.7355	M	0.91406	3.205	0.80722	D	1	D	0.60575	0.988	D	0.71870	0.975	D	0.93350	0.6717	10	0.87932	D	0	.	16.2282	0.82315	1.0:0.0:0.0:0.0	.	919	Q3SY69	AL1L2_HUMAN	A	919	ENSP00000258494:V919A	ENSP00000258494:V919A	V	-	2	0	ALDH1L2	103942348	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.931000	0.92884	2.227000	0.72691	0.533000	0.62120	GTG		0.448	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406098.1	XM_090294	
CCDC64	92558	broad.mit.edu	37	12	120510444	120510444	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:120510444G>A	ENST00000397558.2	+	6	1219	c.1219G>A	c.(1219-1221)Gcc>Acc	p.A407T	CCDC64_ENST00000446727.2_Intron|CCDC64_ENST00000257583.4_Missense_Mutation_p.A56T	NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	407					Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)	p.A407T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AACCTCGTCCGCCAAGGATGT	0.577																																					p.A407T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1219A	12						.						54.0	58.0	57.0					12																	120510444		2107	4221	6328	118994827	SO:0001583	missense	92558	exon6			U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.1219G>A	12.37:g.120510444G>A	ENSP00000380690:p.Ala407Thr	Somatic		Capture	Illumina HiSeq	Phase_I	118994827	NM_207311	A8MUC8|B4DWL0|B5MDJ0|O95000	Missense_Mutation	SNP	ENST00000397558.2	37	CCDS41845.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.322675	0.60634	.	.	ENSG00000135127	ENST00000357093;ENST00000397558;ENST00000548673;ENST00000257583	T;T	0.04862	3.54;3.54	5.67	4.77	0.60923	.	0.298239	0.35378	N	0.003248	T	0.05318	0.0141	L	0.41573	1.285	0.44241	D	0.997087	P;P	0.40909	0.732;0.597	B;B	0.28916	0.096;0.05	T	0.49331	-0.8951	10	0.27082	T	0.32	-6.2879	14.0383	0.64658	0.072:0.0:0.928:0.0	.	56;407	B4DWL0;Q6ZP65	.;BICR1_HUMAN	T	388;407;77;56	ENSP00000380690:A407T;ENSP00000447477:A77T	ENSP00000257583:A56T	A	+	1	0	CCDC64	118994827	1.000000	0.71417	0.972000	0.41901	0.945000	0.59286	6.348000	0.73009	2.697000	0.92050	0.655000	0.94253	GCC		0.577	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403390.2	NM_207311	
LRP6	4040	broad.mit.edu	37	12	12284834	12284834	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:12284834A>G	ENST00000261349.4	-	18	3967	c.3891T>C	c.(3889-3891)agT>agC	p.S1297S	BCL2L14_ENST00000396369.1_Intron|LRP6_ENST00000543091.1_Silent_p.S1252S|LRP6_ENST00000540415.1_5'UTR	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1297	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.S1297S(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TACACTGCCCACTGGCACACT	0.498																																					p.S1297S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3891C	12						.						141.0	114.0	123.0					12																	12284834		2203	4300	6503	12176101	SO:0001819	synonymous_variant	4040	exon18			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3891T>C	12.37:g.12284834A>G		Somatic		Capture	Illumina HiSeq	Phase_I	12176101	NM_002336	Q17RZ2	Silent	SNP	ENST00000261349.4	37	CCDS8647.1																																																																																				0.498	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
VPS33A	65082	broad.mit.edu	37	12	122717430	122717430	+	Missense_Mutation	SNP	C	C	T	rs200715881		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:122717430C>T	ENST00000267199.4	-	12	1638	c.1526G>A	c.(1525-1527)cGg>cAg	p.R509Q	RP11-512M8.5_ENST00000535844.1_Missense_Mutation_p.R470Q	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	509					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)		p.R509Q(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		CTCGATGCTCCGCCAGCCAGG	0.607																																					p.R509Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1526A	12						.						34.0	34.0	34.0					12																	122717430		2203	4300	6503	121283383	SO:0001583	missense	65082	exon12			AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.1526G>A	12.37:g.122717430C>T	ENSP00000267199:p.Arg509Gln	Somatic		Capture	Illumina HiSeq	Phase_I	121283383	NM_022916	Q547V4|Q9H5Q0	Missense_Mutation	SNP	ENST00000267199.4	37	CCDS9231.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541969	0.65198	.	.	ENSG00000139719	ENST00000267199	T	0.76839	-1.05	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.70343	0.3213	L	0.45744	1.44	0.80722	D	1	P	0.42123	0.771	B	0.35510	0.204	T	0.68625	-0.5359	10	0.14656	T	0.56	-27.629	19.4915	0.95052	0.0:1.0:0.0:0.0	.	509	Q96AX1	VP33A_HUMAN	Q	509	ENSP00000267199:R509Q	ENSP00000446319:R470Q	R	-	2	0	VPS33A	121283383	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.786000	0.85741	2.596000	0.87737	0.655000	0.94253	CGG		0.607	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401607.2		
DNAH10	196385	broad.mit.edu	37	12	124330339	124330339	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:124330339C>T	ENST00000409039.3	+	30	5224	c.5199C>T	c.(5197-5199)aaC>aaT	p.N1733N		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1733	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.N1733N(1)|p.N325N(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TAAGCAAAAACGACAGGAAAA	0.473																																					p.N1733N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C5199T	12						.						135.0	142.0	140.0					12																	124330339		2022	4179	6201	122896292	SO:0001819	synonymous_variant	196385	exon30			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5199C>T	12.37:g.124330339C>T		Somatic		Capture	Illumina HiSeq	Phase_I	122896292	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	CCDS9255.2																																																																																				0.473	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
SLC15A4	121260	broad.mit.edu	37	12	129299466	129299466	+	Silent	SNP	G	G	A	rs201921716		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:129299466G>A	ENST00000266771.5	-	2	735	c.696C>T	c.(694-696)tgC>tgT	p.C232C	SLC15A4_ENST00000539703.1_5'UTR	NM_145648.3	NP_663623.1	Q8N697	S15A4_HUMAN	solute carrier family 15 (oligopeptide transporter), member 4	232					ion transport (GO:0006811)|oligopeptide transport (GO:0006857)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	L-histidine transmembrane transporter activity (GO:0005290)|symporter activity (GO:0015293)	p.C232C(1)|p.C232*(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|skin(1)	22	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.69e-06)|Epithelial(86;1.17e-05)|all cancers(50;5.07e-05)		CAAGGCCGACGCAGACAGTGG	0.517																																					p.C232C												.	.	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C696T	12						.						198.0	180.0	186.0					12																	129299466		2203	4300	6503	127865419	SO:0001819	synonymous_variant	121260	exon2			AY038999	CCDS9264.1	12q24.32	2013-07-18	2013-07-18		ENSG00000139370	ENSG00000139370		"""Solute carriers"""	23090	protein-coding gene	gene with protein product		615806	"""solute carrier family 15, member 4"""			11741232	Standard	NM_145648		Approved	PHT1, PTR4	uc001uhu.2	Q8N697	OTTHUMG00000168415	ENST00000266771.5:c.696C>T	12.37:g.129299466G>A		Somatic		Capture	Illumina HiSeq	Phase_I	127865419	NM_145648	A6H8Y9|B3KTK1|Q71M34|Q7Z5F8|Q8TAH0	Silent	SNP	ENST00000266771.5	37	CCDS9264.1																																																																																				0.517	SLC15A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399663.1	NM_145648	
RIMBP2	23504	broad.mit.edu	37	12	130884249	130884249	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:130884249G>A	ENST00000261655.4	-	18	3270	c.3107C>T	c.(3106-3108)aCg>aTg	p.T1036M		NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	1036					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.T1036M(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GCGCATTGGCGTATCTTGAGA	0.443																																					p.T1036M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3107T	12						.						147.0	127.0	134.0					12																	130884249		2203	4300	6503	129450202	SO:0001583	missense	23504	exon18			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.3107C>T	12.37:g.130884249G>A	ENSP00000261655:p.Thr1036Met	Somatic		Capture	Illumina HiSeq	Phase_I	129450202	NM_015347	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714256	0.30413	.	.	ENSG00000060709	ENST00000261655	T	0.21543	2.0	4.89	4.0	0.46444	.	0.827958	0.10801	N	0.632728	T	0.17066	0.0410	L	0.27053	0.805	0.46609	D	0.999127	B	0.24186	0.099	B	0.12156	0.007	T	0.02893	-1.1097	10	0.46703	T	0.11	-0.0048	13.0227	0.58799	0.0786:0.0:0.9214:0.0	.	1036	O15034	RIMB2_HUMAN	M	1036	ENSP00000261655:T1036M	ENSP00000261655:T1036M	T	-	2	0	RIMBP2	129450202	0.671000	0.27521	0.001000	0.08648	0.068000	0.16541	4.047000	0.57383	1.074000	0.40909	0.478000	0.44815	ACG		0.443	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
SFSWAP	6433	broad.mit.edu	37	12	132212871	132212871	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:132212871G>A	ENST00000261674.4	+	7	1120	c.979G>A	c.(979-981)Gca>Aca	p.A327T	SFSWAP_ENST00000541286.1_Missense_Mutation_p.A327T	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	327					mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						TCATCCCCTCGCAGCACTTGT	0.552																																					p.A327T												.	.	0			c.G979A	12						.						183.0	148.0	160.0					12																	132212871		2203	4300	6503	130778824	SO:0001583	missense	6433	exon7			U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.979G>A	12.37:g.132212871G>A	ENSP00000261674:p.Ala327Thr	None		Capture	Illumina HiSeq	Phase_I	130778824	NM_004592	B2RN45|B7ZM97|F5H6B8|Q6PJF7	Missense_Mutation	SNP	ENST00000261674.4	37	CCDS9273.1	.	.	.	.	.	.	.	.	.	.	G	13.51	2.258739	0.39896	.	.	ENSG00000061936	ENST00000261674;ENST00000544623;ENST00000535236;ENST00000541286	T;T;T	0.26660	2.71;1.72;2.7	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.49490	0.1560	M	0.66939	2.045	0.80722	D	1	P;B;D	0.89917	0.886;0.277;1.0	B;B;D	0.83275	0.169;0.02;0.996	T	0.25467	-1.0131	10	0.24483	T	0.36	-18.842	17.8127	0.88620	0.0:0.0:1.0:0.0	.	327;327;264	F5H6B8;Q12872;F5H525	.;SFSWA_HUMAN;.	T	327;264;120;327	ENSP00000261674:A327T;ENSP00000443045:A120T;ENSP00000437738:A327T	ENSP00000261674:A327T	A	+	1	0	SFSWAP	130778824	1.000000	0.71417	0.140000	0.22221	0.191000	0.23601	8.140000	0.89616	2.652000	0.90054	0.655000	0.94253	GCA		0.552	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399276.1	NM_004592	
DPPA3	359787	broad.mit.edu	37	12	7864200	7864200	+	Missense_Mutation	SNP	C	C	A	rs151225281		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:7864200C>A	ENST00000345088.2	+	1	151	c.34C>A	c.(34-36)Cca>Aca	p.P12T		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	12					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)	p.P12T(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		AACCTACATCCCAGGGTCTCC	0.493																																					p.P12T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C34A	12						.						73.0	62.0	66.0					12																	7864200		2203	4300	6503	7755467	SO:0001583	missense	359787	exon1			AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	ENST00000345088.2:c.34C>A	12.37:g.7864200C>A	ENSP00000339250:p.Pro12Thr	Somatic		Capture	Illumina HiSeq	Phase_I	7755467	NM_199286	Q0P5U3|Q6JZS6	Missense_Mutation	SNP	ENST00000345088.2	37	CCDS8582.1	.	.	.	.	.	.	.	.	.	.	C	8.146	0.786391	0.16189	.	.	ENSG00000187569	ENST00000345088	T	0.48201	0.82	2.82	-4.17	0.03857	.	.	.	.	.	T	0.32346	0.0826	L	0.32530	0.975	0.09310	N	1	P	0.50528	0.936	P	0.44477	0.451	T	0.19976	-1.0289	9	0.39692	T	0.17	-0.5977	5.356	0.16061	0.0:0.2225:0.4542:0.3233	.	12	Q6W0C5	DPPA3_HUMAN	T	12	ENSP00000339250:P12T	ENSP00000339250:P12T	P	+	1	0	DPPA3	7755467	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.412000	0.07132	-1.180000	0.02734	-0.136000	0.14681	CCA		0.493	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399718.1	NM_199286	
GRIN2B	2904	broad.mit.edu	37	12	13716760	13716760	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:13716760G>A	ENST00000609686.1	-	13	3621	c.3412C>T	c.(3412-3414)Cga>Tga	p.R1138*		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1138					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.R1138*(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCCTTTGTTCGGAACTGGTCC	0.607																																					p.R1138X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3412T	12						.						100.0	89.0	93.0					12																	13716760		2203	4300	6503	13608027	SO:0001587	stop_gained	2904	exon13				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3412C>T	12.37:g.13716760G>A	ENSP00000477455:p.Arg1138*	Somatic		Capture	Illumina HiSeq	Phase_I	13608027	NM_000834	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Nonsense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	G	41	8.670792	0.98908	.	.	ENSG00000150086	ENST00000279593	.	.	.	5.33	4.4	0.53042	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1387	0.59423	0.0:0.0:0.7124:0.2876	.	.	.	.	X	1138	.	ENSP00000279593:R1138X	R	-	1	2	GRIN2B	13608027	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	6.184000	0.72008	2.488000	0.83962	0.655000	0.94253	CGA		0.607	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
GYS2	2998	broad.mit.edu	37	12	21728845	21728845	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:21728845A>G	ENST00000261195.2	-	3	704	c.450T>C	c.(448-450)aaT>aaC	p.N150N		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	150					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)	p.N150N(1)		NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TCAGCATATCATTGGCTTCTC	0.438																																					p.N150N	Colon(149;9 1820 3690 10544 50424)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T450C	12						.						141.0	131.0	135.0					12																	21728845		2203	4300	6503	21620112	SO:0001819	synonymous_variant	2998	exon3				CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.450T>C	12.37:g.21728845A>G		Somatic		Capture	Illumina HiSeq	Phase_I	21620112	NM_021957	A0AVD8	Silent	SNP	ENST00000261195.2	37	CCDS8690.1																																																																																				0.438	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
TMTC1	83857	broad.mit.edu	37	12	29908777	29908777	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:29908777G>A	ENST00000539277.1	-	4	654	c.596C>T	c.(595-597)aCg>aTg	p.T199M	TMTC1_ENST00000256062.5_Missense_Mutation_p.T91M|TMTC1_ENST00000381224.2_Missense_Mutation_p.T91M|TMTC1_ENST00000552618.1_Missense_Mutation_p.T199M|TMTC1_ENST00000551659.1_Missense_Mutation_p.T199M	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	199						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.T91M(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GGGAGACACCGTGGAAGGGAA	0.463																																					p.T199M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C596T	12						.						87.0	83.0	84.0					12																	29908777		2203	4300	6503	29800044	SO:0001583	missense	83857	exon4				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.596C>T	12.37:g.29908777G>A	ENSP00000442046:p.Thr199Met	Somatic		Capture	Illumina HiSeq	Phase_I	29800044	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	G	19.72	3.880875	0.72294	.	.	ENSG00000133687	ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.70631	-0.49;-0.25;-0.5;-0.37;1.34	5.45	4.53	0.55603	.	0.107355	0.64402	D	0.000005	T	0.81564	0.4849	M	0.65498	2.005	0.43300	D	0.995294	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.991	T	0.81193	-0.1044	9	.	.	.	-16.0282	14.3678	0.66817	0.0:0.0:0.8518:0.1482	.	91;199	Q8IUR5-3;Q8IUR5	.;TMTC1_HUMAN	M	91;199;199;199;91	ENSP00000256062:T91M;ENSP00000448112:T199M;ENSP00000449043:T199M;ENSP00000442046:T199M;ENSP00000370622:T91M	.	T	-	2	0	TMTC1	29800044	1.000000	0.71417	0.735000	0.30896	0.764000	0.43329	6.881000	0.75584	2.555000	0.86185	0.563000	0.77884	ACG		0.463	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
IPO8	10526	broad.mit.edu	37	12	30806009	30806009	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:30806009G>A	ENST00000256079.4	-	18	2304	c.1966C>T	c.(1966-1968)Ctt>Ttt	p.L656F	IPO8_ENST00000544829.1_Missense_Mutation_p.L451F	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	656					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)	p.L656F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					GCCAGGGAAAGAATTTCTTCA	0.368																																					p.L656F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1966T	12						.						49.0	56.0	54.0					12																	30806009		2200	4298	6498	30697276	SO:0001583	missense	10526	exon18			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.1966C>T	12.37:g.30806009G>A	ENSP00000256079:p.Leu656Phe	Somatic		Capture	Illumina HiSeq	Phase_I	30697276	NM_006390	B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	37	CCDS8719.1	.	.	.	.	.	.	.	.	.	.	G	5.914	0.352757	0.11182	.	.	ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829	T;T	0.39787	1.06;1.06	4.78	2.84	0.33178	Armadillo-like helical (1);Armadillo-type fold (1);	0.189470	0.46442	N	0.000300	T	0.39655	0.1086	N	0.21545	0.675	0.48696	D	0.999691	B;D;B	0.71674	0.18;0.998;0.001	B;D;B	0.69824	0.261;0.966;0.012	T	0.37596	-0.9699	10	0.02654	T	1	-7.4126	9.4522	0.38734	0.1849:0.0:0.8151:0.0	.	451;132;656	B7Z7M3;Q59F59;O15397	.;.;IPO8_HUMAN	F	656;132;451	ENSP00000256079:L656F;ENSP00000444520:L451F	ENSP00000256079:L656F	L	-	1	0	IPO8	30697276	1.000000	0.71417	0.966000	0.40874	0.796000	0.44982	3.936000	0.56568	0.484000	0.27630	0.655000	0.94253	CTT		0.368	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
PPHLN1	51535	broad.mit.edu	37	12	42778750	42778750	+	Missense_Mutation	SNP	C	C	T	rs144485658		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:42778750C>T	ENST00000395568.2	+	6	604	c.520C>T	c.(520-522)Cgt>Tgt	p.R174C	PPHLN1_ENST00000449194.2_Intron|PPHLN1_ENST00000552761.1_Missense_Mutation_p.R126C|PPHLN1_ENST00000358314.7_Missense_Mutation_p.R174C|PPHLN1_ENST00000432191.2_Missense_Mutation_p.R119C|PPHLN1_ENST00000317560.9_Intron|PPHLN1_ENST00000256678.8_Intron|PPHLN1_ENST00000395580.3_Missense_Mutation_p.R181C|PPHLN1_ENST00000337898.6_Missense_Mutation_p.R119C|PPHLN1_ENST00000549190.1_Missense_Mutation_p.R192C	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	174	Ser-rich.				keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R174C(2)		breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		AGAGTCCGTGCGTCCTGGTGC	0.498													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20599	0.0		0.0	False		,,,				2504	0.0				p.R126C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C376T	12						.	C	CYS/ARG,,,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	124.0	105.0	111.0		355,,,520,376,520,376,541	4.5	0.8	12	dbSNP_134	111	0,8600		0,0,4300	no	missense,intron,intron,missense,missense,missense,missense,missense	PPHLN1	NM_001143787.1,NM_001143788.1,NM_001143789.1,NM_016488.6,NM_201438.1,NM_201439.1,NM_201440.1,NM_201515.1	180,,,180,180,180,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,,,benign,benign,benign,benign,benign	119/435,,,174/459,126/259,174/368,126/320,181/375	42778750	1,13005	2203	4300	6503	41065017	SO:0001583	missense	51535	exon6			AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.520C>T	12.37:g.42778750C>T	ENSP00000378935:p.Arg174Cys	Somatic		Capture	Illumina HiSeq	Phase_I	41065017	NM_201438	E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Missense_Mutation	SNP	ENST00000395568.2	37	CCDS31777.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850235	0.71719	2.27E-4	0.0	ENSG00000134283	ENST00000549190;ENST00000395580;ENST00000337898;ENST00000358314;ENST00000395568;ENST00000552761;ENST00000432191	.	.	.	5.4	4.49	0.54785	.	0.394307	0.23351	N	0.049131	T	0.65974	0.2743	L	0.47716	1.5	0.40396	D	0.97959	D;D;D;D;D;D;D	0.89917	0.997;1.0;0.999;0.999;0.998;0.998;0.998	P;D;P;P;P;P;P	0.65010	0.642;0.931;0.759;0.736;0.731;0.736;0.804	T	0.66089	-0.6010	9	0.41790	T	0.15	-1.0689	11.8718	0.52525	0.0:0.8248:0.1752:0.0	.	119;119;174;126;181;126;192	B7Z8L1;Q8NEY8-3;Q8NEY8;Q8NEY8-6;Q8NEY8-2;Q8NEY8-5;F8W0Q9	.;.;PPHLN_HUMAN;.;.;.;.	C	192;181;119;174;174;126;119	.	ENSP00000338510:R119C	R	+	1	0	PPHLN1	41065017	0.998000	0.40836	0.831000	0.32960	0.919000	0.55068	1.995000	0.40767	1.464000	0.47987	0.655000	0.94253	CGT		0.498	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404047.1	NM_201515	
KMT2D	8085	broad.mit.edu	37	12	49420526	49420526	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:49420526C>T	ENST00000301067.7	-	48	15222	c.15223G>A	c.(15223-15225)Ggg>Agg	p.G5075R		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5075					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.G5075R(1)|p.G4805R(1)									ATCAGTGCCCCGCCCTGGGTC	0.627																																					p.G5075R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G15223A	12						.						44.0	49.0	47.0					12																	49420526		2079	4201	6280	47706793	SO:0001583	missense	8085	exon48			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.15223G>A	12.37:g.49420526C>T	ENSP00000301067:p.Gly5075Arg	Somatic		Capture	Illumina HiSeq	Phase_I	47706793	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.329952	0.41297	.	.	ENSG00000167548	ENST00000301067	T	0.70399	-0.48	4.48	4.48	0.54585	.	0.000000	0.37304	N	0.002158	D	0.86732	0.6003	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89979	0.4099	10	0.87932	D	0	.	16.3049	0.82844	0.0:1.0:0.0:0.0	.	5075	O14686	MLL2_HUMAN	R	5075	ENSP00000301067:G5075R	ENSP00000301067:G5075R	G	-	1	0	MLL2	47706793	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	7.818000	0.86416	2.226000	0.72624	0.655000	0.94253	GGG		0.627	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KMT2D	8085	broad.mit.edu	37	12	49440130	49440130	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:49440130C>A	ENST00000301067.7	-	16	4495	c.4496G>T	c.(4495-4497)gGg>gTg	p.G1499V		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1499	Cys-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.G1499V(1)|p.G1226V(1)									GGCACAGGGCCCACAGTGTGT	0.547																																					p.G1499V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4496T	12						.						94.0	104.0	101.0					12																	49440130		2150	4252	6402	47726397	SO:0001583	missense	8085	exon16			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.4496G>T	12.37:g.49440130C>A	ENSP00000301067:p.Gly1499Val	Somatic		Capture	Illumina HiSeq	Phase_I	47726397	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.449119	0.26074	.	.	ENSG00000167548	ENST00000301067	T	0.62788	0.0	5.31	4.42	0.53409	Zinc finger, FYVE/PHD-type (1);	0.000000	0.39210	N	0.001437	T	0.71550	0.3353	M	0.73217	2.22	0.80722	D	1	D	0.69078	0.997	P	0.59643	0.861	T	0.73720	-0.3894	10	0.87932	D	0	.	8.1988	0.31413	0.0:0.6521:0.2641:0.0837	.	1499	O14686	MLL2_HUMAN	V	1499	ENSP00000301067:G1499V	ENSP00000301067:G1499V	G	-	2	0	MLL2	47726397	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	3.516000	0.53436	1.236000	0.43740	0.655000	0.94253	GGG		0.547	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
ACVR1B	91	broad.mit.edu	37	12	52385730	52385730	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:52385730G>A	ENST00000257963.4	+	8	1422	c.1345G>A	c.(1345-1347)Gat>Aat	p.D449N	ACVR1B_ENST00000563121.1_3'UTR|ACVR1B_ENST00000542485.1_Missense_Mutation_p.D397N|ACVR1B_ENST00000541224.1_Missense_Mutation_p.D490N|ACVR1B_ENST00000426655.2_Missense_Mutation_p.D449N	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	449	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.D490N(1)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	GGTTGTATGTGATCAGAAGCT	0.493																																					p.D397N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1189A	12						.						169.0	147.0	154.0					12																	52385730		2203	4300	6503	50671997	SO:0001583	missense	91	exon8				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.1345G>A	12.37:g.52385730G>A	ENSP00000257963:p.Asp449Asn	Somatic		Capture	Illumina HiSeq	Phase_I	50671997	NM_020327	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926274	0.92319	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000542485	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	4.05	4.05	0.47172	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.099697	0.64402	D	0.000003	T	0.64768	0.2628	L	0.31207	0.915	0.80722	D	1	P;P;P	0.39862	0.692;0.578;0.523	B;P;B	0.51453	0.397;0.67;0.397	T	0.69989	-0.4995	10	0.72032	D	0.01	.	17.5301	0.87811	0.0:0.0:1.0:0.0	.	490;449;449	P36896-4;P36896;P36896-2	.;ACV1B_HUMAN;.	N	449;490;449;397	ENSP00000257963:D449N;ENSP00000442656:D490N;ENSP00000390477:D449N;ENSP00000442885:D397N	ENSP00000257963:D449N	D	+	1	0	ACVR1B	50671997	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.555000	0.98123	2.545000	0.85829	0.462000	0.41574	GAT		0.493	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
KRT75	9119	broad.mit.edu	37	12	52818430	52818430	+	Silent	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:52818430C>A	ENST00000252245.5	-	9	1747	c.1527G>T	c.(1525-1527)ggG>ggT	p.G509G	RP11-1020M18.10_ENST00000548135.1_RNA	NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	509	Tail.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.G509G(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		CCAGGCTATGCCCACCACTGG	0.607																																					p.G509G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1527T	12						.						92.0	95.0	94.0					12																	52818430		2203	4300	6503	51104697	SO:0001819	synonymous_variant	9119	exon9			Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.1527G>T	12.37:g.52818430C>A		Somatic		Capture	Illumina HiSeq	Phase_I	51104697	NM_004693	B4DQU4|Q9NSA9	Silent	SNP	ENST00000252245.5	37	CCDS8827.1																																																																																				0.607	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1	NM_004693	
KRT73	319101	broad.mit.edu	37	12	53010070	53010070	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:53010070G>T	ENST00000305748.3	-	2	576	c.542C>A	c.(541-543)cCc>cAc	p.P181H	RP11-641A6.2_ENST00000549180.1_RNA|RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	181	Linker 1.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.P181H(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCAAGGATGGGCTCCAGGTT	0.602																																					p.P181H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C542A	12						.						184.0	167.0	173.0					12																	53010070		2203	4300	6503	51296337	SO:0001583	missense	319101	exon2			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.542C>A	12.37:g.53010070G>T	ENSP00000307014:p.Pro181His	Somatic		Capture	Illumina HiSeq	Phase_I	51296337	NM_175068	Q32MB2	Missense_Mutation	SNP	ENST00000305748.3	37	CCDS8834.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.684079	0.47991	.	.	ENSG00000186049	ENST00000305748	D	0.88664	-2.41	5.07	5.07	0.68467	Filament (1);	0.120193	0.37483	N	0.002075	D	0.94666	0.8280	M	0.88512	2.96	0.32570	N	0.529952	D	0.71674	0.998	D	0.70935	0.971	D	0.95769	0.8807	10	0.87932	D	0	.	13.2157	0.59859	0.0854:0.0:0.9146:0.0	.	181	Q86Y46	K2C73_HUMAN	H	181	ENSP00000307014:P181H	ENSP00000307014:P181H	P	-	2	0	KRT73	51296337	0.017000	0.18338	0.996000	0.52242	0.310000	0.27922	1.280000	0.33202	2.739000	0.93911	0.655000	0.94253	CCC		0.602	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068	
HNRNPA1	3178	broad.mit.edu	37	12	54675278	54675278	+	Missense_Mutation	SNP	G	G	A	rs61910737	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:54675278G>A	ENST00000340913.6	+	2	177	c.124G>A	c.(124-126)Gac>Aac	p.D42N	HNRNPA1_ENST00000330752.8_Missense_Mutation_p.D42N|CBX5_ENST00000209875.4_5'Flank|RP11-968A15.8_ENST00000553061.1_RNA|RP11-968A15.2_ENST00000547177.1_RNA|HNRNPA1_ENST00000546500.1_Missense_Mutation_p.D42N|HNRNPA1_ENST00000547276.1_Missense_Mutation_p.D42N	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	42	Globular A domain.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)	p.D42N(1)|p.D42H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						AACGCTCACGGACTGTGTGGT	0.468																																					p.D42N	Colon(83;502 1289 8436 16406 24870)											.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.G124A	12						.						41.0	44.0	43.0					12																	54675278		2134	4281	6415	52961545	SO:0001583	missense	3178	exon2			BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.124G>A	12.37:g.54675278G>A	ENSP00000341826:p.Asp42Asn	Somatic		Capture	Illumina HiSeq	Phase_I	52961545	NM_031157	A8K4Z8|Q3MIB7|Q6PJZ7	Missense_Mutation	SNP	ENST00000340913.6	37	CCDS44909.1	.	.	.	.	.	.	.	.	.	.	G	34	5.357157	0.95854	.	.	ENSG00000135486	ENST00000546500;ENST00000547708;ENST00000547617;ENST00000552494;ENST00000340913;ENST00000330752;ENST00000552591;ENST00000551702;ENST00000551133;ENST00000547276;ENST00000548688	D;D;D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	4.43	4.43	0.53597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.56097	D	0.000022	D	0.91503	0.7317	L	0.60957	1.885	0.58432	D	0.999999	P;P;P;B;P;D	0.56287	0.487;0.928;0.844;0.004;0.928;0.975	B;P;B;B;P;P	0.57101	0.313;0.578;0.313;0.092;0.578;0.813	D	0.92544	0.6044	10	0.87932	D	0	.	15.3753	0.74598	0.0:0.0:1.0:0.0	rs61910737	42;42;42;42;42;42	F8VRQ1;F8W6I7;F8VSB5;P09651-3;P09651-2;P09651	.;.;.;.;.;ROA1_HUMAN	N	42;42;42;42;42;42;42;42;42;42;61	ENSP00000448617:D42N;ENSP00000448229:D42N;ENSP00000341826:D42N;ENSP00000333504:D42N;ENSP00000448117:D42N;ENSP00000447260:D42N;ENSP00000447782:D61N	ENSP00000333504:D42N	D	+	1	0	HNRNPA1	52961545	1.000000	0.71417	0.938000	0.37757	0.927000	0.56198	7.827000	0.86722	2.407000	0.81776	0.491000	0.48974	GAC		0.468	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
DYRK2	8445	broad.mit.edu	37	12	68051842	68051842	+	Silent	SNP	G	G	A	rs146652644		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:68051842G>A	ENST00000344096.3	+	3	1568	c.1155G>A	c.(1153-1155)tcG>tcA	p.S385S	DYRK2_ENST00000393555.3_Silent_p.S312S|RP11-335O4.3_ENST00000425371.2_RNA	NM_006482.2	NP_006473.2	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2	385	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of NFAT protein import into nucleus (GO:0051534)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein phosphorylation (GO:0006468)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|ubiquitin binding (GO:0043130)	p.S385S(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		ACATCCAGTCGCGTTTTTACC	0.488																																					p.S312S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G936A	12						.	G	,	0,4406		0,0,2203	93.0	87.0	89.0		936,1155	-2.4	0.9	12	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	DYRK2	NM_003583.3,NM_006482.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	312/529,385/602	68051842	1,13005	2203	4300	6503	66338109	SO:0001819	synonymous_variant	8445	exon2			Y09216	CCDS8978.1, CCDS8979.1	12q15	2008-07-03				ENSG00000127334			3093	protein-coding gene	gene with protein product		603496				9748265	Standard	NM_003583		Approved		uc001str.4	Q92630		ENST00000344096.3:c.1155G>A	12.37:g.68051842G>A		Somatic		Capture	Illumina HiSeq	Phase_I	66338109	NM_003583	B2R9V9|Q9BRB5	Silent	SNP	ENST00000344096.3	37	CCDS8978.1																																																																																				0.488	DYRK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402218.1		
LGR5	8549	broad.mit.edu	37	12	71977460	71977460	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:71977460G>A	ENST00000266674.5	+	18	1981	c.1670G>A	c.(1669-1671)gGc>gAc	p.G557D	RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000536515.1_Missense_Mutation_p.G485D|LGR5_ENST00000540815.2_Missense_Mutation_p.G533D			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	557					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.G557D(1)	NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						CTGCTTGATGGCTGGCTGATC	0.443																																					p.G557D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1670A	12						.						202.0	187.0	192.0					12																	71977460		2203	4300	6503	70263727	SO:0001583	missense	8549	exon18			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.1670G>A	12.37:g.71977460G>A	ENSP00000266674:p.Gly557Asp	Somatic		Capture	Illumina HiSeq	Phase_I	70263727	NM_003667	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	ENST00000266674.5	37	CCDS9000.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.636798	0.47049	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515;ENST00000540815	D;D;D	0.85702	-2.02;-2.02;-2.02	5.84	4.95	0.65309	.	0.138670	0.51477	D	0.000094	T	0.71256	0.3318	N	0.08118	0	0.39622	D	0.970042	B;B	0.21225	0.053;0.032	B;B	0.28916	0.096;0.027	T	0.65981	-0.6036	10	0.07175	T	0.84	.	14.9721	0.71243	0.0682:0.0:0.9318:0.0	.	533;557	O75473-2;O75473	.;LGR5_HUMAN	D	557;557;485;533	ENSP00000266674:G557D;ENSP00000443033:G485D;ENSP00000441035:G533D	ENSP00000266674:G557D	G	+	2	0	LGR5	70263727	1.000000	0.71417	0.980000	0.43619	0.799000	0.45148	6.778000	0.75043	1.486000	0.48398	0.655000	0.94253	GGC		0.443	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667	
MYF6	4618	broad.mit.edu	37	12	81101618	81101618	+	Silent	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:81101618C>A	ENST00000228641.3	+	1	342	c.120C>A	c.(118-120)acC>acA	p.T40T		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	40					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T40T(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						GTGATGGTACCTTGTCCCCCT	0.582																																					p.T40T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C120A	12						.						77.0	79.0	78.0					12																	81101618		2203	4300	6503	79625749	SO:0001819	synonymous_variant	4618	exon1				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.120C>A	12.37:g.81101618C>A		Somatic		Capture	Illumina HiSeq	Phase_I	79625749	NM_002469	B2R898|Q53X80|Q6FHI9	Silent	SNP	ENST00000228641.3	37	CCDS9019.1																																																																																				0.582	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407756.1	NM_002469	
ACSS3	79611	broad.mit.edu	37	12	81647175	81647175	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:81647175A>G	ENST00000548058.1	+	14	2719	c.1809A>G	c.(1807-1809)gtA>gtG	p.V603V	ACSS3_ENST00000548324.1_Silent_p.V285V|ACSS3_ENST00000261206.3_Silent_p.V602V			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	603						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)	p.V603V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						CACTCTGTGTATTGAGAAAAG	0.423																																					p.V603V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1809G	12						.						192.0	188.0	189.0					12																	81647175		2203	4300	6503	80171306	SO:0001819	synonymous_variant	79611	exon14				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1809A>G	12.37:g.81647175A>G		Somatic		Capture	Illumina HiSeq	Phase_I	80171306	NM_024560	Q8NC66	Silent	SNP	ENST00000548058.1	37	CCDS9022.1																																																																																				0.423	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
APAF1	317	broad.mit.edu	37	12	99097192	99097192	+	Missense_Mutation	SNP	C	C	T	rs200461221		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:99097192C>T	ENST00000551964.1	+	18	3246	c.2510C>T	c.(2509-2511)aCg>aTg	p.T837M	APAF1_ENST00000550527.1_Missense_Mutation_p.T826M|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000339433.3_Intron|APAF1_ENST00000547045.1_Intron|APAF1_ENST00000359972.2_Intron|APAF1_ENST00000549007.1_Intron|APAF1_ENST00000357310.1_Intron	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	837					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)	p.T837M(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	GAAATCCACACGGGCCATCAC	0.413																																					p.T826M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2477T	12						.						101.0	91.0	95.0					12																	99097192		2203	4300	6503	97621323	SO:0001583	missense	317	exon18			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.2510C>T	12.37:g.99097192C>T	ENSP00000448165:p.Thr837Met	Somatic		Capture	Illumina HiSeq	Phase_I	97621323	NM_013229	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	37	CCDS9069.1	.	.	.	.	.	.	.	.	.	.	C	13.21	2.170587	0.38315	.	.	ENSG00000120868	ENST00000551964;ENST00000550527	T;T	0.62788	0.0;0.01	5.93	2.18	0.27775	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.341358	0.37761	N	0.001956	T	0.58694	0.2140	M	0.67953	2.075	0.34371	D	0.691997	P;B	0.35628	0.513;0.24	B;B	0.37731	0.257;0.036	T	0.64635	-0.6361	10	0.48119	T	0.1	-11.5802	9.5883	0.39530	0.0:0.6555:0.0:0.3445	.	837;826	O14727;O14727-2	APAF_HUMAN;.	M	837;826	ENSP00000448165:T837M;ENSP00000448449:T826M	ENSP00000448449:T826M	T	+	2	0	APAF1	97621323	0.151000	0.22747	0.932000	0.37286	0.711000	0.40976	0.920000	0.28705	0.139000	0.18822	-0.794000	0.03295	ACG		0.413	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1	
ANO4	121601	broad.mit.edu	37	12	101368648	101368648	+	Missense_Mutation	SNP	C	C	T	rs144445830		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:101368648C>T	ENST00000392977.3	+	7	793	c.583C>T	c.(583-585)Cgt>Tgt	p.R195C	ANO4_ENST00000538618.1_3'UTR|ANO4_ENST00000392979.3_Missense_Mutation_p.R160C|ANO4_ENST00000299222.9_5'UTR			Q32M45	ANO4_HUMAN	anoctamin 4	195					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.R160C(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CCTGCCCCGCCGTTACAAGTT	0.468										HNSCC(74;0.22)			C|||	1	0.000199681	0.0	0.0	5008	,	,		16629	0.001		0.0	False		,,,				2504	0.0				p.R160C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C478T	12						.						132.0	125.0	128.0					12																	101368648		2203	4300	6503	99892779	SO:0001583	missense	121601	exon6			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.583C>T	12.37:g.101368648C>T	ENSP00000376703:p.Arg195Cys	Somatic		Capture	Illumina HiSeq	Phase_I	99892779	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	22.0	4.229297	0.79688	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.67171	-0.25;-0.25	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000001	T	0.78666	0.4319	L	0.55990	1.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.65010	0.912;0.931	T	0.79429	-0.1807	10	0.62326	D	0.03	.	19.4375	0.94801	0.0:1.0:0.0:0.0	.	195;160	Q32M45;Q32M45-2	ANO4_HUMAN;.	C	160;195	ENSP00000376705:R160C;ENSP00000376703:R195C	ENSP00000376703:R195C	R	+	1	0	ANO4	99892779	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.392000	0.59659	2.594000	0.87642	0.650000	0.86243	CGT		0.468	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
POLE	5426	broad.mit.edu	37	12	133233825	133233825	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr12:133233825C>T	ENST00000320574.5	-	29	3522	c.3479G>A	c.(3478-3480)cGt>cAt	p.R1160H	POLE_ENST00000535270.1_Missense_Mutation_p.R1133H	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1160					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.R1160H(1)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GTGTTTGACACGTGGCACTGG	0.532								DNA polymerases (catalytic subunits)																													p.R1160H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3479A	12						.						103.0	101.0	102.0					12																	133233825		2203	4300	6503	131743898	SO:0001583	missense	5426	exon29				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.3479G>A	12.37:g.133233825C>T	ENSP00000322570:p.Arg1160His	Somatic		Capture	Illumina HiSeq	Phase_I	131743898	NM_006231	Q13533|Q86VH9	De_novo_Start_OutOfFrame	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	C	33	5.273253	0.95429	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000536445;ENST00000376577	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	6.14	6.14	0.99180	.	0.000000	0.85682	D	0.000000	T	0.52853	0.1760	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.993	T	0.56805	-0.7918	10	0.87932	D	0	.	20.8597	0.99761	0.0:1.0:0.0:0.0	.	1133;1160	F5H1D6;Q07864	.;DPOE1_HUMAN	H	1160;1171;1133;940;137;1095	ENSP00000322570:R1160H;ENSP00000406383:R1171H;ENSP00000445753:R1133H;ENSP00000442519:R940H	ENSP00000322570:R1160H	R	-	2	0	POLE	131743898	1.000000	0.71417	0.113000	0.21522	0.934000	0.57294	7.690000	0.84178	2.937000	0.99478	0.650000	0.86243	CGT		0.532	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
C1QTNF9B	387911	broad.mit.edu	37	13	24465977	24465977	+	Silent	SNP	C	C	T	rs200793733		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr13:24465977C>T	ENST00000382140.2	-	5	513	c.453G>A	c.(451-453)ccG>ccA	p.P151P	C1QTNF9B_ENST00000556521.1_Intron|C1QTNF9B-AS1_ENST00000382133.4_RNA|C1QTNF9B-AS1_ENST00000417034.1_RNA|C1QTNF9B_ENST00000382145.1_Intron|C1QTNF9B-AS1_ENST00000435039.2_RNA|C1QTNF9B_ENST00000382057.3_Intron|MIPEP_ENST00000469167.1_5'Flank|C1QTNF9B_ENST00000382137.3_Silent_p.P151P|MIPEP_ENST00000382172.3_5'Flank			B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B	151	Collagen-like 2.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)		p.P151P(1)		breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						CCATGGGGCCCGGTAAACCAG	0.642																																					p.P77P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C231T	13						.	C	,,	1,4389		0,1,2194	15.0	22.0	20.0		453,231,258	-1.8	0.0	13		20	4,8586		0,4,4291	no	coding-synonymous,coding-synonymous,coding-synonymous	C1QTNF9B,C1QTNF9B-AS1	NM_001007537.1,NM_001014442.2,NM_001135816.1	,,	0,5,6485	TT,TC,CC		0.0466,0.0228,0.0385	,,	151/334,77/108,86/117	24465977	5,12975	2195	4295	6490	23363977	SO:0001819	synonymous_variant	387911	exon4			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863			34072	protein-coding gene	gene with protein product		614148				17544811	Standard	NM_001007537		Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382140.2:c.453G>A	13.37:g.24465977C>T		Somatic		Capture	Illumina HiSeq	Phase_I	23363977	NM_001014442	A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Silent	SNP	ENST00000382140.2	37	CCDS31947.1																																																																																				0.642	C1QTNF9B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044162.3	NM_001007537	
PARP4	143	broad.mit.edu	37	13	25029207	25029207	+	Silent	SNP	C	C	T	rs201350007		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr13:25029207C>T	ENST00000381989.3	-	22	2811	c.2706G>A	c.(2704-2706)gcG>gcA	p.A902A	PARP4_ENST00000480576.1_5'Flank	NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	902	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.A902A(2)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CCAAGGACAGCGCATGCAAGG	0.517													c|||	1	0.000199681	0.0	0.0	5008	,	,		20131	0.0		0.001	False		,,,				2504	0.0				p.A902A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2706A	13						.						279.0	240.0	253.0					13																	25029207		2203	4300	6503	23927207	SO:0001819	synonymous_variant	143	exon22			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.2706G>A	13.37:g.25029207C>T		Somatic		Capture	Illumina HiSeq	Phase_I	23927207	NM_006437	O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	ENST00000381989.3	37	CCDS9307.1																																																																																				0.517	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
MTMR6	9107	broad.mit.edu	37	13	25823596	25823596	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr13:25823596C>T	ENST00000381801.5	-	14	2401	c.1640G>A	c.(1639-1641)gGc>gAc	p.G547D	MTMR6_ENST00000540661.1_Intron|AL590787.1_ENST00000408397.1_RNA	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	547					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.G547D(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		GGTGAGGATGCCATCTGTTTG	0.338																																					p.G547D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1640A	13						.						142.0	133.0	136.0					13																	25823596		2203	4300	6503	24721596	SO:0001583	missense	9107	exon14			AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.1640G>A	13.37:g.25823596C>T	ENSP00000371221:p.Gly547Asp	Somatic		Capture	Illumina HiSeq	Phase_I	24721596	NM_004685	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	ENST00000381801.5	37	CCDS9313.1	.	.	.	.	.	.	.	.	.	.	C	6.474	0.455688	0.12283	.	.	ENSG00000139505	ENST00000381801;ENST00000319298	D	0.93811	-3.29	5.65	-2.83	0.05769	.	1.037430	0.07537	N	0.913234	D	0.87935	0.6303	L	0.50333	1.59	0.38106	D	0.937415	B	0.02656	0.0	B	0.04013	0.001	T	0.73541	-0.3950	10	0.26408	T	0.33	.	4.5309	0.12004	0.1018:0.2971:0.0919:0.5092	.	547	Q9Y217	MTMR6_HUMAN	D	547;115	ENSP00000371221:G547D	ENSP00000317987:G115D	G	-	2	0	MTMR6	24721596	0.000000	0.05858	0.018000	0.16275	0.902000	0.53008	-1.173000	0.03108	-0.287000	0.09064	-0.137000	0.14449	GGC		0.338	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044225.1	NM_004685	
ATP8A2	51761	broad.mit.edu	37	13	26411398	26411398	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr13:26411398A>C	ENST00000381655.2	+	29	2994	c.2852A>C	c.(2851-2853)cAg>cCg	p.Q951P	ATP8A2_ENST00000255283.8_Missense_Mutation_p.Q886P|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	911					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.Q951P(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AAAATCACCCAGAATGGCGAA	0.493																																					p.Q951P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2852C	13						.						110.0	103.0	105.0					13																	26411398		1929	4135	6064	25309398	SO:0001583	missense	51761	exon29			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.2852A>C	13.37:g.26411398A>C	ENSP00000371070:p.Gln951Pro	Somatic		Capture	Illumina HiSeq	Phase_I	25309398	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	A	18.86	3.712754	0.68730	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.47869	0.83;0.83	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.59128	0.2171	M	0.69463	2.115	0.80722	D	1	P;P;P	0.45594	0.783;0.862;0.783	B;P;B	0.49953	0.423;0.627;0.26	T	0.62793	-0.6779	10	0.66056	D	0.02	.	16.2009	0.82078	1.0:0.0:0.0:0.0	.	886;731;911	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	P	951;886;731	ENSP00000371070:Q951P;ENSP00000255283:Q886P	ENSP00000255283:Q886P	Q	+	2	0	ATP8A2	25309398	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.339000	0.96797	2.235000	0.73313	0.533000	0.62120	CAG		0.493	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
TRPC4	7223	broad.mit.edu	37	13	38225546	38225546	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr13:38225546A>G	ENST00000379705.3	-	8	2792	c.1935T>C	c.(1933-1935)agT>agC	p.S645S	TRPC4_ENST00000447043.1_Silent_p.S645S|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000355779.2_Silent_p.S645S|TRPC4_ENST00000379681.3_Silent_p.S645S|TRPC4_ENST00000338947.5_Silent_p.S472S|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000358477.2_Silent_p.S645S|TRPC4_ENST00000379679.1_Silent_p.S472S			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	645	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.S645S(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CTTCAAAATAACTCATCCAAA	0.433																																					p.S645S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1935C	13						.						131.0	127.0	128.0					13																	38225546		2203	4300	6503	37123546	SO:0001819	synonymous_variant	7223	exon8			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1935T>C	13.37:g.38225546A>G		Somatic		Capture	Illumina HiSeq	Phase_I	37123546	NM_001135957	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Silent	SNP	ENST00000379705.3	37	CCDS9365.1																																																																																				0.433	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
FREM2	341640	broad.mit.edu	37	13	39424215	39424215	+	Silent	SNP	C	C	T	rs144582052		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr13:39424215C>T	ENST00000280481.7	+	9	6636	c.6420C>T	c.(6418-6420)agC>agT	p.S2140S	FREM2_ENST00000482551.1_3'UTR	NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2140	Calx-beta 4.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S2140R(1)|p.S2140S(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ATACTGGCAGCGAAAGTGATG	0.433													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20495	0.0		0.0	False		,,,				2504	0.0				p.S2140S												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	cervix(1)|large_intestine(1)	c.C6420T	13						.	C		0,4406		0,0,2203	108.0	101.0	103.0		6420	-0.9	0.9	13	dbSNP_134	103	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FREM2	NM_207361.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		2140/3170	39424215	1,13005	2203	4300	6503	38322215	SO:0001819	synonymous_variant	341640	exon9			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.6420C>T	13.37:g.39424215C>T		Somatic		Capture	Illumina HiSeq	Phase_I	38322215	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																				0.433	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
KBTBD6	89890	broad.mit.edu	37	13	41706125	41706125	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr13:41706125C>T	ENST00000379485.1	-	1	757	c.523G>A	c.(523-525)Gcc>Acc	p.A175T	KBTBD6_ENST00000499385.2_Missense_Mutation_p.A109T	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	175								p.A175T(1)		NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		TTGAGGATGGCGGTGCAGTTG	0.572																																					p.A175T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G523A	13						.						98.0	91.0	94.0					13																	41706125		2203	4300	6503	40604125	SO:0001583	missense	89890	exon1			AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.523G>A	13.37:g.41706125C>T	ENSP00000368799:p.Ala175Thr	Somatic		Capture	Illumina HiSeq	Phase_I	40604125	NM_152903	Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	ENST00000379485.1	37	CCDS9376.1	.	.	.	.	.	.	.	.	.	.	c	11.42	1.634365	0.29068	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.69306	-0.39;-0.39	3.56	1.53	0.23141	BTB/Kelch-associated (2);	0.427722	0.22183	N	0.063476	T	0.49609	0.1567	L	0.52573	1.65	0.30006	N	0.815632	D;P	0.55385	0.971;0.935	B;B	0.38655	0.236;0.278	T	0.57659	-0.7773	10	0.87932	D	0	.	1.7941	0.03058	0.2128:0.458:0.2071:0.1221	.	109;175	F5GZN7;Q86V97	.;KBTB6_HUMAN	T	175;109	ENSP00000368799:A175T;ENSP00000444326:A109T	ENSP00000368799:A175T	A	-	1	0	KBTBD6	40604125	1.000000	0.71417	0.926000	0.36857	0.309000	0.27889	4.452000	0.60054	0.799000	0.34018	0.313000	0.20887	GCC		0.572	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903	
SALL2	6297	broad.mit.edu	37	14	22005025	22005025	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:22005025G>A	ENST00000327430.3	-	1	325	c.31C>T	c.(31-33)Cag>Tag	p.Q11*	SALL2_ENST00000317492.5_Nonsense_Mutation_p.Q11*	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	11					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q11*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GAGATTAACTGTTGGGGTTTC	0.627																																					p.Q11X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C31T	14						.						96.0	91.0	93.0					14																	22005025		2203	4300	6503	21074865	SO:0001587	stop_gained	6297	exon1			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.31C>T	14.37:g.22005025G>A	ENSP00000333537:p.Gln11*	Somatic		Capture	Illumina HiSeq	Phase_I	21074865	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Nonsense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	.	.	.	.	.	.	.	.	.	.	G	37	6.356521	0.97502	.	.	ENSG00000165821	ENST00000327430;ENST00000317492;ENST00000541876	.	.	.	5.2	5.2	0.72013	.	0.000000	0.35124	U	0.003430	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-1.1539	15.6582	0.77158	0.0:0.0:1.0:0.0	.	.	.	.	X	11	.	ENSP00000320536:Q11X	Q	-	1	0	SALL2	21074865	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.012000	0.64017	2.421000	0.82119	0.655000	0.94253	CAG		0.627	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
IPO4	79711	broad.mit.edu	37	14	24646684	24646684	+	IGR	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:24646684G>T	ENST00000354464.6	-	0	3646				REC8_ENST00000311457.3_Nonsense_Mutation_p.G250*|REC8_ENST00000559919.1_Nonsense_Mutation_p.G250*	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4						DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)		p.G250*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		GGAAGGAATAGGAGAGGCACT	0.592																																					p.G250X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G748T	14						.						81.0	89.0	86.0					14																	24646684		1985	4169	6154	23716524	SO:0001628	intergenic_variant	9985	exon11			AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801		14.37:g.24646684G>T		Somatic		Capture	Illumina HiSeq	Phase_I	23716524	NM_005132	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Nonsense_Mutation	SNP	ENST00000354464.6	37	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	G	39	7.669404	0.98422	.	.	ENSG00000100918	ENST00000311457;ENST00000447460	.	.	.	5.21	3.37	0.38596	.	2.209150	0.01774	N	0.031327	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	2.8258	6.8989	0.24271	0.0931:0.1765:0.7305:0.0	.	.	.	.	X	250	.	ENSP00000308699:G250X	G	+	1	0	REC8	23716524	0.002000	0.14202	0.001000	0.08648	0.018000	0.09664	1.166000	0.31834	0.763000	0.33175	0.561000	0.74099	GGA		0.592	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
RIPK3	11035	broad.mit.edu	37	14	24808271	24808271	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:24808271G>C	ENST00000216274.5	-	3	639	c.421C>G	c.(421-423)Cgg>Ggg	p.R141G	RIPK3_ENST00000554338.1_5'Flank|RP11-934B9.3_ENST00000555591.1_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	141	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)	p.R141G(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		TTGAGGTCCCGGTGCAGGAGC	0.627																																					p.R141G	Pancreas(58;918 1191 4668 13304 15331)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C421G	14						.						38.0	46.0	43.0					14																	24808271		2197	4296	6493	23878111	SO:0001583	missense	11035	exon3			AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.421C>G	14.37:g.24808271G>C	ENSP00000216274:p.Arg141Gly	Somatic		Capture	Illumina HiSeq	Phase_I	23878111	NM_006871	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Missense_Mutation	SNP	ENST00000216274.5	37	CCDS9628.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889754	0.52014	.	.	ENSG00000129465	ENST00000216274	T	0.74209	-0.82	4.69	-1.24	0.09435	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43919	D	0.000510	T	0.73528	0.3598	L	0.46885	1.475	0.31012	N	0.719141	B;D	0.63046	0.282;0.992	B;P	0.61800	0.057;0.894	T	0.70662	-0.4810	10	0.62326	D	0.03	-12.9857	5.4078	0.16330	0.1637:0.0:0.4071:0.4292	.	141;141	B4DJZ5;Q9Y572	.;RIPK3_HUMAN	G	141	ENSP00000216274:R141G	ENSP00000216274:R141G	R	-	1	2	RIPK3	23878111	0.994000	0.37717	0.728000	0.30774	0.626000	0.37791	1.168000	0.31859	-0.086000	0.12550	0.561000	0.74099	CGG		0.627	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871	
NFATC4	4776	broad.mit.edu	37	14	24839259	24839259	+	Silent	SNP	C	C	A	rs376016567		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:24839259C>A	ENST00000250373.4	+	2	796	c.655C>A	c.(655-657)Cgg>Agg	p.R219R	NFATC4_ENST00000555167.1_5'Flank|NFATC4_ENST00000553708.1_Silent_p.R219R|NFATC4_ENST00000424781.2_Silent_p.R232R|NFATC4_ENST00000554591.1_Silent_p.R282R|NFATC4_ENST00000554050.1_Silent_p.R219R|NFATC4_ENST00000422617.3_Silent_p.R207R|NFATC4_ENST00000553879.1_Silent_p.R149R|NFATC4_ENST00000555590.1_Silent_p.R232R|NFATC4_ENST00000413692.2_Silent_p.R282R|NFATC4_ENST00000539237.2_Silent_p.R251R|NFATC4_ENST00000553469.1_Silent_p.R251R|NFATC4_ENST00000440487.2_3'UTR|NFATC4_ENST00000554661.1_Silent_p.R149R|NFATC4_ENST00000554344.1_Silent_p.R149R|NFATC4_ENST00000556279.1_Silent_p.R251R|NFATC4_ENST00000557451.1_Silent_p.R149R|NFATC4_ENST00000554473.1_5'Flank|NFATC4_ENST00000554966.1_Silent_p.R232R|NFATC4_ENST00000556759.1_5'Flank|NFATC4_ENST00000556169.1_Silent_p.R207R|NFATC4_ENST00000555453.1_Silent_p.R207R	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	219	2 approximate SP repeats.|Pro-rich.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)	p.R219R(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		GCCCTCGCCCCGGGCCTCCCC	0.682																																					p.R282R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C844A	14						.						16.0	19.0	18.0					14																	24839259		2189	4273	6462	23909099	SO:0001819	synonymous_variant	4776	exon3			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.655C>A	14.37:g.24839259C>A		Somatic		Capture	Illumina HiSeq	Phase_I	23909099	NM_001136022	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Silent	SNP	ENST00000250373.4	37	CCDS9629.1																																																																																				0.682	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6	NM_004554	
LRFN5	145581	broad.mit.edu	37	14	42355882	42355882	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:42355882G>A	ENST00000298119.4	+	3	1243	c.54G>A	c.(52-54)caG>caA	p.Q18Q	LRFN5_ENST00000554120.1_Silent_p.Q18Q|LRFN5_ENST00000554171.1_Silent_p.Q18Q	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	18	LRRNT.					integral component of membrane (GO:0016021)		p.Q18Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGAAAGCTCAGATCTGTCCAA	0.383										HNSCC(30;0.082)																											p.Q18Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G54A	14						.						82.0	76.0	78.0					14																	42355882		2203	4300	6503	41425632	SO:0001819	synonymous_variant	145581	exon3			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.54G>A	14.37:g.42355882G>A		Somatic		Capture	Illumina HiSeq	Phase_I	41425632	NM_152447	B3KU78|Q86XL2	Silent	SNP	ENST00000298119.4	37	CCDS9678.1																																																																																				0.383	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
LRFN5	145581	broad.mit.edu	37	14	42356756	42356756	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:42356756G>T	ENST00000298119.4	+	3	2117	c.928G>T	c.(928-930)Gcc>Tcc	p.A310S	LRFN5_ENST00000554120.1_Missense_Mutation_p.A310S|LRFN5_ENST00000554171.1_Missense_Mutation_p.A310S	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	310	Ig-like.					integral component of membrane (GO:0016021)		p.A310S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GAGGTGCAAAGCCAGGGGAGA	0.463										HNSCC(30;0.082)																											p.A310S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G928T	14						.						115.0	110.0	112.0					14																	42356756		2203	4300	6503	41426506	SO:0001583	missense	145581	exon3			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.928G>T	14.37:g.42356756G>T	ENSP00000298119:p.Ala310Ser	Somatic		Capture	Illumina HiSeq	Phase_I	41426506	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809694	0.70797	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.69040	-0.37;-0.37;-0.37	5.4	5.4	0.78164	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000029	D	0.83783	0.5329	M	0.90705	3.14	0.80722	D	1	P;D	0.56287	0.87;0.975	P;P	0.61722	0.612;0.893	D	0.86846	0.2020	10	0.72032	D	0.01	.	17.0338	0.86468	0.0:0.0:1.0:0.0	.	310;310	G3V364;Q96NI6	.;LRFN5_HUMAN	S	310	ENSP00000298119:A310S;ENSP00000451897:A310S;ENSP00000451067:A310S	ENSP00000298119:A310S	A	+	1	0	LRFN5	41426506	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.680000	0.91292	0.563000	0.77884	GCC		0.463	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
C14orf28	122525	broad.mit.edu	37	14	45374591	45374591	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:45374591A>G	ENST00000325192.3	+	5	1046	c.771A>G	c.(769-771)acA>acG	p.T257T	RP11-857B24.5_ENST00000555157.1_RNA|C14orf28_ENST00000557112.1_Silent_p.T227T	NM_001017923.1	NP_001017923.1	Q4W4Y0	CN028_HUMAN	chromosome 14 open reading frame 28	257								p.T257T(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(2)	11						AAGGTGCCACATTATTTAACA	0.303																																					p.T257T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A771G	14						.						109.0	116.0	113.0					14																	45374591		2203	4300	6503	44444341	SO:0001819	synonymous_variant	122525	exon5			AA496212	CCDS32069.1	14q21.2	2012-08-16			ENSG00000179476	ENSG00000179476			19834	protein-coding gene	gene with protein product	"""dopamine receptor interacting protein 1"""						Standard	XM_005267316		Approved	DRIP-1	uc001wvo.3	Q4W4Y0	OTTHUMG00000170722	ENST00000325192.3:c.771A>G	14.37:g.45374591A>G		Somatic		Capture	Illumina HiSeq	Phase_I	44444341	NM_001017923		Silent	SNP	ENST00000325192.3	37	CCDS32069.1																																																																																				0.303	C14orf28-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410086.1	NM_001017923	
PELI2	57161	broad.mit.edu	37	14	56757045	56757045	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:56757045C>T	ENST00000267460.4	+	5	853	c.567C>T	c.(565-567)ggC>ggT	p.G189G		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	189	FHA; atypical.				innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)	p.G189G(1)		kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						CTACTAATGGCGTCCTGGTGA	0.547																																					p.G189G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C567T	14						.						92.0	98.0	96.0					14																	56757045		2203	4300	6503	55826798	SO:0001819	synonymous_variant	57161	exon5			AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.567C>T	14.37:g.56757045C>T		Somatic		Capture	Illumina HiSeq	Phase_I	55826798	NM_021255	B2RDY5	Silent	SNP	ENST00000267460.4	37	CCDS9726.1																																																																																				0.547	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276925.1		
TMEM260	54916	broad.mit.edu	37	14	57052566	57052566	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:57052566G>A	ENST00000261556.6	+	3	402	c.280G>A	c.(280-282)Gtc>Atc	p.V94I	TMEM260_ENST00000538838.1_Missense_Mutation_p.V94I|TMEM260_ENST00000536419.1_5'UTR	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	94						integral component of membrane (GO:0016021)		p.V94I(1)									TGCCTACCGCGTCAATCTTCT	0.403																																					p.V94I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G280A	14						.						245.0	215.0	225.0					14																	57052566		2203	4300	6503	56122319	SO:0001583	missense	54916	exon3			AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.280G>A	14.37:g.57052566G>A	ENSP00000261556:p.Val94Ile	Somatic		Capture	Illumina HiSeq	Phase_I	56122319	NM_017799	A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	ENST00000261556.6	37	CCDS9727.2	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699544	0.48307	.	.	ENSG00000070269	ENST00000556810;ENST00000261556;ENST00000538838	T;T	0.55052	1.15;0.54	5.58	5.58	0.84498	.	0.268179	0.35013	N	0.003504	T	0.44435	0.1293	L	0.31526	0.94	0.80722	D	1	D	0.53745	0.962	B	0.41036	0.346	T	0.34925	-0.9809	10	0.32370	T	0.25	-3.988	19.5475	0.95305	0.0:0.0:1.0:0.0	.	94	Q9NX78	CN101_HUMAN	I	57;94;94	ENSP00000261556:V94I;ENSP00000441934:V94I	ENSP00000261556:V94I	V	+	1	0	C14orf101	56122319	1.000000	0.71417	0.972000	0.41901	0.940000	0.58332	5.911000	0.69939	2.628000	0.89032	0.563000	0.77884	GTC		0.403	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799	
GPX2	2877	broad.mit.edu	37	14	65406390	65406390	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:65406390G>T	ENST00000389614.5	-	2	475	c.389C>A	c.(388-390)cCa>cAa	p.P130Q	FNTB_ENST00000447296.2_Intron|CHURC1-FNTB_ENST00000549987.1_Intron|FNTB_ENST00000542227.1_Intron	NM_002083.3	NP_002074.2	P18283	GPX2_HUMAN	glutathione peroxidase 2 (gastrointestinal)	130					interaction with symbiont (GO:0051702)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|response to oxidative stress (GO:0006979)|response to symbiotic bacterium (GO:0009609)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|glutathione peroxidase activity (GO:0004602)	p.P130Q(1)		large_intestine(2)|ovary(1)|skin(1)	4				all cancers(60;0.00117)|OV - Ovarian serous cystadenocarcinoma(108;0.00557)|BRCA - Breast invasive adenocarcinoma(234;0.00971)	Glutathione(DB00143)	GAGGGAAAATGGGTCATCATA	0.542																																					p.P130Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C389A	14						.						104.0	101.0	102.0					14																	65406390		2005	4168	6173	64476143	SO:0001583	missense	2877	exon2				CCDS41964.1	14q23.3	2012-05-22			ENSG00000176153	ENSG00000176153	1.11.1.9		4554	protein-coding gene	gene with protein product		138319				8428933, 8287691	Standard	NM_002083		Approved	GSHPX-GI	uc021ruq.2	P18283	OTTHUMG00000171677	ENST00000389614.5:c.389C>A	14.37:g.65406390G>T	ENSP00000374265:p.Pro130Gln	Somatic		Capture	Illumina HiSeq	Phase_I	64476143	NM_002083	Q6PJ52|Q8WWI7|Q9NRP9	Missense_Mutation	SNP	ENST00000389614.5	37	CCDS41964.1	.	.	.	.	.	.	.	.	.	.	G	17.14	3.312748	0.60414	.	.	ENSG00000176153	ENST00000389614;ENST00000557049	T;T	0.21734	1.99;3.76	6.05	6.05	0.98169	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.37183	0.0994	M	0.81942	2.565	0.80722	D	1	P	0.48911	0.917	P	0.45538	0.484	T	0.22347	-1.0219	10	0.56958	D	0.05	0.1646	19.3727	0.94495	0.0:0.0:1.0:0.0	.	130	P18283	GPX2_HUMAN	Q	130;74	ENSP00000374265:P130Q;ENSP00000451721:P74Q	ENSP00000374265:P130Q	P	-	2	0	GPX2	64476143	1.000000	0.71417	0.971000	0.41717	0.042000	0.13812	7.979000	0.88103	2.878000	0.98634	0.650000	0.86243	CCA		0.542	GPX2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000414708.1		
PLEKHH1	57475	broad.mit.edu	37	14	68029082	68029082	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:68029082A>G	ENST00000329153.5	+	7	866	c.734A>G	c.(733-735)cAt>cGt	p.H245R		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	245						cytoskeleton (GO:0005856)		p.H245R(1)		endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		AGCACGGTCCATTCTGGGGAA	0.552																																					p.H245R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A734G	14						.						67.0	79.0	75.0					14																	68029082		1927	4144	6071	67098835	SO:0001583	missense	57475	exon7			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.734A>G	14.37:g.68029082A>G	ENSP00000330278:p.His245Arg	Somatic		Capture	Illumina HiSeq	Phase_I	67098835	NM_020715	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	37	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	A	0.572	-0.840926	0.02692	.	.	ENSG00000054690	ENST00000329153	T	0.70399	-0.48	5.21	-3.88	0.04205	.	1.592570	0.02877	N	0.132361	T	0.52853	0.1760	L	0.31294	0.92	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26087	-1.0113	10	0.39692	T	0.17	.	1.6996	0.02870	0.3431:0.1438:0.3578:0.1553	.	245	Q9ULM0	PKHH1_HUMAN	R	245	ENSP00000330278:H245R	ENSP00000330278:H245R	H	+	2	0	PLEKHH1	67098835	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.314000	0.19432	-0.406000	0.07588	0.397000	0.26171	CAT		0.552	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3	XM_031054	
DCAF5	8816	broad.mit.edu	37	14	69521254	69521254	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:69521254C>T	ENST00000341516.5	-	9	2296	c.2149G>A	c.(2149-2151)Gcc>Acc	p.A717T	DCAF5_ENST00000557386.1_Missense_Mutation_p.A716T|DCAF5_ENST00000553293.1_5'Flank|DCAF5_ENST00000554215.1_Missense_Mutation_p.A635T|DCAF5_ENST00000556847.1_Missense_Mutation_p.A635T	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	717					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)		p.A717T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						TTCCTCTGGGCCATTGCTATG	0.552																																					p.A717T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2149A	14						.						120.0	125.0	123.0					14																	69521254		2203	4300	6503	68591007	SO:0001583	missense	8816	exon9			AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.2149G>A	14.37:g.69521254C>T	ENSP00000341351:p.Ala717Thr	Somatic		Capture	Illumina HiSeq	Phase_I	68591007	NM_003861	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	ENST00000341516.5	37	CCDS32106.1	.	.	.	.	.	.	.	.	.	.	C	3.263	-0.150759	0.06585	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	T;T;T;T	0.67865	-0.29;-0.12;-0.12;0.32	4.99	0.933	0.19471	.	0.576467	0.16704	N	0.203001	T	0.38214	0.1032	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.06991	-1.0796	10	0.19147	T	0.46	-0.2903	1.1528	0.01790	0.2404:0.3782:0.2078:0.1736	.	716;717	G3V4J7;Q96JK2	.;DCAF5_HUMAN	T	717;635;635;716	ENSP00000341351:A717T;ENSP00000451551:A635T;ENSP00000452052:A635T;ENSP00000451845:A716T	ENSP00000341351:A717T	A	-	1	0	DCAF5	68591007	0.102000	0.21896	0.065000	0.19835	0.357000	0.29423	0.522000	0.22909	0.675000	0.31264	0.561000	0.74099	GCC		0.552	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861	
ZNF410	57862	broad.mit.edu	37	14	74364900	74364900	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:74364900C>T	ENST00000555044.1	+	5	709	c.515C>T	c.(514-516)gCc>gTc	p.A172V	ZNF410_ENST00000540593.1_Missense_Mutation_p.A99V|RP5-1021I20.4_ENST00000556551.2_3'UTR|ZNF410_ENST00000412490.3_3'UTR|ZNF410_ENST00000334521.4_Missense_Mutation_p.A119V|ZNF410_ENST00000442160.3_Missense_Mutation_p.A189V|RP5-1021I20.5_ENST00000554009.1_RNA|ZNF410_ENST00000556797.1_Missense_Mutation_p.A119V|ZNF410_ENST00000324593.6_Missense_Mutation_p.A172V	NM_001242928.1|NM_021188.2	NP_001229857.1|NP_067011.1	Q86VK4	ZN410_HUMAN	zinc finger protein 410	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A172V(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(234;0.00369)		CAGGAGTTGGCCCATGACAGT	0.498																																					p.A172V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C515T	14						.						130.0	111.0	117.0					14																	74364900		2203	4300	6503	73434653	SO:0001583	missense	57862	exon5			U90919	CCDS9821.1, CCDS55929.1, CCDS55930.1, CCDS55931.1	14q24.3	2013-01-08				ENSG00000119725		"""Zinc fingers, C2H2-type"""	20144	protein-coding gene	gene with protein product						12370286	Standard	NM_001242924		Approved	APA1, APA-1	uc010arz.2	Q86VK4		ENST00000555044.1:c.515C>T	14.37:g.74364900C>T	ENSP00000451763:p.Ala172Val	Somatic		Capture	Illumina HiSeq	Phase_I	73434653	NM_021188	B4DDV5|B4DR78|O00153|Q9BQ19	Missense_Mutation	SNP	ENST00000555044.1	37	CCDS9821.1	.	.	.	.	.	.	.	.	.	.	C	31	5.104681	0.94245	.	.	ENSG00000119725	ENST00000540593;ENST00000324593;ENST00000557363;ENST00000458102;ENST00000442160;ENST00000555044;ENST00000334521;ENST00000556797	T;T;T;T;T	0.11930	2.96;2.82;2.77;2.85;2.73	5.29	4.38	0.52667	.	0.000000	0.39834	N	0.001247	T	0.26304	0.0642	L	0.32530	0.975	0.80722	D	1	D;D;P;P	0.71674	0.998;0.998;0.906;0.849	D;D;P;B	0.77004	0.989;0.98;0.582;0.378	T	0.01834	-1.1264	10	0.35671	T	0.21	.	15.8369	0.78805	0.0:0.8639:0.1361:0.0	.	99;189;172;172	B4DR78;B4DDV5;Q86VK4-3;Q86VK4	.;.;.;ZN410_HUMAN	V	99;172;119;161;189;172;119;119	ENSP00000442228:A99V;ENSP00000323293:A172V;ENSP00000407130:A189V;ENSP00000451763:A172V;ENSP00000334170:A119V	ENSP00000323293:A172V	A	+	2	0	ZNF410	73434653	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.247000	0.78257	1.418000	0.47098	0.655000	0.94253	GCC		0.498	ZNF410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412597.1	NM_021188	
SETD3	84193	broad.mit.edu	37	14	99865308	99865308	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:99865308G>A	ENST00000331768.5	-	13	1652	c.1493C>T	c.(1492-1494)cCg>cTg	p.P498L		NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	498					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)	p.P498L(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				TTTGGGAAGCGGAGCCTTTTC	0.512																																					p.P498L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1493T	14						.						137.0	137.0	137.0					14																	99865308		2203	4300	6503	98935061	SO:0001583	missense	84193	exon13			AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.1493C>T	14.37:g.99865308G>A	ENSP00000327436:p.Pro498Leu	Somatic		Capture	Illumina HiSeq	Phase_I	98935061	NM_032233	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Missense_Mutation	SNP	ENST00000331768.5	37	CCDS9951.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792200	0.50102	.	.	ENSG00000183576	ENST00000331768	T	0.23147	1.92	5.12	4.23	0.50019	Rubisco LS methyltransferase, substrate-binding domain (2);	0.052781	0.85682	D	0.000000	T	0.23806	0.0576	M	0.63843	1.955	0.80722	D	1	B	0.31769	0.339	B	0.12837	0.008	T	0.05241	-1.0897	10	0.59425	D	0.04	-22.8477	10.9605	0.47383	0.1511:0.0:0.8489:0.0	.	498	Q86TU7	SETD3_HUMAN	L	498	ENSP00000327436:P498L	ENSP00000327436:P498L	P	-	2	0	SETD3	98935061	1.000000	0.71417	0.807000	0.32361	0.997000	0.91878	6.130000	0.71663	1.158000	0.42547	0.655000	0.94253	CCG		0.512	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233	
AHNAK2	113146	broad.mit.edu	37	14	105410611	105410611	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr14:105410611A>G	ENST00000333244.5	-	7	11296	c.11177T>C	c.(11176-11178)aTg>aCg	p.M3726T	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3726						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.M3726T(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CAAACTGGGCATCTCCACCTT	0.627																																					p.M3726T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T11177C	14						.						142.0	149.0	147.0					14																	105410611		1869	4096	5965	104481656	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11177T>C	14.37:g.105410611A>G	ENSP00000353114:p.Met3726Thr	Somatic		Capture	Illumina HiSeq	Phase_I	104481656	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	0.875	-0.730570	0.03135	.	.	ENSG00000185567	ENST00000333244	T	0.01323	5.01	4.1	4.1	0.47936	.	.	.	.	.	T	0.03739	0.0106	M	0.93462	3.42	0.09310	N	1	B	0.33238	0.403	B	0.33196	0.159	T	0.41161	-0.9524	9	0.10636	T	0.68	.	8.4348	0.32780	0.8126:0.0:0.0:0.1874	.	3726	Q8IVF2	AHNK2_HUMAN	T	3726	ENSP00000353114:M3726T	ENSP00000353114:M3726T	M	-	2	0	AHNAK2	104481656	0.000000	0.05858	0.872000	0.34217	0.067000	0.16453	0.070000	0.14573	1.517000	0.48917	0.397000	0.26171	ATG		0.627	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ATP10A	57194	broad.mit.edu	37	15	25940110	25940110	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:25940110C>T	ENST00000356865.6	-	14	3055	c.2944G>A	c.(2944-2946)Gct>Act	p.A982T		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	982					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.A982T(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TTCTCGAGAGCGTAGGCCAGG	0.597																																					p.A982T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2944A	15						.						96.0	93.0	94.0					15																	25940110		2203	4300	6503	23491203	SO:0001583	missense	57194	exon14			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2944G>A	15.37:g.25940110C>T	ENSP00000349325:p.Ala982Thr	Somatic		Capture	Illumina HiSeq	Phase_I	23491203	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.425448	0.83667	.	.	ENSG00000206190	ENST00000356865	D	0.89485	-2.52	5.43	5.43	0.79202	HAD-like domain (1);	0.046997	0.85682	D	0.000000	D	0.95214	0.8448	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.94638	0.7828	10	0.42905	T	0.14	-34.3793	19.2412	0.93883	0.0:1.0:0.0:0.0	.	982	O60312	AT10A_HUMAN	T	982	ENSP00000349325:A982T	ENSP00000349325:A982T	A	-	1	0	ATP10A	23491203	1.000000	0.71417	0.896000	0.35187	0.361000	0.29550	7.561000	0.82288	2.552000	0.86080	0.563000	0.77884	GCT		0.597	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
RYR3	6263	broad.mit.edu	37	15	33954902	33954902	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:33954902C>A	ENST00000389232.4	+	35	5241	c.5171C>A	c.(5170-5172)cCt>cAt	p.P1724H	RYR3_ENST00000415757.3_Missense_Mutation_p.P1724H	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1724	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.P1724H(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CAGTTTGTGCCTGTGCTGAAA	0.562																																					p.P1724H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5171A	15						.						93.0	101.0	98.0					15																	33954902		2142	4265	6407	31742194	SO:0001583	missense	6263	exon35				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5171C>A	15.37:g.33954902C>A	ENSP00000373884:p.Pro1724His	Somatic		Capture	Illumina HiSeq	Phase_I	31742194	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584280	0.86748	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.74209	-0.82;-0.44	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.87884	0.6290	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.88822	0.3299	10	0.87932	D	0	.	19.3887	0.94570	0.0:1.0:0.0:0.0	.	1724;1724	Q15413-2;Q15413	.;RYR3_HUMAN	H	1724	ENSP00000373884:P1724H;ENSP00000399610:P1724H	ENSP00000354735:P1724H	P	+	2	0	RYR3	31742194	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.411000	0.80078	2.826000	0.97356	0.655000	0.94253	CCT		0.562	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
EMC4	51234	broad.mit.edu	37	15	34520760	34520760	+	Silent	SNP	G	G	A	rs375492262		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:34520760G>A	ENST00000267750.4	+	4	602	c.486G>A	c.(484-486)tcG>tcA	p.S162S	EMC4_ENST00000249209.4_Intron|EMC4_ENST00000559078.1_Intron|EMC4_ENST00000557879.1_3'UTR|EMC4_ENST00000559421.1_Intron	NM_016454.2	NP_057538.1	Q5J8M3	EMC4_HUMAN	ER membrane protein complex subunit 4	162					apoptotic process (GO:0006915)	ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)		p.S162S(1)									CACATGCATCGGATTGGTTAG	0.448																																					p.S162S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G486A	15						.	G		0,4402		0,0,2201	221.0	199.0	206.0		486	3.3	1.0	15		206	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	TMEM85	NM_016454.2		0,1,6498	AA,AG,GG		0.0116,0.0,0.0077		162/184	34520760	1,12997	2201	4298	6499	32308052	SO:0001819	synonymous_variant	51234	exon4			BC016348	CCDS10035.1, CCDS66732.1	15q14	2012-05-23	2012-05-23	2012-05-23	ENSG00000128463	ENSG00000128463			28032	protein-coding gene	gene with protein product			"""transmembrane protein 85"""	TMEM85		18586032, 22119785	Standard	NM_001286420		Approved	FLJ90746, MGC24415, PIG17	uc001zhq.3	Q5J8M3	OTTHUMG00000129411	ENST00000267750.4:c.486G>A	15.37:g.34520760G>A		Somatic		Capture	Illumina HiSeq	Phase_I	32308052	NM_016454	A8K3A9|B4DJQ4|Q96KX9|Q9BUI5|Q9P0T9	Silent	SNP	ENST00000267750.4	37	CCDS10035.1																																																																																				0.448	EMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251568.1	NM_016454	
INO80	54617	broad.mit.edu	37	15	41277561	41277561	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:41277561C>T	ENST00000361937.3	-	32	4320	c.3896G>A	c.(3895-3897)cGg>cAg	p.R1299Q	INO80_ENST00000401393.3_Missense_Mutation_p.R1299Q|INO80_ENST00000561244.1_5'UTR			Q9ULG1	INO80_HUMAN	INO80 complex subunit	1299	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.R1299Q(2)		NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TTCCCGCTTCCGCTTGCGCTC	0.498																																					p.R1299Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3896A	15						.						231.0	179.0	197.0					15																	41277561		2203	4300	6503	39064853	SO:0001583	missense	54617	exon32			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.3896G>A	15.37:g.41277561C>T	ENSP00000355205:p.Arg1299Gln	Somatic		Capture	Illumina HiSeq	Phase_I	39064853	NM_017553	A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	37	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	C	33	5.240648	0.95240	.	.	ENSG00000128908	ENST00000263793;ENST00000361937;ENST00000401393	D;D	0.91945	-2.94;-2.94	4.79	4.79	0.61399	.	0.114155	0.56097	D	0.000021	D	0.93288	0.7861	L	0.42245	1.32	0.80722	D	1	D	0.64830	0.994	P	0.61201	0.885	D	0.91889	0.5522	10	0.30078	T	0.28	.	17.619	0.88075	0.0:1.0:0.0:0.0	.	1299	Q9ULG1	INO80_HUMAN	Q	93;1299;1299	ENSP00000355205:R1299Q;ENSP00000384686:R1299Q	ENSP00000263793:R93Q	R	-	2	0	INO80	39064853	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.024000	0.70857	2.492000	0.84095	0.563000	0.77884	CGG		0.498	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553	
DUOXA2	405753	broad.mit.edu	37	15	45408791	45408791	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:45408791G>A	ENST00000323030.5	+	4	703	c.418G>A	c.(418-420)Gcg>Acg	p.A140T	DUOX2_ENST00000389039.6_5'Flank|DUOX2_ENST00000603300.1_5'Flank	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	140					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.A140T(1)					all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		GAATTACGCCGCGGAGTACGC	0.602																																					p.A140T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G418A	15						.						59.0	65.0	63.0					15																	45408791		2084	4235	6319	43196083	SO:0001583	missense	405753	exon4			BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.418G>A	15.37:g.45408791G>A	ENSP00000319705:p.Ala140Thr	Somatic		Capture	Illumina HiSeq	Phase_I	43196083	NM_207581	B2RPI9|H0YNQ6	Missense_Mutation	SNP	ENST00000323030.5	37	CCDS10118.2	.	.	.	.	.	.	.	.	.	.	G	5.502	0.277543	0.10403	.	.	ENSG00000140274	ENST00000323030;ENST00000350243	T	0.55234	0.53	5.58	2.14	0.27477	.	0.655297	0.16132	N	0.228125	T	0.35624	0.0938	L	0.43152	1.355	0.09310	N	1	P	0.36733	0.567	B	0.28465	0.09	T	0.12760	-1.0535	10	0.15952	T	0.53	0.2712	9.0321	0.36264	0.1064:0.58:0.3136:0.0	.	140	Q1HG44	DOXA2_HUMAN	T	140;95	ENSP00000319705:A140T	ENSP00000319705:A140T	A	+	1	0	DUOXA2	43196083	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.268000	0.18571	0.078000	0.16900	0.655000	0.94253	GCG		0.602	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254142.1	NM_207581	
SECISBP2L	9728	broad.mit.edu	37	15	49325169	49325169	+	Missense_Mutation	SNP	C	C	A	rs374659832		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:49325169C>A	ENST00000559471.1	-	4	920	c.657G>T	c.(655-657)caG>caT	p.Q219H	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.Q219H	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	219							poly(A) RNA binding (GO:0044822)	p.Q219H(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TACCAGTTTGCTGTGAAGCAT	0.403																																					p.Q219H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G657T	15						.						264.0	239.0	247.0					15																	49325169		2197	4295	6492	47112461	SO:0001583	missense	9728	exon4			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.657G>T	15.37:g.49325169C>A	ENSP00000453854:p.Gln219His	Somatic		Capture	Illumina HiSeq	Phase_I	47112461	NM_014701	Q8N767	Missense_Mutation	SNP	ENST00000559471.1	37	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561569	0.65538	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	D	0.89939	-2.59	5.51	3.63	0.41609	.	0.000000	0.85682	D	0.000000	D	0.89646	0.6775	L	0.34521	1.04	0.45621	D	0.998555	D;D	0.76494	0.998;0.999	D;D	0.77004	0.974;0.989	D	0.88446	0.3045	10	0.72032	D	0.01	.	8.4861	0.33071	0.0:0.7061:0.0:0.2939	.	219;219	Q93073;Q93073-2	SBP2L_HUMAN;.	H	219	ENSP00000261847:Q219H	ENSP00000261847:Q219H	Q	-	3	2	SECISBP2L	47112461	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.832000	0.27490	0.690000	0.31570	0.591000	0.81541	CAG		0.403	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	
DMXL2	23312	broad.mit.edu	37	15	51839455	51839455	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:51839455A>G	ENST00000251076.5	-	7	1005	c.718T>C	c.(718-720)Tgg>Cgg	p.W240R	DMXL2_ENST00000543779.2_Missense_Mutation_p.W240R|DMXL2_ENST00000449909.3_Missense_Mutation_p.W240R|DMXL2_ENST00000560421.1_5'Flank	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	240						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.W240R(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		GTTTTGCGCCACGAAAAACCT	0.358																																					p.W240R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T718C	15						.						98.0	97.0	98.0					15																	51839455		2195	4293	6488	49626747	SO:0001583	missense	23312	exon7			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.718T>C	15.37:g.51839455A>G	ENSP00000251076:p.Trp240Arg	Somatic		Capture	Illumina HiSeq	Phase_I	49626747	NM_015263	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	A	17.96	3.515106	0.64634	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.13420	2.59;2.59;2.59	5.47	5.47	0.80525	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.48978	0.1530	M	0.93939	3.475	0.35678	D	0.81387	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.71122	-0.4684	10	0.87932	D	0	.	15.5528	0.76167	1.0:0.0:0.0:0.0	.	240;240;240	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	R	240	ENSP00000251076:W240R;ENSP00000441858:W240R;ENSP00000400855:W240R	ENSP00000251076:W240R	W	-	1	0	DMXL2	49626747	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.962000	0.93254	2.092000	0.63282	0.477000	0.44152	TGG		0.358	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
TEX9	374618	broad.mit.edu	37	15	56687030	56687030	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:56687030A>G	ENST00000352903.2	+	9	850	c.826A>G	c.(826-828)Agg>Ggg	p.R276G	TEX9_ENST00000561221.2_Missense_Mutation_p.R276G|TEX9_ENST00000558083.2_Missense_Mutation_p.R201G|RP11-48G14.2_ENST00000564401.1_lincRNA|TEX9_ENST00000537232.1_Missense_Mutation_p.R201G|TEX9_ENST00000560582.1_Missense_Mutation_p.R32G	NM_198524.1	NP_940926.1	Q8N6V9	TEX9_HUMAN	testis expressed 9	276								p.R276G(1)		cervix(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	14				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		TTCAGTAGAAAGGGTAATTAT	0.299																																					p.R276G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A826G	15						.						43.0	48.0	46.0					15																	56687030		2187	4284	6471	54474322	SO:0001583	missense	374618	exon9			BC028119	CCDS10157.1, CCDS66776.1	15q21.3	2007-03-13	2007-03-13		ENSG00000151575	ENSG00000151575			29585	protein-coding gene	gene with protein product			"""testis expressed sequence 9"""				Standard	XM_005254361		Approved		uc002adp.3	Q8N6V9	OTTHUMG00000132035	ENST00000352903.2:c.826A>G	15.37:g.56687030A>G	ENSP00000342169:p.Arg276Gly	Somatic		Capture	Illumina HiSeq	Phase_I	54474322	NM_198524	B4DH73	Missense_Mutation	SNP	ENST00000352903.2	37	CCDS10157.1	.	.	.	.	.	.	.	.	.	.	A	10.57	1.387861	0.25031	.	.	ENSG00000151575	ENST00000352903;ENST00000537232	D;D	0.82255	-1.59;-1.59	5.25	2.88	0.33553	.	0.237995	0.49305	D	0.000157	T	0.77711	0.4171	L	0.43152	1.355	0.31439	N	0.672171	P;P	0.37663	0.604;0.604	B;B	0.39531	0.156;0.302	T	0.77448	-0.2584	10	0.66056	D	0.02	-8.7469	11.24	0.48964	0.6961:0.3039:0.0:0.0	.	201;276	B4DH73;Q8N6V9	.;TEX9_HUMAN	G	276;201	ENSP00000342169:R276G;ENSP00000438745:R201G	ENSP00000342169:R276G	R	+	1	2	TEX9	54474322	1.000000	0.71417	0.996000	0.52242	0.199000	0.23934	3.103000	0.50298	0.307000	0.22880	-0.338000	0.08134	AGG		0.299	TEX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255048.2	NM_198524	
TLN2	83660	broad.mit.edu	37	15	63088448	63088448	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:63088448G>A	ENST00000561311.1	+	46	6236	c.6006G>A	c.(6004-6006)gcG>gcA	p.A2002A	TLN2_ENST00000306829.6_Silent_p.A2002A			Q9Y4G6	TLN2_HUMAN	talin 2	2002					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.A2002A(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TTGCAACAGCGGGGACGCTGA	0.592																																					p.A2002A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6006A	15						.						74.0	68.0	70.0					15																	63088448		2203	4300	6503	60875501	SO:0001819	synonymous_variant	83660	exon44			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.6006G>A	15.37:g.63088448G>A		Somatic		Capture	Illumina HiSeq	Phase_I	60875501	NM_015059	A6NLB8	Silent	SNP	ENST00000561311.1	37	CCDS32261.1																																																																																				0.592	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
DIS3L	115752	broad.mit.edu	37	15	66615880	66615880	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:66615880G>A	ENST00000319212.4	+	11	1674	c.1624G>A	c.(1624-1626)Gtc>Atc	p.V542I	RP11-352G18.2_ENST00000565993.1_RNA|DIS3L_ENST00000319194.5_Missense_Mutation_p.V459I|DIS3L_ENST00000441424.2_3'UTR	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	542					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)	p.V542I(1)|p.V459I(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GCTGCCTTCCGTCCTCAGTGC	0.517																																					p.V542I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1624A	15						.						356.0	279.0	305.0					15																	66615880		2201	4299	6500	64402934	SO:0001583	missense	115752	exon11				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.1624G>A	15.37:g.66615880G>A	ENSP00000321711:p.Val542Ile	Somatic		Capture	Illumina HiSeq	Phase_I	64402934	NM_001143688	Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	ENST00000319212.4	37	CCDS45286.1	.	.	.	.	.	.	.	.	.	.	G	2.056	-0.416631	0.04766	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.37058	1.22;1.22	5.74	-8.04	0.01110	Ribonuclease II/R (2);	0.605955	0.19019	N	0.124864	T	0.18551	0.0445	N	0.13098	0.295	0.58432	D	0.999994	B;B;B	0.14012	0.002;0.003;0.009	B;B;B	0.15484	0.013;0.009;0.009	T	0.08006	-1.0743	10	0.19147	T	0.46	-3.9926	19.2483	0.93912	0.3195:0.0:0.6805:0.0	.	542;408;542	Q8TF46;Q8TF46-2;Q8TF46-3	DI3L1_HUMAN;.;.	I	459;542	ENSP00000321583:V459I;ENSP00000321711:V542I	ENSP00000321583:V459I	V	+	1	0	DIS3L	64402934	0.008000	0.16893	0.013000	0.15412	0.171000	0.22731	0.130000	0.15850	-1.976000	0.00996	-0.982000	0.02568	GTC		0.517	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375	
TLE3	7090	broad.mit.edu	37	15	70366913	70366913	+	Missense_Mutation	SNP	C	C	T	rs370686397		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:70366913C>T	ENST00000558939.1	-	6	1708	c.331G>A	c.(331-333)Gcc>Acc	p.A111T	TLE3_ENST00000557997.1_Missense_Mutation_p.A111T|TLE3_ENST00000442299.2_Missense_Mutation_p.A111T|TLE3_ENST00000558201.1_Missense_Mutation_p.A117T|TLE3_ENST00000558379.1_Missense_Mutation_p.A111T|TLE3_ENST00000451782.2_Missense_Mutation_p.A111T|TLE3_ENST00000559929.1_Missense_Mutation_p.A111T|TLE3_ENST00000557907.1_Missense_Mutation_p.A111T|TLE3_ENST00000560939.1_Missense_Mutation_p.A117T|TLE3_ENST00000560589.1_Missense_Mutation_p.A55T|TLE3_ENST00000539550.1_Missense_Mutation_p.A45T|TLE3_ENST00000559191.1_Intron|TLE3_ENST00000440567.3_Missense_Mutation_p.A104T|TLE3_ENST00000317509.8_Missense_Mutation_p.A111T|TLE3_ENST00000559048.1_Missense_Mutation_p.A117T	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	111	Gln-rich.				Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.A111T(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ACCTGCTTGGCGCGCTCCACT	0.582																																					p.A111T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G331A	15						.	C	THR/ALA,THR/ALA,THR/ALA	0,4384		0,0,2192	66.0	73.0	71.0		331,331,331	5.4	1.0	15		71	1,8581		0,1,4290	no	missense,missense,missense	TLE3	NM_001105192.1,NM_005078.2,NM_020908.1	58,58,58	0,1,6482	TT,TC,CC		0.0117,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	111/770,111/773,111/761	70366913	1,12965	2192	4291	6483	68153967	SO:0001583	missense	7090	exon6			M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.331G>A	15.37:g.70366913C>T	ENSP00000452871:p.Ala111Thr	Somatic		Capture	Illumina HiSeq	Phase_I	68153967	NM_020908	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Missense_Mutation	SNP	ENST00000558939.1	37	CCDS45293.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.991077	0.93106	0.0	1.17E-4	ENSG00000140332	ENST00000442299;ENST00000451782;ENST00000317509;ENST00000440567;ENST00000539550;ENST00000537387	T;T;T;T;T	0.73152	0.1;0.12;0.2;0.1;-0.72	5.41	5.41	0.78517	Groucho/TLE, N-terminal Q-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.87410	0.6170	H	0.94264	3.515	0.80722	D	1	P;P;P;P;D;D;P;P	0.64830	0.865;0.889;0.865;0.889;0.994;0.975;0.865;0.865	B;B;B;P;P;P;B;B	0.58520	0.324;0.377;0.324;0.586;0.84;0.586;0.366;0.366	D	0.90931	0.4790	10	0.87932	D	0	-2.1874	19.1972	0.93695	0.0:1.0:0.0:0.0	.	104;111;111;111;111;111;117;45	F8W964;E9PD64;Q04726-3;Q6PI57;Q04726-2;Q04726;Q04726-4;F5H7D6	.;.;.;.;.;TLE3_HUMAN;.;.	T	111;111;111;104;45;8	ENSP00000390007:A111T;ENSP00000394717:A111T;ENSP00000319233:A111T;ENSP00000415057:A104T;ENSP00000442594:A45T	ENSP00000319233:A111T	A	-	1	0	TLE3	68153967	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.684000	0.84104	2.537000	0.85549	0.561000	0.74099	GCC		0.582	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416913.1	NM_005078	
CYP11A1	1583	broad.mit.edu	37	15	74630945	74630945	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:74630945G>A	ENST00000268053.6	-	8	1555	c.1401C>T	c.(1399-1401)atC>atT	p.I467I	CYP11A1_ENST00000419019.2_Silent_p.I309I|CYP11A1_ENST00000358632.4_Silent_p.I309I	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	467					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.I467I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	CTAGCTCAGCGATCCGCCGTC	0.557																																					p.I467I	Esophageal Squamous(87;818 1337 4093 9268 37314)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1401T	15						.						147.0	127.0	134.0					15																	74630945		2198	4297	6495	72417998	SO:0001819	synonymous_variant	1583	exon8			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.1401C>T	15.37:g.74630945G>A		Somatic		Capture	Illumina HiSeq	Phase_I	72417998	NM_000781	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Silent	SNP	ENST00000268053.6	37	CCDS32291.1																																																																																				0.557	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319737.1		
NEIL1	79661	broad.mit.edu	37	15	75646997	75646997	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:75646997G>A	ENST00000564784.1	+	10	1569	c.940G>A	c.(940-942)Gct>Act	p.A314T	RP11-817O13.6_ENST00000563660.1_lincRNA|MIR631_ENST00000384904.1_RNA|NEIL1_ENST00000355059.4_Missense_Mutation_p.A314T|NEIL1_ENST00000569035.1_Missense_Mutation_p.A314T			Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1 (E. coli)	314					base-excision repair (GO:0006284)|negative regulation of nuclease activity (GO:0032074)|nucleotide-excision repair (GO:0006289)|response to oxidative stress (GO:0006979)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)	p.A314T(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)	13						CATCCAGGACGCTTTGCCTCC	0.622								Base excision repair (BER), DNA glycosylases																													p.A314T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G940A	15						.						44.0	48.0	47.0					15																	75646997		2197	4294	6491	73434050	SO:0001583	missense	79661	exon9			AK026055	CCDS10278.1	15q33.33	2008-07-18			ENSG00000140398	ENSG00000140398			18448	protein-coding gene	gene with protein product		608844				11904416	Standard	NM_024608		Approved	FLJ22402, hFPG1, NEI1, FPG1	uc002bae.4	Q96FI4	OTTHUMG00000142821	ENST00000564784.1:c.940G>A	15.37:g.75646997G>A	ENSP00000457352:p.Ala314Thr	Somatic		Capture	Illumina HiSeq	Phase_I	73434050	NM_024608	D3DW75|Q6ZRA7|Q86XW7|Q9H6C3	Missense_Mutation	SNP	ENST00000564784.1	37	CCDS10278.1	.	.	.	.	.	.	.	.	.	.	C	11.51	1.659609	0.29515	.	.	ENSG00000140398	ENST00000355059	T	0.11385	2.78	3.86	2.95	0.34219	.	1.041800	0.07458	N	0.900044	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	B	0.25048	0.117	B	0.15870	0.014	T	0.43909	-0.9362	10	0.19590	T	0.45	1.2733	5.3458	0.16008	0.0:0.6796:0.2087:0.1117	.	314	Q96FI4	NEIL1_HUMAN	T	314	ENSP00000347170:A314T	ENSP00000347170:A314T	A	+	1	0	NEIL1	73434050	0.001000	0.12720	0.003000	0.11579	0.002000	0.02628	0.781000	0.26774	0.628000	0.30357	-0.223000	0.12442	GCT		0.622	NEIL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419885.1	NM_024608	
ACSBG1	23205	broad.mit.edu	37	15	78463864	78463864	+	Silent	SNP	C	C	T	rs375772785		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:78463864C>T	ENST00000258873.4	-	14	2302	c.2097G>A	c.(2095-2097)acG>acA	p.T699T	ACSBG1_ENST00000541759.1_Silent_p.T457T|IDH3A_ENST00000299518.2_3'UTR|ACSBG1_ENST00000560817.1_Silent_p.T457T	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	699					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.T699T(1)		endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						TCAGTTTCATCGTGGGACCTA	0.423																																					p.T695T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2085A	15						.	C	,	1,4391	2.1+/-5.4	0,1,2195	82.0	79.0	80.0		2085,2097	-11.4	0.5	15		80	0,8586		0,0,4293	no	coding-synonymous,coding-synonymous	ACSBG1	NM_001199377.1,NM_015162.4	,	0,1,6488	TT,TC,CC		0.0,0.0228,0.0077	,	695/721,699/725	78463864	1,12977	2196	4293	6489	76250919	SO:0001819	synonymous_variant	23205	exon14			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.2097G>A	15.37:g.78463864C>T		Somatic		Capture	Illumina HiSeq	Phase_I	76250919	NM_001199377	B2RB61|O75126|Q76N27|Q9HC26	Silent	SNP	ENST00000258873.4	37	CCDS10298.1																																																																																				0.423	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162	
DNAJA4	55466	broad.mit.edu	37	15	78572404	78572404	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:78572404G>A	ENST00000394852.3	+	6	1085	c.895G>A	c.(895-897)Ggg>Agg	p.G299R	DNAJA4_ENST00000446172.2_Missense_Mutation_p.G272R|DNAJA4_ENST00000343789.3_Missense_Mutation_p.G299R|RP11-762H8.4_ENST00000558192.1_RNA|DNAJA4_ENST00000394855.3_Missense_Mutation_p.G328R	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	299					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)	p.G299R(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						GATAAAGCACGGGGACCTGAG	0.517																																					p.G272R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G814A	15						.						90.0	80.0	84.0					15																	78572404		2196	4293	6489	76359459	SO:0001583	missense	55466	exon6			AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.895G>A	15.37:g.78572404G>A	ENSP00000378321:p.Gly299Arg	Somatic		Capture	Illumina HiSeq	Phase_I	76359459	NM_001130183	E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Missense_Mutation	SNP	ENST00000394852.3	37	CCDS45316.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925124	0.73213	.	.	ENSG00000140403	ENST00000394855;ENST00000343789;ENST00000394852;ENST00000446172	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.04	4.12	0.48240	Chaperone DnaJ, C-terminal (1);HSP40/DnaJ peptide-binding (1);	0.272598	0.42682	D	0.000661	T	0.70011	0.3175	M	0.92604	3.325	0.80722	D	1	P;P;P	0.45672	0.864;0.864;0.836	P;P;B	0.45449	0.481;0.481;0.3	T	0.77362	-0.2616	10	0.66056	D	0.02	-11.1606	12.6303	0.56653	0.0801:0.0:0.9199:0.0	.	272;299;328	E9PDM9;Q8WW22;Q8WW22-2	.;DNJA4_HUMAN;.	R	328;299;299;272	ENSP00000378324:G328R;ENSP00000339581:G299R;ENSP00000378321:G299R;ENSP00000413499:G272R	ENSP00000339581:G299R	G	+	1	0	DNAJA4	76359459	1.000000	0.71417	0.994000	0.49952	0.692000	0.40212	4.108000	0.57817	1.111000	0.41721	0.555000	0.69702	GGG		0.517	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1	NM_018602	
MESDC2	23184	broad.mit.edu	37	15	81271701	81271701	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:81271701C>A	ENST00000261758.4	-	3	650	c.564G>T	c.(562-564)caG>caT	p.Q188H	MESDC2_ENST00000560244.1_5'Flank	NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	188	Escort domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)		p.Q188H(1)		cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						CGGGGTACACCTGGCCCTCCA	0.488																																					p.Q188H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G564T	15						.						77.0	73.0	75.0					15																	81271701		2203	4300	6503	79058756	SO:0001583	missense	23184	exon3			D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.564G>T	15.37:g.81271701C>A	ENSP00000261758:p.Gln188His	Somatic		Capture	Illumina HiSeq	Phase_I	79058756	NM_015154	B4DW84|D3DW96|Q969U1	Missense_Mutation	SNP	ENST00000261758.4	37	CCDS32308.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506313	0.85282	.	.	ENSG00000117899	ENST00000261758	.	.	.	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.75874	0.3909	M	0.69823	2.125	0.80722	D	1	D	0.64830	0.994	D	0.64144	0.922	T	0.77482	-0.2571	9	0.72032	D	0.01	-25.4764	13.5144	0.61533	0.0:0.9293:0.0:0.0707	.	188	Q14696	MESD_HUMAN	H	188	.	ENSP00000261758:Q188H	Q	-	3	2	MESDC2	79058756	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.765000	0.38481	2.822000	0.97130	0.650000	0.86243	CAG		0.488	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417673.2	NM_015154	
NTRK3	4916	broad.mit.edu	37	15	88799329	88799329	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:88799329C>T	ENST00000360948.2	-	2	217	c.56G>A	c.(55-57)gGa>gAa	p.G19E	NTRK3_ENST00000558676.1_Missense_Mutation_p.G19E|NTRK3_ENST00000557856.1_Missense_Mutation_p.G19E|NTRK3_ENST00000355254.2_Missense_Mutation_p.G19E|NTRK3_ENST00000394480.2_Missense_Mutation_p.G19E|NTRK3_ENST00000540489.2_Missense_Mutation_p.G19E|NTRK3_ENST00000317501.3_Missense_Mutation_p.G19E|NTRK3-AS1_ENST00000569588.1_lincRNA|NTRK3_ENST00000357724.2_Missense_Mutation_p.G19E	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	19					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G19E(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CCAGACGCTTCCCAGCAAGAA	0.557			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.G19E			Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G56A	15						.						189.0	162.0	171.0					15																	88799329		2201	4299	6500	86600333	SO:0001583	missense	4916	exon2			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.56G>A	15.37:g.88799329C>T	ENSP00000354207:p.Gly19Glu	Somatic		Capture	Illumina HiSeq	Phase_I	86600333	NM_001007156	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	c	12.67	2.006216	0.35415	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000540489;ENST00000317501	T;T;T;T;T;T	0.73363	-0.74;-0.69;-0.68;-0.74;0.11;0.11	3.59	2.61	0.31194	.	0.349467	0.19590	U	0.110652	T	0.51584	0.1683	N	0.08118	0	0.26668	N	0.971774	B;B;B;B;B	0.33073	0.107;0.091;0.396;0.044;0.091	B;B;B;B;B	0.26614	0.01;0.055;0.03;0.064;0.071	T	0.48317	-0.9046	10	0.59425	D	0.04	.	11.388	0.49798	0.0:0.8141:0.1859:0.0	.	19;19;19;19;19	E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;NTRK3_HUMAN	E	19	ENSP00000377990:G19E;ENSP00000354207:G19E;ENSP00000350356:G19E;ENSP00000347397:G19E;ENSP00000444673:G19E;ENSP00000318328:G19E	ENSP00000318328:G19E	G	-	2	0	NTRK3	86600333	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.674000	0.61612	0.560000	0.29169	0.450000	0.29827	GGA		0.557	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
POLG	5428	broad.mit.edu	37	15	89862560	89862560	+	Silent	SNP	G	G	A	rs146064249		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:89862560G>A	ENST00000268124.5	-	19	3336	c.3003C>T	c.(3001-3003)ggC>ggT	p.G1001G	POLG_ENST00000442287.2_Silent_p.G1001G	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	1001					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)	p.G1001G(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CCAGCCACTCGCCCTCATCCG	0.572								DNA polymerases (catalytic subunits)																													p.G1001G	Colon(73;648 1203 11348 18386 27782)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3003T	15						.	G	,	1,4399	2.1+/-5.4	0,1,2199	58.0	45.0	49.0		3003,3003	-4.2	0.9	15	dbSNP_134	49	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	POLG	NM_001126131.1,NM_002693.2	,	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	,	1001/1240,1001/1240	89862560	1,12997	2200	4299	6499	87663564	SO:0001819	synonymous_variant	5428	exon19			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.3003C>T	15.37:g.89862560G>A		Somatic		Capture	Illumina HiSeq	Phase_I	87663564	NM_001126131	Q8NFM2|Q92515	Silent	SNP	ENST00000268124.5	37	CCDS10350.1																																																																																				0.572	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
RHCG	51458	broad.mit.edu	37	15	90023515	90023515	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:90023515T>C	ENST00000268122.4	-	4	715	c.647A>G	c.(646-648)cAg>cGg	p.Q216R	RHCG_ENST00000544600.1_Missense_Mutation_p.Q216R	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	216					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.Q216R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					GAGGTCCGACTGGTACACAGA	0.552																																					p.Q216R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A647G	15						.						211.0	185.0	194.0					15																	90023515		2200	4299	6499	87824519	SO:0001583	missense	51458	exon4			AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.647A>G	15.37:g.90023515T>C	ENSP00000268122:p.Gln216Arg	Somatic		Capture	Illumina HiSeq	Phase_I	87824519	NM_016321	A8K4D4|Q6X3Y4	Missense_Mutation	SNP	ENST00000268122.4	37	CCDS10351.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.887660	0.52014	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	T;T	0.22743	1.94;1.94	5.59	4.42	0.53409	Ammonium transporter AmtB-like (3);	0.418904	0.30126	N	0.010344	T	0.12008	0.0292	N	0.19112	0.55	0.20975	N	0.999816	B;B	0.09022	0.002;0.002	B;B	0.12837	0.008;0.008	T	0.19321	-1.0309	9	.	.	.	-12.353	8.1307	0.31024	0.1332:0.0:0.1394:0.7275	.	216;216	A8K4D4;Q9UBD6	.;RHCG_HUMAN	R	216;216;207	ENSP00000438123:Q216R;ENSP00000268122:Q216R	.	Q	-	2	0	RHCG	87824519	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	4.894000	0.63206	2.138000	0.66242	0.456000	0.33151	CAG		0.552	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2	NM_016321	
IDH2	3418	broad.mit.edu	37	15	90634852	90634852	+	Missense_Mutation	SNP	G	G	A	rs201173543		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:90634852G>A	ENST00000330062.3	-	2	253	c.140C>T	c.(139-141)gCg>gTg	p.A47V	IDH2_ENST00000559482.1_Missense_Mutation_p.A47V|IDH2_ENST00000540499.2_5'UTR|IDH2_ENST00000539790.1_Intron	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	47					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.A47V(1)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CACGGGCTTCGCCACCTTGAT	0.607			M		GBM																																p.A47V			Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C140T	15						.						189.0	160.0	170.0					15																	90634852		2200	4298	6498	88435856	SO:0001583	missense	3418	exon2				CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.140C>T	15.37:g.90634852G>A	ENSP00000331897:p.Ala47Val	Somatic		Capture	Illumina HiSeq	Phase_I	88435856	NM_002168	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	ENST00000330062.3	37	CCDS10359.1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.313215	0.40895	.	.	ENSG00000182054	ENST00000330062	T	0.77098	-1.07	5.2	3.03	0.35002	Isopropylmalate dehydrogenase-like domain (2);	0.182567	0.46758	D	0.000278	T	0.69477	0.3115	L	0.52759	1.655	0.80722	D	1	B;B	0.28667	0.052;0.219	B;B	0.16289	0.013;0.015	T	0.69247	-0.5195	10	0.48119	T	0.1	.	12.9975	0.58654	0.0:0.0:0.6888:0.3111	.	47;47	Q53GL5;P48735	.;IDHP_HUMAN	V	47	ENSP00000331897:A47V	ENSP00000331897:A47V	A	-	2	0	IDH2	88435856	1.000000	0.71417	0.913000	0.36048	0.712000	0.41017	3.680000	0.54641	1.132000	0.42129	0.491000	0.48974	GCG		0.607	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1		
IQGAP1	8826	broad.mit.edu	37	15	90934103	90934103	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:90934103G>T	ENST00000268182.5	+	2	277	c.153G>T	c.(151-153)aaG>aaT	p.K51N	IQGAP1_ENST00000560738.1_Intron|RP11-154B12.3_ENST00000560578.1_RNA	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	51	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)	p.K51N(1)		breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			AAGAAGCGAAGAGGTAAAGAT	0.423																																					p.K51N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G153T	15						.						156.0	141.0	146.0					15																	90934103		2198	4298	6496	88735107	SO:0001583	missense	8826	exon2			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.153G>T	15.37:g.90934103G>T	ENSP00000268182:p.Lys51Asn	Somatic		Capture	Illumina HiSeq	Phase_I	88735107	NM_003870	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	37	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.974673	0.74360	.	.	ENSG00000140575	ENST00000268182	D	0.95035	-3.59	4.59	4.59	0.56863	Calponin homology domain (5);	0.063682	0.64402	D	0.000007	D	0.97250	0.9101	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97222	0.9878	10	0.87932	D	0	-23.968	8.4941	0.33117	0.1037:0.0:0.8963:0.0	.	51	P46940	IQGA1_HUMAN	N	51	ENSP00000268182:K51N	ENSP00000268182:K51N	K	+	3	2	IQGAP1	88735107	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.108000	0.50337	2.379000	0.81126	0.462000	0.41574	AAG		0.423	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
IGF1R	3480	broad.mit.edu	37	15	99478104	99478104	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:99478104G>A	ENST00000268035.6	+	16	3619	c.3008G>A	c.(3007-3009)cGg>cAg	p.R1003Q	IGF1R_ENST00000558762.1_Missense_Mutation_p.R1002Q	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	1003	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)	p.R1003Q(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	ACCATGAGCCGGGAACTTGGG	0.502																																					p.R1003Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3008A	15						.						122.0	119.0	120.0					15																	99478104		2197	4297	6494	97295627	SO:0001583	missense	3480	exon16			M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.3008G>A	15.37:g.99478104G>A	ENSP00000268035:p.Arg1003Gln	Somatic		Capture	Illumina HiSeq	Phase_I	97295627	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	37	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	G	34	5.326246	0.95708	.	.	ENSG00000140443	ENST00000268035	D	0.89552	-2.53	5.17	5.17	0.71159	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47455	D	0.000235	D	0.89763	0.6809	L	0.28014	0.82	0.58432	D	0.999996	D;D	0.76494	0.999;0.998	P;P	0.58721	0.836;0.844	D	0.91461	0.5189	10	0.87932	D	0	.	18.6718	0.91514	0.0:0.0:1.0:0.0	.	1002;1003	C9J5X1;P08069	.;IGF1R_HUMAN	Q	1003	ENSP00000268035:R1003Q	ENSP00000268035:R1003Q	R	+	2	0	IGF1R	97295627	1.000000	0.71417	0.990000	0.47175	0.977000	0.68977	5.519000	0.67074	2.410000	0.81850	0.563000	0.77884	CGG		0.502	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
ADAMTS17	170691	broad.mit.edu	37	15	100657199	100657199	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:100657199G>A	ENST00000268070.4	-	13	1846	c.1741C>T	c.(1741-1743)Cac>Tac	p.H581Y		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	581	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.H581Y(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CCCGGGCAGTGTGTGCCTCCA	0.627																																					p.H581Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1741T	15						.						37.0	32.0	33.0					15																	100657199		2203	4300	6503	98474722	SO:0001583	missense	170691	exon13			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1741C>T	15.37:g.100657199G>A	ENSP00000268070:p.His581Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	98474722	NM_139057	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	CCDS10383.1	.	.	.	.	.	.	.	.	.	.	G	1.727	-0.495237	0.04322	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	T	0.58940	0.3	5.18	4.18	0.49190	.	0.210963	0.38436	N	0.001696	T	0.24005	0.0581	N	0.01168	-0.975	0.32686	N	0.514771	B;B	0.12630	0.0;0.006	B;B	0.12837	0.002;0.008	T	0.25502	-1.0130	10	0.02654	T	1	.	12.5248	0.56079	0.0:0.0:0.7059:0.2941	.	338;581	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	Y	581;338	ENSP00000268070:H581Y	ENSP00000268070:H581Y	H	-	1	0	ADAMTS17	98474722	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	2.661000	0.46758	2.419000	0.82065	0.655000	0.94253	CAC		0.627	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
LRRK1	79705	broad.mit.edu	37	15	101589889	101589889	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr15:101589889G>A	ENST00000388948.3	+	23	3699	c.3340G>A	c.(3340-3342)Gga>Aga	p.G1114R	RP11-505E24.3_ENST00000558979.1_RNA|LRRK1_ENST00000284395.5_Missense_Mutation_p.G1111R|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.G1114R(1)|p.G1126R(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GAAGAAAAGCGGAGGAATGAA	0.498																																					p.G1114R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3340A	15						.						100.0	104.0	103.0					15																	101589889		1906	4115	6021	99407412	SO:0001583	missense	79705	exon23			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3340G>A	15.37:g.101589889G>A	ENSP00000373600:p.Gly1114Arg	Somatic		Capture	Illumina HiSeq	Phase_I	99407412	NM_024652		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719169	0.68844	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.72615	-0.64;-0.67	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.80644	0.4662	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.69654	0.965	T	0.78375	-0.2228	10	0.37606	T	0.19	.	19.3098	0.94182	0.0:0.0:1.0:0.0	.	1114	Q38SD2	LRRK1_HUMAN	R	1114;1111	ENSP00000373600:G1114R;ENSP00000284395:G1111R	ENSP00000284395:G1111R	G	+	1	0	LRRK1	99407412	1.000000	0.71417	0.971000	0.41717	0.183000	0.23260	7.609000	0.82925	2.573000	0.86826	0.462000	0.41574	GGA		0.498	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
TRAF7	84231	broad.mit.edu	37	16	2213960	2213961	+	Frame_Shift_Ins	INS	-	-	G	rs542651972		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:2213960_2213961insG	ENST00000326181.6	+	2	171_172	c.39_40insG	c.(40-42)gggfs	p.G14fs		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	14					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P16fs*33(1)|p.G14W(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						ACCGCTTCTCCGGGGGGCCCAG	0.629																																					p.S13fs												.	.	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(1)|lung(1)	c.39_40insG	16						.			5,4253		0,5,2124						-6.1	0.3			45	3,8251		0,3,4124	no	frameshift	TRAF7	NM_032271.2		0,8,6248	A1A1,A1R,RR		0.0363,0.1174,0.0639				8,12504				2153962	SO:0001589	frameshift_variant	84231	exon2			AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.45dupG	16.37:g.2213966_2213966dupG	ENSP00000318944:p.Gly14fs	Somatic		Capture	Illumina HiSeq	Phase_I	2153961	NM_032271	Q9H073	Frame_Shift_Ins	INS	ENST00000326181.6	37	CCDS10461.1																																																																																				0.629	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250762.1	NM_032271	
FAM57B	83723	broad.mit.edu	37	16	30041820	30041821	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:30041820_30041821insC	ENST00000380495.4	-	1	759_760	c.28_29insG	c.(28-30)gtgfs	p.V10fs	FAM57B_ENST00000564806.1_5'Flank|FAM57B_ENST00000279389.4_5'Flank|FAM57B_ENST00000567037.1_5'Flank	NM_031478.4	NP_113666.2	Q71RH2	FA57B_HUMAN	family with sequence similarity 57, member B	10					ceramide biosynthetic process (GO:0046513)|negative regulation of fat cell differentiation (GO:0045599)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sphingosine N-acyltransferase activity (GO:0050291)	p.V10fs*59(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						GGGGAACACCACCCCCCCGGCC	0.668																																					p.V10fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.29_30insG	16						.			17,3523		0,17,1753						3.5	1.0			18	22,7768		1,20,3874	no	frameshift	FAM57B	NM_031478.4		1,37,5627	A1A1,A1R,RR		0.2824,0.4802,0.3442				39,11291				29949322	SO:0001589	frameshift_variant	83723	exon1			AF370365	CCDS10667.2	16p11.2	2013-02-19			ENSG00000149926	ENSG00000149926			25295	protein-coding gene	gene with protein product		615175				11230166, 23275342	Standard	NM_031478		Approved	DKFZP434I2117	uc002dvt.3	Q71RH2	OTTHUMG00000132105	ENST00000380495.4:c.29dupG	16.37:g.30041827_30041827dupC	ENSP00000369863:p.Val10fs	Somatic		Capture	Illumina HiSeq	Phase_I	29949321	NM_031478	Q9H0J1	Frame_Shift_Ins	INS	ENST00000380495.4	37	CCDS10667.2																																																																																				0.668	FAM57B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255142.2	NM_031478	
GRIN2A	2903	broad.mit.edu	37	16	10274195	10274195	+	Missense_Mutation	SNP	G	G	A	rs542256226	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:10274195G>A	ENST00000396573.2	-	3	383	c.74C>T	c.(73-75)gCg>gTg	p.A25V	GRIN2A_ENST00000330684.3_Missense_Mutation_p.A25V|GRIN2A_ENST00000562109.1_Missense_Mutation_p.A25V|GRIN2A_ENST00000396575.2_Missense_Mutation_p.A25V|GRIN2A_ENST00000404927.2_Missense_Mutation_p.A25V	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	25					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.A25V(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CTCCGCCGCCGCGCTCGGCGC	0.672													G|||	2	0.000399361	0.0	0.0	5008	,	,		14860	0.001		0.0	False		,,,				2504	0.001				p.A25V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C74T	16						.						17.0	21.0	20.0					16																	10274195		2187	4285	6472	10181696	SO:0001583	missense	2903	exon2				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.74C>T	16.37:g.10274195G>A	ENSP00000379818:p.Ala25Val	Somatic		Capture	Illumina HiSeq	Phase_I	10181696	NM_001134408	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.031115	0.54790	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000330684;ENST00000396575	T;T;T;T	0.12147	2.73;2.71;2.73;2.73	4.54	3.56	0.40772	.	0.700404	0.12798	N	0.438268	T	0.09905	0.0243	L	0.36672	1.1	0.80722	D	1	B;B;B	0.31519	0.063;0.179;0.327	B;B;B	0.19148	0.016;0.024;0.016	T	0.16100	-1.0414	9	.	.	.	.	9.7413	0.40420	0.0:0.0:0.7933:0.2067	.	25;25;25	Q547U9;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	V	25	ENSP00000379818:A25V;ENSP00000385872:A25V;ENSP00000332549:A25V;ENSP00000379820:A25V	.	A	-	2	0	GRIN2A	10181696	1.000000	0.71417	0.960000	0.40013	0.968000	0.65278	4.238000	0.58688	0.871000	0.35750	0.561000	0.74099	GCG		0.672	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
ABCC6	368	broad.mit.edu	37	16	16244071	16244071	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:16244071C>T	ENST00000205557.7	-	31	4460	c.4431G>A	c.(4429-4431)gtG>gtA	p.V1477V		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1477	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.V1477V(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CGCTCTCTGCCACCTGCCCCT	0.647																																					p.V1477V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4431A	16						.						26.0	29.0	28.0					16																	16244071		2196	4299	6495	16151572	SO:0001819	synonymous_variant	368	exon31			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.4431G>A	16.37:g.16244071C>T		Somatic		Capture	Illumina HiSeq	Phase_I	16151572	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Silent	SNP	ENST00000205557.7	37	CCDS10568.1																																																																																				0.647	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
SMG1	23049	broad.mit.edu	37	16	18880024	18880024	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:18880024C>T	ENST00000446231.2	-	21	3263	c.2851G>A	c.(2851-2853)Gca>Aca	p.A951T	SMG1_ENST00000389467.3_Missense_Mutation_p.A951T|snoU13_ENST00000459248.1_RNA			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	951	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A947T(1)		NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						GTGTGAGCTGCGAGACTTCGA	0.368																																					p.A951T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2851A	16						.						1.0	1.0	1.0					16																	18880024		317	785	1102	18787525	SO:0001583	missense	23049	exon21			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.2851G>A	16.37:g.18880024C>T	ENSP00000402515:p.Ala951Thr	Somatic		Capture	Illumina HiSeq	Phase_I	18787525	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.750559	0.89753	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.14766	2.48;2.48	4.85	4.85	0.62838	Armadillo-type fold (1);	0.000000	0.52532	D	0.000071	T	0.39462	0.1079	M	0.74467	2.265	0.51767	D	0.999938	D	0.76494	0.999	D	0.72625	0.978	T	0.31752	-0.9932	10	0.72032	D	0.01	.	18.3517	0.90340	0.0:1.0:0.0:0.0	.	951	Q96Q15	SMG1_HUMAN	T	951	ENSP00000402515:A951T;ENSP00000374118:A951T	ENSP00000374118:A951T	A	-	1	0	SMG1	18787525	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.734000	0.84928	2.415000	0.81967	0.555000	0.69702	GCA		0.368	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
ACSM1	116285	broad.mit.edu	37	16	20693655	20693655	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:20693655C>T	ENST00000307493.4	-	3	601	c.534G>A	c.(532-534)caG>caA	p.Q178Q	ACSM1_ENST00000520010.1_Silent_p.Q178Q|ACSM1_ENST00000219151.4_De_novo_Start_OutOfFrame	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	178					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.Q178Q(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						GAGAGGGGCACTGAGAAGCTA	0.507																																					p.Q178Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G534A	16						.						87.0	78.0	81.0					16																	20693655		2201	4300	6501	20601156	SO:0001819	synonymous_variant	116285	exon3			AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.534G>A	16.37:g.20693655C>T		Somatic		Capture	Illumina HiSeq	Phase_I	20601156	NM_052956	Q08AH2|Q96A20	Silent	SNP	ENST00000307493.4	37	CCDS10587.1																																																																																				0.507	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254412.1	NM_052956	
LOC81691	81691	broad.mit.edu	37	16	20824567	20824567	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:20824567A>C	ENST00000261377.6	+	3	403	c.194A>C	c.(193-195)cAg>cCg	p.Q65P	AC004381.6_ENST00000567297.1_3'UTR|AC004381.6_ENST00000348433.6_Missense_Mutation_p.Q65P|ERI2_ENST00000564349.1_Intron|AC004381.6_ENST00000564274.1_Missense_Mutation_p.Q65P	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2												p.Q65P(1)									ACCCATGACCAGCTGTGTGAA	0.413																																					p.Q65P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A194C	16						.						81.0	77.0	78.0					16																	20824567		2201	4300	6501	20732068	SO:0001583	missense	81691	exon3																														ENST00000261377.6:c.194A>C	16.37:g.20824567A>C	ENSP00000261377:p.Gln65Pro	Somatic		Capture	Illumina HiSeq	Phase_I	20732068	NM_001199053		Missense_Mutation	SNP	ENST00000261377.6	37	CCDS10591.1	.	.	.	.	.	.	.	.	.	.	A	19.56	3.849827	0.71603	.	.	ENSG00000005189	ENST00000348433;ENST00000261377	T;T	0.34859	1.34;1.73	5.56	5.56	0.83823	.	0.287377	0.34777	N	0.003685	T	0.57636	0.2067	M	0.65498	2.005	0.47037	D	0.999294	D;B	0.89917	1.0;0.063	D;B	0.74674	0.984;0.082	T	0.60845	-0.7182	10	0.66056	D	0.02	-15.4288	13.9585	0.64164	1.0:0.0:0.0:0.0	.	65;65	Q96IC2-2;Q96IC2	.;REXON_HUMAN	P	65	ENSP00000261378:Q65P;ENSP00000261377:Q65P	ENSP00000261377:Q65P	Q	+	2	0	AC004381.6	20732068	1.000000	0.71417	0.703000	0.30354	0.992000	0.81027	5.100000	0.64560	2.114000	0.64651	0.459000	0.35465	CAG		0.413	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254418.2		
VWA3A	146177	broad.mit.edu	37	16	22159506	22159506	+	Missense_Mutation	SNP	G	G	A	rs200655453	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:22159506G>A	ENST00000389398.5	+	28	2959	c.2863G>A	c.(2863-2865)Gtt>Att	p.V955I	VWA3A_ENST00000563755.1_Missense_Mutation_p.V57I|VWA3A_ENST00000389397.4_Missense_Mutation_p.V57I	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	955						extracellular region (GO:0005576)		p.V151I(1)|p.V955I(1)|p.V57I(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		GTTTGGCACCGTTTTGGAGAG	0.582																																					p.V955I												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G2863A	16						.	G	ILE/VAL	1,3901		0,1,1950	50.0	49.0	50.0		2863	3.8	0.8	16		50	1,8289		0,1,4144	no	missense	VWA3A	NM_173615.3	29	0,2,6094	AA,AG,GG		0.0121,0.0256,0.0164	benign	955/1185	22159506	2,12190	1951	4145	6096	22067007	SO:0001583	missense	146177	exon28			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2863G>A	16.37:g.22159506G>A	ENSP00000374049:p.Val955Ile	Somatic		Capture	Illumina HiSeq	Phase_I	22067007	NM_173615	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	ENST00000389398.5	37	CCDS45441.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.546929	0.00926	2.56E-4	1.21E-4	ENSG00000175267	ENST00000389398;ENST00000389397;ENST00000299840	D;D	0.83075	-1.68;-1.68	4.95	3.76	0.43208	.	0.208574	0.40640	N	0.001054	T	0.49949	0.1587	N	0.00778	-1.195	0.20764	N	0.999853	B;B	0.17465	0.002;0.022	B;B	0.14023	0.003;0.01	T	0.49390	-0.8945	10	0.02654	T	1	.	7.8733	0.29578	0.8835:0.0:0.1165:0.0	.	955;57	A6NCI4;A6NCI4-4	VWA3A_HUMAN;.	I	955;57;578	ENSP00000374049:V955I;ENSP00000374048:V57I	ENSP00000299840:V578I	V	+	1	0	VWA3A	22067007	0.934000	0.31675	0.827000	0.32855	0.090000	0.18270	1.704000	0.37857	0.755000	0.32990	-0.355000	0.07637	GTT		0.582	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		
CACNG3	10368	broad.mit.edu	37	16	24366270	24366270	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:24366270G>A	ENST00000005284.3	+	3	1614	c.412G>A	c.(412-414)Gcg>Acg	p.A138T		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	138					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.A138T(1)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		CATTCTCAGCGCGGGCATCTT	0.572																																					p.A138T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G412A	16						.						58.0	53.0	55.0					16																	24366270		2197	4300	6497	24273771	SO:0001583	missense	10368	exon3			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.412G>A	16.37:g.24366270G>A	ENSP00000005284:p.Ala138Thr	Somatic		Capture	Illumina HiSeq	Phase_I	24273771	NM_006539		Missense_Mutation	SNP	ENST00000005284.3	37	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	G	36	5.763234	0.96906	.	.	ENSG00000006116	ENST00000005284	D	0.89617	-2.54	5.41	5.41	0.78517	.	0.112679	0.64402	D	0.000015	D	0.91633	0.7356	M	0.82132	2.575	0.80722	D	1	P	0.51653	0.947	P	0.47827	0.558	D	0.91099	0.4913	10	0.39692	T	0.17	-12.7101	18.9864	0.92771	0.0:0.0:1.0:0.0	.	138	O60359	CCG3_HUMAN	T	138	ENSP00000005284:A138T	ENSP00000005284:A138T	A	+	1	0	CACNG3	24273771	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.961000	0.93122	2.815000	0.96918	0.561000	0.74099	GCG		0.572	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539	
SPNS1	83985	broad.mit.edu	37	16	28994545	28994545	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:28994545C>T	ENST00000311008.11	+	10	1631	c.1254C>T	c.(1252-1254)gcC>gcT	p.A418A	LAT_ENST00000454369.2_5'Flank|SPNS1_ENST00000334536.8_Silent_p.A366A|SPNS1_ENST00000352260.7_Silent_p.A344A|LAT_ENST00000566177.1_5'Flank|LAT_ENST00000354453.4_5'Flank|SPNS1_ENST00000323081.8_Silent_p.A345A|LAT_ENST00000360872.5_5'Flank|LAT_ENST00000395456.2_5'Flank|SPNS1_ENST00000565975.1_Silent_p.A463A|RP11-264B17.3_ENST00000569969.1_RNA|LAT_ENST00000395461.3_5'Flank|LAT_ENST00000564277.1_5'Flank	NM_032038.2	NP_114427.1	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 (Drosophila)	418					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrial inner membrane (GO:0005743)		p.A418A(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)|urinary_tract(1)	21						GCTCCACCGCCGAGGCCTTCC	0.637																																					p.A344A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1032T	16						.						85.0	69.0	74.0					16																	28994545		2197	4300	6497	28902046	SO:0001819	synonymous_variant	83985	exon8			BC006156	CCDS10646.1, CCDS45452.1, CCDS45453.1, CCDS45454.1	16p11.2	2007-04-12			ENSG00000169682	ENSG00000169682			30621	protein-coding gene	gene with protein product		612583				11340170, 12815463	Standard	NM_032038		Approved	HSpin1, nrs, SPINL, PP2030, SPIN1, LAT	uc010vdi.1	Q9H2V7	OTTHUMG00000131762	ENST00000311008.11:c.1254C>T	16.37:g.28994545C>T		Somatic		Capture	Illumina HiSeq	Phase_I	28902046	NM_001142449	B5MDM9|Q6P182|Q71RB5|Q7L541|Q86VU7|Q8N953|Q8TCS5|Q9BRN5	Silent	SNP	ENST00000311008.11	37	CCDS10646.1																																																																																				0.637	SPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254690.2	NM_032038	
ZNF668	79759	broad.mit.edu	37	16	31073154	31073154	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:31073154G>A	ENST00000538906.1	-	3	1879	c.1095C>T	c.(1093-1095)cgC>cgT	p.R365R	ZNF668_ENST00000426488.2_Silent_p.R388R|ZNF668_ENST00000535577.1_Silent_p.R365R|ZNF668_ENST00000300849.4_Silent_p.R365R|ZNF668_ENST00000564456.1_5'Flank|ZNF668_ENST00000417110.2_Silent_p.Q114Q|ZNF668_ENST00000539836.3_Silent_p.R388R|ZNF668_ENST00000394983.2_Silent_p.R365R	NM_001172668.1	NP_001166139	Q96K58	ZN668_HUMAN	zinc finger protein 668	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R365R(1)		breast(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	27						ACTCCTCACAGCGGAAGGGCC	0.672																																					p.R388R	Colon(181;1111 1980 5060 10512 25785)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1164T	16						.						49.0	53.0	52.0					16																	31073154		2197	4297	6494	30980655	SO:0001819	synonymous_variant	79759	exon4				CCDS10701.1, CCDS54003.1	16p11.2	2013-01-08			ENSG00000167394	ENSG00000167394		"""Zinc fingers, C2H2-type"""	25821	protein-coding gene	gene with protein product						12477932	Standard	NM_024706		Approved	FLJ13479	uc021tgt.1	Q96K58	OTTHUMG00000047357	ENST00000538906.1:c.1095C>T	16.37:g.31073154G>A		Somatic		Capture	Illumina HiSeq	Phase_I	30980655	NM_001172669	C9JHH8|F5H7E7|Q59EV1|Q8N669|Q9H8L4	Silent	SNP	ENST00000538906.1	37	CCDS10701.1																																																																																				0.672	ZNF668-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108516.2	NM_024706	
PPL	5493	broad.mit.edu	37	16	4935789	4935789	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:4935789G>A	ENST00000345988.2	-	22	2956	c.2867C>T	c.(2866-2868)aCg>aTg	p.T956M	PPL_ENST00000590782.2_Missense_Mutation_p.T954M	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	956					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.T956M(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CTCTGCCAGCGTCCGCTGCAG	0.642																																					p.T956M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2867T	16						.						69.0	74.0	72.0					16																	4935789		2197	4300	6497	4875790	SO:0001583	missense	5493	exon22			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2867C>T	16.37:g.4935789G>A	ENSP00000340510:p.Thr956Met	Somatic		Capture	Illumina HiSeq	Phase_I	4875790	NM_002705	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.622899	0.28889	.	.	ENSG00000118898	ENST00000345988	T	0.51574	0.7	5.2	4.21	0.49690	.	0.149563	0.51477	D	0.000097	T	0.48409	0.1498	L	0.51422	1.61	0.29189	N	0.875971	D	0.67145	0.996	P	0.50490	0.642	T	0.50083	-0.8869	10	0.56958	D	0.05	.	9.1935	0.37213	0.0:0.3682:0.4208:0.211	.	956	O60437	PEPL_HUMAN	M	956	ENSP00000340510:T956M	ENSP00000340510:T956M	T	-	2	0	PPL	4875790	0.728000	0.28080	0.224000	0.23877	0.055000	0.15305	0.956000	0.29202	1.132000	0.42129	0.555000	0.69702	ACG		0.642	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
BCKDK	10295	broad.mit.edu	37	16	31121809	31121809	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:31121809C>T	ENST00000394951.1	+	8	1254	c.631C>T	c.(631-633)Cat>Tat	p.H211Y	AC135050.1_ENST00000517000.2_RNA|BCKDK_ENST00000394950.3_Missense_Mutation_p.H211Y|BCKDK_ENST00000287507.3_Missense_Mutation_p.H211Y|BCKDK_ENST00000219794.6_Missense_Mutation_p.H211Y			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	211	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)	p.H211Y(1)		breast(1)|stomach(1)	2						CCTGGCGCTGCATGAGGACAA	0.582																																					p.H211Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C631T	16						.						54.0	56.0	55.0					16																	31121809		2197	4300	6497	31029310	SO:0001583	missense	10295	exon7			AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.631C>T	16.37:g.31121809C>T	ENSP00000378405:p.His211Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	31029310	NM_001122957	A8MY43|Q6FGL4|Q96G95|Q96IN5	Missense_Mutation	SNP	ENST00000394951.1	37	CCDS10705.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523600	0.44866	.	.	ENSG00000103507	ENST00000394951;ENST00000219794;ENST00000394950;ENST00000287507	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.37	5.37	0.77165	Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, N-terminal (3);	0.147780	0.64402	D	0.000012	T	0.41096	0.1144	M	0.84082	2.675	0.54753	D	0.999981	B;B	0.12630	0.006;0.006	B;B	0.14578	0.011;0.011	T	0.34650	-0.9820	10	0.52906	T	0.07	-0.9507	16.393	0.83546	0.0:1.0:0.0:0.0	.	211;211	Q96G95;O14874	.;BCKD_HUMAN	Y	211	ENSP00000378405:H211Y;ENSP00000219794:H211Y;ENSP00000378404:H211Y;ENSP00000287507:H211Y	ENSP00000219794:H211Y	H	+	1	0	BCKDK	31029310	1.000000	0.71417	0.958000	0.39756	0.823000	0.46562	5.154000	0.64894	2.676000	0.91093	0.655000	0.94253	CAT		0.582	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108514.1	NM_005881	
IRX3	79191	broad.mit.edu	37	16	54318187	54318187	+	Silent	SNP	G	G	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:54318187G>C	ENST00000329734.3	-	3	2134	c.1422C>G	c.(1420-1422)ctC>ctG	p.L474L		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	474					mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.L474L(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						AAGCTGTCTTGAGTAACTTTT	0.627																																					p.L474L	GBM(143;1830 1866 4487 4646 37383)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1422G	16						.						52.0	49.0	50.0					16																	54318187		2198	4300	6498	52875688	SO:0001819	synonymous_variant	79191	exon3			U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1422C>G	16.37:g.54318187G>C		Somatic		Capture	Illumina HiSeq	Phase_I	52875688	NM_024336	Q7Z4A4|Q7Z4A5|Q8IVC6	Silent	SNP	ENST00000329734.3	37	CCDS10750.1																																																																																				0.627	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CMTM2	146225	broad.mit.edu	37	16	66620969	66620969	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:66620969C>T	ENST00000268595.2	+	3	665	c.514C>T	c.(514-516)Cga>Tga	p.R172*	CMTM2_ENST00000379486.2_Nonsense_Mutation_p.R119*	NM_144673.2	NP_653274.1	Q8TAZ6	CKLF2_HUMAN	CKLF-like MARVEL transmembrane domain containing 2	172	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.			R -> Q (in Ref. 2; BAC05345). {ECO:0000305}.	chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.R172*(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		GAGAAGTCGGCGATCCATGAA	0.517																																					p.R119X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C355T	16						.						256.0	192.0	214.0					16																	66620969		2201	4300	6501	65178470	SO:0001587	stop_gained	146225	exon2			BC025354	CCDS10814.1, CCDS56001.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000140932	ENSG00000140932			19173	protein-coding gene	gene with protein product		607885	"""chemokine-like factor super family 2"", ""chemokine-like factor superfamily 2"""	CKLFSF2			Standard	NM_001199317		Approved	MGC39436, FLJ25732	uc002ept.3	Q8TAZ6	OTTHUMG00000137501	ENST00000268595.2:c.514C>T	16.37:g.66620969C>T	ENSP00000268595:p.Arg172*	Somatic		Capture	Illumina HiSeq	Phase_I	65178470	NM_001199317	Q5I2A4|Q8N7E5	Nonsense_Mutation	SNP	ENST00000268595.2	37	CCDS10814.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.647529	0.47258	.	.	ENSG00000140932	ENST00000379486;ENST00000268595	.	.	.	4.05	-5.28	0.02755	.	3.079760	0.01107	N	0.005493	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	2.5799	6.1256	0.20177	0.6154:0.2159:0.0:0.1687	.	.	.	.	X	119;172	.	ENSP00000268595:R172X	R	+	1	2	CMTM2	65178470	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.338000	0.02655	-0.995000	0.03459	-1.131000	0.01979	CGA		0.517	CMTM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268808.1		
FAM65A	79567	broad.mit.edu	37	16	67576488	67576488	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:67576488G>A	ENST00000379312.3	+	13	1932	c.1811G>A	c.(1810-1812)aGc>aAc	p.S604N	FAM65A_ENST00000042381.4_Missense_Mutation_p.S600N|FAM65A_ENST00000540839.3_Missense_Mutation_p.S620N|CTD-2012K14.3_ENST00000563083.1_RNA|CTD-2012K14.4_ENST00000564717.1_RNA|CTD-2012K14.2_ENST00000567122.1_RNA|FAM65A_ENST00000422602.2_Missense_Mutation_p.S620N|FAM65A_ENST00000428437.2_Missense_Mutation_p.S614N	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	604	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.S600N(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		ACTACCACAAGCCCCACCCAC	0.547																																					p.S604N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1811A	16						.						448.0	434.0	439.0					16																	67576488		2198	4300	6498	66133989	SO:0001583	missense	79567	exon13			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.1811G>A	16.37:g.67576488G>A	ENSP00000368614:p.Ser604Asn	Somatic		Capture	Illumina HiSeq	Phase_I	66133989	NM_001193522	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	.	.	.	.	.	.	.	.	.	.	g	16.40	3.113262	0.56398	.	.	ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	T;T;T	0.15718	2.4;2.4;2.4	4.15	2.07	0.26955	.	1.207580	0.05660	N	0.586687	T	0.09598	0.0236	N	0.08118	0	0.09310	N	1	B;B;B;B	0.33073	0.089;0.089;0.089;0.396	B;B;B;B	0.29785	0.051;0.051;0.051;0.107	T	0.32134	-0.9918	10	0.72032	D	0.01	-0.5153	6.8458	0.23987	0.0:0.1743:0.4674:0.3583	.	614;620;604;620	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9	.;.;FA65A_HUMAN;.	N	604;600;620;614	ENSP00000368614:S604N;ENSP00000042381:S600N;ENSP00000400099:S620N	ENSP00000042381:S600N	S	+	2	0	FAM65A	66133989	0.001000	0.12720	0.083000	0.20561	0.236000	0.25371	0.956000	0.29202	0.481000	0.27557	0.537000	0.68136	AGC		0.547	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
HAS3	3038	broad.mit.edu	37	16	69148721	69148721	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:69148721G>A	ENST00000306560.1	+	4	1370	c.1214G>A	c.(1213-1215)cGc>cAc	p.R405H	HAS3_ENST00000219322.3_Intron|HAS3_ENST00000569188.1_Missense_Mutation_p.R405H	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	405					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.R405H(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		TACCGGGGCCGCATCTGGAAC	0.542																																					p.R405H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1214A	16						.						117.0	109.0	112.0					16																	69148721		2198	4300	6498	67706222	SO:0001583	missense	3038	exon4			BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1214G>A	16.37:g.69148721G>A	ENSP00000304440:p.Arg405His	Somatic		Capture	Illumina HiSeq	Phase_I	67706222	NM_005329	A8K5T5|Q8WTZ0|Q9NYP0	Missense_Mutation	SNP	ENST00000306560.1	37	CCDS10871.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700380	0.88924	.	.	ENSG00000103044	ENST00000306560	T	0.59364	0.27	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.68869	0.3048	L	0.59436	1.845	0.58432	D	0.999998	D	0.63046	0.992	P	0.54312	0.748	T	0.65899	-0.6056	10	0.44086	T	0.13	-8.402	20.2544	0.98414	0.0:0.0:1.0:0.0	.	405	O00219	HAS3_HUMAN	H	405	ENSP00000304440:R405H	ENSP00000304440:R405H	R	+	2	0	HAS3	67706222	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.749000	0.74883	2.885000	0.99019	0.655000	0.94253	CGC		0.542	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2	NM_138612	
NOB1	28987	broad.mit.edu	37	16	69778881	69778881	+	Silent	SNP	A	A	G	rs536540729		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:69778881A>G	ENST00000268802.5	-	8	893	c.864T>C	c.(862-864)tgT>tgC	p.C288C	CTD-2033A16.3_ENST00000575838.1_RNA	NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	288					visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.C288C(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TCTTGTTCCCACAGTGTGAGC	0.587													A|||	1	0.000199681	0.0	0.0	5008	,	,		20737	0.001		0.0	False		,,,				2504	0.0				p.C288C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T864C	16						.						91.0	69.0	76.0					16																	69778881		2198	4300	6498	68336382	SO:0001819	synonymous_variant	28987	exon8			AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.864T>C	16.37:g.69778881A>G		Somatic		Capture	Illumina HiSeq	Phase_I	68336382	NM_014062	Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Silent	SNP	ENST00000268802.5	37	CCDS10884.1																																																																																				0.587	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268958.2	NM_014062	
SF3B3	23450	broad.mit.edu	37	16	70563093	70563093	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:70563093G>A	ENST00000302516.5	+	3	599	c.388G>A	c.(388-390)Gtt>Att	p.V130I	SNORD111B_ENST00000408587.1_RNA	NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	130					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)	p.V130I(1)		breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				AGGGCGAGCCGTTATGATTAG	0.438																																					p.V130I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G388A	16						.						53.0	53.0	53.0					16																	70563093		2198	4300	6498	69120594	SO:0001583	missense	23450	exon3			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.388G>A	16.37:g.70563093G>A	ENSP00000305790:p.Val130Ile	Somatic		Capture	Illumina HiSeq	Phase_I	69120594	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.428744	0.62844	.	.	ENSG00000189091	ENST00000302516;ENST00000310750	T	0.05319	3.46	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.05227	0.0139	N	0.17838	0.53	0.80722	D	1	B	0.17465	0.022	B	0.15870	0.014	T	0.21211	-1.0252	10	0.02654	T	1	.	19.9055	0.97006	0.0:0.0:1.0:0.0	.	130	Q15393	SF3B3_HUMAN	I	130	ENSP00000305790:V130I	ENSP00000305790:V130I	V	+	1	0	SF3B3	69120594	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	9.869000	0.99810	2.711000	0.92665	0.561000	0.74099	GTT		0.438	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
HYDIN	54768	broad.mit.edu	37	16	71127814	71127814	+	Missense_Mutation	SNP	C	C	T	rs7200485	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:71127814C>T	ENST00000393567.2	-	11	1502	c.1352G>A	c.(1351-1353)cGa>cAa	p.R451Q	HYDIN_ENST00000541601.1_Missense_Mutation_p.R468Q|HYDIN_ENST00000448691.1_Missense_Mutation_p.R451Q|HYDIN_ENST00000288168.10_Missense_Mutation_p.R468Q|HYDIN_ENST00000321489.5_Missense_Mutation_p.R451Q|HYDIN_ENST00000448089.2_Missense_Mutation_p.R451Q|HYDIN_ENST00000393550.2_Missense_Mutation_p.R451Q|HYDIN_ENST00000538248.1_Missense_Mutation_p.R478Q|RP11-23E19.1_ENST00000563968.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	451			R -> P (in dbSNP:rs7200485).		cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.R451Q(7)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCCTTTGATTCGGAGGGGCAG	0.428																																					p.R451Q												.	.	7	Substitution - Missense(7)	large_intestine(7)	c.G1352A	16						.						52.0	52.0	52.0					16																	71127814		2198	4300	6498	69685315	SO:0001583	missense	54768	exon11			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.1352G>A	16.37:g.71127814C>T	ENSP00000377197:p.Arg451Gln	Somatic		Capture	Illumina HiSeq	Phase_I	69685315	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939087	0.52972	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601;ENST00000288168;ENST00000393550	T;T;T;T;T;T;T;T	0.13778	5.63;3.81;3.84;3.84;3.79;3.79;3.45;2.56	4.95	4.95	0.65309	.	0.000000	0.29260	U	0.012674	T	0.30572	0.0769	L	0.49350	1.555	0.40935	D	0.984426	D;D;B;D;D	0.89917	0.971;0.971;0.417;0.971;1.0	P;P;B;P;D	0.83275	0.507;0.507;0.119;0.507;0.996	T	0.04115	-1.0976	10	0.14656	T	0.56	.	17.8452	0.88728	0.0:1.0:0.0:0.0	.	478;468;468;451;451	B4DRN4;F5H6V3;F8WD03;Q4G0P3-5;F8WD23	.;.;.;.;.	Q	451;451;451;451;451;478;468;468;451	ENSP00000377197:R451Q;ENSP00000398544:R451Q;ENSP00000394826:R451Q;ENSP00000314736:R451Q;ENSP00000444970:R478Q;ENSP00000437341:R468Q;ENSP00000288168:R468Q;ENSP00000377181:R451Q	ENSP00000288168:R468Q	R	-	2	0	HYDIN	69685315	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.908000	0.48750	2.337000	0.79520	0.194000	0.17425	CGA		0.428	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
OSGIN1	29948	broad.mit.edu	37	16	83994288	83994288	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:83994288C>A	ENST00000343939.2	+	5	951	c.568C>A	c.(568-570)Ctc>Atc	p.L190I	OSGIN1_ENST00000361711.3_Missense_Mutation_p.L107I|OSGIN1_ENST00000393306.1_Missense_Mutation_p.L107I|OSGIN1_ENST00000565123.1_Missense_Mutation_p.L107I			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	190					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)	p.L190I(1)		autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						GAAGTCGGTCCTCACCTGGAA	0.652																																					p.L107I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C319A	16						.						62.0	60.0	61.0					16																	83994288		2200	4300	6500	82551789	SO:0001583	missense	29948	exon4			AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.568C>A	16.37:g.83994288C>A	ENSP00000343376:p.Leu190Ile	Somatic		Capture	Illumina HiSeq	Phase_I	82551789	NM_182980	Q52M33|Q86UQ1|Q96S88|Q9BZ70	Missense_Mutation	SNP	ENST00000343939.2	37		.	.	.	.	.	.	.	.	.	.	C	17.86	3.492498	0.64074	.	.	ENSG00000140961	ENST00000343939;ENST00000361711;ENST00000393306	T;T;T	0.31247	2.42;1.5;1.5	4.85	4.85	0.62838	.	0.000000	0.64402	D	0.000001	T	0.45875	0.1364	L	0.37800	1.135	0.41175	D	0.98619	D	0.76494	0.999	D	0.78314	0.991	T	0.35176	-0.9799	10	0.38643	T	0.18	-35.1112	16.9387	0.86210	0.0:1.0:0.0:0.0	.	190	Q9UJX0	OSGI1_HUMAN	I	190;107;107	ENSP00000343376:L190I;ENSP00000355374:L107I;ENSP00000376983:L107I	ENSP00000343376:L190I	L	+	1	0	OSGIN1	82551789	1.000000	0.71417	0.938000	0.37757	0.441000	0.31987	5.639000	0.67868	2.228000	0.72767	0.491000	0.48974	CTC		0.652	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	NM_013370	
TAF1C	9013	broad.mit.edu	37	16	84216898	84216898	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:84216898C>T	ENST00000567759.1	-	5	542	c.360G>A	c.(358-360)gcG>gcA	p.A120A	TAF1C_ENST00000565544.1_5'Flank|TAF1C_ENST00000341690.6_Silent_p.A53A|TAF1C_ENST00000570117.1_Intron|TAF1C_ENST00000378541.4_Silent_p.A120A|TAF1C_ENST00000566732.1_Silent_p.A120A|TAF1C_ENST00000541676.1_Silent_p.A53A	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	120					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.A120A(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						TCCCCAGGGGCGCAAAGGCTA	0.617																																					p.A53A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G159A	16						.						79.0	70.0	73.0					16																	84216898		2200	4300	6500	82774399	SO:0001819	synonymous_variant	9013	exon5			L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.360G>A	16.37:g.84216898C>T		Somatic		Capture	Illumina HiSeq	Phase_I	82774399	NM_139353	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Silent	SNP	ENST00000567759.1	37	CCDS32496.1																																																																																				0.617	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353	
ANKRD11	29123	broad.mit.edu	37	16	89349963	89349963	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr16:89349963C>T	ENST00000301030.4	-	9	3447	c.2987G>A	c.(2986-2988)gGc>gAc	p.G996D	ANKRD11_ENST00000378330.2_Missense_Mutation_p.G996D	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	996	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G996D(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CGGCTCCAGGCCCTTCCCAAA	0.597																																					p.G996D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2987A	16						.						107.0	110.0	109.0					16																	89349963		2198	4300	6498	87877464	SO:0001583	missense	29123	exon9			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.2987G>A	16.37:g.89349963C>T	ENSP00000301030:p.Gly996Asp	Somatic		Capture	Illumina HiSeq	Phase_I	87877464	NM_013275	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	C	7.055	0.565142	0.13498	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.35973	1.28;1.28	5.87	-0.0415	0.13867	.	1.125940	0.06563	N	0.747057	T	0.20901	0.0503	N	0.22421	0.69	0.09310	N	1	B	0.23442	0.085	B	0.19666	0.026	T	0.26018	-1.0115	10	0.12766	T	0.61	.	5.7219	0.17992	0.0:0.2578:0.3327:0.4095	.	996	Q6UB99	ANR11_HUMAN	D	996	ENSP00000301030:G996D;ENSP00000367581:G996D	ENSP00000301030:G996D	G	-	2	0	ANKRD11	87877464	0.003000	0.15002	0.238000	0.24106	0.306000	0.27790	0.016000	0.13377	0.177000	0.19895	0.655000	0.94253	GGC		0.597	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
FAM83G	644815	broad.mit.edu	37	17	18881128	18881129	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:18881128_18881129insA	ENST00000388995.6	-	5	2073_2074	c.1850_1851insT	c.(1849-1851)gagfs	p.E617fs	FAM83G_ENST00000585154.2_Frame_Shift_Ins_p.E617fs|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000395645.3_Intron|FAM83G_ENST00000345041.4_Frame_Shift_Ins_p.E617fs|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000317977.6_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	617					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.E617fs*93(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						CGAAGTACTCCTCTGACACAGA	0.658																																					p.E617fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1851_1852insT	17						.																																			18821854	SO:0001589	frameshift_variant	644815	exon5			AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.1850_1851insT	17.37:g.18881128_18881129insA	ENSP00000373647:p.Glu617fs	Somatic		Capture	Illumina HiSeq	Phase_I	18821853	NM_001039999	Q3KQZ4|Q6ZW60	Frame_Shift_Ins	INS	ENST00000388995.6	37	CCDS42276.1																																																																																				0.658	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4		
ULK2	9706	broad.mit.edu	37	17	19687053	19687053	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:19687053A>G	ENST00000395544.4	-	22	2916	c.2417T>C	c.(2416-2418)aTc>aCc	p.I806T	ULK2_ENST00000361658.2_Missense_Mutation_p.I806T	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	806					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.I806T(1)		large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TTCAAAGGTGATGAGCCCCTC	0.547																																					p.I806T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2417C	17						.						90.0	101.0	97.0					17																	19687053		2203	4300	6503	19627645	SO:0001583	missense	9706	exon22			AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.2417T>C	17.37:g.19687053A>G	ENSP00000378914:p.Ile806Thr	Somatic		Capture	Illumina HiSeq	Phase_I	19627645	NM_001142610	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	A	17.37	3.371281	0.61624	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.70516	-0.49;-0.49	5.58	5.58	0.84498	.	0.209202	0.49916	D	0.000140	T	0.64159	0.2573	L	0.46157	1.445	0.47547	D	0.999455	B	0.31383	0.321	B	0.28465	0.09	T	0.63233	-0.6683	10	0.38643	T	0.18	-2.7467	14.9374	0.70967	1.0:0.0:0.0:0.0	.	806	Q8IYT8	ULK2_HUMAN	T	806	ENSP00000354877:I806T;ENSP00000378914:I806T	ENSP00000354877:I806T	I	-	2	0	ULK2	19627645	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.894000	0.92506	2.111000	0.64477	0.533000	0.62120	ATC		0.547	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
ULK2	9706	broad.mit.edu	37	17	19705173	19705173	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:19705173G>A	ENST00000395544.4	-	16	1857	c.1358C>T	c.(1357-1359)tCc>tTc	p.S453F	ULK2_ENST00000361658.2_Missense_Mutation_p.S453F|ULK2_ENST00000580130.1_5'UTR	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	453					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S453F(1)		large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TGGTACTGGGGAGCATGATCC	0.498																																					p.S453F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1358T	17						.						185.0	185.0	185.0					17																	19705173		2203	4300	6503	19645765	SO:0001583	missense	9706	exon16			AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.1358C>T	17.37:g.19705173G>A	ENSP00000378914:p.Ser453Phe	Somatic		Capture	Illumina HiSeq	Phase_I	19645765	NM_001142610	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.745529	0.89663	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.46819	0.86;0.86	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.68201	0.2975	M	0.64997	1.995	0.58432	D	0.999999	D	0.71674	0.998	D	0.78314	0.991	T	0.66126	-0.6001	10	0.54805	T	0.06	-14.3998	19.5289	0.95219	0.0:0.0:1.0:0.0	.	453	Q8IYT8	ULK2_HUMAN	F	453	ENSP00000354877:S453F;ENSP00000378914:S453F	ENSP00000354877:S453F	S	-	2	0	ULK2	19645765	1.000000	0.71417	0.998000	0.56505	0.808000	0.45660	9.176000	0.94839	2.865000	0.98341	0.655000	0.94253	TCC		0.498	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
ASPA	443	broad.mit.edu	37	17	3402272	3402272	+	Missense_Mutation	SNP	G	G	A	rs140581464	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:3402272G>A	ENST00000263080.2	+	6	990	c.832G>A	c.(832-834)Gtg>Atg	p.V278M	ASPA_ENST00000456349.2_Missense_Mutation_p.V278M|SPATA22_ENST00000541913.1_Intron	NM_000049.2	NP_000040.1	P45381	ACY2_HUMAN	aspartoacylase	278					aspartate catabolic process (GO:0006533)|central nervous system myelination (GO:0022010)|positive regulation of oligodendrocyte differentiation (GO:0048714)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminoacylase activity (GO:0004046)|aspartoacylase activity (GO:0019807)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)	p.V278M(1)		breast(2)|endometrium(2)|large_intestine(6)|lung(5)|stomach(1)|urinary_tract(1)	17					L-Aspartic Acid(DB00128)	AGACTGTACCGTGTACCCCGT	0.463													g|||	5	0.000998403	0.0008	0.0	5008	,	,		15348	0.004		0.0	False		,,,				2504	0.0				p.V278M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G832A	17						.	G	MET/VAL,MET/VAL	3,4403	6.2+/-15.9	0,3,2200	83.0	70.0	74.0		832,832	5.8	1.0	17	dbSNP_134	74	0,8600		0,0,4300	yes	missense,missense	ASPA	NM_000049.2,NM_001128085.1	21,21	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	probably-damaging,probably-damaging	278/314,278/314	3402272	3,13003	2203	4300	6503	3349022	SO:0001583	missense	443	exon6			S67156	CCDS11028.1	17p13.3	2010-06-24	2010-06-24		ENSG00000108381	ENSG00000108381	3.5.1.15		756	protein-coding gene	gene with protein product	"""aminoacylase 2"", ""Canavan disease"""	608034	"""aspartoacylase (aminoacylase 2, Canavan disease)"""			8252036	Standard	NM_001128085		Approved	ASP, ACY2	uc002fvq.3	P45381	OTTHUMG00000090655	ENST00000263080.2:c.832G>A	17.37:g.3402272G>A	ENSP00000263080:p.Val278Met	Somatic		Capture	Illumina HiSeq	Phase_I	3349022	NM_000049		Missense_Mutation	SNP	ENST00000263080.2	37	CCDS11028.1	4	0.0018315018315018315	1	0.0020325203252032522	0	0.0	3	0.005244755244755245	0	0.0	g	18.74	3.689148	0.68271	6.81E-4	0.0	ENSG00000108381	ENST00000456349;ENST00000263080	D;D	0.97924	-4.61;-4.61	5.76	5.76	0.90799	.	0.053759	0.64402	D	0.000001	D	0.98273	0.9428	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	D	0.96312	0.9229	10	0.66056	D	0.02	-13.2238	19.3276	0.94268	0.0:0.0:1.0:0.0	.	278	P45381	ACY2_HUMAN	M	278	ENSP00000409976:V278M;ENSP00000263080:V278M	ENSP00000263080:V278M	V	+	1	0	ASPA	3349022	1.000000	0.71417	0.974000	0.42286	0.028000	0.11728	7.609000	0.82925	2.894000	0.99253	0.591000	0.81541	GTG		0.463	ASPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207315.1	NM_000049	
SUPT6H	6830	broad.mit.edu	37	17	27020792	27020792	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:27020792G>A	ENST00000314616.6	+	28	3995	c.3712G>A	c.(3712-3714)Ggc>Agc	p.G1238S	SUPT6H_ENST00000347486.4_Missense_Mutation_p.G1238S	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1238	Interaction with KDM6A. {ECO:0000250}.|S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G1238S(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TGGTGTCACCGGCTTCATCCC	0.522																																					p.G1238S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3712A	17						.						125.0	108.0	113.0					17																	27020792		2203	4300	6503	24044919	SO:0001583	missense	6830	exon28			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3712G>A	17.37:g.27020792G>A	ENSP00000319104:p.Gly1238Ser	Somatic		Capture	Illumina HiSeq	Phase_I	24044919	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	36	5.904337	0.97087	.	.	ENSG00000109111	ENST00000314616	T	0.59638	0.25	5.82	5.82	0.92795	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.82939	0.5146	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86029	0.1512	10	0.72032	D	0.01	-20.8201	20.0989	0.97860	0.0:0.0:1.0:0.0	.	1238	Q7KZ85	SPT6H_HUMAN	S	1238	ENSP00000319104:G1238S	ENSP00000319104:G1238S	G	+	1	0	SUPT6H	24044919	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.121000	0.94375	2.764000	0.94973	0.650000	0.86243	GGC		0.522	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
IGFBP4	3487	broad.mit.edu	37	17	38610289	38610289	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:38610289G>A	ENST00000269593.4	+	3	892	c.617G>A	c.(616-618)cGc>cAc	p.R206H	IGFBP4_ENST00000542955.1_Missense_Mutation_p.R106H	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	206	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.R206H(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			AACTGCGACCGCAACGGCAAC	0.667																																					p.R206H	GBM(160;940 3581 26177)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G617A	17						.						128.0	120.0	122.0					17																	38610289		2203	4300	6503	35863815	SO:0001583	missense	3487	exon3			M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.617G>A	17.37:g.38610289G>A	ENSP00000269593:p.Arg206His	Somatic		Capture	Illumina HiSeq	Phase_I	35863815	NM_001552	A0N9W2|B4E351|Q5U012|Q9UCL6	Missense_Mutation	SNP	ENST00000269593.4	37	CCDS11367.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803522	0.90623	.	.	ENSG00000141753	ENST00000542955;ENST00000269593	T;T	0.63913	-0.07;-0.07	5.91	5.91	0.95273	Thyroglobulin type-1 (5);	0.112611	0.64402	D	0.000012	T	0.73659	0.3615	L	0.43701	1.375	0.44871	D	0.997884	D	0.89917	1.0	D	0.69307	0.963	T	0.74746	-0.3561	10	0.87932	D	0	-6.157	18.0867	0.89460	0.0:0.0:1.0:0.0	.	206	P22692	IBP4_HUMAN	H	106;206	ENSP00000437734:R106H;ENSP00000269593:R206H	ENSP00000269593:R206H	R	+	2	0	IGFBP4	35863815	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.138000	0.64795	2.793000	0.96121	0.655000	0.94253	CGC		0.667	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
SMARCE1	6605	broad.mit.edu	37	17	38787103	38787103	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:38787103C>T	ENST00000348513.6	-	10	1670	c.890G>A	c.(889-891)cGc>cAc	p.R297H	SMARCE1_ENST00000578044.1_Missense_Mutation_p.R227H|SMARCE1_ENST00000431889.2_Missense_Mutation_p.R279H|SMARCE1_ENST00000400122.3_Missense_Mutation_p.R227H|SMARCE1_ENST00000377808.4_Missense_Mutation_p.R262H|KRT222_ENST00000476049.1_3'UTR|SMARCE1_ENST00000580419.1_Missense_Mutation_p.R262H|SMARCE1_ENST00000544009.1_Missense_Mutation_p.R227H	NM_003079.4	NP_003070.3	Q969G3	SMCE1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	297					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|metabolic process (GO:0008152)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|N-acetyltransferase activity (GO:0008080)|protein N-terminus binding (GO:0047485)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)	p.R297H(1)		large_intestine(1)	1		Breast(137;0.000812)				CTGCCTTTTGCGGGCCTGTTC	0.507																																					p.R297H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G890A	17						.						122.0	106.0	111.0					17																	38787103		2203	4300	6503	36040629	SO:0001583	missense	6605	exon10			AF035262	CCDS11370.1	17q21.2	2006-09-20			ENSG00000073584	ENSG00000073584			11109	protein-coding gene	gene with protein product		603111				9435219	Standard	NM_003079		Approved	BAF57	uc002hux.2	Q969G3	OTTHUMG00000133367	ENST00000348513.6:c.890G>A	17.37:g.38787103C>T	ENSP00000323967:p.Arg297His	Somatic		Capture	Illumina HiSeq	Phase_I	36040629	NM_003079	B3KMC1|B4DFR4|C0IMW4|C0IMW5|C0IMW7|H7C3F6|O43539	Missense_Mutation	SNP	ENST00000348513.6	37	CCDS11370.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.53|17.53	3.412636|3.412636	0.62511|0.62511	.|.	.|.	ENSG00000073584|ENSG00000073584	ENST00000400122|ENST00000348513;ENST00000544009;ENST00000431889;ENST00000377808;ENST00000447024	.|T;T;T	.|0.20598	.|2.07;2.06;2.3	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	.|0.048290	.|0.85682	.|D	.|0.000000	T|T	0.44993|0.44993	0.1320|0.1320	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.76071	.|0.987;0.98;0.98	T|T	0.28332|0.28332	-1.0047|-1.0047	5|10	.|0.72032	.|D	.|0.01	.|.	19.7017|19.7017	0.96057|0.96057	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|262;262;297	.|C0IMW5;C0IMW4;Q969G3	.|.;.;SMCE1_HUMAN	T|H	123|297;227;279;262;91	.|ENSP00000323967:R297H;ENSP00000445370:R279H;ENSP00000367039:R262H	.|ENSP00000323967:R297H	A|R	-|-	1|2	0|0	SMARCE1|SMARCE1	36040629|36040629	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.872000|0.872000	0.50106|0.50106	6.978000|6.978000	0.76147|0.76147	2.724000|2.724000	0.93272|0.93272	0.561000|0.561000	0.74099|0.74099	GCA|CGC		0.507	SMARCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257203.1	NM_003079	
KRT25	147183	broad.mit.edu	37	17	38911437	38911437	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:38911437G>T	ENST00000312150.4	-	1	147	c.87C>A	c.(85-87)agC>agA	p.S29R		NM_181534.3	NP_853512.1			keratin 25									p.S29R(1)		endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				CAGTACCAAAGCTGGTTCCCC	0.532																																					p.S29R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C87A	17						.						53.0	51.0	52.0					17																	38911437		2203	4300	6503	36164963	SO:0001583	missense	147183	exon1			AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.87C>A	17.37:g.38911437G>T	ENSP00000310573:p.Ser29Arg	Somatic		Capture	Illumina HiSeq	Phase_I	36164963	NM_181534		Missense_Mutation	SNP	ENST00000312150.4	37	CCDS11373.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.639431	0.47153	.	.	ENSG00000204897	ENST00000394042;ENST00000312150	D	0.83673	-1.75	5.76	2.58	0.30949	.	0.147930	0.48767	D	0.000170	T	0.67664	0.2917	N	0.14661	0.345	0.30599	N	0.760747	B	0.26876	0.162	B	0.30855	0.121	T	0.65998	-0.6032	10	0.48119	T	0.1	.	7.144	0.25573	0.2055:0.1301:0.6644:0.0	.	29	Q7Z3Z0	K1C25_HUMAN	R	29	ENSP00000310573:S29R	ENSP00000310573:S29R	S	-	3	2	KRT25	36164963	0.007000	0.16637	1.000000	0.80357	0.964000	0.63967	0.649000	0.24843	1.451000	0.47736	0.655000	0.94253	AGC		0.532	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257218.1	NM_181534	
KRT34	3885	broad.mit.edu	37	17	39535699	39535699	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:39535699C>A	ENST00000394001.1	-	5	938	c.908G>T	c.(907-909)aGc>aTc	p.S303I		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	303	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.S303I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				CTGCTCTGAGCTGGATACCAC	0.612																																					p.S303I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G908T	17						.						139.0	115.0	123.0					17																	39535699		2203	4300	6503	36789225	SO:0001583	missense	3885	exon5			Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.908G>T	17.37:g.39535699C>A	ENSP00000377570:p.Ser303Ile	Somatic		Capture	Illumina HiSeq	Phase_I	36789225	NM_021013	Q8IUT8|Q8N4W2	Missense_Mutation	SNP	ENST00000394001.1	37	CCDS11390.1	.	.	.	.	.	.	.	.	.	.	c	17.69	3.451004	0.63290	.	.	ENSG00000131737	ENST00000394001;ENST00000251648	.	.	.	4.75	4.75	0.60458	Filament (1);	0.000000	0.85682	D	0.000000	D	0.84831	0.5559	H	0.94306	3.52	0.32585	N	0.527908	D	0.89917	1.0	D	0.85130	0.997	D	0.90761	0.4665	9	0.87932	D	0	.	17.0877	0.86615	0.0:1.0:0.0:0.0	.	303	O76011	KRT34_HUMAN	I	261;303	.	ENSP00000251648:S303I	S	-	2	0	KRT34	36789225	0.988000	0.35896	1.000000	0.80357	0.543000	0.35085	1.378000	0.34328	2.341000	0.79615	0.555000	0.69702	AGC		0.612	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257304.3	NM_021013	
DHX58	79132	broad.mit.edu	37	17	40257981	40257981	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:40257981C>T	ENST00000251642.3	-	9	1246	c.1024G>A	c.(1024-1026)Gca>Aca	p.A342T		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	342					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.A342T(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CCATGAGTTGCCAAGTGGGCC	0.517																																					p.A342T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1024A	17						.						96.0	96.0	96.0					17																	40257981		2203	4300	6503	37511507	SO:0001583	missense	79132	exon9			BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.1024G>A	17.37:g.40257981C>T	ENSP00000251642:p.Ala342Thr	Somatic		Capture	Illumina HiSeq	Phase_I	37511507	NM_024119	Q9HAM6	Missense_Mutation	SNP	ENST00000251642.3	37	CCDS11416.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.138505	0.77775	.	.	ENSG00000108771	ENST00000251642;ENST00000423748	T	0.42131	0.98	4.9	4.9	0.64082	.	0.060660	0.64402	D	0.000005	T	0.60612	0.2282	M	0.81179	2.53	0.34235	D	0.677028	D;D	0.89917	1.0;1.0	D;D	0.68353	0.957;0.957	T	0.70238	-0.4927	10	0.33141	T	0.24	.	9.2496	0.37547	0.0:0.9009:0.0:0.0991	.	335;342	B7Z455;Q96C10	.;DHX58_HUMAN	T	342;305	ENSP00000251642:A342T	ENSP00000251642:A342T	A	-	1	0	DHX58	37511507	1.000000	0.71417	0.382000	0.26119	0.280000	0.26924	2.209000	0.42806	2.273000	0.75805	0.455000	0.32223	GCA		0.517	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257396.1	NM_024119	
MPP3	4356	broad.mit.edu	37	17	41891379	41891379	+	Splice_Site	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:41891379G>A	ENST00000398389.4	-	16	1420	c.1255C>T	c.(1255-1257)Cat>Tat	p.H419Y	MPP3_ENST00000398393.1_Splice_Site_p.H444Y|MPP3_ENST00000475450.1_5'UTR	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	419	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)	p.H419Y(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		GCCCTCTTACGTGGAACAGCG	0.522																																					p.H419Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1255T	17						.						98.0	99.0	99.0					17																	41891379		1977	4162	6139	39246905	SO:0001630	splice_region_variant	4356	exon16				CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.1255+1C>T	17.37:g.41891379G>A		Somatic		Capture	Illumina HiSeq	Phase_I	39246905	NM_001932	B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Missense_Mutation	SNP	ENST00000398389.4	37	CCDS42344.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.456151	0.84209	.	.	ENSG00000161647	ENST00000398393;ENST00000398389	T;T	0.18657	2.2;2.2	4.86	4.86	0.63082	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.110905	0.64402	D	0.000008	T	0.34366	0.0895	M	0.62154	1.92	0.80722	D	1	D;D	0.59767	0.961;0.986	P;P	0.52189	0.692;0.692	T	0.04216	-1.0968	9	.	.	.	.	16.362	0.83271	0.0:0.0:1.0:0.0	.	419;444	Q13368;D3DX46	MPP3_HUMAN;.	Y	444;419	ENSP00000381430:H444Y;ENSP00000381425:H419Y	.	H	-	1	0	MPP3	39246905	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.806000	0.75195	2.512000	0.84698	0.561000	0.74099	CAT		0.522	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	NM_001932	Missense_Mutation
SLC4A1	6521	broad.mit.edu	37	17	42335424	42335424	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:42335424C>A	ENST00000262418.6	-	11	1367	c.1212G>T	c.(1210-1212)caG>caT	p.Q404H	AC003043.1_ENST00000597382.1_Intron|SLC4A1_ENST00000471005.1_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	404	Membrane (anion exchange).		Missing (in EL4; increased rigidity of the erythrocyte membrane leading to increased resistance to shear stress and increased resistance to P.falciparum). {ECO:0000269|PubMed:1538405, ECO:0000269|PubMed:1722314}.		anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.Q404H(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CAGCCAGGACCTGGGGGCTGA	0.597																																					p.Q404H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1212T	17						.						81.0	79.0	80.0					17																	42335424		2203	4300	6503	39690950	SO:0001583	missense	6521	exon11				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.1212G>T	17.37:g.42335424C>A	ENSP00000262418:p.Gln404His	Somatic		Capture	Illumina HiSeq	Phase_I	39690950	NM_000342	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	ENST00000262418.6	37	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	c	19.83	3.900093	0.72754	.	.	ENSG00000004939	ENST00000262418	D	0.81996	-1.56	4.96	1.87	0.25490	Bicarbonate transporter, C-terminal (1);	0.125473	0.56097	D	0.000029	D	0.90721	0.7088	M	0.92367	3.3	0.54753	D	0.999982	D;P	0.76494	0.999;0.936	D;P	0.66716	0.946;0.789	D	0.88845	0.3315	10	0.87932	D	0	.	7.2786	0.26297	0.0:0.7011:0.1404:0.1584	.	404;404	E2RVJ0;P02730	.;B3AT_HUMAN	H	404	ENSP00000262418:Q404H	ENSP00000262418:Q404H	Q	-	3	2	SLC4A1	39690950	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.958000	0.40402	0.284000	0.22305	0.561000	0.74099	CAG		0.597	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342	
GRN	2896	broad.mit.edu	37	17	42427660	42427660	+	Silent	SNP	G	G	A	rs543344476	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:42427660G>A	ENST00000053867.3	+	5	476	c.414G>A	c.(412-414)acG>acA	p.T138T	GRN_ENST00000589265.1_Silent_p.T138T	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	138					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)	p.T138T(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		ACTTCTCCACGTGCTGTGTTA	0.587																																					p.T138T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G414A	17						.						225.0	197.0	206.0					17																	42427660		2203	4300	6503	39783186	SO:0001819	synonymous_variant	2896	exon5			M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.414G>A	17.37:g.42427660G>A		Somatic		Capture	Illumina HiSeq	Phase_I	39783186	NM_002087	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Silent	SNP	ENST00000053867.3	37	CCDS11483.1	.	.	.	.	.	.	.	.	.	.	G	0.304	-0.972167	0.02215	.	.	ENSG00000030582	ENST00000393566	.	.	.	4.22	-8.45	0.00946	.	.	.	.	.	T	0.55353	0.1915	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66933	-0.5798	5	0.45353	T	0.12	-11.8416	9.9567	0.41671	0.5319:0.3432:0.1249:0.0	.	.	.	.	H	45	.	ENSP00000377196:R45H	R	+	2	0	GRN	39783186	0.000000	0.05858	0.337000	0.25536	0.029000	0.11900	-2.992000	0.00657	-2.486000	0.00520	-0.672000	0.03802	CGT		0.587	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457766.1	NM_002087	
PELP1	27043	broad.mit.edu	37	17	4576070	4576070	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:4576070A>G	ENST00000574876.1	-	16	2233	c.2216T>C	c.(2215-2217)aTc>aCc	p.I739T	AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000436683.2_Missense_Mutation_p.I592T|PELP1_ENST00000572293.1_Missense_Mutation_p.I789T|PELP1_ENST00000269230.7_Missense_Mutation_p.I649T|PELP1_ENST00000301396.4_Missense_Mutation_p.I883T			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	739	Pro-rich.				cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.I789T(1)		breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						AGGGGCAAGGATGGGGTCCTC	0.597																																					p.I739T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2216C	17						.						21.0	24.0	23.0					17																	4576070		1901	4109	6010	4522819	SO:0001583	missense	27043	exon16				CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.2216T>C	17.37:g.4576070A>G	ENSP00000461625:p.Ile739Thr	Somatic		Capture	Illumina HiSeq	Phase_I	4522819	NM_014389	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Missense_Mutation	SNP	ENST00000574876.1	37	CCDS58503.1	.	.	.	.	.	.	.	.	.	.	A	9.388	1.074682	0.20227	.	.	ENSG00000141456	ENST00000301396;ENST00000269230;ENST00000436683	T;T;T	0.52526	0.72;0.66;1.41	5.2	4.09	0.47781	.	0.759165	0.11823	N	0.526020	T	0.25680	0.0625	N	0.14661	0.345	0.25917	N	0.983168	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.22452	-1.0216	10	0.09338	T	0.73	-10.9749	6.5314	0.22330	0.8542:0.0:0.1458:0.0	.	592;739	E7EV54;Q8IZL8	.;PELP1_HUMAN	T	883;649;592	ENSP00000301396:I883T;ENSP00000269230:I649T;ENSP00000416231:I592T	ENSP00000269230:I649T	I	-	2	0	AC091153.1	4522819	0.966000	0.33281	0.810000	0.32431	0.906000	0.53458	2.144000	0.42197	1.959000	0.56917	0.459000	0.35465	ATC		0.597	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
PELP1	27043	broad.mit.edu	37	17	4576684	4576684	+	Missense_Mutation	SNP	G	G	A	rs371213384		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:4576684G>A	ENST00000574876.1	-	15	1723	c.1706C>T	c.(1705-1707)cCg>cTg	p.P569L	AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000436683.2_Missense_Mutation_p.P422L|PELP1_ENST00000572293.1_Missense_Mutation_p.P619L|PELP1_ENST00000269230.7_Intron|PELP1_ENST00000301396.4_Missense_Mutation_p.P713L			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	569					cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.P619L(1)		breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						GCTCGTGTACGGGGAGCTGCC	0.642																																					p.P569L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1706T	17						.	G	LEU/PRO	0,4220		0,0,2110	17.0	27.0	23.0		1706	4.6	1.0	17		23	1,8479		0,1,4239	no	missense	PELP1	NM_014389.2	98	0,1,6349	AA,AG,GG		0.0118,0.0,0.0079	benign	569/1131	4576684	1,12699	2110	4240	6350	4523433	SO:0001583	missense	27043	exon15				CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.1706C>T	17.37:g.4576684G>A	ENSP00000461625:p.Pro569Leu	Somatic		Capture	Illumina HiSeq	Phase_I	4523433	NM_014389	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Missense_Mutation	SNP	ENST00000574876.1	37	CCDS58503.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344190	0.41498	0.0	1.18E-4	ENSG00000141456	ENST00000301396;ENST00000436683	T;T	0.71579	-0.58;-0.37	5.54	4.58	0.56647	Uncharacterised domain NUC202 (1);	0.126906	0.53938	N	0.000046	T	0.63628	0.2527	M	0.63843	1.955	0.46901	D	0.999244	B;B	0.32800	0.385;0.385	B;B	0.26517	0.07;0.07	T	0.62048	-0.6936	10	0.28530	T	0.3	-18.2818	11.9345	0.52866	0.0827:0.0:0.9173:0.0	.	422;569	E7EV54;Q8IZL8	.;PELP1_HUMAN	L	713;422	ENSP00000301396:P713L;ENSP00000416231:P422L	ENSP00000301396:P713L	P	-	2	0	AC091153.1	4523433	1.000000	0.71417	0.981000	0.43875	0.805000	0.45488	4.764000	0.62264	1.581000	0.49865	0.655000	0.94253	CCG		0.642	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
DBF4B	80174	broad.mit.edu	37	17	42825823	42825823	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:42825823C>T	ENST00000315005.3	+	13	1317	c.1179C>T	c.(1177-1179)tgC>tgT	p.C393C	DBF4B_ENST00000393547.2_Silent_p.C393C	NM_145663.2	NP_663696.1	Q8NFT6	DBF4B_HUMAN	DBF4 zinc finger B	393					cell cycle (GO:0007049)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of protein kinase activity (GO:0045860)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.C393C(1)		kidney(1)|large_intestine(1)|lung(5)	7		Prostate(33;0.0322)				AAGACAGCTGCCAGGCATCAG	0.582																																					p.C393C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1179T	17						.						98.0	80.0	86.0					17																	42825823		2203	4300	6503	40181349	SO:0001819	synonymous_variant	80174	exon13			AF465820	CCDS11485.1, CCDS45706.1, CCDS45706.2	17q21.31	2014-02-17	2014-02-17		ENSG00000161692	ENSG00000161692		"""Zinc fingers, DBF-type"""	17883	protein-coding gene	gene with protein product	"""chiffon homolog B (Drosophila)"", ""zinc finger, DBF-type containing 1B"""	611661	"""DBF4 homolog B (S. cerevisiae)"""			15668232	Standard	NM_145663		Approved	FLJ13087, DRF1, ASKL1, chifb, ZDBF1B	uc002ihf.3	Q8NFT6	OTTHUMG00000165717	ENST00000315005.3:c.1179C>T	17.37:g.42825823C>T		Somatic		Capture	Illumina HiSeq	Phase_I	40181349	NM_025104	D3DX56|Q8TEX0|Q96B19|Q9H912	Silent	SNP	ENST00000315005.3	37	CCDS11485.1																																																																																				0.582	DBF4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385930.1	NM_025104	
COL1A1	1277	broad.mit.edu	37	17	48267940	48267940	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:48267940G>A	ENST00000225964.5	-	34	2479	c.2361C>T	c.(2359-2361)agC>agT	p.S787S		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	787	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.S787S(1)	COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	CAGCAGGGCCGCTGGGACCAC	0.607			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.S787S			Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2361T	17						.						74.0	87.0	83.0					17																	48267940		2202	4300	6502	45622939	SO:0001819	synonymous_variant	1277	exon34			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.2361C>T	17.37:g.48267940G>A		Somatic		Capture	Illumina HiSeq	Phase_I	45622939	NM_000088	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Silent	SNP	ENST00000225964.5	37	CCDS11561.1																																																																																				0.607	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
ZFP3	124961	broad.mit.edu	37	17	4996103	4996103	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:4996103A>G	ENST00000318833.3	+	2	1640	c.1304A>G	c.(1303-1305)gAg>gGg	p.E435G		NM_153018.2	NP_694563.1	Q96NJ6	ZFP3_HUMAN	ZFP3 zinc finger protein	435					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E435G(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(3)|prostate(1)	20						GATAATTCTGAGCTGCTTCTC	0.418																																					p.E435G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1304G	17						.						65.0	67.0	66.0					17																	4996103		2203	4300	6503	4936827	SO:0001583	missense	124961	exon2			BX647638	CCDS11067.1	17p13.2	2013-01-08	2012-11-27		ENSG00000180787	ENSG00000180787		"""Zinc fingers, C2H2-type"""	12861	protein-coding gene	gene with protein product		194480	"""zinc finger protein homologous to Zfp-3 in mouse"", ""zinc finger protein 3 homolog (mouse)"""				Standard	NM_153018		Approved	FLJ30726, ZNF752	uc002gaq.3	Q96NJ6		ENST00000318833.3:c.1304A>G	17.37:g.4996103A>G	ENSP00000320347:p.Glu435Gly	Somatic		Capture	Illumina HiSeq	Phase_I	4936827	NM_153018	A5PLL4	Missense_Mutation	SNP	ENST00000318833.3	37	CCDS11067.1	.	.	.	.	.	.	.	.	.	.	A	9.067	0.996042	0.19043	.	.	ENSG00000180787	ENST00000318833	T	0.15017	2.46	3.9	2.83	0.33086	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.209891	0.23813	N	0.044307	T	0.08313	0.0207	N	0.11064	0.09	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.27262	-1.0079	10	0.36615	T	0.2	-6.4269	7.4538	0.27255	0.8935:0.0:0.1065:0.0	.	435	Q96NJ6	ZFP3_HUMAN	G	435	ENSP00000320347:E435G	ENSP00000320347:E435G	E	+	2	0	ZFP3	4936827	0.000000	0.05858	0.957000	0.39632	0.998000	0.95712	0.145000	0.16157	0.866000	0.35629	0.533000	0.62120	GAG		0.418	ZFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438979.1	NM_153018	
NLRP1	22861	broad.mit.edu	37	17	5424989	5424989	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:5424989G>A	ENST00000572272.1	-	13	3637	c.3638C>T	c.(3637-3639)tCc>tTc	p.S1213F	NLRP1_ENST00000269280.4_Missense_Mutation_p.S1213F|NLRP1_ENST00000262467.5_Missense_Mutation_p.S1217F|NLRP1_ENST00000354411.3_Missense_Mutation_p.S1183F|NLRP1_ENST00000345221.3_Missense_Mutation_p.S1213F|NLRP1_ENST00000577119.1_Missense_Mutation_p.S1183F			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1213					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.S1213F(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				TCCCAAGGGGGAGAAGCTGGG	0.547																																					p.S1183F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3548T	17						.						81.0	84.0	83.0					17																	5424989		2203	4300	6503	5365713	SO:0001583	missense	22861	exon12			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3638C>T	17.37:g.5424989G>A	ENSP00000460475:p.Ser1213Phe	Somatic		Capture	Illumina HiSeq	Phase_I	5365713	NM_033007	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934588	0.52866	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221;ENST00000537069	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	4.2	2.15	0.27550	.	0.000000	0.38111	N	0.001819	T	0.52741	0.1753	M	0.83953	2.67	0.26261	N	0.978573	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.42015	-0.9476	10	0.87932	D	0	.	7.5723	0.27915	0.0956:0.1675:0.7369:0.0	.	1183;1183;1213;1213;1217	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;NALP1_HUMAN;.;.	F	1217;1217;1213;1183;1213;479	ENSP00000442029:S1217F;ENSP00000262467:S1217F;ENSP00000269280:S1213F;ENSP00000346390:S1183F;ENSP00000324366:S1213F	ENSP00000262467:S1217F	S	-	2	0	NLRP1	5365713	0.936000	0.31750	0.166000	0.22797	0.820000	0.46376	1.322000	0.33689	0.520000	0.28426	0.650000	0.86243	TCC		0.547	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
MYCBPAP	84073	broad.mit.edu	37	17	48595912	48595912	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:48595912G>A	ENST00000323776.5	+	5	770	c.608G>A	c.(607-609)cGg>cAg	p.R203Q	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.R166Q	NM_032133.4	NP_115509.4			MYCBP associated protein									p.R166Q(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			CTGGCTGAGCGGATACCTACC	0.542																																					p.R203Q												MYCBPAP,urinary_tract,bladder,Substitution - Missense,0 	.	2	Substitution - Missense(2)	urinary_tract(1)|large_intestine(1)	c.G608A	17						.						153.0	154.0	154.0					17																	48595912		2203	4300	6503	45950911	SO:0001583	missense	84073	exon5			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.608G>A	17.37:g.48595912G>A	ENSP00000323184:p.Arg203Gln	Somatic		Capture	Illumina HiSeq	Phase_I	45950911	NM_032133		Missense_Mutation	SNP	ENST00000323776.5	37	CCDS32680.2	.	.	.	.	.	.	.	.	.	.	G	10.79	1.449310	0.26074	.	.	ENSG00000136449	ENST00000323776;ENST00000452039;ENST00000436259	T;T	0.23552	1.9;1.9	5.5	4.42	0.53409	.	0.608951	0.15654	N	0.251235	T	0.12774	0.0310	N	0.14661	0.345	0.21105	N	0.999787	B;B	0.20988	0.014;0.05	B;B	0.06405	0.001;0.002	T	0.28267	-1.0049	10	0.20519	T	0.43	-5.8498	5.8622	0.18754	0.0:0.0856:0.1719:0.7425	.	166;203	Q8TBZ2;B4DZQ1	MYBPP_HUMAN;.	Q	203;218;166	ENSP00000323184:R203Q;ENSP00000397209:R166Q	ENSP00000323184:R203Q	R	+	2	0	MYCBPAP	45950911	1.000000	0.71417	0.949000	0.38748	0.197000	0.23852	1.404000	0.34623	0.924000	0.37069	-0.256000	0.11100	CGG		0.542	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133	
DVL2	1856	broad.mit.edu	37	17	7129741	7129741	+	Splice_Site	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:7129741C>A	ENST00000005340.5	-	14	2043	c.1761G>T	c.(1759-1761)gaG>gaT	p.E587D	DVL2_ENST00000575458.1_Splice_Site_p.E581D|DVL2_ENST00000574642.1_5'Flank	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	587					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)	p.E587D(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						ATGACTTACCCTCACTATGCT	0.612																																					p.E587D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1761T	17						.						42.0	40.0	41.0					17																	7129741		2203	4300	6503	7070465	SO:0001630	splice_region_variant	1856	exon14			BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.1762+1G>T	17.37:g.7129741C>A		Somatic		Capture	Illumina HiSeq	Phase_I	7070465	NM_004422	D3DTN3|Q53XM0	Missense_Mutation	SNP	ENST00000005340.5	37	CCDS11091.1	.	.	.	.	.	.	.	.	.	.	C	13.11	2.140354	0.37825	.	.	ENSG00000004975	ENST00000005340	T	0.05025	3.51	4.91	2.8	0.32819	Dishevelled C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.23171	0.0560	M	0.84585	2.705	0.53688	D	0.999971	D;D	0.63046	0.992;0.992	D;D	0.74348	0.983;0.983	T	0.00423	-1.1748	10	0.49607	T	0.09	-22.8236	8.247	0.31695	0.0:0.7892:0.0:0.2108	.	581;587	B4DLQ0;O14641	.;DVL2_HUMAN	D	587	ENSP00000005340:E587D	ENSP00000005340:E587D	E	-	3	2	DVL2	7070465	0.125000	0.22332	1.000000	0.80357	0.972000	0.66771	-0.092000	0.11129	0.572000	0.29383	0.655000	0.94253	GAG		0.612	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	Missense_Mutation
DVL2	1856	broad.mit.edu	37	17	7130761	7130761	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:7130761C>T	ENST00000005340.5	-	12	1607	c.1325G>A	c.(1324-1326)cGc>cAc	p.R442H	DVL2_ENST00000575458.1_Missense_Mutation_p.R436H|DVL2_ENST00000574642.1_5'Flank	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	442	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)	p.R442H(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						GAGCCACATGCGGTCCCGGAC	0.612																																					p.R442H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1325A	17						.						71.0	74.0	73.0					17																	7130761		2203	4300	6503	7071485	SO:0001583	missense	1856	exon12			BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.1325G>A	17.37:g.7130761C>T	ENSP00000005340:p.Arg442His	Somatic		Capture	Illumina HiSeq	Phase_I	7071485	NM_004422	D3DTN3|Q53XM0	Missense_Mutation	SNP	ENST00000005340.5	37	CCDS11091.1	.	.	.	.	.	.	.	.	.	.	C	32	5.163986	0.94727	.	.	ENSG00000004975	ENST00000005340	T	0.26518	1.73	4.76	4.76	0.60689	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.63965	0.2556	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.76623	-0.2891	10	0.87932	D	0	-16.3986	15.2834	0.73806	0.0:1.0:0.0:0.0	.	436;442	B4DLQ0;O14641	.;DVL2_HUMAN	H	442	ENSP00000005340:R442H	ENSP00000005340:R442H	R	-	2	0	DVL2	7071485	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.482000	0.83794	0.655000	0.94253	CGC		0.612	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
TEX14	56155	broad.mit.edu	37	17	56676676	56676676	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:56676676T>G	ENST00000240361.8	-	14	2133	c.2048A>C	c.(2047-2049)gAg>gCg	p.E683A	TEX14_ENST00000389934.3_Missense_Mutation_p.E677A|TEX14_ENST00000349033.5_Missense_Mutation_p.E677A			Q8IWB6	TEX14_HUMAN	testis expressed 14	683					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.E677A(1)|p.E683A(1)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCTCTCATCCTCACTGCCAAA	0.478																																					p.E677A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2030C	17						.						150.0	142.0	144.0					17																	56676676		2203	4300	6503	54031675	SO:0001583	missense	56155	exon14			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.2048A>C	17.37:g.56676676T>G	ENSP00000240361:p.Glu683Ala	Somatic		Capture	Illumina HiSeq	Phase_I	54031675	NM_198393	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.691742	0.48097	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	D;D;D	0.83075	-1.68;-1.68;-1.59	5.54	5.54	0.83059	.	0.467657	0.21843	N	0.068287	T	0.81772	0.4893	M	0.65975	2.015	0.24777	N	0.992833	B;B;B	0.21753	0.035;0.06;0.06	B;B;B	0.22601	0.018;0.037;0.04	T	0.74771	-0.3552	10	0.59425	D	0.04	-7.4452	13.0651	0.59028	0.0:0.0:0.0:1.0	.	683;677;677	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	A	683;677;677	ENSP00000240361:E683A;ENSP00000374584:E677A;ENSP00000268910:E677A	ENSP00000240361:E683A	E	-	2	0	TEX14	54031675	0.941000	0.31946	0.078000	0.20375	0.087000	0.18053	3.005000	0.49521	2.112000	0.64535	0.533000	0.62120	GAG		0.478	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
EIF5A	1984	broad.mit.edu	37	17	7214700	7214700	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:7214700T>G	ENST00000336458.8	+	4	703	c.302T>G	c.(301-303)cTg>cGg	p.L101R	EIF5A_ENST00000336452.7_Missense_Mutation_p.L131R|EIF5A_ENST00000416016.2_Missense_Mutation_p.L101R|EIF5A_ENST00000571955.1_Missense_Mutation_p.L101R|EIF5A_ENST00000573542.1_Missense_Mutation_p.L101R|EIF5A_ENST00000419711.2_Missense_Mutation_p.L101R|EIF5A_ENST00000572815.1_Missense_Mutation_p.L101R|EIF5A_ENST00000576930.1_Missense_Mutation_p.L101R|GPS2_ENST00000391950.3_3'UTR	NM_001970.4	NP_001961.1	P63241	IF5A1_HUMAN	eukaryotic translation initiation factor 5A	101					apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|mRNA export from nucleus (GO:0006406)|nucleocytoplasmic transport (GO:0006913)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of translational elongation (GO:0045901)|positive regulation of translational termination (GO:0045905)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|translational frameshifting (GO:0006452)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation elongation factor activity (GO:0003746)|U6 snRNA binding (GO:0017070)	p.L101R(1)		endometrium(2)|kidney(1)|large_intestine(2)|urinary_tract(1)	6						TACCTATCACTGCTCCAGGAC	0.567																																					p.L101R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T302G	17						.						110.0	102.0	105.0					17																	7214700		2203	4300	6503	7155424	SO:0001583	missense	1984	exon4				CCDS11099.1, CCDS45601.1	17p13-p12	2009-05-01			ENSG00000132507	ENSG00000132507			3300	protein-coding gene	gene with protein product		600187				7759117	Standard	NM_001143760		Approved	EIF5A1, EIF-5A, MGC99547, MGC104255	uc002gfr.3	P63241	OTTHUMG00000102197	ENST00000336458.8:c.302T>G	17.37:g.7214700T>G	ENSP00000336776:p.Leu101Arg	Somatic		Capture	Illumina HiSeq	Phase_I	7155424	NM_001143761	A8K9A0|D3DTP2|P10159|Q16182|Q7L7L3|Q7Z4L1|Q9D0G2	Missense_Mutation	SNP	ENST00000336458.8	37	CCDS11099.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.481740	0.84747	.	.	ENSG00000132507	ENST00000336452;ENST00000336458;ENST00000419711;ENST00000416016	T;T;T;T	0.57907	0.37;0.43;0.43;0.43	4.45	4.45	0.53987	Nucleic acid-binding, OB-fold-like (1);Translation elongation factor, IF5A C-terminal (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.64402	D	0.000018	T	0.78672	0.4320	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.84650	0.0700	10	0.72032	D	0.01	-0.4114	13.1271	0.59363	0.0:0.0:0.0:1.0	.	101;131	P63241;P63241-2	IF5A1_HUMAN;.	R	131;101;101;101	ENSP00000336702:L131R;ENSP00000336776:L101R;ENSP00000390677:L101R;ENSP00000396073:L101R	ENSP00000336702:L131R	L	+	2	0	EIF5A	7155424	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.282000	0.78630	2.015000	0.59207	0.459000	0.35465	CTG		0.567	EIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220047.3	NM_001970	
TRIM47	91107	broad.mit.edu	37	17	73871098	73871098	+	Silent	SNP	C	C	T	rs143007460		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:73871098C>T	ENST00000254816.2	-	6	1409	c.1383G>A	c.(1381-1383)tcG>tcA	p.S461S	TRIM47_ENST00000587339.1_Silent_p.S223S|RP11-552F3.9_ENST00000586076.1_RNA	NM_033452.2	NP_258411.2	Q96LD4	TRI47_HUMAN	tripartite motif containing 47	461	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S461S(1)		autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22			Epithelial(20;4.23e-06)|all cancers(21;5.24e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGCGGGTGGGCGACAAGGGGT	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		16070	0.0		0.001	False		,,,				2504	0.0				p.S461S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1383A	17						.	C		1,4405	2.1+/-5.4	0,1,2202	70.0	71.0	71.0		1383	-10.4	0.2	17	dbSNP_134	71	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	TRIM47	NM_033452.2		0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384		461/639	73871098	5,13001	2203	4300	6503	71382693	SO:0001819	synonymous_variant	91107	exon6			AY026763	CCDS32737.1	17q25	2013-01-09	2011-01-25			ENSG00000132481		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19020	protein-coding gene	gene with protein product		611041	"""tripartite motif-containing 47"""				Standard	NM_033452		Approved	GOA, RNF100	uc002jpw.3	Q96LD4		ENST00000254816.2:c.1383G>A	17.37:g.73871098C>T		Somatic		Capture	Illumina HiSeq	Phase_I	71382693	NM_033452	Q96AD0|Q96GU5|Q9BRN7	Silent	SNP	ENST00000254816.2	37	CCDS32737.1																																																																																				0.567	TRIM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448934.1		
SYNGR2	9144	broad.mit.edu	37	17	76166903	76166903	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:76166903C>T	ENST00000225777.3	+	2	164	c.105C>T	c.(103-105)ttC>ttT	p.F35F	SYNGR2_ENST00000585591.1_Silent_p.F35F|SYNGR2_ENST00000589711.1_Intron|SYNGR2_ENST00000590201.1_5'UTR|SYNGR2_ENST00000588282.1_Silent_p.F35F|SYNGR2_ENST00000592456.1_3'UTR			O43760	SNG2_HUMAN	synaptogyrin 2	35	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				protein targeting (GO:0006605)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)		p.F35F(1)		endometrium(2)|large_intestine(1)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	7			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.0994)			GGCAGGTCTTCGCCTTGATCG	0.617																																					p.F35F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C105T	17						.						146.0	152.0	150.0					17																	76166903		2203	4300	6503	73678498	SO:0001819	synonymous_variant	9144	exon2			AJ002308	CCDS11753.1	17q25.3	2014-09-11			ENSG00000108639	ENSG00000108639			11499	protein-coding gene	gene with protein product	"""cellugyrin"""	603926				9760194	Standard	NM_004710		Approved		uc002juu.1	O43760	OTTHUMG00000177457	ENST00000225777.3:c.105C>T	17.37:g.76166903C>T		Somatic		Capture	Illumina HiSeq	Phase_I	73678498	NM_004710	O43762|Q3KQZ2|Q658S7	Silent	SNP	ENST00000225777.3	37	CCDS11753.1																																																																																				0.617	SYNGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437009.2		
RNF213	57674	broad.mit.edu	37	17	78321478	78321478	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:78321478G>A	ENST00000582970.1	+	29	9486	c.9343G>A	c.(9343-9345)Gca>Aca	p.A3115T	RNF213_ENST00000336301.6_Missense_Mutation_p.A1188T|RNF213_ENST00000508628.2_Missense_Mutation_p.A3164T	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3115					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A3164T(2)|p.A1188T(2)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CCTCTACGACGCACTCAACCA	0.562																																					p.A3164T												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.G9490A	17						.						82.0	83.0	83.0					17																	78321478		2203	4300	6503	75936073	SO:0001583	missense	57674	exon30			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9343G>A	17.37:g.78321478G>A	ENSP00000464087:p.Ala3115Thr	Somatic		Capture	Illumina HiSeq	Phase_I	75936073	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268061	0.59540	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.26223	1.75	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	M	0.85859	2.78	0.52501	D	0.999956	D	0.69078	0.997	D	0.68353	0.957	T	0.63994	-0.6511	10	0.72032	D	0.01	.	18.9568	0.92661	0.0:0.0:1.0:0.0	.	1188	Q63HN8	RN213_HUMAN	T	3115;3164;1188	ENSP00000338218:A1188T	ENSP00000338218:A1188T	A	+	1	0	RNF213	75936073	1.000000	0.71417	0.948000	0.38648	0.959000	0.62525	9.671000	0.98627	2.542000	0.85734	0.563000	0.77884	GCA		0.562	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
CCDC137	339230	broad.mit.edu	37	17	79637369	79637369	+	Missense_Mutation	SNP	G	G	A	rs200920452		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:79637369G>A	ENST00000329214.8	+	3	786	c.383G>A	c.(382-384)cGc>cAc	p.R128H		NM_199287.2	NP_954981.1	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137	128							poly(A) RNA binding (GO:0044822)	p.R128H(2)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(2)	12	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			TATATCCACCGCATGCAGCAA	0.572																																					p.R128H												.	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.G383A	17						.						31.0	37.0	35.0					17																	79637369		1965	4157	6122	77247774	SO:0001583	missense	339230	exon3			BC009369	CCDS42400.1	17q25.3	2008-07-04				ENSG00000185298			33451	protein-coding gene	gene with protein product		614271					Standard	NM_199287		Approved	MGC16597	uc002kbc.4	Q6PK04		ENST00000329214.8:c.383G>A	17.37:g.79637369G>A	ENSP00000329360:p.Arg128His	Somatic		Capture	Illumina HiSeq	Phase_I	77247774	NM_199287		Missense_Mutation	SNP	ENST00000329214.8	37	CCDS42400.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801710	0.50315	.	.	ENSG00000185298	ENST00000329214	T	0.54479	0.57	4.88	3.91	0.45181	.	0.064498	0.64402	N	0.000007	T	0.52273	0.1724	M	0.84082	2.675	0.46149	D	0.998898	P	0.41710	0.76	B	0.32533	0.147	T	0.63712	-0.6575	10	0.87932	D	0	-0.5677	13.2228	0.59899	0.0784:0.0:0.9216:0.0	.	128	Q6PK04	CC137_HUMAN	H	128	ENSP00000329360:R128H	ENSP00000329360:R128H	R	+	2	0	CCDC137	77247774	1.000000	0.71417	0.961000	0.40146	0.548000	0.35241	5.112000	0.64634	1.264000	0.44198	0.655000	0.94253	CGC		0.572	CCDC137-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440387.1		
CCDC137	339230	broad.mit.edu	37	17	79638834	79638834	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:79638834G>A	ENST00000329214.8	+	4	961	c.558G>A	c.(556-558)agG>agA	p.R186R		NM_199287.2	NP_954981.1	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137	186							poly(A) RNA binding (GO:0044822)	p.R186R(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(2)	12	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			CGGCAGACAGGCTGGAGCAGG	0.577																																					p.R186R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G558A	17						.						49.0	56.0	54.0					17																	79638834		2018	4177	6195	77249239	SO:0001819	synonymous_variant	339230	exon4			BC009369	CCDS42400.1	17q25.3	2008-07-04				ENSG00000185298			33451	protein-coding gene	gene with protein product		614271					Standard	NM_199287		Approved	MGC16597	uc002kbc.4	Q6PK04		ENST00000329214.8:c.558G>A	17.37:g.79638834G>A		Somatic		Capture	Illumina HiSeq	Phase_I	77249239	NM_199287		Silent	SNP	ENST00000329214.8	37	CCDS42400.1																																																																																				0.577	CCDC137-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440387.1		
GAS7	8522	broad.mit.edu	37	17	9829995	9829995	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:9829995C>T	ENST00000432992.2	-	10	1137	c.977G>A	c.(976-978)cGc>cAc	p.R326H	GAS7_ENST00000585266.1_Missense_Mutation_p.R266H|GAS7_ENST00000542249.1_Missense_Mutation_p.R262H|GAS7_ENST00000579158.1_Missense_Mutation_p.R262H|GAS7_ENST00000437099.2_Missense_Mutation_p.R262H|GAS7_ENST00000323816.4_Missense_Mutation_p.R266H|GAS7_ENST00000396115.2_Intron|GAS7_ENST00000540214.1_Intron|GAS7_ENST00000583882.1_Intron|GAS7_ENST00000580865.1_Missense_Mutation_p.R186H	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	326					actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R326H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						GAGCTGCTTGCGAAGGTCGGC	0.602			T	MLL	AML*																																p.R186H			Dom	yes		17	17p	8522	growth arrest-specific 7		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G557A	17						.						65.0	61.0	62.0					17																	9829995		2203	4300	6503	9770720	SO:0001583	missense	8522	exon6			AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.977G>A	17.37:g.9829995C>T	ENSP00000407552:p.Arg326His	Somatic		Capture	Illumina HiSeq	Phase_I	9770720	NM_003644	A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Missense_Mutation	SNP	ENST00000432992.2	37	CCDS11152.1	.	.	.	.	.	.	.	.	.	.	C	36	5.815209	0.96982	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000432992;ENST00000537970;ENST00000541114	T	0.39997	1.05	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.43233	0.1238	L	0.27053	0.805	0.80722	D	1	D;D;P;D	0.58268	0.962;0.982;0.925;0.982	P;P;B;P	0.50708	0.484;0.565;0.395;0.648	T	0.08911	-1.0699	9	.	.	.	-8.0527	19.1994	0.93704	0.0:1.0:0.0:0.0	.	278;266;186;326	B7Z2L1;A8KAC2;O60861-2;O60861	.;.;.;GAS7_HUMAN	H	326;266;265;186;266;140	ENSP00000379421:R266H	.	R	-	2	0	GAS7	9770720	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.696000	0.84270	2.837000	0.97791	0.655000	0.94253	CGC		0.602	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1	NM_003644, NM_201432, NM_201433	
CCDC57	284001	broad.mit.edu	37	17	80136987	80136987	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr17:80136987C>T	ENST00000389641.4	-	9	1326	c.1290G>A	c.(1288-1290)tgG>tgA	p.W430*	CCDC57_ENST00000392347.1_Nonsense_Mutation_p.W430*|CCDC57_ENST00000392343.3_Nonsense_Mutation_p.W430*|CCDC57_ENST00000327026.3_Intron			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	430								p.W430*(2)		endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			AGCGGCGCTGCCAGTCCAGGC	0.587																																					p.W430X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G1290A	17						.						52.0	57.0	55.0					17																	80136987		2114	4232	6346	77730276	SO:0001587	stop_gained	284001	exon9			BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.1290G>A	17.37:g.80136987C>T	ENSP00000374292:p.Trp430*	Somatic		Capture	Illumina HiSeq	Phase_I	77730276	NM_198082	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Nonsense_Mutation	SNP	ENST00000389641.4	37		.	.	.	.	.	.	.	.	.	.	C	38	7.278407	0.98182	.	.	ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000392343	.	.	.	5.52	5.52	0.82312	.	0.094131	0.48767	D	0.000163	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.7077	14.9303	0.70908	0.0:1.0:0.0:0.0	.	.	.	.	X	430	.	ENSP00000374292:W430X	W	-	3	0	CCDC57	77730276	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.989000	0.63870	2.581000	0.87130	0.557000	0.71058	TGG		0.587	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082	
ELP2	55250	broad.mit.edu	37	18	33726311	33726311	+	Silent	SNP	G	G	A	rs367642754		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:33726311G>A	ENST00000358232.6	+	11	1155	c.1092G>A	c.(1090-1092)gcG>gcA	p.A364A	ELP2_ENST00000442325.2_Silent_p.A429A|ELP2_ENST00000351393.6_Silent_p.A338A|ELP2_ENST00000350494.6_Intron|ELP2_ENST00000542824.1_Intron|ELP2_ENST00000423854.2_Silent_p.A294A	NM_018255.2	NP_060725.1	Q6IA86	ELP2_HUMAN	elongator acetyltransferase complex subunit 2	364					chromatin organization (GO:0006325)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)		p.A364A(1)		NS(1)|breast(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|urinary_tract(2)	30						TCCACGGAGCGTTGCACCTTT	0.373																																					p.A364A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1092A	18						.	G	,,,,,	0,4406		0,0,2203	163.0	155.0	158.0		1287,,1014,,882,1092	1.5	0.7	18		158	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,intron,coding-synonymous,intron,coding-synonymous,coding-synonymous	ELP2	NM_001242875.1,NM_001242876.1,NM_001242877.1,NM_001242878.1,NM_001242879.1,NM_018255.2	,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,	429/892,,338/801,,294/757,364/827	33726311	1,13005	2203	4300	6503	31980309	SO:0001819	synonymous_variant	55250	exon11			AK001741	CCDS11918.1, CCDS56065.1, CCDS56066.1, CCDS56067.1, CCDS56068.1, CCDS56069.1	18q12.1	2013-01-10	2012-08-08	2007-04-20	ENSG00000134759	ENSG00000134759		"""Elongator acetyltransferase complex subunits"", ""WD repeat domain containing"""	18248	protein-coding gene	gene with protein product			"""signal transducer and activator of transcription 3 interacting protein 1"", ""elongation protein 2 homolog (S. cerevisiae)"""	STATIP1		11714725, 10954736	Standard	NM_001242875		Approved	FLJ10879, StIP	uc002kzk.2	Q6IA86	OTTHUMG00000132589	ENST00000358232.6:c.1092G>A	18.37:g.33726311G>A		Somatic		Capture	Illumina HiSeq	Phase_I	31980309	NM_018255	A8KAI6|B4DTG0|B4DXP0|E7EP23|E9PCX0|Q53GZ0|Q687Y8|Q8N5C2|Q96GV4|Q96PI7|Q9H9N0|Q9NV81	Silent	SNP	ENST00000358232.6	37	CCDS11918.1	.	.	.	.	.	.	.	.	.	.	G	8.743	0.919433	0.17982	0.0	1.16E-4	ENSG00000134759	ENST00000535093	.	.	.	5.6	1.48	0.22813	.	.	.	.	.	T	0.42449	0.1203	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25572	-1.0128	4	.	.	.	-15.0312	1.2838	0.02046	0.4179:0.2831:0.0949:0.2041	.	.	.	.	H	185	.	.	R	+	2	0	ELP2	31980309	0.000000	0.05858	0.662000	0.29724	0.948000	0.59901	-0.243000	0.08915	0.324000	0.23333	0.313000	0.20887	CGT		0.373	ELP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255800.2	NM_018255	
TCEB3B	51224	broad.mit.edu	37	18	44559539	44559539	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:44559539G>T	ENST00000332567.4	-	1	2449	c.2097C>A	c.(2095-2097)agC>agA	p.S699R	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	699					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S699R(1)		breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GAAGGAtgctgctgctgctgt	0.667																																					p.S699R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2097A	18						.						30.0	35.0	34.0					18																	44559539		2202	4300	6502	42813537	SO:0001583	missense	51224	exon1			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.2097C>A	18.37:g.44559539G>T	ENSP00000331302:p.Ser699Arg	Somatic		Capture	Illumina HiSeq	Phase_I	42813537	NM_016427	Q9P2V9	Missense_Mutation	SNP	ENST00000332567.4	37	CCDS11932.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873087	0.33069	.	.	ENSG00000206181	ENST00000332567	T	0.08546	3.08	1.95	-1.59	0.08453	.	2.269110	0.02462	U	0.086653	T	0.05273	0.0140	N	0.22421	0.69	0.09310	N	1	P	0.35011	0.48	B	0.26770	0.073	T	0.29610	-1.0006	10	0.33940	T	0.23	-2.2314	4.9228	0.13878	0.0:0.4472:0.3263:0.2264	.	699	Q8IYF1	ELOA2_HUMAN	R	699	ENSP00000331302:S699R	ENSP00000331302:S699R	S	-	3	2	TCEB3B	42813537	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.037000	0.12164	-0.471000	0.06891	0.563000	0.77884	AGC		0.667	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427	
ZBTB14	7541	broad.mit.edu	37	18	5291249	5291249	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:5291249G>A	ENST00000357006.4	-	4	1296	c.958C>T	c.(958-960)Ctg>Ttg	p.L320L	ZBTB14_ENST00000400143.3_Silent_p.L320L	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	320					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.L320L(1)									TGTTCTTTCAGGTGGGCCTGT	0.458																																					p.L320L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C958T	18						.						141.0	137.0	138.0					18																	5291249		2203	4300	6503	5281249	SO:0001819	synonymous_variant	7541	exon3			D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.958C>T	18.37:g.5291249G>A		Somatic		Capture	Illumina HiSeq	Phase_I	5281249	NM_003409	O00403|Q2TB80	Silent	SNP	ENST00000357006.4	37	CCDS11837.1																																																																																				0.458	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254425.1	NM_003409	
DCC	1630	broad.mit.edu	37	18	50592504	50592504	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:50592504A>G	ENST00000442544.2	+	7	1845	c.1229A>G	c.(1228-1230)cAg>cGg	p.Q410R	DCC_ENST00000580146.1_3'UTR|DCC_ENST00000412726.1_Missense_Mutation_p.Q258R|DCC_ENST00000581580.1_Missense_Mutation_p.Q65R	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	410	Ig-like C2-type 4.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.Q410R(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GGAAATGCCCAGACCAGTGCA	0.448																																					p.Q410R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1229G	18						.						152.0	138.0	143.0					18																	50592504		2203	4300	6503	48846502	SO:0001583	missense	1630	exon7			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1229A>G	18.37:g.50592504A>G	ENSP00000389140:p.Gln410Arg	Somatic		Capture	Illumina HiSeq	Phase_I	48846502	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	A	14.81	2.647073	0.47258	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.67345	-0.26;-0.26	5.31	5.31	0.75309	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.72716	0.3495	L	0.28504	0.86	0.49915	D	0.999838	P;D;D	0.76494	0.954;0.996;0.999	P;D;D	0.78314	0.86;0.953;0.991	T	0.76154	-0.3063	10	0.72032	D	0.01	.	14.2532	0.66033	1.0:0.0:0.0:0.0	.	258;258;410	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	R	410;343;258	ENSP00000389140:Q410R;ENSP00000397322:Q258R	ENSP00000304146:Q343R	Q	+	2	0	DCC	48846502	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.707000	0.74654	2.020000	0.59435	0.528000	0.53228	CAG		0.448	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
KDSR	2531	broad.mit.edu	37	18	60999113	60999113	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:60999113G>A	ENST00000406396.3	-	10	1292	c.901C>T	c.(901-903)Cgc>Tgc	p.R301C	KDSR_ENST00000326575.5_Missense_Mutation_p.R237C|KDSR_ENST00000589592.1_5'UTR	NM_002035.2	NP_002026.1	Q06136	KDSR_HUMAN	3-ketodihydrosphingosine reductase	301					3-keto-sphinganine metabolic process (GO:0006666)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-dehydrosphinganine reductase activity (GO:0047560)	p.R301C(1)		endometrium(2)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	9						GCAATAGTGCGGAAAAGGCCC	0.423																																					p.R301C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C901T	18						.						107.0	99.0	102.0					18																	60999113		2203	4300	6503	59150093	SO:0001583	missense	2531	exon10				CCDS11982.1	18q21	2011-09-20	2008-02-20	2008-02-20	ENSG00000119537	ENSG00000119537	1.1.1.102	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	4021	protein-coding gene	gene with protein product	"""3-dehydrosphinganine reductase"", ""short chain dehydrogenase/reductase family 35C, member 1"""	136440	"""follicular lymphoma variant translocation 1"""	FVT1		8417785, 15328338, 17420465, 19027726	Standard	NM_002035		Approved	DHSR, SDR35C1	uc010dpw.3	Q06136	OTTHUMG00000132792	ENST00000406396.3:c.901C>T	18.37:g.60999113G>A	ENSP00000385083:p.Arg301Cys	Somatic		Capture	Illumina HiSeq	Phase_I	59150093	NM_002035	B2R5Y1|B4DMX0	Missense_Mutation	SNP	ENST00000406396.3	37	CCDS11982.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.396158	0.62177	.	.	ENSG00000119537	ENST00000406396;ENST00000326575	D;T	0.87650	-2.28;-1.16	5.99	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.94489	0.8226	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.97110	0.828;1.0	D	0.95454	0.8537	10	0.87932	D	0	.	16.6041	0.84824	0.0:0.0:0.8687:0.1313	.	237;301	B4DMX0;Q06136	.;KDSR_HUMAN	C	301;237	ENSP00000385083:R301C;ENSP00000312939:R237C	ENSP00000312939:R237C	R	-	1	0	KDSR	59150093	1.000000	0.71417	0.948000	0.38648	0.022000	0.10575	9.869000	0.99810	1.520000	0.48965	-0.181000	0.13052	CGC		0.423	KDSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256200.2		
DSEL	92126	broad.mit.edu	37	18	65179442	65179442	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:65179442G>A	ENST00000310045.7	-	2	3907	c.2434C>T	c.(2434-2436)Cga>Tga	p.R812*	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	802					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.R812*(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				AATATCCATCGCATTAGTTTT	0.343																																					p.R812X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2434T	18						.						60.0	61.0	60.0					18																	65179442		2203	4300	6503	63330422	SO:0001587	stop_gained	92126	exon2			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.2434C>T	18.37:g.65179442G>A	ENSP00000310565:p.Arg812*	Somatic		Capture	Illumina HiSeq	Phase_I	63330422	NM_032160	Q17RH1|Q6P5Z3	Nonsense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	G	48	14.717513	0.99807	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	.	.	.	4.99	3.17	0.36434	.	0.071667	0.56097	U	0.000023	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.9975	0.80262	0.0:0.0:0.7545:0.2455	.	.	.	.	X	812;802	.	ENSP00000310565:R812X	R	-	1	2	DSEL	63330422	1.000000	0.71417	0.899000	0.35326	0.209000	0.24338	5.621000	0.67743	0.146000	0.19002	-2.048000	0.00412	CGA		0.343	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
LAMA1	284217	broad.mit.edu	37	18	7040083	7040083	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:7040083C>G	ENST00000389658.3	-	10	1507	c.1414G>C	c.(1414-1416)Gtt>Ctt	p.V472L		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	472	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.V472L(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ACCTTACAAACACAGGGCCCT	0.532																																					p.V472L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1414C	18						.						76.0	72.0	73.0					18																	7040083		2203	4300	6503	7030083	SO:0001583	missense	284217	exon10			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1414G>C	18.37:g.7040083C>G	ENSP00000374309:p.Val472Leu	Somatic		Capture	Illumina HiSeq	Phase_I	7030083	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	3.320	-0.138975	0.06669	.	.	ENSG00000101680	ENST00000389658	T	0.60424	0.19	5.03	2.11	0.27256	EGF-like, laminin (4);	0.468007	0.21718	N	0.070161	T	0.37320	0.0999	N	0.12569	0.235	0.21984	N	0.999433	B	0.02656	0.0	B	0.09377	0.004	T	0.09907	-1.0653	10	0.10377	T	0.69	.	16.9578	0.86264	0.0:0.544:0.456:0.0	.	472	P25391	LAMA1_HUMAN	L	472	ENSP00000374309:V472L	ENSP00000374309:V472L	V	-	1	0	LAMA1	7030083	0.995000	0.38212	0.996000	0.52242	0.807000	0.45602	0.535000	0.23114	0.241000	0.21283	-0.147000	0.13772	GTT		0.532	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
SOCS6	9306	broad.mit.edu	37	18	67992659	67992659	+	Missense_Mutation	SNP	C	C	T	rs374835963		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:67992659C>T	ENST00000397942.3	+	2	1071	c.755C>T	c.(754-756)gCg>gTg	p.A252V	SOCS6_ENST00000582322.1_Missense_Mutation_p.A252V	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	252					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)		p.A252V(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GAAGTCTCTGCGGTTCCTCCT	0.537																																					p.A252V	Melanoma(84;1024 1361 24382 36583 42651)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C755T	18						.	C	VAL/ALA	0,4406		0,0,2203	93.0	77.0	82.0		755	5.2	0.4	18		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	SOCS6	NM_004232.3	64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	252/536	67992659	1,13005	2203	4300	6503	66143639	SO:0001583	missense	9306	exon2			AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.755C>T	18.37:g.67992659C>T	ENSP00000381034:p.Ala252Val	Somatic		Capture	Illumina HiSeq	Phase_I	66143639	NM_004232	Q8WUM3	Missense_Mutation	SNP	ENST00000397942.3	37	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.468754	0.43839	0.0	1.16E-4	ENSG00000170677	ENST00000397942	T	0.26223	1.75	5.25	5.25	0.73442	.	0.739566	0.12917	N	0.428480	T	0.17831	0.0428	N	0.08118	0	0.37168	D	0.902895	B	0.09022	0.002	B	0.04013	0.001	T	0.14504	-1.0470	10	0.38643	T	0.18	-12.8814	18.8773	0.92343	0.0:1.0:0.0:0.0	.	252	O14544	SOCS6_HUMAN	V	252	ENSP00000381034:A252V	ENSP00000381034:A252V	A	+	2	0	SOCS6	66143639	0.903000	0.30736	0.438000	0.26821	0.506000	0.33950	5.655000	0.67981	2.441000	0.82636	0.655000	0.94253	GCG		0.537	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
CNDP2	55748	broad.mit.edu	37	18	72173170	72173170	+	Silent	SNP	C	C	T	rs376422174		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:72173170C>T	ENST00000324262.4	+	4	607	c.291C>T	c.(289-291)taC>taT	p.Y97Y	CNDP2_ENST00000324301.8_Intron|CNDP2_ENST00000579847.1_Silent_p.Y97Y	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	97					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.Y97Y(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		TGTGCATTTACGGGCACCTGG	0.657																																					p.Y97Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C291T	18						.	C	,	0,4406		0,0,2203	59.0	58.0	58.0		,291	-3.5	0.2	18		58	1,8599	1.2+/-3.3	0,1,4299	no	intron,coding-synonymous	CNDP2	NM_001168499.1,NM_018235.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	,97/476	72173170	1,13005	2203	4300	6503	70324150	SO:0001819	synonymous_variant	55748	exon4			AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.291C>T	18.37:g.72173170C>T		Somatic		Capture	Illumina HiSeq	Phase_I	70324150	NM_018235	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Silent	SNP	ENST00000324262.4	37	CCDS12006.1																																																																																				0.657	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
MTCL1	23255	broad.mit.edu	37	18	8784518	8784518	+	Missense_Mutation	SNP	C	C	T	rs201898483		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:8784518C>T	ENST00000306329.11	+	5	2488	c.2488C>T	c.(2488-2490)Cgc>Tgc	p.R830C	SOGA2_ENST00000359865.3_Missense_Mutation_p.R470C|SOGA2_ENST00000517570.1_Missense_Mutation_p.R470C|SOGA2_ENST00000400050.3_Missense_Mutation_p.R470C|SOGA2_ENST00000306285.7_5'UTR														p.R470C(1)									GACGGTGGAGCGCCTCATCAC	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		14795	0.0		0.001	False		,,,				2504	0.0				p.R470C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1408T	18						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	75.0	88.0	83.0		1408	2.3	1.0	18		83	0,8600		0,0,4300	yes	missense	CCDC165	NM_015210.3	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	470/1587	8784518	1,13005	2203	4300	6503	8774518	SO:0001583	missense	23255	exon6																														ENST00000306329.11:c.2488C>T	18.37:g.8784518C>T	ENSP00000305027:p.Arg830Cys	Somatic		Capture	Illumina HiSeq	Phase_I	8774518	NM_015210		Missense_Mutation	SNP	ENST00000306329.11	37		0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	3.361	-0.130406	0.06753	2.27E-4	0.0	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T	0.41758	0.99;0.99;0.99	5.31	2.31	0.28768	.	1.128570	0.06761	N	0.781751	T	0.65417	0.2689	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.71184	0.808;0.972	T	0.55276	-0.8166	10	0.66056	D	0.02	-9.8518	14.0477	0.64714	0.426:0.574:0.0:0.0	.	491;470	A8MQ54;Q9Y4B5-3	.;.	C	491;470;470;470	ENSP00000429556:R470C;ENSP00000352927:R470C;ENSP00000382924:R470C	ENSP00000305027:R491C	R	+	1	0	CCDC165	8774518	1.000000	0.71417	0.996000	0.52242	0.019000	0.09904	2.053000	0.41326	0.133000	0.18654	0.591000	0.81541	CGC		0.672	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
MBP	4155	broad.mit.edu	37	18	74696766	74696766	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr18:74696766C>T	ENST00000397869.3	-	5	677	c.631G>A	c.(631-633)Gat>Aat	p.D211N	MBP_ENST00000354542.4_Intron|MBP_ENST00000397865.5_Missense_Mutation_p.D135N|MBP_ENST00000579129.1_Intron|MBP_ENST00000526111.1_Missense_Mutation_p.D124N|MBP_ENST00000528160.1_Intron|MBP_ENST00000355994.2_Missense_Mutation_p.D279N|RP11-862L9.3_ENST00000580580.1_RNA|MBP_ENST00000578193.1_Missense_Mutation_p.D146N|RP11-862L9.3_ENST00000582763.1_RNA|MBP_ENST00000397875.3_Missense_Mutation_p.D156N|MBP_ENST00000359645.3_Missense_Mutation_p.D161N|MBP_ENST00000580402.1_Missense_Mutation_p.D279N|MBP_ENST00000397866.4_Missense_Mutation_p.D146N|MBP_ENST00000527041.1_Intron|RP11-862L9.3_ENST00000582546.1_RNA|MBP_ENST00000382582.3_Missense_Mutation_p.D172N			P13727	PRG2_HUMAN	myelin basic protein	0	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)	p.D279N(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)	Sargramostim(DB00020)	CCCTGGGCATCGACTCCCTTG	0.557																																					p.D161N	NSCLC(17;72 1131 19392)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G481A	18						.						91.0	91.0	91.0					18																	74696766		2203	4300	6503	72825754	SO:0001583	missense	4155	exon5				CCDS12011.1, CCDS32847.1, CCDS42448.1, CCDS42449.1, CCDS42450.1	18q23	2008-08-01			ENSG00000197971	ENSG00000197971			6925	protein-coding gene	gene with protein product		159430				2425357	Standard	XM_005266699		Approved		uc010xfd.2	P02686	OTTHUMG00000132874	ENST00000397869.3:c.631G>A	18.37:g.74696766C>T	ENSP00000380967:p.Asp211Asn	Somatic		Capture	Illumina HiSeq	Phase_I	72825754	NM_002385	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	ENST00000397869.3	37		.	.	.	.	.	.	.	.	.	.	C	22.1	4.237510	0.79800	.	.	ENSG00000197971	ENST00000382582;ENST00000355994;ENST00000397875;ENST00000397866;ENST00000397865;ENST00000359645;ENST00000397869;ENST00000526111;ENST00000397868;ENST00000447114	.	.	.	4.71	3.82	0.43975	.	0.304202	0.24945	N	0.034354	T	0.52709	0.1751	L	0.43152	1.355	0.09310	N	1	D;D;D;D	0.89917	0.995;1.0;1.0;1.0	P;D;D;D	0.87578	0.858;0.992;0.998;0.998	T	0.35226	-0.9797	9	0.72032	D	0.01	-17.5832	9.6335	0.39793	0.0:0.903:0.0:0.097	.	279;135;161;172	P02686;P02686-6;P02686-4;P02686-3	MBP_HUMAN;.;.;.	N	172;279;156;146;135;161;211;124;146;90	.	ENSP00000348273:D279N	D	-	1	0	MBP	72825754	0.980000	0.34600	0.001000	0.08648	0.875000	0.50365	1.851000	0.39338	2.148000	0.66965	0.462000	0.41574	GAT		0.557	MBP-024	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000267964.1	NM_001025081	
ZNF491	126069	broad.mit.edu	37	19	11917053	11917053	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:11917053G>A	ENST00000323169.5	+	3	616	c.285G>A	c.(283-285)agG>agA	p.R95R	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	95					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R95R(2)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						CACATGAAAGGCCTCACACTA	0.393																																					p.R95R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G285A	19						.						53.0	54.0	54.0					19																	11917053		2199	4300	6499	11778053	SO:0001819	synonymous_variant	126069	exon3			AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.285G>A	19.37:g.11917053G>A		Somatic		Capture	Illumina HiSeq	Phase_I	11778053	NM_152356	Q3MJ35|Q8NAT8	Silent	SNP	ENST00000323169.5	37	CCDS12267.1																																																																																				0.393	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344518.1	NM_152356	
ZNF44	51710	broad.mit.edu	37	19	12383628	12383628	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:12383628C>T	ENST00000356109.5	-	5	1704	c.1586G>A	c.(1585-1587)tGt>tAt	p.C529Y	ZNF44_ENST00000355684.5_Missense_Mutation_p.C481Y	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	529					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		TGCTTTCCCACACTCCTTACA	0.353																																					p.C481Y												.	.	0			c.G1442A	19						.						85.0	91.0	89.0					19																	12383628		2045	4222	6267	12244628	SO:0001583	missense	51710	exon4			X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.1586G>A	19.37:g.12383628C>T	ENSP00000348419:p.Cys529Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	12244628	NM_016264	B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	ENST00000356109.5	37	CCDS54223.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.576888	0.45902	.	.	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	D;D;D	0.85861	-2.04;-2.04;-2.04	0.997	-0.0898	0.13667	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92496	0.7617	H	0.94886	3.595	.	.	.	D;D	0.76494	0.999;0.996	D;P	0.75020	0.985;0.856	D	0.90284	0.4317	8	0.72032	D	0.01	.	6.3812	0.21536	0.0:0.8104:0.0:0.1896	.	529;481	P15621;F8W7T7	ZNF44_HUMAN;.	Y	529;529;481;481	ENSP00000377008:C529Y;ENSP00000348419:C529Y;ENSP00000347910:C481Y	ENSP00000347910:C481Y	C	-	2	0	ZNF44	12244628	0.853000	0.29707	0.004000	0.12327	0.440000	0.31957	3.242000	0.51384	0.015000	0.14971	0.305000	0.20034	TGT		0.353	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344132.1	NM_016264	
C19orf53	28974	broad.mit.edu	37	19	13888962	13888962	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:13888962G>A	ENST00000588234.1	+	3	560	c.250G>A	c.(250-252)Gcc>Acc	p.A84T	C19orf53_ENST00000593274.1_Missense_Mutation_p.A41T	NM_014047.2	NP_054766.1	Q9UNZ5	L10K_HUMAN	chromosome 19 open reading frame 53	84								p.A84T(1)		breast(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	6			OV - Ovarian serous cystadenocarcinoma(19;7.7e-24)|Epithelial(5;2.53e-19)			GAAGGCCCCAGCCAAGAAGAA	0.592																																					p.A84T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G250A	19						.						51.0	50.0	50.0					19																	13888962		2203	4299	6502	13749962	SO:0001583	missense	28974	exon3			AF078852	CCDS12298.1	19p13.2	2011-11-24			ENSG00000104979	ENSG00000104979			24991	protein-coding gene	gene with protein product	"""leydig cell tumor 10 kDa protein homolog"""					11042152	Standard	NM_014047		Approved	HSPC023, LYDG10	uc002mxg.3	Q9UNZ5		ENST00000588234.1:c.250G>A	19.37:g.13888962G>A	ENSP00000465432:p.Ala84Thr	Somatic		Capture	Illumina HiSeq	Phase_I	13749962	NM_014047	B2R4J9	Missense_Mutation	SNP	ENST00000588234.1	37	CCDS12298.1	.	.	.	.	.	.	.	.	.	.	G	8.836	0.941120	0.18281	.	.	ENSG00000104979	ENST00000221576	.	.	.	4.99	-3.59	0.04583	.	1.329970	0.04685	N	0.413161	T	0.16514	0.0397	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.13019	-1.0525	8	0.18710	T	0.47	.	1.6193	0.02710	0.1681:0.1219:0.3182:0.3918	.	84	Q9UNZ5	L10K_HUMAN	T	84	.	ENSP00000221576:A84T	A	+	1	0	C19orf53	13749962	0.007000	0.16637	0.000000	0.03702	0.041000	0.13682	-0.109000	0.10840	-0.436000	0.07254	0.485000	0.47835	GCC		0.592	C19orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453621.1	NM_014047	
OR10H2	26538	broad.mit.edu	37	19	15838976	15838976	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:15838976C>T	ENST00000305899.3	+	1	143	c.123C>T	c.(121-123)ggC>ggT	p.G41G		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G41G(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					CGCTGCTGGGCAACCTGCTCA	0.587																																					p.G41G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C123T	19						.						222.0	183.0	196.0					19																	15838976		2203	4297	6500	15699976	SO:0001819	synonymous_variant	26538	exon1			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.123C>T	19.37:g.15838976C>T		Somatic		Capture	Illumina HiSeq	Phase_I	15699976	NM_013939	Q6IFQ1|Q96R58	Silent	SNP	ENST00000305899.3	37	CCDS12333.1																																																																																				0.587	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
BST2	684	broad.mit.edu	37	19	17514553	17514553	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:17514553G>A	ENST00000252593.6	-	4	566	c.494C>T	c.(493-495)gCg>gTg	p.A165V	BST2_ENST00000527220.1_5'Flank|CTD-2521M24.9_ENST00000500836.2_lincRNA	NM_004335.2	NP_004326.1	Q10589	BST2_HUMAN	bone marrow stromal cell antigen 2	165					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of plasmacytoid dendritic cell cytokine production (GO:0002737)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of actin cytoskeleton organization (GO:0032956)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metalloendopeptidase inhibitor activity (GO:0008191)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.A165V(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(2)	9						CAGCTGGGGCGCCGCAGCGGA	0.612																																					p.A165V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C494T	19						.						77.0	78.0	77.0					19																	17514553		2203	4300	6503	17375553	SO:0001583	missense	684	exon4				CCDS12358.1	19p13.2	2009-10-30				ENSG00000130303		"""CD molecules"""	1119	protein-coding gene	gene with protein product		600534				7607676	Standard	NM_004335		Approved	CD317, tetherin	uc002ngl.3	Q10589		ENST00000252593.6:c.494C>T	19.37:g.17514553G>A	ENSP00000252593:p.Ala165Val	Somatic		Capture	Illumina HiSeq	Phase_I	17375553	NM_004335	A8K4Y4|Q53G07	Missense_Mutation	SNP	ENST00000252593.6	37	CCDS12358.1	.	.	.	.	.	.	.	.	.	.	G	3.982	-0.006323	0.07773	.	.	ENSG00000130303	ENST00000252593	T	0.50813	0.73	1.72	-3.43	0.04810	.	.	.	.	.	T	0.22936	0.0554	N	0.19112	0.55	0.09310	N	1	P	0.35700	0.516	B	0.19391	0.025	T	0.02758	-1.1114	9	0.38643	T	0.18	.	7.1476	0.25591	0.0:0.442:0.4024:0.1557	.	165	Q10589	BST2_HUMAN	V	165	ENSP00000252593:A165V	ENSP00000252593:A165V	A	-	2	0	BST2	17375553	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.973000	0.01500	-2.063000	0.00890	-2.281000	0.00270	GCG		0.612	BST2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387346.1	NM_004335	
ZNF555	148254	broad.mit.edu	37	19	2853130	2853130	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:2853130G>A	ENST00000334241.4	+	4	1205	c.1067G>A	c.(1066-1068)cGa>cAa	p.R356Q	ZNF555_ENST00000591539.1_Missense_Mutation_p.R355Q|AC006130.3_ENST00000589365.1_RNA	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	356					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R356Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGTCCTTTCGAAGACATGAA	0.428																																					p.R355Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1064A	19						.						72.0	65.0	68.0					19																	2853130		2203	4300	6503	2804130	SO:0001583	missense	148254	exon4			AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.1067G>A	19.37:g.2853130G>A	ENSP00000334853:p.Arg356Gln	Somatic		Capture	Illumina HiSeq	Phase_I	2804130	NM_001172775	A8KA89|K7EQM2|Q8NA46|Q96MP1	Missense_Mutation	SNP	ENST00000334241.4	37	CCDS12096.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004618	0.35320	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	T	0.07444	3.19	3.31	-3.51	0.04696	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02455	0.0075	N	0.13098	0.295	0.09310	N	1	D;P	0.53312	0.959;0.508	B;B	0.34824	0.19;0.02	T	0.40869	-0.9540	9	0.15952	T	0.53	.	1.0558	0.01590	0.4349:0.159:0.2446:0.1614	.	356;355	Q8NEP9;A8KA89	ZN555_HUMAN;.	Q	356;355	ENSP00000334853:R356Q	ENSP00000334853:R356Q	R	+	2	0	ZNF555	2804130	0.000000	0.05858	0.000000	0.03702	0.972000	0.66771	-0.838000	0.04372	-0.339000	0.08401	0.561000	0.74099	CGA		0.428	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451637.3	NM_152791	
SLC27A1	376497	broad.mit.edu	37	19	17612144	17612144	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:17612144G>A	ENST00000252595.7	+	11	1796	c.1699G>A	c.(1699-1701)Gcg>Acg	p.A567T	SLC27A1_ENST00000442725.1_Missense_Mutation_p.A567T|SLC27A1_ENST00000598424.1_Missense_Mutation_p.A388T|SLC27A1_ENST00000598848.1_Intron|CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_198580.1	NP_940982.1	Q6PCB7	S27A1_HUMAN	solute carrier family 27 (fatty acid transporter), member 1	567					adiponectin-activated signaling pathway (GO:0033211)|cardiolipin biosynthetic process (GO:0032049)|cellular lipid metabolic process (GO:0044255)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|negative regulation of phospholipid biosynthetic process (GO:0071072)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phosphatidylglycerol biosynthetic process (GO:0006655)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylserine biosynthetic process (GO:0006659)|positive regulation of heat generation (GO:0031652)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to cold (GO:0009409)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.A567T(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						GGACCCCAACGCGATATACCA	0.672																																					p.A567T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1699A	19						.						55.0	53.0	53.0					19																	17612144		2203	4300	6503	17473144	SO:0001583	missense	376497	exon11			BC059399	CCDS32953.1	19p13.11	2013-07-15			ENSG00000130304	ENSG00000130304		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10995	protein-coding gene	gene with protein product		600691				10873384	Standard	NM_198580		Approved	FATP1, FATP, MGC71751, FLJ00336, ACSVL5	uc002ngu.1	Q6PCB7	OTTHUMG00000182878	ENST00000252595.7:c.1699G>A	19.37:g.17612144G>A	ENSP00000252595:p.Ala567Thr	Somatic		Capture	Illumina HiSeq	Phase_I	17473144	NM_198580	A6NIH2|B7Z662	Missense_Mutation	SNP	ENST00000252595.7	37	CCDS32953.1	.	.	.	.	.	.	.	.	.	.	G	6.172	0.399911	0.11696	.	.	ENSG00000130304	ENST00000442725;ENST00000252595	T;T	0.58506	0.33;0.33	4.65	2.35	0.29111	.	0.852314	0.10624	N	0.653012	T	0.41305	0.1153	L	0.35249	1.045	0.09310	N	1	B;B	0.16396	0.007;0.017	B;B	0.06405	0.002;0.002	T	0.23726	-1.0180	10	0.21014	T	0.42	-9.7582	5.9853	0.19430	0.1023:0.0:0.6468:0.2509	.	388;567	B7Z662;Q6PCB7	.;S27A1_HUMAN	T	567	ENSP00000413424:A567T;ENSP00000252595:A567T	ENSP00000252595:A567T	A	+	1	0	SLC27A1	17473144	0.000000	0.05858	0.036000	0.18154	0.568000	0.35870	0.764000	0.26532	0.747000	0.32809	0.561000	0.74099	GCG		0.672	SLC27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464145.1	NM_198580	
TSHZ3	57616	broad.mit.edu	37	19	31768401	31768401	+	Silent	SNP	C	C	T	rs368908849		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:31768401C>T	ENST00000240587.4	-	2	2625	c.2298G>A	c.(2296-2298)ccG>ccA	p.P766P		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	766					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P766P(1)|p.P583P(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GCAGGGGCGGCGGGGTGGCCA	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16006	0.0		0.0	False		,,,				2504	0.0				p.P766P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2298A	19						.	C		0,4406		0,0,2203	65.0	64.0	64.0		2298	-8.0	0.2	19		64	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TSHZ3	NM_020856.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		766/1082	31768401	1,13005	2203	4300	6503	36460241	SO:0001819	synonymous_variant	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2298G>A	19.37:g.31768401C>T		Somatic		Capture	Illumina HiSeq	Phase_I	36460241	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																				0.597	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
KMT2B	9757	broad.mit.edu	37	19	36220121	36220121	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:36220121G>A	ENST00000222270.7	+	22	4841	c.4841G>A	c.(4840-4842)tGg>tAg	p.W1614*	KMT2B_ENST00000420124.1_Nonsense_Mutation_p.W1614*|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1614					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.W1616*(1)									TGTGCCATCTGGTCGGCGGAA	0.637																																					p.W1614X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G4841A	19						.						50.0	50.0	50.0					19																	36220121		2128	4242	6370	40911961	SO:0001587	stop_gained	9757	exon22			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.4841G>A	19.37:g.36220121G>A	ENSP00000222270:p.Trp1614*	Somatic		Capture	Illumina HiSeq	Phase_I	40911961	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Nonsense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	G	43	10.141454	0.99345	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	.	.	.	5.13	5.13	0.70059	.	0.000000	0.42053	D	0.000768	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.5104	0.87758	0.0:0.0:1.0:0.0	.	.	.	.	X	1614	.	ENSP00000222270:W1614X	W	+	2	0	AD000671.1	40911961	1.000000	0.71417	1.000000	0.80357	0.580000	0.36256	9.547000	0.98100	2.669000	0.90835	0.655000	0.94253	TGG		0.637	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
ZNF345	25850	broad.mit.edu	37	19	37368373	37368373	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:37368373G>A	ENST00000529555.1	+	2	1429	c.641G>A	c.(640-642)gGt>gAt	p.G214D	ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000589046.1_Missense_Mutation_p.G214D|ZNF345_ENST00000420450.1_Missense_Mutation_p.G214D|ZNF345_ENST00000526123.1_Intron			Q14585	ZN345_HUMAN	zinc finger protein 345	214					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G214D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTGGCAGTGGTTCAAACCTT	0.433																																					p.G214D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G641A	19						.						76.0	74.0	74.0					19																	37368373		2203	4300	6503	42060213	SO:0001583	missense	25850	exon3			X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.641G>A	19.37:g.37368373G>A	ENSP00000431202:p.Gly214Asp	Somatic		Capture	Illumina HiSeq	Phase_I	42060213	NM_003419		Missense_Mutation	SNP	ENST00000529555.1	37	CCDS12497.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981259	0.34942	.	.	ENSG00000251247	ENST00000420450;ENST00000529555	T;T	0.01203	5.18;5.18	4.14	3.1	0.35709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01092	0.0036	L	0.33485	1.01	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47420	-0.9119	8	.	.	.	.	5.8115	0.18469	0.1087:0.1978:0.6935:0.0	.	214	Q14585	ZN345_HUMAN	D	214	ENSP00000431216:G214D;ENSP00000431202:G214D	.	G	+	2	0	ZNF345	42060213	0.000000	0.05858	1.000000	0.80357	0.992000	0.81027	-0.664000	0.05292	1.064000	0.40671	0.561000	0.74099	GGT		0.433	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388258.1		
ZNF570	148268	broad.mit.edu	37	19	37975867	37975867	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:37975867G>A	ENST00000330173.1	+	5	1872	c.1343G>A	c.(1342-1344)gGg>gAg	p.G448E	ZNF570_ENST00000388801.3_Missense_Mutation_p.G245E|ZNF570_ENST00000586475.1_Missense_Mutation_p.G504E	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	448					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G448E(1)		endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATTGAATGTGGGAAGGCTTTT	0.418																																					p.G448E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1343A	19						.						115.0	112.0	113.0					19																	37975867		2203	4300	6503	42667707	SO:0001583	missense	148268	exon5			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.1343G>A	19.37:g.37975867G>A	ENSP00000331540:p.Gly448Glu	Somatic		Capture	Illumina HiSeq	Phase_I	42667707	NM_144694	A1L472|B4DMP1	Missense_Mutation	SNP	ENST00000330173.1	37	CCDS12504.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.904011	0.52333	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	T;T	0.01221	5.15;5.15	4.16	4.16	0.48862	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43416	D	0.000564	T	0.03477	0.0100	L	0.38838	1.175	0.39168	D	0.962535	B;D	0.89917	0.219;1.0	B;D	0.75020	0.115;0.985	T	0.53165	-0.8477	10	0.49607	T	0.09	.	6.0746	0.19907	0.1032:0.1939:0.7028:0.0	.	245;448	B4DMP1;Q96NI8	.;ZN570_HUMAN	E	448;245	ENSP00000331540:G448E;ENSP00000373453:G245E	ENSP00000331540:G448E	G	+	2	0	ZNF570	42667707	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.108000	0.64609	2.299000	0.77371	0.563000	0.77884	GGG		0.418	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109600.1	NM_144694	
HNRNPL	3191	broad.mit.edu	37	19	39336612	39336612	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:39336612C>T	ENST00000221419.5	-	3	871	c.505G>A	c.(505-507)Gct>Act	p.A169T	HNRNPL_ENST00000600873.1_Missense_Mutation_p.A36T|AC008982.2_ENST00000600473.1_RNA	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	169	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)	p.A169T(1)|p.A36T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			TTGACAAAAGCTGGGTGACCA	0.517																																					p.A36T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G106A	19						.						121.0	116.0	118.0					19																	39336612		2203	4300	6503	44028452	SO:0001583	missense	3191	exon3			X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.505G>A	19.37:g.39336612C>T	ENSP00000221419:p.Ala169Thr	Somatic		Capture	Illumina HiSeq	Phase_I	44028452	NM_001005335	A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	ENST00000221419.5	37	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	C	31	5.081872	0.94050	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750;ENST00000423415;ENST00000536292	.	.	.	5.39	5.39	0.77823	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.052169	0.85682	D	0.000000	T	0.72550	0.3474	L	0.60455	1.87	0.58432	D	0.999997	D	0.58970	0.984	P	0.56612	0.802	T	0.73751	-0.3884	9	0.52906	T	0.07	.	17.9088	0.88928	0.0:1.0:0.0:0.0	.	169	P14866	HNRPL_HUMAN	T	169;36;36;36;97	.	ENSP00000221419:A169T	A	-	1	0	HNRNPL	44028452	1.000000	0.71417	0.982000	0.44146	0.841000	0.47740	4.626000	0.61269	2.541000	0.85698	0.462000	0.41574	GCT		0.517	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
PAPL	390928	broad.mit.edu	37	19	39589681	39589681	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:39589681G>A	ENST00000331256.5	+	4	678	c.404G>A	c.(403-405)cGt>cAt	p.R135H	PAPL_ENST00000594229.1_Missense_Mutation_p.R135H	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		135						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)	p.R135H(1)									TGGAGTCCCCGTCTGGCTGTG	0.637																																					p.R135H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G404A	19						.						46.0	51.0	49.0					19																	39589681		2203	4300	6503	44281521	SO:0001583	missense	390928	exon4																														ENST00000331256.5:c.404G>A	19.37:g.39589681G>A	ENSP00000327557:p.Arg135His	Somatic		Capture	Illumina HiSeq	Phase_I	44281521	NM_001004318	B2RN68	Missense_Mutation	SNP	ENST00000331256.5	37	CCDS33018.1	.	.	.	.	.	.	.	.	.	.	G	16.67	3.187619	0.57909	.	.	ENSG00000183760	ENST00000331256	D	0.86956	-2.19	5.14	4.1	0.47936	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.87700	0.6243	M	0.89414	3.03	0.47949	D	0.999553	B	0.29085	0.232	B	0.22601	0.04	D	0.86167	0.1597	10	0.52906	T	0.07	-10.0438	11.7067	0.51601	0.088:0.0:0.912:0.0	.	135	Q6ZNF0	PAPL_HUMAN	H	135	ENSP00000327557:R135H	ENSP00000327557:R135H	R	+	2	0	AC011443.1	44281521	0.995000	0.38212	0.740000	0.30986	0.875000	0.50365	2.325000	0.43840	1.142000	0.42291	0.655000	0.94253	CGT		0.637	PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463810.1		
GMFG	9535	broad.mit.edu	37	19	39826084	39826084	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:39826084C>T	ENST00000597595.1	-	2	299	c.91G>A	c.(91-93)Gcc>Acc	p.A31T	GMFG_ENST00000595636.1_Missense_Mutation_p.A31T|GMFG_ENST00000253054.8_5'UTR|GMFG_ENST00000594700.1_Missense_Mutation_p.A31T|GMFG_ENST00000601387.1_Intron|GMFG_ENST00000600322.1_5'UTR|GMFG_ENST00000602185.1_Intron|GMFG_ENST00000598034.1_Missense_Mutation_p.A31T	NM_004877.2	NP_004868.1	O60234	GMFG_HUMAN	glia maturation factor, gamma	31	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				negative regulation of protein kinase activity (GO:0006469)|positive regulation of catalytic activity (GO:0043085)|protein phosphorylation (GO:0006468)	intracellular (GO:0005622)	enzyme activator activity (GO:0008047)|protein kinase inhibitor activity (GO:0004860)	p.A31T(1)		breast(1)|large_intestine(2)|liver(2)|lung(3)|skin(1)|stomach(1)	10	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.15e-27)|all cancers(26;1.3e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CTTATGATGGCTGCATTGTCT	0.577																																					p.A31T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G91A	19						.						186.0	140.0	156.0					19																	39826084		2203	4300	6503	44517924	SO:0001583	missense	9535	exon2			AB001993	CCDS12532.1, CCDS74364.1	19q13.2	2014-08-12			ENSG00000130755	ENSG00000130755			4374	protein-coding gene	gene with protein product		604104				9545571, 9653160, 17127212	Standard	XM_005259440		Approved		uc002okz.4	O60234	OTTHUMG00000182811	ENST00000597595.1:c.91G>A	19.37:g.39826084C>T	ENSP00000472249:p.Ala31Thr	Somatic		Capture	Illumina HiSeq	Phase_I	44517924	NM_004877	Q6IB37	Missense_Mutation	SNP	ENST00000597595.1	37	CCDS12532.1	.	.	.	.	.	.	.	.	.	.	C	32	5.123480	0.94429	.	.	ENSG00000130755	ENST00000253054	.	.	.	4.26	4.26	0.50523	Actin-binding, cofilin/tropomyosin type (3);	0.000000	0.64402	D	0.000014	D	0.84388	0.5461	H	0.94734	3.575	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.81914	0.986;0.995	D	0.85406	0.1134	9	0.30078	T	0.28	-19.6211	12.0388	0.53442	0.0:1.0:0.0:0.0	.	31;31	O60234;Q6IB37	GMFG_HUMAN;.	T	31	.	ENSP00000253054:A31T	A	-	1	0	GMFG	44517924	1.000000	0.71417	0.986000	0.45419	0.973000	0.67179	6.780000	0.75063	2.197000	0.70478	0.561000	0.74099	GCC		0.577	GMFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463839.1		
TIMM50	92609	broad.mit.edu	37	19	39976406	39976406	+	Missense_Mutation	SNP	G	G	A	rs199511949	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:39976406G>A	ENST00000607714.1	+	6	473	c.451G>A	c.(451-453)Gtt>Att	p.V151I	TIMM50_ENST00000314349.4_Missense_Mutation_p.V254I|TIMM50_ENST00000544017.1_Missense_Mutation_p.V38I|TIMM50_ENST00000599794.1_Intron			Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)	151	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				cellular protein metabolic process (GO:0044267)|mitochondrial membrane organization (GO:0007006)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein targeting to mitochondrion (GO:0006626)|release of cytochrome c from mitochondria (GO:0001836)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)	interleukin-2 receptor binding (GO:0005134)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)	p.V254I(1)		NS(1)|endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)	14	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CTACACGCTCGTTTTGGAGCT	0.607													G|||	2	0.000399361	0.0	0.0	5008	,	,		18018	0.002		0.0	False		,,,				2504	0.0				p.V254I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G760A	19						.						81.0	59.0	66.0					19																	39976406		2203	4300	6503	44668246	SO:0001583	missense	92609	exon6			BC009072	CCDS33023.1	19q13.2	2010-06-21	2006-04-04		ENSG00000105197	ENSG00000105197		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	23656	protein-coding gene	gene with protein product		607381	"""translocase of inner mitochondrial membrane 50 homolog (yeast)"""			12437925	Standard	NM_001001563		Approved	TIM50L	uc002olu.1	Q3ZCQ8		ENST00000607714.1:c.451G>A	19.37:g.39976406G>A	ENSP00000475531:p.Val151Ile	Somatic		Capture	Illumina HiSeq	Phase_I	44668246	NM_001001563	Q330K1|Q6QA00|Q96FJ5|Q96GY2|Q9H370	Missense_Mutation	SNP	ENST00000607714.1	37		2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	26.5	4.741705	0.89573	.	.	ENSG00000105197	ENST00000314349;ENST00000544017	T;T	0.34072	1.38;1.38	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.47857	0.1468	M	0.61703	1.905	0.80722	D	1	D	0.54601	0.967	P	0.51135	0.66	T	0.43114	-0.9411	9	.	.	.	-25.0287	17.1668	0.86818	0.0:0.0:1.0:0.0	.	254	Q3ZCQ8-2	.	I	254;38	ENSP00000318115:V254I;ENSP00000445806:V38I	.	V	+	1	0	TIMM50	44668246	1.000000	0.71417	0.594000	0.28785	0.622000	0.37654	9.176000	0.94839	2.576000	0.86940	0.561000	0.74099	GTT		0.607	TIMM50-021	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470728.1	NM_001001563	
SHKBP1	92799	broad.mit.edu	37	19	41088331	41088331	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:41088331G>T	ENST00000291842.5	+	10	968	c.919G>T	c.(919-921)Ggg>Tgg	p.G307W	SHKBP1_ENST00000600733.1_Splice_Site	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	307					protein homooligomerization (GO:0051260)			p.G307W(1)		breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AAGCCACACAGGGCGCATCGG	0.597																																					p.G307W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G919T	19						.						88.0	84.0	85.0					19																	41088331		2203	4300	6503	45780171	SO:0001583	missense	92799	exon10			AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.919G>T	19.37:g.41088331G>T	ENSP00000291842:p.Gly307Trp	Somatic		Capture	Illumina HiSeq	Phase_I	45780171	NM_138392	Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	ENST00000291842.5	37	CCDS12560.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035634	0.75617	.	.	ENSG00000160410	ENST00000291842;ENST00000446701	T	0.12361	2.69	4.62	4.62	0.57501	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.41789	0.1174	M	0.82193	2.58	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.46484	-0.9188	10	0.87932	D	0	-25.3929	16.3577	0.83243	0.0:0.0:1.0:0.0	.	185;144;230;144;307	B4DLI0;B4DUW2;B4DUV2;B3KVX8;Q8TBC3	.;.;.;.;SHKB1_HUMAN	W	307;144	ENSP00000291842:G307W	ENSP00000291842:G307W	G	+	1	0	SHKBP1	45780171	1.000000	0.71417	0.697000	0.30258	0.658000	0.38924	9.023000	0.93683	2.405000	0.81733	0.561000	0.74099	GGG		0.597	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392	
NUMBL	9253	broad.mit.edu	37	19	41188693	41188693	+	Silent	SNP	G	G	A	rs376443919		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:41188693G>A	ENST00000252891.4	-	5	506	c.339C>T	c.(337-339)tcC>tcT	p.S113S	NUMBL_ENST00000599594.1_5'Flank|NUMBL_ENST00000598779.1_Silent_p.S72S|NUMBL_ENST00000540131.1_Silent_p.S72S	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	113	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)		p.S113S(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			CAGACTTCACGGACTTTCGGC	0.652																																					p.S113S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C339T	19						.	G		1,4405	2.1+/-5.4	0,1,2202	97.0	88.0	91.0		339	-7.9	0.9	19		91	0,8600		0,0,4300	no	coding-synonymous	NUMBL	NM_004756.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		113/610	41188693	1,13005	2203	4300	6503	45880533	SO:0001819	synonymous_variant	9253	exon5			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.339C>T	19.37:g.41188693G>A		Somatic		Capture	Illumina HiSeq	Phase_I	45880533	NM_004756	Q7Z4J9	Silent	SNP	ENST00000252891.4	37	CCDS12561.1																																																																																				0.652	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
TICAM1	148022	broad.mit.edu	37	19	4817991	4817991	+	Silent	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:4817991C>A	ENST00000248244.5	-	2	628	c.399G>T	c.(397-399)ctG>ctT	p.L133L		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	133					apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.L133L(1)		NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		GAAGTTCCCCCAGCCGGTGGT	0.672																																					p.L133L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G399T	19						.						68.0	68.0	68.0					19																	4817991		2203	4300	6503	4768991	SO:0001819	synonymous_variant	148022	exon2			AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.399G>T	19.37:g.4817991C>A		Somatic		Capture	Illumina HiSeq	Phase_I	4768991	NM_182919	B3Y691|O75532|Q86XP8|Q96GA0	Silent	SNP	ENST00000248244.5	37	CCDS12136.1																																																																																				0.672	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450435.1	NM_014261	
GRIK5	2901	broad.mit.edu	37	19	42546706	42546706	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:42546706G>A	ENST00000262895.3	-	11	1470	c.1471C>T	c.(1471-1473)Cgg>Tgg	p.R491W	GRIK5_ENST00000593562.1_Missense_Mutation_p.R491W|GRIK5_ENST00000301218.4_Missense_Mutation_p.R491W	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	491					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R491W(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				AGCCATACCCGGTTGATGAGC	0.687																																					p.R491W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1471T	19						.						42.0	46.0	44.0					19																	42546706		2203	4298	6501	47238546	SO:0001583	missense	2901	exon11				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.1471C>T	19.37:g.42546706G>A	ENSP00000262895:p.Arg491Trp	Somatic		Capture	Illumina HiSeq	Phase_I	47238546	NM_002088	Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	37	CCDS12595.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081019	0.76528	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	T;T	0.12569	2.67;2.67	5.74	5.74	0.90152	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.42698	0.1214	M	0.87269	2.87	0.44862	D	0.997876	D	0.89917	1.0	D	0.79784	0.993	T	0.39563	-0.9608	10	0.87932	D	0	.	13.9834	0.64319	0.0:0.0:0.8483:0.1517	.	491	Q16478	GRIK5_HUMAN	W	491	ENSP00000262895:R491W;ENSP00000301218:R491W	ENSP00000262895:R491W	R	-	1	2	GRIK5	47238546	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	1.840000	0.39230	2.884000	0.98904	0.655000	0.94253	CGG		0.687	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1		
PSG2	5670	broad.mit.edu	37	19	43576028	43576028	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:43576028G>A	ENST00000406487.1	-	4	886	c.788C>T	c.(787-789)gCg>gTg	p.A263V		NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	263	Ig-like C2-type 2.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.A263V(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				GTTAGAGTTCGCGAAGCAAGA	0.443																																					p.A263V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C788T	19						.						180.0	190.0	187.0					19																	43576028		2202	4299	6501	48267868	SO:0001583	missense	5670	exon4				CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.788C>T	19.37:g.43576028G>A	ENSP00000385706:p.Ala263Val	Somatic		Capture	Illumina HiSeq	Phase_I	48267868	NM_031246	Q8TCD9|Q9UEA4|Q9UQ78	Missense_Mutation	SNP	ENST00000406487.1	37	CCDS12616.1	.	.	.	.	.	.	.	.	.	.	g	11.96	1.794088	0.31777	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	T	0.14144	2.53	1.26	1.26	0.21427	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.16214	0.0390	M	0.72894	2.215	0.09310	N	1	B;P	0.37423	0.339;0.594	B;B	0.38378	0.184;0.272	T	0.16276	-1.0408	9	0.66056	D	0.02	.	5.8601	0.18743	0.0:0.0:1.0:0.0	.	263;263	B5MCM8;P11465	.;PSG2_HUMAN	V	263	ENSP00000385706:A263V	ENSP00000332984:A263V	A	-	2	0	PSG2	48267868	0.001000	0.12720	0.002000	0.10522	0.004000	0.04260	0.584000	0.23864	0.659000	0.30945	0.398000	0.26397	GCG		0.443	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
CADM4	199731	broad.mit.edu	37	19	44130985	44130985	+	Silent	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:44130985G>T	ENST00000222374.2	-	4	498	c.450C>A	c.(448-450)tcC>tcA	p.S150S	CADM4_ENST00000593506.1_5'Flank	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	150	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S150S(1)		endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				CAGCCGGACGGGACCGCGGAA	0.677																																					p.S150S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C450A	19						.						47.0	54.0	52.0					19																	44130985		2201	4298	6499	48822825	SO:0001819	synonymous_variant	199731	exon4			AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.450C>A	19.37:g.44130985G>T		Somatic		Capture	Illumina HiSeq	Phase_I	48822825	NM_145296	B2R7L5|Q9Y4A4	Silent	SNP	ENST00000222374.2	37	CCDS12627.1																																																																																				0.677	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463352.1	NM_145296	
PLAUR	5329	broad.mit.edu	37	19	44156387	44156387	+	Silent	SNP	G	G	T	rs4251912	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:44156387G>T	ENST00000340093.3	-	6	973	c.744C>A	c.(742-744)acC>acA	p.T248T	PLAUR_ENST00000601723.1_Intron|PLAUR_ENST00000339082.3_Silent_p.T248T|PLAUR_ENST00000221264.4_Silent_p.T203T	NM_002659.3	NP_002650.1	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor	248	UPAR/Ly6 3.				attachment of GPI anchor to protein (GO:0016255)|blood coagulation (GO:0007596)|C-terminal protein lipidation (GO:0006501)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|chemotaxis (GO:0006935)|fibrinolysis (GO:0042730)|post-translational protein modification (GO:0043687)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|urokinase plasminogen activator signaling pathway (GO:0038195)	anchored component of membrane (GO:0031225)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)|urokinase plasminogen activator receptor activity (GO:0030377)	p.T248T(2)		endometrium(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|urinary_tract(3)	20		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	CGTGAGTGCCGGTGGCTACCA	0.547											OREG0025532	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T203T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C609A	19						.						69.0	64.0	65.0					19																	44156387		2203	4300	6503	48848227	SO:0001819	synonymous_variant	5329	exon5				CCDS12628.1, CCDS33041.1, CCDS33042.1, CCDS74386.1	19q13	2012-03-15			ENSG00000011422	ENSG00000011422		"""CD molecules"""	9053	protein-coding gene	gene with protein product	"""urokinase-type plasminogen activator (uPA) receptor"", ""urokinase plasminogen activator surface receptor"""	173391					Standard	NM_002659		Approved	URKR, UPAR, CD87	uc002oxf.2	Q03405		ENST00000340093.3:c.744C>A	19.37:g.44156387G>T		Somatic	921	Capture	Illumina HiSeq	Phase_I	48848227	NM_001005377	A8K409|Q12876|Q15845|Q16887|Q6IB52|Q9BWT0|Q9NYC8|Q9UD69|Q9UEA6|Q9UM92|Q9UMV0	Silent	SNP	ENST00000340093.3	37	CCDS12628.1																																																																																				0.547	PLAUR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463571.1	NM_002659	
ZNF226	7769	broad.mit.edu	37	19	44681696	44681696	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:44681696G>A	ENST00000590089.1	+	7	2648	c.2281G>A	c.(2281-2283)Ggt>Agt	p.G761S	ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Missense_Mutation_p.G761S|ZNF226_ENST00000337433.5_Missense_Mutation_p.G761S			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	761					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G761S(1)					Prostate(69;0.0352)|all_neural(266;0.202)				TGAGATATGTGGTAAGAGCTT	0.403																																					p.G761S	Pancreas(115;581 1665 13228 19278 50070)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2281A	19						.						90.0	98.0	96.0					19																	44681696		2162	4274	6436	49373536	SO:0001583	missense	7769	exon6			AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.2281G>A	19.37:g.44681696G>A	ENSP00000465121:p.Gly761Ser	Somatic		Capture	Illumina HiSeq	Phase_I	49373536	NM_001032372	Q8WWE6|Q96TE6|Q9NS44	Missense_Mutation	SNP	ENST00000590089.1	37	CCDS46102.1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.170432	0.38315	.	.	ENSG00000167380	ENST00000337433;ENST00000454662	T;T	0.57752	0.38;0.38	3.76	0.298	0.15766	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44787	0.1310	M	0.65498	2.005	0.25234	N	0.989807	B	0.26081	0.141	B	0.26864	0.074	T	0.48490	-0.9031	9	0.66056	D	0.02	.	1.836	0.03140	0.1894:0.1586:0.4892:0.1628	.	761	Q9NYT6	ZN226_HUMAN	S	761	ENSP00000336719:G761S;ENSP00000393265:G761S	ENSP00000336719:G761S	G	+	1	0	ZNF226	49373536	0.447000	0.25673	0.812000	0.32479	0.995000	0.86356	0.540000	0.23191	0.056000	0.16144	0.563000	0.77884	GGT		0.403	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
ZNF227	7770	broad.mit.edu	37	19	44739245	44739245	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:44739245C>T	ENST00000313040.7	+	6	867	c.662C>T	c.(661-663)aCa>aTa	p.T221I	ZNF227_ENST00000391961.2_Missense_Mutation_p.T170I|ZNF227_ENST00000589005.1_Missense_Mutation_p.T170I	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T221I(1)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				AAAACTGACACAGAACCAAAA	0.373																																					p.T221I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C662T	19						.						62.0	62.0	62.0					19																	44739245		2203	4300	6503	49431085	SO:0001583	missense	7770	exon6			AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.662C>T	19.37:g.44739245C>T	ENSP00000321049:p.Thr221Ile	Somatic		Capture	Illumina HiSeq	Phase_I	49431085	NM_182490	B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	37	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518003	0.27211	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980	T;T	0.08634	3.2;3.07	4.27	0.864	0.19068	.	.	.	.	.	T	0.09113	0.0225	M	0.64567	1.98	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.001	T	0.30090	-0.9990	9	0.46703	T	0.11	.	4.9017	0.13779	0.1757:0.6324:0.0:0.1919	.	142;200;173;221	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	I	221;178;170;200	ENSP00000321049:T221I;ENSP00000375823:T170I	ENSP00000321049:T221I	T	+	2	0	ZNF227	49431085	0.000000	0.05858	0.000000	0.03702	0.398000	0.30690	0.041000	0.13927	0.157000	0.19338	0.563000	0.77884	ACA		0.373	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
LIG1	3978	broad.mit.edu	37	19	48626507	48626507	+	Silent	SNP	G	G	A	rs200644453		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:48626507G>A	ENST00000263274.7	-	22	2492	c.2073C>T	c.(2071-2073)ggC>ggT	p.G691G	CTC-453G23.5_ENST00000596563.1_RNA|LIG1_ENST00000536218.1_Silent_p.G623G|CTC-453G23.5_ENST00000596839.1_RNA|LIG1_ENST00000427526.2_Silent_p.G660G	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	691					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)	p.G691G(1)		breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	AGACAAACTCGCCCTCTGTCT	0.607								Nucleotide excision repair (NER)					G|||	1	0.000199681	0.0	0.0	5008	,	,		17884	0.001		0.0	False		,,,				2504	0.0				p.G691G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2073T	19						.						66.0	63.0	64.0					19																	48626507		2203	4300	6503	53318319	SO:0001819	synonymous_variant	3978	exon22				CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.2073C>T	19.37:g.48626507G>A		Somatic		Capture	Illumina HiSeq	Phase_I	53318319	NM_000234	B2RAI8|Q2TB12|Q32P23	Silent	SNP	ENST00000263274.7	37	CCDS12711.1																																																																																				0.607	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465575.1	NM_000234	
SAFB	6294	broad.mit.edu	37	19	5664064	5664064	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:5664064C>T	ENST00000292123.5	+	16	2292	c.2185C>T	c.(2185-2187)Cgg>Tgg	p.R729W	SAFB_ENST00000433404.1_Missense_Mutation_p.R559W|SAFB_ENST00000592224.1_Missense_Mutation_p.R728W|SAFB_ENST00000538656.1_Missense_Mutation_p.R571W|SAFB_ENST00000454510.1_Missense_Mutation_p.R660W|SAFB_ENST00000588852.1_Missense_Mutation_p.R729W	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	729	Arg-rich.|Interaction with POLR2A.|Interaction with SAFB2.				chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R729W(1)		breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		GGAAGCCAAGCGGGCCGCCCT	0.597																																					p.R729W	Colon(88;338 1345 6184 8214 20897)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2185T	19						.						51.0	50.0	50.0					19																	5664064		2203	4300	6503	5615064	SO:0001583	missense	6294	exon16			L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.2185C>T	19.37:g.5664064C>T	ENSP00000292123:p.Arg729Trp	Somatic		Capture	Illumina HiSeq	Phase_I	5615064	NM_002967	A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Missense_Mutation	SNP	ENST00000292123.5	37	CCDS12142.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146544	0.57044	.	.	ENSG00000160633	ENST00000454510;ENST00000540206;ENST00000433404;ENST00000292123;ENST00000538656	T;T;T;T	0.21361	2.11;2.23;2.01;2.05	4.99	2.54	0.30619	.	0.000000	0.46758	D	0.000266	T	0.44435	0.1293	M	0.76170	2.325	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.998;0.998;0.998	T	0.50849	-0.8779	10	0.87932	D	0	-18.0747	12.8642	0.57930	0.3555:0.6445:0.0:0.0	.	528;571;660;728;729;729;728	B7Z1C7;B7Z2F6;F5H0H3;B7ZLP5;A0AV56;Q15424;B7ZLP6	.;.;.;.;.;SAFB1_HUMAN;.	W	660;624;559;729;571	ENSP00000415895:R660W;ENSP00000404545:R559W;ENSP00000292123:R729W;ENSP00000438880:R571W	ENSP00000292123:R729W	R	+	1	2	SAFB	5615064	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.797000	0.38804	1.204000	0.43247	0.563000	0.77884	CGG		0.597	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451641.2		
PPFIA3	8541	broad.mit.edu	37	19	49642999	49642999	+	Silent	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:49642999C>A	ENST00000334186.4	+	17	2500	c.2151C>A	c.(2149-2151)ccC>ccA	p.P717P	PPFIA3_ENST00000602351.1_Silent_p.P717P	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	717					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)		p.P717P(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		CCCCACCACCCACTCCCCGCT	0.657																																					p.P717P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2151A	19						.						38.0	37.0	38.0					19																	49642999		2203	4300	6503	54334811	SO:0001819	synonymous_variant	8541	exon17			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.2151C>A	19.37:g.49642999C>A		Somatic		Capture	Illumina HiSeq	Phase_I	54334811	NM_003660	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Silent	SNP	ENST00000334186.4	37	CCDS12758.1	.	.	.	.	.	.	.	.	.	.	c	16.99	3.274932	0.59649	.	.	ENSG00000177380	ENST00000421230	.	.	.	4.46	2.3	0.28687	.	0.000000	0.47455	U	0.000232	T	0.42832	0.1220	.	.	.	0.25951	N	0.982749	.	.	.	.	.	.	T	0.35895	-0.9770	6	0.87932	D	0	-19.9964	7.4748	0.27369	0.0:0.7187:0.0:0.2813	.	.	.	.	Q	567	.	ENSP00000411758:P567Q	P	+	2	0	PPFIA3	54334811	0.708000	0.27876	0.995000	0.50966	0.972000	0.66771	0.006000	0.13152	0.436000	0.26393	0.552000	0.68991	CCA		0.657	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
SIGLEC8	27181	broad.mit.edu	37	19	51960939	51960939	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:51960939G>T	ENST00000321424.3	-	2	575	c.509C>A	c.(508-510)tCc>tAc	p.S170Y	SIGLEC8_ENST00000340550.5_Intron|SIGLEC8_ENST00000430817.1_Intron|SIGLEC8_ENST00000597352.1_5'UTR	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	170	Ig-like C2-type 1.		S -> P (in dbSNP:rs10409962). {ECO:0000269|PubMed:15489334}.		cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.S170Y(1)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CAGGTTCCTGGAGTGGCCAGA	0.617																																					p.S170Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C509A	19						.						78.0	86.0	83.0					19																	51960939		2203	4300	6503	56652751	SO:0001583	missense	27181	exon2			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.509C>A	19.37:g.51960939G>T	ENSP00000321077:p.Ser170Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	56652751	NM_014442	Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	9.020	0.984664	0.18889	.	.	ENSG00000105366	ENST00000321424	T	0.27104	1.69	2.69	-0.741	0.11112	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.596060	0.14002	N	0.348073	T	0.13586	0.0329	N	0.24115	0.695	0.09310	N	1	B	0.14012	0.009	B	0.22386	0.039	T	0.23048	-1.0199	10	0.66056	D	0.02	.	2.016	0.03498	0.312:0.0:0.4227:0.2653	.	170	Q9NYZ4	SIGL8_HUMAN	Y	170	ENSP00000321077:S170Y	ENSP00000321077:S170Y	S	-	2	0	SIGLEC8	56652751	0.005000	0.15991	0.000000	0.03702	0.037000	0.13140	1.310000	0.33551	0.020000	0.15106	0.502000	0.49764	TCC		0.617	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
LILRB2	10288	broad.mit.edu	37	19	54783293	54783293	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:54783293T>C	ENST00000391749.4	-	5	836	c.565A>G	c.(565-567)Aat>Gat	p.N189D	LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000434421.1_Missense_Mutation_p.N73D|LILRB2_ENST00000391746.1_Missense_Mutation_p.N189D|LILRB2_ENST00000314446.5_Missense_Mutation_p.N189D|LILRB2_ENST00000391748.1_Missense_Mutation_p.N189D|MIR4752_ENST00000579672.1_RNA	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	189	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)	p.N189D(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CACCTGCGATTCGGGCTCACG	0.587																																					p.N189D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A565G	19						.						117.0	113.0	115.0					19																	54783293		2203	4300	6503	59475105	SO:0001583	missense	10288	exon5			AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.565A>G	19.37:g.54783293T>C	ENSP00000375629:p.Asn189Asp	Somatic		Capture	Illumina HiSeq	Phase_I	59475105	NM_001080978	A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Missense_Mutation	SNP	ENST00000391749.4	37	CCDS12886.1	.	.	.	.	.	.	.	.	.	.	T	10.51	1.369703	0.24771	.	.	ENSG00000131042	ENST00000391748;ENST00000314446;ENST00000391749;ENST00000391746;ENST00000434421	T;T;T;T;T	0.02863	4.13;4.13;4.13;4.13;4.13	2.58	-5.16	0.02857	Immunoglobulin-like fold (1);	1.500930	0.04006	N	0.297313	T	0.01592	0.0051	N	0.05280	-0.08	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.14578	0.0;0.011;0.003	T	0.47315	-0.9127	10	0.59425	D	0.04	.	3.4513	0.07499	0.5277:0.1243:0.0:0.3479	.	189;206;189	A8MU67;E7EVY1;Q8N423	.;.;LIRB2_HUMAN	D	189;189;189;189;73	ENSP00000375628:N189D;ENSP00000319960:N189D;ENSP00000375629:N189D;ENSP00000375626:N189D;ENSP00000410117:N73D	ENSP00000319960:N189D	N	-	1	0	LILRB2	59475105	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.436000	0.00471	-1.421000	0.02007	-0.460000	0.05396	AAT		0.587	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1		
LENG8	114823	broad.mit.edu	37	19	54969555	54969555	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:54969555G>A	ENST00000326764.5	+	15	2574	c.2095G>A	c.(2095-2097)Gcc>Acc	p.A699T	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	662								p.A699T(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		CGTGGCCCACGCCTTGGCATT	0.577																																					p.A699T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2095A	19						.						130.0	97.0	108.0					19																	54969555		2203	4300	6503	59661367	SO:0001583	missense	114823	exon15			AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.2095G>A	19.37:g.54969555G>A	ENSP00000318374:p.Ala699Thr	Somatic		Capture	Illumina HiSeq	Phase_I	59661367	NM_052925	B0VJY9|Q8IZ27|Q8NCX6	Missense_Mutation	SNP	ENST00000326764.5	37	CCDS12894.1	.	.	.	.	.	.	.	.	.	.	G	34	5.382455	0.95967	.	.	ENSG00000167615	ENST00000326764;ENST00000301196;ENST00000376526;ENST00000431846	T;T;T	0.39406	1.08;1.08;1.08	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.69940	0.3167	M	0.86573	2.825	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.91635	0.999;0.963	T	0.75331	-0.3355	10	0.87932	D	0	-27.5492	16.9426	0.86222	0.0:0.0:1.0:0.0	.	699;662	Q96PV6-2;F8W9Q9	.;.	T	699;662;662;699	ENSP00000318374:A699T;ENSP00000365709:A662T;ENSP00000388053:A699T	ENSP00000301196:A662T	A	+	1	0	LENG8	59661367	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	6.786000	0.75094	2.684000	0.91462	0.555000	0.69702	GCC		0.577	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925	
NLRP11	204801	broad.mit.edu	37	19	56321611	56321611	+	Missense_Mutation	SNP	C	C	T	rs375545663		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:56321611C>T	ENST00000589093.1	-	3	458	c.365G>A	c.(364-366)cGt>cAt	p.R122H	NLRP11_ENST00000592953.1_Missense_Mutation_p.R23H|NLRP11_ENST00000589824.2_Missense_Mutation_p.R122H|NLRP11_ENST00000360133.3_Missense_Mutation_p.R122H|NLRP11_ENST00000443188.1_Missense_Mutation_p.R122H			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	122							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)	p.R122H(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CGAAACGTCACGAAAAAATTT	0.383																																					p.R122H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G365A	19						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	42.0	41.0	41.0		365	-0.7	0.0	19		41	2,8598	2.2+/-6.3	0,2,4298	no	missense	NLRP11	NM_145007.3	29	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	benign	122/1034	56321611	3,13003	2203	4300	6503	61013423	SO:0001583	missense	204801	exon5			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.365G>A	19.37:g.56321611C>T	ENSP00000466285:p.Arg122His	Somatic		Capture	Illumina HiSeq	Phase_I	61013423	NM_145007	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	37	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	C	6.814	0.519364	0.13005	2.27E-4	2.33E-4	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.74209	-0.82;-0.76	1.99	-0.658	0.11428	.	.	.	.	.	T	0.48409	0.1498	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.0	T	0.27020	-1.0086	9	0.33141	T	0.24	.	4.4735	0.11724	0.0:0.379:0.0:0.621	.	122;122	P59045;P59045-2	NAL11_HUMAN;.	H	122	ENSP00000409898:R122H;ENSP00000353251:R122H	ENSP00000353251:R122H	R	-	2	0	NLRP11	61013423	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.117000	0.03283	-0.162000	0.10964	0.655000	0.94253	CGT		0.383	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
SAFB2	9667	broad.mit.edu	37	19	5587282	5587282	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:5587282delG	ENST00000252542.4	-	21	3098	c.2834delC	c.(2833-2835)ccgfs	p.P945fs		NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	945	Interacts with SAFB1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P945fs*>9(1)		endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		gtgggggtacggggggggatg	0.657																																					p.P945fs	Ovarian(127;888 1728 23957 44128 52668)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2834delC	19						.						21.0	21.0	21.0					19																	5587282		2201	4300	6501	5538282	SO:0001589	frameshift_variant	9667	exon21			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.2834delC	19.37:g.5587282delG	ENSP00000252542:p.Pro945fs	Somatic		Capture	Illumina HiSeq	Phase_I	5538282	NM_014649	B4DKG3|Q8TB13	Frame_Shift_Del	DEL	ENST00000252542.4	37	CCDS32879.1																																																																																				0.657	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451016.1	NM_014649	
ADAMTS10	81794	broad.mit.edu	37	19	8665856	8665856	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:8665856C>T	ENST00000597188.1	-	6	1036	c.766G>A	c.(766-768)Ggg>Agg	p.G256R	ADAMTS10_ENST00000596709.1_5'UTR|ADAMTS10_ENST00000270328.4_Missense_Mutation_p.G256R	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	256	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						TCCCGGCGCCCGTGATAGGCC	0.617																																					p.G256R												.	.	0			c.G766A	19						.						107.0	92.0	97.0					19																	8665856		2203	4300	6503	8571856	SO:0001583	missense	81794	exon6			AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.766G>A	19.37:g.8665856C>T	ENSP00000471851:p.Gly256Arg	None		Capture	Illumina HiSeq	Phase_I	8571856	NM_030957	M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	37	CCDS12206.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.1|29.1	4.979585|4.979585	0.92982|0.92982	.|.	.|.	ENSG00000142303|ENSG00000142303	ENST00000270328|ENST00000393912	D|.	0.88741|.	-2.42|.	5.19|5.19	5.19|5.19	0.71726|0.71726	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78355|0.78355	0.4270|0.4270	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	P|.	0.47350|.	0.894|.	P|.	0.50970|.	0.655|.	T|T	0.80181|0.80181	-0.1489|-0.1489	10|6	0.87932|0.51188	D|T	0|0.08	.|.	17.7019|17.7019	0.88298|0.88298	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	256|.	Q9H324|.	ATS10_HUMAN|.	R|Q	256|8	ENSP00000270328:G256R|.	ENSP00000270328:G256R|ENSP00000377489:R8Q	G|R	-|-	1|2	0|0	ADAMTS10|ADAMTS10	8571856|8571856	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	7.333000|7.333000	0.79214|0.79214	2.423000|2.423000	0.82170|0.82170	0.455000|0.455000	0.32223|0.32223	GGG|CGG		0.617	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
MUC16	94025	broad.mit.edu	37	19	9016998	9016998	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:9016998G>T	ENST00000397910.4	-	27	38200	c.37997C>A	c.(37996-37998)cCt>cAt	p.P12666H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12668					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P12666H(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTGGGCACAGGGATCCAATG	0.537																																					p.P12666H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C37997A	19						.						113.0	104.0	107.0					19																	9016998		1970	4147	6117	8877998	SO:0001583	missense	94025	exon27			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37997C>A	19.37:g.9016998G>T	ENSP00000381008:p.Pro12666His	Somatic		Capture	Illumina HiSeq	Phase_I	8877998	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	1.859	-0.463044	0.04476	.	.	ENSG00000181143	ENST00000397910	T	0.02236	4.38	1.48	0.398	0.16319	.	.	.	.	.	T	0.01523	0.0049	N	0.14661	0.345	.	.	.	B	0.12630	0.006	B	0.04013	0.001	T	0.41052	-0.9530	8	0.87932	D	0	.	3.7039	0.08392	0.2532:0.0:0.7468:0.0	.	12666	B5ME49	.	H	12666	ENSP00000381008:P12666H	ENSP00000381008:P12666H	P	-	2	0	MUC16	8877998	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.070000	0.14573	0.166000	0.19597	0.455000	0.32223	CCT		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	broad.mit.edu	37	19	9074093	9074093	+	Missense_Mutation	SNP	G	G	T	rs563365165		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:9074093G>T	ENST00000397910.4	-	3	13556	c.13353C>A	c.(13351-13353)agC>agA	p.S4451R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4453	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S4451R(2)|p.S84R(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AAGAGGGATAGCTGGTTTCTG	0.502																																					p.S4451R												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C13353A	19						.						115.0	112.0	113.0					19																	9074093		2050	4190	6240	8935093	SO:0001583	missense	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13353C>A	19.37:g.9074093G>T	ENSP00000381008:p.Ser4451Arg	Somatic		Capture	Illumina HiSeq	Phase_I	8935093	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	8.614	0.889776	0.17540	.	.	ENSG00000181143	ENST00000397910	T	0.29397	1.57	2.23	-1.62	0.08372	.	.	.	.	.	T	0.18923	0.0454	L	0.37630	1.12	.	.	.	B	0.31383	0.321	B	0.30316	0.114	T	0.26360	-1.0105	8	0.87932	D	0	.	2.3029	0.04167	0.3094:0.0:0.4519:0.2387	.	4451	B5ME49	.	R	4451	ENSP00000381008:S4451R	ENSP00000381008:S4451R	S	-	3	2	MUC16	8935093	0.003000	0.15002	0.000000	0.03702	0.591000	0.36615	-0.250000	0.08830	-0.247000	0.09597	0.305000	0.20034	AGC		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CRTC1	23373	broad.mit.edu	37	19	18887993	18887993	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:18887993delC	ENST00000321949.8	+	14	1732	c.1706delC	c.(1705-1707)tccfs	p.S569fs	CRTC1_ENST00000594658.1_Frame_Shift_Del_p.S528fs|CRTC1_ENST00000338797.6_Frame_Shift_Del_p.S585fs|CRTC1_ENST00000601916.1_Frame_Shift_Del_p.S327fs	NM_015321.2	NP_056136.2			CREB regulated transcription coactivator 1									p.S572fs*6(2)	CRTC1/MAML2(516)	NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	19						ACAGGAGAGTCCCCCCCCAGC	0.637																																					p.S569fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.1706delC	19						.		,	36,4218		5,26,2096	32.0	37.0	35.0		,	3.8	1.0	19		34	39,8205		5,29,4088	no	frameshift,frameshift	CRTC1	NM_015321.2,NM_001098482.1	,	10,55,6184	A1A1,A1R,RR		0.4731,0.8463,0.6001	,	,	18887993	75,12423	2201	4298	6499	18748993	SO:0001589	frameshift_variant	23373	exon14			AY040323	CCDS32963.1, CCDS42525.1	19p13	2012-07-31	2005-11-24	2005-11-24					16062	protein-coding gene	gene with protein product	"""transducer of regulated cAMP response element-binding protein"""	607536	"""mucoepidermoid carcinoma translocated 1"""	MECT1		12539049, 14536081, 14506290	Standard	NM_015321		Approved	KIAA0616, FLJ14027, TORC1	uc010ebv.3	Q6UUV9		ENST00000321949.8:c.1706delC	19.37:g.18887993delC	ENSP00000323332:p.Ser569fs	Somatic		Capture	Illumina HiSeq	Phase_I	18748993	NM_015321		Frame_Shift_Del	DEL	ENST00000321949.8	37	CCDS32963.1																																																																																				0.637	CRTC1-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465151.3	NM_025021	
TRIM28	10155	broad.mit.edu	37	19	59061320	59061320	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr19:59061320G>A	ENST00000253024.5	+	15	2400	c.2111G>A	c.(2110-2112)tGt>tAt	p.C704Y	TRIM28_ENST00000341753.6_Missense_Mutation_p.C622Y	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	704	Bromo.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.C704Y(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		TTGTAGAAATGTGAGCGTGTA	0.572																																					p.C704Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2111A	19						.						99.0	88.0	92.0					19																	59061320		2203	4300	6503	63753132	SO:0001583	missense	10155	exon15				CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.2111G>A	19.37:g.59061320G>A	ENSP00000253024:p.Cys704Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	63753132	NM_005762	O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	ENST00000253024.5	37	CCDS12985.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.936167	0.52972	.	.	ENSG00000130726	ENST00000253024;ENST00000341753	T;T	0.48201	0.82;0.82	4.75	4.75	0.60458	Bromodomain (2);	0.063554	0.64402	D	0.000010	T	0.64260	0.2582	L	0.54323	1.7	0.54753	D	0.999987	D;D;D	0.71674	0.998;0.991;0.997	D;D;D	0.87578	0.998;0.961;0.995	T	0.66709	-0.5855	10	0.87932	D	0	-13.7401	15.6482	0.77070	0.0:0.0:1.0:0.0	.	622;704;704	Q13263-2;B2R8R5;Q13263	.;.;TIF1B_HUMAN	Y	704;622	ENSP00000253024:C704Y;ENSP00000342232:C622Y	ENSP00000253024:C704Y	C	+	2	0	TRIM28	63753132	1.000000	0.71417	1.000000	0.80357	0.287000	0.27160	4.869000	0.63028	2.643000	0.89663	0.443000	0.29094	TGT		0.572	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467074.1	NM_005762	
WDR47	22911	broad.mit.edu	37	1	109524462	109524462	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:109524462C>T	ENST00000369962.3	-	13	2513	c.2291G>A	c.(2290-2292)tGg>tAg	p.W764*	WDR47_ENST00000357672.3_Nonsense_Mutation_p.W736*|WDR47_ENST00000361054.3_Nonsense_Mutation_p.W736*|WDR47_ENST00000400794.3_Nonsense_Mutation_p.W772*|WDR47_ENST00000369965.4_Nonsense_Mutation_p.W765*			O94967	WDR47_HUMAN	WD repeat domain 47	764					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.W765*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		CCAGCCACTCCAGGTATAAAG	0.378																																					p.W765X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2294A	1						.						100.0	101.0	101.0					1																	109524462		2203	4300	6503	109325985	SO:0001587	stop_gained	22911	exon13			AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.2291G>A	1.37:g.109524462C>T	ENSP00000358979:p.Trp764*	Somatic		Capture	Illumina HiSeq	Phase_I	109325985	NM_014969	A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Nonsense_Mutation	SNP	ENST00000369962.3	37	CCDS44187.1	.	.	.	.	.	.	.	.	.	.	C	42	9.358406	0.99147	.	.	ENSG00000085433	ENST00000400794;ENST00000369962;ENST00000361054;ENST00000369965;ENST00000357672	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-21.2021	19.1641	0.93546	0.0:1.0:0.0:0.0	.	.	.	.	X	772;764;736;765;736	.	ENSP00000350301:W736X	W	-	2	0	WDR47	109325985	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.532000	0.85374	0.591000	0.81541	TGG		0.378	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032414.2	NM_014969	
KCND3	3752	broad.mit.edu	37	1	112524400	112524400	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:112524400A>G	ENST00000315987.2	-	2	1428	c.949T>C	c.(949-951)Tgt>Cgt	p.C317R	KCND3_ENST00000369697.1_Missense_Mutation_p.C317R|KCND3_ENST00000302127.4_Missense_Mutation_p.C317R	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	317					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.C317R(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TCGGAGGCACAGCTCTTCAGT	0.582																																					p.C317R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T949C	1						.						107.0	105.0	106.0					1																	112524400		2203	4300	6503	112325923	SO:0001583	missense	3752	exon2			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.949T>C	1.37:g.112524400A>G	ENSP00000319591:p.Cys317Arg	Somatic		Capture	Illumina HiSeq	Phase_I	112325923	NM_004980	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	ENST00000315987.2	37	CCDS843.1	.	.	.	.	.	.	.	.	.	.	A	17.60	3.430672	0.62844	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.98345	-4.88;-4.88;-4.88	5.49	5.49	0.81192	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98513	0.9504	M	0.69463	2.115	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	D	0.99906	1.1181	10	0.87932	D	0	.	15.2422	0.73480	1.0:0.0:0.0:0.0	.	317;317	Q14D71;Q9UK17	.;KCND3_HUMAN	R	317	ENSP00000358711:C317R;ENSP00000319591:C317R;ENSP00000306923:C317R	ENSP00000306923:C317R	C	-	1	0	KCND3	112325923	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.085000	0.62840	0.533000	0.62120	TGT		0.582	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
MTHFR	4524	broad.mit.edu	37	1	11854850	11854850	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:11854850C>A	ENST00000376592.1	-	6	1230	c.1102G>T	c.(1102-1104)Gcc>Tcc	p.A368S	MTHFR_ENST00000376585.1_Missense_Mutation_p.A409S|MTHFR_ENST00000376583.3_Missense_Mutation_p.A409S|MTHFR_ENST00000376590.3_Missense_Mutation_p.A368S			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	368					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)	p.A368S(1)		NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	GGTCTGGAGGCCCAGAAGATG	0.587																																					p.A368S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1102T	1						.						103.0	101.0	102.0					1																	11854850		2203	4300	6503	11777437	SO:0001583	missense	4524	exon7			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.1102G>T	1.37:g.11854850C>A	ENSP00000365777:p.Ala368Ser	Somatic		Capture	Illumina HiSeq	Phase_I	11777437	NM_005957	B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Missense_Mutation	SNP	ENST00000376592.1	37	CCDS137.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.728056	0.48833	.	.	ENSG00000177000	ENST00000376592;ENST00000376583;ENST00000376590;ENST00000376585	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	4.91	4.91	0.64330	.	0.049471	0.85682	D	0.000000	T	0.56790	0.2009	N	0.24115	0.695	0.58432	D	0.999996	B;B	0.21688	0.004;0.059	B;B	0.18263	0.009;0.021	T	0.52852	-0.8520	10	0.13853	T	0.58	.	17.4549	0.87604	0.0:1.0:0.0:0.0	.	368;409	P42898;Q5SNW6	MTHR_HUMAN;.	S	368;409;368;409	ENSP00000365777:A368S;ENSP00000365767:A409S;ENSP00000365775:A368S;ENSP00000365770:A409S	ENSP00000365767:A409S	A	-	1	0	MTHFR	11777437	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.823000	0.48081	2.407000	0.81776	0.462000	0.41574	GCC		0.587	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006538.1	NM_005957	
MTHFR	4524	broad.mit.edu	37	1	11855397	11855397	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:11855397G>T	ENST00000376592.1	-	5	917	c.789C>A	c.(787-789)caC>caA	p.H263Q	MTHFR_ENST00000376585.1_Missense_Mutation_p.H304Q|MTHFR_ENST00000376583.3_Missense_Mutation_p.H304Q|MTHFR_ENST00000376590.3_Missense_Mutation_p.H263Q			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	263					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)	p.H263Q(1)		NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	GCCGAAGGGAGTGGTAGCCCT	0.572																																					p.H263Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C789A	1						.						49.0	48.0	48.0					1																	11855397		2203	4300	6503	11777984	SO:0001583	missense	4524	exon6			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.789C>A	1.37:g.11855397G>T	ENSP00000365777:p.His263Gln	Somatic		Capture	Illumina HiSeq	Phase_I	11777984	NM_005957	B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Missense_Mutation	SNP	ENST00000376592.1	37	CCDS137.1	.	.	.	.	.	.	.	.	.	.	G	9.931	1.214849	0.22373	.	.	ENSG00000177000	ENST00000376592;ENST00000376583;ENST00000376590;ENST00000376585	D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88	4.83	3.89	0.44902	.	0.325143	0.38217	N	0.001764	T	0.79287	0.4420	N	0.04132	-0.27	0.38918	D	0.95767	B;B	0.02656	0.0;0.0	B;B	0.08055	0.0;0.003	T	0.71307	-0.4632	10	0.15952	T	0.53	.	9.3387	0.38067	0.1673:0.0:0.8327:0.0	.	263;304	P42898;Q5SNW6	MTHR_HUMAN;.	Q	263;304;263;304	ENSP00000365777:H263Q;ENSP00000365767:H304Q;ENSP00000365775:H263Q;ENSP00000365770:H304Q	ENSP00000365767:H304Q	H	-	3	2	MTHFR	11777984	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	1.290000	0.33319	1.125000	0.41998	0.561000	0.74099	CAC		0.572	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006538.1	NM_005957	
KCND3	3752	broad.mit.edu	37	1	112524695	112524695	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:112524695G>A	ENST00000315987.2	-	2	1133	c.654C>T	c.(652-654)tgC>tgT	p.C218C	KCND3_ENST00000369697.1_Silent_p.C218C|KCND3_ENST00000302127.4_Silent_p.C218C	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	218					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.C218C(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	AGCGCTCCCCGCACGGCAGCT	0.647																																					p.C218C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C654T	1						.						28.0	29.0	29.0					1																	112524695		2203	4300	6503	112326218	SO:0001819	synonymous_variant	3752	exon2			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.654C>T	1.37:g.112524695G>A		Somatic		Capture	Illumina HiSeq	Phase_I	112326218	NM_004980	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Silent	SNP	ENST00000315987.2	37	CCDS843.1																																																																																				0.647	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
SNX27	81609	broad.mit.edu	37	1	151611470	151611470	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:151611470G>A	ENST00000458013.2	+	2	538	c.418G>A	c.(418-420)Gca>Aca	p.A140T	SNX27_ENST00000368838.1_Missense_Mutation_p.A47T|SNX27_ENST00000368843.3_Missense_Mutation_p.A140T			Q96L92	SNX27_HUMAN	sorting nexin family member 27	140					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)	p.A140T(1)		central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCCTCATGAGGCAGATAACCT	0.483																																					p.A140T	Colon(46;291 966 40145 41237 41888)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G418A	1						.						139.0	122.0	128.0					1																	151611470		2203	4300	6503	149878094	SO:0001583	missense	81609	exon2			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.418G>A	1.37:g.151611470G>A	ENSP00000400333:p.Ala140Thr	Somatic		Capture	Illumina HiSeq	Phase_I	149878094	NM_030918	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	ENST00000458013.2	37		.	.	.	.	.	.	.	.	.	.	G	16.69	3.194542	0.58017	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	T;T;T	0.53857	0.6;0.6;0.75	4.13	4.13	0.48395	Phox homologous domain (1);PDZ/DHR/GLGF (1);	0.163596	0.53938	D	0.000043	T	0.35278	0.0926	L	0.46157	1.445	0.58432	D	0.999992	B;B	0.23591	0.03;0.088	B;B	0.26693	0.072;0.072	T	0.40021	-0.9585	10	0.52906	T	0.07	.	15.4734	0.75458	0.0:0.0:1.0:0.0	.	140;140	Q96L92;Q96L92-3	SNX27_HUMAN;.	T	140;140;47	ENSP00000400333:A140T;ENSP00000357836:A140T;ENSP00000357831:A47T	ENSP00000357831:A47T	A	+	1	0	SNX27	149878094	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.355000	0.79434	2.297000	0.77311	0.591000	0.81541	GCA		0.483	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918	
FLG	2312	broad.mit.edu	37	1	152279744	152279744	+	Missense_Mutation	SNP	G	G	A	rs547788565	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:152279744G>A	ENST00000368799.1	-	3	7653	c.7618C>T	c.(7618-7620)Cgg>Tgg	p.R2540W	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2540	Ser-rich.		R -> Q (in dbSNP:rs12407748).		establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R2540W(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTCGGCCCGAGAGGAAGCT	0.582									Ichthyosis				G|||	19	0.00379393	0.0	0.0014	5008	,	,		19348	0.0		0.0	False		,,,				2504	0.0184				p.R2540W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7618T	1						.						222.0	246.0	238.0					1																	152279744		2202	4299	6501	150546368	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7618C>T	1.37:g.152279744G>A	ENSP00000357789:p.Arg2540Trp	Somatic		Capture	Illumina HiSeq	Phase_I	150546368	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	5.200	0.222430	0.09863	.	.	ENSG00000143631	ENST00000368799	T	0.03635	3.86	1.28	-2.57	0.06248	.	.	.	.	.	T	0.00637	0.0021	N	0.16307	0.4	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.46020	-0.9221	9	0.62326	D	0.03	.	2.9866	0.05970	0.3982:0.2356:0.3662:0.0	.	2540	P20930	FILA_HUMAN	W	2540	ENSP00000357789:R2540W	ENSP00000357789:R2540W	R	-	1	2	FLG	150546368	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.152000	0.01288	-1.874000	0.01133	-0.699000	0.03677	CGG		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
SLC27A3	11000	broad.mit.edu	37	1	153745493	153745493	+	5'Flank	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:153745493G>A	ENST00000368661.3	+	0	0				SLC27A3_ENST00000271857.2_5'Flank|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000456435.1_Missense_Mutation_p.R856Q|INTS3_ENST00000435409.2_Missense_Mutation_p.R996Q|INTS3_ENST00000512605.1_Missense_Mutation_p.R856Q|INTS3_ENST00000318967.2_Missense_Mutation_p.R996Q	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3						fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)	p.R996Q(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCCAGCCCTCGAAGTCGAAAG	0.567																																					p.R996Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2987A	1						.						101.0	108.0	106.0					1																	153745493		2203	4300	6503	152012117	SO:0001631	upstream_gene_variant	65123	exon29			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155		1.37:g.153745493G>A	Exception_encountered	Somatic		Capture	Illumina HiSeq	Phase_I	152012117	NM_023015	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	37	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919839	0.92249	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.45115	0.1326	L	0.40543	1.245	0.28563	N	0.911018	D;D;D	0.69078	0.997;0.994;0.997	D;P;D	0.69479	0.964;0.885;0.947	T	0.31916	-0.9926	9	0.23891	T	0.37	.	15.0624	0.71964	0.0:0.0:1.0:0.0	.	856;997;996	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	Q	996;856;996;856	.	ENSP00000318641:R996Q	R	+	2	0	INTS3	152012117	1.000000	0.71417	0.935000	0.37517	0.988000	0.76386	8.442000	0.90317	2.620000	0.88729	0.561000	0.74099	CGA		0.567	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
ATP8B2	57198	broad.mit.edu	37	1	154309900	154309900	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:154309900G>A	ENST00000368489.3	+	12	1013	c.1013G>A	c.(1012-1014)cGt>cAt	p.R338H	ATP8B2_ENST00000368487.3_Missense_Mutation_p.R305H|RNU7-57P_ENST00000459540.1_RNA|ATP8B2_ENST00000341822.2_Missense_Mutation_p.R324H|ATP8B2_ENST00000426445.1_3'UTR	NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	324					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R338H(1)	IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GTGGGGATGCGTTTCCAGGTC	0.552																																					p.R305H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G914A	1						.						346.0	282.0	304.0					1																	154309900		2203	4300	6503	152576524	SO:0001583	missense	57198	exon12			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1013G>A	1.37:g.154309900G>A	ENSP00000357475:p.Arg338His	Somatic		Capture	Illumina HiSeq	Phase_I	152576524	NM_001005855	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368489.3	37	CCDS1066.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.367685	0.24771	.	.	ENSG00000143515	ENST00000368487;ENST00000368489;ENST00000341822	D;D;D	0.88277	-2.36;-2.36;-2.36	5.17	3.28	0.37604	ATPase, P-type, ATPase-associated domain (1);	0.242107	0.36200	N	0.002730	T	0.62221	0.2410	N	0.04148	-0.265	0.29759	N	0.835712	P;B;B	0.44734	0.842;0.001;0.0	B;B;B	0.43728	0.429;0.005;0.002	T	0.62115	-0.6922	10	0.30854	T	0.27	.	8.2546	0.31748	0.247:0.0:0.753:0.0	.	324;338;305	P98198;P98198-3;P98198-4	AT8B2_HUMAN;.;.	H	305;338;324	ENSP00000357472:R305H;ENSP00000357475:R338H;ENSP00000340448:R324H	ENSP00000340448:R324H	R	+	2	0	ATP8B2	152576524	0.980000	0.34600	0.978000	0.43139	0.783000	0.44284	1.365000	0.34182	0.752000	0.32923	0.561000	0.74099	CGT		0.552	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
ADAM15	8751	broad.mit.edu	37	1	155030538	155030538	+	Missense_Mutation	SNP	C	C	T	rs148719743		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:155030538C>T	ENST00000356955.2	+	14	1729	c.1628C>T	c.(1627-1629)gCg>gTg	p.A543V	ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000447332.3_Missense_Mutation_p.A527V|ADAM15_ENST00000531455.1_Missense_Mutation_p.A553V|ADAM15_ENST00000360674.4_Missense_Mutation_p.A543V|ADAM15_ENST00000368413.1_Missense_Mutation_p.A249V|ADAM15_ENST00000359280.4_Missense_Mutation_p.A543V|ADAM15_ENST00000271836.6_Missense_Mutation_p.A543V|ADAM15_ENST00000449910.2_Missense_Mutation_p.A543V|ADAM15_ENST00000368410.2_Missense_Mutation_p.A249V|ADAM15_ENST00000355956.2_Missense_Mutation_p.A543V|ADAM15_ENST00000368412.3_Missense_Mutation_p.A543V	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	543	Cys-rich.				angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.A543V(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CAGCCCGCTGCGCCACTTTGC	0.622													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19240	0.0		0.0	False		,,,				2504	0.0				p.A543V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1628T	1						.	C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	6,4400	11.4+/-27.6	0,6,2197	56.0	58.0	57.0		1628,1628,1628,1628,1628,1628	1.5	0.0	1	dbSNP_134	57	0,8600		0,0,4300	yes	missense,missense,missense,missense,missense,missense	ADAM15	NM_003815.3,NM_207191.1,NM_207194.1,NM_207195.1,NM_207196.1,NM_207197.1	64,64,64,64,64,64	0,6,6497	TT,TC,CC		0.0,0.1362,0.0461	benign,benign,benign,benign,benign,benign	543/815,543/773,543/840,543/839,543/863,543/864	155030538	6,13000	2203	4300	6503	153297162	SO:0001583	missense	8751	exon14			U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.1628C>T	1.37:g.155030538C>T	ENSP00000349436:p.Ala543Val	Somatic		Capture	Illumina HiSeq	Phase_I	153297162	NM_207195	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Missense_Mutation	SNP	ENST00000356955.2	37	CCDS1087.1	.	.	.	.	.	.	.	.	.	.	C	9.410	1.080296	0.20309	0.001362	0.0	ENSG00000143537	ENST00000356955;ENST00000449910;ENST00000359280;ENST00000360674;ENST00000368412;ENST00000355956;ENST00000368410;ENST00000271836;ENST00000368413;ENST00000531455	T;T;T;T;T;T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93	5.4	1.49	0.22878	ADAM, cysteine-rich (2);	1.103280	0.07012	N	0.825263	T	0.10337	0.0253	L	0.35644	1.08	0.09310	N	1	P;P;P;P;P;P;P;P;P;P;P	0.51791	0.948;0.948;0.89;0.886;0.886;0.936;0.936;0.936;0.775;0.907;0.948	P;P;B;B;B;B;B;B;B;B;B	0.46659	0.523;0.523;0.322;0.388;0.3;0.3;0.3;0.3;0.294;0.426;0.426	T	0.19224	-1.0312	10	0.87932	D	0	.	3.9518	0.09372	0.1656:0.5744:0.0:0.2599	.	553;560;527;543;543;543;543;543;543;543;540	E9PN65;B7Z390;B4DMH8;Q13444-10;Q13444-2;Q13444-4;Q13444-5;Q13444-3;Q13444-9;Q13444;Q59GF2	.;.;.;.;.;.;.;.;.;ADA15_HUMAN;.	V	543;543;543;543;543;543;249;543;249;553	ENSP00000349436:A543V;ENSP00000403843:A543V;ENSP00000352226:A543V;ENSP00000353892:A543V;ENSP00000357397:A543V;ENSP00000348227:A543V;ENSP00000357395:A249V;ENSP00000271836:A543V;ENSP00000357398:A249V;ENSP00000432927:A553V	ENSP00000271836:A543V	A	+	2	0	ADAM15	153297162	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.666000	0.25097	0.126000	0.18424	-0.140000	0.14226	GCG		0.622	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387168.1	NM_003815	
MMP23B	8510	broad.mit.edu	37	1	1572313	1572313	+	IGR	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:1572313G>T	ENST00000356026.5	+	0	1326				CDK11B_ENST00000341832.6_Silent_p.T538T|CDK11B_ENST00000407249.3_Silent_p.T585T|CDK11B_ENST00000317673.7_Silent_p.T583T|CDK11B_ENST00000340677.5_Silent_p.T572T			O75900	MMP23_HUMAN	matrix metallopeptidase 23B						proteolysis (GO:0006508)|reproduction (GO:0000003)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T585T(1)		large_intestine(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	Marimastat(DB00786)	CCACGACCGGGGTGTAGGCCT	0.687																																					p.T580T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1740A	1						.						39.0	49.0	45.0					1																	1572313		2065	4188	6253	1562176	SO:0001628	intergenic_variant	984	exon16				CCDS30559.1	1p36.3	2013-01-11	2005-08-08		ENSG00000189409	ENSG00000189409		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7171	protein-coding gene	gene with protein product	"""matrix metalloproteinase 22"", ""femalysin"", ""matrix metalloproteinase in the female reproductive tract"""	603321	"""matrix metalloproteinase 23B"""	MMP22		9740677, 9750192	Standard	XM_005244810		Approved	MIFR, MIFR-1	uc001agp.3	O75900	OTTHUMG00000074713		1.37:g.1572313G>T		Somatic		Capture	Illumina HiSeq	Phase_I	1562176	NM_033486	A2AGN0|A2AGN1|O75894|O75895|Q5QPQ8|Q76P96|Q7LDM6|Q7LDM7|Q9UBR9|Q9UJK8	Silent	SNP	ENST00000356026.5	37	CCDS30559.1																																																																																				0.687	MMP23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158492.2	NM_006983	
GPATCH4	54865	broad.mit.edu	37	1	156565887	156565887	+	Silent	SNP	C	C	T	rs8937		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:156565887C>T	ENST00000438976.2	-	7	507	c.477G>A	c.(475-477)ggG>ggA	p.G159G	GPATCH4_ENST00000497287.1_5'UTR|GPATCH4_ENST00000368232.4_Silent_p.G154G			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	154							poly(A) RNA binding (GO:0044822)	p.G154G(1)		autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTGCTGTTCGCCCCTCACAGG	0.527																																					p.G159G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G477A	1						.						137.0	120.0	126.0					1																	156565887		2203	4300	6503	154832511	SO:0001819	synonymous_variant	54865	exon7			BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000438976.2:c.477G>A	1.37:g.156565887C>T		Somatic		Capture	Illumina HiSeq	Phase_I	154832511	NM_015590	Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Silent	SNP	ENST00000438976.2	37	CCDS44245.1																																																																																				0.527	GPATCH4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386947.1	NM_017725	
DDI2	84301	broad.mit.edu	37	1	15964830	15964830	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:15964830A>T	ENST00000480945.1	+	5	832	c.661A>T	c.(661-663)Ata>Tta	p.I221L		NM_032341.4	NP_115717.3	Q5TDH0	DDI2_HUMAN	DNA-damage inducible 1 homolog 2 (S. cerevisiae)	221							aspartic-type endopeptidase activity (GO:0004190)	p.I221L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|stomach(1)	17		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		AAACATGACAATAGCTATGGA	0.408																																					p.I221L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A661T	1						.						169.0	167.0	167.0					1																	15964830		2203	4300	6503	15837417	SO:0001583	missense	84301	exon5				CCDS30607.1	1p36.13	2010-05-04	2010-05-04		ENSG00000197312	ENSG00000197312			24578	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae)"""				Standard	NM_032341		Approved	MGC14844	uc001awx.2	Q5TDH0	OTTHUMG00000002381	ENST00000480945.1:c.661A>T	1.37:g.15964830A>T	ENSP00000417748:p.Ile221Leu	Somatic		Capture	Illumina HiSeq	Phase_I	15837417	NM_032341	A8KAE1|Q7RTZ0|Q9BRT1	Missense_Mutation	SNP	ENST00000480945.1	37	CCDS30607.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.713622	0.89112	.	.	ENSG00000197312	ENST00000480945	T	0.40225	1.04	5.58	5.58	0.84498	Peptidase aspartic (1);Peptidase aspartic, eukaryotic predicted (1);	0.000000	0.85682	U	0.000000	T	0.27559	0.0677	N	0.04297	-0.235	0.54753	D	0.999989	P	0.38788	0.647	P	0.44897	0.463	T	0.14783	-1.0460	10	0.10636	T	0.68	-19.2523	15.4299	0.75084	1.0:0.0:0.0:0.0	.	221	Q5TDH0	DDI2_HUMAN	L	221	ENSP00000417748:I221L	ENSP00000417748:I221L	I	+	1	0	DDI2	15837417	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.130000	0.65690	0.377000	0.23210	ATA		0.408	DDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006826.1	NM_032341	
APCS	325	broad.mit.edu	37	1	159557954	159557954	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:159557954C>T	ENST00000255040.2	+	2	225	c.128C>T	c.(127-129)aCa>aTa	p.T43I		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	43	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)	p.T43I(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					AACTTGATCACACCGCTGGAG	0.443																																					p.T43I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C128T	1						.						105.0	103.0	104.0					1																	159557954		2203	4300	6503	157824578	SO:0001583	missense	325	exon2				CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.128C>T	1.37:g.159557954C>T	ENSP00000255040:p.Thr43Ile	Somatic		Capture	Illumina HiSeq	Phase_I	157824578	NM_001639		Missense_Mutation	SNP	ENST00000255040.2	37	CCDS1186.1	.	.	.	.	.	.	.	.	.	.	C	7.485	0.649439	0.14516	.	.	ENSG00000132703	ENST00000255040	T	0.63580	-0.05	4.24	2.28	0.28536	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.385364	0.27460	N	0.019263	T	0.35970	0.0950	M	0.64997	1.995	0.09310	N	1	B	0.25390	0.125	B	0.23716	0.048	T	0.38542	-0.9656	10	0.66056	D	0.02	0.0311	6.6288	0.22845	0.1931:0.7089:0.0:0.098	.	43	P02743	SAMP_HUMAN	I	43	ENSP00000255040:T43I	ENSP00000255040:T43I	T	+	2	0	APCS	157824578	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	1.018000	0.30002	0.474000	0.27392	0.655000	0.94253	ACA		0.443	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059024.2	NM_001639	
LY9	4063	broad.mit.edu	37	1	160783637	160783637	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:160783637C>T	ENST00000263285.6	+	3	696	c.666C>T	c.(664-666)tgC>tgT	p.C222C	LY9_ENST00000471816.1_3'UTR|LY9_ENST00000368037.5_Silent_p.C222C|LY9_ENST00000341032.4_Silent_p.C222C|LY9_ENST00000392203.4_Silent_p.C222C|LY9_ENST00000368041.2_Silent_p.C182C|LY9_ENST00000368040.1_5'UTR			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	222	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.C222C(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CATACATCTGCACAGCCCAGA	0.567																																					p.C222C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C666T	1						.						196.0	188.0	191.0					1																	160783637		2203	4300	6503	159050261	SO:0001819	synonymous_variant	4063	exon3			L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.666C>T	1.37:g.160783637C>T		Somatic		Capture	Illumina HiSeq	Phase_I	159050261	NM_002348	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Silent	SNP	ENST00000263285.6	37	CCDS30916.1																																																																																				0.567	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348	
RSG1	79363	broad.mit.edu	37	1	16560232	16560232	+	Missense_Mutation	SNP	G	G	A	rs202049255		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:16560232G>A	ENST00000375599.3	-	2	559	c.140C>T	c.(139-141)cCg>cTg	p.P47L		NM_030907.3	NP_112169.2	Q9BU20	RSG1_HUMAN	REM2 and RAB-like small GTPase 1	47					cellular protein localization (GO:0034613)|cilium assembly (GO:0042384)|exocytosis (GO:0006887)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of vesicle fusion (GO:0031338)|small GTPase mediated signal transduction (GO:0007264)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)	GTP binding (GO:0005525)	p.P47L(1)		large_intestine(2)|lung(2)|pancreas(1)|prostate(1)	6						GGACACAGGCGGCAGCAGCAC	0.607													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19640	0.0		0.0	False		,,,				2504	0.0				p.P47L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C140T	1						.						58.0	54.0	55.0					1																	16560232		2203	4300	6503	16432819	SO:0001583	missense	79363	exon2			BC008702	CCDS171.1	1p36.13	2014-02-21	2011-02-22	2011-02-22	ENSG00000132881	ENSG00000132881			28127	protein-coding gene	gene with protein product	"""Rem/Rab-Similar GTPase 1"""		"""chromosome 1 open reading frame 89"""	C1orf89		19767740	Standard	NM_030907		Approved	MGC10731	uc001ayd.3	Q9BU20	OTTHUMG00000002214	ENST00000375599.3:c.140C>T	1.37:g.16560232G>A	ENSP00000364749:p.Pro47Leu	Somatic		Capture	Illumina HiSeq	Phase_I	16432819	NM_030907	Q5TEV7	Missense_Mutation	SNP	ENST00000375599.3	37	CCDS171.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	24.6	4.545700	0.86022	.	.	ENSG00000132881	ENST00000375599	T	0.57273	0.41	5.4	5.4	0.78164	.	0.056442	0.64402	D	0.000001	T	0.39064	0.1064	L	0.41710	1.295	0.80722	D	1	P	0.52316	0.952	B	0.38020	0.263	T	0.22800	-1.0206	10	0.12103	T	0.63	-19.1547	14.5384	0.67976	0.0:0.0:1.0:0.0	.	47	Q9BU20	RSG1_HUMAN	L	47	ENSP00000364749:P47L	ENSP00000364749:P47L	P	-	2	0	RSG1	16432819	1.000000	0.71417	0.953000	0.39169	0.696000	0.40369	8.682000	0.91232	2.818000	0.97014	0.655000	0.94253	CCG		0.607	RSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006279.2	NM_030907	
MGST3	4259	broad.mit.edu	37	1	165624622	165624622	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:165624622C>T	ENST00000367889.3	+	6	780	c.340C>T	c.(340-342)Cga>Tga	p.R114*	MGST3_ENST00000367883.1_Nonsense_Mutation_p.R128*|MGST3_ENST00000367884.2_Nonsense_Mutation_p.R114*|MGST3_ENST00000367886.2_Nonsense_Mutation_p.R128*|MGST3_ENST00000367888.4_Intron|MGST3_ENST00000367885.1_Nonsense_Mutation_p.R128*	NM_004528.3	NP_004519.1	O14880	MGST3_HUMAN	microsomal glutathione S-transferase 3	114					glutathione derivative biosynthetic process (GO:1901687)|lipid metabolic process (GO:0006629)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|peroxidase activity (GO:0004601)	p.R114*(1)		endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	6	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Glutathione(DB00143)	CAAGCGTAGTCGAGGAGCCCT	0.512																																					p.R114X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C340T	1						.						56.0	54.0	54.0					1																	165624622		2203	4300	6503	163891246	SO:0001587	stop_gained	4259	exon6			AF026977	CCDS1249.1	1q23	2012-06-21			ENSG00000143198	ENSG00000143198	2.5.1.18	"""Glutathione S-transferases / Microsomal"""	7064	protein-coding gene	gene with protein product	"""microsomal glutathione S-transferase III"", ""microsomal GST-3"", ""microsomal GST-III"""	604564				9278457	Standard	NM_004528		Approved	GST-III	uc001gdf.3	O14880	OTTHUMG00000034627	ENST00000367889.3:c.340C>T	1.37:g.165624622C>T	ENSP00000356864:p.Arg114*	Somatic		Capture	Illumina HiSeq	Phase_I	163891246	NM_004528	B2R592|Q6ICN4	Nonsense_Mutation	SNP	ENST00000367889.3	37	CCDS1249.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784320	0.90282	.	.	ENSG00000143198	ENST00000367889;ENST00000367885;ENST00000404549;ENST00000367884;ENST00000367883;ENST00000367886	.	.	.	5.52	4.6	0.57074	.	0.190076	0.44483	D	0.000455	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-18.6611	11.3789	0.49746	0.3291:0.6709:0.0:0.0	.	.	.	.	X	114;128;128;114;128;128	.	ENSP00000356858:R128X	R	+	1	2	MGST3	163891246	0.588000	0.26799	0.253000	0.24343	0.800000	0.45204	0.976000	0.29462	1.306000	0.44926	0.555000	0.69702	CGA		0.512	MGST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083797.3	NM_004528	
DUSP27	92235	broad.mit.edu	37	1	167097552	167097552	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:167097552T>C	ENST00000361200.2	+	6	3350	c.3184T>C	c.(3184-3186)Tgg>Cgg	p.W1062R	DUSP27_ENST00000443333.1_Missense_Mutation_p.W1062R|DUSP27_ENST00000271385.5_Missense_Mutation_p.W1062R|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1062					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.W1062R(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GCGCCCAAATTGGGCCAGGTC	0.557																																					p.W1062R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3184C	1						.						32.0	37.0	35.0					1																	167097552		2203	4300	6503	165364176	SO:0001583	missense	92235	exon5			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3184T>C	1.37:g.167097552T>C	ENSP00000354483:p.Trp1062Arg	Somatic		Capture	Illumina HiSeq	Phase_I	165364176	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	T	0.044	-1.274771	0.01410	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.02944	4.1;4.1;4.1	5.29	2.92	0.33932	.	0.146336	0.32518	N	0.005981	T	0.00906	0.0030	M	0.63428	1.95	0.28969	N	0.88936	B	0.06786	0.001	B	0.06405	0.002	T	0.50533	-0.8817	10	0.15952	T	0.53	-8.609	2.3337	0.04242	0.1437:0.0845:0.2662:0.5056	.	1062	Q5VZP5	DUS27_HUMAN	R	1062	ENSP00000354483:W1062R;ENSP00000271385:W1062R;ENSP00000404874:W1062R	ENSP00000271385:W1062R	W	+	1	0	DUSP27	165364176	0.150000	0.22732	0.361000	0.25849	0.005000	0.04900	0.294000	0.19047	0.306000	0.22856	0.448000	0.29417	TGG		0.557	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
MYOC	4653	broad.mit.edu	37	1	171605266	171605266	+	Silent	SNP	G	G	A	rs375235405		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:171605266G>A	ENST00000037502.6	-	3	1385	c.1314C>T	c.(1312-1314)acC>acT	p.T438T		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	438	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.		T -> I (in GLC1A). {ECO:0000269|PubMed:12872267}.		bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)	p.T438T(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					AGCTGCTGACGGTGTACAAGG	0.498																																					p.T438T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1314T	1						.	G		0,4406		0,0,2203	287.0	241.0	257.0		1314	-4.8	0.0	1		257	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MYOC	NM_000261.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		438/505	171605266	1,13005	2203	4300	6503	169871889	SO:0001819	synonymous_variant	4653	exon3			BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.1314C>T	1.37:g.171605266G>A		Somatic		Capture	Illumina HiSeq	Phase_I	169871889	NM_000261	B2RD84|O00620|Q7Z6Q9	Silent	SNP	ENST00000037502.6	37	CCDS1297.1																																																																																				0.498	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	NM_000261	
ANKRD45	339416	broad.mit.edu	37	1	173616055	173616055	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:173616055C>T	ENST00000333279.2	-	3	486	c.426G>A	c.(424-426)cgG>cgA	p.R142R		NM_198493.2	NP_940895.1	Q5TZF3	ANR45_HUMAN	ankyrin repeat domain 45	158								p.R142R(1)		NS(2)|endometrium(2)|large_intestine(4)|lung(3)|skin(1)	12						CCCTTTCTTCCCGGAAGTTCA	0.468																																					p.R142R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G426A	1						.						141.0	140.0	140.0					1																	173616055		2203	4300	6503	171882678	SO:0001819	synonymous_variant	339416	exon3				CCDS1309.1	1q25.1	2013-01-10			ENSG00000183831	ENSG00000183831		"""Ankyrin repeat domain containing"""	24786	protein-coding gene	gene with protein product	"""cancer/testis antigen 117"""						Standard	NM_198493		Approved	FLJ45235, CT117	uc001gja.1	Q5TZF3	OTTHUMG00000040546	ENST00000333279.2:c.426G>A	1.37:g.173616055C>T		Somatic		Capture	Illumina HiSeq	Phase_I	171882678	NM_198493	A1A4G2|Q6ZST1	Silent	SNP	ENST00000333279.2	37	CCDS1309.1																																																																																				0.468	ANKRD45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097580.2	NM_198493	
TNN	63923	broad.mit.edu	37	1	175092543	175092543	+	Silent	SNP	C	C	T	rs187781360		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:175092543C>T	ENST00000239462.4	+	12	2771	c.2658C>T	c.(2656-2658)gaC>gaT	p.D886D		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	886	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.D886D(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		AAGAAATTGACGGCCCCAAAA	0.463													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18515	0.0		0.0	False		,,,				2504	0.0				p.D886D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2658T	1						.	C		0,4406		0,0,2203	60.0	63.0	62.0		2658	4.0	1.0	1		62	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TNN	NM_022093.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		886/1300	175092543	1,13005	2203	4300	6503	173359166	SO:0001819	synonymous_variant	63923	exon12			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2658C>T	1.37:g.175092543C>T		Somatic		Capture	Illumina HiSeq	Phase_I	173359166	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	37	CCDS30943.1																																																																																				0.463	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
CEP350	9857	broad.mit.edu	37	1	179965890	179965890	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:179965890C>T	ENST00000367607.3	+	6	1016	c.598C>T	c.(598-600)Cga>Tga	p.R200*		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	200					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R200*(3)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TTTAAATGATCGACCAGCAAT	0.393																																					p.R200X												.	.	3	Substitution - Nonsense(3)	large_intestine(3)	c.C598T	1						.						80.0	73.0	76.0					1																	179965890		2203	4300	6503	178232513	SO:0001587	stop_gained	9857	exon6			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.598C>T	1.37:g.179965890C>T	ENSP00000356579:p.Arg200*	Somatic		Capture	Illumina HiSeq	Phase_I	178232513	NM_014810	O75068|Q8TDK3|Q8WY20	Nonsense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	C	38	6.781856	0.97833	.	.	ENSG00000135837	ENST00000367607;ENST00000491495	.	.	.	5.55	1.22	0.21188	.	0.176245	0.26875	N	0.022050	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1118	0.42568	0.2587:0.4027:0.3386:0.0	.	.	.	.	X	200;174	.	.	R	+	1	2	CEP350	178232513	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	0.752000	0.26362	-0.041000	0.13558	0.579000	0.79373	CGA		0.393	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
CACNA1E	777	broad.mit.edu	37	1	181759665	181759665	+	Silent	SNP	C	C	T	rs368162082	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:181759665C>T	ENST00000367573.2	+	44	5871	c.5871C>T	c.(5869-5871)gaC>gaT	p.D1957D	CACNA1E_ENST00000367567.4_Silent_p.D1564D|CACNA1E_ENST00000358338.5_Silent_p.D1889D|CACNA1E_ENST00000526775.1_Silent_p.D1938D|CACNA1E_ENST00000357570.5_Silent_p.D1908D|CACNA1E_ENST00000367570.1_Silent_p.D1957D|CACNA1E_ENST00000360108.3_Silent_p.D1938D	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1957					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.D1957D(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CCGCCGATGACGGACAGTTCC	0.473													T|||	3	0.000599042	0.0	0.0	5008	,	,		18954	0.0		0.001	False		,,,				2504	0.002				p.D1957D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5871T	1						.	T	,,	0,3790		0,0,1895	78.0	87.0	84.0		5871,5871,5814	-4.8	0.4	1		84	2,8222		0,2,4110	no	coding-synonymous,coding-synonymous,coding-synonymous	CACNA1E	NM_000721.3,NM_001205293.1,NM_001205294.1	,,	0,2,6005	TT,TC,CC		0.0243,0.0,0.0166	,,	1957/2271,1957/2314,1938/2252	181759665	2,12012	1895	4112	6007	180026288	SO:0001819	synonymous_variant	777	exon44			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5871C>T	1.37:g.181759665C>T		Somatic		Capture	Illumina HiSeq	Phase_I	180026288	NM_000721	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1																																																																																				0.473	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
HMCN1	83872	broad.mit.edu	37	1	186114925	186114925	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:186114925C>T	ENST00000271588.4	+	93	14707	c.14478C>T	c.(14476-14478)tgC>tgT	p.C4826C	HMCN1_ENST00000367492.2_Silent_p.C4826C	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4826	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.C4826C(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GGAGCCAGTGCTCTGCCTCCT	0.512																																					p.C4826C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C14478T	1						.						73.0	72.0	72.0					1																	186114925		2203	4300	6503	184381548	SO:0001819	synonymous_variant	83872	exon93			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14478C>T	1.37:g.186114925C>T		Somatic		Capture	Illumina HiSeq	Phase_I	184381548	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																				0.512	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
TROVE2	6738	broad.mit.edu	37	1	193051407	193051407	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:193051407A>G	ENST00000367446.3	+	7	1505	c.1295A>G	c.(1294-1296)cAg>cGg	p.Q432R	TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000367441.1_Missense_Mutation_p.Q432R|TROVE2_ENST00000367445.3_Missense_Mutation_p.Q432R|TROVE2_ENST00000367443.1_Missense_Mutation_p.Q432R|TROVE2_ENST00000432079.1_Missense_Mutation_p.Q157R|TROVE2_ENST00000416058.2_Missense_Mutation_p.Q157R|TROVE2_ENST00000400968.2_Missense_Mutation_p.Q432R|TROVE2_ENST00000367444.3_Missense_Mutation_p.Q432R	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2	432	VWFA-like domain. {ECO:0000250}.				cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)	p.Q432R(1)		biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						ACCTTACAACAGGTTTTAATG	0.323																																					p.Q432R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1295G	1						.						126.0	114.0	118.0					1																	193051407		1832	4091	5923	191318030	SO:0001583	missense	6738	exon7			BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.1295A>G	1.37:g.193051407A>G	ENSP00000356416:p.Gln432Arg	Somatic		Capture	Illumina HiSeq	Phase_I	191318030	NM_001173524	B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Missense_Mutation	SNP	ENST00000367446.3	37	CCDS1379.1	.	.	.	.	.	.	.	.	.	.	A	18.49	3.636303	0.67130	.	.	ENSG00000116747	ENST00000400968;ENST00000416058;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441	.	.	.	5.47	5.47	0.80525	.	0.163295	0.53938	D	0.000046	T	0.63757	0.2538	M	0.63843	1.955	0.43637	D	0.996031	P;P;P;P	0.44776	0.843;0.843;0.837;0.801	P;P;B;B	0.48770	0.589;0.589;0.334;0.197	T	0.61705	-0.7008	9	0.29301	T	0.29	-25.0376	15.846	0.78890	1.0:0.0:0.0:0.0	.	432;432;432;432	Q5LJ99;Q5LJ98;Q5LJA0;P10155	.;.;.;RO60_HUMAN	R	432;157;432;432;432;432;432	.	ENSP00000356411:Q432R	Q	+	2	0	TROVE2	191318030	1.000000	0.71417	0.988000	0.46212	0.965000	0.64279	4.984000	0.63838	2.190000	0.69967	0.528000	0.53228	CAG		0.323	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086688.1	NM_004600	
NAV1	89796	broad.mit.edu	37	1	201782299	201782299	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:201782299C>T	ENST00000367296.4	+	28	5673	c.5253C>T	c.(5251-5253)ggC>ggT	p.G1751G	NAV1_ENST00000367300.3_Silent_p.G1691G|NAV1_ENST00000367302.1_Silent_p.G1704G|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367295.1_Silent_p.G1357G|NAV1_ENST00000295624.6_Silent_p.G1748G|NAV1_ENST00000367297.4_Silent_p.G1743G	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1751					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.G1748G(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						GTCCCATTGGCATTGAGGACT	0.522																																					p.G1357G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4071T	1						.						160.0	131.0	141.0					1																	201782299		2203	4300	6503	200048922	SO:0001819	synonymous_variant	89796	exon25			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.5253C>T	1.37:g.201782299C>T		Somatic		Capture	Illumina HiSeq	Phase_I	200048922	NM_001167738	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Silent	SNP	ENST00000367296.4	37	CCDS1414.2																																																																																				0.522	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
MDM4	4194	broad.mit.edu	37	1	204515953	204515953	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:204515953T>C	ENST00000367182.3	+	10	1013	c.851T>C	c.(850-852)cTg>cCg	p.L284P	MDM4_ENST00000463049.1_3'UTR|MDM4_ENST00000391947.2_3'UTR|MDM4_ENST00000507825.2_Intron|MDM4_ENST00000367183.3_Intron|MDM4_ENST00000454264.2_Missense_Mutation_p.L234P	NM_001204171.1|NM_001278516.1|NM_001278517.1|NM_001278518.1|NM_001278519.1|NM_002393.4	NP_001191100.1|NP_001265445.1|NP_001265446.1|NP_001265447.1|NP_001265448.1|NP_002384.2	O15151	MDM4_HUMAN	MDM4, p53 regulator	284	Asp/Glu-rich (acidic).|Region II.				cell proliferation (GO:0008283)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|G0 to G1 transition (GO:0045023)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|zinc ion binding (GO:0008270)	p.L284P(1)		central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)			AATGATGACCTGGAGGACTCT	0.378			A		"""GBM, bladder, retinoblastoma"""																																p.L284P			Dom	yes		1	1q32	4194	Mdm4 p53 binding protein homolog		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T851C	1						.						129.0	123.0	125.0					1																	204515953		2203	4300	6503	202782576	SO:0001583	missense	4194	exon10			AF007111	CCDS1447.1, CCDS55674.1, CCDS55675.1, CCDS60396.1, CCDS73007.1, CCDS73008.1, CCDS73009.1	1q32	2014-03-03	2014-03-03		ENSG00000198625	ENSG00000198625			6974	protein-coding gene	gene with protein product		602704	"""mouse double minute 4, human homolog of; p53-binding protein"", ""Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)"", ""Mdm4 p53 binding protein homolog (mouse)"""			9226370, 14660608	Standard	NM_002393		Approved	MDMX, HDMX	uc001hba.3	O15151	OTTHUMG00000035877	ENST00000367182.3:c.851T>C	1.37:g.204515953T>C	ENSP00000356150:p.Leu284Pro	Somatic		Capture	Illumina HiSeq	Phase_I	202782576	NM_002393	Q2M2Y2|Q32SL2|Q6GS18|Q8IV83	Missense_Mutation	SNP	ENST00000367182.3	37	CCDS1447.1	.	.	.	.	.	.	.	.	.	.	T	8.094	0.775132	0.16051	.	.	ENSG00000198625	ENST00000367182;ENST00000454264;ENST00000367179;ENST00000444261	T;T;T;T	0.09350	2.99;2.99;2.99;2.99	5.59	3.24	0.37175	.	0.586383	0.19721	N	0.107587	T	0.07908	0.0198	L	0.29908	0.895	0.80722	D	1	B;B	0.17268	0.021;0.001	B;B	0.17979	0.02;0.002	T	0.26224	-1.0109	10	0.28530	T	0.3	-0.5163	8.1101	0.30909	0.0:0.1703:0.0:0.8297	.	284;234	O15151;Q2M2Y2	MDM4_HUMAN;.	P	284;234;169;62	ENSP00000356150:L284P;ENSP00000396840:L234P;ENSP00000356147:L169P;ENSP00000395254:L62P	ENSP00000356147:L169P	L	+	2	0	MDM4	202782576	0.030000	0.19436	0.983000	0.44433	0.175000	0.22909	0.614000	0.24314	0.477000	0.27464	-0.270000	0.10280	CTG		0.378	MDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087415.2	NM_002393	
EIF2D	1939	broad.mit.edu	37	1	206775704	206775704	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:206775704G>A	ENST00000271764.2	-	7	1096	c.888C>T	c.(886-888)caC>caT	p.H296H	EIF2D_ENST00000367114.3_Intron	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	296					formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)	p.H296H(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						AGGAGAACATGTGGCTGCCAA	0.542																																					p.H296H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C888T	1						.						114.0	94.0	101.0					1																	206775704		2203	4300	6503	204842327	SO:0001819	synonymous_variant	1939	exon7			BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.888C>T	1.37:g.206775704G>A		Somatic		Capture	Illumina HiSeq	Phase_I	204842327	NM_006893	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Silent	SNP	ENST00000271764.2	37	CCDS1465.1																																																																																				0.542	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088475.1	NM_006893	
CAMK1G	57172	broad.mit.edu	37	1	209773416	209773416	+	Missense_Mutation	SNP	C	C	T	rs145309971	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:209773416C>T	ENST00000009105.1	+	3	426	c.181C>T	c.(181-183)Cgg>Tgg	p.R61W	CAMK1G_ENST00000361322.2_Missense_Mutation_p.R61W			Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	61	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.R61W(1)		breast(2)|central_nervous_system(1)|large_intestine(8)|lung(8)|stomach(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		ACCTGCCTTCCGGGACAGCAG	0.458																																					p.R61W	Ovarian(163;530 1939 9680 28669 48710)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C181T	1						.	C	TRP/ARG	0,4406		0,0,2203	131.0	119.0	123.0		181	5.5	1.0	1	dbSNP_134	123	3,8597	3.0+/-9.4	0,3,4297	yes	missense	CAMK1G	NM_020439.2	101	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	61/477	209773416	3,13003	2203	4300	6503	207840039	SO:0001583	missense	57172	exon3				CCDS1486.1	1q32.2	2012-09-20			ENSG00000008118	ENSG00000008118			14585	protein-coding gene	gene with protein product		614994				12637513	Standard	NM_020439		Approved	VWS1, CLICKIII, dJ272L16.1	uc001hhd.3	Q96NX5	OTTHUMG00000036361	ENST00000009105.1:c.181C>T	1.37:g.209773416C>T	ENSP00000009105:p.Arg61Trp	Somatic		Capture	Illumina HiSeq	Phase_I	207840039	NM_020439	Q86UH5|Q9Y3J7	Missense_Mutation	SNP	ENST00000009105.1	37	CCDS1486.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.825615	0.71143	0.0	3.49E-4	ENSG00000008118	ENST00000009105;ENST00000423146;ENST00000361322	T;T;T	0.66280	-0.2;-0.2;-0.2	5.51	5.51	0.81932	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000113	T	0.77890	0.4198	M	0.80422	2.495	0.58432	D	0.999998	D;D	0.71674	0.998;0.998	P;P	0.61658	0.827;0.892	T	0.81072	-0.1098	10	0.87932	D	0	.	15.1542	0.72726	0.1499:0.8501:0.0:0.0	.	61;61	Q96NX5-2;Q96NX5	.;KCC1G_HUMAN	W	61	ENSP00000009105:R61W;ENSP00000392173:R61W;ENSP00000354861:R61W	ENSP00000009105:R61W	R	+	1	2	CAMK1G	207840039	0.599000	0.26891	1.000000	0.80357	0.940000	0.58332	1.094000	0.30951	2.589000	0.87451	0.563000	0.77884	CGG		0.458	CAMK1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088526.1	NM_020439	
LAMB3	3914	broad.mit.edu	37	1	209803256	209803256	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:209803256C>T	ENST00000356082.4	-	10	1092	c.958G>A	c.(958-960)Ggg>Agg	p.G320R	LAMB3_ENST00000391911.1_Missense_Mutation_p.G320R|LAMB3_ENST00000367030.3_Missense_Mutation_p.G320R	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	320	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.G320R(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TCTGAGTGCCCATTGCAGTCG	0.557																																					p.G320R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G958A	1						.						79.0	74.0	76.0					1																	209803256		2203	4300	6503	207869879	SO:0001583	missense	3914	exon9			D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.958G>A	1.37:g.209803256C>T	ENSP00000348384:p.Gly320Arg	Somatic		Capture	Illumina HiSeq	Phase_I	207869879	NM_001017402	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	37	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918628	0.73098	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.66995	-0.24;-0.24;-0.24	5.66	5.66	0.87406	EGF-like, laminin (3);	0.237278	0.46145	D	0.000320	T	0.81254	0.4784	M	0.81112	2.525	0.36964	D	0.8935	D	0.89917	1.0	D	0.81914	0.995	D	0.84864	0.0821	10	0.52906	T	0.07	.	12.7192	0.57131	0.0:0.9242:0.0:0.0758	.	320	Q13751	LAMB3_HUMAN	R	320	ENSP00000375778:G320R;ENSP00000348384:G320R;ENSP00000355997:G320R	ENSP00000348384:G320R	G	-	1	0	LAMB3	207869879	0.276000	0.24211	0.919000	0.36401	0.934000	0.57294	2.354000	0.44098	2.687000	0.91594	0.650000	0.86243	GGG		0.557	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228	
FLVCR1	28982	broad.mit.edu	37	1	213062509	213062509	+	Silent	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:213062509T>C	ENST00000366971.4	+	8	1633	c.1435T>C	c.(1435-1437)Ttg>Ctg	p.L479L	FLVCR1_ENST00000483790.1_3'UTR	NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1	479					blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)	p.L479L(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		TTTGTTCACATTGGCTCAAGG	0.313																																					p.L479L	Esophageal Squamous(199;2235 2952 19233 26256)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1435C	1						.						119.0	117.0	118.0					1																	213062509		2203	4300	6503	211129132	SO:0001819	synonymous_variant	28982	exon8			AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	ENST00000366971.4:c.1435T>C	1.37:g.213062509T>C		Somatic		Capture	Illumina HiSeq	Phase_I	211129132	NM_014053	Q1HE16|Q86XY9|Q9NVR9	Silent	SNP	ENST00000366971.4	37	CCDS1510.1																																																																																				0.313	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089678.2	NM_014053	
MARK1	4139	broad.mit.edu	37	1	220773171	220773171	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:220773171G>A	ENST00000366917.4	+	5	656	c.390G>A	c.(388-390)aaG>aaA	p.K130K	MARK1_ENST00000366918.4_Intron|MARK1_ENST00000402574.1_5'UTR					MAP/microtubule affinity-regulating kinase 1									p.K130K(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		AAACAGAGAAGACTCTCTATT	0.323																																					p.K130K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G390A	1						.						94.0	96.0	96.0					1																	220773171		1804	4067	5871	218839794	SO:0001819	synonymous_variant	4139	exon5			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.390G>A	1.37:g.220773171G>A		Somatic		Capture	Illumina HiSeq	Phase_I	218839794	NM_018650		Silent	SNP	ENST00000366917.4	37	CCDS31029.2																																																																																				0.323	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1		
DUSP10	11221	broad.mit.edu	37	1	221912321	221912321	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:221912321G>T	ENST00000366899.3	-	2	1004	c.766C>A	c.(766-768)Ctc>Atc	p.L256I	DUSP10_ENST00000468085.1_5'Flank|DUSP10_ENST00000323825.3_Intron|DUSP10_ENST00000544095.1_5'Flank	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	256	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L256I(1)		NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		AGGGACTCGAGGACTATGTGA	0.483																																					p.L256I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C766A	1						.						159.0	167.0	164.0					1																	221912321		2203	4300	6503	219978944	SO:0001583	missense	11221	exon2			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.766C>A	1.37:g.221912321G>T	ENSP00000355866:p.Leu256Ile	Somatic		Capture	Illumina HiSeq	Phase_I	219978944	NM_007207	D3DTB4|Q6GSI4|Q9H9Z5	Missense_Mutation	SNP	ENST00000366899.3	37	CCDS1528.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639777	0.67244	.	.	ENSG00000143507	ENST00000366899;ENST00000418487	T	0.36878	1.23	5.86	4.94	0.65067	Rhodanese-like (5);	0.000000	0.64402	D	0.000001	T	0.52435	0.1734	M	0.62016	1.91	0.80722	D	1	P	0.47762	0.9	P	0.59595	0.86	T	0.50684	-0.8799	10	0.59425	D	0.04	.	12.6839	0.56936	0.1295:0.0:0.8705:0.0	.	256	Q9Y6W6	DUS10_HUMAN	I	256;201	ENSP00000355866:L256I	ENSP00000355866:L256I	L	-	1	0	DUSP10	219978944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.778000	0.62368	2.778000	0.95560	0.655000	0.94253	CTC		0.483	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090716.1	NM_007207	
ACTA1	58	broad.mit.edu	37	1	229568798	229568798	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:229568798C>T	ENST00000366684.3	-	2	167	c.65G>A	c.(64-66)gGc>gAc	p.G22D	ACTA1_ENST00000366683.2_Missense_Mutation_p.G22D	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	22					cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)	p.G22D(1)		endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				CCCGGCGAAGCCGGCTTTCAC	0.677																																					p.G22D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G65A	1						.						49.0	52.0	51.0					1																	229568798		2203	4300	6503	227635421	SO:0001583	missense	58	exon2			J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.65G>A	1.37:g.229568798C>T	ENSP00000355645:p.Gly22Asp	Somatic		Capture	Illumina HiSeq	Phase_I	227635421	NM_001100	P02568|P99020|Q5T8M9	Missense_Mutation	SNP	ENST00000366684.3	37	CCDS1578.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.190935	0.38707	.	.	ENSG00000143632	ENST00000366684;ENST00000308794;ENST00000366683;ENST00000366682;ENST00000342787	D;D	0.99730	-6.56;-6.56	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	D	0.99902	0.9953	H	0.99991	5.335	0.42926	D	0.994305	D	0.89917	1.0	D	0.91635	0.999	D	0.95668	0.8721	10	0.87932	D	0	.	16.4956	0.84242	0.0:1.0:0.0:0.0	.	22	P68133	ACTS_HUMAN	D	22	ENSP00000355645:G22D;ENSP00000355644:G22D	ENSP00000312351:G22D	G	-	2	0	ACTA1	227635421	1.000000	0.71417	1.000000	0.80357	0.056000	0.15407	7.638000	0.83328	2.419000	0.82065	0.655000	0.94253	GGC		0.677	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092781.1	NM_001100	
NUP133	55746	broad.mit.edu	37	1	229613368	229613368	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:229613368G>A	ENST00000261396.3	-	13	1823	c.1732C>T	c.(1732-1734)Cgg>Tgg	p.R578W	NUP133_ENST00000537506.1_Missense_Mutation_p.R562W	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	578					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.R578W(1)		NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				TCAGCCCACCGTGGGTCAGAT	0.433																																					p.R578W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1732T	1						.						79.0	71.0	74.0					1																	229613368		2203	4300	6503	227679991	SO:0001583	missense	55746	exon13				CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.1732C>T	1.37:g.229613368G>A	ENSP00000261396:p.Arg578Trp	Somatic		Capture	Illumina HiSeq	Phase_I	227679991	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	37	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717535	0.89205	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.49432	0.97;0.78;0.98	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.69993	0.3173	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72204	-0.4361	10	0.54805	T	0.06	-21.7906	15.2438	0.73490	0.0:0.0:0.851:0.149	.	578	Q8WUM0	NU133_HUMAN	W	578;578;578;562	ENSP00000261396:R578W;ENSP00000355640:R578W;ENSP00000443496:R562W	ENSP00000261396:R578W	R	-	1	2	NUP133	227679991	1.000000	0.71417	0.865000	0.33974	0.995000	0.86356	4.181000	0.58303	2.683000	0.91414	0.655000	0.94253	CGG		0.433	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
NID1	4811	broad.mit.edu	37	1	236189231	236189231	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:236189231C>T	ENST00000264187.6	-	8	2031	c.1949G>A	c.(1948-1950)cGc>cAc	p.R650H	NID1_ENST00000366595.3_Missense_Mutation_p.R650H	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	650	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.R650H(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GAGAGCATAGCGCAAGATCTT	0.567																																					p.R650H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1949A	1						.						212.0	192.0	199.0					1																	236189231		2203	4300	6503	234255854	SO:0001583	missense	4811	exon8			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1949G>A	1.37:g.236189231C>T	ENSP00000264187:p.Arg650His	Somatic		Capture	Illumina HiSeq	Phase_I	234255854	NM_002508	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	ENST00000264187.6	37	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.029807	0.93518	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.27890	1.64;1.64	5.02	5.02	0.67125	G2 nidogen/fibulin G2F (2);Green fluorescent protein-like (1);	0.000000	0.85682	D	0.000000	T	0.61085	0.2319	M	0.84219	2.685	0.54753	D	0.999984	D;D	0.89917	1.0;0.998	D;P	0.91635	0.999;0.729	T	0.67035	-0.5772	10	0.87932	D	0	.	18.5244	0.90967	0.0:1.0:0.0:0.0	.	650;650	P14543-2;P14543	.;NID1_HUMAN	H	650	ENSP00000264187:R650H;ENSP00000355554:R650H	ENSP00000264187:R650H	R	-	2	0	NID1	234255854	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.213000	0.77950	2.600000	0.87896	0.655000	0.94253	CGC		0.567	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	
ACTN2	88	broad.mit.edu	37	1	236906323	236906323	+	Missense_Mutation	SNP	C	C	T	rs139515659	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:236906323C>T	ENST00000366578.4	+	11	1401	c.1235C>T	c.(1234-1236)aCg>aTg	p.T412M	ACTN2_ENST00000546208.1_5'UTR|ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.T412M	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	412					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.T412M(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			AAGGCCTCAACGCACGAGACT	0.507																																					p.T412M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1235T	1						.	C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	101.0	92.0	95.0		1235	5.5	0.1	1	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ACTN2	NM_001103.2	81	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	412/895	236906323	2,13004	2203	4300	6503	234972946	SO:0001583	missense	88	exon11			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1235C>T	1.37:g.236906323C>T	ENSP00000355537:p.Thr412Met	Somatic		Capture	Illumina HiSeq	Phase_I	234972946	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	C	9.020	0.984687	0.18889	2.27E-4	1.16E-4	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.50813	0.73;0.73	5.47	5.47	0.80525	.	1.092340	0.06795	N	0.787705	T	0.28632	0.0709	N	0.03917	-0.325	0.40966	D	0.984666	B;B;B;B	0.31241	0.053;0.031;0.315;0.009	B;B;B;B	0.21917	0.014;0.012;0.037;0.002	T	0.08289	-1.0729	10	0.56958	D	0.05	.	12.9802	0.58559	0.0:0.9258:0.0:0.0742	.	197;412;182;412	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	M	412;412;181	ENSP00000443495:T412M;ENSP00000355537:T412M	ENSP00000355537:T412M	T	+	2	0	ACTN2	234972946	0.002000	0.14202	0.080000	0.20451	0.234000	0.25298	0.675000	0.25232	2.721000	0.93114	0.655000	0.94253	ACG		0.507	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
CCDC27	148870	broad.mit.edu	37	1	3680346	3680346	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:3680346G>A	ENST00000294600.2	+	8	1482	c.1398G>A	c.(1396-1398)acG>acA	p.T466T		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	466								p.T466T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		AAAATGAGACGCTGCAGAAGG	0.577																																					p.T466T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1398A	1						.						72.0	70.0	71.0					1																	3680346		2203	4300	6503	3670206	SO:0001819	synonymous_variant	148870	exon8				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.1398G>A	1.37:g.3680346G>A		Somatic		Capture	Illumina HiSeq	Phase_I	3670206	NM_152492	Q5TBV3|Q96M50	Silent	SNP	ENST00000294600.2	37	CCDS50.1																																																																																				0.577	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009740.1	NM_152492	
CEP104	9731	broad.mit.edu	37	1	3761503	3761503	+	Silent	SNP	G	G	A	rs201775417		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:3761503G>A	ENST00000378230.3	-	6	858	c.534C>T	c.(532-534)agC>agT	p.S178S	CEP104_ENST00000378223.3_Silent_p.S178S	NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	178						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)	p.S178S(2)		breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						CAGGGTCCTCGCTGTTGTGCC	0.478													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16536	0.0		0.0	False		,,,				2504	0.0				p.S178S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C534T	1						.						120.0	102.0	108.0					1																	3761503		2203	4300	6503	3751363	SO:0001819	synonymous_variant	9731	exon6			AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.534C>T	1.37:g.3761503G>A		Somatic		Capture	Illumina HiSeq	Phase_I	3751363	NM_014704	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Silent	SNP	ENST00000378230.3	37	CCDS30571.1																																																																																				0.478	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704	
IFNLR1	163702	broad.mit.edu	37	1	24495969	24495969	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:24495969G>A	ENST00000327535.1	-	3	317	c.305C>T	c.(304-306)aCg>aTg	p.T102M	IFNLR1_ENST00000374419.1_Missense_Mutation_p.T19M|IFNLR1_ENST00000374421.3_Missense_Mutation_p.T102M|IFNLR1_ENST00000327575.2_Missense_Mutation_p.T102M|IFNLR1_ENST00000374418.3_Missense_Mutation_p.T102M	NM_170743.3|NM_173064.2	NP_734464.1|NP_775087.1	Q8IU57	INLR1_HUMAN	interferon, lambda receptor 1	102	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mucosal immune response (GO:0002385)|negative regulation of cell proliferation (GO:0008285)|regulation of defense response to virus by host (GO:0050691)|response to type III interferon (GO:0034342)	integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)		p.T102M(1)									GGGAGAAACCGTCCGCACGCG	0.542																																					p.T102M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C305T	1						.						100.0	94.0	96.0					1																	24495969		2203	4300	6503	24368556	SO:0001583	missense	163702	exon3			AY129153	CCDS248.1, CCDS249.1, CCDS250.1	1p36.11	2012-11-27	2012-11-26	2012-11-26	ENSG00000185436	ENSG00000185436		"""Interferons"""	18584	protein-coding gene	gene with protein product	"""interferon lambda receptor 1"""	607404	"""interleukin 28 receptor, alpha"", ""interleukin 28 receptor, alpha (interferon, lambda receptor)"""	IL28RA			Standard	NM_173064		Approved	CRF2/12, IFNLR, IL-28R1	uc001bis.3	Q8IU57	OTTHUMG00000003036	ENST00000327535.1:c.305C>T	1.37:g.24495969G>A	ENSP00000327824:p.Thr102Met	Somatic		Capture	Illumina HiSeq	Phase_I	24368556	NM_170743	Q5VTX5|Q5VTX7|Q5VTX8|Q6ZML8|Q8IV66|Q8IZI7|Q8IZI8	Missense_Mutation	SNP	ENST00000327535.1	37	CCDS248.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650233	0.47362	.	.	ENSG00000185436	ENST00000327535;ENST00000327575;ENST00000374421;ENST00000374419;ENST00000374418	T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79	5.41	3.52	0.40303	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.291914	0.37393	N	0.002115	T	0.77274	0.4106	L	0.38175	1.15	0.09310	N	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	P;D;D;D	0.74348	0.839;0.983;0.974;0.934	T	0.66991	-0.5783	10	0.72032	D	0.01	-8.2027	8.5986	0.33732	0.1795:0.0:0.8205:0.0	.	102;102;102;102	Q8IU57-3;Q8IV66;Q8IU57;Q8IU57-2	.;.;I28RA_HUMAN;.	M	102;102;102;19;102	ENSP00000327824:T102M;ENSP00000328994:T102M;ENSP00000363542:T102M;ENSP00000363539:T102M	ENSP00000327824:T102M	T	-	2	0	IL28RA	24368556	0.024000	0.19004	0.007000	0.13788	0.001000	0.01503	0.965000	0.29319	0.647000	0.30713	0.655000	0.94253	ACG		0.542	IFNLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008402.1	NM_170743	
FAM76A	199870	broad.mit.edu	37	1	28060666	28060666	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:28060666C>T	ENST00000373954.6	+	4	428	c.326C>T	c.(325-327)gCa>gTa	p.A109V	FAM76A_ENST00000419687.2_Intron|FAM76A_ENST00000010299.6_Missense_Mutation_p.A143V|FAM76A_ENST00000530324.1_Missense_Mutation_p.A109V|FAM76A_ENST00000234549.7_Missense_Mutation_p.A143V|FAM76A_ENST00000373949.1_Missense_Mutation_p.A109V	NM_001143912.1|NM_152660.2	NP_001137384.1|NP_689873.1	Q8TAV0	FA76A_HUMAN	family with sequence similarity 76, member A	109								p.A109V(1)		endometrium(4)|kidney(2)|large_intestine(1)|lung(2)	9		Colorectal(325;0.000147)|all_lung(284;0.00181)|Lung NSC(340;0.00278)|Renal(390;0.00357)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00253)|KIRC - Kidney renal clear cell carcinoma(1967;0.00292)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCAGTGTGCATTTGACAGG	0.363																																					p.A143V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C428T	1						.						102.0	99.0	100.0					1																	28060666		2203	4300	6503	27933253	SO:0001583	missense	199870	exon5			AK098318	CCDS309.1, CCDS44092.1, CCDS44093.1, CCDS44094.1, CCDS44095.1	1p35.3	2008-02-05			ENSG00000009780	ENSG00000009780			28530	protein-coding gene	gene with protein product							Standard	NM_001143912		Approved	MGC34648	uc001bor.3	Q8TAV0	OTTHUMG00000003729	ENST00000373954.6:c.326C>T	1.37:g.28060666C>T	ENSP00000363065:p.Ala109Val	Somatic		Capture	Illumina HiSeq	Phase_I	27933253	NM_001143913	B4DWT3|O95565|O95566|Q8N7J5	Missense_Mutation	SNP	ENST00000373954.6	37	CCDS309.1	.	.	.	.	.	.	.	.	.	.	C	36	5.747867	0.96882	.	.	ENSG00000009780	ENST00000373954;ENST00000530324;ENST00000234549;ENST00000373949;ENST00000010299	T;T	0.57273	0.61;0.41	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000004	T	0.72518	0.3470	M	0.78049	2.395	0.80722	D	1	D;P;P;D;D	0.58268	0.967;0.814;0.95;0.982;0.967	P;P;B;P;P	0.60789	0.879;0.731;0.384;0.841;0.841	T	0.74633	-0.3600	10	0.87932	D	0	0.1071	19.3309	0.94288	0.0:1.0:0.0:0.0	.	109;109;143;143;109	E9PQL1;Q8TAV0-2;Q8TAV0-4;Q8TAV0-3;Q8TAV0	.;.;.;.;FA76A_HUMAN	V	109;109;143;109;143	ENSP00000234549:A143V;ENSP00000010299:A143V	ENSP00000010299:A143V	A	+	2	0	FAM76A	27933253	1.000000	0.71417	0.978000	0.43139	0.999000	0.98932	7.772000	0.85439	2.880000	0.98712	0.650000	0.86243	GCA		0.363	FAM76A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000010514.3	NM_152660	
RHBDL2	54933	broad.mit.edu	37	1	39361719	39361719	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:39361719A>G	ENST00000289248.2	-	5	1539	c.531T>C	c.(529-531)ttT>ttC	p.F177F	RP5-864K19.4_ENST00000433671.2_RNA|RHBDL2_ENST00000372990.1_Silent_p.F177F|RHBDL2_ENST00000372985.3_Silent_p.F257F|RHBDL2_ENST00000538156.1_Silent_p.F244F			Q9NX52	RHBL2_HUMAN	rhomboid, veinlet-like 2 (Drosophila)	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.F177F(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	8	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			TGAGTGGGTCAAAGATGGAGC	0.428																																					p.F177F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T531C	1						.						57.0	57.0	57.0					1																	39361719		2203	4300	6503	39134306	SO:0001819	synonymous_variant	54933	exon5			AK000442	CCDS30680.1	1p35.1	2014-01-28	2001-11-28		ENSG00000158315	ENSG00000158315			16083	protein-coding gene	gene with protein product		608962	"""rhomboid (veinlet, Drosophila)-like 2"""				Standard	NM_017821		Approved	FLJ20435	uc001ccu.1	Q9NX52	OTTHUMG00000000487	ENST00000289248.2:c.531T>C	1.37:g.39361719A>G		Somatic		Capture	Illumina HiSeq	Phase_I	39134306	NM_017821	B2RNT3|B9EH75|Q6P175|Q8NER8|Q96E02	Silent	SNP	ENST00000289248.2	37	CCDS30680.1																																																																																				0.428	RHBDL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001216.1	NM_017821	
KIAA0754	643314	broad.mit.edu	37	1	39879289	39879289	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:39879289G>A	ENST00000530275.1	+	1	3139	c.2944G>A	c.(2944-2946)Gcc>Acc	p.A982T	MACF1_ENST00000289893.4_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000567887.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	982	Ala-rich.									central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAGGAGCCCGCCTCCCCAGC	0.721																																					p.A1118T												.	.	0			c.G3352A	1						.						5.0	7.0	6.0					1																	39879289		1733	3912	5645	39651876	SO:0001583	missense	643314	exon1					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2944G>A	1.37:g.39879289G>A	ENSP00000431179:p.Ala982Thr	None		Capture	Illumina HiSeq	Phase_I	39651876	NM_015038	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37		.	.	.	.	.	.	.	.	.	.	G	11.36	1.616131	0.28801	.	.	ENSG00000255103	ENST00000530275	T	0.24350	1.86	5.38	1.21	0.21127	.	.	.	.	.	T	0.12008	0.0292	N	0.14661	0.345	0.09310	N	1	B	0.23490	0.086	B	0.15052	0.012	T	0.37056	-0.9722	9	0.11182	T	0.66	.	7.8976	0.29715	0.4558:0.0:0.5442:0.0	.	982	O94854	K0754_HUMAN	T	982	ENSP00000431179:A982T	ENSP00000431179:A982T	A	+	1	0	RP4-562N20.1	39651876	0.000000	0.05858	0.001000	0.08648	0.145000	0.21501	-1.540000	0.02200	-0.011000	0.14247	0.491000	0.48974	GCC		0.721	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038	
KLF17	128209	broad.mit.edu	37	1	44596342	44596342	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:44596342C>T	ENST00000372299.3	+	3	1142	c.1084C>T	c.(1084-1086)Cag>Tag	p.Q362*	KLF17_ENST00000476802.1_3'UTR	NM_173484.3	NP_775755.3	Q5JT82	KLF17_HUMAN	Kruppel-like factor 17	362					gamete generation (GO:0007276)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q362*(1)		NS(1)|breast(2)|central_nervous_system(1)|large_intestine(1)|lung(6)|ovary(3)|prostate(1)|skin(2)|stomach(1)	18	Acute lymphoblastic leukemia(166;0.155)					CAAGCAACACCAGAAGACTCA	0.532																																					p.Q362X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1084T	1						.						126.0	109.0	115.0					1																	44596342		2203	4300	6503	44368929	SO:0001587	stop_gained	128209	exon3			BC049844	CCDS508.1	1p34.1	2011-11-15	2006-02-17	2006-02-17	ENSG00000171872	ENSG00000171872		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	18830	protein-coding gene	gene with protein product		609602	"""zinc finger protein 393"""	ZNF393		16460907	Standard	NM_173484		Approved	Zfp393, FLJ40160	uc001clp.3	Q5JT82	OTTHUMG00000009664	ENST00000372299.3:c.1084C>T	1.37:g.44596342C>T	ENSP00000361373:p.Gln362*	Somatic		Capture	Illumina HiSeq	Phase_I	44368929	NM_173484	Q86VQ7|Q8N805	Nonsense_Mutation	SNP	ENST00000372299.3	37	CCDS508.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372931	0.61624	.	.	ENSG00000171872	ENST00000372299	.	.	.	4.34	-0.0542	0.13815	.	0.489229	0.17280	N	0.180037	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.7045	0.23242	0.3415:0.3471:0.3114:0.0	.	.	.	.	X	362	.	ENSP00000361373:Q362X	Q	+	1	0	KLF17	44368929	0.995000	0.38212	0.214000	0.23707	0.404000	0.30871	0.827000	0.27421	0.009000	0.14813	0.462000	0.41574	CAG		0.532	KLF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026646.1	NM_173484	
LRRC41	10489	broad.mit.edu	37	1	46751268	46751268	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:46751268C>T	ENST00000343304.6	-	4	1546	c.1261G>A	c.(1261-1263)Gct>Act	p.A421T	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	421					protein ubiquitination (GO:0016567)	membrane (GO:0016020)		p.A421T(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TTCTCGCCAGCCACAATAAAA	0.562																																					p.A421T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1261A	1						.						99.0	94.0	95.0					1																	46751268		2203	4300	6503	46523855	SO:0001583	missense	10489	exon4			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.1261G>A	1.37:g.46751268C>T	ENSP00000343298:p.Ala421Thr	Somatic		Capture	Illumina HiSeq	Phase_I	46523855	NM_006369	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	ENST00000343304.6	37	CCDS533.1	.	.	.	.	.	.	.	.	.	.	c	19.66	3.868806	0.72065	.	.	ENSG00000132128	ENST00000343304;ENST00000371972	T	0.57273	0.41	5.16	5.16	0.70880	.	0.090332	0.47852	D	0.000217	T	0.56411	0.1983	N	0.19112	0.55	0.34118	D	0.663738	D;D;D	0.71674	0.998;0.998;0.995	P;D;P	0.66351	0.882;0.943;0.882	T	0.68300	-0.5445	10	0.56958	D	0.05	-5.282	14.3379	0.66603	0.0:0.8518:0.1482:0.0	.	421;399;421	Q15345-3;E9PE58;Q15345	.;.;LRC41_HUMAN	T	421;399	ENSP00000343298:A421T	ENSP00000343298:A421T	A	-	1	0	LRRC41	46523855	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	3.420000	0.52735	2.424000	0.82194	0.450000	0.29827	GCT		0.562	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021438.1	NM_006369	
MOB3C	148932	broad.mit.edu	37	1	47078581	47078581	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:47078581C>T	ENST00000319928.3	-	2	643	c.413G>A	c.(412-414)cGt>cAt	p.R138H	MKNK1_ENST00000545730.1_Intron|MOB3C_ENST00000477318.1_5'UTR|MOB3C_ENST00000271139.8_Missense_Mutation_p.R190H|MOB3C_ENST00000371940.1_Missense_Mutation_p.R161H	NM_201403.2	NP_958805.1	Q70IA8	MOB3C_HUMAN	MOB kinase activator 3C	138							metal ion binding (GO:0046872)	p.R190H(1)									CTCACCAACACGCGTGGGAAA	0.577																																					p.R190H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G569A	1						.						34.0	38.0	37.0					1																	47078581		2183	4291	6474	46851168	SO:0001583	missense	148932	exon2			AK091808	CCDS539.1, CCDS540.1	1p34.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000142961	ENSG00000142961		"""MOB kinase activators"""	29800	protein-coding gene	gene with protein product			"""MOB1, Mps One Binder kinase activator-like 2C (yeast)"""	MOBKL2C		12477932	Standard	NM_145279		Approved	MOB1E	uc001cqe.4	Q70IA8	OTTHUMG00000007989	ENST00000319928.3:c.413G>A	1.37:g.47078581C>T	ENSP00000315113:p.Arg138His	Somatic		Capture	Illumina HiSeq	Phase_I	46851168	NM_145279	D3DQ22|Q0VA98|Q5TC10|Q5TC11|Q8NAZ2|Q8NF28	Missense_Mutation	SNP	ENST00000319928.3	37	CCDS540.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.758726	0.69763	.	.	ENSG00000142961	ENST00000319928;ENST00000271139;ENST00000371940	.	.	.	5.26	4.14	0.48551	.	0.048730	0.85682	D	0.000000	T	0.57636	0.2067	L	0.56124	1.755	0.58432	D	0.999999	B	0.09022	0.002	B	0.10450	0.005	T	0.60052	-0.7338	9	0.59425	D	0.04	-15.8032	13.8511	0.63496	0.0:0.9122:0.0:0.0878	.	138	Q70IA8	MOB3C_HUMAN	H	138;190;161	.	ENSP00000271139:R190H	R	-	2	0	MOBKL2C	46851168	1.000000	0.71417	0.978000	0.43139	0.971000	0.66376	6.056000	0.71111	2.462000	0.83206	0.557000	0.71058	CGT		0.577	MOB3C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145279	
CYP4B1	1580	broad.mit.edu	37	1	47280904	47280904	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:47280904C>T	ENST00000271153.4	+	8	1074	c.1038C>T	c.(1036-1038)cgC>cgT	p.R346R	CYP4B1_ENST00000452782.2_Silent_p.R184R|CYP4B1_ENST00000371919.4_Silent_p.R332R|CYP4B1_ENST00000371923.4_Silent_p.R347R			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	346					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.R346R(2)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	AGGAGGTCCGCGAGATCCTAG	0.582																																					p.R347R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1041T	1						.						96.0	82.0	87.0					1																	47280904		2203	4300	6503	47053491	SO:0001819	synonymous_variant	1580	exon8			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.1038C>T	1.37:g.47280904C>T		Somatic		Capture	Illumina HiSeq	Phase_I	47053491	NM_001099772	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Silent	SNP	ENST00000271153.4	37	CCDS542.1																																																																																				0.582	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
DAB1	1600	broad.mit.edu	37	1	57602312	57602312	+	Silent	SNP	G	G	A	rs143307821		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:57602312G>A	ENST00000371231.1	-	3	244	c.210C>T	c.(208-210)ggC>ggT	p.G70G	DAB1_ENST00000371236.2_Silent_p.G70G|DAB1_ENST00000439789.2_Silent_p.G70G|DAB1_ENST00000371234.4_Silent_p.G70G|DAB1_ENST00000420954.2_Silent_p.G70G|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371230.1_Silent_p.G70G|DAB1_ENST00000414851.2_Silent_p.G70G			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	70	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.G70G(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CAGCAACAACGCCCTGTTGAA	0.408																																					p.G70G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C210T	1						.	G		0,4406		0,0,2203	61.0	60.0	60.0		210	-2.6	1.0	1	dbSNP_134	60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DAB1	NM_021080.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		70/556	57602312	1,13005	2203	4300	6503	57374900	SO:0001819	synonymous_variant	1600	exon6			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.210C>T	1.37:g.57602312G>A		Somatic		Capture	Illumina HiSeq	Phase_I	57374900	NM_021080	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Silent	SNP	ENST00000371231.1	37																																																																																					0.408	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080	
TNNI3K	51086	broad.mit.edu	37	1	75009632	75009632	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:75009632G>A	ENST00000326637.3	+	25	2525	c.2474G>A	c.(2473-2475)tGc>tAc	p.C825Y	TNNI3K_ENST00000465473.1_3'UTR|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.C939Y|TNNI3K_ENST00000370891.2_Missense_Mutation_p.C926Y	NM_015978.2	NP_057062.1			TNNI3 interacting kinase									p.C825Y(1)		cervix(1)|endometrium(3)|kidney(5)|large_intestine(21)|lung(31)|ovary(4)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	76						TTTCATTCTTGCCGAAATAGT	0.453																																					p.C825Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2474A	1						.						139.0	117.0	124.0					1																	75009632		2203	4300	6503	74782220	SO:0001583	missense	51086	exon25			AF116826	CCDS664.1, CCDS44161.1	1p31.1	2014-09-17				ENSG00000116783			19661	protein-coding gene	gene with protein product		613932				12721663	Standard	NM_015978		Approved	CARK		Q59H18	OTTHUMG00000171318	ENST00000326637.3:c.2474G>A	1.37:g.75009632G>A	ENSP00000322251:p.Cys825Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	74782220	NM_015978		Missense_Mutation	SNP	ENST00000326637.3	37	CCDS664.1	.	.	.	.	.	.	.	.	.	.	G	4.055	0.007970	0.07866	.	.	ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000557284;ENST00000370891;ENST00000326637	T;T;T	0.73897	-0.79;-0.79;-0.77	5.32	3.33	0.38152	.	0.410669	0.26753	N	0.022665	T	0.41096	0.1144	N	0.24115	0.695	0.31554	N	0.658441	B;B	0.16802	0.011;0.019	B;B	0.16722	0.004;0.016	T	0.14420	-1.0473	10	0.25751	T	0.34	.	9.8163	0.40853	0.0:0.1483:0.6994:0.1523	.	825;926	Q59H18;Q59H18-1	TNI3K_HUMAN;.	Y	926;926;825	ENSP00000450895:C926Y;ENSP00000359928:C926Y;ENSP00000322251:C825Y	ENSP00000322251:C825Y	C	+	2	0	RP11-653A5.2;AC093158.1	74782220	1.000000	0.71417	0.993000	0.49108	0.309000	0.27889	3.234000	0.51320	2.648000	0.89879	0.561000	0.74099	TGC		0.453	TNNI3K-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026432.1	NM_015978	
CRYZ	1429	broad.mit.edu	37	1	75188919	75188919	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:75188919G>A	ENST00000340866.5	-	3	234	c.147C>T	c.(145-147)ccC>ccT	p.P49P	CRYZ_ENST00000370872.3_5'UTR|CRYZ_ENST00000370871.3_Silent_p.P49P|CRYZ_ENST00000417775.1_Silent_p.P49P	NM_001889.3	NP_001880.2	Q08257	QOR_HUMAN	crystallin, zeta (quinone reductase)	49					protein homotetramerization (GO:0051289)|visual perception (GO:0007601)|xenobiotic catabolic process (GO:0042178)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	mRNA 3'-UTR binding (GO:0003730)|NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)	p.P49P(1)		NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)	10					Dicoumarol(DB00266)	ATGTCTCCACGGGGTTGACAC	0.418																																					p.P49P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C147T	1						.						176.0	156.0	162.0					1																	75188919		2203	4300	6503	74961507	SO:0001819	synonymous_variant	1429	exon3				CCDS665.1, CCDS44162.1, CCDS44163.1	1p31.1	2013-02-14			ENSG00000116791	ENSG00000116791			2419	protein-coding gene	gene with protein product		123691					Standard	NM_001889		Approved		uc001dgj.3	Q08257	OTTHUMG00000009620	ENST00000340866.5:c.147C>T	1.37:g.75188919G>A		Somatic		Capture	Illumina HiSeq	Phase_I	74961507	NM_001889	A6NN60|D3DQ76|Q53FT0|Q59EU7|Q5HYE7|Q6NSK9	Silent	SNP	ENST00000340866.5	37	CCDS665.1																																																																																				0.418	CRYZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026514.1		
PLD5	200150	broad.mit.edu	37	1	242451790	242451790	+	Silent	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr1:242451790T>C	ENST00000536534.2	-	3	610	c.369A>G	c.(367-369)tcA>tcG	p.S123S	PLD5_ENST00000442594.2_Silent_p.S31S|PLD5_ENST00000427495.1_Silent_p.S61S			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	123						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.S31S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			GTGCATTTTCTGAATAGTTAA	0.363																																					p.S61S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A183G	1						.						55.0	52.0	53.0					1																	242451790		2203	4293	6496	240518413	SO:0001819	synonymous_variant	200150	exon3			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.369A>G	1.37:g.242451790T>C		Somatic		Capture	Illumina HiSeq	Phase_I	240518413	NM_001195811	A1KXV0|B7Z324|Q494U9|Q8NB22	Silent	SNP	ENST00000536534.2	37	CCDS1621.2																																																																																				0.363	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	
SNX5	27131	broad.mit.edu	37	20	17928269	17928269	+	Silent	SNP	G	G	A	rs373050708	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:17928269G>A	ENST00000377768.3	-	12	1251	c.939C>T	c.(937-939)acC>acT	p.T313T	SNX5_ENST00000377759.4_Silent_p.T313T|SNX5_ENST00000483485.1_5'UTR	NM_152227.1	NP_689413.1	Q9Y5X3	SNX5_HUMAN	sorting nexin 5	313	BAR.				intracellular protein transport (GO:0006886)|pinocytosis (GO:0006907)	cytoplasmic vesicle (GO:0031410)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|extrinsic component of endosome membrane (GO:0031313)|macropinocytic cup (GO:0070685)	phosphatidylinositol binding (GO:0035091)	p.T313T(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	11						TGAGGGCTTTGGTGCGTCTGT	0.438													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17374	0.0		0.0	False		,,,				2504	0.0				p.T313T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C939T	20						.	G	,	1,4405	2.1+/-5.4	0,1,2202	80.0	72.0	75.0		939,939	-1.3	1.0	20		75	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	SNX5	NM_014426.2,NM_152227.1	,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,	313/405,313/405	17928269	1,13003	2203	4299	6502	17876269	SO:0001819	synonymous_variant	27131	exon12			AF121855	CCDS13130.1	20p11	2008-05-22			ENSG00000089006	ENSG00000089006		"""Sorting nexins"""	14969	protein-coding gene	gene with protein product		605937				10600472, 17148574	Standard	NM_152227		Approved		uc002wqc.3	Q9Y5X3	OTTHUMG00000031953	ENST00000377768.3:c.939C>T	20.37:g.17928269G>A		Somatic		Capture	Illumina HiSeq	Phase_I	17876269	NM_152227	B7ZKN3|D3DW26|Q52LC4|Q7KZN0|Q9BWP0	Silent	SNP	ENST00000377768.3	37	CCDS13130.1																																																																																				0.438	SNX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078137.4		
APMAP	57136	broad.mit.edu	37	20	24952173	24952173	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:24952173C>T	ENST00000217456.2	-	5	751	c.461G>A	c.(460-462)gGt>gAt	p.G154D	APMAP_ENST00000447138.1_Missense_Mutation_p.G154D|RNU6-1257P_ENST00000384625.1_RNA	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	154					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)	p.G154D(1)									TGCACGGATACCCAGGGGTCT	0.493																																					p.G154D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G461A	20						.						94.0	95.0	95.0					20																	24952173		2203	4300	6503	24900173	SO:0001583	missense	57136	exon5			AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.461G>A	20.37:g.24952173C>T	ENSP00000217456:p.Gly154Asp	Somatic		Capture	Illumina HiSeq	Phase_I	24900173	NM_020531	A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	ENST00000217456.2	37	CCDS13166.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.4|27.4	4.827808|4.827808	0.90955|0.90955	.|.	.|.	ENSG00000101474|ENSG00000101474	ENST00000217456;ENST00000447138|ENST00000451442	T;T|.	0.40225|.	1.04;1.04|.	5.47|5.47	5.47|5.47	0.80525|0.80525	Six-bladed beta-propeller, TolB-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87645|0.87645	0.6229|0.6229	H|H	0.96691|0.96691	3.865|3.865	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;0.999;1.0|.	D|D	0.91324|0.91324	0.5084|0.5084	10|5	0.87932|.	D|.	0|.	-25.6206|-25.6206	14.8269|14.8269	0.70120|0.70120	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	154;138;154|.	Q9HDC9-2;A2A2F9;Q9HDC9|.	.;.;APMAP_HUMAN|.	D|I	154|139	ENSP00000217456:G154D;ENSP00000415373:G154D|.	ENSP00000217456:G154D|.	G|V	-|-	2|1	0|0	C20orf3|C20orf3	24900173|24900173	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	5.179000|5.179000	0.65043|0.65043	2.563000|2.563000	0.86464|0.86464	0.561000|0.561000	0.74099|0.74099	GGT|GTA		0.493	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078380.2	NM_020531	
VSX1	30813	broad.mit.edu	37	20	25060112	25060112	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:25060112C>T	ENST00000376709.4	-	2	726	c.463G>A	c.(463-465)Gca>Aca	p.A155T	VSX1_ENST00000429762.3_Missense_Mutation_p.A155T|VSX1_ENST00000451258.1_Missense_Mutation_p.A155T|VSX1_ENST00000424574.1_Missense_Mutation_p.A155T|VSX1_ENST00000376707.3_Missense_Mutation_p.A155T|VSX1_ENST00000444511.2_Missense_Mutation_p.A155T	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	155					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A155T(1)		central_nervous_system(1)|large_intestine(3)|lung(2)	6						GTGGGGGATGCCTTTAGGTCA	0.537																																					p.A155T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G463A	20						.						67.0	52.0	57.0					20																	25060112		2203	4300	6503	25008112	SO:0001583	missense	30813	exon2			AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.463G>A	20.37:g.25060112C>T	ENSP00000365899:p.Ala155Thr	Somatic		Capture	Illumina HiSeq	Phase_I	25008112	NM_199425	B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	ENST00000376709.4	37	CCDS13168.1	.	.	.	.	.	.	.	.	.	.	C	7.850	0.723820	0.15439	.	.	ENSG00000100987	ENST00000429762;ENST00000444511;ENST00000424574;ENST00000451258;ENST00000376709;ENST00000376707	D;D;D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78;-3.78;-3.78	4.87	2.76	0.32466	Homeodomain-like (1);	1.020930	0.07766	N	0.950959	D	0.89146	0.6632	L	0.27053	0.805	0.58432	D	0.999999	B;B;B;B	0.29716	0.061;0.061;0.079;0.255	B;B;B;B	0.21917	0.013;0.027;0.021;0.037	T	0.80480	-0.1364	10	0.11485	T	0.65	.	7.0956	0.25307	0.0:0.7162:0.0:0.2838	.	155;155;155;155	Q9NZR4-7;Q9NZR4-8;Q9NZR4-2;Q9NZR4	.;.;.;VSX1_HUMAN	T	155	ENSP00000401690:A155T;ENSP00000387720:A155T;ENSP00000399496:A155T;ENSP00000389654:A155T;ENSP00000365899:A155T;ENSP00000365897:A155T	ENSP00000365897:A155T	A	-	1	0	VSX1	25008112	0.279000	0.24239	0.093000	0.20910	0.432000	0.31715	0.502000	0.22594	1.237000	0.43756	0.462000	0.41574	GCA		0.537	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078384.3		
ZNF337	26152	broad.mit.edu	37	20	25656779	25656779	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:25656779T>G	ENST00000376436.1	-	4	1684	c.1145A>C	c.(1144-1146)aAg>aCg	p.K382T	RP4-694B14.5_ENST00000421829.1_RNA|ZNF337_ENST00000252979.5_Missense_Mutation_p.K382T|RP4-694B14.5_ENST00000428254.1_RNA|ZNF337_ENST00000481610.1_5'Flank|RP4-694B14.5_ENST00000414393.1_RNA|RP4-694B14.5_ENST00000439498.1_RNA|RP4-694B14.5_ENST00000455791.1_RNA|ZNF337_ENST00000538750.1_Missense_Mutation_p.K350T			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K382T(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AAAACTTTGCTTACACTGCCT	0.507																																					p.K382T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1145C	20						.						112.0	98.0	103.0					20																	25656779		2203	4300	6503	25604779	SO:0001583	missense	26152	exon5				CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.1145A>C	20.37:g.25656779T>G	ENSP00000365619:p.Lys382Thr	Somatic		Capture	Illumina HiSeq	Phase_I	25604779	NM_015655	B4DSM2|Q9Y3Y5	Missense_Mutation	SNP	ENST00000376436.1	37	CCDS13174.1	.	.	.	.	.	.	.	.	.	.	.	14.48	2.546974	0.45383	.	.	ENSG00000130684	ENST00000376436;ENST00000252979;ENST00000376412;ENST00000538750	T;T;T	0.08458	3.09;3.09;3.09	1.3	0.253	0.15551	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05914	0.0154	N	0.17674	0.51	0.19575	N	0.999966	B;B	0.29571	0.249;0.249	B;B	0.33799	0.17;0.17	T	0.40421	-0.9564	9	0.87932	D	0	.	5.2473	0.15504	0.0:0.7626:0.0:0.2374	.	350;382	B4DSM2;Q9Y3M9	.;ZN337_HUMAN	T	382;382;382;350	ENSP00000365619:K382T;ENSP00000252979:K382T;ENSP00000442181:K350T	ENSP00000252979:K382T	K	-	2	0	ZNF337	25604779	0.009000	0.17119	0.014000	0.15608	0.919000	0.55068	0.023000	0.13533	0.078000	0.16900	0.254000	0.18369	AAG		0.507	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078454.1		
MYLK2	85366	broad.mit.edu	37	20	30418689	30418689	+	Missense_Mutation	SNP	G	G	A	rs200390693		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:30418689G>A	ENST00000375994.2	+	8	1565	c.1292G>A	c.(1291-1293)cGg>cAg	p.R431Q	MYLK2_ENST00000468730.1_3'UTR|MYLK2_ENST00000375985.4_Missense_Mutation_p.R431Q			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	431	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.R431Q(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GGCCTGGCACGGAGGTACCAC	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		11717	0.001		0.0	False		,,,				2504	0.0				p.R431Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1292A	20						.						103.0	102.0	102.0					20																	30418689		2203	4300	6503	29882350	SO:0001583	missense	85366	exon9			AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1292G>A	20.37:g.30418689G>A	ENSP00000365162:p.Arg431Gln	Somatic		Capture	Illumina HiSeq	Phase_I	29882350	NM_033118	Q569L1|Q96I84	Missense_Mutation	SNP	ENST00000375994.2	37	CCDS13191.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	27.2	4.806632	0.90623	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.47177	0.85;0.85	3.76	3.76	0.43208	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.59101	0.2169	L	0.48877	1.53	0.53005	D	0.999966	D	0.76494	0.999	D	0.66497	0.944	T	0.60255	-0.7299	9	0.44086	T	0.13	.	15.0927	0.72207	0.0:0.0:1.0:0.0	.	431	Q9H1R3	MYLK2_HUMAN	Q	431	ENSP00000365162:R431Q;ENSP00000365152:R431Q	ENSP00000365152:R431Q	R	+	2	0	MYLK2	29882350	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.655000	0.83696	2.063000	0.61619	0.561000	0.74099	CGG		0.622	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2	NM_033118	
FAM83C	128876	broad.mit.edu	37	20	33875381	33875381	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:33875381G>A	ENST00000374408.3	-	4	1297	c.1201C>T	c.(1201-1203)Cct>Tct	p.P401S	EIF6_ENST00000374443.3_5'Flank|EIF6_ENST00000374436.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA|EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374450.3_5'Flank	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	401								p.P401S(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CCGTGGTTAGGGTCTGACAGT	0.617																																					p.P401S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1201T	20						.						109.0	88.0	95.0					20																	33875381		2203	4300	6503	33338795	SO:0001583	missense	128876	exon4			AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.1201C>T	20.37:g.33875381G>A	ENSP00000363529:p.Pro401Ser	Somatic		Capture	Illumina HiSeq	Phase_I	33338795	NM_178468	Q14D67|Q5JWN6|Q8N276	Missense_Mutation	SNP	ENST00000374408.3	37	CCDS13251.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.350928	0.24512	.	.	ENSG00000125998	ENST00000374408	T	0.06608	3.28	5.05	3.06	0.35304	.	0.172940	0.27966	N	0.017135	T	0.07908	0.0198	M	0.72353	2.195	0.38594	D	0.950502	P	0.43094	0.799	B	0.36845	0.234	T	0.28902	-1.0029	10	0.33940	T	0.23	-1.0149	9.6767	0.40045	0.1765:0.0:0.8235:0.0	.	401	Q9BQN1	FA83C_HUMAN	S	401	ENSP00000363529:P401S	ENSP00000363529:P401S	P	-	1	0	FAM83C	33338795	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	1.229000	0.32600	1.273000	0.44346	0.561000	0.74099	CCT		0.617	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3		
CEP250	11190	broad.mit.edu	37	20	34091767	34091767	+	Missense_Mutation	SNP	G	G	A	rs73903079	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:34091767G>A	ENST00000397527.1	+	30	6290	c.5570G>A	c.(5569-5571)cGt>cAt	p.R1857H	CEP250_ENST00000342580.4_Missense_Mutation_p.R1801H	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1857	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.R1857H(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CTGAAGGAGCGTCATGGAGAG	0.622													G|||	20	0.00399361	0.0129	0.0043	5008	,	,		22193	0.0		0.0	False		,,,				2504	0.0				p.R1857H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5570A	20						.	G	HIS/ARG	49,4355	48.9+/-83.8	0,49,2153	57.0	54.0	55.0		5570	-1.8	0.0	20	dbSNP_130	55	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CEP250	NM_007186.3	29	0,51,6451	AA,AG,GG		0.0233,1.1126,0.3922	benign	1857/2443	34091767	51,12953	2202	4300	6502	33555181	SO:0001583	missense	11190	exon30			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.5570G>A	20.37:g.34091767G>A	ENSP00000380661:p.Arg1857His	Somatic		Capture	Illumina HiSeq	Phase_I	33555181	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	37	CCDS13255.1	11	0.005036630036630037	10	0.02032520325203252	1	0.0027624309392265192	0	0.0	0	0.0	G	1.180	-0.638472	0.03557	0.011126	2.33E-4	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.48522	2.91;2.91;0.81	4.94	-1.78	0.07957	.	1.090020	0.06863	N	0.799546	T	0.25044	0.0608	L	0.50919	1.6	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.34775	-0.9815	10	0.38643	T	0.18	.	10.3186	0.43751	0.601:0.0:0.399:0.0	.	1857	Q9BV73	CP250_HUMAN	H	1857;1801;345	ENSP00000380661:R1857H;ENSP00000341541:R1801H;ENSP00000395992:R345H	ENSP00000341541:R1801H	R	+	2	0	CEP250	33555181	0.002000	0.14202	0.007000	0.13788	0.021000	0.10359	0.230000	0.17852	-0.181000	0.10619	-0.137000	0.14449	CGT		0.622	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
CHD6	84181	broad.mit.edu	37	20	40143499	40143499	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:40143499A>G	ENST00000373233.3	-	4	824	c.647T>C	c.(646-648)cTg>cCg	p.L216P	CHD6_ENST00000373222.3_Missense_Mutation_p.L251P|CHD6_ENST00000309279.7_Missense_Mutation_p.L216P	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	216	Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.L216P(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TGGGTTCGTCAGGCCCTGATC	0.532																																					p.L216P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T647C	20						.						133.0	123.0	127.0					20																	40143499		2203	4300	6503	39576913	SO:0001583	missense	84181	exon4			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.647T>C	20.37:g.40143499A>G	ENSP00000362330:p.Leu216Pro	Somatic		Capture	Illumina HiSeq	Phase_I	39576913	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.437094	0.83885	.	.	ENSG00000124177	ENST00000373233;ENST00000309279;ENST00000373222	D;D;T	0.95035	-2.09;-3.59;-1.48	5.64	5.64	0.86602	.	0.000000	0.44097	D	0.000492	D	0.95030	0.8391	L	0.34521	1.04	0.80722	D	1	D;B	0.89917	1.0;0.093	D;B	0.74674	0.984;0.028	D	0.94187	0.7437	10	0.30854	T	0.27	-9.3024	15.8531	0.78952	1.0:0.0:0.0:0.0	.	251;216	Q8TD26-2;Q8TD26	.;CHD6_HUMAN	P	216;216;251	ENSP00000362330:L216P;ENSP00000308684:L216P;ENSP00000362319:L251P	ENSP00000308684:L216P	L	-	2	0	CHD6	39576913	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.593000	0.74100	2.149000	0.67028	0.459000	0.35465	CTG		0.532	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
KCNB1	3745	broad.mit.edu	37	20	47989826	47989826	+	Silent	SNP	G	G	A	rs190726852		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:47989826G>A	ENST00000371741.4	-	2	2437	c.2271C>T	c.(2269-2271)gaC>gaT	p.D757D		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	757					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)	p.D757D(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	CTGTGTCTGCGTCAATGTACT	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		14715	0.0		0.001	False		,,,				2504	0.0				p.D757D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2271T	20						.						139.0	149.0	145.0					20																	47989826		2203	4300	6503	47423233	SO:0001819	synonymous_variant	3745	exon2			AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.2271C>T	20.37:g.47989826G>A		Somatic		Capture	Illumina HiSeq	Phase_I	47423233	NM_004975	Q14193	Silent	SNP	ENST00000371741.4	37	CCDS13418.1																																																																																				0.567	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	
PLCB4	5332	broad.mit.edu	37	20	9417789	9417789	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:9417789A>T	ENST00000378493.1	+	26	2733	c.2718A>T	c.(2716-2718)gaA>gaT	p.E906D	PLCB4_ENST00000378473.3_Missense_Mutation_p.E918D|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000334005.3_Missense_Mutation_p.E906D|PLCB4_ENST00000378501.2_Missense_Mutation_p.E906D|PLCB4_ENST00000414679.2_Missense_Mutation_p.E918D|PLCB4_ENST00000278655.4_Missense_Mutation_p.E906D			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	906					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.E906D(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CTGGTGTGGAAGCCAAGAAAG	0.478																																					p.E906D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2718T	20						.						62.0	57.0	59.0					20																	9417789		2203	4300	6503	9365789	SO:0001583	missense	5332	exon26				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.2718A>T	20.37:g.9417789A>T	ENSP00000367754:p.Glu906Asp	Somatic		Capture	Illumina HiSeq	Phase_I	9365789	NM_000933	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	A	13.63	2.293448	0.40594	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.61627	2.19;2.2;0.09;0.09;2.19;2.0	6.03	1.18	0.20946	.	0.097075	0.64402	D	0.000001	T	0.28928	0.0718	N	0.08118	0	0.53005	D	0.99996	B;B;B;B	0.12013	0.0;0.005;0.0;0.0	B;B;B;B	0.13407	0.0;0.009;0.001;0.002	T	0.02991	-1.1085	10	0.17832	T	0.49	.	5.5873	0.17281	0.5915:0.0:0.2855:0.123	.	918;753;906;906	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	D	906;918;906;906;906;754	ENSP00000334105:E906D;ENSP00000367734:E918D;ENSP00000278655:E906D;ENSP00000367754:E906D;ENSP00000367762:E906D;ENSP00000390616:E754D	ENSP00000278655:E906D	E	+	3	2	PLCB4	9365789	0.607000	0.26958	1.000000	0.80357	0.987000	0.75469	0.237000	0.17985	0.135000	0.18707	0.533000	0.62120	GAA		0.478	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
CTSA	5476	broad.mit.edu	37	20	44523668	44523668	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:44523668delC	ENST00000372459.2	+	10	1177	c.984delC	c.(982-984)gacfs	p.D328fs	RP3-337O18.9_ENST00000607703.1_RNA|CTSA_ENST00000354880.5_Frame_Shift_Del_p.D329fs|CTSA_ENST00000372484.3_Frame_Shift_Del_p.D346fs|CTSA_ENST00000191018.5_Frame_Shift_Del_p.D328fs			P10619	PPGB_HUMAN	cathepsin A	328					glycosphingolipid metabolic process (GO:0006687)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|enzyme activator activity (GO:0008047)|serine-type carboxypeptidase activity (GO:0004185)	p.C349fs*36(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				TGCGCATGGACCCCCCCTGCA	0.632																																					p.D346fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1038delC	20						.						75.0	65.0	69.0					20																	44523668		2203	4300	6503	43957075	SO:0001589	frameshift_variant	5476	exon11			M22960	CCDS13385.2, CCDS46609.1, CCDS54467.1	20q13.12	2012-02-10	2006-12-05	2006-12-05	ENSG00000064601	ENSG00000064601	3.4.16.5	"""Cathepsins"""	9251	protein-coding gene	gene with protein product	"""carboxypeptidase C"", ""lysosomal protective protein"", ""carboxypeptidase-L"", ""carboxypeptidase Y-like kininase"", ""deamidase"", ""lysosomal carboxypeptidase A"", ""urinary kininase"""	613111	"""protective protein for beta-galactosidase (galactosialidosis)"""	GSL, PPGB		2071143	Standard	NM_000308		Approved		uc002xqh.3	P10619	OTTHUMG00000033078	ENST00000372459.2:c.984delC	20.37:g.44523668delC	ENSP00000361537:p.Asp328fs	Somatic		Capture	Illumina HiSeq	Phase_I	43957075	NM_000308	B2R798|Q561W6|Q5JZH1|Q96KJ2|Q9BR08|Q9BW68	Frame_Shift_Del	DEL	ENST00000372459.2	37	CCDS46609.1																																																																																				0.632	CTSA-012	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471297.2	NM_000308	
CTCFL	140690	broad.mit.edu	37	20	56098917	56098918	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	AG	AG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:56098917_56098918delAG	ENST00000608263.1	-	1	1005_1006	c.344_345delCT	c.(343-345)cctfs	p.P115fs	CTCFL_ENST00000432255.2_Frame_Shift_Del_p.P115fs|CTCFL_ENST00000608903.1_Intron|CTCFL_ENST00000243914.3_Frame_Shift_Del_p.P115fs|CTCFL_ENST00000429804.3_Frame_Shift_Del_p.P115fs|CTCFL_ENST00000608158.1_Frame_Shift_Del_p.P115fs|CTCFL_ENST00000371196.2_Frame_Shift_Del_p.P115fs|CTCFL_ENST00000423479.3_Frame_Shift_Del_p.P115fs|CTCFL_ENST00000433949.3_Intron|CTCFL_ENST00000502686.2_Intron|CTCFL_ENST00000539382.1_Intron|CTCFL_ENST00000422869.2_Frame_Shift_Del_p.P115fs|CTCFL_ENST00000609232.1_Frame_Shift_Del_p.P115fs|CTCFL_ENST00000608858.1_Intron|CTCFL_ENST00000481655.2_Frame_Shift_Del_p.P115fs|CTCFL_ENST00000608425.1_Frame_Shift_Del_p.P115fs|CTCFL_ENST00000608440.1_Frame_Shift_Del_p.P115fs	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	115					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)	p.P115fs*8(1)		NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			ACCCAGGGCCAGGCTGTTGCAC	0.584																																					p.115_115del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.344_345del	20						.																																			55532324	SO:0001589	frameshift_variant	140690	exon2				CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.344_345delCT	20.37:g.56098917_56098918delAG	ENSP00000476783:p.Pro115fs	Somatic		Capture	Illumina HiSeq	Phase_I	55532323	NM_080618	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Frame_Shift_Del	DEL	ENST00000608263.1	37	CCDS13459.1																																																																																				0.584	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
MYT1	4661	broad.mit.edu	37	20	62836946	62836946	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr20:62836946G>T	ENST00000328439.1	+	6	554	c.190G>T	c.(190-192)Ggc>Tgc	p.G64C	MYT1_ENST00000536311.1_Missense_Mutation_p.G64C|MYT1_ENST00000360149.4_Missense_Mutation_p.G64C	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Pro-rich.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G64C(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GAAGCTGGAGGGCGCTGAGGC	0.627																																					p.G64C	GBM(59;481 1041 20555 21139 33705)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G190T	20						.						77.0	70.0	72.0					20																	62836946		2203	4300	6503	62307390	SO:0001583	missense	4661	exon6			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.190G>T	20.37:g.62836946G>T	ENSP00000327465:p.Gly64Cys	Somatic		Capture	Illumina HiSeq	Phase_I	62307390	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.115198	0.37339	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.48201	0.82;0.89;0.89	5.49	3.53	0.40419	.	0.203652	0.41938	D	0.000797	T	0.45296	0.1335	L	0.44542	1.39	0.24248	N	0.995334	B;D	0.53885	0.001;0.963	B;P	0.50231	0.001;0.635	T	0.33929	-0.9849	10	0.62326	D	0.03	-4.1578	6.949	0.24534	0.069:0.1265:0.6732:0.1312	.	64;64	Q01538;Q6P6D5	MYT1_HUMAN;.	C	64	ENSP00000353269:G64C;ENSP00000327465:G64C;ENSP00000442412:G64C	ENSP00000327465:G64C	G	+	1	0	MYT1	62307390	1.000000	0.71417	0.540000	0.28089	0.822000	0.46500	3.510000	0.53393	0.682000	0.31407	-0.282000	0.10007	GGC		0.627	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
MORC3	23515	broad.mit.edu	37	21	37711179	37711179	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr21:37711179G>T	ENST00000400485.1	+	5	644	c.568G>T	c.(568-570)Ggc>Tgc	p.G190C	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	190					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)	p.G190C(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						TGCTATTATAGGCAAGAAGGG	0.438																																					p.G190C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G568T	21						.						187.0	166.0	172.0					21																	37711179		1947	4142	6089	36633049	SO:0001583	missense	23515	exon5			AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.568G>T	21.37:g.37711179G>T	ENSP00000383333:p.Gly190Cys	Somatic		Capture	Illumina HiSeq	Phase_I	36633049	NM_015358	A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511883	0.85389	.	.	ENSG00000159256	ENST00000400485	T	0.74002	-0.8	5.55	5.55	0.83447	ATPase-like, ATP-binding domain (2);	0.219009	0.46442	D	0.000298	D	0.83041	0.5168	M	0.71581	2.175	0.53688	D	0.99997	P	0.52170	0.951	P	0.55577	0.779	T	0.82464	-0.0444	9	.	.	.	-20.4015	19.1041	0.93285	0.0:0.0:1.0:0.0	.	190	Q14149	MORC3_HUMAN	C	190	ENSP00000383333:G190C	.	G	+	1	0	MORC3	36633049	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.041000	0.57339	2.606000	0.88127	0.591000	0.81541	GGC		0.438	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
ABCG1	9619	broad.mit.edu	37	21	43702466	43702466	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr21:43702466G>A	ENST00000361802.2	+	6	816	c.671G>A	c.(670-672)cGc>cAc	p.R224H	ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000398457.2_Missense_Mutation_p.R226H|ABCG1_ENST00000398449.3_Missense_Mutation_p.R224H|ABCG1_ENST00000343687.3_Missense_Mutation_p.R235H|ABCG1_ENST00000347800.2_Missense_Mutation_p.R221H|ABCG1_ENST00000398437.1_Missense_Mutation_p.R370H|ABCG1_ENST00000340588.4_Missense_Mutation_p.R332H	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	224	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)	p.R226H(1)|p.R224H(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	CAGCGCAAGCGCCTGGCCATC	0.617																																					p.R221H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G662A	21						.						62.0	58.0	59.0					21																	43702466		2203	4300	6503	42575535	SO:0001583	missense	9619	exon6			U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.671G>A	21.37:g.43702466G>A	ENSP00000354995:p.Arg224His	Somatic		Capture	Illumina HiSeq	Phase_I	42575535	NM_207629	Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Missense_Mutation	SNP	ENST00000361802.2	37	CCDS13682.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.008467	0.75046	.	.	ENSG00000160179	ENST00000398457;ENST00000347800;ENST00000450121;ENST00000398449;ENST00000361802;ENST00000343687;ENST00000398437;ENST00000340588	T;T;D;T;T;T;T;T	0.97430	0.52;0.52;-4.38;0.52;0.52;0.52;0.52;0.52	4.44	4.44	0.53790	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.143694	0.43416	D	0.000578	D	0.99312	0.9759	H	0.99783	4.775	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.91635	0.999;0.998;0.994;0.998;0.998;0.994	D	0.98132	1.0431	9	.	.	.	-28.838	17.4322	0.87542	0.0:0.0:1.0:0.0	.	235;235;224;224;221;226	B4DPT7;P45844-2;P45844;P45844-4;P45844-5;P45844-3	.;.;ABCG1_HUMAN;.;.;.	H	226;221;207;224;224;235;370;332	ENSP00000381475:R226H;ENSP00000291524:R221H;ENSP00000414541:R207H;ENSP00000381467:R224H;ENSP00000354995:R224H;ENSP00000339744:R235H;ENSP00000381464:R370H;ENSP00000343820:R332H	.	R	+	2	0	ABCG1	42575535	1.000000	0.71417	0.999000	0.59377	0.226000	0.24999	9.451000	0.97610	2.177000	0.69029	0.591000	0.81541	CGC		0.617	ABCG1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195318.2	NM_207174	
RSPH1	89765	broad.mit.edu	37	21	43906510	43906510	+	Silent	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr21:43906510G>T	ENST00000291536.3	-	4	503	c.336C>A	c.(334-336)acC>acA	p.T112T	RSPH1_ENST00000398352.3_Silent_p.T74T	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	112					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.T112T(1)		large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						CTCCAGTGTAGGTGTCATTAT	0.453																																					p.T112T	Esophageal Squamous(23;63 706 6286 10288 12913)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C336A	21						.						210.0	178.0	189.0					21																	43906510		2203	4300	6503	42779579	SO:0001819	synonymous_variant	89765	exon4			AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.336C>A	21.37:g.43906510G>T		Somatic		Capture	Illumina HiSeq	Phase_I	42779579	NM_080860	A8MWV0|B2RBN9|Q3MJA1	Silent	SNP	ENST00000291536.3	37	CCDS13688.1																																																																																				0.453	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195379.1		
KRTAP10-6	386674	broad.mit.edu	37	21	46012305	46012305	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr21:46012305G>T	ENST00000400368.1	-	1	81	c.61C>A	c.(61-63)Ctt>Att	p.L21I	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	21						keratin filament (GO:0045095)		p.L21I(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GAACCAGGAAGGCAGACGCGG	0.672																																					p.L21I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C61A	21						.						49.0	56.0	54.0					21																	46012305		2126	4237	6363	44836733	SO:0001583	missense	386674	exon1			AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.61C>A	21.37:g.46012305G>T	ENSP00000383219:p.Leu21Ile	Somatic		Capture	Illumina HiSeq	Phase_I	44836733	NM_198688		Missense_Mutation	SNP	ENST00000400368.1	37	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	g	6.634	0.485403	0.12641	.	.	ENSG00000188155	ENST00000400368	T	0.01084	5.36	3.23	-0.464	0.12160	.	.	.	.	.	T	0.01320	0.0043	M	0.62088	1.915	0.09310	N	1	P	0.39809	0.689	B	0.31547	0.132	T	0.45789	-0.9237	9	0.41790	T	0.15	.	6.8335	0.23923	0.0:0.1642:0.5013:0.3345	.	21	P60371	KR106_HUMAN	I	21	ENSP00000383219:L21I	ENSP00000383219:L21I	L	-	1	0	KRTAP10-6	44836733	0.659000	0.27411	0.095000	0.20976	0.010000	0.07245	0.002000	0.13061	0.004000	0.14682	-0.413000	0.06143	CTT		0.672	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
SUMO3	6612	broad.mit.edu	37	21	46228915	46228915	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr21:46228915G>A	ENST00000397898.3	-	3	351	c.269C>T	c.(268-270)gCg>gTg	p.A90V	SUMO3_ENST00000479153.1_Intron|SUMO3_ENST00000411651.2_Intron|SUMO3_ENST00000397893.3_Intron|SUMO3_ENST00000332859.6_Intron					small ubiquitin-like modifier 3											prostate(1)	1				Colorectal(79;0.058)		CAGTTACCCCGCACAAATCGG	0.453																																					.												.	.	0			.	21						.						90.0	62.0	71.0					21																	46228915		2203	4300	6503	45053343	SO:0001583	missense	6612	.				CCDS33587.1, CCDS68220.1	21q22.3	2013-06-05	2013-06-05	2004-05-19	ENSG00000184900	ENSG00000184900			11124	protein-coding gene	gene with protein product		602231	"""SMT3 (suppressor of mif two 3, yeast) homolog 1"", ""SMT3 suppressor of mif two 3 homolog 3 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)"""	SMT3H1		9119407	Standard	NM_006936		Approved	SMT3A	uc002zfz.1	P55854	OTTHUMG00000090256	ENST00000397898.3:c.269C>T	21.37:g.46228915G>A	ENSP00000380995:p.Ala90Val	Somatic		Capture	Illumina HiSeq	Phase_I	45053343	.		Missense_Mutation	SNP	ENST00000397898.3	37		.	.	.	.	.	.	.	.	.	.	G	8.684	0.905813	0.17760	.	.	ENSG00000184900	ENST00000397898	T	0.23754	1.89	2.64	-5.1	0.02911	.	.	.	.	.	T	0.14141	0.0342	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.29458	-1.0011	8	0.59425	D	0.04	.	3.8583	0.08985	0.2869:0.0:0.4475:0.2656	.	90	A8MUA9	.	V	90	ENSP00000380995:A90V	ENSP00000380995:A90V	A	-	2	0	SUMO3	45053343	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.939000	0.03933	-1.133000	0.02903	-1.314000	0.01303	GCG		0.453	SUMO3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000206561.1		
DIP2A	23181	broad.mit.edu	37	21	47918534	47918534	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr21:47918534G>A	ENST00000417564.2	+	5	464	c.443G>A	c.(442-444)cGa>cAa	p.R148Q	DIP2A_ENST00000318711.7_Missense_Mutation_p.R148Q|DIP2A_ENST00000427143.2_Missense_Mutation_p.R84Q|DIP2A_ENST00000400274.1_Missense_Mutation_p.R148Q|DIP2A_ENST00000435722.3_Missense_Mutation_p.R148Q|DIP2A_ENST00000457905.3_Missense_Mutation_p.R148Q|DIP2A_ENST00000466639.1_Missense_Mutation_p.R148Q			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	148					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.R148Q(2)		cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		TCTTTACGGCGACCCGGGCGA	0.582																																					p.R84Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G251A	21						.						126.0	143.0	137.0					21																	47918534		2134	4235	6369	46742962	SO:0001583	missense	23181	exon3			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.443G>A	21.37:g.47918534G>A	ENSP00000392066:p.Arg148Gln	Somatic		Capture	Illumina HiSeq	Phase_I	46742962	NM_001146114	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.638609	0.67130	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.26660	1.83;1.72;1.85;1.82;1.77;1.82;1.85	5.4	3.53	0.40419	.	0.762252	0.12086	N	0.500850	T	0.25754	0.0627	L	0.46885	1.475	0.58432	D	0.999998	D;P;B;P;P;P	0.55385	0.971;0.602;0.196;0.602;0.678;0.474	P;B;B;B;B;B	0.45681	0.49;0.042;0.011;0.069;0.261;0.077	T	0.02751	-1.1115	10	0.22109	T	0.4	-7.9865	10.3935	0.44188	0.0744:0.1336:0.792:0.0	.	148;84;148;148;148;148	E9PER1;E7EMA5;Q14689-3;Q14689;Q14689-4;Q14689-2	.;.;.;DIP2A_HUMAN;.;.	Q	148;84;148;148;148;148;148;148	ENSP00000383133:R148Q;ENSP00000400528:R84Q;ENSP00000323633:R148Q;ENSP00000393434:R148Q;ENSP00000430249:R148Q;ENSP00000415089:R148Q;ENSP00000392066:R148Q	ENSP00000323633:R148Q	R	+	2	0	DIP2A	46742962	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	6.274000	0.72587	1.237000	0.43756	0.555000	0.69702	CGA		0.582	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
CDC45	8318	broad.mit.edu	37	22	19483525	19483525	+	Silent	SNP	C	C	T	rs367976893		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr22:19483525C>T	ENST00000407835.1	+	8	820	c.564C>T	c.(562-564)taC>taT	p.Y188Y	CDC45_ENST00000263201.1_Silent_p.Y188Y|CDC45_ENST00000404724.3_Silent_p.Y142Y|CDC45_ENST00000437685.2_Silent_p.Y220Y			O75419	CDC45_HUMAN	cell division cycle 45	188					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.Y188Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	19						TCTTTGACTACGAGCAGTATG	0.393																																					p.Y220Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C660T	22						.	C	,,	0,4406		0,0,2203	212.0	205.0	207.0		660,426,564	-3.4	1.0	22		207	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	CDC45	NM_001178010.1,NM_001178011.1,NM_003504.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	220/599,142/521,188/567	19483525	1,13005	2203	4300	6503	17863525	SO:0001819	synonymous_variant	8318	exon8			AF053074	CCDS13762.1, CCDS54499.1, CCDS54500.1	22q11.21	2013-01-17	2013-01-17	2010-03-24	ENSG00000093009	ENSG00000093009			1739	protein-coding gene	gene with protein product	"""human CDC45"""	603465	"""CDC45 (cell division cycle 45, S.cerevisiae, homolog)-like"", ""CDC45 cell division cycle 45-like (S. cerevisiae)"", ""cell division cycle 45 homolog (S. cerevisiae)"""	CDC45L2, CDC45L		9660782, 9724329, 17608804	Standard	NM_001178010		Approved		uc011aha.2	O75419	OTTHUMG00000150386	ENST00000407835.1:c.564C>T	22.37:g.19483525C>T		Somatic		Capture	Illumina HiSeq	Phase_I	17863525	NM_001178010	B4DDB4|B4DDU3|E9PDH7|O60856|Q20WK8|Q6UW54|Q9UP68	Silent	SNP	ENST00000407835.1	37	CCDS13762.1																																																																																				0.393	CDC45-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317903.1	NM_003504	
GNB1L	54584	broad.mit.edu	37	22	19789724	19789724	+	Missense_Mutation	SNP	G	G	A	rs572852392		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr22:19789724G>A	ENST00000329517.6	-	7	768	c.532C>T	c.(532-534)Cgc>Tgc	p.R178C	GNB1L_ENST00000405009.1_Missense_Mutation_p.R178C|GNB1L_ENST00000460402.1_5'UTR|GNB1L_ENST00000403325.1_Missense_Mutation_p.R178C	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like	178					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)		p.R178C(1)		breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					AGGAGTGGGCGGGAGCTGCAG	0.632													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18031	0.0		0.0	False		,,,				2504	0.0				p.R178C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C532T	22						.						38.0	36.0	37.0					22																	19789724		2202	4300	6502	18169724	SO:0001583	missense	54584	exon7			AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.532C>T	22.37:g.19789724G>A	ENSP00000331313:p.Arg178Cys	Somatic		Capture	Illumina HiSeq	Phase_I	18169724	NM_053004	Q9H2S2|Q9H4M4	Missense_Mutation	SNP	ENST00000329517.6	37	CCDS13768.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.942651	0.34283	.	.	ENSG00000185838	ENST00000329517;ENST00000403325;ENST00000405009	T;T;T	0.18502	2.21;2.21;5.01	5.46	4.37	0.52481	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.476139	0.21448	U	0.074365	T	0.14098	0.0341	L	0.47716	1.5	0.41641	D	0.989079	B	0.19817	0.039	B	0.08055	0.003	T	0.10019	-1.0648	10	0.87932	D	0	-6.4664	5.6411	0.17565	0.0749:0.14:0.6403:0.1448	.	178	Q9BYB4	GNB1L_HUMAN	C	178	ENSP00000331313:R178C;ENSP00000385154:R178C;ENSP00000384626:R178C	ENSP00000331313:R178C	R	-	1	0	GNB1L	18169724	1.000000	0.71417	0.998000	0.56505	0.631000	0.37964	1.629000	0.37071	2.724000	0.93272	0.561000	0.74099	CGC		0.632	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075202.1		
BCR	613	broad.mit.edu	37	22	23655111	23655111	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr22:23655111C>T	ENST00000305877.8	+	20	4111	c.3360C>T	c.(3358-3360)gaC>gaT	p.D1120D	BCR_ENST00000359540.3_Silent_p.D1076D|BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	1120	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D1120D(1)	BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	GCGAGATGGACGTGAACGCCA	0.587			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.D1076D			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3228T	22						.						35.0	33.0	34.0					22																	23655111		2083	3938	6021	21985111	SO:0001819	synonymous_variant	613	exon19				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3360C>T	22.37:g.23655111C>T		Somatic		Capture	Illumina HiSeq	Phase_I	21985111	NM_021574	P78501|Q12842|Q4LE80|Q6NZI3	Silent	SNP	ENST00000305877.8	37	CCDS13806.1																																																																																				0.587	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
ADORA2A	135	broad.mit.edu	37	22	24836882	24836882	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr22:24836882C>T	ENST00000337539.7	+	3	1123	c.664C>T	c.(664-666)Cgg>Tgg	p.R222W	ADORA2A-AS1_ENST00000543438.1_RNA|ADORA2A-AS1_ENST00000326341.4_RNA|ADORA2A-AS1_ENST00000427813.2_RNA|ADORA2A_ENST00000496497.1_3'UTR|SPECC1L-ADORA2A_ENST00000358654.2_3'UTR	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	222					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)	p.R222W(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	GGAGCGGGCACGGTCCACACT	0.617																																					p.R222W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C664T	22						.						144.0	141.0	142.0					22																	24836882		2203	4300	6503	23166882	SO:0001583	missense	135	exon3			X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.664C>T	22.37:g.24836882C>T	ENSP00000336630:p.Arg222Trp	Somatic		Capture	Illumina HiSeq	Phase_I	23166882	NM_000675	B2R7E0	Missense_Mutation	SNP	ENST00000337539.7	37	CCDS13826.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.551962	0.45487	.	.	ENSG00000128271	ENST00000444262;ENST00000541988;ENST00000337539;ENST00000417596	T;T	0.38240	1.15;1.15	5.13	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.189958	0.44902	D	0.000411	T	0.65903	0.2736	M	0.93854	3.465	0.54753	D	0.99998	D	0.89917	1.0	D	0.78314	0.991	T	0.73401	-0.3994	10	0.87932	D	0	-37.4259	10.7292	0.46087	0.156:0.7082:0.1358:0.0	.	222	P29274	AA2AR_HUMAN	W	222	ENSP00000414802:R222W;ENSP00000336630:R222W	ENSP00000336630:R222W	R	+	1	2	ADORA2A	23166882	0.976000	0.34144	0.807000	0.32361	0.221000	0.24807	2.418000	0.44662	1.111000	0.41721	0.462000	0.41574	CGG		0.617	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319971.2	NM_000675	
SLC35E4	339665	broad.mit.edu	37	22	31042911	31042911	+	Missense_Mutation	SNP	G	G	A	rs372345536		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr22:31042911G>A	ENST00000343605.4	+	2	1745	c.946G>A	c.(946-948)Gca>Aca	p.A316T	SLC35E4_ENST00000300385.8_Intron|SLC35E4_ENST00000406566.1_Intron	NM_001001479.2	NP_001001479.1	Q6ICL7	S35E4_HUMAN	solute carrier family 35, member E4	316	Leu-rich.					integral component of membrane (GO:0016021)		p.A316T(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|skin(1)	10						CGTGGGCATCGCACTCACTCT	0.642																																					p.A316T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G946A	22						.	G	THR/ALA	0,4406		0,0,2203	93.0	76.0	82.0		946	0.7	0.0	22		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC35E4	NM_001001479.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	316/351	31042911	1,13005	2203	4300	6503	29372911	SO:0001583	missense	339665	exon2				CCDS13882.1	22q12.2	2013-05-22			ENSG00000100036	ENSG00000100036		"""Solute carriers"""	17058	protein-coding gene	gene with protein product							Standard	NM_001001479		Approved		uc003ais.1	Q6ICL7	OTTHUMG00000151110	ENST00000343605.4:c.946G>A	22.37:g.31042911G>A	ENSP00000339626:p.Ala316Thr	Somatic		Capture	Illumina HiSeq	Phase_I	29372911	NM_001001479	Q567P0	Missense_Mutation	SNP	ENST00000343605.4	37	CCDS13882.1	.	.	.	.	.	.	.	.	.	.	G	9.465	1.094058	0.20471	0.0	1.16E-4	ENSG00000100036	ENST00000343605	T	0.72505	-0.66	4.35	0.697	0.18081	Domain of unknown function DUF250 (1);	0.357631	0.28209	N	0.016186	T	0.45296	0.1335	N	0.11756	0.17	0.23144	N	0.998226	B	0.13594	0.008	B	0.10450	0.005	T	0.22800	-1.0206	10	0.20519	T	0.43	-13.1907	7.4271	0.27105	0.1693:0.1383:0.6924:0.0	.	316	Q6ICL7	S35E4_HUMAN	T	316	ENSP00000339626:A316T	ENSP00000339626:A316T	A	+	1	0	SLC35E4	29372911	0.294000	0.24380	0.010000	0.14722	0.619000	0.37552	3.041000	0.49807	0.532000	0.28657	-0.224000	0.12420	GCA		0.642	SLC35E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321382.1	XM_290973	
SUN2	25777	broad.mit.edu	37	22	39144767	39144767	+	Silent	SNP	C	C	T	rs200221237		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr22:39144767C>T	ENST00000405510.1	-	8	994	c.636G>A	c.(634-636)acG>acA	p.T212T	SUN2_ENST00000405018.1_Silent_p.T233T|SUN2_ENST00000411587.2_Silent_p.T201T|RP3-508I15.14_ENST00000416406.1_RNA|SUN2_ENST00000216064.4_Silent_p.T212T|SUN2_ENST00000406622.1_Silent_p.T212T	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	212					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)	p.T212T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						ACCAGAGGAACGTCTTCAGGG	0.647																																					p.T212T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G636A	22						.						115.0	99.0	104.0					22																	39144767		2203	4300	6503	37474713	SO:0001819	synonymous_variant	25777	exon7			AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.636G>A	22.37:g.39144767C>T		Somatic		Capture	Illumina HiSeq	Phase_I	37474713	NM_015374	B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Silent	SNP	ENST00000405510.1	37	CCDS13978.1	.	.	.	.	.	.	.	.	.	.	C	10.07	1.248567	0.22880	.	.	ENSG00000100242	ENST00000430185	.	.	.	4.73	-9.46	0.00597	.	.	.	.	.	T	0.14184	0.0343	.	.	.	0.21256	N	0.999744	.	.	.	.	.	.	T	0.11518	-1.0584	4	.	.	.	-0.6299	0.9998	0.01475	0.1909:0.1589:0.2725:0.3778	.	.	.	.	H	69	.	.	R	-	2	0	SUN2	37474713	0.000000	0.05858	0.123000	0.21794	0.945000	0.59286	-4.370000	0.00245	-3.117000	0.00240	-0.367000	0.07326	CGT		0.647	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321057.1	XM_039332	
ARHGAP8	23779	broad.mit.edu	37	22	45221422	45221422	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr22:45221422C>A	ENST00000389774.2	+	8	779	c.638C>A	c.(637-639)cCa>cAa	p.P213Q	ARHGAP8_ENST00000356099.6_Missense_Mutation_p.P182Q|ARHGAP8_ENST00000389773.5_Missense_Mutation_p.P304Q|PRR5-ARHGAP8_ENST00000352766.7_Missense_Mutation_p.P392Q|ARHGAP8_ENST00000336963.4_Missense_Mutation_p.P182Q|ARHGAP8_ENST00000517296.3_Missense_Mutation_p.P392Q|PRR5-ARHGAP8_ENST00000361473.5_Missense_Mutation_p.P313Q	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	213					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.P213Q(1)|p.P218Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		ACCAAGACACCACCGCCGCGG	0.652																																					p.P304Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C911A	22						.						31.0	34.0	33.0					22																	45221422		2202	4299	6501	43600086	SO:0001583	missense	553158	exon10			AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.638C>A	22.37:g.45221422C>A	ENSP00000374424:p.Pro213Gln	Somatic		Capture	Illumina HiSeq	Phase_I	43600086	NM_181334	A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Missense_Mutation	SNP	ENST00000389774.2	37	CCDS33664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	15.30|15.30	2.792022|2.792022	0.50102|0.50102	.|.	.|.	ENSG00000248405|ENSG00000248405;ENSG00000248405;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484	ENST00000515632|ENST00000361473;ENST00000352766;ENST00000517296;ENST00000389773;ENST00000389774;ENST00000336963;ENST00000356099	.|T;T;T;T;T;T;T	.|0.60920	.|2.24;2.2;2.2;2.24;2.15;0.15;2.17	4.39|4.39	3.33|3.33	0.38152|0.38152	.|.	.|0.419612	.|0.17552	.|U	.|0.170142	T|T	0.67785|0.67785	0.2930|0.2930	M|M	0.63428|0.63428	1.95|1.95	0.28696|0.28696	N|N	0.904318|0.904318	.|B;B;D;P;B;D;B	.|0.69078	.|0.215;0.129;0.993;0.904;0.215;0.997;0.255	.|B;B;P;P;B;D;B	.|0.63597	.|0.101;0.043;0.843;0.514;0.101;0.916;0.07	T|T	0.59611|0.59611	-0.7422|-0.7422	5|10	.|0.39692	.|T	.|0.17	.|.	10.8184|10.8184	0.46591|0.46591	0.0:0.9069:0.0:0.0931|0.0:0.9069:0.0:0.0931	.|.	.|218;182;218;213;223;392;313	.|B7ZMA4;A6ZJ79;A2RU51;P85298;Q6PCC7;B1AHC4;B1AHC3	.|.;.;.;RHG08_HUMAN;.;.;.	N|Q	236|313;392;392;304;213;182;182	.|ENSP00000354732:P313Q;ENSP00000262731:P392Q;ENSP00000429240:P392Q;ENSP00000374423:P304Q;ENSP00000374424:P213Q;ENSP00000337287:P182Q;ENSP00000348407:P182Q	.|ENSP00000337287:P182Q	H|P	+|+	1|2	0|0	PRR5-ARHGAP8|PRR5-ARHGAP8;ARHGAP8	43600086|43600086	0.983000|0.983000	0.35010|0.35010	0.051000|0.051000	0.19133|0.19133	0.003000|0.003000	0.03518|0.03518	5.382000|5.382000	0.66213|0.66213	2.253000|2.253000	0.74438|0.74438	0.651000|0.651000	0.88453|0.88453	CAC|CCA		0.652	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701	
RRP7A	27341	broad.mit.edu	37	22	42912179	42912179	+	Intron	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr22:42912179G>A	ENST00000323013.6	-	3	232					NM_015703.4	NP_056518.2	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A (S. cerevisiae)								nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	10						GTGAGCATCCGCAGGGCCATC	0.657																																					.												.	.	0			.	22						.						26.0	27.0	26.0					22																	42912179		2202	4300	6502	41242123	SO:0001627	intron_variant	27341	.			BC035992	CCDS14036.1	22q13.2	2008-08-08			ENSG00000189306	ENSG00000189306			24286	protein-coding gene	gene with protein product						10810093, 12087473	Standard	NM_015703		Approved	CGI-96	uc003bcq.3	Q9Y3A4	OTTHUMG00000150891	ENST00000323013.6:c.217-37C>T	22.37:g.42912179G>A		Somatic		Capture	Illumina HiSeq	Phase_I	41242123	.	A4FTX2|B2RBG4|Q0VAD0|Q5JZ94|Q6P4B5|Q8IVR9|Q8IVY0|Q8N5Q3|Q8NEY6|Q9Y3H5	Silent	SNP	ENST00000323013.6	37	CCDS14036.1																																																																																				0.657	RRP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320451.1	NM_015703	
ZBED4	9889	broad.mit.edu	37	22	50278045	50278045	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr22:50278045C>T	ENST00000216268.5	+	2	1212	c.735C>T	c.(733-735)tgC>tgT	p.C245C		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	245						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C245C(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		CGGAGAAGTGCGGCAGAGAAG	0.532																																					p.C245C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C735T	22						.						65.0	71.0	69.0					22																	50278045		2203	4300	6503	48664049	SO:0001819	synonymous_variant	9889	exon2			AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.735C>T	22.37:g.50278045C>T		Somatic		Capture	Illumina HiSeq	Phase_I	48664049	NM_014838	B2RZH1|Q1ECU0|Q9UGG8	Silent	SNP	ENST00000216268.5	37	CCDS33677.1																																																																																				0.532	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	NM_014838	
AMER3	205147	broad.mit.edu	37	2	131519839	131519840	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:131519839_131519840insC	ENST00000423981.1	+	2	304_305	c.194_195insC	c.(193-198)tgccccfs	p.CP65fs	AMER3_ENST00000321420.4_Frame_Shift_Ins_p.CP65fs	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	65					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.N67fs*106(1)									TACGACAGATGCCCCAACAAAG	0.634																																					p.C65fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.194_195insC	2						.																																			131236310	SO:0001589	frameshift_variant	205147	exon2			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.198dupC	2.37:g.131519843_131519843dupC	ENSP00000392700:p.Cys65fs	Somatic		Capture	Illumina HiSeq	Phase_I	131236309	NM_001105193	B7ZLH6	Frame_Shift_Ins	INS	ENST00000423981.1	37	CCDS2164.1																																																																																				0.634	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
UXS1	80146	broad.mit.edu	37	2	106761754	106761754	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:106761754C>T	ENST00000409501.3	-	6	406	c.349G>A	c.(349-351)Gtg>Atg	p.V117M	UXS1_ENST00000540130.1_Missense_Mutation_p.V60M|UXS1_ENST00000283148.7_Missense_Mutation_p.V122M|UXS1_ENST00000428048.2_Intron|UXS1_ENST00000479621.1_5'UTR			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	117					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)	p.V122M(1)|p.V117M(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						TTGTCCACCACGGTCACCTCG	0.552																																					p.V117M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G349A	2						.						90.0	90.0	90.0					2																	106761754		2031	4187	6218	106128186	SO:0001583	missense	80146	exon6			AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.349G>A	2.37:g.106761754C>T	ENSP00000387019:p.Val117Met	Somatic		Capture	Illumina HiSeq	Phase_I	106128186	NM_025076	Q8NBX3|Q9H5C2	Missense_Mutation	SNP	ENST00000409501.3	37	CCDS46378.1	.	.	.	.	.	.	.	.	.	.	C	32	5.171889	0.94807	.	.	ENSG00000115652	ENST00000283148;ENST00000540130;ENST00000409501;ENST00000457835	D;D;D;D	0.97352	-4.24;-4.2;-4.24;-4.35	5.84	5.84	0.93424	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99089	0.9687	H	0.96111	3.77	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.99107	1.0845	10	0.87932	D	0	-9.4627	20.1381	0.98040	0.0:1.0:0.0:0.0	.	122;117	Q8NBZ7-2;Q8NBZ7	.;UXS1_HUMAN	M	122;60;117;60	ENSP00000283148:V122M;ENSP00000438265:V60M;ENSP00000387019:V117M;ENSP00000399316:V60M	ENSP00000283148:V122M	V	-	1	0	UXS1	106128186	1.000000	0.71417	0.972000	0.41901	0.844000	0.47949	7.456000	0.80751	2.763000	0.94921	0.650000	0.86243	GTG		0.552	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329778.1	NM_025076.3	
MERTK	10461	broad.mit.edu	37	2	112786035	112786035	+	Missense_Mutation	SNP	G	G	A	rs546088670		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:112786035G>A	ENST00000295408.4	+	19	2851	c.2594G>A	c.(2593-2595)cGg>cAg	p.R865Q	MERTK_ENST00000409780.1_Missense_Mutation_p.R689Q|MERTK_ENST00000421804.2_Missense_Mutation_p.R865Q			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	865			R -> W (in dbSNP:rs2230516). {ECO:0000269|PubMed:17344846}.		apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R865Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						CCTGACGTTCGGAACCAAGCA	0.507													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18187	0.0		0.0	False		,,,				2504	0.0				p.R865Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2594A	2						.						110.0	115.0	113.0					2																	112786035		2203	4300	6503	112502506	SO:0001583	missense	10461	exon19			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2594G>A	2.37:g.112786035G>A	ENSP00000295408:p.Arg865Gln	Somatic		Capture	Illumina HiSeq	Phase_I	112502506	NM_006343	Q9HBB4	Missense_Mutation	SNP	ENST00000295408.4	37	CCDS2094.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.604058	0.00849	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000393237;ENST00000409780;ENST00000449344	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	5.81	-2.99	0.05497	Protein kinase-like domain (1);	0.894198	0.09052	N	0.855697	T	0.24928	0.0605	N	0.02721	-0.515	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.28396	-1.0045	10	0.02654	T	1	-0.3308	2.7843	0.05369	0.2831:0.3072:0.3086:0.1011	.	865	Q12866	MERTK_HUMAN	Q	865;865;524;689;189	ENSP00000295408:R865Q;ENSP00000389152:R865Q;ENSP00000387277:R689Q;ENSP00000412660:R189Q	ENSP00000295408:R865Q	R	+	2	0	MERTK	112502506	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.090000	0.11163	-0.389000	0.07786	-0.302000	0.09304	CGG		0.507	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		
MARCO	8685	broad.mit.edu	37	2	119752091	119752091	+	Missense_Mutation	SNP	G	G	A	rs200590124	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:119752091G>A	ENST00000327097.4	+	17	1693	c.1558G>A	c.(1558-1560)Gtc>Atc	p.V520I	MARCO_ENST00000541757.1_Missense_Mutation_p.V442I	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	520					apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.V520I(3)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GGAGTGCAGCGTCTGACCCGG	0.602													G|||	2	0.000399361	0.0	0.0	5008	,	,		19902	0.001		0.001	False		,,,				2504	0.0				p.V520I	GBM(8;18 374 7467 11269 32796)											.	.	3	Substitution - Missense(3)	large_intestine(1)|lung(1)|breast(1)	c.G1558A	2						.	G	ILE/VAL	0,4406		0,0,2203	113.0	88.0	96.0		1558	-1.5	0.0	2		96	1,8599	1.2+/-3.3	0,1,4299	yes	missense	MARCO	NM_006770.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	520/521	119752091	1,13005	2203	4300	6503	119468561	SO:0001583	missense	8685	exon17			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.1558G>A	2.37:g.119752091G>A	ENSP00000318916:p.Val520Ile	Somatic		Capture	Illumina HiSeq	Phase_I	119468561	NM_006770	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	CCDS2124.1	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	G	0.017	-1.509622	0.00984	0.0	1.16E-4	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.90788	-2.73;-2.69	0.758	-1.52	0.08637	.	.	.	.	.	D	0.85427	0.5694	M	0.65677	2.01	0.09310	N	1	P	0.42692	0.787	B	0.35240	0.198	T	0.71583	-0.4549	8	.	.	.	.	6.6215	0.22806	0.3734:0.0:0.6266:0.0	.	520	Q9UEW3	MARCO_HUMAN	I	520;466;442	ENSP00000318916:V520I;ENSP00000441769:V442I	.	V	+	1	0	MARCO	119468561	0.003000	0.15002	0.007000	0.13788	0.002000	0.02628	-0.355000	0.07671	-2.165000	0.00781	-2.299000	0.00261	GTC		0.602	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
MAP3K19	80122	broad.mit.edu	37	2	135745195	135745195	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:135745195G>T	ENST00000375845.3	-	7	1277	c.1247C>A	c.(1246-1248)gCt>gAt	p.A416D	MAP3K19_ENST00000358371.4_Missense_Mutation_p.A303D|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000392915.1_Missense_Mutation_p.A433D|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	416							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A416D(1)									TCTTTTTGAAGCAGCTTTATT	0.343																																					p.A416D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1247A	2						.						92.0	93.0	92.0					2																	135745195		2203	4300	6503	135461665	SO:0001583	missense	80122	exon7			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.1247C>A	2.37:g.135745195G>T	ENSP00000365005:p.Ala416Asp	Somatic		Capture	Illumina HiSeq	Phase_I	135461665	NM_025052	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.563920	0.00134	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915	T;T;T	0.69040	-0.37;-0.37;2.0	5.03	-0.156	0.13391	.	0.624908	0.14188	N	0.335550	T	0.30355	0.0762	N	0.04090	-0.28	0.09310	N	0.999997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.24799	-1.0150	10	0.02654	T	1	.	1.8085	0.03085	0.1292:0.1518:0.1446:0.5744	.	303;433;416	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	D	416;303;433	ENSP00000365005:A416D;ENSP00000351140:A303D;ENSP00000376647:A433D	ENSP00000351140:A303D	A	-	2	0	YSK4	135461665	0.000000	0.05858	0.004000	0.12327	0.073000	0.16967	0.081000	0.14823	0.065000	0.16485	-1.081000	0.02215	GCT		0.343	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
MBD5	55777	broad.mit.edu	37	2	149243479	149243479	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:149243479C>A	ENST00000407073.1	+	11	4011	c.3014C>A	c.(3013-3015)gCt>gAt	p.A1005D	MBD5_ENST00000404807.1_Missense_Mutation_p.A1238D	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1005					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.A1005D(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CCTTGCCCAGCTAACAATAAC	0.433																																					p.A1005D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3014A	2						.						112.0	117.0	115.0					2																	149243479		2203	4300	6503	148959949	SO:0001583	missense	55777	exon11			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3014C>A	2.37:g.149243479C>A	ENSP00000386049:p.Ala1005Asp	Somatic		Capture	Illumina HiSeq	Phase_I	148959949	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	37	CCDS33302.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.26|15.26	2.780700|2.780700	0.49891|0.49891	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000407073;ENST00000404807|ENST00000416015	T;T|.	0.21361|.	2.01;2.01|.	5.47|5.47	4.55|4.55	0.56014|0.56014	.|.	0.100652|.	0.43579|.	D|.	0.000558|.	T|T	0.44912|0.44912	0.1316|0.1316	N|N	0.14661|0.14661	0.345|0.345	0.33788|0.33788	D|D	0.625144|0.625144	B;B|.	0.25609|.	0.13;0.13|.	B;B|.	0.28849|.	0.095;0.095|.	T|T	0.52931|0.52931	-0.8509|-0.8509	10|5	0.66056|.	D|.	0.02|.	-7.1965|-7.1965	17.8667|17.8667	0.88797|0.88797	0.0:0.8682:0.1318:0.0|0.0:0.8682:0.1318:0.0	.|.	1238;1005|.	E9PHH0;Q9P267|.	.;MBD5_HUMAN|.	D|I	1005;1238|978	ENSP00000386049:A1005D;ENSP00000384672:A1238D|.	ENSP00000384672:A1238D|.	A|L	+|+	2|1	0|2	MBD5|MBD5	148959949|148959949	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	3.494000|3.494000	0.53273|0.53273	2.579000|2.579000	0.87056|0.87056	0.591000|0.591000	0.81541|0.81541	GCT|CTA		0.433	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
TANK	10010	broad.mit.edu	37	2	162036237	162036237	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:162036237G>A	ENST00000392749.2	+	2	303	c.64G>A	c.(64-66)Gat>Aat	p.D22N	TANK_ENST00000405852.1_Missense_Mutation_p.D22N|TANK_ENST00000402568.1_Missense_Mutation_p.D80N|TANK_ENST00000406287.1_Missense_Mutation_p.D80N|TANK_ENST00000259075.2_Missense_Mutation_p.D22N|TANK_ENST00000403609.1_Missense_Mutation_p.D22N|TANK_ENST00000457476.1_Missense_Mutation_p.D22N	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	22					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)	p.D22N(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						GGCATGCATGGATAGAGATTC	0.403																																					p.D22N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G64A	2						.						121.0	115.0	117.0					2																	162036237		2203	4300	6503	161744483	SO:0001583	missense	10010	exon2			U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.64G>A	2.37:g.162036237G>A	ENSP00000376505:p.Asp22Asn	Somatic		Capture	Illumina HiSeq	Phase_I	161744483	NM_001199135	D3DPB5|Q7Z4J6|Q92885	Missense_Mutation	SNP	ENST00000392749.2	37	CCDS2215.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.981785	0.93044	.	.	ENSG00000136560	ENST00000259075;ENST00000432002;ENST00000457476;ENST00000392749;ENST00000440506;ENST00000429217;ENST00000406287;ENST00000402568;ENST00000405852;ENST00000456358;ENST00000403609	T;T;T;T;T	0.51574	1.17;1.17;2.01;0.7;2.01	6.03	6.03	0.97812	.	0.050782	0.85682	D	0.000000	T	0.62109	0.2401	L	0.34521	1.04	0.49389	D	0.999783	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.995	T	0.62515	-0.6838	10	0.87932	D	0	-14.7684	20.1547	0.98103	0.0:0.0:1.0:0.0	.	22;22	Q92844;Q7Z4J6	TANK_HUMAN;.	N	22;22;22;22;22;22;80;80;22;48;22	ENSP00000259075:D22N;ENSP00000376505:D22N;ENSP00000384492:D80N;ENSP00000385487:D22N;ENSP00000392776:D48N	ENSP00000259075:D22N	D	+	1	0	TANK	161744483	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.432000	0.80349	2.868000	0.98415	0.555000	0.69702	GAT		0.403	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324232.1	NM_133484	
COBLL1	22837	broad.mit.edu	37	2	165551401	165551401	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:165551401C>T	ENST00000392717.2	-	13	2733	c.2729G>A	c.(2728-2730)gGc>gAc	p.G910D	COBLL1_ENST00000194871.6_Missense_Mutation_p.G939D|COBLL1_ENST00000342193.4_Missense_Mutation_p.G872D|COBLL1_ENST00000375458.2_Missense_Mutation_p.G834D|COBLL1_ENST00000409184.3_Missense_Mutation_p.G872D			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	910						extracellular vesicular exosome (GO:0070062)		p.G872D(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						AGGAGCTGTGCCAGTGTCTCT	0.438																																					p.G872D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2615A	2						.						88.0	84.0	86.0					2																	165551401		2203	4300	6503	165259647	SO:0001583	missense	22837	exon12			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.2729G>A	2.37:g.165551401C>T	ENSP00000376478:p.Gly910Asp	Somatic		Capture	Illumina HiSeq	Phase_I	165259647	NM_014900	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	37		.	.	.	.	.	.	.	.	.	.	C	10.47	1.359159	0.24598	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	6.17	3.26	0.37387	.	0.343781	0.29139	N	0.013027	T	0.51652	0.1687	M	0.62723	1.935	0.09310	N	1	D;D;D	0.76494	0.992;0.992;0.999	P;P;D	0.76071	0.875;0.875;0.987	T	0.38200	-0.9672	9	0.27785	T	0.31	-1.0388	3.3324	0.07089	0.2734:0.3753:0.2662:0.085	.	910;939;872	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	D	834;872;872;910;939	.	ENSP00000194871:G939D	G	-	2	0	COBLL1	165259647	0.000000	0.05858	0.249000	0.24280	0.128000	0.20619	-0.388000	0.07352	0.898000	0.36418	-0.165000	0.13383	GGC		0.438	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014900	
CSRNP3	80034	broad.mit.edu	37	2	166514326	166514326	+	Silent	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:166514326T>C	ENST00000342316.4	+	3	476	c.204T>C	c.(202-204)agT>agC	p.S68S	CSRNP3_ENST00000409420.1_Silent_p.S100S|CSRNP3_ENST00000314499.7_Silent_p.S68S	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	68					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S68S(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						TACATTTTAGTTGTGTCACCG	0.502																																					p.S68S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T204C	2						.						85.0	77.0	80.0					2																	166514326		2203	4300	6503	166222572	SO:0001819	synonymous_variant	80034	exon5			AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.204T>C	2.37:g.166514326T>C		Somatic		Capture	Illumina HiSeq	Phase_I	166222572	NM_001172173	B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Silent	SNP	ENST00000342316.4	37	CCDS2225.1																																																																																				0.502	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255191.2	NM_024969	
XIRP2	129446	broad.mit.edu	37	2	168107830	168107830	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:168107830C>G	ENST00000409195.1	+	9	10017	c.9928C>G	c.(9928-9930)Cag>Gag	p.Q3310E	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.Q3088E|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.Q3310E	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3135					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.Q3310E(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGAGCACACACAGAGATATGA	0.453																																					p.Q3088E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C9262G	2						.						106.0	107.0	107.0					2																	168107830		2011	4188	6199	167816076	SO:0001583	missense	129446	exon7			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9928C>G	2.37:g.168107830C>G	ENSP00000386840:p.Gln3310Glu	Somatic		Capture	Illumina HiSeq	Phase_I	167816076	NM_001199144	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.634629	0.00806	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02301	4.35;4.35;4.35	5.77	2.68	0.31781	.	0.407810	0.29205	N	0.012827	T	0.01489	0.0048	N	0.16307	0.4	0.09310	N	1	B;B;B	0.09022	0.0;0.001;0.002	B;B;B	0.09377	0.001;0.002;0.004	T	0.48779	-0.9005	10	0.09590	T	0.72	-0.1401	9.5876	0.39526	0.2242:0.4781:0.2976:0.0	.	3135;3135;3088	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	E	3310;3310;3088;724	ENSP00000386840:Q3310E;ENSP00000295237:Q3310E;ENSP00000387255:Q3088E	ENSP00000295237:Q3310E	Q	+	1	0	XIRP2	167816076	0.249000	0.23941	0.573000	0.28510	0.103000	0.19146	0.594000	0.24014	0.777000	0.33496	0.585000	0.79938	CAG		0.453	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
LRP2	4036	broad.mit.edu	37	2	170044552	170044552	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:170044552G>A	ENST00000263816.3	-	49	9541	c.9256C>T	c.(9256-9258)Cgc>Tgc	p.R3086C		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3086	LDL-receptor class A 25. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R3086C(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TCGATGCAGCGCCCATTGTCA	0.507																																					p.R3086C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C9256T	2						.						150.0	123.0	132.0					2																	170044552		2203	4300	6503	169752798	SO:0001583	missense	4036	exon49				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9256C>T	2.37:g.170044552G>A	ENSP00000263816:p.Arg3086Cys	Somatic		Capture	Illumina HiSeq	Phase_I	169752798	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.740467	0.49045	.	.	ENSG00000081479	ENST00000263816	D	0.96136	-3.92	5.82	2.45	0.29901	Growth factor, receptor (1);	0.355303	0.35436	N	0.003211	D	0.95354	0.8492	L	0.46670	1.46	0.80722	D	1	D	0.62365	0.991	P	0.56788	0.806	D	0.94587	0.7784	10	0.56958	D	0.05	.	14.1966	0.65675	0.0:0.0:0.5615:0.4385	.	3086	P98164	LRP2_HUMAN	C	3086	ENSP00000263816:R3086C	ENSP00000263816:R3086C	R	-	1	0	LRP2	169752798	0.942000	0.31987	0.997000	0.53966	0.071000	0.16799	1.217000	0.32455	0.659000	0.30945	0.650000	0.86243	CGC		0.507	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
FASTKD1	79675	broad.mit.edu	37	2	170403168	170403168	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:170403168G>A	ENST00000453153.2	-	8	1607	c.1261C>T	c.(1261-1263)Cgt>Tgt	p.R421C	FASTKD1_ENST00000453929.2_Missense_Mutation_p.R421C	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	421					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.R421C(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						GAAATAGCACGGACCAGAACA	0.393																																					p.R421C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1261T	2						.						52.0	56.0	55.0					2																	170403168		2203	4300	6503	170111414	SO:0001583	missense	79675	exon8			AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.1261C>T	2.37:g.170403168G>A	ENSP00000400513:p.Arg421Cys	Somatic		Capture	Illumina HiSeq	Phase_I	170111414	NM_024622	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Missense_Mutation	SNP	ENST00000453153.2	37	CCDS33318.1	.	.	.	.	.	.	.	.	.	.	G	1.218	-0.627720	0.03610	.	.	ENSG00000138399	ENST00000453153;ENST00000453929	T;T	0.19806	2.14;2.12	4.44	-4.03	0.04021	.	1.279750	0.05217	N	0.507894	T	0.08268	0.0206	N	0.03084	-0.415	0.09310	N	0.999999	B;B	0.16802	0.019;0.011	B;B	0.14023	0.01;0.004	T	0.32188	-0.9916	10	0.35671	T	0.21	-12.7177	5.3525	0.16043	0.2872:0.0:0.4572:0.2556	.	421;421	Q53R41-2;Q53R41	.;FAKD1_HUMAN	C	421	ENSP00000400513:R421C;ENSP00000403229:R421C	ENSP00000400513:R421C	R	-	1	0	FASTKD1	170111414	0.050000	0.20438	0.000000	0.03702	0.000000	0.00434	0.349000	0.20055	-0.570000	0.06022	-2.222000	0.00295	CGT		0.393	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337788.2	NM_024622	
METTL5	29081	broad.mit.edu	37	2	170677753	170677753	+	Silent	SNP	G	G	A	rs554782778	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:170677753G>A	ENST00000260953.5	-	3	571	c.255C>T	c.(253-255)gaC>gaT	p.D85D	METTL5_ENST00000308099.3_Silent_p.D85D|METTL5_ENST00000392640.2_Silent_p.D85D|METTL5_ENST00000410097.1_Silent_p.D85D|METTL5_ENST00000409837.1_Silent_p.D85D|METTL5_ENST00000409340.1_Intron|METTL5_ENST00000409965.1_Silent_p.D85D	NM_014168.2	NP_054887.2	Q9NRN9	METL5_HUMAN	methyltransferase like 5	85							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)	p.D85D(2)		breast(2)|central_nervous_system(1)|large_intestine(5)|lung(1)|prostate(1)	10						TTTCCAATGCGTCTTCATCTA	0.333													G|||	2	0.000399361	0.0	0.0	5008	,	,		16241	0.002		0.0	False		,,,				2504	0.0				p.D85D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C255T	2						.						96.0	95.0	95.0					2																	170677753		2203	4299	6502	170385999	SO:0001819	synonymous_variant	29081	exon3			AF201938	CCDS33320.1	2q31.1	2011-01-28			ENSG00000138382	ENSG00000138382			25006	protein-coding gene	gene with protein product						11042152	Standard	XM_005246478		Approved	HSPC133	uc002ufn.3	Q9NRN9	OTTHUMG00000154117	ENST00000260953.5:c.255C>T	2.37:g.170677753G>A		Somatic		Capture	Illumina HiSeq	Phase_I	170385999	NM_014168	D3DPC9|Q9NVX1	Silent	SNP	ENST00000260953.5	37	CCDS33320.1																																																																																				0.333	METTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333957.1	NM_014168	
ATF2	1386	broad.mit.edu	37	2	175939457	175939457	+	Silent	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:175939457G>T	ENST00000264110.2	-	14	1696	c.1398C>A	c.(1396-1398)acC>acA	p.T466T	ATF2_ENST00000409437.1_Silent_p.T350T|ATF2_ENST00000345739.5_Silent_p.T408T|ATF2_ENST00000409635.1_Silent_p.T408T|ATF2_ENST00000392544.1_Silent_p.T466T|ATF2_ENST00000426833.3_Silent_p.T448T|ATF2_ENST00000392543.2_Silent_p.T87T|ATF2_ENST00000409499.1_Silent_p.T105T|ATF2_ENST00000487334.2_3'UTR|ATF2_ENST00000538946.1_3'UTR	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2	466					adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.T466T(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	CTGCCTTGGAGGTTGAACTGA	0.488																																					p.T466T	Pancreas(17;87 705 4534 15538 30988)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1398A	2						.						94.0	82.0	86.0					2																	175939457		2203	4300	6503	175647703	SO:0001819	synonymous_variant	1386	exon14			X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.1398C>A	2.37:g.175939457G>T		Somatic		Capture	Illumina HiSeq	Phase_I	175647703	NM_001880	A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	Silent	SNP	ENST00000264110.2	37	CCDS2262.1	.	.	.	.	.	.	.	.	.	.	G	4.303	0.055478	0.08291	.	.	ENSG00000115966	ENST00000435004	.	.	.	5.83	-1.56	0.08532	.	.	.	.	.	T	0.37972	0.1023	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30736	-0.9968	4	.	.	.	-35.4295	0.0456	0.00010	0.2704:0.2041:0.2253:0.3002	.	.	.	.	I	260	.	.	L	-	1	0	ATF2	175647703	0.022000	0.18835	0.993000	0.49108	0.989000	0.77384	-0.969000	0.03813	-0.154000	0.11118	-0.145000	0.13849	CTC		0.488	ATF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255562.1	NM_001880	
TTN	7273	broad.mit.edu	37	2	179576880	179576880	+	Missense_Mutation	SNP	C	C	A	rs369108107		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:179576880C>A	ENST00000591111.1	-	94	26950	c.26726G>T	c.(26725-26727)tGc>tTc	p.C8909F	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.C9226F|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.C7982F			Q8WZ42	TITIN_HUMAN	titin	13055	Ig-like 72.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.C7982F(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCAAGCTGGCATTGTAGAGA	0.428																																					p.C7982F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G23945T	2						.						55.0	54.0	55.0					2																	179576880		1886	4117	6003	179285125	SO:0001583	missense	7273	exon93			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26726G>T	2.37:g.179576880C>A	ENSP00000465570:p.Cys8909Phe	Somatic		Capture	Illumina HiSeq	Phase_I	179285125	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	14.87	2.663735	0.47572	.	.	ENSG00000155657	ENST00000342992	T	0.62941	-0.01	5.65	5.65	0.86999	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89368	0.6695	H	0.99535	4.615	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93487	0.6832	9	0.87932	D	0	.	20.073	0.97731	0.0:1.0:0.0:0.0	.	8909	Q8WZ42	TITIN_HUMAN	F	7982	ENSP00000343764:C7982F	ENSP00000343764:C7982F	C	-	2	0	TTN	179285125	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	6.054000	0.71096	2.811000	0.96726	0.655000	0.94253	TGC		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179597687	179597687	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:179597687C>T	ENST00000591111.1	-	53	15489	c.15265G>A	c.(15265-15267)Gca>Aca	p.A5089T	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A5406T|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.A4162T|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12459	Ig-like 31.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCACAAATGCTATCCTGTAT	0.478																																					p.A4162T												.	.	0			c.G12484A	2						.						76.0	70.0	72.0					2																	179597687		1955	4154	6109	179305932	SO:0001583	missense	7273	exon52			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.15265G>A	2.37:g.179597687C>T	ENSP00000465570:p.Ala5089Thr	None		Capture	Illumina HiSeq	Phase_I	179305932	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	11.99	1.802667	0.31869	.	.	ENSG00000155657	ENST00000342992	T	0.65364	-0.15	6.17	5.29	0.74685	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.29749	0.0743	N	0.00811	-1.165	0.80722	D	1	B	0.27013	0.166	B	0.28916	0.096	T	0.23797	-1.0178	9	0.87932	D	0	.	4.9469	0.13994	0.2559:0.535:0.1391:0.0701	.	5089	Q8WZ42	TITIN_HUMAN	T	4162	ENSP00000343764:A4162T	ENSP00000343764:A4162T	A	-	1	0	TTN	179305932	0.972000	0.33761	0.997000	0.53966	0.907000	0.53573	2.603000	0.46266	1.606000	0.50161	-0.182000	0.12963	GCA		0.478	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SF3B1	23451	broad.mit.edu	37	2	198274548	198274548	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:198274548C>T	ENST00000335508.6	-	7	941	c.850G>A	c.(850-852)Gca>Aca	p.A284T		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	284	Interaction with PPP1R8.|U2AF homology region; mediates interaction with RMB39.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.A284T(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CTGGAAGTTGCGCCTCCATGG	0.517			Mis		myelodysplastic syndrome																																p.A284T			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G850A	2						.						250.0	257.0	255.0					2																	198274548		2203	4300	6503	197982793	SO:0001583	missense	23451	exon7			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.850G>A	2.37:g.198274548C>T	ENSP00000335321:p.Ala284Thr	Somatic		Capture	Illumina HiSeq	Phase_I	197982793	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962062	0.74016	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.47930	0.1472	N	0.14661	0.345	0.80722	D	1	B	0.13145	0.007	B	0.16289	0.015	T	0.35051	-0.9804	9	0.23302	T	0.38	.	19.3193	0.94231	0.0:1.0:0.0:0.0	.	284	O75533	SF3B1_HUMAN	T	284	.	ENSP00000335321:A284T	A	-	1	0	SF3B1	197982793	1.000000	0.71417	0.974000	0.42286	0.989000	0.77384	5.835000	0.69368	2.559000	0.86315	0.655000	0.94253	GCA		0.517	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
PTH2R	5746	broad.mit.edu	37	2	209353743	209353743	+	Silent	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:209353743G>T	ENST00000272847.2	+	11	1296	c.1083G>T	c.(1081-1083)ctG>ctT	p.L361L	PTH2R_ENST00000413482.1_3'UTR|AC019185.4_ENST00000424628.1_RNA	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	361					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.L361L(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	TTAGGAAACTGGCCAAATCGA	0.473																																					p.L361L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1083T	2						.						175.0	141.0	153.0					2																	209353743		2203	4300	6503	209061988	SO:0001819	synonymous_variant	5746	exon11			BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1083G>T	2.37:g.209353743G>T		Somatic		Capture	Illumina HiSeq	Phase_I	209061988	NM_005048	Q8N429	Silent	SNP	ENST00000272847.2	37	CCDS2383.1																																																																																				0.473	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048	
LANCL1	10314	broad.mit.edu	37	2	211319865	211319865	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:211319865T>C	ENST00000443314.1	-	3	715	c.373A>G	c.(373-375)Aac>Gac	p.N125D	AC007970.1_ENST00000420418.1_RNA|LANCL1_ENST00000431941.2_Missense_Mutation_p.N125D|LANCL1_ENST00000441020.3_Missense_Mutation_p.N125D|LANCL1_ENST00000450366.2_Missense_Mutation_p.N125D|LANCL1_ENST00000233714.4_Missense_Mutation_p.N125D|AC007970.1_ENST00000433296.1_RNA			O43813	LANC1_HUMAN	LanC lantibiotic synthetase component C-like 1 (bacterial)	125					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|G-protein coupled receptor activity (GO:0004930)|glutathione binding (GO:0043295)|low-density lipoprotein particle receptor binding (GO:0050750)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.N125D(1)		breast(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12				Epithelial(149;0.00562)|Lung(261;0.0468)|LUSC - Lung squamous cell carcinoma(261;0.0495)|all cancers(144;0.0569)		TTCTCATTGTTCATCTTGTGA	0.438																																					p.N125D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A373G	2						.						107.0	94.0	98.0					2																	211319865		2203	4300	6503	211028110	SO:0001583	missense	10314	exon4			Y11395	CCDS2392.1	2q33-q35	2008-05-23	2001-12-04		ENSG00000115365	ENSG00000115365			6508	protein-coding gene	gene with protein product		604155	"""LanC (bacterial lantibiotic synthetase component C)-like 1"""	GPR69A		9512664	Standard	NM_001136574		Approved	p40	uc010zjh.2	O43813	OTTHUMG00000132991	ENST00000443314.1:c.373A>G	2.37:g.211319865T>C	ENSP00000388713:p.Asn125Asp	Somatic		Capture	Illumina HiSeq	Phase_I	211028110	NM_001136574		Missense_Mutation	SNP	ENST00000443314.1	37	CCDS2392.1	.	.	.	.	.	.	.	.	.	.	T	11.88	1.770581	0.31320	.	.	ENSG00000115365	ENST00000443314;ENST00000441020;ENST00000450366;ENST00000233714;ENST00000431941;ENST00000448951	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	5.64	3.24	0.37175	Six-hairpin glycosidase-like (1);	0.441478	0.30392	N	0.009731	T	0.34803	0.0910	L	0.57536	1.79	0.26845	N	0.968287	B	0.11235	0.004	B	0.10450	0.005	T	0.28202	-1.0051	10	0.48119	T	0.1	.	5.4847	0.16743	0.0:0.1472:0.436:0.4168	.	125	O43813	LANC1_HUMAN	D	125	ENSP00000388713:N125D;ENSP00000393323:N125D;ENSP00000393597:N125D;ENSP00000233714:N125D;ENSP00000397646:N125D;ENSP00000396518:N125D	ENSP00000233714:N125D	N	-	1	0	LANCL1	211028110	1.000000	0.71417	1.000000	0.80357	0.430000	0.31655	1.702000	0.37836	1.124000	0.41980	0.528000	0.53228	AAC		0.438	LANCL1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336817.1	NM_006055	
SLC11A1	6556	broad.mit.edu	37	2	219249005	219249005	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:219249005C>G	ENST00000233202.6	+	3	530	c.190C>G	c.(190-192)Cct>Gct	p.P64A	SLC11A1_ENST00000539932.1_5'UTR|SLC11A1_ENST00000473367.1_Intron	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	64	Pro/Ser-rich.				activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)	p.P64A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTCACGGGGCCTGGCTTCCT	0.602																																					p.P64A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C190G	2						.						107.0	102.0	103.0					2																	219249005		2203	4300	6503	218957249	SO:0001583	missense	6556	exon3			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.190C>G	2.37:g.219249005C>G	ENSP00000233202:p.Pro64Ala	Somatic		Capture	Illumina HiSeq	Phase_I	218957249	NM_000578	C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	37	CCDS2415.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.852969	0.91355	.	.	ENSG00000018280	ENST00000233202	T	0.62788	-0.0	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000001	D	0.85353	0.5677	H	0.94964	3.605	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.968;1.0	D	0.89436	0.3720	10	0.87932	D	0	-19.7715	18.6237	0.91330	0.0:1.0:0.0:0.0	.	64;64;64	Q9HBK0;B4DQ73;P49279	.;.;NRAM1_HUMAN	A	64	ENSP00000233202:P64A	ENSP00000233202:P64A	P	+	1	0	SLC11A1	218957249	1.000000	0.71417	0.993000	0.49108	0.956000	0.61745	7.404000	0.79996	2.620000	0.88729	0.561000	0.74099	CCT		0.602	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578	
FAM134A	79137	broad.mit.edu	37	2	220047058	220047058	+	Missense_Mutation	SNP	G	G	A	rs199754357		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:220047058G>A	ENST00000430297.2	+	9	1475	c.1339G>A	c.(1339-1341)Ggc>Agc	p.G447S		NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	447						integral component of membrane (GO:0016021)		p.G447S(2)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGCTCTGCCCGGCACCCTGTC	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		16412	0.001		0.0	False		,,,				2504	0.0				p.G447S												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1339A	2						.						98.0	102.0	100.0					2																	220047058		2203	4300	6503	219755302	SO:0001583	missense	79137	exon9			AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.1339G>A	2.37:g.220047058G>A	ENSP00000395249:p.Gly447Ser	Somatic		Capture	Illumina HiSeq	Phase_I	219755302	NM_024293	Q6P1P5|Q9H0K7	Missense_Mutation	SNP	ENST00000430297.2	37	CCDS2434.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.014	-1.574413	0.00887	.	.	ENSG00000144567	ENST00000430297	T	0.27402	1.67	5.26	2.69	0.31865	.	0.554279	0.20114	N	0.098944	T	0.06508	0.0167	N	0.00237	-1.79	0.21841	N	0.999518	B	0.02656	0.0	B	0.01281	0.0	T	0.37079	-0.9721	9	.	.	.	-1.1331	7.3225	0.26536	0.7965:0.0:0.2035:0.0	.	447	Q8NC44	F134A_HUMAN	S	447	ENSP00000395249:G447S	.	G	+	1	0	FAM134A	219755302	1.000000	0.71417	0.469000	0.27204	0.006000	0.05464	4.339000	0.59322	0.371000	0.24564	-0.238000	0.12139	GGC		0.647	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336147.2	NM_024293	
ASIC4	55515	broad.mit.edu	37	2	220402018	220402018	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:220402018T>C	ENST00000347842.3	+	7	1714	c.1700T>C	c.(1699-1701)cTg>cCg	p.L567P	ASIC4_ENST00000358078.4_Missense_Mutation_p.L586P	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	567					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)	p.L586P(1)									CTCACGTTGCTGGAGATCCTC	0.657																																					p.L586P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1757C	2						.						37.0	33.0	34.0					2																	220402018		2203	4300	6503	220110262	SO:0001583	missense	55515	exon8			AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1700T>C	2.37:g.220402018T>C	ENSP00000326627:p.Leu567Pro	Somatic		Capture	Illumina HiSeq	Phase_I	220110262	NM_018674	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	ENST00000347842.3	37	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	T	16.93	3.258269	0.59321	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	T;T	0.68624	-0.34;-0.34	5.32	5.32	0.75619	.	0.162068	0.42294	D	0.000721	D	0.84460	0.5477	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.87792	0.2619	10	0.87932	D	0	-12.2365	14.1735	0.65525	0.0:0.0:0.0:1.0	.	567;586	Q96FT7;Q96FT7-4	ACCN4_HUMAN;.	P	567;586	ENSP00000326627:L567P;ENSP00000350786:L586P	ENSP00000326627:L567P	L	+	2	0	ACCN4	220110262	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	7.996000	0.88334	2.149000	0.67028	0.533000	0.62120	CTG		0.657	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674	
SPHKAP	80309	broad.mit.edu	37	2	228881417	228881417	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:228881417A>T	ENST00000392056.3	-	7	4199	c.4153T>A	c.(4153-4155)Tca>Aca	p.S1385T	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S1385T	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1385						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.S1385T(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CTCAAAGATGACACTGGGGGC	0.478																																					p.S1385T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T4153A	2						.						84.0	87.0	86.0					2																	228881417		2203	4300	6503	228589661	SO:0001583	missense	80309	exon7				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4153T>A	2.37:g.228881417A>T	ENSP00000375909:p.Ser1385Thr	Somatic		Capture	Illumina HiSeq	Phase_I	228589661	NM_001142644	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.447976	0.26074	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.11930	2.73;2.73	5.58	-1.78	0.07957	.	1.294450	0.04992	N	0.467403	T	0.10508	0.0257	L	0.57536	1.79	0.09310	N	1	B;P;B	0.37864	0.009;0.61;0.051	B;B;B	0.29598	0.003;0.104;0.017	T	0.33548	-0.9864	10	0.23302	T	0.38	.	3.2926	0.06954	0.3392:0.3956:0.0714:0.1938	.	416;1385;1385	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	T	1385	ENSP00000375909:S1385T;ENSP00000339886:S1385T	ENSP00000339886:S1385T	S	-	1	0	SPHKAP	228589661	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.176000	0.09811	0.026000	0.15269	0.533000	0.62120	TCA		0.478	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
ATG16L1	55054	broad.mit.edu	37	2	234172709	234172709	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:234172709A>G	ENST00000392017.4	+	4	644	c.387A>G	c.(385-387)gcA>gcG	p.A129A	ATG16L1_ENST00000392018.1_Silent_p.A129A|ATG16L1_ENST00000347464.5_Intron|ATG16L1_ENST00000392020.4_Silent_p.A129A|ATG16L1_ENST00000373525.5_Intron	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	129					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)	p.A129A(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		TGAATGAAGCAAAGTGAGTAG	0.502																																					p.A129A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A387G	2						.						120.0	117.0	118.0					2																	234172709		2203	4300	6503	233837448	SO:0001819	synonymous_variant	55054	exon4			AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.387A>G	2.37:g.234172709A>G		Somatic		Capture	Illumina HiSeq	Phase_I	233837448	NM_017974	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Silent	SNP	ENST00000392017.4	37	CCDS2503.2																																																																																				0.502	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257069.2	NM_017974	
TRPM8	79054	broad.mit.edu	37	2	234878954	234878954	+	Missense_Mutation	SNP	G	G	A	rs200649506		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:234878954G>A	ENST00000324695.4	+	17	2279	c.2239G>A	c.(2239-2241)Gcc>Acc	p.A747T	TRPM8_ENST00000433712.2_Intron	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	747					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.A747T(1)		breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	CTTCTACATCGCCTTCCTCCT	0.542																																					p.A747T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2239A	2						.	G	THR/ALA	0,4406		0,0,2203	436.0	383.0	401.0		2239	4.7	1.0	2		401	2,8598	2.2+/-6.3	0,2,4298	no	missense	TRPM8	NM_024080.4	58	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	747/1105	234878954	2,13004	2203	4300	6503	234543693	SO:0001583	missense	79054	exon17			AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.2239G>A	2.37:g.234878954G>A	ENSP00000323926:p.Ala747Thr	Somatic		Capture	Illumina HiSeq	Phase_I	234543693	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	ENST00000324695.4	37	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.472197	0.63737	0.0	2.33E-4	ENSG00000144481	ENST00000324695	T	0.66280	-0.2	4.72	4.72	0.59763	.	0.095535	0.46145	D	0.000313	T	0.41971	0.1182	N	0.20574	0.59	0.80722	D	1	P	0.45078	0.85	B	0.28553	0.091	T	0.50355	-0.8838	10	0.41790	T	0.15	-28.626	16.6947	0.85332	0.0:0.0:1.0:0.0	.	747	Q7Z2W7	TRPM8_HUMAN	T	747	ENSP00000323926:A747T	ENSP00000323926:A747T	A	+	1	0	TRPM8	234543693	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	5.801000	0.69115	2.357000	0.79964	0.558000	0.71614	GCC		0.542	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
NCOA1	8648	broad.mit.edu	37	2	24951213	24951213	+	Silent	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:24951213T>C	ENST00000406961.1	+	16	3406	c.2754T>C	c.(2752-2754)tgT>tgC	p.C918C	NCOA1_ENST00000288599.5_Silent_p.C918C|NCOA1_ENST00000407230.1_Silent_p.C767C|NCOA1_ENST00000395856.3_Silent_p.C918C|NCOA1_ENST00000405141.1_Silent_p.C918C|NCOA1_ENST00000348332.3_Silent_p.C918C|NCOA1_ENST00000538539.1_Silent_p.C918C			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	918	Interaction with CREBBP.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.C918C(2)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCTTCTCTGTCCACCCACAA	0.388			T	PAX3	alveolar rhadomyosarcoma																																p.C918C			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T2754C	2						.						81.0	74.0	77.0					2																	24951213		2203	4300	6503	24804717	SO:0001819	synonymous_variant	8648	exon14			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.2754T>C	2.37:g.24951213T>C		Somatic		Capture	Illumina HiSeq	Phase_I	24804717	NM_003743	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Silent	SNP	ENST00000406961.1	37	CCDS1712.1																																																																																				0.388	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
DNMT3A	1788	broad.mit.edu	37	2	25469589	25469589	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:25469589A>G	ENST00000264709.3	-	10	1516	c.1179T>C	c.(1177-1179)agT>agC	p.S393S	DNMT3A_ENST00000402667.1_Silent_p.S170S|DNMT3A_ENST00000474887.1_5'Flank|DNMT3A_ENST00000380746.4_Silent_p.S204S|DNMT3A_ENST00000321117.5_Silent_p.S393S	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	393	Interaction with DNMT1 and DNMT3B.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.S204S(1)|p.S393S(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCAGTGTCACTCTCATCGC	0.652			"""Mis, F, N, S"""		AML																																p.S393S			Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1179C	2						.						84.0	82.0	82.0					2																	25469589		2203	4299	6502	25323093	SO:0001819	synonymous_variant	1788	exon10				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1179T>C	2.37:g.25469589A>G		Somatic		Capture	Illumina HiSeq	Phase_I	25323093	NM_175629	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Silent	SNP	ENST00000264709.3	37	CCDS33157.1																																																																																				0.652	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	
DNMT3A	1788	broad.mit.edu	37	2	25470920	25470920	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:25470920C>T	ENST00000264709.3	-	7	1178	c.841G>A	c.(841-843)Gag>Aag	p.E281K	DNMT3A_ENST00000402667.1_Missense_Mutation_p.E58K|DNMT3A_ENST00000380746.4_Missense_Mutation_p.E92K|DNMT3A_ENST00000321117.5_Missense_Mutation_p.E281K	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	281	Interaction with DNMT1 and DNMT3B.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.E281K(1)|p.E92K(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACTCTGGCTCGTCATCGCCT	0.652			"""Mis, F, N, S"""		AML																																p.E281K			Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G841A	2						.						64.0	58.0	60.0					2																	25470920		2203	4300	6503	25324424	SO:0001583	missense	1788	exon7				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.841G>A	2.37:g.25470920C>T	ENSP00000264709:p.Glu281Lys	Somatic		Capture	Illumina HiSeq	Phase_I	25324424	NM_175629	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	37	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226709	0.79576	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.93247	-3.16;-3.19;-3.19;-3.16	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.88496	0.6452	L	0.32530	0.975	0.80722	D	1	B;B	0.31548	0.328;0.012	B;B	0.17433	0.018;0.002	D	0.85892	0.1429	10	0.25751	T	0.34	-12.2161	18.2356	0.89948	0.0:1.0:0.0:0.0	.	281;92	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	K	92;281;281;58	ENSP00000370122:E92K;ENSP00000324375:E281K;ENSP00000264709:E281K;ENSP00000384237:E58K	ENSP00000264709:E281K	E	-	1	0	DNMT3A	25324424	1.000000	0.71417	0.667000	0.29798	0.915000	0.54546	6.598000	0.74122	2.653000	0.90120	0.563000	0.77884	GAG		0.652	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	
CCDC121	79635	broad.mit.edu	37	2	27850588	27850588	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:27850588G>A	ENST00000324364.3	-	2	259	c.79C>T	c.(79-81)Cga>Tga	p.R27*	GPN1_ENST00000407583.3_5'Flank|GPN1_ENST00000610189.1_5'Flank|GPN1_ENST00000458167.2_5'Flank|GPN1_ENST00000264718.3_5'Flank|GPN1_ENST00000424214.1_5'Flank|CCDC121_ENST00000394775.3_Nonsense_Mutation_p.R189*|ZNF512_ENST00000556601.1_Intron|GPN1_ENST00000515877.1_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|GPN1_ENST00000503738.1_5'Flank	NM_024584.4	NP_078860.2	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121	27								p.R27*(1)|p.R189R(1)|p.R27R(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(172;0.155)					AACTTTTCTCGGTGTAGCTCC	0.433																																					p.R189X												.	.	3	Substitution - coding silent(2)|Substitution - Nonsense(1)	lung(2)|large_intestine(1)	c.C565T	2						.						109.0	116.0	113.0					2																	27850588		2203	4300	6503	27704092	SO:0001587	stop_gained	79635	exon2			AK125354	CCDS1759.1, CCDS46247.1	2p23.2	2008-02-05			ENSG00000176714	ENSG00000176714			25833	protein-coding gene	gene with protein product							Standard	NM_024584		Approved	FLJ43364, FLJ13646	uc002rld.3	Q6ZUS5	OTTHUMG00000128427	ENST00000324364.3:c.79C>T	2.37:g.27850588G>A	ENSP00000339087:p.Arg27*	Somatic		Capture	Illumina HiSeq	Phase_I	27704092	NM_001142683	B3KW66|J3KQZ8|Q9H8G6	Nonsense_Mutation	SNP	ENST00000324364.3	37	CCDS1759.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696277	0.30052	.	.	ENSG00000176714	ENST00000324364;ENST00000394775	.	.	.	4.21	-7.71	0.01254	.	16.406600	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-14.8479	9.3952	0.38397	0.0:0.5903:0.1644:0.2453	.	.	.	.	X	27;189	.	ENSP00000339087:R27X	R	-	1	2	CCDC121	27704092	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.107000	0.01337	-1.324000	0.02272	-0.274000	0.10170	CGA		0.433	CCDC121-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250215.1	NM_024584	
GALNT14	79623	broad.mit.edu	37	2	31215827	31215827	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:31215827C>T	ENST00000349752.5	-	2	815	c.176G>A	c.(175-177)cGg>cAg	p.R59Q	GALNT14_ENST00000324589.5_Intron|GALNT14_ENST00000420311.2_Missense_Mutation_p.R24Q|AC009305.1_ENST00000449780.1_RNA|GALNT14_ENST00000406653.1_Missense_Mutation_p.R39Q|GALNT14_ENST00000356174.3_Missense_Mutation_p.R59Q	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	59					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R59Q(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CAGATACCGCCGCTCATCAAA	0.582																																					p.R59Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G176A	2						.						91.0	77.0	82.0					2																	31215827		2203	4300	6503	31069331	SO:0001583	missense	79623	exon2			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.176G>A	2.37:g.31215827C>T	ENSP00000288988:p.Arg59Gln	Somatic		Capture	Illumina HiSeq	Phase_I	31069331	NM_024572	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	C	26.0	4.699694	0.88830	.	.	ENSG00000158089	ENST00000349752;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T	0.63096	0.48;0.49;0.23;0.5;-0.02	4.8	4.8	0.61643	.	.	.	.	.	T	0.67599	0.2910	L	0.39147	1.195	0.46113	D	0.998874	D;D;D;B;D	0.76494	0.978;0.963;0.999;0.322;0.999	P;P;P;B;P	0.58970	0.611;0.511;0.834;0.088;0.849	T	0.62402	-0.6862	9	0.21014	T	0.42	.	18.0538	0.89357	0.0:1.0:0.0:0.0	.	24;24;59;59;39	F5H263;B7Z5C5;Q96FL9-2;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	Q	59;39;59;24;59	ENSP00000288988:R59Q;ENSP00000385435:R39Q;ENSP00000348497:R59Q;ENSP00000415514:R24Q;ENSP00000406399:R59Q	ENSP00000288988:R59Q	R	-	2	0	GALNT14	31069331	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.306000	0.51881	2.479000	0.83701	0.555000	0.69702	CGG		0.582	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
THADA	63892	broad.mit.edu	37	2	43458360	43458360	+	Silent	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:43458360T>C	ENST00000405006.4	-	38	5940	c.5589A>G	c.(5587-5589)ccA>ccG	p.P1863P	THADA_ENST00000415080.2_Silent_p.P1544P|THADA_ENST00000330266.7_Intron|THADA_ENST00000405975.2_Silent_p.P1863P|AC010883.5_ENST00000423354.1_RNA	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1863								p.P1863P(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TCTCAGGGCTTGGGGGACGCC	0.522																																					p.P1863P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A5589G	2						.						38.0	40.0	40.0					2																	43458360		1946	4139	6085	43311864	SO:0001819	synonymous_variant	63892	exon38			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.5589A>G	2.37:g.43458360T>C		Somatic		Capture	Illumina HiSeq	Phase_I	43311864	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Silent	SNP	ENST00000405006.4	37	CCDS46268.1	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.505383	0.00992	.	.	ENSG00000115970	ENST00000407351	.	.	.	5.08	-4.36	0.03645	.	.	.	.	.	T	0.17408	0.0418	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26538	-1.0100	4	.	.	.	-25.2724	1.2966	0.02070	0.3125:0.1143:0.3437:0.2295	.	.	.	.	R	1103	.	.	Q	-	2	0	THADA	43311864	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	-0.720000	0.04969	-0.669000	0.05289	-1.142000	0.01873	CAA		0.522	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
TSPYL6	388951	broad.mit.edu	37	2	54482773	54482773	+	Silent	SNP	G	G	A	rs375383770		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:54482773G>A	ENST00000317802.7	-	1	636	c.516C>T	c.(514-516)gaC>gaT	p.D172D	ACYP2_ENST00000607452.1_Intron|ACYP2_ENST00000303536.4_Intron|ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000606865.1_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	172					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)		p.D172D(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						CTTCCGCCACGTCCATTTCTT	0.612																																					p.D172D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C516T	2						.	G	,	0,4142		0,0,2071	64.0	70.0	68.0		516,	0.3	0.0	2		68	2,8396		0,2,4197	no	coding-synonymous,intron	ACYP2,TSPYL6	NM_001003937.2,NM_138448.3	,	0,2,6268	AA,AG,GG		0.0238,0.0,0.0159	,	172/411,	54482773	2,12538	2071	4199	6270	54336277	SO:0001819	synonymous_variant	388951	exon1			AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.516C>T	2.37:g.54482773G>A		Somatic		Capture	Illumina HiSeq	Phase_I	54336277	NM_001003937	Q6NUJ3	Silent	SNP	ENST00000317802.7	37	CCDS42682.1																																																																																				0.612	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324069.3	XM_371494	
B3GNT2	10678	broad.mit.edu	37	2	62449850	62449850	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:62449850G>T	ENST00000301998.4	+	2	747	c.495G>T	c.(493-495)tgG>tgT	p.W165C	B3GNT2_ENST00000405767.1_Missense_Mutation_p.W165C	NM_006577.5	NP_006568.2	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	165					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)	p.W165C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)	18	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			GGGAATCCTGGGGCCAAGAAA	0.537																																					p.W165C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G495T	2						.						57.0	60.0	59.0					2																	62449850		2203	4300	6503	62303354	SO:0001583	missense	10678	exon2			AB049584	CCDS1870.1	2p15	2013-02-19	2006-04-12	2006-04-12	ENSG00000170340	ENSG00000170340		"""Beta 3-glycosyltransferases"""	15629	protein-coding gene	gene with protein product		605581	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1"""	B3GNT1		9892646, 11042166	Standard	NM_006577		Approved	B3GNT-2, BETA3GNT, B3GN-T2, B3GN-T1	uc002sbs.3	Q9NY97	OTTHUMG00000129444	ENST00000301998.4:c.495G>T	2.37:g.62449850G>T	ENSP00000305595:p.Trp165Cys	Somatic		Capture	Illumina HiSeq	Phase_I	62303354	NM_006577	Q54AC1|Q9NQQ9|Q9NQR0|Q9NUT9	Missense_Mutation	SNP	ENST00000301998.4	37	CCDS1870.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.056245	0.55325	.	.	ENSG00000170340	ENST00000301998;ENST00000405767	D;D	0.82711	-1.64;-1.64	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.94525	0.8237	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95608	0.8669	10	0.87932	D	0	.	19.9598	0.97242	0.0:0.0:1.0:0.0	.	165	Q9NY97	B3GN2_HUMAN	C	165	ENSP00000305595:W165C;ENSP00000384692:W165C	ENSP00000305595:W165C	W	+	3	0	B3GNT2	62303354	1.000000	0.71417	1.000000	0.80357	0.344000	0.29017	9.869000	0.99810	2.716000	0.92895	0.655000	0.94253	TGG		0.537	B3GNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251606.2	NM_006577	
OTX1	5013	broad.mit.edu	37	2	63283355	63283355	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:63283355C>T	ENST00000282549.2	+	5	1245	c.969C>T	c.(967-969)ggC>ggT	p.G323G	OTX1_ENST00000366671.3_Silent_p.G323G	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	323					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.G323G(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					AGGAGCCTGGCGCCGCTGCTG	0.602																																					p.G323G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C969T	2						.						68.0	58.0	62.0					2																	63283355		2203	4300	6503	63136859	SO:0001819	synonymous_variant	5013	exon5				CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.969C>T	2.37:g.63283355C>T		Somatic		Capture	Illumina HiSeq	Phase_I	63136859	NM_001199770	A6NHA2|B3KTJ4|Q53TG6	Silent	SNP	ENST00000282549.2	37	CCDS1873.1																																																																																				0.602	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1		
PELI1	57162	broad.mit.edu	37	2	64322234	64322234	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:64322234T>C	ENST00000358912.4	-	7	1301	c.859A>G	c.(859-861)Aac>Gac	p.N287D		NM_020651.3	NP_065702.2	Q96FA3	PELI1_HUMAN	pellino E3 ubiquitin protein ligase 1	287					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|protein K48-linked ubiquitination (GO:0070936)|response to dsRNA (GO:0043331)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.N287D(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	19						GCTAGTGTGTTGAACCCTACA	0.453																																					p.N287D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A859G	2						.						144.0	130.0	134.0					2																	64322234		2203	4300	6503	64175738	SO:0001583	missense	57162	exon7				CCDS1876.1	2p13.3	2012-02-23	2012-02-23		ENSG00000197329	ENSG00000197329		"""Pellino homologs"""	8827	protein-coding gene	gene with protein product		614797	"""pellino (Drosophila) homolog 1"", ""pellino homolog 1 (Drosophila)"""			11306823, 16951688	Standard	NM_020651		Approved		uc002sct.4	Q96FA3	OTTHUMG00000129511	ENST00000358912.4:c.859A>G	2.37:g.64322234T>C	ENSP00000351789:p.Asn287Asp	Somatic		Capture	Illumina HiSeq	Phase_I	64175738	NM_020651	Q96SM0|Q9GZY5|Q9HCX0	Missense_Mutation	SNP	ENST00000358912.4	37	CCDS1876.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.936260	0.73442	.	.	ENSG00000197329	ENST00000358912	T	0.47869	0.83	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	M	0.83483	2.645	0.80722	D	1	P	0.45634	0.863	P	0.49953	0.627	T	0.69877	-0.5026	10	0.72032	D	0.01	-17.4453	16.2792	0.82664	0.0:0.0:0.0:1.0	.	287	Q96FA3	PELI1_HUMAN	D	287	ENSP00000351789:N287D	ENSP00000351789:N287D	N	-	1	0	PELI1	64175738	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.243000	0.73865	0.533000	0.62120	AAC		0.453	PELI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251686.1	NM_020651	
AAK1	22848	broad.mit.edu	37	2	69723140	69723140	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:69723140G>T	ENST00000409085.4	-	17	2718	c.2342C>A	c.(2341-2343)cCt>cAt	p.P781H	AAK1_ENST00000406297.3_Missense_Mutation_p.P781H|AAK1_ENST00000409068.1_Intron	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	781					endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)	p.P781H(2)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						TACTTGAAGAGGAATGAAAGG	0.498																																					p.P781H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2342A	2						.						44.0	48.0	47.0					2																	69723140		1911	4068	5979	69576644	SO:0001583	missense	22848	exon17			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.2342C>A	2.37:g.69723140G>T	ENSP00000386456:p.Pro781His	Somatic		Capture	Illumina HiSeq	Phase_I	69576644	NM_014911	Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	ENST00000409085.4	37	CCDS1893.2	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177957	0.57692	.	.	ENSG00000115977	ENST00000409085;ENST00000406297	T;T	0.25579	1.79;1.79	4.98	4.98	0.66077	.	0.214094	0.41605	D	0.000852	T	0.26882	0.0658	N	0.24115	0.695	0.32602	N	0.525819	P;P;P	0.40083	0.577;0.702;0.577	B;P;B	0.47015	0.334;0.534;0.334	T	0.32052	-0.9921	10	0.72032	D	0.01	-5.8234	15.1118	0.72362	0.0:0.0:1.0:0.0	.	781;781;781	B7ZLC4;Q2M2I8-2;Q2M2I8	.;.;AAK1_HUMAN	H	781	ENSP00000386456:P781H;ENSP00000385181:P781H	ENSP00000385181:P781H	P	-	2	0	AAK1	69576644	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.984000	0.63838	2.590000	0.87494	0.561000	0.74099	CCT		0.498	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4	NM_014911	
SMYD5	10322	broad.mit.edu	37	2	73447283	73447283	+	Missense_Mutation	SNP	C	C	T	rs376603112		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:73447283C>T	ENST00000389501.4	+	3	355	c.310C>T	c.(310-312)Cgc>Tgc	p.R104C	SMYD5_ENST00000474652.1_3'UTR	NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	104	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R104C(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						GTGCACTGTGCGCAAAGACCT	0.587																																					p.R104C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C310T	2						.	C	CYS/ARG	1,4075		0,1,2037	47.0	49.0	48.0		310	4.8	1.0	2		48	0,8374		0,0,4187	no	missense	SMYD5	NM_006062.2	180	0,1,6224	TT,TC,CC		0.0,0.0245,0.0080	possibly-damaging	104/419	73447283	1,12449	2038	4187	6225	73300791	SO:0001583	missense	10322	exon3			U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.310C>T	2.37:g.73447283C>T	ENSP00000374152:p.Arg104Cys	Somatic		Capture	Illumina HiSeq	Phase_I	73300791	NM_006062	D6W5H3|Q13558	Missense_Mutation	SNP	ENST00000389501.4	37	CCDS33221.2	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755717	0.89843	2.45E-4	0.0	ENSG00000135632	ENST00000389501;ENST00000443900	T	0.47528	0.84	5.73	4.84	0.62591	SET domain (2);	0.113825	0.64402	D	0.000008	T	0.54679	0.1873	L	0.35723	1.085	0.80722	D	1	D	0.76494	0.999	P	0.58928	0.848	T	0.57653	-0.7774	10	0.56958	D	0.05	-18.177	14.9472	0.71042	0.1442:0.8558:0.0:0.0	.	104	Q6GMV2	SMYD5_HUMAN	C	104;77	ENSP00000374152:R104C	ENSP00000374152:R104C	R	+	1	0	SMYD5	73300791	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	3.435000	0.52849	1.531000	0.49152	0.655000	0.94253	CGC		0.587	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318301.1	NM_006062	
CTNNA2	1496	broad.mit.edu	37	2	80101241	80101241	+	Missense_Mutation	SNP	G	G	A	rs370270410		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:80101241G>A	ENST00000402739.4	+	5	630	c.625G>A	c.(625-627)Gcc>Acc	p.A209T	CTNNA2_ENST00000541047.1_Missense_Mutation_p.A209T|CTNNA2_ENST00000496558.1_Missense_Mutation_p.A209T|CTNNA2_ENST00000466387.1_Missense_Mutation_p.A209T|CTNNA2_ENST00000361291.4_Missense_Mutation_p.A243T|CTNNA2_ENST00000540488.1_Missense_Mutation_p.A209T	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	209					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.A209T(4)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GATGGCAGCCGCCCGAGGGGC	0.512																																					p.A209T												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.G625A	2						.						41.0	45.0	44.0					2																	80101241		2024	4190	6214	79954749	SO:0001583	missense	1496	exon6				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.625G>A	2.37:g.80101241G>A	ENSP00000384638:p.Ala209Thr	Somatic		Capture	Illumina HiSeq	Phase_I	79954749	NM_004389	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	G	35	5.589614	0.96590	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.72382	0.3453	M	0.88105	2.93	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.77183	-0.2681	10	0.87932	D	0	.	19.8351	0.96655	0.0:0.0:1.0:0.0	.	209;209;209	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	T	209;209;243;209;209;209	ENSP00000418191:A209T;ENSP00000419295:A209T;ENSP00000355398:A243T;ENSP00000384638:A209T;ENSP00000444675:A209T;ENSP00000441705:A209T	ENSP00000355398:A243T	A	+	1	0	CTNNA2	79954749	1.000000	0.71417	0.982000	0.44146	0.988000	0.76386	9.869000	0.99810	2.693000	0.91896	0.650000	0.86243	GCC		0.512	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
TGOLN2	10618	broad.mit.edu	37	2	85554110	85554110	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:85554110G>T	ENST00000409232.3	-	2	806	c.745C>A	c.(745-747)Cct>Act	p.P249T	TGOLN2_ENST00000377386.3_Missense_Mutation_p.P249T|TGOLN2_ENST00000444342.2_Missense_Mutation_p.P249T|TGOLN2_ENST00000282120.2_Missense_Mutation_p.P151T|TGOLN2_ENST00000398263.2_Missense_Mutation_p.P249T|TGOLN2_ENST00000409015.1_Missense_Mutation_p.P249T			O43493	TGON2_HUMAN	trans-golgi network protein 2	249	14 X 14 AA tandem repeats.					Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)		p.P249T(1)									ACCTTGTTAGGGCTGTCTTTT	0.567																																					p.P249T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C745A	2						.						96.0	96.0	96.0					2																	85554110		1952	4134	6086	85407621	SO:0001583	missense	10618	exon2			AF027515	CCDS46351.1, CCDS56126.1, CCDS56127.1	2p11.2	2012-06-25			ENSG00000152291	ENSG00000152291			15450	protein-coding gene	gene with protein product	"""trans-Golgi network protein (46, 48, 51kD isoforms)"""	603062				9422759, 21994457	Standard	NM_001206840		Approved	TGN51, TGN46, TGN48, TGN38, TTGN2	uc021vjw.1	O43493	OTTHUMG00000153017	ENST00000409232.3:c.745C>A	2.37:g.85554110G>T	ENSP00000386443:p.Pro249Thr	Somatic		Capture	Illumina HiSeq	Phase_I	85407621	NM_006464	B2R686|B8ZZ88|D6W5K3|F8WBK2|O15282|O43492|O43499|O43500|O43501|Q53G68|Q53GV2|Q6MZV1|Q6ZTM7|Q8N6T8|Q92760|Q96QL2	Missense_Mutation	SNP	ENST00000409232.3	37	CCDS56126.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231630	0.39399	.	.	ENSG00000152291	ENST00000377386;ENST00000282120;ENST00000398263;ENST00000409232;ENST00000409015;ENST00000444342	T;T;T;T;T;T	0.16073	2.69;2.37;2.41;2.73;2.69;2.68	3.96	-6.8	0.01709	.	.	.	.	.	T	0.15132	0.0365	L	0.36672	1.1	0.09310	N	1	B;B;P;B	0.46064	0.23;0.244;0.872;0.244	B;B;P;B	0.48454	0.074;0.038;0.578;0.038	T	0.18555	-1.0333	9	0.72032	D	0.01	.	7.0067	0.24840	0.3347:0.0:0.5465:0.1188	.	249;249;249;249	O43493;O43493-5;O43493-4;O43493-2	TGON2_HUMAN;.;.;.	T	249;151;249;249;249;249	ENSP00000366603:P249T;ENSP00000282120:P151T;ENSP00000381312:P249T;ENSP00000386443:P249T;ENSP00000387035:P249T;ENSP00000391190:P249T	ENSP00000282120:P151T	P	-	1	0	TGOLN2	85407621	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.736000	0.01845	-1.234000	0.02548	-0.717000	0.03617	CCT		0.567	TGOLN2-006	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329045.2	NM_006464	
ELMOD3	84173	broad.mit.edu	37	2	85617349	85617349	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:85617349C>T	ENST00000409890.2	+	13	1571	c.904C>T	c.(904-906)Cag>Tag	p.Q302*	ELMOD3_ENST00000315658.7_Nonsense_Mutation_p.Q302*|ELMOD3_ENST00000490508.1_3'UTR|ELMOD3_ENST00000409344.3_Nonsense_Mutation_p.Q302*|ELMOD3_ENST00000393852.4_Nonsense_Mutation_p.Q302*|ELMOD3_ENST00000409013.3_Nonsense_Mutation_p.Q302*			Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3	302	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.Q302*(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	12						CTGGAGGACACAGCGGAAGAC	0.557																																					p.Q302X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C904T	2						.						124.0	95.0	105.0					2																	85617349		2203	4300	6503	85470860	SO:0001587	stop_gained	84173	exon14			AF258573	CCDS1973.1, CCDS46352.1	2p11.2	2014-01-28	2008-08-14	2008-08-14	ENSG00000115459	ENSG00000115459		"""RNA binding motif (RRM) containing"""	26158	protein-coding gene	gene with protein product		615427	"""RNA binding motif protein 29"", ""RNA binding motif and ELMO/CED-12 domain 1"", ""deafness, autosomal recessive 88"""	RBM29, RBED1, DFNB88		24039609	Standard	NM_032213		Approved	FLJ21977	uc010ysn.2	Q96FG2	OTTHUMG00000130170	ENST00000409890.2:c.904C>T	2.37:g.85617349C>T	ENSP00000386304:p.Gln302*	Somatic		Capture	Illumina HiSeq	Phase_I	85470860	NM_001135021	B8ZZD6|D6W5K4|Q2M1K3|Q2XSU3|Q2XSU4|Q8NAC1|Q8TCK4|Q8WV70|Q8WY75|Q9H6Q8	Nonsense_Mutation	SNP	ENST00000409890.2	37	CCDS46352.1	.	.	.	.	.	.	.	.	.	.	C	42	9.568945	0.99207	.	.	ENSG00000115459	ENST00000409013;ENST00000409890;ENST00000409344;ENST00000393852;ENST00000315658	.	.	.	5.08	3.13	0.36017	.	0.126133	0.53938	D	0.000046	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-8.2896	13.139	0.59424	0.0:0.6946:0.3054:0.0	.	.	.	.	X	302	.	ENSP00000318264:Q302X	Q	+	1	0	ELMOD3	85470860	0.993000	0.37304	0.854000	0.33618	0.954000	0.61252	3.145000	0.50623	1.085000	0.41206	0.563000	0.77884	CAG		0.557	ELMOD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329124.1	NM_032213	
SFTPB	6439	broad.mit.edu	37	2	85892817	85892817	+	Missense_Mutation	SNP	C	C	T	rs370750455		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:85892817C>T	ENST00000519937.2	-	5	513	c.494G>A	c.(493-495)cGg>cAg	p.R165Q	SFTPB_ENST00000409383.1_Missense_Mutation_p.R177Q|SFTPB_ENST00000342375.3_Missense_Mutation_p.R165Q|SFTPB_ENST00000393822.3_Missense_Mutation_p.R177Q			P07988	PSPB_HUMAN	surfactant protein B	165					organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)		p.R165Q(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						CAGAGGGTCCCGCAGAGGTTT	0.667													c|||	1	0.000199681	0.0	0.0	5008	,	,		17274	0.0		0.001	False		,,,				2504	0.0				p.R177Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G530A	2						.		GLN/ARG,GLN/ARG	0,4406		0,0,2203	53.0	55.0	54.0		530,530	0.2	0.0	2		54	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SFTPB	NM_000542.3,NM_198843.2	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	177/394,177/394	85892817	1,13005	2203	4300	6503	85746328	SO:0001583	missense	6439	exon6			J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.494G>A	2.37:g.85892817C>T	ENSP00000428719:p.Arg165Gln	Somatic		Capture	Illumina HiSeq	Phase_I	85746328	NM_198843	Q96R04	Missense_Mutation	SNP	ENST00000519937.2	37		.	.	.	.	.	.	.	.	.	.	c	1.599	-0.526996	0.04141	0.0	1.16E-4	ENSG00000168878	ENST00000519937;ENST00000393822;ENST00000342375;ENST00000409383;ENST00000441838	T;T;T;T	0.68903	0.68;-0.18;-0.36;-0.18	1.21	0.164	0.14990	.	1.074710	0.07470	N	0.902121	T	0.37865	0.1019	N	0.08118	0	0.09310	N	1	B;B	0.19817	0.0;0.039	B;B	0.06405	0.0;0.002	T	0.22347	-1.0219	10	0.13108	T	0.6	.	2.8028	0.05419	0.0:0.6223:0.0:0.3777	.	177;165	D6W5L6;P07988	.;PSPB_HUMAN	Q	167;177;165;177;133	ENSP00000428719:R167Q;ENSP00000377409:R177Q;ENSP00000345161:R165Q;ENSP00000386346:R177Q	ENSP00000345161:R165Q	R	-	2	0	SFTPB	85746328	0.000000	0.05858	0.022000	0.16811	0.044000	0.14063	-1.761000	0.01805	0.503000	0.28060	0.506000	0.49869	CGG		0.667	SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252499.3	NM_198843	
ACTR1B	10120	broad.mit.edu	37	2	98274992	98274992	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:98274992A>G	ENST00000289228.5	-	6	771	c.555T>C	c.(553-555)atT>atC	p.I185I		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	185					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.I185I(1)		endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						CGCGGCCGGCAATGTCCACCC	0.592																																					p.I185I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T555C	2						.						142.0	127.0	132.0					2																	98274992		2203	4300	6503	97641424	SO:0001819	synonymous_variant	10120	exon6			X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.555T>C	2.37:g.98274992A>G		Somatic		Capture	Illumina HiSeq	Phase_I	97641424	NM_005735	D3DVH2|Q53SK5|Q9BRB7	Silent	SNP	ENST00000289228.5	37	CCDS2033.1																																																																																				0.592	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252973.1	NM_005735	
REV1	51455	broad.mit.edu	37	2	100020158	100020158	+	Splice_Site	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:100020158C>A	ENST00000258428.3	-	19	3394	c.3166G>T	c.(3166-3168)Gtg>Ttg	p.V1056L	REV1_ENST00000393445.3_Splice_Site_p.V1055L|REV1_ENST00000465835.1_5'UTR|RP11-527J8.1_ENST00000608144.1_RNA	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1056					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)	p.V1056L(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAAGGCTCACCAGATGCGCTG	0.468								Direct reversal of damage																													p.V1056L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3166T	2						.						121.0	116.0	118.0					2																	100020158		2203	4300	6503	99386590	SO:0001630	splice_region_variant	51455	exon19			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3166+1G>T	2.37:g.100020158C>A		Somatic		Capture	Illumina HiSeq	Phase_I	99386590	NM_016316	O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	ENST00000258428.3	37	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365932	0.41902	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.26223	1.75;1.75	5.94	5.94	0.96194	.	0.220298	0.37437	N	0.002097	T	0.32645	0.0836	M	0.63428	1.95	0.45097	D	0.998117	B;B	0.23806	0.089;0.091	B;B	0.26094	0.03;0.066	T	0.04885	-1.0920	9	.	.	.	.	20.3658	0.98878	0.0:1.0:0.0:0.0	.	1056;1055	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	L	1055;1056	ENSP00000377091:V1055L;ENSP00000258428:V1056L	.	V	-	1	0	REV1	99386590	0.996000	0.38824	0.965000	0.40720	0.508000	0.34012	3.722000	0.54948	2.820000	0.97059	0.650000	0.86243	GTG		0.468	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	Missense_Mutation
ACVR2A	92	broad.mit.edu	37	2	148683686	148683686	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:148683686delA	ENST00000241416.7	+	10	1939	c.1303delA	c.(1303-1305)aaafs	p.K437fs	ACVR2A_ENST00000535787.1_Frame_Shift_Del_p.K329fs|ACVR2A_ENST00000495775.1_3'UTR|ACVR2A_ENST00000404590.1_Frame_Shift_Del_p.K437fs	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	437	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.K437fs*5(3)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TGTTGTGCATAAAAAAAAGAG	0.368																																					p.K435fs												.	.	3	Deletion - Frameshift(3)	large_intestine(2)|ovary(1)	c.1303delA	2						.						156.0	129.0	138.0					2																	148683686		2203	4299	6502	148400156	SO:0001589	frameshift_variant	92	exon10				CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1303delA	2.37:g.148683686delA	ENSP00000241416:p.Lys437fs	Somatic		Capture	Illumina HiSeq	Phase_I	148400156	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Frame_Shift_Del	DEL	ENST00000241416.7	37	CCDS33301.1																																																																																				0.368	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
COL6A3	1293	broad.mit.edu	37	2	238287489	238287489	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr2:238287489C>T	ENST00000295550.4	-	6	2739	c.2287G>A	c.(2287-2289)Gcc>Acc	p.A763T	COL6A3_ENST00000409809.1_Missense_Mutation_p.A557T|COL6A3_ENST00000346358.4_Intron|COL6A3_ENST00000392003.2_Missense_Mutation_p.A356T|COL6A3_ENST00000392004.3_Missense_Mutation_p.A557T|COL6A3_ENST00000353578.4_Missense_Mutation_p.A557T|COL6A3_ENST00000347401.3_Missense_Mutation_p.A562T|COL6A3_ENST00000472056.1_Intron	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	763	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A763T(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AAGGCGTTGGCAGCTTGCAAA	0.577																																					p.A557T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1669A	2						.						55.0	53.0	54.0					2																	238287489		2203	4300	6503	237952228	SO:0001583	missense	1293	exon5			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.2287G>A	2.37:g.238287489C>T	ENSP00000295550:p.Ala763Thr	Somatic		Capture	Illumina HiSeq	Phase_I	237952228	NM_057167	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.575562	0.86645	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000409809;ENST00000392004;ENST00000392003	D;D;D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58;-1.58;-1.58	5.52	4.57	0.56435	von Willebrand factor, type A (3);	0.134755	0.33591	N	0.004757	D	0.91540	0.7328	M	0.88450	2.955	0.80722	D	1	D;D;D;D	0.69078	0.983;0.971;0.997;0.987	D;P;D;D	0.65773	0.938;0.868;0.925;0.926	D	0.92729	0.6198	10	0.62326	D	0.03	.	15.496	0.75648	0.1848:0.8152:0.0:0.0	.	356;557;557;763	A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;CO6A3_HUMAN	T	763;562;557;557;557;356	ENSP00000295550:A763T;ENSP00000315609:A562T;ENSP00000315873:A557T;ENSP00000386844:A557T;ENSP00000375861:A557T;ENSP00000375860:A356T	ENSP00000295550:A763T	A	-	1	0	COL6A3	237952228	0.985000	0.35326	0.995000	0.50966	0.887000	0.51463	2.801000	0.47908	2.595000	0.87683	0.655000	0.94253	GCC		0.577	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
GPR156	165829	broad.mit.edu	37	3	119900008	119900008	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:119900008A>G	ENST00000464295.1	-	8	1342	c.897T>C	c.(895-897)tgT>tgC	p.C299C	GPR156_ENST00000461057.1_Silent_p.C295C|GPR156_ENST00000315843.3_Silent_p.C299C			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)	p.C299C(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		TTGTAGTTGTACAAACAAAGA	0.458																																					p.C295C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T885C	3						.						89.0	90.0	90.0					3																	119900008		2203	4300	6503	121382698	SO:0001819	synonymous_variant	165829	exon7			AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.897T>C	3.37:g.119900008A>G		Somatic		Capture	Illumina HiSeq	Phase_I	121382698	NM_001168271	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Silent	SNP	ENST00000464295.1	37	CCDS2997.1																																																																																				0.458	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002	
IQSEC1	9922	broad.mit.edu	37	3	12950917	12950917	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:12950917G>A	ENST00000273221.4	-	11	2692	c.2476C>T	c.(2476-2478)Cgg>Tgg	p.R826W		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	826	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.R826W(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GAGGTGAGCCGGATGCCATTG	0.542																																					p.R826W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2476T	3						.						78.0	79.0	79.0					3																	12950917		2203	4300	6503	12925917	SO:0001583	missense	9922	exon11			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2476C>T	3.37:g.12950917G>A	ENSP00000273221:p.Arg826Trp	Somatic		Capture	Illumina HiSeq	Phase_I	12925917	NM_014869	O94863|Q96D85	Missense_Mutation	SNP	ENST00000273221.4	37	CCDS33703.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.27|19.27	3.794463|3.794463	0.70452|0.70452	.|.	.|.	ENSG00000144711|ENSG00000144711	ENST00000450726|ENST00000273221;ENST00000435445;ENST00000429247	.|T;T	.|0.53857	.|0.6;0.6	4.76|4.76	3.86|3.86	0.44501|0.44501	.|Pleckstrin homology-type (1);Pleckstrin homology domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.70885|0.70885	0.3275|0.3275	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.77004	.|0.94;0.989;0.94	T|T	0.74615|0.74615	-0.3606|-0.3606	4|9	.|0.87932	.|D	.|0	.|.	12.2582|12.2582	0.54634|0.54634	0.0:0.0:0.691:0.309|0.0:0.0:0.691:0.309	.|.	.|812;812;826	.|E9PG60;C9JMG9;Q6DN90	.|.;.;IQEC1_HUMAN	L|W	826|826;812;812	.|ENSP00000273221:R826W;ENSP00000402299:R812W	.|ENSP00000273221:R826W	P|R	-|-	2|1	0|2	IQSEC1|IQSEC1	12925917|12925917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	4.006000|4.006000	0.57083|0.57083	1.089000|1.089000	0.41292|0.41292	0.655000|0.655000	0.94253|0.94253	CCG|CGG		0.542	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869	
KBTBD12	166348	broad.mit.edu	37	3	127642852	127642852	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:127642852C>T	ENST00000405109.1	+	2	1415	c.948C>T	c.(946-948)taC>taT	p.Y316Y	KBTBD12_ENST00000407609.3_Intron|KBTBD12_ENST00000405256.1_Silent_p.Y316Y|KBTBD12_ENST00000343941.4_Intron			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	316								p.Y316Y(2)		endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						CTCCCAAGTACGGAGAGGGTT	0.408																																					p.Y316Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C948T	3						.						135.0	129.0	131.0					3																	127642852		1908	4108	6016	129125542	SO:0001819	synonymous_variant	166348	exon1				CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.948C>T	3.37:g.127642852C>T		Somatic		Capture	Illumina HiSeq	Phase_I	129125542	NM_207335	B5MCC6|Q6ZRK1	Silent	SNP	ENST00000405109.1	37	CCDS33848.2																																																																																				0.408	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
SEC61A1	29927	broad.mit.edu	37	3	127783785	127783785	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:127783785C>T	ENST00000243253.3	+	8	866	c.682C>T	c.(682-684)Cga>Tga	p.R228*	RUVBL1_ENST00000464873.1_3'UTR|SEC61A1_ENST00000464451.1_Nonsense_Mutation_p.R234*|SEC61A1_ENST00000483956.1_Intron|SEC61A1_ENST00000424880.2_Nonsense_Mutation_p.R108*	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	228					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)	p.R228*(1)		central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						AGACAAGGTCCGAGCCCTTCG	0.507																																					p.R228X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C682T	3						.						128.0	120.0	123.0					3																	127783785		2203	4300	6503	129266475	SO:0001587	stop_gained	29927	exon8			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.682C>T	3.37:g.127783785C>T	ENSP00000243253:p.Arg228*	Somatic		Capture	Illumina HiSeq	Phase_I	129266475	NM_013336	P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Nonsense_Mutation	SNP	ENST00000243253.3	37	CCDS3046.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.508329	0.85282	.	.	ENSG00000058262	ENST00000464451;ENST00000243253;ENST00000424880	.	.	.	5.6	2.79	0.32731	.	0.055186	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.6508	0.12594	0.1746:0.5937:0.1018:0.1299	.	.	.	.	X	234;228;108	.	ENSP00000243253:R228X	R	+	1	2	SEC61A1	129266475	1.000000	0.71417	1.000000	0.80357	0.234000	0.25298	3.301000	0.51842	0.700000	0.31782	-0.150000	0.13652	CGA		0.507	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356541.2	NM_013336	
EFCAB12	90288	broad.mit.edu	37	3	129127687	129127687	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:129127687G>A	ENST00000505956.1	-	6	1212	c.1050C>T	c.(1048-1050)tcC>tcT	p.S350S	EFCAB12_ENST00000326085.3_Silent_p.S350S	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	350							calcium ion binding (GO:0005509)	p.S350S(1)									TGTACTGGATGGAGGGGATCG	0.597																																					p.S350S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1050T	3						.						50.0	52.0	51.0					3																	129127687		2109	4222	6331	130610377	SO:0001819	synonymous_variant	90288	exon6			AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.1050C>T	3.37:g.129127687G>A		Somatic		Capture	Illumina HiSeq	Phase_I	130610377	NM_207307	Q69YX4	Silent	SNP	ENST00000505956.1	37	CCDS54638.1																																																																																				0.597	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355530.1	NM_207307	
DNAJC13	23317	broad.mit.edu	37	3	132179198	132179198	+	Silent	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:132179198T>C	ENST00000260818.6	+	14	1802	c.1554T>C	c.(1552-1554)caT>caC	p.H518H	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	518					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)		p.H518H(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TTAATTCCCATGTGGTAAGTT	0.318																																					p.H518H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1554C	3						.						41.0	45.0	43.0					3																	132179198		2203	4298	6501	133661888	SO:0001819	synonymous_variant	23317	exon14			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.1554T>C	3.37:g.132179198T>C		Somatic		Capture	Illumina HiSeq	Phase_I	133661888	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Silent	SNP	ENST00000260818.6	37	CCDS33857.1																																																																																				0.318	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
SERPINI1	5274	broad.mit.edu	37	3	167507158	167507158	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:167507158T>A	ENST00000295777.5	+	2	673	c.242T>A	c.(241-243)cTa>cAa	p.L81Q	SERPINI1_ENST00000446050.2_Missense_Mutation_p.L81Q	NM_005025.4	NP_005016.1	Q99574	NEUS_HUMAN	serpin peptidase inhibitor, clade I (neuroserpin), member 1	81					cell death (GO:0008219)|central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|peripheral nervous system development (GO:0007422)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.L81Q(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(7)|skin(2)	20						TATGACAGCCTAAAAAATGGT	0.388																																					p.L81Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T242A	3						.						86.0	92.0	90.0					3																	167507158		2203	4300	6503	168989852	SO:0001583	missense	5274	exon2			Z81326	CCDS3203.1	3q26.1	2014-02-18	2005-08-18		ENSG00000163536	ENSG00000163536		"""Serine (or cysteine) peptidase inhibitors"""	8943	protein-coding gene	gene with protein product		602445	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1"""	PI12		24172014	Standard	NM_005025		Approved	neuroserpin	uc003ffa.4	Q99574	OTTHUMG00000158450	ENST00000295777.5:c.242T>A	3.37:g.167507158T>A	ENSP00000295777:p.Leu81Gln	Somatic		Capture	Illumina HiSeq	Phase_I	168989852	NM_001122752	A8K217|D3DNP1|Q6AHZ4	Missense_Mutation	SNP	ENST00000295777.5	37	CCDS3203.1	.	.	.	.	.	.	.	.	.	.	T	11.90	1.778026	0.31502	.	.	ENSG00000163536	ENST00000472941;ENST00000446050;ENST00000295777;ENST00000472747	D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84	5.23	5.23	0.72850	Serpin domain (3);	0.065370	0.64402	D	0.000007	D	0.90783	0.7106	M	0.69185	2.1	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.89710	0.3911	10	0.33141	T	0.24	.	15.4201	0.75003	0.0:0.0:0.0:1.0	.	81	Q99574	NEUS_HUMAN	Q	81	ENSP00000420133:L81Q;ENSP00000397373:L81Q;ENSP00000295777:L81Q;ENSP00000420561:L81Q	ENSP00000295777:L81Q	L	+	2	0	SERPINI1	168989852	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	6.999000	0.76283	2.081000	0.62600	0.533000	0.62120	CTA		0.388	SERPINI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351056.1		
LRRC31	79782	broad.mit.edu	37	3	169565908	169565908	+	Splice_Site	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:169565908C>A	ENST00000316428.5	-	8	1384	c.1327G>T	c.(1327-1329)Gca>Tca	p.A443S	LRRC31_ENST00000523069.1_Splice_Site_p.E443*|LRRC31_ENST00000264676.5_Splice_Site_p.A387S	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	443								p.A443S(1)		cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			AGATACACACCCAGGAGAGCC	0.562																																					p.A443S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1327T	3						.						65.0	68.0	67.0					3																	169565908		2051	4191	6242	171048602	SO:0001630	splice_region_variant	79782	exon8			AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.1327+1G>T	3.37:g.169565908C>A		Somatic		Capture	Illumina HiSeq	Phase_I	171048602	NM_024727	B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	Missense_Mutation	SNP	ENST00000316428.5	37	CCDS43167.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.55|15.55	2.866897|2.866897	0.51588|0.51588	.|.	.|.	ENSG00000114248|ENSG00000114248	ENST00000316428;ENST00000264676|ENST00000523069	T;T|.	0.54479|.	0.57;0.57|.	4.61|4.61	3.74|3.74	0.42951|0.42951	.|.	0.230621|.	0.42294|.	D|.	0.000725|.	T|.	0.48874|.	0.1524|.	M|M	0.71206|0.71206	2.165|2.165	0.19945|0.19945	N|N	0.999947|0.999947	D;D|.	0.61697|.	0.99;0.983|.	P;P|.	0.57152|.	0.814;0.656|.	T|.	0.39057|.	-0.9632|.	9|.	.|.	.|.	.|.	-6.7318|-6.7318	7.9173|7.9173	0.29825|0.29825	0.0:0.7558:0.0:0.2442|0.0:0.7558:0.0:0.2442	.|.	387;443|.	Q6UY01-2;Q6UY01|.	.;LRC31_HUMAN|.	S|X	443;387|443	ENSP00000325978:A443S;ENSP00000264676:A387S|.	.|.	A|E	-|-	1|1	0|0	LRRC31|LRRC31	171048602|171048602	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.013000|0.013000	0.08279|0.08279	1.792000|1.792000	0.38754|0.38754	0.931000|0.931000	0.37242|0.37242	-0.136000|-0.136000	0.14681|0.14681	GCA|GAG		0.562	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378699.1	NM_024727	Missense_Mutation
TNFSF10	8743	broad.mit.edu	37	3	172227085	172227085	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:172227085C>T	ENST00000241261.2	-	4	462	c.340G>A	c.(340-342)Gtg>Atg	p.V114M	TNFSF10_ENST00000420541.2_Intron	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	114					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)	p.V114M(1)		breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CTTTCTCTCACTAGGGGAGAA	0.398																																					p.V114M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G340A	3						.						93.0	91.0	91.0					3																	172227085		2203	4300	6503	173709779	SO:0001583	missense	8743	exon4			U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.340G>A	3.37:g.172227085C>T	ENSP00000241261:p.Val114Met	Somatic		Capture	Illumina HiSeq	Phase_I	173709779	NM_003810	A1Y9B3	Missense_Mutation	SNP	ENST00000241261.2	37	CCDS3219.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.454209	0.26161	.	.	ENSG00000121858	ENST00000241261	D	0.87256	-2.23	4.71	1.16	0.20824	.	2.335370	0.01569	N	0.020499	T	0.81288	0.4791	L	0.36672	1.1	0.09310	N	1	P	0.45078	0.85	B	0.37780	0.258	T	0.69323	-0.5175	10	0.45353	T	0.12	2.1362	6.9505	0.24542	0.3071:0.4217:0.2712:0.0	.	114	P50591	TNF10_HUMAN	M	114	ENSP00000241261:V114M	ENSP00000241261:V114M	V	-	1	0	TNFSF10	173709779	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.246000	0.08878	0.052000	0.16007	0.557000	0.71058	GTG		0.398	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346601.1		
TTC14	151613	broad.mit.edu	37	3	180320687	180320687	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:180320687A>T	ENST00000296015.4	+	2	302	c.170A>T	c.(169-171)aAg>aTg	p.K57M	TTC14_ENST00000412756.2_Missense_Mutation_p.K57M|TTC14_ENST00000382584.4_Missense_Mutation_p.K57M|RP11-496B10.3_ENST00000472596.1_lincRNA	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	57							RNA binding (GO:0003723)	p.K57M(1)		endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AGAAAAGAGAAGAGAGTTGAC	0.368																																					p.K57M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A170T	3						.						33.0	36.0	35.0					3																	180320687		2202	4299	6501	181803381	SO:0001583	missense	151613	exon2			AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.170A>T	3.37:g.180320687A>T	ENSP00000296015:p.Lys57Met	Somatic		Capture	Illumina HiSeq	Phase_I	181803381	NM_133462	G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	CCDS3237.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.025525	0.75390	.	.	ENSG00000163728	ENST00000296015;ENST00000491380;ENST00000412756;ENST00000382584	T;T	0.49432	0.81;0.78	5.95	3.28	0.37604	.	0.524458	0.21965	N	0.066527	T	0.44603	0.1301	L	0.29908	0.895	0.80722	D	1	D;P;B	0.61080	0.989;0.504;0.02	P;B;B	0.55112	0.769;0.386;0.015	T	0.41161	-0.9524	10	0.72032	D	0.01	-13.0713	6.3072	0.21145	0.6679:0.0:0.3321:0.0	.	57;57;57	Q96N46-2;G5E9X0;Q96N46	.;.;TTC14_HUMAN	M	57	ENSP00000296015:K57M;ENSP00000372027:K57M	ENSP00000296015:K57M	K	+	2	0	TTC14	181803381	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.245000	0.32790	1.082000	0.41137	0.533000	0.62120	AAG		0.368	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462	
ECE2	9718	broad.mit.edu	37	3	183994750	183994750	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:183994750C>A	ENST00000402825.3	+	3	551	c.551C>A	c.(550-552)gCc>gAc	p.A184D	ECE2_ENST00000359140.4_Missense_Mutation_p.A37D|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000357474.5_Missense_Mutation_p.A112D|ECE2_ENST00000404464.3_Missense_Mutation_p.A66D	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	184					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)	p.A37D(1)|p.A184D(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TTAGCAGGTGCCTCTCTACTG	0.582																																					p.A184D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C551A	3						.						57.0	50.0	52.0					3																	183994750		2203	4300	6503	185477444	SO:0001583	missense	9718	exon3			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.551C>A	3.37:g.183994750C>A	ENSP00000384223:p.Ala184Asp	Somatic		Capture	Illumina HiSeq	Phase_I	185477444	NM_014693	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	.	.	.	.	.	.	.	.	.	.	T	15.52	2.858004	0.51376	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;T	0.83163	-1.51;-1.68;-1.69;-1.67;-1.39	4.97	4.97	0.65823	.	0.609826	0.17503	N	0.171932	T	0.65719	0.2718	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.29341	0.16;0.242;0.009;0.032;0.014;0.133	B;B;B;B;B;B	0.28385	0.006;0.089;0.017;0.008;0.006;0.058	T	0.57894	-0.7732	10	0.59425	D	0.04	-10.0466	6.0577	0.19820	0.0:0.0858:0.1631:0.7511	.	37;112;66;112;37;184	B4DKF3;B7Z1P1;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;ECE2_HUMAN	D	184;37;66;112;58	ENSP00000384223:A184D;ENSP00000352052:A37D;ENSP00000385846:A66D;ENSP00000350066:A112D;ENSP00000398444:A58D	ENSP00000350066:A112D	A	+	2	0	ECE2	185477444	0.739000	0.28196	0.250000	0.24296	0.986000	0.74619	1.436000	0.34980	0.721000	0.32231	-0.254000	0.11334	GCC		0.582	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	
ECE2	9718	broad.mit.edu	37	3	183995111	183995111	+	Missense_Mutation	SNP	G	G	A	rs200344434		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:183995111G>A	ENST00000402825.3	+	4	689	c.689G>A	c.(688-690)cGa>cAa	p.R230Q	ECE2_ENST00000359140.4_Missense_Mutation_p.R83Q|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000357474.5_Missense_Mutation_p.R158Q|ECE2_ENST00000404464.3_Missense_Mutation_p.R112Q	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	230	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)	p.R230Q(1)|p.R83Q(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCCCTGGACCGAGGGGTGAGC	0.602																																					p.R230Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G689A	3						.						64.0	65.0	65.0					3																	183995111		2203	4300	6503	185477805	SO:0001583	missense	9718	exon4			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.689G>A	3.37:g.183995111G>A	ENSP00000384223:p.Arg230Gln	Somatic		Capture	Illumina HiSeq	Phase_I	185477805	NM_014693	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	.	.	.	.	.	.	.	.	.	.	G	17.22	3.335205	0.60853	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6;-1.6	5.91	5.91	0.95273	.	0.169160	0.49305	D	0.000142	T	0.78130	0.4235	L	0.46157	1.445	0.58432	D	0.999999	P;P;P;P;P;P	0.48407	0.764;0.91;0.609;0.848;0.585;0.602	B;B;B;B;B;B	0.42916	0.122;0.402;0.103;0.241;0.064;0.042	T	0.74481	-0.3651	10	0.11485	T	0.65	-11.2389	15.2708	0.73699	0.0:0.1408:0.8592:0.0	.	83;158;112;158;83;230	B4DKF3;B7Z1P1;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;ECE2_HUMAN	Q	230;83;112;158;104	ENSP00000384223:R230Q;ENSP00000352052:R83Q;ENSP00000385846:R112Q;ENSP00000350066:R158Q;ENSP00000398444:R104Q	ENSP00000350066:R158Q	R	+	2	0	ECE2	185477805	1.000000	0.71417	0.972000	0.41901	0.997000	0.91878	4.145000	0.58065	2.801000	0.96364	0.655000	0.94253	CGA		0.602	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	
CHRD	8646	broad.mit.edu	37	3	184105733	184105733	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:184105733G>T	ENST00000204604.1	+	20	2712	c.2466G>T	c.(2464-2466)gaG>gaT	p.E822D	EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000348986.3_Missense_Mutation_p.E782D|CHRD_ENST00000545352.1_Missense_Mutation_p.E364D|CHRD_ENST00000450923.1_Missense_Mutation_p.E822D	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	822	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)	p.E822D(1)|p.G501C(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCACTGGAGAGGTGCACTGTG	0.607																																					p.E822D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2466T	3						.						44.0	36.0	39.0					3																	184105733		2203	4300	6503	185588427	SO:0001583	missense	8646	exon20			AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.2466G>T	3.37:g.184105733G>T	ENSP00000204604:p.Glu822Asp	Somatic		Capture	Illumina HiSeq	Phase_I	185588427	NM_003741	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	CCDS3266.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.92|18.92	3.724816|3.724816	0.68959|0.68959	.|.	.|.	ENSG00000090539|ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352|ENST00000342610	T;T;T;T|.	0.72615|.	-0.67;-0.67;-0.67;-0.67|.	4.95|4.95	4.07|4.07	0.47477|0.47477	von Willebrand factor, type C (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.45895|0.45895	0.1365|0.1365	L|L	0.60455|0.60455	1.87|1.87	0.24503|0.24503	N|N	0.994241|0.994241	D;D;D;D|.	0.76494|.	0.98;0.998;0.994;0.999|.	P;D;D;D|.	0.69479|.	0.887;0.962;0.96;0.964|.	T|T	0.43065|0.43065	-0.9414|-0.9414	10|6	0.62326|0.87932	D|D	0.03|0	-20.4811|-20.4811	6.9234|6.9234	0.24401|0.24401	0.274:0.0:0.726:0.0|0.274:0.0:0.726:0.0	.|.	364;782;822;822|.	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0|.	.;.;.;CHRD_HUMAN|.	D|C	822;822;782;364|501	ENSP00000204604:E822D;ENSP00000408972:E822D;ENSP00000334036:E782D;ENSP00000442948:E364D|.	ENSP00000204604:E822D|ENSP00000339396:G501C	E|G	+|+	3|1	2|0	CHRD|CHRD	185588427|185588427	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	1.660000|1.660000	0.37397|0.37397	1.072000|1.072000	0.40860|0.40860	0.557000|0.557000	0.71058|0.71058	GAG|GGT		0.607	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741	
ITPR1	3708	broad.mit.edu	37	3	4712493	4712493	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:4712493A>G	ENST00000443694.2	+	17	2042	c.2042A>G	c.(2041-2043)gAg>gGg	p.E681G	ITPR1_ENST00000357086.4_Missense_Mutation_p.E696G|ITPR1_ENST00000456211.2_Missense_Mutation_p.E681G|ITPR1_ENST00000302640.8_Missense_Mutation_p.E681G|ITPR1_ENST00000423119.2_Missense_Mutation_p.E696G|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.E696G			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	696					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.E681G(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GACGAGGAAGAGGTGTGGCTG	0.498																																					p.E696G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2087G	3						.						64.0	62.0	63.0					3																	4712493		1968	4162	6130	4687493	SO:0001583	missense	3708	exon20			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.2042A>G	3.37:g.4712493A>G	ENSP00000401671:p.Glu681Gly	Somatic		Capture	Illumina HiSeq	Phase_I	4687493	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.697751	0.88830	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.92199	-2.98;-2.98;-2.98;-2.98;-2.99;-2.98	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	D	0.95746	0.8616	M	0.79926	2.475	0.80722	D	1	P;D;D	0.89917	0.949;0.995;1.0	P;P;D	0.97110	0.53;0.856;1.0	D	0.95947	0.8951	10	0.56958	D	0.05	.	14.139	0.65308	1.0:0.0:0.0:0.0	.	681;696;696	E7EPX7;Q14643;G5E9P1	.;ITPR1_HUMAN;.	G	696;681;696;696;696;681;681	ENSP00000306253:E681G;ENSP00000346595:E696G;ENSP00000405934:E696G;ENSP00000349597:E696G;ENSP00000397885:E681G;ENSP00000401671:E681G	ENSP00000306253:E681G	E	+	2	0	ITPR1	4687493	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	9.062000	0.93920	1.920000	0.55613	0.533000	0.62120	GAG		0.498	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
CRTAP	10491	broad.mit.edu	37	3	33175678	33175678	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:33175678C>A	ENST00000320954.6	+	6	1172	c.1073C>A	c.(1072-1074)gCa>gAa	p.A358E	CRTAP_ENST00000449224.1_Missense_Mutation_p.A315E	NM_006371.4	NP_006362.1	O75718	CRTAP_HUMAN	cartilage associated protein	358					chaperone-mediated protein folding (GO:0061077)|extracellular matrix organization (GO:0030198)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation to 3-hydroxy-L-proline (GO:0018400)|protein stabilization (GO:0050821)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|macromolecular complex (GO:0032991)|proteinaceous extracellular matrix (GO:0005578)	protein complex binding (GO:0032403)	p.A358E(1)		breast(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9						GAACAGGAAGCAGTTCAGTTC	0.413																																					p.A358E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1073A	3						.						151.0	137.0	141.0					3																	33175678		2203	4300	6503	33150682	SO:0001583	missense	10491	exon6			AJ006470	CCDS2657.1	3p22	2014-09-17			ENSG00000170275	ENSG00000170275			2379	protein-coding gene	gene with protein product	"""leprecan-like 3"""	605497				9217321, 10429950	Standard	NM_006371		Approved	CASP, LEPREL3	uc003cfl.4	O75718	OTTHUMG00000130746	ENST00000320954.6:c.1073C>A	3.37:g.33175678C>A	ENSP00000323696:p.Ala358Glu	Somatic		Capture	Illumina HiSeq	Phase_I	33150682	NM_006371	B2RBL6	Missense_Mutation	SNP	ENST00000320954.6	37	CCDS2657.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626211	0.87560	.	.	ENSG00000170275	ENST00000320954;ENST00000539684;ENST00000449224	T;T	0.62639	0.09;0.01	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.82440	0.5037	M	0.87381	2.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.85761	0.1349	10	0.72032	D	0.01	-5.1579	18.5767	0.91157	0.0:1.0:0.0:0.0	.	315;358	C9JP16;O75718	.;CRTAP_HUMAN	E	358;345;315	ENSP00000323696:A358E;ENSP00000409997:A315E	ENSP00000323696:A358E	A	+	2	0	CRTAP	33150682	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.053000	0.76641	2.469000	0.83416	0.462000	0.41574	GCA		0.413	CRTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253246.3		
XIRP1	165904	broad.mit.edu	37	3	39228610	39228610	+	Missense_Mutation	SNP	C	C	T	rs144904530		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:39228610C>T	ENST00000340369.3	-	2	2555	c.2327G>A	c.(2326-2328)cGg>cAg	p.R776Q	XIRP1_ENST00000396251.1_Missense_Mutation_p.R776Q|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	776			R -> W (in dbSNP:rs9823779).		cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.R776Q(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		ATGCAGAGTCCGCAGGGTCCC	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		18077	0.0		0.001	False		,,,				2504	0.0				p.R776Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2327A	3						.	C	GLN/ARG,GLN/ARG	5,4401	9.9+/-24.2	0,5,2198	62.0	60.0	61.0		2327,2327	-0.1	0.0	3	dbSNP_134	61	0,8600		0,0,4300	yes	missense,missense	XIRP1	NM_001198621.1,NM_194293.2	43,43	0,5,6498	TT,TC,CC		0.0,0.1135,0.0384	probably-damaging,probably-damaging	776/1122,776/1844	39228610	5,13001	2203	4300	6503	39203614	SO:0001583	missense	165904	exon2			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.2327G>A	3.37:g.39228610C>T	ENSP00000343140:p.Arg776Gln	Somatic		Capture	Illumina HiSeq	Phase_I	39203614	NM_194293	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	4.979	0.181841	0.09495	0.001135	0.0	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.04970	3.52;3.9	4.11	-0.0539	0.13816	.	0.614125	0.15525	N	0.257835	T	0.05593	0.0147	L	0.51422	1.61	0.09310	N	0.999998	B;B	0.16166	0.003;0.016	B;B	0.08055	0.001;0.003	T	0.32929	-0.9888	10	0.54805	T	0.06	.	2.9896	0.05979	0.1936:0.4772:0.0:0.3292	.	776;776	Q702N8;Q702N8-2	XIRP1_HUMAN;.	Q	776	ENSP00000379550:R776Q;ENSP00000343140:R776Q	ENSP00000343140:R776Q	R	-	2	0	XIRP1	39203614	0.001000	0.12720	0.009000	0.14445	0.285000	0.27093	0.383000	0.20651	0.157000	0.19338	0.563000	0.77884	CGG		0.632	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
KLHL40	131377	broad.mit.edu	37	3	42728088	42728088	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:42728088G>T	ENST00000287777.4	+	1	1078	c.978G>T	c.(976-978)gaG>gaT	p.E326D		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	326					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)		p.E326D(1)									TCAGTGAGGAGGGCGCTGTGG	0.572																																					p.E326D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G978T	3						.						128.0	118.0	122.0					3																	42728088		2203	4300	6503	42703092	SO:0001583	missense	131377	exon1			AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.978G>T	3.37:g.42728088G>T	ENSP00000287777:p.Glu326Asp	Somatic		Capture	Illumina HiSeq	Phase_I	42703092	NM_152393	Q86SI1|Q96MR2	Missense_Mutation	SNP	ENST00000287777.4	37	CCDS2703.1	.	.	.	.	.	.	.	.	.	.	G	8.204	0.798782	0.16397	.	.	ENSG00000157119	ENST00000287777;ENST00000452129	T	0.71698	-0.59	5.09	0.502	0.16932	.	0.408600	0.28042	N	0.016825	T	0.51092	0.1654	L	0.36672	1.1	0.29805	N	0.832139	B	0.06786	0.001	B	0.04013	0.001	T	0.32929	-0.9888	10	0.13853	T	0.58	.	5.8979	0.18949	0.3117:0.0:0.4963:0.192	.	326	Q2TBA0	KBTB5_HUMAN	D	326;71	ENSP00000287777:E326D	ENSP00000287777:E326D	E	+	3	2	KBTBD5	42703092	0.122000	0.22280	1.000000	0.80357	0.992000	0.81027	-0.474000	0.06607	0.164000	0.19529	0.655000	0.94253	GAG		0.572	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256651.1	NM_152393	
FYCO1	79443	broad.mit.edu	37	3	46008499	46008499	+	Missense_Mutation	SNP	G	G	A	rs536061109		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:46008499G>A	ENST00000296137.2	-	8	2532	c.2327C>T	c.(2326-2328)gCg>gTg	p.A776V	FYCO1_ENST00000535325.1_Missense_Mutation_p.A776V	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	776					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)	p.A776V(1)		NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TTCCAGCTGCGCCTGAGACAG	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		17517	0.001		0.0	False		,,,				2504	0.0				p.A776V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2327T	3						.						54.0	55.0	55.0					3																	46008499		2203	4300	6503	45983503	SO:0001583	missense	79443	exon8			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.2327C>T	3.37:g.46008499G>A	ENSP00000296137:p.Ala776Val	Somatic		Capture	Illumina HiSeq	Phase_I	45983503	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	37	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	G	9.130	1.011215	0.19277	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.23147	1.92;1.93	5.55	1.26	0.21427	.	0.682664	0.16155	N	0.227074	T	0.15609	0.0376	L	0.33485	1.01	0.09310	N	0.999999	B;B	0.15473	0.013;0.006	B;B	0.08055	0.003;0.003	T	0.17776	-1.0358	10	0.36615	T	0.2	-2.8207	4.6087	0.12391	0.1821:0.0:0.3841:0.4338	.	776;776	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	V	776	ENSP00000296137:A776V;ENSP00000441178:A776V	ENSP00000296137:A776V	A	-	2	0	FYCO1	45983503	0.000000	0.05858	0.272000	0.24630	0.571000	0.35966	0.512000	0.22755	0.301000	0.22738	-0.181000	0.13052	GCG		0.627	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
COL7A1	1294	broad.mit.edu	37	3	48607599	48607599	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:48607599G>A	ENST00000328333.8	-	98	7560	c.7453C>T	c.(7453-7455)Cgc>Tgc	p.R2485C	COL7A1_ENST00000454817.1_Missense_Mutation_p.R2453C	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2485	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R2485C(2)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGGCCGGGGCGGCCATCTTCA	0.592																																					p.R2485C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C7453T	3						.						71.0	77.0	75.0					3																	48607599		2203	4300	6503	48582603	SO:0001583	missense	1294	exon98			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7453C>T	3.37:g.48607599G>A	ENSP00000332371:p.Arg2485Cys	Somatic		Capture	Illumina HiSeq	Phase_I	48582603	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	G	8.540	0.873008	0.17322	.	.	ENSG00000114270	ENST00000328333;ENST00000454817;ENST00000422991	D;D;D	0.94576	-3.46;-3.46;-3.46	4.89	3.11	0.35812	.	0.325448	0.22094	N	0.064707	D	0.91656	0.7363	M	0.71581	2.175	0.35010	D	0.756802	B	0.06786	0.001	B	0.10450	0.005	D	0.87797	0.2622	10	0.45353	T	0.12	.	5.0568	0.14537	0.1668:0.0:0.6674:0.1658	.	2485	Q02388	CO7A1_HUMAN	C	2485;2453;150	ENSP00000332371:R2485C;ENSP00000412569:R2453C;ENSP00000391608:R150C	ENSP00000332371:R2485C	R	-	1	0	COL7A1	48582603	1.000000	0.71417	0.716000	0.30569	0.554000	0.35429	3.449000	0.52950	0.488000	0.27723	-1.008000	0.02478	CGC		0.592	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
NDUFAF3	25915	broad.mit.edu	37	3	49062093	49062093	+	IGR	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:49062093G>A	ENST00000326925.6	+	0	2012				IMPDH2_ENST00000326739.4_Splice_Site_p.R480*|DALRD3_ENST00000496568.1_5'Flank	NM_199069.1	NP_951032.1	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 3						mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)		p.R480*(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	8						CAAGCTCACCGGACTTGGGTC	0.552																																					p.R480X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1438T	3						.						104.0	104.0	104.0					3																	49062093		2203	4300	6503	49037097	SO:0001628	intergenic_variant	3615	exon12				CCDS2784.1, CCDS2785.1	3p21.31	2012-10-12	2012-05-08	2009-03-18	ENSG00000178057	ENSG00000178057		"""Mitochondrial respiratory chain complex assembly factors"""	29918	protein-coding gene	gene with protein product		612911	"""chromosome 3 open reading frame 60"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3"""	C3orf60		12653254, 9349717	Standard	NM_199069		Approved	MGC10527, DKFZP564J0123, E3-3, 2P1	uc003cvq.3	Q9BU61	OTTHUMG00000156773		3.37:g.49062093G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49037097	NM_000884		Nonsense_Mutation	SNP	ENST00000326925.6	37	CCDS2784.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.854412|4.854412	0.91355|0.91355	.|.	.|.	ENSG00000178035|ENSG00000178035	ENST00000429182|ENST00000326739	.|.	.|.	.|.	5.68|5.68	-0.338|-0.338	0.12651|0.12651	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.35364|.	0.0929|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.38415|.	-0.9662|.	3|.	.|0.02654	.|T	.|1	-7.7775|-7.7775	17.3066|17.3066	0.87197|0.87197	0.0:0.0:0.3236:0.6764|0.0:0.0:0.3236:0.6764	.|.	.|.	.|.	.|.	L|X	435|480	.|.	.|ENSP00000321584:R480X	P|R	-|-	2|1	0|2	IMPDH2|IMPDH2	49037097|49037097	0.999000|0.999000	0.42202|0.42202	0.968000|0.968000	0.41197|0.41197	0.991000|0.991000	0.79684|0.79684	0.590000|0.590000	0.23954|0.23954	0.011000|0.011000	0.14865|0.14865	-0.169000|-0.169000	0.13324|0.13324	CCG|CGA		0.552	NDUFAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345683.2	NM_199069	
IP6K1	9807	broad.mit.edu	37	3	49765638	49765638	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:49765638C>T	ENST00000321599.4	-	5	991	c.690G>A	c.(688-690)cgG>cgA	p.R230R	IP6K1_ENST00000468463.1_Silent_p.R230R|IP6K1_ENST00000395238.1_Silent_p.R65R|IP6K1_ENST00000460540.1_Silent_p.R65R	NM_001242829.1|NM_153273.3	NP_001229758.1|NP_695005.1	Q92551	IP6K1_HUMAN	inositol hexakisphosphate kinase 1	230					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.R230R(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	15						CGCCATGCTGCCGCGTGCCCA	0.612																																					p.R230R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G690A	3						.						110.0	93.0	99.0					3																	49765638		2203	4300	6503	49740642	SO:0001819	synonymous_variant	9807	exon5			D87452	CCDS33760.1, CCDS43092.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000176095	ENSG00000176095			18360	protein-coding gene	gene with protein product		606991	"""inositol hexaphosphate kinase 1"""	IHPK1			Standard	NM_001242829		Approved	KIAA0263	uc003cxm.1	Q92551	OTTHUMG00000158197	ENST00000321599.4:c.690G>A	3.37:g.49765638C>T		Somatic		Capture	Illumina HiSeq	Phase_I	49740642	NM_153273	A8K157|A8MUX4|Q7L3I7|Q96E38	Silent	SNP	ENST00000321599.4	37	CCDS33760.1																																																																																				0.612	IP6K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350380.1	NM_153273	
CAMKV	79012	broad.mit.edu	37	3	49897114	49897114	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:49897114G>A	ENST00000477224.1	-	11	1621	c.1143C>T	c.(1141-1143)ccC>ccT	p.P381P	CAMKV_ENST00000463537.1_Intron|CAMKV_ENST00000467248.1_Silent_p.P306P|CAMKV_ENST00000488336.1_Intron|CAMKV_ENST00000466940.1_Intron|CAMKV_ENST00000296471.7_Silent_p.P353P|CAMKV_ENST00000498324.1_5'Flank			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	381	Ala-rich.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.P381P(1)		central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TACGGTCTGCGGGGGCCACAT	0.642																																					p.P381P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1143T	3						.						76.0	77.0	77.0					3																	49897114		2203	4300	6503	49872118	SO:0001819	synonymous_variant	79012	exon11			BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.1143C>T	3.37:g.49897114G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49872118	NM_024046	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Silent	SNP	ENST00000477224.1	37	CCDS33762.1																																																																																				0.642	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350584.4	NM_024046	
DOCK3	1795	broad.mit.edu	37	3	51312516	51312516	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:51312516G>A	ENST00000266037.9	+	25	2578	c.2555G>A	c.(2554-2556)cGc>cAc	p.R852H		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	852					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R852H(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CCAGAATCCCGCCGCATCCTG	0.483																																					p.P838P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2514A	3						.						183.0	183.0	183.0					3																	51312516		1901	4126	6027	51287556	SO:0001583	missense	1795	exon25			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2555G>A	3.37:g.51312516G>A	ENSP00000266037:p.Arg852His	Somatic		Capture	Illumina HiSeq	Phase_I	51287556	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	G	35	5.524854	0.96431	.	.	ENSG00000088538	ENST00000266037	T	0.15139	2.45	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.47911	-0.9080	10	0.87932	D	0	.	20.1224	0.97967	0.0:0.0:1.0:0.0	.	852	Q8IZD9	DOCK3_HUMAN	H	852	ENSP00000266037:R852H	ENSP00000266037:R852H	R	+	2	0	DOCK3	51287556	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.864000	0.99589	2.749000	0.94314	0.650000	0.86243	CGC		0.483	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
DOCK3	1795	broad.mit.edu	37	3	51392444	51392444	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:51392444C>T	ENST00000266037.9	+	41	4262	c.4239C>T	c.(4237-4239)tgC>tgT	p.C1413C		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1413	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.C1413C(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCCTACAGTGCGATGCCCAGT	0.602																																					p.R1400X												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4198T	3						.						60.0	64.0	63.0					3																	51392444		2099	4215	6314	51367484	SO:0001819	synonymous_variant	1795	exon41			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4239C>T	3.37:g.51392444C>T		Somatic		Capture	Illumina HiSeq	Phase_I	51367484	NM_004947	O15017	Silent	SNP	ENST00000266037.9	37	CCDS46835.1																																																																																				0.602	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
RRP9	9136	broad.mit.edu	37	3	51968680	51968680	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:51968680C>T	ENST00000232888.6	-	12	1220	c.1147G>A	c.(1147-1149)Gca>Aca	p.A383T		NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	383					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)	p.A383T(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		AGGAGGGCTGCCACCGACGAT	0.667																																					p.A383T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1147A	3						.						52.0	54.0	53.0					3																	51968680		2203	4300	6503	51943720	SO:0001583	missense	9136	exon12			AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.1147G>A	3.37:g.51968680C>T	ENSP00000232888:p.Ala383Thr	Somatic		Capture	Illumina HiSeq	Phase_I	51943720	NM_004704	B2R996|Q8IZ30	Missense_Mutation	SNP	ENST00000232888.6	37	CCDS2837.1	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508780	0.64410	.	.	ENSG00000114767	ENST00000232888	D	0.82803	-1.65	5.17	3.01	0.34805	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.054851	0.64402	D	0.000001	T	0.80884	0.4709	M	0.72576	2.205	0.80722	D	1	P	0.39748	0.686	B	0.38156	0.266	T	0.81773	-0.0779	10	0.52906	T	0.07	-6.9636	12.218	0.54416	0.0:0.8314:0.0:0.1686	.	383	O43818	U3IP2_HUMAN	T	383	ENSP00000232888:A383T	ENSP00000232888:A383T	A	-	1	0	RRP9	51943720	1.000000	0.71417	0.756000	0.31282	0.930000	0.56654	5.893000	0.69798	1.186000	0.42985	0.462000	0.41574	GCA		0.667	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346637.1	NM_004704	
TWF2	11344	broad.mit.edu	37	3	52265960	52265960	+	Splice_Site	SNP	G	G	T	rs370584351	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:52265960G>T	ENST00000305533.5	-	3	525	c.282C>A	c.(280-282)ccC>ccA	p.P94P	TLR9_ENST00000597542.1_5'UTR|TWF2_ENST00000499914.2_Splice_Site_p.P94P|TLR9_ENST00000494383.1_5'Flank	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	94	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)	p.P94P(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CAGGACTCACGGGGGAGTTAT	0.652											OREG0015610	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P94P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C282A	3						.						86.0	85.0	85.0					3																	52265960		2203	4300	6503	52241000	SO:0001630	splice_region_variant	11344	exon3			Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.282+1C>A	3.37:g.52265960G>T		Somatic	983	Capture	Illumina HiSeq	Phase_I	52241000	NM_007284	Q9Y3F5	Silent	SNP	ENST00000305533.5	37	CCDS2849.1																																																																																				0.652	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350199.2		Silent
PHF7	51533	broad.mit.edu	37	3	52457262	52457262	+	Missense_Mutation	SNP	C	C	T	rs372765636		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:52457262C>T	ENST00000327906.3	+	11	1735	c.1075C>T	c.(1075-1077)Cgt>Tgt	p.R359C	PHF7_ENST00000347025.2_Missense_Mutation_p.R320C	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7	359						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.R359C(1)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		AGAGTCCTCTCGTGGCAGGAG	0.493																																					p.R359C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1075T	3						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	58.0	62.0	61.0		1075,958	0.8	0.7	3		61	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PHF7	NM_016483.4,NM_173341.1	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	359/382,320/343	52457262	1,13005	2203	4300	6503	52432302	SO:0001583	missense	51533	exon11			AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495	ENST00000327906.3:c.1075C>T	3.37:g.52457262C>T	ENSP00000333024:p.Arg359Cys	Somatic		Capture	Illumina HiSeq	Phase_I	52432302	NM_016483	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	37	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	C	8.026	0.760708	0.15914	0.0	1.16E-4	ENSG00000010318	ENST00000478707;ENST00000327906;ENST00000347025;ENST00000394916	D;D;D	0.92397	-2.05;-2.05;-3.03	4.98	0.781	0.18561	.	0.508381	0.19927	N	0.102949	T	0.77857	0.4193	N	0.08118	0	0.24525	N	0.994149	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.65923	-0.6050	10	0.48119	T	0.1	-2.84	1.3207	0.02116	0.1975:0.1684:0.4566:0.1775	.	359;359	A8K856;Q9BWX1	.;PHF7_HUMAN	C	359;359;320;268	ENSP00000419316:R359C;ENSP00000333024:R359C;ENSP00000246282:R320C	ENSP00000333024:R359C	R	+	1	0	PHF7	52432302	0.949000	0.32298	0.714000	0.30535	0.211000	0.24417	0.384000	0.20668	0.283000	0.22279	-0.165000	0.13383	CGT		0.493	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
ERC2	26059	broad.mit.edu	37	3	55984497	55984497	+	Missense_Mutation	SNP	G	G	A	rs371754235		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:55984497G>A	ENST00000288221.6	-	13	2614	c.2359C>T	c.(2359-2361)Cgc>Tgc	p.R787C		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	787						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)		p.R787C(2)		breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TCTCGCCTGCGCACTTCTTCT	0.428																																					p.R785C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2353T	3						.	G	CYS/ARG	0,3908		0,0,1954	151.0	147.0	148.0		2359	5.1	0.9	3		148	1,8325		0,1,4162	no	missense	ERC2	NM_015576.1	180	0,1,6116	AA,AG,GG		0.012,0.0,0.0082	probably-damaging	787/958	55984497	1,12233	1954	4163	6117	55959537	SO:0001583	missense	26059	exon12			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2359C>T	3.37:g.55984497G>A	ENSP00000288221:p.Arg787Cys	Somatic		Capture	Illumina HiSeq	Phase_I	55959537	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	37	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054543	0.75960	0.0	1.2E-4	ENSG00000187672	ENST00000288221	T	0.46819	0.86	5.96	5.08	0.68730	.	0.173237	0.52532	N	0.000073	T	0.61489	0.2351	M	0.64997	1.995	0.48341	D	0.999635	D	0.76494	0.999	P	0.57960	0.83	T	0.65685	-0.6108	10	0.66056	D	0.02	-4.5821	15.0468	0.71833	0.068:0.0:0.932:0.0	.	787	O15083	ERC2_HUMAN	C	787	ENSP00000288221:R787C	ENSP00000288221:R787C	R	-	1	0	ERC2	55959537	1.000000	0.71417	0.948000	0.38648	0.987000	0.75469	6.945000	0.75947	1.514000	0.48869	0.650000	0.86243	CGC		0.428	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
C3orf67	200844	broad.mit.edu	37	3	58853638	58853638	+	Missense_Mutation	SNP	G	G	A	rs141916956	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:58853638G>A	ENST00000482387.1	-	6	761	c.665C>T	c.(664-666)cCg>cTg	p.P222L	C3orf67_ENST00000295966.7_Missense_Mutation_p.P222L|RP11-147N17.1_ENST00000493123.1_RNA|RP11-147N17.1_ENST00000463703.1_RNA|C3orf67_ENST00000472469.1_Intron|RP11-147N17.1_ENST00000482372.1_RNA|RP11-147N17.1_ENST00000492031.1_RNA			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	222								p.P222L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		AGGGGGATGCGGATGCATAAT	0.388																																					p.P222L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C665T	3						.	G	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	160.0	152.0	155.0		665	5.6	1.0	3	dbSNP_134	155	0,8600	1.2+/-3.3	0,0,4300	yes	missense	C3orf67	NM_198463.2	98	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	222/564	58853638	1,13005	2203	4300	6503	58828678	SO:0001583	missense	200844	exon10			AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.665C>T	3.37:g.58853638G>A	ENSP00000417122:p.Pro222Leu	Somatic		Capture	Illumina HiSeq	Phase_I	58828678	NM_198463	B9EKV6|Q6ZV69	Missense_Mutation	SNP	ENST00000482387.1	37		.	.	.	.	.	.	.	.	.	.	G	14.92	2.680473	0.47886	2.27E-4	0.0	ENSG00000163689	ENST00000295966;ENST00000482387	T;T	0.61274	0.12;0.12	5.57	5.57	0.84162	.	0.060788	0.64402	D	0.000003	T	0.59183	0.2175	M	0.71036	2.16	0.80722	D	1	D;D	0.55605	0.972;0.972	P;B	0.44447	0.45;0.286	T	0.66184	-0.5987	10	0.87932	D	0	-15.0891	11.5143	0.50511	0.0892:0.0:0.9108:0.0	.	222;222	Q6ZVT6-2;Q6ZVT6	.;CC067_HUMAN	L	222	ENSP00000295966:P222L;ENSP00000417122:P222L	ENSP00000295966:P222L	P	-	2	0	C3orf67	58828678	1.000000	0.71417	1.000000	0.80357	0.175000	0.22909	2.838000	0.48199	2.612000	0.88384	0.655000	0.94253	CCG		0.388	C3orf67-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000353803.1	NM_198463	
ROBO1	6091	broad.mit.edu	37	3	78666882	78666882	+	Silent	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:78666882G>T	ENST00000464233.1	-	27	4298	c.4185C>A	c.(4183-4185)ggC>ggA	p.G1395G	ROBO1_ENST00000436010.2_Silent_p.G1356G|ROBO1_ENST00000495273.1_Silent_p.G1350G|ROBO1_ENST00000467549.1_Silent_p.G1295G	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1395					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.G1350G(1)|p.G1372G(1)|p.G1395G(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGAAAAAGGAGCCGTCCGAAG	0.572																																					p.G1395G												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C4185A	3						.						57.0	62.0	61.0					3																	78666882		1976	4142	6118	78749572	SO:0001819	synonymous_variant	6091	exon27			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.4185C>A	3.37:g.78666882G>T		Somatic		Capture	Illumina HiSeq	Phase_I	78749572	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	37	CCDS54611.1																																																																																				0.572	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
EPHA3	2042	broad.mit.edu	37	3	89480385	89480385	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:89480385G>A	ENST00000336596.2	+	13	2447	c.2222G>A	c.(2221-2223)gGc>gAc	p.G741D	EPHA3_ENST00000494014.1_Missense_Mutation_p.G741D	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	741	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.G741D(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TCAGACATGGGCTATGTTCAC	0.493										TSP Lung(6;0.00050)																											p.G741D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2222A	3						.						168.0	145.0	153.0					3																	89480385		2203	4300	6503	89563075	SO:0001583	missense	2042	exon13			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2222G>A	3.37:g.89480385G>A	ENSP00000337451:p.Gly741Asp	Somatic		Capture	Illumina HiSeq	Phase_I	89563075	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561740	0.86335	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.65916	-0.18;-0.18	5.33	5.33	0.75918	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.77130	0.4085	L	0.60957	1.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75221	-0.3394	9	.	.	.	.	19.3726	0.94495	0.0:0.0:1.0:0.0	.	741	P29320	EPHA3_HUMAN	D	741	ENSP00000337451:G741D;ENSP00000419190:G741D	.	G	+	2	0	EPHA3	89563075	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	8.009000	0.88606	2.648000	0.89879	0.585000	0.79938	GGC		0.493	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
MASP1	5648	broad.mit.edu	37	3	187003787	187003787	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr3:187003787G>A	ENST00000337774.5	-	2	452	c.63C>T	c.(61-63)acC>acT	p.T21T	MASP1_ENST00000392472.2_Intron|MASP1_ENST00000169293.6_Silent_p.T21T|MASP1_ENST00000296280.6_Silent_p.T21T|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000392470.2_5'UTR	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	21	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.|Homodimerization. {ECO:0000250}.|Interaction with FCN2.|Interaction with MBL2.		T -> I (in dbSNP:rs1062049).		complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.T21T(2)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TTAGCTCCACGGTGTGGGCTG	0.463																																					p.T21T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C63T	3						.						83.0	75.0	78.0					3																	187003787		2203	4300	6503	188486481	SO:0001819	synonymous_variant	5648	exon2			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.63C>T	3.37:g.187003787G>A		Somatic		Capture	Illumina HiSeq	Phase_I	188486481	NM_001031849	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	ENST00000337774.5	37	CCDS33907.1																																																																																				0.463	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
HADH	3033	broad.mit.edu	37	4	108954417	108954417	+	Silent	SNP	C	C	T	rs143416676	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:108954417C>T	ENST00000309522.3	+	7	944	c.795C>T	c.(793-795)gtC>gtT	p.V265V	HADH_ENST00000510728.1_3'UTR|HADH_ENST00000403312.1_Silent_p.V341V|HADH_ENST00000603302.1_Silent_p.V282V|HADH_ENST00000454409.2_Silent_p.V269V|HADH_ENST00000505878.1_Silent_p.V269V	NM_005327.4	NP_005318	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase	591					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)	p.V265V(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	15		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)		TAGATTATGTCGGACTGGATA	0.403																																					p.V282V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C846T	4						.	C	,	1,4405	2.1+/-5.4	0,1,2202	144.0	134.0	137.0		846,795	-6.1	0.7	4	dbSNP_134	137	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	HADH	NM_001184705.2,NM_005327.4	,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,	282/332,265/315	108954417	2,13004	2203	4300	6503	109173866	SO:0001819	synonymous_variant	3033	exon8			X96752	CCDS3678.1, CCDS54790.1	4q22-q26	2012-10-02	2010-04-30		ENSG00000138796	ENSG00000138796	1.1.1.35		4799	protein-coding gene	gene with protein product		601609	"""L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain"", ""hydroxyacyl-Coenzyme A dehydrogenase"""	HADHSC		975867, 16176262	Standard	NM_001184705		Approved	HADH1, SCHAD	uc010ilx.3	Q16836	OTTHUMG00000131810	ENST00000309522.3:c.795C>T	4.37:g.108954417C>T		Somatic		Capture	Illumina HiSeq	Phase_I	109173866	NM_001184705	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Silent	SNP	ENST00000309522.3	37	CCDS3678.1																																																																																				0.403	HADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254750.2	NM_005327	
ANK2	287	broad.mit.edu	37	4	114274779	114274779	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:114274779C>T	ENST00000357077.4	+	38	5058	c.5005C>T	c.(5005-5007)Ctg>Ttg	p.L1669L	ANK2_ENST00000264366.6_Silent_p.L1636L|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1669					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.L1669L(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATGTGAGGCTCTGGCTGTTGG	0.473																																					p.L1669L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5005T	4						.						69.0	70.0	70.0					4																	114274779		2203	4299	6502	114494228	SO:0001819	synonymous_variant	287	exon38			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5005C>T	4.37:g.114274779C>T		Somatic		Capture	Illumina HiSeq	Phase_I	114494228	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	37	CCDS3702.1																																																																																				0.473	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
NDST4	64579	broad.mit.edu	37	4	115856407	115856407	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:115856407T>G	ENST00000264363.2	-	6	2169	c.1491A>C	c.(1489-1491)aaA>aaC	p.K497N		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	497	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.K497N(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CTCTGATACTTTTATCCAGTT	0.383																																					p.K497N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1491C	4						.						186.0	191.0	189.0					4																	115856407		2203	4300	6503	116075856	SO:0001583	missense	64579	exon6			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1491A>C	4.37:g.115856407T>G	ENSP00000264363:p.Lys497Asn	Somatic		Capture	Illumina HiSeq	Phase_I	116075856	NM_022569	Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	T	14.82	2.650394	0.47362	.	.	ENSG00000138653	ENST00000264363	T	0.38401	1.14	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.45357	0.1338	M	0.73753	2.245	0.47949	D	0.999558	B	0.28760	0.221	B	0.35727	0.209	T	0.46748	-0.9169	10	0.51188	T	0.08	.	14.9199	0.70829	0.0:0.0:0.0:1.0	.	497	Q9H3R1	NDST4_HUMAN	N	497	ENSP00000264363:K497N	ENSP00000264363:K497N	K	-	3	2	NDST4	116075856	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.618000	0.46393	1.912000	0.55364	0.482000	0.46254	AAA		0.383	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
NDST3	9348	broad.mit.edu	37	4	118975397	118975397	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:118975397C>T	ENST00000296499.5	+	2	735	c.332C>T	c.(331-333)gCc>gTc	p.A111V	NDST3_ENST00000433996.2_Missense_Mutation_p.A111V	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	111	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.A111V(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						ATTGAAATTGCCCCTGGAAAG	0.353																																					p.A111V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C332T	4						.						42.0	43.0	43.0					4																	118975397		2203	4298	6501	119194845	SO:0001583	missense	9348	exon2			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.332C>T	4.37:g.118975397C>T	ENSP00000296499:p.Ala111Val	Somatic		Capture	Illumina HiSeq	Phase_I	119194845	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	37	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446995	0.43429	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.47177	1.16;0.85	5.53	4.68	0.58851	.	0.049760	0.85682	D	0.000000	T	0.46964	0.1420	L	0.58969	1.84	0.48185	D	0.999607	B;B;B	0.19583	0.001;0.021;0.037	B;B;B	0.30029	0.006;0.11;0.041	T	0.39418	-0.9615	10	0.32370	T	0.25	.	13.7625	0.62975	0.0:0.9264:0.0:0.0736	.	111;111;111	B4DI67;O95803;O95803-2	.;NDST3_HUMAN;.	V	111	ENSP00000296499:A111V;ENSP00000396625:A111V	ENSP00000296499:A111V	A	+	2	0	NDST3	119194845	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	4.929000	0.63455	2.577000	0.86979	0.650000	0.86243	GCC		0.353	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
PRSS12	8492	broad.mit.edu	37	4	119237362	119237362	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:119237362C>T	ENST00000296498.3	-	6	1549	c.1267G>A	c.(1267-1269)Gtg>Atg	p.V423M		NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	423	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.V423M(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						CGACAAACCACGTATGTATTC	0.413																																					p.V423M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1267A	4						.						115.0	106.0	109.0					4																	119237362		2203	4300	6503	119456810	SO:0001583	missense	8492	exon6			AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.1267G>A	4.37:g.119237362C>T	ENSP00000296498:p.Val423Met	Somatic		Capture	Illumina HiSeq	Phase_I	119456810	NM_003619	Q9UP16	Missense_Mutation	SNP	ENST00000296498.3	37	CCDS3709.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.263093	0.80358	.	.	ENSG00000164099	ENST00000296498	T	0.48836	0.8	6.16	3.55	0.40652	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.054938	0.64402	D	0.000001	T	0.75657	0.3879	H	0.95224	3.64	0.53688	D	0.999972	D	0.89917	1.0	D	0.97110	1.0	T	0.79482	-0.1785	10	0.56958	D	0.05	.	11.7966	0.52104	0.0:0.8117:0.0:0.1883	.	423	P56730	NETR_HUMAN	M	423	ENSP00000296498:V423M	ENSP00000296498:V423M	V	-	1	0	PRSS12	119456810	0.998000	0.40836	0.485000	0.27403	0.984000	0.73092	3.829000	0.55760	0.494000	0.27859	0.650000	0.86243	GTG		0.413	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256516.2		
KIAA1109	84162	broad.mit.edu	37	4	123275094	123275094	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:123275094C>T	ENST00000264501.4	+	82	14600	c.14227C>T	c.(14227-14229)Cgt>Tgt	p.R4743C	KIAA1109_ENST00000388738.3_Missense_Mutation_p.R4743C			Q2LD37	K1109_HUMAN	KIAA1109	4743					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R4743C(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GATAACAAGGCGTCGCCATGA	0.393																																					p.R4743C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C14227T	4						.						94.0	90.0	92.0					4																	123275094		1868	4116	5984	123494544	SO:0001583	missense	84162	exon80			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14227C>T	4.37:g.123275094C>T	ENSP00000264501:p.Arg4743Cys	Somatic		Capture	Illumina HiSeq	Phase_I	123494544	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283300	0.80803	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	T;T;T	0.57436	0.4;0.4;0.4	6.04	6.04	0.98038	Fragile site-associated protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65249	0.2673	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.64918	-0.6294	10	0.62326	D	0.03	.	13.9184	0.63916	0.2654:0.7345:0.0:0.0	.	4742;4743	Q2LD37-4;Q2LD37	.;K1109_HUMAN	C	4743;4743;1412;344	ENSP00000264501:R4743C;ENSP00000373390:R4743C;ENSP00000410874:R1412C	ENSP00000264501:R4743C	R	+	1	0	KIAA1109	123494544	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.834000	0.55798	2.876000	0.98609	0.650000	0.86243	CGT		0.393	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
FBXW7	55294	broad.mit.edu	37	4	153251907	153251907	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:153251907G>A	ENST00000281708.4	-	7	2328	c.1099C>T	c.(1099-1101)Cga>Tga	p.R367*	FBXW7_ENST00000263981.5_Nonsense_Mutation_p.R287*|FBXW7_ENST00000603548.1_Nonsense_Mutation_p.R367*|FBXW7_ENST00000296555.5_Nonsense_Mutation_p.R249*|FBXW7_ENST00000393956.3_Nonsense_Mutation_p.R191*|FBXW7_ENST00000603841.1_Nonsense_Mutation_p.R367*	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	367					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R367*(10)|p.R287*(3)|p.R128*(3)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				AGTTCTCCTCGCCTCCAGTTA	0.388			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R287X			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,central_nervous_system,brain,Substitution - Nonsense,0 	.	17	Substitution - Nonsense(16)|Unknown(1)	large_intestine(10)|upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|endometrium(1)	c.C859T	4						.						335.0	288.0	304.0					4																	153251907		2203	4300	6503	153471357	SO:0001587	stop_gained	55294	exon6			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1099C>T	4.37:g.153251907G>A	ENSP00000281708:p.Arg367*	Somatic		Capture	Illumina HiSeq	Phase_I	153471357	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Nonsense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	37	6.344024	0.97489	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	.	.	.	6.07	5.22	0.72569	.	0.052867	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-12.733	16.6928	0.85326	0.0:0.0:0.8693:0.1307	.	.	.	.	X	367;249;287;191	.	ENSP00000263981:R287X	R	-	1	2	FBXW7	153471357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.642000	0.46596	1.556000	0.49512	0.650000	0.86243	CGA		0.388	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
TAPT1	202018	broad.mit.edu	37	4	16188496	16188496	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:16188496G>A	ENST00000405303.2	-	6	837	c.754C>T	c.(754-756)Cat>Tat	p.H252Y	TAPT1_ENST00000304584.8_Intron|TAPT1_ENST00000508888.1_5'UTR|TAPT1_ENST00000399920.3_Missense_Mutation_p.H141Y	NM_153365.2	NP_699196.2	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation 1	252					embryonic skeletal system development (GO:0048706)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|post-embryonic development (GO:0009791)	integral component of membrane (GO:0016021)	growth hormone-releasing hormone receptor activity (GO:0016520)	p.H252Y(1)		NS(1)|breast(2)|cervix(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	10						AGAATTGCATGCAAAACTAAT	0.269																																					p.H252Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C754T	4						.						81.0	75.0	77.0					4																	16188496		1797	4073	5870	15797594	SO:0001583	missense	202018	exon6			AK074494	CCDS47030.1	4p15.32	2014-01-28			ENSG00000169762	ENSG00000169762			26887	protein-coding gene	gene with protein product		612758				12477932	Standard	NM_153365		Approved	FLJ90013	uc010ied.1	Q6NXT6	OTTHUMG00000160177	ENST00000405303.2:c.754C>T	4.37:g.16188496G>A	ENSP00000385347:p.His252Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	15797594	NM_153365	Q8N2S3|Q9NZK9	Missense_Mutation	SNP	ENST00000405303.2	37	CCDS47030.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.610304	0.87258	.	.	ENSG00000169762	ENST00000405303;ENST00000542770;ENST00000399920	T;T	0.65364	-0.15;-0.12	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.84160	0.5411	M	0.91459	3.21	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.87399	0.2368	10	0.87932	D	0	-13.0893	19.472	0.94966	0.0:0.0:1.0:0.0	.	252	Q6NXT6	TAPT1_HUMAN	Y	252;252;141	ENSP00000385347:H252Y;ENSP00000382803:H141Y	ENSP00000382803:H141Y	H	-	1	0	TAPT1	15797594	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	9.420000	0.97426	2.665000	0.90641	0.591000	0.81541	CAT		0.269	TAPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359568.1	NM_153365	
DCHS2	54798	broad.mit.edu	37	4	155254557	155254557	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:155254557G>A	ENST00000357232.4	-	9	1305	c.1306C>T	c.(1306-1308)Cgg>Tgg	p.R436W	DCHS2_ENST00000507542.1_5'UTR|DCHS2_ENST00000339452.1_Missense_Mutation_p.R935W	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	436	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R436W(1)|p.R935W(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGGGGCTTCCGGGTGCGAATA	0.587																																					p.R935W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2803T	4						.						42.0	46.0	45.0					4																	155254557		2203	4300	6503	155474007	SO:0001583	missense	54798	exon5			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1306C>T	4.37:g.155254557G>A	ENSP00000349768:p.Arg436Trp	Somatic		Capture	Illumina HiSeq	Phase_I	155474007	NM_001142552	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663490	0.67700	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.53857	0.6;0.6	5.78	4.04	0.47022	Cadherin (4);Cadherin-like (1);	1.529110	0.04003	N	0.296797	T	0.73032	0.3535	M	0.82923	2.615	0.09310	N	0.999998	D;D	0.76494	0.998;0.999	P;P	0.60012	0.802;0.867	T	0.41662	-0.9496	10	0.56958	D	0.05	.	8.9663	0.35879	0.0717:0.0:0.6113:0.317	.	935;436	E9PC11;Q6V1P9	.;PCD23_HUMAN	W	436;935;935	ENSP00000349768:R436W;ENSP00000345062:R935W	ENSP00000345062:R935W	R	-	1	2	DCHS2	155474007	0.698000	0.27777	0.104000	0.21259	0.939000	0.58152	1.591000	0.36665	0.785000	0.33685	0.563000	0.77884	CGG		0.587	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
GLRB	2743	broad.mit.edu	37	4	158041774	158041774	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:158041774A>G	ENST00000264428.4	+	3	459	c.189A>G	c.(187-189)ttA>ttG	p.L63L	GLRB_ENST00000512619.1_Intron|GLRB_ENST00000509282.1_Silent_p.L63L|GLRB_ENST00000541722.1_Silent_p.L63L	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	63					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)	p.L63L(1)		central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	TGAACAGGTTATTGGTCAGTT	0.358																																					p.L63L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A189G	4						.						108.0	114.0	112.0					4																	158041774		2203	4300	6503	158261224	SO:0001819	synonymous_variant	2743	exon3			U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.189A>G	4.37:g.158041774A>G		Somatic		Capture	Illumina HiSeq	Phase_I	158261224	NM_001166060	A8K3K2|D3DP23|F5GWE1	Silent	SNP	ENST00000264428.4	37	CCDS3796.1																																																																																				0.358	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824	
RAPGEF2	9693	broad.mit.edu	37	4	160277271	160277271	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:160277271G>A	ENST00000264431.4	+	23	4854	c.4435G>A	c.(4435-4437)Gcc>Acc	p.A1479T		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	1479					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)	p.A1467T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CCCGCGCCTCGCCCCCTATCA	0.532																																					p.A1479T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4435A	4						.						38.0	41.0	40.0					4																	160277271		2045	4190	6235	160496721	SO:0001583	missense	9693	exon23			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.4435G>A	4.37:g.160277271G>A	ENSP00000264431:p.Ala1479Thr	Somatic		Capture	Illumina HiSeq	Phase_I	160496721	NM_014247	D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	CCDS43277.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.649378	0.67358	.	.	ENSG00000109756	ENST00000264431	T	0.43294	0.95	5.23	4.39	0.52855	.	0.331298	0.28796	N	0.014105	T	0.39172	0.1068	L	0.52573	1.65	0.37158	D	0.90244	B	0.21225	0.053	B	0.11329	0.006	T	0.43877	-0.9364	10	0.72032	D	0.01	.	13.8941	0.63761	0.0738:0.0:0.9262:0.0	.	1479	Q9Y4G8	RPGF2_HUMAN	T	1479	ENSP00000264431:A1479T	ENSP00000264431:A1479T	A	+	1	0	RAPGEF2	160496721	0.992000	0.36948	0.355000	0.25773	0.970000	0.65996	2.356000	0.44116	1.199000	0.43173	0.563000	0.77884	GCC		0.532	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247	
FSTL5	56884	broad.mit.edu	37	4	162577530	162577530	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:162577530A>T	ENST00000306100.5	-	7	1280	c.844T>A	c.(844-846)Tgg>Agg	p.W282R	FSTL5_ENST00000427802.2_Missense_Mutation_p.W281R|FSTL5_ENST00000536695.1_Missense_Mutation_p.W281R|FSTL5_ENST00000379164.4_Missense_Mutation_p.W281R|FSTL5_ENST00000511170.1_5'UTR	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	282	Ig-like 1.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.W282R(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TTCCTTTTCCAGATAATGGGA	0.353																																					p.W282R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T844A	4						.						65.0	65.0	65.0					4																	162577530		2203	4300	6503	162796980	SO:0001583	missense	56884	exon7			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.844T>A	4.37:g.162577530A>T	ENSP00000305334:p.Trp282Arg	Somatic		Capture	Illumina HiSeq	Phase_I	162796980	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.989970	0.74589	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	D;D;D;D	0.95980	-3.87;-3.87;-3.87;-3.87	5.38	5.38	0.77491	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.98745	0.9578	H	0.98786	4.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.99517	1.0957	10	0.87932	D	0	.	14.8745	0.70485	1.0:0.0:0.0:0.0	.	281;281;282	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	R	282;281;281;281	ENSP00000305334:W282R;ENSP00000368462:W281R;ENSP00000389270:W281R;ENSP00000440409:W281R	ENSP00000305334:W282R	W	-	1	0	FSTL5	162796980	1.000000	0.71417	0.999000	0.59377	0.795000	0.44927	8.880000	0.92407	2.164000	0.68074	0.528000	0.53228	TGG		0.353	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
AGA	175	broad.mit.edu	37	4	178363529	178363529	+	Start_Codon_SNP	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:178363529T>C	ENST00000264595.2	-	1	128	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	AGA_ENST00000506853.1_5'UTR|RP11-130F10.1_ENST00000507023.1_RNA	NM_000027.3|NM_001171988.1	NP_000018.2|NP_001165459.1	P20933	ASPG_HUMAN	aspartylglucosaminidase	1					protein deglycosylation (GO:0006517)|protein maturation (GO:0051604)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity (GO:0003948)|peptidase activity (GO:0008233)	p.M1V(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|skin(2)	16		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)		TTCCGCGCCATCCCTGACCAC	0.657																																					p.M1V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1G	4						.						66.0	59.0	61.0					4																	178363529		2203	4300	6503	178600523	SO:0001582	initiator_codon_variant	175	exon1			X55330	CCDS3829.1	4q34.3	2014-06-23			ENSG00000038002	ENSG00000038002	3.5.1.26		318	protein-coding gene	gene with protein product	"""glycosylasparaginase"", ""N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase"""	613228					Standard	NM_000027		Approved	ASRG	uc003iuu.2	P20933	OTTHUMG00000160723	ENST00000264595.2:c.1A>G	4.37:g.178363529T>C	ENSP00000264595:p.Met1Val	Somatic		Capture	Illumina HiSeq	Phase_I	178600523	NM_001171988	B2R7H2|D3DP47|Q4W5Q2|Q6FHN6|Q9UCK6|Q9UCK7|Q9UCK8	Missense_Mutation	SNP	ENST00000264595.2	37	CCDS3829.1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.675430	0.47781	.	.	ENSG00000038002	ENST00000264595	D	0.86694	-2.16	5.03	2.55	0.30701	.	1.016910	0.07859	N	0.966045	T	0.81182	0.4769	.	.	.	0.80722	D	1	B	0.22003	0.063	B	0.22386	0.039	T	0.78804	-0.2060	9	0.87932	D	0	-24.4913	5.1803	0.15156	0.1612:0.0897:0.0:0.7491	.	1	P20933	ASPG_HUMAN	V	1	ENSP00000264595:M1V	ENSP00000264595:M1V	M	-	1	0	AGA	178600523	0.869000	0.29996	0.706000	0.30403	0.017000	0.09413	1.662000	0.37418	2.101000	0.63845	0.533000	0.62120	ATG		0.657	AGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361916.1	NM_000027	Missense_Mutation
ZNF595	152687	broad.mit.edu	37	4	86252	86252	+	3'UTR	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:86252T>C	ENST00000339368.6	+	0	1061							Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		CCTACAAATGTAAAGAATGTG	0.383																																					p.V286A												.	.	0			c.T857C	4						.						34.0	37.0	36.0					4																	86252		2113	4252	6365	76252	SO:0001624	3_prime_UTR_variant	152687	exon4			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000339368.6:c.*1058T>C	4.37:g.86252T>C		Somatic		Capture	Illumina HiSeq	Phase_I	76252	NM_182524		Silent	SNP	ENST00000339368.6	37																																																																																					0.383	ZNF595-001	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000357814.2	NM_182524	
STK32B	55351	broad.mit.edu	37	4	5461929	5461929	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:5461929G>A	ENST00000282908.5	+	9	1305	c.883G>A	c.(883-885)Gca>Aca	p.A295T	STK32B_ENST00000512636.1_Missense_Mutation_p.A218T|RN7SKP275_ENST00000364626.1_RNA|STK32B_ENST00000508728.1_3'UTR|STK32B_ENST00000510398.1_Missense_Mutation_p.A248T	NM_018401.1	NP_060871.1			serine/threonine kinase 32B									p.A295T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						GTTCAAGAAGGCACTGATGCC	0.587											OREG0016061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A295T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G883A	4						.						157.0	129.0	138.0					4																	5461929		2203	4300	6503	5512830	SO:0001583	missense	55351	exon9			AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.883G>A	4.37:g.5461929G>A	ENSP00000282908:p.Ala295Thr	Somatic	626	Capture	Illumina HiSeq	Phase_I	5512830	NM_018401		Missense_Mutation	SNP	ENST00000282908.5	37	CCDS3380.1	.	.	.	.	.	.	.	.	.	.	G	7.326	0.618000	0.14129	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.24538	1.85;1.85;1.85	4.51	2.77	0.32553	Protein kinase-like domain (1);	0.161832	0.28354	N	0.015656	T	0.14657	0.0354	L	0.27053	0.805	0.24748	N	0.992998	B	0.18610	0.029	B	0.14023	0.01	T	0.17806	-1.0357	10	0.33141	T	0.24	.	5.1475	0.14993	0.1781:0.0:0.6589:0.163	.	295	Q9NY57	ST32B_HUMAN	T	295;218;248	ENSP00000282908:A295T;ENSP00000423209:A218T;ENSP00000420984:A248T	ENSP00000282908:A295T	A	+	1	0	STK32B	5512830	0.625000	0.27111	0.199000	0.23439	0.088000	0.18126	0.251000	0.18257	0.453000	0.26858	-0.309000	0.09137	GCA		0.587	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
GPR125	166647	broad.mit.edu	37	4	22390718	22390718	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:22390718C>T	ENST00000334304.5	-	18	2985	c.2716G>A	c.(2716-2718)Gca>Aca	p.A906T	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	906					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)	p.A906T(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CACTAGGGTGCGTTTGGCCGA	0.408																																					p.A906T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2716A	4						.						199.0	211.0	207.0					4																	22390718		2203	4300	6503	21999816	SO:0001583	missense	166647	exon18			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.2716G>A	4.37:g.22390718C>T	ENSP00000334952:p.Ala906Thr	Somatic		Capture	Illumina HiSeq	Phase_I	21999816	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	37	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850785	0.71719	.	.	ENSG00000152990	ENST00000334304	T	0.53857	0.6	5.85	5.85	0.93711	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.48943	0.1528	L	0.39245	1.2	0.80722	D	1	B;D	0.56746	0.213;0.977	B;P	0.46110	0.064;0.504	T	0.36504	-0.9745	10	0.26408	T	0.33	-13.3325	15.7232	0.77732	0.1373:0.8627:0.0:0.0	.	763;906	Q8IWK6-3;Q8IWK6	.;GP125_HUMAN	T	906	ENSP00000334952:A906T	ENSP00000334952:A906T	A	-	1	0	GPR125	21999816	0.997000	0.39634	0.889000	0.34880	0.972000	0.66771	3.633000	0.54295	2.755000	0.94549	0.655000	0.94253	GCA		0.408	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
TLR10	81793	broad.mit.edu	37	4	38775803	38775803	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:38775803T>C	ENST00000308973.4	-	4	2014	c.1409A>G	c.(1408-1410)gAa>gGa	p.E470G	TLR10_ENST00000506111.1_Missense_Mutation_p.E470G|TLR10_ENST00000361424.2_Missense_Mutation_p.E470G|TLR10_ENST00000508334.1_Missense_Mutation_p.E470G|TLR10_ENST00000507953.1_5'Flank	NM_001017388.2|NM_001195107.1|NM_030956.3	NP_001017388.1|NP_001182036.1|NP_112218.2	Q9BXR5	TLR10_HUMAN	toll-like receptor 10	470					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of inflammatory response (GO:0050729)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.E470G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(2)	25						AATATTTAGTTCTCGTAAGGC	0.363																																					p.E470G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1409G	4						.						89.0	95.0	93.0					4																	38775803		2203	4300	6503	38452198	SO:0001583	missense	81793	exon4			AF296673	CCDS3445.1	4p14	2009-11-23			ENSG00000174123	ENSG00000174123		"""CD molecules"""	15634	protein-coding gene	gene with protein product		606270				11267672	Standard	NM_030956		Approved	CD290	uc003gtk.3	Q9BXR5	OTTHUMG00000128578	ENST00000308973.4:c.1409A>G	4.37:g.38775803T>C	ENSP00000308925:p.Glu470Gly	Somatic		Capture	Illumina HiSeq	Phase_I	38452198	NM_030956	A8K7L1|B3Y668|D1CS21|D1CS22|Q32MI7|Q32MI8|Q5FWG4|Q6UXL3	Missense_Mutation	SNP	ENST00000308973.4	37	CCDS3445.1	.	.	.	.	.	.	.	.	.	.	T	11.37	1.618302	0.28801	.	.	ENSG00000174123	ENST00000308973;ENST00000506111;ENST00000361424;ENST00000508334	T;T;T;T	0.26373	1.74;1.74;1.74;1.74	5.32	5.32	0.75619	.	0.000000	0.48767	D	0.000166	T	0.47451	0.1446	M	0.62266	1.93	0.34386	D	0.693624	D	0.62365	0.991	D	0.65684	0.937	T	0.63413	-0.6643	10	0.87932	D	0	.	15.2878	0.73843	0.0:0.0:0.0:1.0	.	470	Q9BXR5	TLR10_HUMAN	G	470	ENSP00000308925:E470G;ENSP00000421483:E470G;ENSP00000354459:E470G;ENSP00000424923:E470G	ENSP00000308925:E470G	E	-	2	0	TLR10	38452198	0.993000	0.37304	0.251000	0.24312	0.297000	0.27493	3.302000	0.51849	2.014000	0.59158	0.477000	0.44152	GAA		0.363	TLR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250430.1		
ATP10D	57205	broad.mit.edu	37	4	47537967	47537967	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:47537967G>A	ENST00000273859.3	+	7	1201	c.932G>A	c.(931-933)cGc>cAc	p.R311H	ATP10D_ENST00000504445.1_Missense_Mutation_p.R311H	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	311					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R311H(2)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						CGGTATAAGCGCAGCAAATTA	0.418																																					p.R311H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G932A	4						.						114.0	103.0	107.0					4																	47537967		2203	4300	6503	47232724	SO:0001583	missense	57205	exon7			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.932G>A	4.37:g.47537967G>A	ENSP00000273859:p.Arg311His	Somatic		Capture	Illumina HiSeq	Phase_I	47232724	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.763571	0.89932	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	D;D	0.91686	-2.89;-2.89	5.31	5.31	0.75309	ATPase, P-type, ATPase-associated domain (1);	0.059827	0.64402	D	0.000002	D	0.97074	0.9044	M	0.93283	3.4	0.58432	D	0.999997	D;D	0.76494	0.999;0.998	D;D	0.70487	0.969;0.969	D	0.97421	1.0009	10	0.54805	T	0.06	-16.3315	18.3416	0.90307	0.0:0.0:1.0:0.0	.	311;311	Q9P241;Q6PEW3	AT10D_HUMAN;.	H	311	ENSP00000273859:R311H;ENSP00000420909:R311H	ENSP00000273859:R311H	R	+	2	0	ATP10D	47232724	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	6.721000	0.74728	2.635000	0.89317	0.563000	0.77884	CGC		0.418	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
FRYL	285527	broad.mit.edu	37	4	48512881	48512881	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:48512881A>G	ENST00000503238.1	-	55	8265	c.8266T>C	c.(8266-8268)Tgc>Cgc	p.C2756R	FRYL_ENST00000264319.7_Missense_Mutation_p.C152R|FRYL_ENST00000358350.4_Missense_Mutation_p.C2756R|FRYL_ENST00000537810.1_Missense_Mutation_p.C2756R|FRYL_ENST00000507873.2_Missense_Mutation_p.C152R			O94915	FRYL_HUMAN	FRY-like	2756					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.C2756R(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ACTGTTGGGCATTCTGAACAC	0.368																																					p.C2756R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T8266C	4						.						124.0	115.0	118.0					4																	48512881		1887	4106	5993	48207638	SO:0001583	missense	285527	exon58			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.8266T>C	4.37:g.48512881A>G	ENSP00000426064:p.Cys2756Arg	Somatic		Capture	Illumina HiSeq	Phase_I	48207638	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.175558	0.57692	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000264319;ENST00000507873	T;T;T	0.26373	1.74;1.74;1.74	6.02	6.02	0.97574	.	0.000000	0.85682	U	0.000000	T	0.55114	0.1900	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.58989	-0.7538	10	0.62326	D	0.03	.	16.5494	0.84464	1.0:0.0:0.0:0.0	.	2756;2756;152	O94915;F5GX82;O94915-2	FRYL_HUMAN;.;.	R	2756;2756;2756;152;152	ENSP00000426064:C2756R;ENSP00000351113:C2756R;ENSP00000441114:C2756R	ENSP00000264319:C152R	C	-	1	0	FRYL	48207638	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	8.875000	0.92372	2.299000	0.77371	0.528000	0.53228	TGC		0.368	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
KIAA1211	57482	broad.mit.edu	37	4	57181654	57181654	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:57181654G>A	ENST00000504228.1	+	6	2091	c.1986G>A	c.(1984-1986)gcG>gcA	p.A662A	KIAA1211_ENST00000541073.1_Silent_p.A655A|KIAA1211_ENST00000264229.6_Silent_p.A662A			Q6ZU35	K1211_HUMAN	KIAA1211	662								p.A662A(1)		endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CCAGCAGCGCGTCCGCACTCG	0.687																																					p.A662A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1986A	4						.						28.0	33.0	31.0					4																	57181654		1974	4144	6118	56876411	SO:0001819	synonymous_variant	57482	exon8			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1986G>A	4.37:g.57181654G>A		Somatic		Capture	Illumina HiSeq	Phase_I	56876411	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	37	CCDS43230.1																																																																																				0.687	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
EPHA5	2044	broad.mit.edu	37	4	66230893	66230893	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:66230893C>T	ENST00000273854.3	-	12	2678	c.2078G>A	c.(2077-2079)cGt>cAt	p.R693H	EPHA5_ENST00000354839.4_Missense_Mutation_p.R671H|EPHA5_ENST00000432638.2_Missense_Mutation_p.R530H|EPHA5_ENST00000511294.1_Missense_Mutation_p.R694H	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	693	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.R693H(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TAGTTTCAAACGTCCACTACA	0.358										TSP Lung(17;0.13)																											p.R693H												.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.G2078A	4						.						131.0	137.0	135.0					4																	66230893		2203	4300	6503	65913488	SO:0001583	missense	2044	exon12			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2078G>A	4.37:g.66230893C>T	ENSP00000273854:p.Arg693His	Somatic		Capture	Illumina HiSeq	Phase_I	65913488	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722513	0.89298	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	5.97	5.97	0.96955	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000017	T	0.71609	0.3360	L	0.35341	1.055	0.53688	D	0.999971	D;B;D;D	0.89917	0.996;0.033;0.995;1.0	D;B;P;D	0.66497	0.942;0.047;0.903;0.944	T	0.70364	-0.4892	10	0.49607	T	0.09	.	20.4238	0.99064	0.0:1.0:0.0:0.0	.	672;694;671;693	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	H	693;530;671;694	ENSP00000273854:R693H;ENSP00000389208:R530H;ENSP00000346899:R671H;ENSP00000427638:R694H	ENSP00000273854:R693H	R	-	2	0	EPHA5	65913488	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.308000	0.51896	2.834000	0.97654	0.650000	0.86243	CGT		0.358	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
TMPRSS11F	389208	broad.mit.edu	37	4	68930607	68930607	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:68930607C>T	ENST00000356291.2	-	8	870	c.811G>A	c.(811-813)Gca>Aca	p.A271T	RP11-35D5.1_ENST00000600441.1_RNA|UBA6-AS1_ENST00000511571.1_RNA|UBA6-AS1_ENST00000499180.2_RNA|UBA6-AS1_ENST00000500538.2_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	271	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.A271T(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						CGTTTCACTGCGGGTGGTGTT	0.348																																					p.A271T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G811A	4						.						81.0	75.0	77.0					4																	68930607		2203	4300	6503	68613202	SO:0001583	missense	389208	exon8			AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.811G>A	4.37:g.68930607C>T	ENSP00000348639:p.Ala271Thr	Somatic		Capture	Illumina HiSeq	Phase_I	68613202	NM_207407	A8MXX2	Missense_Mutation	SNP	ENST00000356291.2	37	CCDS3520.1	.	.	.	.	.	.	.	.	.	.	C	9.118	1.008365	0.19199	.	.	ENSG00000198092	ENST00000356291	D	0.88741	-2.42	5.71	2.68	0.31781	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.922513	0.09150	N	0.841762	T	0.72137	0.3423	N	0.04063	-0.285	0.09310	N	1	P	0.46142	0.873	B	0.37650	0.255	T	0.61734	-0.7002	10	0.15499	T	0.54	.	7.411	0.27017	0.3165:0.5977:0.0:0.0859	.	271	Q6ZWK6	TM11F_HUMAN	T	271	ENSP00000348639:A271T	ENSP00000348639:A271T	A	-	1	0	TMPRSS11F	68613202	0.000000	0.05858	0.474000	0.27266	0.472000	0.32918	0.057000	0.14279	0.739000	0.32628	-0.126000	0.14955	GCA		0.348	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407	
YTHDC1	91746	broad.mit.edu	37	4	69188474	69188474	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:69188474C>T	ENST00000344157.4	-	11	1929	c.1594G>A	c.(1594-1596)Gtg>Atg	p.V532M	YTHDC1_ENST00000579690.1_Missense_Mutation_p.V532M|YTHDC1_ENST00000355665.3_Missense_Mutation_p.V514M	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	532	Arg-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V532M(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						AACCTTCCCACATCCCGGACT	0.448																																					p.V532M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1594A	4						.						83.0	80.0	81.0					4																	69188474		2203	4300	6503	68871069	SO:0001583	missense	91746	exon11			AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1594G>A	4.37:g.69188474C>T	ENSP00000339245:p.Val532Met	Somatic		Capture	Illumina HiSeq	Phase_I	68871069	NM_001031732	Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	37	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732798	0.30684	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.24538	1.85;1.85	5.92	5.92	0.95590	.	0.064498	0.64402	D	0.000009	T	0.17789	0.0427	N	0.12182	0.205	0.46185	D	0.998911	P;B	0.37101	0.582;0.141	B;B	0.32583	0.148;0.035	T	0.04017	-1.0984	10	0.45353	T	0.12	.	20.327	0.98704	0.0:1.0:0.0:0.0	.	514;532	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	M	532;514	ENSP00000339245:V532M;ENSP00000347888:V514M	ENSP00000339245:V532M	V	-	1	0	YTHDC1	68871069	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.160000	0.50739	2.794000	0.96219	0.650000	0.86243	GTG		0.448	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
ANKRD17	26057	broad.mit.edu	37	4	73963878	73963878	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:73963878T>C	ENST00000358602.4	-	26	5049	c.4933A>G	c.(4933-4935)Acc>Gcc	p.T1645A	ANKRD17_ENST00000509867.2_Missense_Mutation_p.T1532A|ANKRD17_ENST00000330838.6_Missense_Mutation_p.T1394A	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	1645	Ser-rich.				blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.T1645A(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTCACAGTGGTAGTGACCACA	0.433																																					p.T1394A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4180G	4						.						228.0	196.0	207.0					4																	73963878		2203	4300	6503	74182742	SO:0001583	missense	26057	exon25			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.4933A>G	4.37:g.73963878T>C	ENSP00000351416:p.Thr1645Ala	Somatic		Capture	Illumina HiSeq	Phase_I	74182742	NM_198889	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	T	8.037	0.763074	0.15914	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.21543	2.0;2.0;2.0	5.18	-1.7	0.08159	.	0.694506	0.13607	N	0.375361	T	0.14184	0.0343	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.20907	-1.0261	10	0.49607	T	0.09	.	6.0828	0.19950	0.0:0.2777:0.1247:0.5976	.	1644;1394;1645;1532	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	A	1645;1052;1394;1532;29	ENSP00000351416:T1645A;ENSP00000332265:T1394A;ENSP00000427151:T1532A	ENSP00000332265:T1394A	T	-	1	0	ANKRD17	74182742	0.027000	0.19231	0.032000	0.17829	0.746000	0.42486	0.271000	0.18626	-0.181000	0.10619	-0.438000	0.05819	ACC		0.433	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
AFP	174	broad.mit.edu	37	4	74318183	74318183	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:74318183C>T	ENST00000395792.2	+	12	1594	c.1494C>T	c.(1492-1494)ggC>ggT	p.G498G	AFP_ENST00000226359.2_Silent_p.G498G	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	498	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)	p.G498G(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTGGTGTTGGCCAGTGCTGCA	0.443									Alpha-Fetoprotein, Hereditary Persistence of																												p.G498G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1494T	4						.						139.0	129.0	133.0					4																	74318183		2203	4300	6503	74537047	SO:0001819	synonymous_variant	174	exon12	Familial Cancer Database	HPAFP	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.1494C>T	4.37:g.74318183C>T		Somatic		Capture	Illumina HiSeq	Phase_I	74537047	NM_001134	B2RBU3	Silent	SNP	ENST00000395792.2	37	CCDS3556.1																																																																																				0.443	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252284.3		
FRAS1	80144	broad.mit.edu	37	4	79420998	79420998	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:79420998G>A	ENST00000264895.6	+	61	9679	c.9239G>A	c.(9238-9240)cGc>cAc	p.R3080H		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3076	Calx-beta 5.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.R3080H(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TCCAAGGTTCGCTGCAGCACG	0.552																																					p.R3080H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9239A	4						.						125.0	125.0	125.0					4																	79420998		2003	4187	6190	79640022	SO:0001583	missense	80144	exon61			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.9239G>A	4.37:g.79420998G>A	ENSP00000264895:p.Arg3080His	Somatic		Capture	Illumina HiSeq	Phase_I	79640022	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	G	32	5.164562	0.94727	.	.	ENSG00000138759	ENST00000264895	T	0.30714	1.52	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.64571	0.2610	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.68671	-0.5347	10	0.87932	D	0	.	20.2983	0.98569	0.0:0.0:1.0:0.0	.	3079;3080	Q86XX4-2;E9PHH6	.;.	H	3080	ENSP00000264895:R3080H	ENSP00000264895:R3080H	R	+	2	0	FRAS1	79640022	1.000000	0.71417	0.999000	0.59377	0.676000	0.39594	9.727000	0.98787	2.802000	0.96397	0.655000	0.94253	CGC		0.552	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
IBSP	3381	broad.mit.edu	37	4	88732909	88732909	+	Silent	SNP	C	C	A	rs201386479	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:88732909C>A	ENST00000226284.5	+	7	868	c.801C>A	c.(799-801)ggC>ggA	p.G267G		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	267					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)		p.G267G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		AATACACGGGCGCCAATGAAT	0.473																																					p.G267G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C801A	4						.						67.0	62.0	64.0					4																	88732909		2203	4300	6503	88951933	SO:0001819	synonymous_variant	3381	exon7				CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.801C>A	4.37:g.88732909C>A		Somatic		Capture	Illumina HiSeq	Phase_I	88951933	NM_004967		Silent	SNP	ENST00000226284.5	37	CCDS3624.1																																																																																				0.473	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253050.2		
BMPR1B	658	broad.mit.edu	37	4	96052531	96052531	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:96052531T>C	ENST00000515059.1	+	10	1227	c.944T>C	c.(943-945)tTa>tCa	p.L315S	BMPR1B_ENST00000394931.1_Missense_Mutation_p.L315S|BMPR1B_ENST00000264568.4_Missense_Mutation_p.L315S|BMPR1B_ENST00000440890.2_Missense_Mutation_p.L345S	NM_001203.2	NP_001194.1	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	315	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				BMP signaling pathway (GO:0030509)|cartilage condensation (GO:0001502)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|eye development (GO:0001654)|inflammatory response (GO:0006954)|limb morphogenesis (GO:0035108)|ovarian cumulus expansion (GO:0001550)|ovulation cycle (GO:0042698)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell differentiation (GO:0045597)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|skeletal system development (GO:0001501)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.L315S(2)		breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		TTATGTCATTTACACACAGAA	0.388																																					p.L315S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T944C	4						.						119.0	107.0	111.0					4																	96052531		2203	4300	6503	96271554	SO:0001583	missense	658	exon10			D89675	CCDS3642.1, CCDS58919.1	4q23-q24	2008-02-05			ENSG00000138696	ENSG00000138696		"""CD molecules"""	1077	protein-coding gene	gene with protein product		603248				8140412, 9730621	Standard	NM_001203		Approved	ALK6, CDw293	uc031sgn.1	O00238	OTTHUMG00000130991	ENST00000515059.1:c.944T>C	4.37:g.96052531T>C	ENSP00000426617:p.Leu315Ser	Somatic		Capture	Illumina HiSeq	Phase_I	96271554	NM_001203	B2R953|B4DSV1|P78366	Missense_Mutation	SNP	ENST00000515059.1	37	CCDS3642.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.355840	0.82243	.	.	ENSG00000138696	ENST00000515059;ENST00000512312;ENST00000509540;ENST00000440890;ENST00000264568;ENST00000394931	D;D;D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4;-4.4;-4.4	6.06	6.06	0.98353	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99010	0.9662	H	0.95884	3.735	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99433	1.0936	10	0.87932	D	0	.	16.6093	0.84858	0.0:0.0:0.0:1.0	.	315	O00238	BMR1B_HUMAN	S	315;315;315;345;315;315	ENSP00000426617:L315S;ENSP00000425444:L315S;ENSP00000421671:L315S;ENSP00000401907:L345S;ENSP00000264568:L315S;ENSP00000378389:L315S	ENSP00000264568:L315S	L	+	2	0	BMPR1B	96271554	1.000000	0.71417	0.971000	0.41717	0.833000	0.47200	7.994000	0.88315	2.324000	0.78689	0.533000	0.62120	TTA		0.388	BMPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253609.3	NM_001203	
MTNR1A	4543	broad.mit.edu	37	4	187455386	187455386	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr4:187455386G>A	ENST00000307161.5	-	2	711	c.510C>T	c.(508-510)taC>taT	p.Y170Y	RP11-215A19.2_ENST00000509111.1_Intron	NM_005958.3	NP_005949.1	P48039	MTR1A_HUMAN	melatonin receptor 1A	170					circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|mating behavior (GO:0007617)|positive regulation of cGMP biosynthetic process (GO:0030828)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	hormone binding (GO:0042562)|melatonin receptor activity (GO:0008502)|organic cyclic compound binding (GO:0097159)	p.Y170Y(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	TCCTCGGGTCGTACTGGAGAG	0.597																																					p.Y170Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C510T	4						.						128.0	107.0	114.0					4																	187455386		2203	4300	6503	187692380	SO:0001819	synonymous_variant	4543	exon2				CCDS3848.1	4q35	2012-08-08				ENSG00000168412		"""GPCR / Class A : Melatonin receptors"""	7463	protein-coding gene	gene with protein product		600665				7558006	Standard	NM_005958		Approved	MEL-1A-R	uc003izd.1	P48039		ENST00000307161.5:c.510C>T	4.37:g.187455386G>A		Somatic		Capture	Illumina HiSeq	Phase_I	187692380	NM_005958	A0AVC5|B0M0L2	Silent	SNP	ENST00000307161.5	37	CCDS3848.1																																																																																				0.597	MTNR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360189.1		
CTNND2	1501	broad.mit.edu	37	5	11159846	11159846	+	Silent	SNP	G	G	A	rs149766664		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:11159846G>A	ENST00000304623.8	-	12	2190	c.2001C>T	c.(1999-2001)tgC>tgT	p.C667C	CTNND2_ENST00000458100.2_Silent_p.C234C|CTNND2_ENST00000511377.1_Silent_p.C576C|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Silent_p.C667C|CTNND2_ENST00000503622.1_Silent_p.C330C	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	667					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.C667C(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGAGTGCATCGCATGAGGAGA	0.483													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20525	0.0		0.0	False		,,,				2504	0.0				p.C667C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2001T	5						.	G		19,4387	26.2+/-53.5	0,19,2184	144.0	139.0	141.0		2001	-6.3	0.3	5	dbSNP_134	141	0,8600		0,0,4300	yes	coding-synonymous	CTNND2	NM_001332.2		0,19,6484	AA,AG,GG		0.0,0.4312,0.1461		667/1226	11159846	19,12987	2203	4300	6503	11212846	SO:0001819	synonymous_variant	1501	exon12			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2001C>T	5.37:g.11159846G>A		Somatic		Capture	Illumina HiSeq	Phase_I	11212846	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	CCDS3881.1																																																																																				0.483	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
DNAH5	1767	broad.mit.edu	37	5	13737378	13737378	+	Missense_Mutation	SNP	C	C	T	rs143612682		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:13737378C>T	ENST00000265104.4	-	66	11542	c.11438G>A	c.(11437-11439)cGg>cAg	p.R3813Q		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3813					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3813Q(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTATTCCTCCCGGGCTGAGTT	0.428									Kartagener syndrome				C|||	1	0.000199681	0.0	0.0	5008	,	,		17360	0.0		0.001	False		,,,				2504	0.0				p.R3813Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G11438A	5						.	C	GLN/ARG	0,4406		0,0,2203	119.0	123.0	122.0		11438	5.4	1.0	5	dbSNP_134	122	1,8599	1.2+/-3.3	0,1,4299	no	missense	DNAH5	NM_001369.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	3813/4625	13737378	1,13005	2203	4300	6503	13790378	SO:0001583	missense	1767	exon66	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11438G>A	5.37:g.13737378C>T	ENSP00000265104:p.Arg3813Gln	Somatic		Capture	Illumina HiSeq	Phase_I	13790378	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647847	0.87958	0.0	1.16E-4	ENSG00000039139	ENST00000265104	T	0.54279	0.58	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.73361	0.3577	H	0.94734	3.575	0.80722	D	1	D	0.57571	0.98	P	0.49752	0.621	T	0.80400	-0.1398	10	0.42905	T	0.14	.	19.2675	0.93996	0.0:1.0:0.0:0.0	.	3813	Q8TE73	DYH5_HUMAN	Q	3813	ENSP00000265104:R3813Q	ENSP00000265104:R3813Q	R	-	2	0	DNAH5	13790378	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.770000	0.85390	2.573000	0.86826	0.655000	0.94253	CGG		0.428	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
SLC22A4	6583	broad.mit.edu	37	5	131671628	131671628	+	Missense_Mutation	SNP	C	C	T	rs200543879		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:131671628C>T	ENST00000200652.3	+	8	1553	c.1379C>T	c.(1378-1380)gCg>gTg	p.A460V	AC034220.3_ENST00000437091.1_RNA|AC034220.3_ENST00000417795.1_RNA	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	460					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)	p.A460V(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	AGGAACATGGCGGTGGGGGTC	0.517													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16400	0.0		0.0	False		,,,				2504	0.0				p.A460V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1379T	5						.						154.0	149.0	150.0					5																	131671628		2203	4300	6503	131699527	SO:0001583	missense	6583	exon8			AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.1379C>T	5.37:g.131671628C>T	ENSP00000200652:p.Ala460Val	Somatic		Capture	Illumina HiSeq	Phase_I	131699527	NM_003059	O14546	Missense_Mutation	SNP	ENST00000200652.3	37	CCDS4153.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	25.7	4.662811	0.88251	.	.	ENSG00000197208	ENST00000200652	T	0.79352	-1.26	5.57	5.57	0.84162	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.162068	0.53938	D	0.000057	D	0.84973	0.5591	M	0.86740	2.835	0.58432	D	0.999992	D	0.54397	0.966	P	0.49953	0.627	D	0.87897	0.2688	10	0.87932	D	0	.	15.0873	0.72165	0.0:0.8587:0.1413:0.0	.	460	Q9H015	S22A4_HUMAN	V	460	ENSP00000200652:A460V	ENSP00000200652:A460V	A	+	2	0	SLC22A4	131699527	0.969000	0.33509	0.961000	0.40146	0.780000	0.44128	2.314000	0.43743	2.633000	0.89246	0.637000	0.83480	GCG		0.517	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059	
LRRTM2	26045	broad.mit.edu	37	5	138209582	138209582	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:138209582G>A	ENST00000274711.6	-	2	1046	c.668C>T	c.(667-669)gCt>gTt	p.A223V	LRRTM2_ENST00000518785.1_3'UTR|CTNNA1_ENST00000302763.7_Intron|LRRTM2_ENST00000523537.1_5'Flank|CTNNA1_ENST00000520400.1_Intron|CTNNA1_ENST00000540387.1_5'Flank|CTNNA1_ENST00000355078.5_Intron|LRRTM2_ENST00000521094.2_Intron|CTNNA1_ENST00000518825.1_Intron	NM_015564.2	NP_056379.1	O43300	LRRT2_HUMAN	leucine rich repeat transmembrane neuronal 2	223					long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|synapse organization (GO:0050808)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.A223V(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|urinary_tract(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TAGGAAATGAGCAAAATTAAT	0.443																																					p.A223V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C668T	5						.						259.0	252.0	254.0					5																	138209582		1942	4148	6090	138237481	SO:0001583	missense	26045	exon2			AB007876	CCDS47272.1	5q31	2008-02-05				ENSG00000146006			19409	protein-coding gene	gene with protein product		610868				12676565	Standard	NM_015564		Approved	KIAA0416	uc011cyz.1	O43300		ENST00000274711.6:c.668C>T	5.37:g.138209582G>A	ENSP00000274711:p.Ala223Val	Somatic		Capture	Illumina HiSeq	Phase_I	138237481	NM_015564	A0AVL3|A8K4U9|B7ZLN8|Q7L770	Missense_Mutation	SNP	ENST00000274711.6	37	CCDS47272.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.776927	0.70107	.	.	ENSG00000146006	ENST00000274711	T	0.04502	3.61	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.19087	0.0458	L	0.59436	1.845	0.80722	D	1	D;D	0.76494	0.991;0.999	D;D	0.80764	0.992;0.994	T	0.00087	-1.2093	10	0.35671	T	0.21	.	19.1682	0.93565	0.0:0.0:1.0:0.0	.	89;223	B7Z4G4;O43300	.;LRRT2_HUMAN	V	223	ENSP00000274711:A223V	ENSP00000274711:A223V	A	-	2	0	LRRTM2	138237481	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.865000	0.98341	0.655000	0.94253	GCT		0.443	LRRTM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374043.2		
PCDHA10	56139	broad.mit.edu	37	5	140236466	140236466	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:140236466A>G	ENST00000307360.5	+	1	833	c.833A>G	c.(832-834)tAt>tGt	p.Y278C	PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.Y278C|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	278	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.Y278C(2)		NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAATGATGTATTCATTTAGC	0.358																																					p.Y278C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A833G	5						.						74.0	73.0	74.0					5																	140236466		2196	4270	6466	140216650	SO:0001583	missense	56139	exon1			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.833A>G	5.37:g.140236466A>G	ENSP00000304234:p.Tyr278Cys	Somatic		Capture	Illumina HiSeq	Phase_I	140216650	NM_031860	A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	37	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.614857	0.46631	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.63255	-0.03;-0.03	4.29	4.29	0.51040	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.86280	0.5895	H	0.98936	4.375	0.35120	D	0.766949	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.996	D	0.92761	0.6224	9	0.87932	D	0	.	11.2306	0.48910	0.8473:0.1527:0.0:0.0	.	278;278;278	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	C	278	ENSP00000421030:Y278C;ENSP00000304234:Y278C	ENSP00000304234:Y278C	Y	+	2	0	PCDHA10	140216650	1.000000	0.71417	0.992000	0.48379	0.956000	0.61745	7.184000	0.77705	1.931000	0.55961	0.459000	0.35465	TAT		0.358	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
PCDHA11	56138	broad.mit.edu	37	5	140249736	140249736	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:140249736G>A	ENST00000398640.2	+	1	1048	c.1048G>A	c.(1048-1050)Gcc>Acc	p.A350T	PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	350	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A350T(1)		breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTGAAGTCGCCGTGACTTC	0.547																																					p.A350T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1048A	5						.						68.0	73.0	71.0					5																	140249736		2203	4300	6503	140229920	SO:0001583	missense	56138	exon1			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1048G>A	5.37:g.140249736G>A	ENSP00000381636:p.Ala350Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140229920	NM_031861	B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.455096	0.00173	.	.	ENSG00000249158	ENST00000398640	T	0.59906	0.23	5.73	0.616	0.17613	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.26846	0.0657	N	0.05383	-0.06	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.26326	-1.0106	9	0.02654	T	1	.	4.6734	0.12699	0.5058:0.0:0.297:0.1972	.	350;350	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	T	350	ENSP00000381636:A350T	ENSP00000381636:A350T	A	+	1	0	PCDHA11	140229920	0.000000	0.05858	0.000000	0.03702	0.328000	0.28507	-2.764000	0.00784	0.119000	0.18210	-1.320000	0.01293	GCC		0.547	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902	
PCDHA12	56137	broad.mit.edu	37	5	140255760	140255760	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:140255760G>A	ENST00000398631.2	+	1	703	c.703G>A	c.(703-705)Gtg>Atg	p.V235M	PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	235	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V235M(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTCCTGGATGTGAATGACAA	0.433																																					p.V235M	Pancreas(113;759 1672 13322 24104 50104)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G703A	5						.						100.0	97.0	97.0					5																	140255760		1884	4114	5998	140235944	SO:0001583	missense	56137	exon1			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.703G>A	5.37:g.140255760G>A	ENSP00000381628:p.Val235Met	Somatic		Capture	Illumina HiSeq	Phase_I	140235944	NM_031864	O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.455120	0.63401	.	.	ENSG00000251664	ENST00000398631	T	0.63744	-0.06	5.07	4.19	0.49359	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.81297	0.4793	M	0.90369	3.11	0.25636	N	0.986251	D;D	0.76494	0.999;0.996	D;D	0.72338	0.977;0.947	T	0.72808	-0.4181	9	0.87932	D	0	.	11.1511	0.48460	0.1569:0.0:0.8431:0.0	.	235;235	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	M	235	ENSP00000381628:V235M	ENSP00000381628:V235M	V	+	1	0	PCDHA12	140235944	0.380000	0.25131	0.999000	0.59377	0.951000	0.60555	1.401000	0.34589	1.100000	0.41517	0.591000	0.81541	GTG		0.433	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
PCDHAC1	56135	broad.mit.edu	37	5	140306757	140306757	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:140306757G>A	ENST00000253807.2	+	1	280	c.280G>A	c.(280-282)Gtc>Atc	p.V94I	PCDHA9_ENST00000532602.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.V94I|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	94	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V94I(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTGCCTGCGTCTTGACCTA	0.612																																					p.V94I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G280A	5						.						48.0	47.0	47.0					5																	140306757		2203	4300	6503	140286941	SO:0001583	missense	56135	exon1			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.280G>A	5.37:g.140306757G>A	ENSP00000253807:p.Val94Ile	Somatic		Capture	Illumina HiSeq	Phase_I	140286941	NM_031882	Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	ENST00000253807.2	37	CCDS4241.1	.	.	.	.	.	.	.	.	.	.	G	9.976	1.226697	0.22542	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.28895	1.59;1.59	5.5	-0.563	0.11778	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.13072	0.0317	N	0.13352	0.335	0.09310	N	1	B;B	0.19935	0.04;0.012	B;B	0.15484	0.009;0.013	T	0.26503	-1.0101	9	0.25106	T	0.35	.	1.3022	0.02081	0.2356:0.2096:0.3602:0.1946	.	94;94	Q9H158;Q9H158-2	PCDC1_HUMAN;.	I	94	ENSP00000386356:V94I;ENSP00000253807:V94I	ENSP00000253807:V94I	V	+	1	0	PCDHAC1	140286941	0.000000	0.05858	0.992000	0.48379	0.710000	0.40934	-0.659000	0.05323	-0.040000	0.13580	0.561000	0.74099	GTC		0.612	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
PCDHB5	26167	broad.mit.edu	37	5	140516394	140516394	+	Nonsense_Mutation	SNP	C	C	T	rs201677139		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:140516394C>T	ENST00000231134.5	+	1	1595	c.1378C>T	c.(1378-1380)Cga>Tga	p.R460*		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	460	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R460*(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGTTCGTCCGAGAGAACAA	0.617																																					p.R460X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1378T	5						.						114.0	106.0	109.0					5																	140516394		2202	4296	6498	140496578	SO:0001587	stop_gained	26167	exon1			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1378C>T	5.37:g.140516394C>T	ENSP00000231134:p.Arg460*	Somatic		Capture	Illumina HiSeq	Phase_I	140496578	NM_015669	Q549F4|Q9UFU9	Nonsense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.899141	0.72754	.	.	ENSG00000113209	ENST00000231134;ENST00000537936	.	.	.	4.81	2.92	0.33932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.1449	0.48424	0.134:0.6072:0.2588:0.0	.	.	.	.	X	460;244	.	ENSP00000231134:R460X	R	+	1	2	PCDHB5	140496578	0.000000	0.05858	0.005000	0.12908	0.362000	0.29581	-0.272000	0.08560	0.502000	0.28037	-0.314000	0.08810	CGA		0.617	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
FCHSD1	89848	broad.mit.edu	37	5	141029020	141029020	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:141029020C>T	ENST00000435817.2	-	5	367	c.317G>A	c.(316-318)cGa>cAa	p.R106Q	FCHSD1_ENST00000522783.1_Missense_Mutation_p.R104Q|FCHSD1_ENST00000519800.1_Missense_Mutation_p.R104Q|FCHSD1_ENST00000523856.1_5'Flank|FCHSD1_ENST00000522126.1_Missense_Mutation_p.R30Q	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	106								p.R106Q(1)	FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCACGGTATCGGTCAGACGC	0.642																																					p.R106Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G317A	5						.						99.0	114.0	109.0					5																	141029020		2113	4235	6348	141009204	SO:0001583	missense	89848	exon5			AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.317G>A	5.37:g.141029020C>T	ENSP00000399259:p.Arg106Gln	Somatic		Capture	Illumina HiSeq	Phase_I	141009204	NM_033449	Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	ENST00000435817.2	37	CCDS47295.1	.	.	.	.	.	.	.	.	.	.	c	18.66	3.672755	0.67928	.	.	ENSG00000197948	ENST00000435817;ENST00000522126;ENST00000522783;ENST00000519800	T;T;T;T	0.15952	2.38;2.58;2.38;2.38	5.04	5.04	0.67666	Fps/Fes/Fer/CIP4 homology (1);	0.627510	0.14789	N	0.298323	T	0.15739	0.0379	L	0.36672	1.1	0.30671	N	0.753417	P	0.51147	0.942	B	0.43445	0.42	T	0.02167	-1.1202	10	0.10636	T	0.68	-10.2036	15.0893	0.72180	0.0:1.0:0.0:0.0	.	106	Q86WN1	FCSD1_HUMAN	Q	106;30;104;104	ENSP00000399259:R106Q;ENSP00000427796:R30Q;ENSP00000428677:R104Q;ENSP00000428776:R104Q	ENSP00000399259:R106Q	R	-	2	0	FCHSD1	141009204	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	1.943000	0.40253	2.335000	0.79485	0.556000	0.70494	CGA		0.642	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375282.2	NM_033449	
TRIO	7204	broad.mit.edu	37	5	14508201	14508201	+	Silent	SNP	C	C	T	rs55898643		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:14508201C>T	ENST00000344204.4	+	57	8988	c.8964C>T	c.(8962-8964)ggC>ggT	p.G2988G	TRIO_ENST00000344135.5_Silent_p.G487G|TRIO_ENST00000537187.1_Silent_p.G2812G	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2988	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G2988G(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TTCTTAGTGGCGTGTCCCCCT	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		21317	0.0		0.0	False		,,,				2504	0.001				p.G2988G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C8964T	5						.						143.0	137.0	139.0					5																	14508201		2203	4300	6503	14561201	SO:0001819	synonymous_variant	7204	exon57			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.8964C>T	5.37:g.14508201C>T		Somatic		Capture	Illumina HiSeq	Phase_I	14561201	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	CCDS3883.1																																																																																				0.522	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
ARAP3	64411	broad.mit.edu	37	5	141059328	141059328	+	Splice_Site	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:141059328C>A	ENST00000239440.4	-	3	651	c.586G>T	c.(586-588)Gtg>Ttg	p.V196L	ARAP3_ENST00000508305.1_Splice_Site_p.V118L	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	196					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.V196L(1)		NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						ACCCAGTTACCTGTGCCTGTT	0.587																																					p.V196L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G586T	5						.						68.0	68.0	68.0					5																	141059328		2203	4300	6503	141039512	SO:0001630	splice_region_variant	64411	exon3			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.586+1G>T	5.37:g.141059328C>A		Somatic		Capture	Illumina HiSeq	Phase_I	141039512	NM_022481	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292570	0.59976	.	.	ENSG00000120318	ENST00000522690;ENST00000508305;ENST00000239440;ENST00000504448	T;T;T	0.17691	2.51;3.21;2.26	4.89	4.89	0.63831	.	0.187837	0.37530	N	0.002051	T	0.16257	0.0391	N	0.24115	0.695	0.80722	D	1	P;D	0.53151	0.73;0.958	P;P	0.48552	0.547;0.581	T	0.01993	-1.1233	9	.	.	.	.	13.4053	0.60908	0.0:1.0:0.0:0.0	.	118;196	G5E9Y3;Q8WWN8	.;ARAP3_HUMAN	L	118;118;196;196	ENSP00000421826:V118L;ENSP00000239440:V196L;ENSP00000421148:V196L	.	V	-	1	0	ARAP3	141039512	1.000000	0.71417	1.000000	0.80357	0.153000	0.21895	4.297000	0.59061	2.536000	0.85505	0.462000	0.41574	GTG		0.587	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	Missense_Mutation
JAKMIP2	9832	broad.mit.edu	37	5	147040713	147040713	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:147040713C>T	ENST00000265272.5	-	3	892	c.425G>A	c.(424-426)cGg>cAg	p.R142Q	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.R100Q|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.R142Q	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	142						Golgi apparatus (GO:0005794)		p.R142Q(2)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAACAGTTTCCGGGCCTCCTC	0.557																																					p.R142Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.G425A	5						.						113.0	116.0	115.0					5																	147040713		2203	4300	6503	147020906	SO:0001583	missense	9832	exon3			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.425G>A	5.37:g.147040713C>T	ENSP00000265272:p.Arg142Gln	Somatic		Capture	Illumina HiSeq	Phase_I	147020906	NM_014790	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	C	32	5.182271	0.94885	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.43294	0.95;0.95;0.95	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.63534	0.2519	M	0.69823	2.125	0.58432	D	0.999999	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.66847	0.947;0.947;0.947;0.947	T	0.63721	-0.6573	10	0.44086	T	0.13	.	18.7349	0.91750	0.0:1.0:0.0:0.0	.	100;142;142;142	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	Q	142;142;100;142	ENSP00000421398:R142Q;ENSP00000265272:R142Q;ENSP00000328989:R100Q	ENSP00000265272:R142Q	R	-	2	0	JAKMIP2	147020906	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	6.040000	0.70980	2.598000	0.87819	0.655000	0.94253	CGG		0.557	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
ABLIM3	22885	broad.mit.edu	37	5	148586587	148586587	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:148586587G>T	ENST00000506113.1	+	5	947	c.465G>T	c.(463-465)aaG>aaT	p.K155N	ABLIM3_ENST00000504238.1_Missense_Mutation_p.K155N|RP11-331K21.1_ENST00000522685.1_RNA|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000508983.1_Missense_Mutation_p.K155N|ABLIM3_ENST00000309868.7_Missense_Mutation_p.K155N|ABLIM3_ENST00000356541.3_Missense_Mutation_p.K155N|ABLIM3_ENST00000326685.7_Missense_Mutation_p.K155N			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	155	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)	p.K155N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGGGTGCAAGGAGGAGATCA	0.602																																					p.K155N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G465T	5						.						86.0	74.0	79.0					5																	148586587		2203	4300	6503	148566780	SO:0001583	missense	22885	exon6			AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.465G>T	5.37:g.148586587G>T	ENSP00000425394:p.Lys155Asn	Somatic		Capture	Illumina HiSeq	Phase_I	148566780	NM_014945	A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	ENST00000506113.1	37	CCDS4294.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.626720	0.46840	.	.	ENSG00000173210	ENST00000326685;ENST00000356541;ENST00000309868;ENST00000506113;ENST00000504238;ENST00000508983	D;D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17;-2.17	5.33	4.45	0.53987	Zinc finger, LIM-type (5);	0.291697	0.39210	N	0.001431	D	0.84370	0.5457	N	0.16602	0.42	0.53688	D	0.999974	D;D;P	0.62365	0.99;0.991;0.863	P;P;B	0.59424	0.81;0.857;0.438	T	0.83015	-0.0170	10	0.38643	T	0.18	.	9.4887	0.38946	0.1639:0.0:0.8361:0.0	.	155;155;155	O94929-3;O94929-2;O94929	.;.;ABLM3_HUMAN	N	155	ENSP00000315841:K155N;ENSP00000348938:K155N;ENSP00000310309:K155N;ENSP00000425394:K155N;ENSP00000421183:K155N;ENSP00000420855:K155N	ENSP00000310309:K155N	K	+	3	2	ABLIM3	148566780	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.969000	0.29370	1.214000	0.43395	0.484000	0.47621	AAG		0.602	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373435.1	NM_014945	
ARSI	340075	broad.mit.edu	37	5	149676983	149676983	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:149676983C>T	ENST00000328668.7	-	2	2083	c.1504G>A	c.(1504-1506)Gta>Ata	p.V502I		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	502					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.V502I(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGTAGCGTACCGGGATGGCT	0.632																																					p.V502I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1504A	5						.						82.0	92.0	88.0					5																	149676983		2203	4300	6503	149657176	SO:0001583	missense	340075	exon2			AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.1504G>A	5.37:g.149676983C>T	ENSP00000333395:p.Val502Ile	Somatic		Capture	Illumina HiSeq	Phase_I	149657176	NM_001012301	A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	ENST00000328668.7	37	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.305625	0.40795	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	D;D	0.97505	-4.41;-4.41	4.55	4.55	0.56014	Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.96396	0.8824	L	0.39898	1.24	0.58432	D	0.999999	D	0.55605	0.972	P	0.55508	0.777	D	0.94941	0.8091	10	0.19147	T	0.46	.	17.5101	0.87758	0.0:1.0:0.0:0.0	.	502	Q5FYB1	ARSI_HUMAN	I	502;359	ENSP00000333395:V502I;ENSP00000426879:V359I	ENSP00000333395:V502I	V	-	1	0	ARSI	149657176	1.000000	0.71417	0.965000	0.40720	0.917000	0.54804	7.313000	0.78978	2.352000	0.79861	0.637000	0.83480	GTA		0.632	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301	
KIF4B	285643	broad.mit.edu	37	5	154395212	154395212	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:154395212G>A	ENST00000435029.4	+	1	1953	c.1793G>A	c.(1792-1794)cGc>cAc	p.R598H		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	598					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.R598H(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGTGAGCACCGCCACAAACTT	0.438																																					p.R598H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1793A	5						.						88.0	90.0	89.0					5																	154395212		2203	4300	6503	154375405	SO:0001583	missense	285643	exon1			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1793G>A	5.37:g.154395212G>A	ENSP00000387875:p.Arg598His	Somatic		Capture	Illumina HiSeq	Phase_I	154375405	NM_001099293		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	g	10.78	1.447684	0.26074	.	.	ENSG00000226650	ENST00000435029	T	0.17213	2.29	2.14	1.22	0.21188	.	.	.	.	.	T	0.19406	0.0466	L	0.49699	1.58	0.58432	D	0.999998	D	0.65815	0.995	P	0.51550	0.673	T	0.07558	-1.0766	9	0.24483	T	0.36	.	6.8458	0.23987	0.1667:0.0:0.8333:0.0	.	598	Q2VIQ3	KIF4B_HUMAN	H	598	ENSP00000387875:R598H	ENSP00000387875:R598H	R	+	2	0	KIF4B	154375405	1.000000	0.71417	0.043000	0.18650	0.072000	0.16883	6.141000	0.71744	0.194000	0.20326	0.563000	0.77884	CGC		0.438	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
TTC1	7265	broad.mit.edu	37	5	159437637	159437637	+	Silent	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:159437637T>C	ENST00000231238.5	+	2	212	c.102T>C	c.(100-102)ccT>ccC	p.P34P	Y_RNA_ENST00000362528.1_RNA|TTC1_ENST00000522793.1_Silent_p.P34P	NM_001282500.1|NM_003314.1	NP_001269429.1|NP_003305.1	Q99614	TTC1_HUMAN	tetratricopeptide repeat domain 1	34					protein folding (GO:0006457)	peroxisomal membrane (GO:0005778)	unfolded protein binding (GO:0051082)	p.P34P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|prostate(1)|skin(1)	12	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)		CTCCAGTTCCTGATCCCAAAA	0.517																																					p.P34P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T102C	5						.						56.0	57.0	57.0					5																	159437637		2203	4300	6503	159370215	SO:0001819	synonymous_variant	7265	exon2			U46570	CCDS4348.1	5q32-q33.2	2013-01-10			ENSG00000113312	ENSG00000113312		"""Tetratricopeptide (TTC) repeat domain containing"""	12391	protein-coding gene	gene with protein product		601963				8836031	Standard	NM_003314		Approved	TPR1	uc003lxu.3	Q99614	OTTHUMG00000130326	ENST00000231238.5:c.102T>C	5.37:g.159437637T>C		Somatic		Capture	Illumina HiSeq	Phase_I	159370215	NM_003314	B2RCT2|D3DQJ8|Q9BVT3	Silent	SNP	ENST00000231238.5	37	CCDS4348.1																																																																																				0.517	TTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252675.3	NM_003314	
TENM2	57451	broad.mit.edu	37	5	167545399	167545399	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:167545399A>G	ENST00000518659.1	+	10	1955	c.1916A>G	c.(1915-1917)cAg>cGg	p.Q639R	TENM2_ENST00000545108.1_Missense_Mutation_p.Q639R|TENM2_ENST00000520394.1_Missense_Mutation_p.Q407R|TENM2_ENST00000403607.2_Missense_Mutation_p.Q472R|TENM2_ENST00000519204.1_Missense_Mutation_p.Q518R|CTB-178M22.1_ENST00000517408.1_RNA	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	639	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.Q472R(1)|p.Q639R(1)									CCCATGAATCAGTGCATCGAT	0.582																																					p.Q639R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1916G	5						.						157.0	161.0	160.0					5																	167545399		2132	4250	6382	167477977	SO:0001583	missense	57451	exon10			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1916A>G	5.37:g.167545399A>G	ENSP00000429430:p.Gln639Arg	Somatic		Capture	Illumina HiSeq	Phase_I	167477977	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	A	29.1	4.974299	0.92919	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.03496	3.91;3.91;3.91;3.91;3.91	4.92	4.92	0.64577	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.051038	0.85682	D	0.000000	T	0.13114	0.0318	M	0.66297	2.02	0.48632	D	0.999687	P;P;P	0.52170	0.919;0.571;0.951	P;B;P	0.57548	0.67;0.163;0.823	T	0.00477	-1.1716	10	0.56958	D	0.05	.	14.5822	0.68300	1.0:0.0:0.0:0.0	.	639;407;518	Q9NT68;F8VNQ3;G3V106	TEN2_HUMAN;.;.	R	639;639;518;407;472	ENSP00000429430:Q639R;ENSP00000438635:Q639R;ENSP00000428964:Q518R;ENSP00000427874:Q407R;ENSP00000384905:Q472R	ENSP00000384905:Q472R	Q	+	2	0	ODZ2	167477977	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	1.849000	0.53698	0.533000	0.62120	CAG		0.582	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
ADAMTS16	170690	broad.mit.edu	37	5	5239843	5239843	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:5239843C>T	ENST00000274181.7	+	16	2466	c.2328C>T	c.(2326-2328)atC>atT	p.I776I		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	776	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTATCCGCATCTATGAAATGA	0.502																																					p.I776I												.	.	0			c.C2328T	5						.						155.0	145.0	148.0					5																	5239843		1892	4111	6003	5292843	SO:0001819	synonymous_variant	170690	exon16			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2328C>T	5.37:g.5239843C>T		None		Capture	Illumina HiSeq	Phase_I	5292843	NM_139056	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1																																																																																				0.502	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
ADAMTS16	170690	broad.mit.edu	37	5	5306763	5306763	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:5306763G>A	ENST00000274181.7	+	21	3471	c.3333G>A	c.(3331-3333)ccG>ccA	p.P1111P		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1111	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P1111P(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CCTGCGCCCCGCTTCCATGCC	0.612																																					p.P1111P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3333A	5						.						37.0	39.0	39.0					5																	5306763		1931	4128	6059	5359763	SO:0001819	synonymous_variant	170690	exon21			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3333G>A	5.37:g.5306763G>A		Somatic		Capture	Illumina HiSeq	Phase_I	5359763	NM_139056	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1																																																																																				0.612	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
NSUN2	54888	broad.mit.edu	37	5	6607320	6607320	+	Missense_Mutation	SNP	C	C	T	rs376441708		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:6607320C>T	ENST00000264670.6	-	13	1812	c.1501G>A	c.(1501-1503)Gtg>Atg	p.V501M	NSUN2_ENST00000506139.1_Missense_Mutation_p.V466M|NSUN2_ENST00000539938.1_Missense_Mutation_p.V265M	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	501					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)	p.V501M(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						TACCCACACACGCCATCTTTC	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		21118	0.0		0.0	False		,,,				2504	0.001				p.V501M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1501A	5						.	C	MET/VAL,MET/VAL	0,4406		0,0,2203	284.0	280.0	281.0		1396,1501	5.6	1.0	5		281	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	NSUN2	NM_001193455.1,NM_017755.5	21,21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	466/733,501/768	6607320	1,13005	2203	4300	6503	6660320	SO:0001583	missense	54888	exon13			AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.1501G>A	5.37:g.6607320C>T	ENSP00000264670:p.Val501Met	Somatic		Capture	Illumina HiSeq	Phase_I	6660320	NM_017755	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	37	CCDS3869.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311537	0.60414	0.0	1.16E-4	ENSG00000037474	ENST00000264670;ENST00000539938;ENST00000506139	T;T;T	0.55588	1.24;0.51;1.24	5.61	5.61	0.85477	.	0.178154	0.48767	D	0.000166	T	0.53514	0.1801	M	0.80982	2.52	0.58432	D	0.999999	D;P	0.56035	0.974;0.702	B;B	0.36719	0.231;0.111	T	0.63695	-0.6579	10	0.46703	T	0.11	-52.9002	16.7327	0.85439	0.0:1.0:0.0:0.0	.	466;501	B4DQW2;Q08J23	.;NSUN2_HUMAN	M	501;265;466	ENSP00000264670:V501M;ENSP00000444338:V265M;ENSP00000420957:V466M	ENSP00000264670:V501M	V	-	1	0	NSUN2	6660320	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.079000	0.57613	2.793000	0.96121	0.655000	0.94253	GTG		0.443	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
ADCY2	108	broad.mit.edu	37	5	7414706	7414706	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:7414706G>A	ENST00000338316.4	+	2	320	c.231G>A	c.(229-231)gcG>gcA	p.A77A		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	77					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.A77A(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						ACCATGTGGCGTTTCTAATAA	0.398																																					p.A77A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G231A	5						.						251.0	237.0	242.0					5																	7414706		2203	4300	6503	7467706	SO:0001819	synonymous_variant	108	exon2			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.231G>A	5.37:g.7414706G>A		Somatic		Capture	Illumina HiSeq	Phase_I	7467706	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																				0.398	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
ZFR	51663	broad.mit.edu	37	5	32417797	32417797	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:32417797G>A	ENST00000265069.8	-	4	623	c.521C>T	c.(520-522)gCt>gTt	p.A174V		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	174	Ala-rich.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		AGGTTGGGCAGCGGCAGCTAC	0.428																																					p.A174V												.	.	0			c.C521T	5						.						87.0	93.0	91.0					5																	32417797		2203	4300	6503	32453554	SO:0001583	missense	51663	exon4			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.521C>T	5.37:g.32417797G>A	ENSP00000265069:p.Ala174Val	None		Capture	Illumina HiSeq	Phase_I	32453554	NM_016107	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	37	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.916002	0.92178	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.06449	3.3	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.18215	0.0437	L	0.38175	1.15	0.80722	D	1	P;D	0.63880	0.924;0.993	P;D	0.65443	0.827;0.935	T	0.00149	-1.1988	10	0.56958	D	0.05	.	20.0424	0.97595	0.0:0.0:1.0:0.0	.	174;174	B2RNR6;Q96KR1	.;ZFR_HUMAN	V	174;152	ENSP00000265069:A174V	ENSP00000265069:A174V	A	-	2	0	ZFR	32453554	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.794000	0.85869	2.725000	0.93324	0.557000	0.71058	GCT		0.428	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
PDE4D	5144	broad.mit.edu	37	5	58272189	58272189	+	Silent	SNP	G	G	A	rs368591431		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:58272189G>A	ENST00000340635.6	-	13	1993	c.1818C>T	c.(1816-1818)tcC>tcT	p.S606S	PDE4D_ENST00000405755.2_Silent_p.S484S|PDE4D_ENST00000358923.6_Silent_p.S304S|PDE4D_ENST00000317118.8_Silent_p.S315S|PDE4D_ENST00000360047.5_Silent_p.S470S|PDE4D_ENST00000507116.1_Silent_p.S542S|PDE4D_ENST00000502484.2_Silent_p.S545S|PDE4D_ENST00000546160.1_Silent_p.S545S|PDE4D_ENST00000503258.1_Silent_p.S476S	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	606					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.S542S(1)|p.S606S(1)|p.S470S(1)|p.S484S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GAATCCTATCGGAATAATTAT	0.393																																					p.S382S												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.C1146T	5						.						86.0	86.0	86.0					5																	58272189		1907	4127	6034	58307946	SO:0001819	synonymous_variant	5144	exon8				CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.1818C>T	5.37:g.58272189G>A		Somatic		Capture	Illumina HiSeq	Phase_I	58307946	NM_001197222	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Silent	SNP	ENST00000340635.6	37	CCDS47213.1																																																																																				0.393	PDE4D-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367940.3		
PIK3R1	5295	broad.mit.edu	37	5	67588167	67588167	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:67588167T>A	ENST00000521381.1	+	8	1613	c.997T>A	c.(997-999)Tgg>Agg	p.W333R	PIK3R1_ENST00000274335.5_Missense_Mutation_p.W333R|PIK3R1_ENST00000336483.5_Missense_Mutation_p.W63R|PIK3R1_ENST00000396611.1_Missense_Mutation_p.W333R|PIK3R1_ENST00000523872.1_5'Flank|PIK3R1_ENST00000521657.1_Missense_Mutation_p.W333R|PIK3R1_ENST00000320694.8_Missense_Mutation_p.W33R	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	333	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)|p.W333R(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	AGATGCTGAATGGTACTGGGG	0.383			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.W333R			Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	.	3	Substitution - Missense(1)|Whole gene deletion(1)|Unknown(1)	large_intestine(2)|lung(1)	c.T997A	5						.						164.0	152.0	156.0					5																	67588167		2203	4300	6503	67623923	SO:0001583	missense	5295	exon7			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.997T>A	5.37:g.67588167T>A	ENSP00000428056:p.Trp333Arg	Somatic		Capture	Illumina HiSeq	Phase_I	67623923	NM_181523	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	ENST00000521381.1	37	CCDS3993.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.092532	0.76756	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000523807;ENST00000522084;ENST00000320694;ENST00000336483	D;D;D;D;D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48	5.13	5.13	0.70059	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.98611	0.9535	H	0.99565	4.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.99513	1.0956	10	0.87932	D	0	-10.8887	15.377	0.74615	0.0:0.0:0.0:1.0	.	63;33;333	P27986-2;P27986-3;P27986	.;.;P85A_HUMAN	R	333;333;333;333;63;63;33;63	ENSP00000428056:W333R;ENSP00000429277:W333R;ENSP00000379855:W333R;ENSP00000274335:W333R;ENSP00000430126:W63R;ENSP00000429766:W63R;ENSP00000323512:W33R;ENSP00000338554:W63R	ENSP00000274335:W333R	W	+	1	0	PIK3R1	67623923	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.825000	0.86693	2.276000	0.75962	0.460000	0.39030	TGG		0.383	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
GTF2H2C	728340	broad.mit.edu	37	5	68868294	68868294	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:68868294G>A	ENST00000510979.1	+	8	582	c.387G>A	c.(385-387)acG>acA	p.T129T	GTF2H2C_ENST00000508344.2_Silent_p.T72T|GTF2H2C_ENST00000380729.3_Silent_p.T129T|GTF2H2C_ENST00000512736.1_Silent_p.T129T|GTF2H2C_ENST00000514162.1_Intron	NM_001098728.1	NP_001092198.1	Q6P1K8	T2H2L_HUMAN	GTF2H2 family member C	129	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				nucleotide-excision repair (GO:0006289)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	core TFIIH complex (GO:0000439)	zinc ion binding (GO:0008270)	p.T129T(1)		large_intestine(1)|lung(1)	2						AACATATAACGTCTTTGAAGG	0.303																																					p.T129T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G387A	5						.						90.0	90.0	90.0					5																	68868294		2202	4296	6498	68904050	SO:0001819	synonymous_variant	728340	exon8				CCDS43325.1	5q13.2	2014-03-28	2014-03-28		ENSG00000183474	ENSG00000183474			31394	protein-coding gene	gene with protein product			"""general transcription factor IIH, polypeptide 2C"""				Standard	NM_001098728		Approved		uc003jwz.4	Q6P1K8	OTTHUMG00000162365	ENST00000510979.1:c.387G>A	5.37:g.68868294G>A		Somatic		Capture	Illumina HiSeq	Phase_I	68904050	NM_001098728	A6NED9|A8K8J6|B2RCU4|B7ZW39	Silent	SNP	ENST00000510979.1	37	CCDS43325.1																																																																																				0.303	GTF2H2C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368637.3	NM_001098728	
MAP1B	4131	broad.mit.edu	37	5	71490040	71490040	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:71490040C>T	ENST00000296755.7	+	5	1156	c.858C>T	c.(856-858)ggC>ggT	p.G286G		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	286					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.G286G(3)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TCATCAATGGCGGATCAGAGA	0.488																																					p.G286G	Melanoma(17;367 822 11631 31730 47712)											.	.	3	Substitution - coding silent(3)	large_intestine(2)|ovary(1)	c.C858T	5						.						81.0	86.0	84.0					5																	71490040		2203	4300	6503	71525796	SO:0001819	synonymous_variant	4131	exon5			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.858C>T	5.37:g.71490040C>T		Somatic		Capture	Illumina HiSeq	Phase_I	71525796	NM_005909	A2BDK5	Silent	SNP	ENST00000296755.7	37	CCDS4012.1																																																																																				0.488	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
FCHO2	115548	broad.mit.edu	37	5	72264329	72264329	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:72264329delA	ENST00000430046.2	+	2	154	c.38delA	c.(37-39)gaafs	p.E13fs	FCHO2_ENST00000341845.6_Frame_Shift_Del_p.E13fs|FCHO2_ENST00000512348.1_Frame_Shift_Del_p.E13fs|FCHO2_ENST00000287761.6_Frame_Shift_Del_p.E13fs	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	13	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.|Mediates dimerization and binding to membranes enriched in Pi(4,5)-P2 and induces their tubulation.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.N15fs*11(2)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		TTTTAGGGGGAAAAAAATAGT	0.289																																					p.E13fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.38delA	5						.						16.0	16.0	16.0					5																	72264329		1783	4027	5810	72300085	SO:0001589	frameshift_variant	115548	exon2			AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.38delA	5.37:g.72264329delA	ENSP00000393776:p.Glu13fs	Somatic		Capture	Illumina HiSeq	Phase_I	72300085	NM_001146032	A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Frame_Shift_Del	DEL	ENST00000430046.2	37	CCDS47230.1																																																																																				0.289	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368795.3	XM_291142	
FAM169A	26049	broad.mit.edu	37	5	74096804	74096804	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:74096804C>T	ENST00000389156.4	-	10	1094	c.1004G>A	c.(1003-1005)cGg>cAg	p.R335Q	FAM169A_ENST00000380515.3_3'UTR|FAM169A_ENST00000510496.1_Missense_Mutation_p.R275Q	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	335						membrane (GO:0016020)|nucleus (GO:0005634)		p.R335Q(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						AATCTTTGGCCGCTTTAGATT	0.373																																					p.R335Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1004A	5						.						109.0	102.0	104.0					5																	74096804		1828	4074	5902	74132560	SO:0001583	missense	26049	exon10				CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.1004G>A	5.37:g.74096804C>T	ENSP00000373808:p.Arg335Gln	Somatic		Capture	Illumina HiSeq	Phase_I	74132560	NM_015566	A8K1T9|Q6MZT0|Q9H989	Missense_Mutation	SNP	ENST00000389156.4	37	CCDS43330.1	.	.	.	.	.	.	.	.	.	.	C	35	5.448528	0.96205	.	.	ENSG00000198780	ENST00000389156;ENST00000510496	T	0.49139	0.79	5.93	5.93	0.95920	.	0.113706	0.39407	N	0.001379	T	0.50394	0.1613	L	0.34521	1.04	0.80722	D	1	D;D	0.64830	0.994;0.986	P;P	0.53912	0.737;0.709	T	0.24261	-1.0165	10	0.15952	T	0.53	-12.1619	18.906	0.92462	0.0:1.0:0.0:0.0	.	275;335	D6RB01;Q9Y6X4	.;F169A_HUMAN	Q	335;275	ENSP00000373808:R335Q	ENSP00000373808:R335Q	R	-	2	0	FAM169A	74132560	0.992000	0.36948	1.000000	0.80357	0.982000	0.71751	3.049000	0.49869	2.810000	0.96702	0.655000	0.94253	CGG		0.373	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371092.2		
OTP	23440	broad.mit.edu	37	5	76932669	76932669	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:76932669C>T	ENST00000306422.3	-	2	1562	c.424G>A	c.(424-426)Ggg>Agg	p.G142R	OTP_ENST00000515716.1_5'UTR	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	142					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G142R(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		TCGGTCAGCCCGATACGCAGT	0.617																																					p.G142R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G424A	5						.						79.0	75.0	77.0					5																	76932669		2203	4300	6503	76968425	SO:0001583	missense	23440	exon2				CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.424G>A	5.37:g.76932669C>T	ENSP00000302814:p.Gly142Arg	Somatic		Capture	Illumina HiSeq	Phase_I	76968425	NM_032109		Missense_Mutation	SNP	ENST00000306422.3	37	CCDS4039.1	.	.	.	.	.	.	.	.	.	.	C	35	5.487009	0.96323	.	.	ENSG00000171540	ENST00000306422	D	0.96619	-4.07	5.21	5.21	0.72293	Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (2);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97742	0.9259	M	0.83384	2.64	0.80722	D	1	D	0.65815	0.995	P	0.57009	0.811	D	0.98360	1.0548	10	0.72032	D	0.01	.	18.712	0.91661	0.0:1.0:0.0:0.0	.	142	Q5XKR4	OTP_HUMAN	R	142	ENSP00000302814:G142R	ENSP00000302814:G142R	G	-	1	0	OTP	76968425	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.981000	0.70524	2.597000	0.87782	0.655000	0.94253	GGG		0.617	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220016.2		
HAPLN1	1404	broad.mit.edu	37	5	82937441	82937441	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:82937441G>A	ENST00000274341.4	-	5	1789	c.939C>T	c.(937-939)agC>agT	p.S313S		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	313	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.S313S(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	GGTAGCGGACGCTGCCATCCG	0.537																																					p.S313S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C939T	5						.						108.0	113.0	111.0					5																	82937441		2203	4300	6503	82973197	SO:0001819	synonymous_variant	1404	exon5				CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.939C>T	5.37:g.82937441G>A		Somatic		Capture	Illumina HiSeq	Phase_I	82973197	NM_001884	B2R9A9	Silent	SNP	ENST00000274341.4	37	CCDS4061.1																																																																																				0.537	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884	
GPR98	84059	broad.mit.edu	37	5	90059212	90059212	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:90059212C>T	ENST00000405460.2	+	59	12307	c.12211C>T	c.(12211-12213)Cga>Tga	p.R4071*		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4071	Calx-beta 27. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.R4071*(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGGAACCGTCCGACTTGAGTG	0.448																																					p.R4071X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C12211T	5						.						71.0	69.0	70.0					5																	90059212		1864	4110	5974	90094968	SO:0001587	stop_gained	84059	exon59			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.12211C>T	5.37:g.90059212C>T	ENSP00000384582:p.Arg4071*	Somatic		Capture	Illumina HiSeq	Phase_I	90094968	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Nonsense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	52	19.790776	0.99923	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	.	.	.	5.21	4.32	0.51571	.	0.451392	0.24613	N	0.037027	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1596	0.59537	0.412:0.588:0.0:0.0	.	.	.	.	X	4071	.	ENSP00000296619:R4071X	R	+	1	2	GPR98	90094968	0.003000	0.15002	0.263000	0.24496	0.156000	0.22039	1.128000	0.31369	1.287000	0.44583	0.563000	0.77884	CGA		0.448	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
CNOT6	57472	broad.mit.edu	37	5	179992872	179992872	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr5:179992872G>A	ENST00000393356.1	+	9	1036	c.612G>A	c.(610-612)cgG>cgA	p.R204R	CNOT6_ENST00000261951.4_Silent_p.R204R			Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6	204	Nuclease domain. {ECO:0000250}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)	p.R204R(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|skin(1)	23	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		ATGCGACCCGGCAGTTATACG	0.398																																					p.R204R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G612A	5						.						128.0	121.0	124.0					5																	179992872		2203	4300	6503	179925478	SO:0001819	synonymous_variant	57472	exon7			AB033020	CCDS4455.1	5q35.3	2014-06-17			ENSG00000113300	ENSG00000113300			14099	protein-coding gene	gene with protein product		608951				11889047	Standard	XM_005265953		Approved	CCR4, KIAA1194, Ccr4a	uc003mlx.3	Q9ULM6	OTTHUMG00000130935	ENST00000393356.1:c.612G>A	5.37:g.179992872G>A		Somatic		Capture	Illumina HiSeq	Phase_I	179925478	NM_015455	A7MD46|D3DWR0	Silent	SNP	ENST00000393356.1	37	CCDS4455.1																																																																																				0.398	CNOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253532.1	NM_015455	
TAPBP	6892	broad.mit.edu	37	6	33273072	33273073	+	Frame_Shift_Ins	INS	-	-	G	rs561629511		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:33273072_33273073insG	ENST00000489157.1	-	3	512_513	c.300_301insC	c.(298-303)cccaccfs	p.T101fs	TAPBP_ENST00000456592.2_Frame_Shift_Ins_p.T188fs|TAPBP_ENST00000426633.2_Frame_Shift_Ins_p.T188fs|TAPBP_ENST00000434618.2_Frame_Shift_Ins_p.T188fs|TAPBP_ENST00000475304.1_Frame_Shift_Ins_p.T206fs			O15533	TPSN_HUMAN	TAP binding protein (tapasin)	188					amide transport (GO:0042886)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|peptide antigen stabilization (GO:0050823)|peptide transport (GO:0015833)|protein complex assembly (GO:0006461)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|MHC class I peptide loading complex (GO:0042824)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)|peptide antigen-transporting ATPase activity (GO:0015433)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)|unfolded protein binding (GO:0051082)	p.T188fs*26(2)		endometrium(2)|large_intestine(5)|lung(8)|ovary(3)	18						GCCTCGGAGGTGGGGGGCATGT	0.629																																					p.T188fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.562_563insC	6						.																																			33381051	SO:0001589	frameshift_variant	6892	exon4			Y13582	CCDS34426.1, CCDS34427.1, CCDS34428.1, CCDS34427.2, CCDS34428.2	6p21.3	2014-09-17			ENSG00000231925	ENSG00000231925		"""Immunoglobulin superfamily / C1-set domain containing"""	11566	protein-coding gene	gene with protein product		601962				9238042	Standard	NM_003190		Approved	TAPA	uc003odz.3	O15533	OTTHUMG00000031090	ENST00000489157.1:c.301dupC	6.37:g.33273078_33273078dupG	ENSP00000419659:p.Thr101fs	Somatic		Capture	Illumina HiSeq	Phase_I	33381050	NM_003190	A2AB91|A2ABC0|B0V003|B0V0A6|B2ZUA4|E9PGM2|O15210|O15272|Q5STJ8|Q5STK6|Q5STQ5|Q5STQ6|Q66K65|Q96KK7|Q9HAN8|Q9UEE0|Q9UEE4|Q9UIZ6|Q9Y6K2	Frame_Shift_Ins	INS	ENST00000489157.1	37	CCDS34427.2																																																																																				0.629	TAPBP-006	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276425.2		
GJA1	2697	broad.mit.edu	37	6	121768708	121768708	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:121768708C>T	ENST00000282561.3	+	2	872	c.715C>T	c.(715-717)Cgg>Tgg	p.R239W		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	239			R -> Q (in CMDR). {ECO:0000269|PubMed:23951358}.|R -> W (in congenital heart malformations; dbSNP:rs2227887). {ECO:0000269|PubMed:15978203}.		adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)	p.R239W(1)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	CGTTAAGGATCGGGTTAAGGG	0.478																																					p.R239W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C715T	6	GRCh37	CM055952	GJA1	M		.						109.0	109.0	109.0					6																	121768708		2203	4300	6503	121810407	SO:0001583	missense	2697	exon2			BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.715C>T	6.37:g.121768708C>T	ENSP00000282561:p.Arg239Trp	Somatic		Capture	Illumina HiSeq	Phase_I	121810407	NM_000165	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.270834	0.40194	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.97455	-4.39	5.54	5.54	0.83059	.	0.063974	0.64402	D	0.000006	D	0.92721	0.7686	L	0.32530	0.975	0.58432	D	0.999997	D	0.64830	0.994	B	0.42653	0.394	D	0.93496	0.6840	10	0.54805	T	0.06	.	15.0337	0.71728	0.0:0.8583:0.1417:0.0	.	239	P17302	CXA1_HUMAN	W	223;239	ENSP00000282561:R239W	ENSP00000282561:R239W	R	+	1	2	GJA1	121810407	1.000000	0.71417	0.994000	0.49952	0.192000	0.23643	5.656000	0.67988	2.609000	0.88269	0.460000	0.39030	CGG		0.478	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
NCOA7	135112	broad.mit.edu	37	6	126210970	126210970	+	Silent	SNP	G	G	A	rs369216530		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:126210970G>A	ENST00000368357.3	+	10	2122	c.1770G>A	c.(1768-1770)ccG>ccA	p.P590P	NCOA7_ENST00000229634.9_Silent_p.P475P|NCOA7_ENST00000392477.2_Silent_p.P590P	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	590					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)	p.P590P(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		AGCCCCTCCCGGTAAAACTGA	0.468																																					p.P590P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1770A	6						.	G	,,,,	0,4406		0,0,2203	54.0	59.0	57.0		1737,1770,1770,1425,1770	-3.1	0.0	6		57	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NCOA7	NM_001122842.2,NM_001199619.1,NM_001199620.1,NM_001199621.1,NM_181782.4	,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,	579/932,590/943,590/943,475/828,590/943	126210970	1,13005	2203	4300	6503	126252663	SO:0001819	synonymous_variant	135112	exon11			AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.1770G>A	6.37:g.126210970G>A		Somatic		Capture	Illumina HiSeq	Phase_I	126252663	NM_001199620	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Silent	SNP	ENST00000368357.3	37	CCDS5132.1																																																																																				0.468	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748	
THEMIS	387357	broad.mit.edu	37	6	128134053	128134053	+	Missense_Mutation	SNP	G	G	A	rs370574765		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:128134053G>A	ENST00000368248.2	-	4	1881	c.1733C>T	c.(1732-1734)aCg>aTg	p.T578M	THEMIS_ENST00000537166.1_Missense_Mutation_p.T543M|THEMIS_ENST00000368250.1_Missense_Mutation_p.T499M|THEMIS_ENST00000543064.1_Missense_Mutation_p.T578M	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	578					negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T578M(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						CAGGTCTACCGTCCTTTCTTC	0.478													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18463	0.0		0.0	False		,,,				2504	0.0				p.T578M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1733T	6						.	G	MET/THR,MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	161.0	164.0	163.0		1733,1733,1628	-2.6	0.0	6		163	0,8600		0,0,4300	no	missense,missense,missense	THEMIS	NM_001010923.2,NM_001164685.1,NM_001164687.1	81,81,81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	578/642,578/681,543/607	128134053	1,13005	2203	4300	6503	128175746	SO:0001583	missense	387357	exon4			AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1733C>T	6.37:g.128134053G>A	ENSP00000357231:p.Thr578Met	Somatic		Capture	Illumina HiSeq	Phase_I	128175746	NM_001010923	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	37	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	G	2.917	-0.224039	0.06061	2.27E-4	0.0	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166	T;T;T;T	0.18810	2.19;2.21;2.2;2.19	5.96	-2.63	0.06133	.	0.802256	0.11314	N	0.576752	T	0.06645	0.0170	L	0.47716	1.5	0.09310	N	1	D;P	0.54964	0.969;0.909	B;B	0.42882	0.401;0.151	T	0.17137	-1.0379	10	0.62326	D	0.03	0.0915	5.0583	0.14544	0.1593:0.3753:0.369:0.0963	.	578;578	F5H1J9;Q8N1K5	.;THMS1_HUMAN	M	499;578;578;543	ENSP00000357233:T499M;ENSP00000439594:T578M;ENSP00000357231:T578M;ENSP00000439863:T543M	ENSP00000357231:T578M	T	-	2	0	THEMIS	128175746	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.373000	0.20484	-0.378000	0.07918	-0.808000	0.03180	ACG		0.478	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
LAMA2	3908	broad.mit.edu	37	6	129828783	129828783	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:129828783A>C	ENST00000421865.2	+	62	8902	c.8853A>C	c.(8851-8853)aaA>aaC	p.K2951N		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2951	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.K2951N(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GTTTTGCCAAAGCAGGTAAGG	0.418																																					p.K2947N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A8841C	6						.						165.0	160.0	161.0					6																	129828783		2203	4300	6503	129870476	SO:0001583	missense	3908	exon61			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.8853A>C	6.37:g.129828783A>C	ENSP00000400365:p.Lys2951Asn	Somatic		Capture	Illumina HiSeq	Phase_I	129870476	NM_001079823	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	A	16.52	3.145099	0.57044	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	T	0.44881	0.91	5.52	5.52	0.82312	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.131138	0.64402	D	0.000001	T	0.35038	0.0918	M	0.68952	2.095	0.52501	D	0.999955	D;D	0.56521	0.976;0.976	P;P	0.44921	0.464;0.464	T	0.26052	-1.0114	9	.	.	.	.	15.6493	0.77078	1.0:0.0:0.0:0.0	.	2952;2951	A6NF00;P24043	.;LAMA2_HUMAN	N	2951;2950;2951;969	ENSP00000400365:K2951N	.	K	+	3	2	LAMA2	129870476	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.458000	0.90364	2.109000	0.64355	0.402000	0.26972	AAA		0.418	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
SYNE1	23345	broad.mit.edu	37	6	152603035	152603035	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:152603035G>T	ENST00000367255.5	-	97	18889	c.18288C>A	c.(18286-18288)gaC>gaA	p.D6096E	SYNE1_ENST00000448038.1_Missense_Mutation_p.D6025E|SYNE1_ENST00000341594.5_Missense_Mutation_p.D5708E|SYNE1_ENST00000356820.4_Missense_Mutation_p.D620E|SYNE1_ENST00000423061.1_Missense_Mutation_p.D6025E|SYNE1_ENST00000265368.4_Missense_Mutation_p.D6096E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6096					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.D6096E(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGAGCCAGCTGTCCAGCTCAT	0.552										HNSCC(10;0.0054)																											p.D620E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1860A	6						.						105.0	87.0	93.0					6																	152603035		2203	4300	6503	152644728	SO:0001583	missense	23345	exon12			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18288C>A	6.37:g.152603035G>T	ENSP00000356224:p.Asp6096Glu	Somatic		Capture	Illumina HiSeq	Phase_I	152644728	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	9.565	1.119454	0.20877	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.53857	0.69;0.66;0.6;0.66;0.8;1.05	5.23	4.36	0.52297	.	0.187614	0.37053	N	0.002265	T	0.26268	0.0641	L	0.56769	1.78	0.42780	D	0.993867	B;B;B;B	0.29835	0.017;0.167;0.167;0.258	B;B;B;B	0.31547	0.016;0.062;0.062;0.132	T	0.13737	-1.0498	10	0.07030	T	0.85	.	11.0693	0.47993	0.1499:0.0:0.8501:0.0	.	511;6096;6096;6025	B7ZBD0;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	E	6096;6025;6096;6025;5708;620	ENSP00000356224:D6096E;ENSP00000396024:D6025E;ENSP00000265368:D6096E;ENSP00000390975:D6025E;ENSP00000341887:D5708E;ENSP00000349276:D620E	ENSP00000265368:D6096E	D	-	3	2	SYNE1	152644728	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	1.772000	0.38552	1.345000	0.45676	0.591000	0.81541	GAC		0.552	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SCAF8	22828	broad.mit.edu	37	6	155153497	155153497	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:155153497G>A	ENST00000367178.3	+	20	3360	c.2784G>A	c.(2782-2784)ccG>ccA	p.P928P	SCAF8_ENST00000367186.4_Silent_p.P994P|SCAF8_ENST00000417268.1_Silent_p.P928P|TIAM2_ENST00000461783.3_5'Flank	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	928	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)	p.P928P(2)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						ACATTCGTCCGGGACTAATAC	0.512																																					p.P928P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G2784A	6						.						157.0	167.0	164.0					6																	155153497		2203	4300	6503	155195189	SO:0001819	synonymous_variant	22828	exon20			AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.2784G>A	6.37:g.155153497G>A		Somatic		Capture	Illumina HiSeq	Phase_I	155195189	NM_014892	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Silent	SNP	ENST00000367178.3	37	CCDS5247.1																																																																																				0.512	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892	
TULP4	56995	broad.mit.edu	37	6	158924380	158924380	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:158924380C>T	ENST00000367097.3	+	13	5042	c.3685C>T	c.(3685-3687)Ccg>Tcg	p.P1229S	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1229					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P1229S(1)		endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GGTCCTTCAGCCGCTGTACCC	0.602																																					p.P1229S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3685T	6						.						59.0	55.0	56.0					6																	158924380		2203	4300	6503	158844368	SO:0001583	missense	56995	exon13				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.3685C>T	6.37:g.158924380C>T	ENSP00000356064:p.Pro1229Ser	Somatic		Capture	Illumina HiSeq	Phase_I	158844368	NM_020245	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.525026	0.44969	.	.	ENSG00000130338	ENST00000367097	T	0.21734	1.99	5.08	4.21	0.49690	.	0.057024	0.64402	D	0.000001	T	0.17577	0.0422	M	0.65498	2.005	0.80722	D	1	P	0.47762	0.9	B	0.43889	0.435	T	0.03503	-1.1030	10	0.62326	D	0.03	-14.0068	15.1576	0.72755	0.1421:0.8579:0.0:0.0	.	1229	Q9NRJ4	TULP4_HUMAN	S	1229	ENSP00000356064:P1229S	ENSP00000356064:P1229S	P	+	1	0	TULP4	158844368	1.000000	0.71417	0.925000	0.36789	0.592000	0.36648	4.295000	0.59049	1.365000	0.46057	0.561000	0.74099	CCG		0.602	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	
DSP	1832	broad.mit.edu	37	6	7583617	7583617	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:7583617G>A	ENST00000379802.3	+	24	6463	c.6122G>A	c.(6121-6123)aGc>aAc	p.S2041N	DSP_ENST00000418664.2_Missense_Mutation_p.S1442N	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2041	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.S2041N(1)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AAATTAATCAGCCCAGAATCC	0.493																																					p.S1442N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4325A	6						.						52.0	57.0	56.0					6																	7583617		2203	4300	6503	7528616	SO:0001583	missense	1832	exon24			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6122G>A	6.37:g.7583617G>A	ENSP00000369129:p.Ser2041Asn	Somatic		Capture	Illumina HiSeq	Phase_I	7528616	NM_001008844	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.564517	0.27915	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.67865	-0.29;-0.29	4.98	2.06	0.26882	.	0.563281	0.16936	N	0.193468	T	0.31327	0.0793	L	0.36672	1.1	0.09310	N	1	P;B	0.44429	0.835;0.0	B;B	0.38500	0.275;0.0	T	0.21724	-1.0237	10	0.17369	T	0.5	.	11.1707	0.48569	0.1308:0.5978:0.2713:0.0	.	1489;2041	Q4LE79;P15924	.;DESP_HUMAN	N	2041;1442	ENSP00000369129:S2041N;ENSP00000396591:S1442N	ENSP00000369129:S2041N	S	+	2	0	DSP	7528616	0.610000	0.26983	0.970000	0.41538	0.884000	0.51177	0.943000	0.29030	0.179000	0.19938	-0.165000	0.13383	AGC		0.493	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
ATXN1	6310	broad.mit.edu	37	6	16327913	16327915	+	In_Frame_Del	DEL	TGA	TGA	-	rs11969612|rs369629396	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	TGA	TGA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:16327913_16327915delTGA	ENST00000244769.4	-	8	1563_1565	c.627_629delTCA	c.(625-630)catcag>cag	p.H209del	ATXN1_ENST00000436367.1_In_Frame_Del_p.H209del	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	209	Poly-Gln.		H -> Q (in dbSNP:rs11969612).		adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.H209delH(2)|p.H209_H211delHQH(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				ctgctgatgctgatgctgctgct	0.665																																					p.209_210del												.	.	3	Deletion - In frame(3)	upper_aerodigestive_tract(1)|large_intestine(1)|prostate(1)	c.627_629del	6						.		,|,	615,313,2022|637,2259		169,39,238,43,188,798|112,413,923					,|,		0.0|0.0		dbSNP_130	7|7	1006,693,4879|752,5866		252,19,483,15,644,1876|24,704,2581	no|no	codingComplex,codingComplex|coding,coding	ATXN1|ATXN1	NM_001128164.1,NM_000332.3|NM_001128164.1,NM_000332.3	,|,	421,58,721,58,832,2674|136,1117,3504	A1A1,A1A2,A1R,A2A2,A2R,RR|A1A1,A1R,RR		25.8285,31.4576,27.5714|11.3629,21.9959,14.5995	,|,	,|,		1621,1006,6901|1389,8125				16435894	SO:0001651	inframe_deletion	6310	exon8			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.627_629delTCA	6.37:g.16327913_16327915delTGA	ENSP00000244769:p.His209del	Somatic		Capture	Illumina HiSeq	Phase_I	16435892	NM_000332	Q17S02|Q9UJG2|Q9Y4J1	In_Frame_Del	DEL	ENST00000244769.4	37	CCDS34342.1																																																																																				0.665	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
GPLD1	2822	broad.mit.edu	37	6	24437399	24437399	+	Silent	SNP	G	G	A	rs369479070		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:24437399G>A	ENST00000230036.1	-	21	2249	c.2139C>T	c.(2137-2139)cgC>cgT	p.R713R		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	713					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)	p.R713R(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						GGGAGAAGCGGCGGTCTCCGC	0.557																																					p.R713R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2139T	6						.	G		2,4404	4.2+/-10.8	0,2,2201	110.0	97.0	101.0		2139	-0.9	1.0	6		101	0,8600		0,0,4300	no	coding-synonymous	GPLD1	NM_001503.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		713/841	24437399	2,13004	2203	4300	6503	24545378	SO:0001819	synonymous_variant	2822	exon21			L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.2139C>T	6.37:g.24437399G>A		Somatic		Capture	Illumina HiSeq	Phase_I	24545378	NM_001503	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Silent	SNP	ENST00000230036.1	37	CCDS4553.1																																																																																				0.557	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043315.1	NM_001503	
HIST1H4E	8367	broad.mit.edu	37	6	26205097	26205097	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:26205097G>A	ENST00000360441.4	+	1	240	c.225G>A	c.(223-225)gaG>gaA	p.E75E		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	75					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.E75E(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				CTTACACGGAGCACGCCAAAC	0.542																																					p.E75E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G225A	6						.						146.0	126.0	133.0					6																	26205097		2203	4300	6503	26313076	SO:0001819	synonymous_variant	8367	exon1			Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.225G>A	6.37:g.26205097G>A		Somatic		Capture	Illumina HiSeq	Phase_I	26313076	NM_003545	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000360441.4	37	CCDS4593.1																																																																																				0.542	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040104.1	NM_003545	
GABBR1	2550	broad.mit.edu	37	6	29572410	29572410	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:29572410C>T	ENST00000377034.4	-	22	2908	c.2573G>A	c.(2572-2574)cGc>cAc	p.R858H	GABBR1_ENST00000355973.3_Missense_Mutation_p.R741H|GABBR1_ENST00000377012.4_Missense_Mutation_p.R741H|GABBR1_ENST00000377016.4_Missense_Mutation_p.R796H|GABBR1_ENST00000376977.3_3'UTR	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	858					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.R858H(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	GATCAGCCTGCGCATCTGGGG	0.577																																					p.R796H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2387A	6						.						115.0	95.0	102.0					6																	29572410		1511	2709	4220	29680389	SO:0001583	missense	2550	exon21			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2573G>A	6.37:g.29572410C>T	ENSP00000366233:p.Arg858His	Somatic		Capture	Illumina HiSeq	Phase_I	29680389	NM_021904	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	37	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	C	31	5.069416	0.93950	.	.	ENSG00000204681	ENST00000355973;ENST00000377016;ENST00000377012;ENST00000377034	D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25	4.74	4.74	0.60224	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.89291	0.6673	L	0.42686	1.345	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	D	0.90211	0.4264	10	0.72032	D	0.01	-32.5256	15.6169	0.76775	0.0:1.0:0.0:0.0	.	796;858;741	Q9UBS5-3;Q9UBS5;Q5SUJ9	.;GABR1_HUMAN;.	H	741;796;741;858	ENSP00000348248:R741H;ENSP00000366215:R796H;ENSP00000366211:R741H;ENSP00000366233:R858H	ENSP00000348248:R741H	R	-	2	0	GABBR1	29680389	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.099000	0.76981	2.639000	0.89480	0.655000	0.94253	CGC		0.577	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
HLA-E	3133	broad.mit.edu	37	6	30460337	30460337	+	Silent	SNP	G	G	T	rs575525017		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:30460337G>T	ENST00000376630.4	+	7	1121	c.1056G>T	c.(1054-1056)ggG>ggT	p.G352G		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	352					antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)	p.G352G(1)		breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						GTGCCCAGGGGTCTGAGTCTC	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17463	0.0		0.0	False		,,,				2504	0.0				p.G352G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1056T	6						.						51.0	58.0	56.0					6																	30460337		2203	4300	6503	30568316	SO:0001819	synonymous_variant	3133	exon7			M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.1056G>T	6.37:g.30460337G>T		Somatic		Capture	Illumina HiSeq	Phase_I	30568316	NM_005516	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Silent	SNP	ENST00000376630.4	37	CCDS34379.1																																																																																				0.562	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076282.2	NM_005516	
C6orf15	29113	broad.mit.edu	37	6	31080037	31080037	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:31080037C>A	ENST00000259870.3	-	2	102	c.99G>T	c.(97-99)gaG>gaT	p.E33D	PSORS1C1_ENST00000259881.9_5'Flank	NM_014070.2	NP_054789.2	Q6UXA7	CF015_HUMAN	chromosome 6 open reading frame 15	33					extracellular matrix organization (GO:0030198)	interstitial matrix (GO:0005614)	heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)	p.E33D(1)		endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)|stomach(1)	17						AAACTTTCTCCTCCACAACAC	0.577																																					p.E33D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G99T	6						.						105.0	125.0	118.0					6																	31080037		2143	4260	6403	31188016	SO:0001583	missense	29113	exon2			AB031481	CCDS4693.1	6p21	2011-12-12			ENSG00000204542	ENSG00000204542			13927	protein-coding gene	gene with protein product		611401					Standard	NM_014070		Approved	STG	uc003nsk.1	Q6UXA7	OTTHUMG00000031111	ENST00000259870.3:c.99G>T	6.37:g.31080037C>A	ENSP00000259870:p.Glu33Asp	Somatic		Capture	Illumina HiSeq	Phase_I	31188016	NM_014070	B0S7V8|Q0EFA6|Q2L6G7|Q5SQ81|Q86Z05|Q9UIG3	Missense_Mutation	SNP	ENST00000259870.3	37	CCDS4693.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.055906	0.55325	.	.	ENSG00000204542	ENST00000259870	T	0.12255	2.7	4.81	2.06	0.26882	.	0.393153	0.21768	N	0.069418	T	0.04407	0.0121	M	0.62723	1.935	0.22142	N	0.999333	P	0.40144	0.704	B	0.34489	0.184	T	0.28170	-1.0052	10	0.62326	D	0.03	-4.4641	4.892	0.13731	0.0:0.6333:0.175:0.1917	.	33	Q6UXA7	CF015_HUMAN	D	33	ENSP00000259870:E33D	ENSP00000259870:E33D	E	-	3	2	C6orf15	31188016	0.427000	0.25514	0.574000	0.28523	0.030000	0.12068	0.119000	0.15626	0.240000	0.21263	-0.275000	0.10095	GAG		0.577	C6orf15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076184.2	NM_014070	
ANKS1A	23294	broad.mit.edu	37	6	35047313	35047313	+	Silent	SNP	C	C	T	rs138150663	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:35047313C>T	ENST00000360359.3	+	15	2442	c.2304C>T	c.(2302-2304)gaC>gaT	p.D768D	ANKS1A_ENST00000535627.1_Intron|ANKS1A_ENST00000470698.1_3'UTR	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	768					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.D768D(1)|p.D94D(1)		cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						TGGGTTATGACGGGAACAGCC	0.597													C|||	5	0.000998403	0.0038	0.0	5008	,	,		19877	0.0		0.0	False		,,,				2504	0.0				p.D768D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2304T	6						.	C		5,4401	9.9+/-24.2	0,5,2198	92.0	78.0	83.0		2304	-10.2	0.1	6	dbSNP_134	83	0,8600		0,0,4300	no	coding-synonymous	ANKS1A	NM_015245.2		0,5,6498	TT,TC,CC		0.0,0.1135,0.0384		768/1135	35047313	5,13001	2203	4300	6503	35155291	SO:0001819	synonymous_variant	23294	exon15			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.2304C>T	6.37:g.35047313C>T		Somatic		Capture	Illumina HiSeq	Phase_I	35155291	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Silent	SNP	ENST00000360359.3	37	CCDS4798.1																																																																																				0.597	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
SRPK1	6732	broad.mit.edu	37	6	35803137	35803137	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:35803137G>C	ENST00000373825.2	-	16	2197	c.1912C>G	c.(1912-1914)Cct>Gct	p.P638A	SRPK1_ENST00000423325.2_Missense_Mutation_p.P622A|SRPK1_ENST00000373822.1_Missense_Mutation_p.P530A					SRSF protein kinase 1									p.P637A(1)		endometrium(2)|large_intestine(10)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21						CTCTTCTCAGGGATCAGCTCC	0.567																																					p.P638A	NSCLC(31;67 978 16289 24856 26454)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1912G	6						.						52.0	60.0	57.0					6																	35803137		2034	4182	6216	35911115	SO:0001583	missense	6732	exon16			U09564	CCDS47415.1	6p21.31	2010-06-23	2010-06-23		ENSG00000096063	ENSG00000096063			11305	protein-coding gene	gene with protein product	"""SR protein kinase 1"", ""serine/arginine-rich splicing factor kinase 1"""	601939	"""SFRS protein kinase 1"""			8208298, 10198174	Standard	NM_003137		Approved	SFRSK1	uc003olj.3	Q96SB4	OTTHUMG00000014583	ENST00000373825.2:c.1912C>G	6.37:g.35803137G>C	ENSP00000362931:p.Pro638Ala	Somatic		Capture	Illumina HiSeq	Phase_I	35911115	NM_003137		Missense_Mutation	SNP	ENST00000373825.2	37	CCDS47415.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484043	0.84854	.	.	ENSG00000096063	ENST00000373825;ENST00000361690;ENST00000423325;ENST00000373822	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.61652	0.2364	M	0.91038	3.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.70539	-0.4844	9	0.87932	D	0	-9.8932	19.6922	0.96007	0.0:0.0:1.0:0.0	.	622;638	B4DS61;Q96SB4	.;SRPK1_HUMAN	A	638;654;622;530	ENSP00000362931:P638A;ENSP00000354674:P654A;ENSP00000391069:P622A;ENSP00000362928:P530A	ENSP00000354674:P654A	P	-	1	0	SRPK1	35911115	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.864000	0.99589	2.645000	0.89757	0.655000	0.94253	CCT		0.567	SRPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040319.3	NM_003137	
KCTD20	222658	broad.mit.edu	37	6	36452576	36452576	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:36452576delA	ENST00000373731.2	+	7	1333	c.942delA	c.(940-942)ctafs	p.L314fs	KCTD20_ENST00000474988.1_3'UTR|KCTD20_ENST00000536244.1_Frame_Shift_Del_p.L169fs|KCTD20_ENST00000449081.2_Frame_Shift_Del_p.L148fs|KCTD20_ENST00000544295.1_Frame_Shift_Del_p.L68fs	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	314					protein homooligomerization (GO:0051260)			p.N316fs*64(2)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						AACGGGGCCTAAAAAACATTC	0.343																																					p.L314fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.942delA	6						.						103.0	115.0	111.0					6																	36452576		2203	4300	6503	36560554	SO:0001589	frameshift_variant	222658	exon7			BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.942delA	6.37:g.36452576delA	ENSP00000362836:p.Leu314fs	Somatic		Capture	Illumina HiSeq	Phase_I	36560554	NM_173562	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Frame_Shift_Del	DEL	ENST00000373731.2	37	CCDS4821.1																																																																																				0.343	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562	
CUL9	23113	broad.mit.edu	37	6	43153283	43153283	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:43153283C>T	ENST00000252050.4	+	3	769	c.685C>T	c.(685-687)Ctg>Ttg	p.L229L	CUL9_ENST00000372647.2_Silent_p.L229L|CUL9_ENST00000354495.3_Silent_p.L229L	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	229					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.L229L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						ATTGCTGGAGCTGTTTGCAGA	0.502																																					p.L229L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C685T	6						.						149.0	118.0	128.0					6																	43153283		2203	4300	6503	43261261	SO:0001819	synonymous_variant	23113	exon3			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.685C>T	6.37:g.43153283C>T		Somatic		Capture	Illumina HiSeq	Phase_I	43261261	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	CCDS4890.1																																																																																				0.502	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
PKHD1	5314	broad.mit.edu	37	6	51875151	51875151	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:51875151C>T	ENST00000371117.3	-	35	5982	c.5707G>A	c.(5707-5709)Gtc>Atc	p.V1903I	PKHD1_ENST00000340994.4_Missense_Mutation_p.V1903I	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1903					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.V1903I(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GTAATCTTGACGGTAATTGGC	0.393																																					p.V1903I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5707A	6						.						150.0	133.0	139.0					6																	51875151		2203	4300	6503	51983110	SO:0001583	missense	5314	exon35			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.5707G>A	6.37:g.51875151C>T	ENSP00000360158:p.Val1903Ile	Somatic		Capture	Illumina HiSeq	Phase_I	51983110	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765491	0.31228	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87491	-2.08;-2.26	5.53	4.66	0.58398	.	0.146948	0.47093	D	0.000253	T	0.56659	0.2000	N	0.08118	0	0.24542	N	0.994062	P;P	0.41313	0.745;0.509	B;B	0.27500	0.08;0.017	T	0.59311	-0.7478	10	0.62326	D	0.03	.	14.1511	0.65384	0.0:0.9279:0.0:0.0721	.	1903;1903	P08F94-2;P08F94	.;PKHD1_HUMAN	I	1903	ENSP00000360158:V1903I;ENSP00000341097:V1903I	ENSP00000341097:V1903I	V	-	1	0	PKHD1	51983110	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.119000	0.41958	1.335000	0.45486	0.557000	0.71058	GTC		0.393	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
FAM46A	55603	broad.mit.edu	37	6	82459454	82459454	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:82459454C>T	ENST00000320172.6	-	3	1601	c.1287G>A	c.(1285-1287)acG>acA	p.T429T	FAM46A_ENST00000369754.3_Silent_p.T448T|FAM46A_ENST00000369756.3_Silent_p.T510T	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	429					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)	p.T429T(2)		endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		GTTGCTGGCACGTGAATACTG	0.443																																					p.T429T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1287A	6						.						131.0	118.0	123.0					6																	82459454		2203	4300	6503	82516173	SO:0001819	synonymous_variant	55603	exon3			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.1287G>A	6.37:g.82459454C>T		Somatic		Capture	Illumina HiSeq	Phase_I	82516173	NM_017633	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	37	CCDS34489.1																																																																																				0.443	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
HTR1E	3354	broad.mit.edu	37	6	87725674	87725674	+	Missense_Mutation	SNP	G	G	A	rs3828741	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:87725674G>A	ENST00000305344.5	+	2	1325	c.622G>A	c.(622-624)Gcg>Acg	p.A208T		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	208			A -> T (in dbSNP:rs3828741).		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.A208T(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	GATTTACCACGCGGCCAAGAG	0.448													G|||	12	0.00239617	0.0	0.0	5008	,	,		18217	0.0119		0.0	False		,,,				2504	0.0				p.A208T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G622A	6						.	G	THR/ALA	0,4406		0,0,2203	88.0	88.0	88.0		622	4.4	1.0	6	dbSNP_107	88	1,8599	1.2+/-3.3	0,1,4299	yes	missense	HTR1E	NM_000865.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	208/366	87725674	1,13005	2203	4300	6503	87782393	SO:0001583	missense	3354	exon2				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.622G>A	6.37:g.87725674G>A	ENSP00000307766:p.Ala208Thr	Somatic		Capture	Illumina HiSeq	Phase_I	87782393	NM_000865	E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	CCDS5006.1	11	0.005036630036630037	0	0.0	0	0.0	11	0.019230769230769232	0	0.0	G	21.4	4.142117	0.77775	0.0	1.16E-4	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.36340	1.26;1.26	4.38	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000010	T	0.50497	0.1619	M	0.67953	2.075	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.55366	-0.8152	10	0.54805	T	0.06	.	16.9054	0.86126	0.0:0.0:1.0:0.0	rs3828741;rs52810768;rs3828741	208	P28566	5HT1E_HUMAN	T	208	ENSP00000307766:A208T;ENSP00000358597:A208T	ENSP00000307766:A208T	A	+	1	0	HTR1E	87782393	1.000000	0.71417	0.955000	0.39395	0.847000	0.48162	9.219000	0.95173	2.000000	0.58554	0.195000	0.17529	GCG		0.448	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865	
ZNF292	23036	broad.mit.edu	37	6	87928358	87928358	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:87928358delT	ENST00000369577.3	+	4	490	c.447delT	c.(445-447)catfs	p.H149fs	ZNF292_ENST00000369578.2_3'UTR|ZNF292_ENST00000339907.4_Frame_Shift_Del_p.H149fs	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	149						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.L11fs*1(1)|p.L151fs*1(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GTGAATTGCATTTTTTAGCTA	0.363																																					p.H149fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.447delT	6						.						39.0	37.0	37.0					6																	87928358		1822	4079	5901	87985077	SO:0001589	frameshift_variant	23036	exon4			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.447delT	6.37:g.87928358delT	ENSP00000358590:p.His149fs	Somatic		Capture	Illumina HiSeq	Phase_I	87985077	NM_015021	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Frame_Shift_Del	DEL	ENST00000369577.3	37	CCDS47457.1																																																																																				0.363	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
MAP3K4	4216	broad.mit.edu	37	6	161518132	161518132	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr6:161518132C>T	ENST00000392142.4	+	16	3596	c.3448C>T	c.(3448-3450)Cgt>Tgt	p.R1150C	MAP3K4_ENST00000348824.7_Missense_Mutation_p.R1146C|MAP3K4_ENST00000366919.2_Missense_Mutation_p.R1150C|MAP3K4_ENST00000366920.2_Missense_Mutation_p.R1146C	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1150					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.R1150C(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GAACAGCCCCCGTCCTATGAA	0.448																																					p.R1150C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3448T	6						.						165.0	132.0	143.0					6																	161518132		2203	4300	6503	161438122	SO:0001583	missense	4216	exon16			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3448C>T	6.37:g.161518132C>T	ENSP00000375986:p.Arg1150Cys	Somatic		Capture	Illumina HiSeq	Phase_I	161438122	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	C	34	5.316112	0.95655	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.75050	-0.78;-0.72;-0.9;-0.86	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.78941	0.4363	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;P;D;D	0.87578	0.99;0.785;0.997;0.998	T	0.78720	-0.2094	10	0.56958	D	0.05	-22.4888	20.6208	0.99490	0.0:1.0:0.0:0.0	.	1146;136;1150;1150	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	C	1150;1150;1150;1146;1146	ENSP00000355886:R1150C;ENSP00000375986:R1150C;ENSP00000355887:R1146C;ENSP00000297332:R1146C	ENSP00000297332:R1146C	R	+	1	0	MAP3K4	161438122	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	7.294000	0.78760	2.882000	0.98803	0.655000	0.94253	CGT		0.448	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
DNAJC2	27000	broad.mit.edu	37	7	102985031	102985031	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:102985031G>A	ENST00000379263.3	-	1	289	c.39C>T	c.(37-39)acC>acT	p.T13T	DNAJC2_ENST00000412522.1_Silent_p.T13T|PSMC2_ENST00000435765.1_5'Flank|DNAJC2_ENST00000249270.7_Silent_p.T13T	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	13					'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)	p.T13T(2)		endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						GGGTGATGGCGGTGCCCCGGC	0.706																																					p.T13T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C39T	7						.						52.0	63.0	60.0					7																	102985031		2031	4187	6218	102772267	SO:0001819	synonymous_variant	27000	exon1			X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.39C>T	7.37:g.102985031G>A		Somatic		Capture	Illumina HiSeq	Phase_I	102772267	NM_001129887	A4VCI0|Q9BVX1	Silent	SNP	ENST00000379263.3	37	CCDS43628.1	.	.	.	.	.	.	.	.	.	.	G	5.875	0.345513	0.11126	.	.	ENSG00000105821	ENST00000426036	.	.	.	4.7	2.83	0.33086	.	.	.	.	.	T	0.52240	0.1722	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46569	-0.9182	4	.	.	.	-7.3458	4.9162	0.13847	0.0842:0.1462:0.6191:0.1505	.	.	.	.	L	2	.	.	P	-	2	0	DNAJC2	102772267	1.000000	0.71417	1.000000	0.80357	0.280000	0.26924	0.960000	0.29253	1.181000	0.42912	-0.169000	0.13324	CCG		0.706	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1		
RELN	5649	broad.mit.edu	37	7	103159778	103159778	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:103159778A>G	ENST00000428762.1	-	49	8013	c.7854T>C	c.(7852-7854)agT>agC	p.S2618S	RELN_ENST00000424685.2_Silent_p.S2618S|RELN_ENST00000343529.5_Silent_p.S2618S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2618					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.S2618S(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACCCGGGCTTACTGTACTGGT	0.453																																					p.S2618S	NSCLC(146;835 1944 15585 22231 52158)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T7854C	7						.						106.0	95.0	99.0					7																	103159778		2203	4300	6503	102947014	SO:0001819	synonymous_variant	5649	exon49				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7854T>C	7.37:g.103159778A>G		Somatic		Capture	Illumina HiSeq	Phase_I	102947014	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																				0.453	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
PIK3CG	5294	broad.mit.edu	37	7	106509339	106509339	+	Missense_Mutation	SNP	G	G	A	rs150482982		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:106509339G>A	ENST00000359195.3	+	2	1643	c.1333G>A	c.(1333-1335)Gcc>Acc	p.A445T	PIK3CG_ENST00000496166.1_Missense_Mutation_p.A445T|PIK3CG_ENST00000440650.2_Missense_Mutation_p.A445T	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	445	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A445S(1)|p.A445T(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						GTCCAGCAAGGCCTCTGCAGA	0.522																																					p.A445T												PIK3CG,central_nervous_system,brain,Substitution - Missense,-1 	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G1333A	7						.	G	THR/ALA	0,4406		0,0,2203	64.0	67.0	66.0		1333	3.5	0.7	7	dbSNP_134	66	1,8599	1.2+/-3.3	0,1,4299	no	missense	PIK3CG	NM_002649.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	445/1103	106509339	1,13005	2203	4300	6503	106296575	SO:0001583	missense	5294	exon2				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1333G>A	7.37:g.106509339G>A	ENSP00000352121:p.Ala445Thr	Somatic		Capture	Illumina HiSeq	Phase_I	106296575	NM_002649	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	37	CCDS5739.1	.	.	.	.	.	.	.	.	.	.	G	0.038	-1.299183	0.01364	0.0	1.16E-4	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.76316	-1.01;-1.01;-1.01	5.29	3.48	0.39840	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.512326	0.22051	N	0.065314	T	0.55609	0.1931	N	0.17082	0.46	0.23336	N	0.997882	B	0.06786	0.001	B	0.09377	0.004	T	0.33420	-0.9869	10	0.13108	T	0.6	-9.294	4.9363	0.13943	0.2482:0.0:0.6032:0.1486	.	445	P48736	PK3CG_HUMAN	T	445	ENSP00000392258:A445T;ENSP00000419260:A445T;ENSP00000352121:A445T	ENSP00000352121:A445T	A	+	1	0	PIK3CG	106296575	0.988000	0.35896	0.659000	0.29680	0.100000	0.18952	1.722000	0.38042	0.620000	0.30215	0.655000	0.94253	GCC		0.522	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1		
GPR22	2845	broad.mit.edu	37	7	107115664	107115664	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:107115664G>A	ENST00000304402.4	+	3	2502	c.1159G>A	c.(1159-1161)Gtt>Att	p.V387I	COG5_ENST00000347053.3_Intron|COG5_ENST00000393603.2_Intron|COG5_ENST00000297135.3_Intron|COG5_ENST00000475638.2_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	387					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.V387I(1)		large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						AAAGCGAGTTGTTTCTATAGT	0.323																																					p.V387I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1159A	7						.						56.0	63.0	61.0					7																	107115664		2203	4296	6499	106902900	SO:0001583	missense	2845	exon3			U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.1159G>A	7.37:g.107115664G>A	ENSP00000302676:p.Val387Ile	Somatic		Capture	Illumina HiSeq	Phase_I	106902900	NM_005295	O14554	Missense_Mutation	SNP	ENST00000304402.4	37	CCDS5744.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.122217	0.56613	.	.	ENSG00000172209	ENST00000304402	T	0.36878	1.23	5.66	5.66	0.87406	.	0.133375	0.49916	D	0.000129	T	0.32526	0.0832	L	0.32530	0.975	0.58432	D	0.999999	P	0.42908	0.793	B	0.40506	0.331	T	0.02378	-1.1168	10	0.23302	T	0.38	-12.5037	19.7327	0.96190	0.0:0.0:1.0:0.0	.	387	Q99680	GPR22_HUMAN	I	387	ENSP00000302676:V387I	ENSP00000302676:V387I	V	+	1	0	GPR22	106902900	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.869000	0.99810	2.674000	0.91012	0.585000	0.79938	GTT		0.323	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337598.1		
DOCK4	9732	broad.mit.edu	37	7	111405236	111405236	+	Missense_Mutation	SNP	G	G	A	rs550574924		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:111405236G>A	ENST00000437633.1	-	38	4187	c.3931C>T	c.(3931-3933)Cgt>Tgt	p.R1311C	DOCK4_ENST00000494651.2_Missense_Mutation_p.R194C|DOCK4_ENST00000428084.1_Missense_Mutation_p.R1320C	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1311	DHR-2.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.R1308C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GGTTCAAGACGTTGCTGGTCC	0.328													G|||	1	0.000199681	0.0	0.0	5008	,	,		16039	0.0		0.001	False		,,,				2504	0.0				p.R1311C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3931T	7						.						42.0	39.0	40.0					7																	111405236		1824	4067	5891	111192472	SO:0001583	missense	9732	exon38				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.3931C>T	7.37:g.111405236G>A	ENSP00000404179:p.Arg1311Cys	Somatic		Capture	Illumina HiSeq	Phase_I	111192472	NM_014705	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669433	0.88348	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288;ENST00000437129	T;T;T;T	0.60299	3.24;2.61;3.26;0.2	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.82226	0.4991	M	0.91818	3.245	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.85319	0.1083	10	0.87932	D	0	.	19.6745	0.95926	0.0:0.0:1.0:0.0	.	218;194;1356;1311;1320	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2	.;.;.;DOCK4_HUMAN;.	C	1299;1320;194;1311;1308;185	ENSP00000410746:R1320C;ENSP00000440944:R194C;ENSP00000404179:R1311C;ENSP00000406298:R185C	ENSP00000345432:R1308C	R	-	1	0	DOCK4	111192472	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	5.917000	0.69989	2.880000	0.98712	0.650000	0.86243	CGT		0.328	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
RBM28	55131	broad.mit.edu	37	7	127964700	127964700	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:127964700C>T	ENST00000223073.2	-	12	1365	c.1251G>A	c.(1249-1251)gcG>gcA	p.A417A	RBM28_ENST00000415472.2_Silent_p.A276A	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	417	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A417A(2)		breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						CACGGGTCACCGCCAAGTCAA	0.557																																					p.A276A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G828A	7						.						163.0	168.0	166.0					7																	127964700		2203	4300	6503	127751936	SO:0001819	synonymous_variant	55131	exon8			AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.1251G>A	7.37:g.127964700C>T		Somatic		Capture	Illumina HiSeq	Phase_I	127751936	NM_001166135	A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Silent	SNP	ENST00000223073.2	37	CCDS5801.1																																																																																				0.557	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349442.2	NM_018077	
PLXNA4	91584	broad.mit.edu	37	7	131866155	131866155	+	Silent	SNP	C	C	T	rs10248377	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:131866155C>T	ENST00000359827.3	-	18	4439	c.3477G>A	c.(3475-3477)acG>acA	p.T1159T	PLXNA4_ENST00000321063.4_Silent_p.T1159T			Q9HCM2	PLXA4_HUMAN	plexin A4	1159	IPT/TIG 4.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.T1159T(4)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGATGATGGGCGTGCCAGGCT	0.577													C|||	162	0.0323482	0.121	0.0029	5008	,	,		17066	0.0		0.0	False		,,,				2504	0.0				p.T1159T												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.G3477A	7						.	C		358,3534		16,326,1604	154.0	159.0	158.0		3477	-10.2	0.0	7	dbSNP_119	158	2,8278		0,2,4138	no	coding-synonymous	PLXNA4	NM_020911.1		16,328,5742	TT,TC,CC		0.0242,9.1984,2.9576		1159/1895	131866155	360,11812	1946	4140	6086	131516695	SO:0001819	synonymous_variant	91584	exon18			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.3477G>A	7.37:g.131866155C>T		Somatic		Capture	Illumina HiSeq	Phase_I	131516695	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	CCDS43646.1																																																																																				0.577	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
CALD1	800	broad.mit.edu	37	7	134618116	134618116	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:134618116A>C	ENST00000361675.2	+	5	825	c.596A>C	c.(595-597)aAg>aCg	p.K199T	CALD1_ENST00000361901.2_Missense_Mutation_p.K199T|CALD1_ENST00000424922.1_Missense_Mutation_p.K193T|CALD1_ENST00000417172.1_Missense_Mutation_p.K199T|CALD1_ENST00000543443.1_Missense_Mutation_p.K204T|CALD1_ENST00000495522.1_Missense_Mutation_p.K193T|CALD1_ENST00000393118.2_Missense_Mutation_p.K193T|CALD1_ENST00000422748.1_Missense_Mutation_p.K199T|CALD1_ENST00000361388.2_Missense_Mutation_p.K199T			Q05682	CALD1_HUMAN	caldesmon 1	199	Myosin and calmodulin-binding. {ECO:0000250}.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)	p.K199T(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						gagaagccaaagcgagggagc	0.448																																					p.K199T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A596C	7						.						68.0	65.0	66.0					7																	134618116		2203	4300	6503	134268656	SO:0001583	missense	800	exon5			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.596A>C	7.37:g.134618116A>C	ENSP00000354826:p.Lys199Thr	Somatic		Capture	Illumina HiSeq	Phase_I	134268656	NM_033157	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	ENST00000361675.2	37	CCDS5835.1	.	.	.	.	.	.	.	.	.	.	A	11.15	1.555039	0.27739	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000361675;ENST00000361901;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;2.92;0.77;2.92	5.22	5.22	0.72569	.	0.000000	0.45867	D	0.000328	T	0.62368	0.2422	M	0.71581	2.175	0.32006	N	0.60277	P;D;D;D;D;P;D;D;D	0.58620	0.946;0.979;0.983;0.979;0.979;0.827;0.979;0.983;0.983	P;P;P;P;P;P;P;P;P	0.60415	0.775;0.801;0.825;0.732;0.732;0.506;0.732;0.874;0.874	T	0.67181	-0.5735	10	0.21014	T	0.42	-13.6704	15.0813	0.72117	1.0:0.0:0.0:0.0	.	148;204;199;193;193;199;199;199;199	B4DPW5;F5H1Z9;A8K0X1;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;.;CALD1_HUMAN;.	T	199;199;199;199;199;199;193;193;193;204	ENSP00000398826:K199T;ENSP00000411476:K199T;ENSP00000355000:K199T;ENSP00000395710:K199T;ENSP00000354826:K199T;ENSP00000354513:K199T;ENSP00000376826:K193T;ENSP00000393621:K193T;ENSP00000419673:K193T;ENSP00000445641:K204T	ENSP00000355000:K199T	K	+	2	0	CALD1	134268656	1.000000	0.71417	0.998000	0.56505	0.480000	0.33159	6.013000	0.70776	1.964000	0.57103	0.460000	0.39030	AAG		0.448	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	NM_033138	
TRIM24	8805	broad.mit.edu	37	7	138264223	138264223	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:138264223G>A	ENST00000343526.4	+	15	2746	c.2531G>A	c.(2530-2532)tGc>tAc	p.C844Y	TRIM24_ENST00000415680.2_Missense_Mutation_p.C810Y			O15164	TIF1A_HUMAN	tripartite motif containing 24	844					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.C810Y(1)|p.C844Y(1)		breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						TGTGAAAAGTGCCCCAAAGTA	0.438																																					p.C810Y	Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2429A	7						.						88.0	90.0	89.0					7																	138264223		2203	4300	6503	137914763	SO:0001583	missense	8805	exon15			AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.2531G>A	7.37:g.138264223G>A	ENSP00000340507:p.Cys844Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	137914763	NM_003852	A4D1R7|A4D1R8|O95854	Missense_Mutation	SNP	ENST00000343526.4	37	CCDS5847.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.806106	0.90623	.	.	ENSG00000122779	ENST00000343526;ENST00000536822;ENST00000415680	D;D	0.99938	-8.34;-8.34	5.77	5.77	0.91146	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.99961	0.9984	H	0.98818	4.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96472	0.9349	10	0.87932	D	0	-7.1904	19.5879	0.95497	0.0:0.0:1.0:0.0	.	844;810	O15164;O15164-2	TIF1A_HUMAN;.	Y	844;755;810	ENSP00000340507:C844Y;ENSP00000390829:C810Y	ENSP00000340507:C844Y	C	+	2	0	TRIM24	137914763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.745000	0.94114	0.650000	0.86243	TGC		0.438	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341814.1	NM_015905	
IQCE	23288	broad.mit.edu	37	7	2629734	2629735	+	Frame_Shift_Del	DEL	AG	AG	-	rs201488742		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	AG	AG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:2629734_2629735delAG	ENST00000402050.2	+	14	1422_1423	c.1238_1239delAG	c.(1237-1239)cagfs	p.Q413fs	IQCE_ENST00000438376.2_Frame_Shift_Del_p.Q397fs|IQCE_ENST00000404984.1_Frame_Shift_Del_p.Q362fs|IQCE_ENST00000325979.7_Frame_Shift_Del_p.Q348fs	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	413						mitochondrion (GO:0005739)		p.D415fs*65(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CAGCTGCTGCAGAGAGAGTAGG	0.668																																					p.413_413del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1238_1239del	7						.																																			2596261	SO:0001589	frameshift_variant	23288	exon14			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1238_1239delAG	7.37:g.2629740_2629741delAG	ENSP00000385597:p.Gln413fs	Somatic		Capture	Illumina HiSeq	Phase_I	2596260	NM_152558	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Frame_Shift_Del	DEL	ENST00000402050.2	37	CCDS43542.1																																																																																				0.668	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2	NM_152558	
FOXK1	221937	broad.mit.edu	37	7	4780549	4780549	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:4780549C>T	ENST00000328914.4	+	2	641	c.641C>T	c.(640-642)cCg>cTg	p.P214L	FOXK1_ENST00000446823.1_Missense_Mutation_p.P51L	NM_001037165.1	NP_001032242.1			forkhead box K1									p.P40L(1)|p.P214L(1)|p.P40Q(1)|p.P214Q(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		CCAGCCTCCCCGCTGCGGCCA	0.647																																					p.P214L												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.C641T	7						.						105.0	113.0	110.0					7																	4780549		2203	4300	6503	4747075	SO:0001583	missense	221937	exon2			BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.641C>T	7.37:g.4780549C>T	ENSP00000328720:p.Pro214Leu	Somatic		Capture	Illumina HiSeq	Phase_I	4747075	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538863	0.85917	.	.	ENSG00000164916	ENST00000446823;ENST00000328914;ENST00000545598	D;D	0.96300	-3.71;-3.97	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.97448	0.9165	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.965	D;D;P	0.87578	0.998;0.992;0.497	D	0.97862	1.0281	10	0.54805	T	0.06	.	17.8708	0.88810	0.0:1.0:0.0:0.0	.	214;97;51	P85037;F5H8G8;P85037-2	FOXK1_HUMAN;.;.	L	51;214;97	ENSP00000394442:P51L;ENSP00000328720:P214L	ENSP00000328720:P214L	P	+	2	0	FOXK1	4747075	1.000000	0.71417	0.679000	0.29978	0.718000	0.41266	7.684000	0.84104	2.449000	0.82847	0.563000	0.77884	CCG		0.647	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
HDAC9	9734	broad.mit.edu	37	7	18625003	18625003	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:18625003T>A	ENST00000432645.2	+	2	122	c.122T>A	c.(121-123)gTc>gAc	p.V41D	HDAC9_ENST00000456174.2_Missense_Mutation_p.V10D|HDAC9_ENST00000406451.4_Missense_Mutation_p.V41D|HDAC9_ENST00000417496.2_Missense_Mutation_p.V83D|HDAC9_ENST00000476135.1_3'UTR|HDAC9_ENST00000428307.2_Missense_Mutation_p.V41D|HDAC9_ENST00000405010.3_Missense_Mutation_p.V41D|HDAC9_ENST00000406072.1_Missense_Mutation_p.V69D|HDAC9_ENST00000524023.1_Missense_Mutation_p.V10D|HDAC9_ENST00000441542.2_Missense_Mutation_p.V41D|HDAC9_ENST00000401921.1_Missense_Mutation_p.V41D	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	41					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.V41D(3)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GACCCTGTTGTCCGTGAGAAG	0.498																																					p.V41D												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.T122A	7						.						97.0	98.0	98.0					7																	18625003		1973	4182	6155	18591528	SO:0001583	missense	9734	exon3			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.122T>A	7.37:g.18625003T>A	ENSP00000410337:p.Val41Asp	Somatic		Capture	Illumina HiSeq	Phase_I	18591528	NM_178423	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.539165	0.85917	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000413509;ENST00000413380;ENST00000430454;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000441986;ENST00000456174;ENST00000524023;ENST00000341009	T;T;T;T;T;T;T;T;T;T;T;T;T	0.59502	0.84;0.86;0.86;0.85;0.27;0.84;0.86;0.26;0.27;0.27;0.86;0.84;0.82	5.93	5.93	0.95920	Histone deacetylase, glutamine rich N-terminal domain (1);	0.506797	0.18047	N	0.153409	T	0.57359	0.2048	L	0.29908	0.895	0.58432	D	0.999996	P;B;P;P;P;B;P;P;P;P;P;P;P	0.49253	0.6;0.371;0.904;0.836;0.921;0.371;0.904;0.904;0.921;0.773;0.904;0.755;0.921	B;B;B;P;P;B;P;P;P;P;P;B;P	0.49192	0.291;0.383;0.367;0.58;0.5;0.383;0.466;0.466;0.602;0.478;0.466;0.347;0.5	T	0.61407	-0.7069	10	0.87932	D	0	-10.7007	16.3766	0.83401	0.0:0.0:0.0:1.0	.	10;10;41;69;83;41;41;41;41;10;41;41;60	E7EX34;C9JS87;Q9UKV0-4;B5MCF1;B7Z917;Q68D71;Q9UKV0-6;Q9UKV0-7;Q9UKV0;B7Z928;Q9UKV0-5;Q9UKV0-3;Q8N879	.;.;.;.;.;.;.;.;HDAC9_HUMAN;.;.;.;.	D	83;86;41;41;10;41;41;41;69;41;41;41;10;10;10;41	ENSP00000401669:V83D;ENSP00000412497:V41D;ENSP00000392564:V41D;ENSP00000384382:V41D;ENSP00000384657:V41D;ENSP00000395655:V41D;ENSP00000384017:V69D;ENSP00000383912:V41D;ENSP00000410337:V41D;ENSP00000408617:V41D;ENSP00000404763:V10D;ENSP00000388568:V10D;ENSP00000430036:V10D	ENSP00000262069:V86D	V	+	2	0	HDAC9	18591528	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	6.289000	0.72696	2.263000	0.75096	0.533000	0.62120	GTC		0.498	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
HOXA2	3199	broad.mit.edu	37	7	27140762	27140762	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:27140762G>A	ENST00000222718.5	-	2	1024	c.714C>T	c.(712-714)agC>agT	p.S238S	HOTAIRM1_ENST00000428939.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000593300.1_RNA|HOTAIRM1_ENST00000425358.2_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	238					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S238S(1)		breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						CCCCAGAGACGCTAAGGGCTT	0.517																																					p.S238S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C714T	7						.						97.0	92.0	94.0					7																	27140762		2203	4300	6503	27107287	SO:0001819	synonymous_variant	3199	exon2				CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.714C>T	7.37:g.27140762G>A		Somatic		Capture	Illumina HiSeq	Phase_I	27107287	NM_006735	A1L4K3|B2RMW3	Silent	SNP	ENST00000222718.5	37	CCDS5403.1																																																																																				0.517	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358508.2		
HOXA3	3200	broad.mit.edu	37	7	27148311	27148311	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:27148311C>T	ENST00000396352.4	-	3	754	c.555G>A	c.(553-555)ccG>ccA	p.P185P	HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000521401.1_5'Flank|HOXA3_ENST00000317201.2_Silent_p.P185P	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	185					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P185P(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						CCTGCCCCGGCGGGCTCTTGT	0.711																																					p.P185P	Esophageal Squamous(136;1368 1743 5685 7935 50360)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G555A	7						.						23.0	25.0	24.0					7																	27148311		2197	4296	6493	27114836	SO:0001819	synonymous_variant	3200	exon3				CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.555G>A	7.37:g.27148311C>T		Somatic		Capture	Illumina HiSeq	Phase_I	27114836	NM_030661	A4D181	Silent	SNP	ENST00000396352.4	37	CCDS5404.1																																																																																				0.711	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358708.2		
RP9	6100	broad.mit.edu	37	7	33136124	33136124	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:33136124G>A	ENST00000297157.3	-	5	465	c.448C>T	c.(448-450)Cga>Tga	p.R150*		NM_203288.1	NP_976033.1	Q8TA86	RP9_HUMAN	retinitis pigmentosa 9 (autosomal dominant)	150	PIM1-binding. {ECO:0000250}.				cognition (GO:0050890)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|signal recognition particle receptor complex (GO:0005785)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R150*(2)		large_intestine(3)|lung(3)|urinary_tract(1)	7			GBM - Glioblastoma multiforme(11;0.0403)			TTTTCATGTCGTTTATTGTCT	0.373																																					p.R150X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C448T	7						.						266.0	223.0	237.0					7																	33136124		2203	4300	6503	33102649	SO:0001587	stop_gained	6100	exon5			AX016710	CCDS5440.1	7p14.3	2014-01-28			ENSG00000164610	ENSG00000164610			10288	protein-coding gene	gene with protein product	"""Pim-1 kinase associated protein"""	607331				8513323	Standard	NM_203288		Approved	PAP-1	uc003tdm.3	Q8TA86	OTTHUMG00000152988	ENST00000297157.3:c.448C>T	7.37:g.33136124G>A	ENSP00000297157:p.Arg150*	Somatic		Capture	Illumina HiSeq	Phase_I	33102649	NM_203288		Nonsense_Mutation	SNP	ENST00000297157.3	37	CCDS5440.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.282275	0.80692	.	.	ENSG00000164610	ENST00000297157;ENST00000448915	.	.	.	3.66	0.932	0.19466	.	0.120359	0.53938	D	0.000060	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.8648	9.5843	0.39506	0.0:0.0:0.5931:0.4069	.	.	.	.	X	150;116	.	ENSP00000297157:R150X	R	-	1	2	RP9	33102649	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.989000	0.40707	0.535000	0.28714	-0.602000	0.04101	CGA		0.373	RP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328914.1	NM_203288	
INHBA	3624	broad.mit.edu	37	7	41729776	41729776	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:41729776G>A	ENST00000242208.4	-	3	999	c.753C>T	c.(751-753)ggC>ggT	p.G251G	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Silent_p.G251G	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	251					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.G251G(2)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CCAAGCTGGCGCCACTCTCCT	0.587										TSP Lung(11;0.080)																											p.G251G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C753T	7						.						39.0	40.0	40.0					7																	41729776		2203	4300	6503	41696301	SO:0001819	synonymous_variant	3624	exon3				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.753C>T	7.37:g.41729776G>A		Somatic		Capture	Illumina HiSeq	Phase_I	41696301	NM_002192	Q14599	Silent	SNP	ENST00000242208.4	37	CCDS5464.1																																																																																				0.587	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
AEBP1	165	broad.mit.edu	37	7	44151764	44151764	+	Silent	SNP	G	G	A	rs558299236		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:44151764G>A	ENST00000223357.3	+	17	2366	c.2061G>A	c.(2059-2061)gcG>gcA	p.A687A	AEBP1_ENST00000450684.2_Silent_p.A262A|MIR4649_ENST00000582839.1_RNA	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	687	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A687A(1)		NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						GGAACTGGGCGCTGGGACTGT	0.617																																					p.A687A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2061A	7						.						77.0	77.0	77.0					7																	44151764		2203	4300	6503	44118289	SO:0001819	synonymous_variant	165	exon17			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2061G>A	7.37:g.44151764G>A		Somatic		Capture	Illumina HiSeq	Phase_I	44118289	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Silent	SNP	ENST00000223357.3	37	CCDS5476.1																																																																																				0.617	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
DTX2	113878	broad.mit.edu	37	7	76112227	76112227	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:76112227A>G	ENST00000324432.5	+	5	1181	c.671A>G	c.(670-672)tAc>tGc	p.Y224C	DTX2_ENST00000430490.2_Missense_Mutation_p.Y224C|DTX2_ENST00000307569.8_Missense_Mutation_p.Y224C|DTX2_ENST00000413936.2_Missense_Mutation_p.Y224C|DTX2_ENST00000446820.2_Missense_Mutation_p.Y224C|DTX2_ENST00000446600.1_Missense_Mutation_p.Y133C	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	224					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.Y224C(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						CTCCCTGCATACCCCGTCCCC	0.652																																					p.Y224C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A671G	7						.						118.0	121.0	120.0					7																	76112227		2203	4300	6503	75950163	SO:0001583	missense	113878	exon3				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.671A>G	7.37:g.76112227A>G	ENSP00000322885:p.Tyr224Cys	Somatic		Capture	Illumina HiSeq	Phase_I	75950163	NM_001102595	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Missense_Mutation	SNP	ENST00000324432.5	37	CCDS5587.1	.	.	.	.	.	.	.	.	.	.	.	10.12	1.262898	0.23051	.	.	ENSG00000091073	ENST00000324432;ENST00000307569;ENST00000541989;ENST00000446600;ENST00000413936;ENST00000430490;ENST00000446820	T;T;T;T;T;T	0.11821	2.75;2.74;2.75;2.75;2.75;2.74	5.18	3.95	0.45737	.	0.369653	0.28365	N	0.015603	T	0.23965	0.0580	L	0.51422	1.61	0.18873	N	0.999988	D;D;P	0.71674	0.995;0.998;0.943	P;P;P	0.60286	0.846;0.872;0.598	T	0.02560	-1.1141	10	0.39692	T	0.17	-19.378	10.0025	0.41938	0.6543:0.3457:0.0:0.0	.	133;224;224	F5GX89;Q86UW9-2;Q86UW9	.;.;DTX2_HUMAN	C	224;224;133;133;224;224;224	ENSP00000322885:Y224C;ENSP00000305242:Y224C;ENSP00000397648:Y133C;ENSP00000390218:Y224C;ENSP00000411986:Y224C;ENSP00000392545:Y224C	ENSP00000305242:Y224C	Y	+	2	0	AC005522.1	75950163	0.993000	0.37304	0.546000	0.28166	0.040000	0.13550	5.048000	0.64238	1.969000	0.57287	0.459000	0.35465	TAC		0.652	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2		
CYP3A5	1577	broad.mit.edu	37	7	99246003	99246003	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:99246003C>T	ENST00000222982.4	-	13	1533	c.1434G>A	c.(1432-1434)acG>acA	p.T478T	CYP3A5_ENST00000339843.2_3'UTR|CYP3A5_ENST00000343703.5_Silent_p.T468T	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	478					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)	p.T478T(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	GAAGTCCTTGCGTGTCTAATT	0.343																																					p.T478T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1434A	7						.																																			99083939	SO:0001819	synonymous_variant	1577	exon13			L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.1434G>A	7.37:g.99246003C>T		Somatic		Capture	Illumina HiSeq	Phase_I	99083939	NM_000777	A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	Silent	SNP	ENST00000222982.4	37	CCDS5672.1																																																																																				0.343	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345469.1		
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.V600E	Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	BRAF,pituitary,NS,Substitution - Missense,0 	.	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	c.T1799A	7						.						112.0	104.0	107.0					7																	140453136		2203	4300	6503	140099605	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu	Somatic		Capture	Illumina HiSeq	Phase_I	140099605	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
RP1L1	94137	broad.mit.edu	37	8	10464778	10464778	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr8:10464778G>T	ENST00000382483.3	-	4	7053	c.6830C>A	c.(6829-6831)cCc>cAc	p.P2277H		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2357	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.P2277H(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGGTGGAGTGGGCCTGTCCTC	0.602																																					p.P2277H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6830A	8						.						122.0	126.0	125.0					8																	10464778		1961	4146	6107	10502188	SO:0001583	missense	94137	exon4			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.6830C>A	8.37:g.10464778G>T	ENSP00000371923:p.Pro2277His	Somatic		Capture	Illumina HiSeq	Phase_I	10502188	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	4.461	0.085332	0.08583	.	.	ENSG00000183638	ENST00000382483	T	0.04706	3.57	4.48	2.19	0.27852	.	0.582703	0.13119	U	0.412337	T	0.04952	0.0133	N	0.08118	0	0.09310	N	1	D	0.69078	0.997	P	0.59012	0.85	T	0.37549	-0.9701	10	0.48119	T	0.1	-3.2798	2.4512	0.04518	0.5049:0.0:0.2641:0.2309	.	2277	A6NKC6	.	H	2277	ENSP00000371923:P2277H	ENSP00000371923:P2277H	P	-	2	0	RP1L1	10502188	.	.	0.009000	0.14445	0.065000	0.16274	.	.	0.397000	0.25310	0.505000	0.49811	CCC		0.602	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
EMC2	9694	broad.mit.edu	37	8	109462689	109462689	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr8:109462689G>A	ENST00000220853.3	+	3	222	c.187G>A	c.(187-189)Gca>Aca	p.A63T		NM_014673.3	NP_055488.1	Q15006	EMC2_HUMAN	ER membrane protein complex subunit 2	63						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|ER membrane protein complex (GO:0072546)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.A63T(1)									GATGATTGCAGCACTAGACTA	0.313																																					p.A63T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G187A	8						.						206.0	201.0	203.0					8																	109462689		2203	4300	6503	109531865	SO:0001583	missense	9694	exon3			BC021667	CCDS6309.1	8q23.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000104412	ENSG00000104412			28963	protein-coding gene	gene with protein product		607722	"""tetratricopeptide repeat domain 35"""	KIAA0103, TTC35		7788527, 22119785	Standard	NM_014673		Approved		uc003ymw.1	Q15006	OTTHUMG00000164873	ENST00000220853.3:c.187G>A	8.37:g.109462689G>A	ENSP00000220853:p.Ala63Thr	Somatic		Capture	Illumina HiSeq	Phase_I	109531865	NM_014673	Q8WUE1	Missense_Mutation	SNP	ENST00000220853.3	37	CCDS6309.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.984000	0.93044	.	.	ENSG00000104412	ENST00000524143;ENST00000220853	T	0.18174	2.23	5.86	5.86	0.93980	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.43656	0.1257	M	0.88241	2.94	0.80722	D	1	D	0.56968	0.978	P	0.52856	0.711	T	0.45483	-0.9258	10	0.52906	T	0.07	-6.7012	20.5632	0.99335	0.0:0.0:1.0:0.0	.	63	Q15006	TTC35_HUMAN	T	64;63	ENSP00000430122:A64T	ENSP00000220853:A63T	A	+	1	0	TTC35	109531865	1.000000	0.71417	0.690000	0.30148	0.598000	0.36846	9.400000	0.97290	2.937000	0.99478	0.650000	0.86243	GCA		0.313	EMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380717.1	NM_014673	
PTK2	5747	broad.mit.edu	37	8	141711017	141711017	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr8:141711017G>A	ENST00000522684.1	-	26	2701	c.2472C>T	c.(2470-2472)cgC>cgT	p.R824R	PTK2_ENST00000538769.1_Silent_p.R492R|PTK2_ENST00000535192.1_Silent_p.R778R|PTK2_ENST00000519419.1_Silent_p.R868R|PTK2_ENST00000395218.2_Silent_p.R824R|PTK2_ENST00000517887.1_Silent_p.R868R|PTK2_ENST00000340930.3_Silent_p.R824R|PTK2_ENST00000519465.1_Silent_p.R452R|PTK2_ENST00000430260.2_Silent_p.R134R|PTK2_ENST00000521059.1_Silent_p.R824R	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	824	Interaction with TGFB1I1.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)	p.R824R(1)|p.R846R(1)|p.R776R(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TTTCCAGCCAGCGCTGATCTT	0.433																																					p.R824R												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C2472T	8						.						121.0	120.0	120.0					8																	141711017		2203	4300	6503	141780199	SO:0001819	synonymous_variant	5747	exon26			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.2472C>T	8.37:g.141711017G>A		Somatic		Capture	Illumina HiSeq	Phase_I	141780199	NM_001199649	B4E2N6|F5H4S4|Q14291|Q9UD85	Silent	SNP	ENST00000522684.1	37	CCDS6381.1																																																																																				0.433	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
DLGAP2	9228	broad.mit.edu	37	8	1497558	1497558	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr8:1497558C>T	ENST00000421627.2	+	2	833	c.699C>T	c.(697-699)agC>agT	p.S233S		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	312					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.S255S(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GGACGCCCAGCGTGCTCAACC	0.687																																					p.S233S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C699T	8						.						50.0	62.0	58.0					8																	1497558		2167	4272	6439	1484965	SO:0001819	synonymous_variant	9228	exon2			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.699C>T	8.37:g.1497558C>T		Somatic		Capture	Illumina HiSeq	Phase_I	1484965	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	C	1.401	-0.578225	0.03854	.	.	ENSG00000198010	ENST00000520901	.	.	.	5.12	2.72	0.32119	.	.	.	.	.	T	0.54464	0.1860	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48875	-0.8996	4	.	.	.	-13.446	6.1981	0.20561	0.0:0.5427:0.0:0.4573	.	.	.	.	V	250	.	.	A	+	2	0	DLGAP2	1484965	0.997000	0.39634	0.122000	0.21767	0.076000	0.17211	0.407000	0.21049	1.004000	0.39156	0.655000	0.94253	GCG		0.687	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
CSMD1	64478	broad.mit.edu	37	8	2832112	2832112	+	Silent	SNP	G	G	A	rs368720706		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr8:2832112G>A	ENST00000520002.1	-	57	9159	c.8604C>T	c.(8602-8604)aaC>aaT	p.N2868N	CSMD1_ENST00000602723.1_Silent_p.N2810N|CSMD1_ENST00000537824.1_Silent_p.N2867N|CSMD1_ENST00000400186.3_Silent_p.N2810N|CSMD1_ENST00000542608.1_Silent_p.N2809N|CSMD1_ENST00000602557.1_Silent_p.N2868N			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2868	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.N2596N(1)|p.N2867N(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGAGGACGGCGTTGGCAGGGA	0.507																																					p.R2868C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C8602T	8						.	G		0,3942		0,0,1971	37.0	40.0	39.0		8601	-7.7	0.3	8		39	1,8281		0,1,4140	no	coding-synonymous	CSMD1	NM_033225.5		0,1,6111	AA,AG,GG		0.0121,0.0,0.0082		2867/3565	2832112	1,12223	1971	4141	6112	2819519	SO:0001819	synonymous_variant	64478	exon56					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8604C>T	8.37:g.2832112G>A		Somatic		Capture	Illumina HiSeq	Phase_I	2819519	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	0.864	-0.734195	0.03111	0.0	1.21E-4	ENSG00000183117	ENST00000335551	.	.	.	5.81	-7.67	0.01272	.	.	.	.	.	T	0.48502	0.1503	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54781	-0.8242	4	.	.	.	.	9.1371	0.36881	0.4365:0.0:0.4628:0.1006	.	.	.	.	C	2285	.	.	R	-	1	0	CSMD1	2819519	0.999000	0.42202	0.322000	0.25334	0.010000	0.07245	0.897000	0.28390	-1.197000	0.02673	-1.021000	0.02439	CGC		0.507	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
BMP1	649	broad.mit.edu	37	8	22031170	22031170	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr8:22031170A>G	ENST00000306385.5	+	2	874	c.204A>G	c.(202-204)gtA>gtG	p.V68V	BMP1_ENST00000306349.8_Silent_p.V68V|BMP1_ENST00000397816.3_Silent_p.V68V|BMP1_ENST00000354870.5_Silent_p.V68V|BMP1_ENST00000523849.1_3'UTR|BMP1_ENST00000397814.3_Silent_p.V68V	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	68					cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)	p.V68V(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		CCTTCCAGGTACAGCAGGCTG	0.557																																					p.V68V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A204G	8						.						130.0	102.0	112.0					8																	22031170		2203	4300	6503	22087115	SO:0001819	synonymous_variant	649	exon2				CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.204A>G	8.37:g.22031170A>G		Somatic		Capture	Illumina HiSeq	Phase_I	22087115	NM_006129	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Silent	SNP	ENST00000306385.5	37	CCDS6026.1																																																																																				0.557	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	NM_006132	
KIF13B	23303	broad.mit.edu	37	8	28980935	28980935	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr8:28980935C>T	ENST00000524189.1	-	28	3465	c.3427G>A	c.(3427-3429)Gcg>Acg	p.A1143T	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1143					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)	p.A1143T(1)		endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		ACCATCACCGCGTTCCTCTCC	0.542																																					p.A1143T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3427A	8						.						108.0	108.0	108.0					8																	28980935		1963	4149	6112	29036854	SO:0001583	missense	23303	exon28			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3427G>A	8.37:g.28980935C>T	ENSP00000427900:p.Ala1143Thr	Somatic		Capture	Illumina HiSeq	Phase_I	29036854	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707820	0.89018	.	.	ENSG00000197892	ENST00000524189	D	0.82803	-1.65	4.63	4.63	0.57726	.	0.050998	0.85682	D	0.000000	D	0.88537	0.6463	L	0.61218	1.895	0.80722	D	1	D	0.71674	0.998	P	0.59948	0.866	D	0.89701	0.3905	10	0.62326	D	0.03	.	17.6814	0.88245	0.0:1.0:0.0:0.0	.	1143	F8VPJ2	.	T	1143	ENSP00000427900:A1143T	ENSP00000427900:A1143T	A	-	1	0	KIF13B	29036854	1.000000	0.71417	0.090000	0.20809	0.582000	0.36321	7.215000	0.77966	2.381000	0.81170	0.655000	0.94253	GCG		0.542	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
PRKDC	5591	broad.mit.edu	37	8	48845643	48845643	+	Silent	SNP	G	G	A	rs373088662		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr8:48845643G>A	ENST00000314191.2	-	16	1769	c.1713C>T	c.(1711-1713)tcC>tcT	p.S571S	PRKDC_ENST00000338368.3_Silent_p.S571S|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	571					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.S571S(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TCTTCAAAACGGATTTTACAA	0.294								Non-homologous end-joining																													p.S571S	Esophageal Squamous(79;1091 1253 12329 31680 40677)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1713T	8						.	G	,	0,3600		0,0,1800	37.0	34.0	35.0		1713,1713	-12.1	0.8	8		35	1,8093		0,1,4046	no	coding-synonymous,coding-synonymous	PRKDC	NM_001081640.1,NM_006904.6	,	0,1,5846	AA,AG,GG		0.0124,0.0,0.0086	,	571/4098,571/4129	48845643	1,11693	1800	4047	5847	49008196	SO:0001819	synonymous_variant	5591	exon16				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.1713C>T	8.37:g.48845643G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49008196	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	ENST00000314191.2	37																																																																																					0.294	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
OTUD6B	51633	broad.mit.edu	37	8	92096322	92096322	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr8:92096322delA	ENST00000285420.4	+	6	966	c.867delA	c.(865-867)tcafs	p.S289fs	OTUD6B_ENST00000404789.3_Frame_Shift_Del_p.S158fs	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	259				VNIVTENCS -> GKHSY (in Ref. 1; AAD34073). {ECO:0000305}.			cysteine-type peptidase activity (GO:0008234)	p.K261fs*3(1)|p.K291fs*3(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			AAGAATATTCAAAAAAACCAC	0.284																																					p.S289fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.867delA	8						.			1,4251		0,1,2125	47.0	42.0	44.0			2.9	0.0	8		45	6,8230		0,6,4112	no	frameshift	OTUD6B	NM_016023.3		0,7,6237	A1A1,A1R,RR		0.0729,0.0235,0.0561			92096322	7,12481	2198	4292	6490	92165498	SO:0001589	frameshift_variant	51633	exon6				CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.867delA	8.37:g.92096322delA	ENSP00000285420:p.Ser289fs	Somatic		Capture	Illumina HiSeq	Phase_I	92165498	NM_016023	A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Frame_Shift_Del	DEL	ENST00000285420.4	37	CCDS6253.2																																																																																				0.284	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000319968.1	NM_016023	
CYP11B1	1584	broad.mit.edu	37	8	143957153	143957153	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr8:143957153G>A	ENST00000292427.4	-	6	1128	c.1096C>T	c.(1096-1098)Cgt>Tgt	p.R366C	CYP11B1_ENST00000377675.3_Missense_Mutation_p.R437C|CYP11B1_ENST00000517471.1_Missense_Mutation_p.R366C	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	366					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.R366C(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	AGGGCCGCACGCAGCAAGGGC	0.692									Familial Hyperaldosteronism type I																												p.R366C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1096T	8						.						64.0	66.0	65.0					8																	143957153		2202	4300	6502	143954155	SO:0001583	missense	1584	exon6	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1096C>T	8.37:g.143957153G>A	ENSP00000292427:p.Arg366Cys	Somatic		Capture	Illumina HiSeq	Phase_I	143954155	NM_001026213	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	13.06	2.124653	0.37533	.	.	ENSG00000160882	ENST00000519285;ENST00000292427;ENST00000517471;ENST00000377675	T;T;T;T	0.76709	-1.04;-0.4;-0.4;-0.4	4.42	0.276	0.15663	.	0.144353	0.31976	N	0.006780	D	0.85699	0.5757	M	0.85299	2.745	0.39781	D	0.972305	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.77557	0.99;0.987;0.987;0.983;0.985	T	0.83304	-0.0026	10	0.87932	D	0	.	7.1337	0.25517	0.0859:0.0:0.3417:0.5724	.	437;366;366;366;82	Q4VAR0;Q8TDD0;Q4VAQ9;P15538;Q8N9P8	.;.;.;C11B1_HUMAN;.	C	21;366;366;437	ENSP00000430144:R21C;ENSP00000292427:R366C;ENSP00000428043:R366C;ENSP00000366903:R437C	ENSP00000292427:R366C	R	-	1	0	CYP11B1	143954155	0.999000	0.42202	0.087000	0.20705	0.304000	0.27724	1.579000	0.36536	-0.191000	0.10448	-0.324000	0.08512	CGT		0.692	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
ACTL7A	10881	broad.mit.edu	37	9	111624793	111624793	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:111624793C>A	ENST00000333999.3	+	1	191	c.191C>A	c.(190-192)cCc>cAc	p.P64H		NM_006687.2	NP_006678.1	Q9Y615	ACL7A_HUMAN	actin-like 7A	64						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|motile cilium (GO:0031514)|nucleus (GO:0005634)|protein complex (GO:0043234)	structural constituent of cytoskeleton (GO:0005200)	p.P64H(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AAGGAGAGGCCCAAGCAGGAG	0.587																																					p.P64H	Esophageal Squamous(177;1480 3591 17554)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C191A	9						.						70.0	67.0	68.0					9																	111624793		2203	4300	6503	110664614	SO:0001583	missense	10881	exon1			BC014610	CCDS6772.1	9q31	2008-02-05			ENSG00000187003	ENSG00000187003			161	protein-coding gene	gene with protein product		604303				10373328	Standard	NM_006687		Approved		uc004bdj.1	Q9Y615	OTTHUMG00000020461	ENST00000333999.3:c.191C>A	9.37:g.111624793C>A	ENSP00000334300:p.Pro64His	Somatic		Capture	Illumina HiSeq	Phase_I	110664614	NM_006687	B2RC83|Q5JSV0	Missense_Mutation	SNP	ENST00000333999.3	37	CCDS6772.1	.	.	.	.	.	.	.	.	.	.	C	9.800	1.180184	0.21787	.	.	ENSG00000187003	ENST00000333999	D	0.94537	-3.45	5.62	2.61	0.31194	.	1.065910	0.07393	N	0.889413	D	0.95611	0.8573	L	0.46157	1.445	0.09310	N	1	D	0.89917	1.0	D	0.68192	0.956	D	0.85982	0.1483	10	0.87932	D	0	.	8.9616	0.35851	0.159:0.5336:0.3074:0.0	.	64	Q9Y615	ACL7A_HUMAN	H	64	ENSP00000334300:P64H	ENSP00000334300:P64H	P	+	2	0	ACTL7A	110664614	.	.	0.001000	0.08648	0.110000	0.19582	.	.	0.251000	0.21505	0.655000	0.94253	CCC		0.587	ACTL7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053570.1	NM_006687	
CTNNAL1	8727	broad.mit.edu	37	9	111745439	111745439	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:111745439T>A	ENST00000325551.4	-	6	972	c.886A>T	c.(886-888)Att>Ttt	p.I296F	CTNNAL1_ENST00000374595.4_Missense_Mutation_p.I296F|CTNNAL1_ENST00000325580.6_Missense_Mutation_p.I296F	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	296					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.I296F(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		AATTCCTTAATTCCAGTAAAA	0.303																																					p.I296F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A886T	9						.						78.0	74.0	76.0					9																	111745439		2202	4300	6502	110785260	SO:0001583	missense	8727	exon6			AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.886A>T	9.37:g.111745439T>A	ENSP00000320434:p.Ile296Phe	Somatic		Capture	Illumina HiSeq	Phase_I	110785260	NM_003798	B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Missense_Mutation	SNP	ENST00000325551.4	37	CCDS6775.1	.	.	.	.	.	.	.	.	.	.	T	18.00	3.526199	0.64860	.	.	ENSG00000119326	ENST00000374595;ENST00000325551;ENST00000325580	T;T;T	0.31510	1.49;1.62;1.49	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.87578	0.998;0.996;0.981;0.998	T	0.54417	-0.8297	10	0.31617	T	0.26	-16.847	14.299	0.66334	0.0:0.0:0.0:1.0	.	296;296;296;296	B2RBI4;Q9UBT7-3;Q9UBT7-2;Q9UBT7	.;.;.;CTNL1_HUMAN	F	296	ENSP00000363723:I296F;ENSP00000320434:I296F;ENSP00000323351:I296F	ENSP00000320434:I296F	I	-	1	0	CTNNAL1	110785260	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.214000	0.72200	2.263000	0.75096	0.528000	0.53228	ATT		0.303	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053577.1	NM_003798	
KIAA0368	23392	broad.mit.edu	37	9	114159344	114159344	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:114159344C>T	ENST00000338205.5	-	24	2961	c.2742G>A	c.(2740-2742)tgG>tgA	p.W914*	KIAA0368_ENST00000374378.3_5'UTR|KIAA0368_ENST00000259335.4_Nonsense_Mutation_p.W1092*			Q5VYK3	ECM29_HUMAN	KIAA0368	920					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)		p.W1092*(1)		NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						CAGTCATTTGCCAGGCATCTC	0.423																																					p.W1092X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G3276A	9						.						115.0	114.0	114.0					9																	114159344		1897	4107	6004	113199165	SO:0001587	stop_gained	23392	exon26			AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.2742G>A	9.37:g.114159344C>T	ENSP00000339889:p.Trp914*	Somatic		Capture	Illumina HiSeq	Phase_I	113199165	NM_001080398	O15074|Q8WU82	Nonsense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	C	44	11.045225	0.99507	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000543827	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	19.3973	0.94612	0.0:1.0:0.0:0.0	.	.	.	.	X	914;1092;389	.	ENSP00000259335:W1092X	W	-	3	0	KIAA0368	113199165	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.414000	0.80117	2.660000	0.90430	0.655000	0.94253	TGG		0.423	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
OR1K1	392392	broad.mit.edu	37	9	125563017	125563017	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:125563017G>A	ENST00000277309.2	+	1	648	c.616G>A	c.(616-618)Gca>Aca	p.A206T		NM_080859.1	NP_543135.1	Q8NGR3	OR1K1_HUMAN	olfactory receptor, family 1, subfamily K, member 1	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A206T(1)		endometrium(1)|large_intestine(8)|lung(2)|ovary(1)|skin(4)|stomach(1)	17						CGAGGGCGCCGCAGTGGTGGT	0.637																																					p.A206T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G616A	9						.						76.0	65.0	69.0					9																	125563017		2203	4300	6503	124602838	SO:0001583	missense	392392	exon1			AL359512	CCDS35132.1	9q33	2013-09-20			ENSG00000165204	ENSG00000165204		"""GPCR / Class A : Olfactory receptors"""	8212	protein-coding gene	gene with protein product							Standard	NM_080859		Approved	hg99, MNAB	uc011lze.2	Q8NGR3	OTTHUMG00000020625	ENST00000277309.2:c.616G>A	9.37:g.125563017G>A	ENSP00000277309:p.Ala206Thr	Somatic		Capture	Illumina HiSeq	Phase_I	124602838	NM_080859	B9EH41|Q4VXB7|Q96R23	Missense_Mutation	SNP	ENST00000277309.2	37	CCDS35132.1	.	.	.	.	.	.	.	.	.	.	G	4.332	0.060940	0.08339	.	.	ENSG00000165204	ENST00000277309	T	0.37058	1.22	4.37	0.347	0.16022	GPCR, rhodopsin-like superfamily (1);	0.199711	0.24557	U	0.037518	T	0.14570	0.0352	N	0.10685	0.025	0.09310	N	1	P	0.43231	0.801	B	0.41646	0.362	T	0.10894	-1.0610	10	0.46703	T	0.11	.	0.3059	0.00280	0.2684:0.143:0.2966:0.292	.	206	Q8NGR3	OR1K1_HUMAN	T	206	ENSP00000277309:A206T	ENSP00000277309:A206T	A	+	1	0	OR1K1	124602838	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.322000	0.01118	-0.111000	0.12001	-0.217000	0.12591	GCA		0.637	OR1K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053958.1		
RALGPS1	9649	broad.mit.edu	37	9	129974998	129974998	+	Splice_Site	SNP	C	C	T	rs149497407	byFrequency	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:129974998C>T	ENST00000259351.5	+	16	1713	c.1446C>T	c.(1444-1446)caC>caT	p.H482H	RALGPS1_ENST00000373434.1_Splice_Site_p.H440H|RP13-225O21.2_ENST00000453199.1_RNA|RALGPS1_ENST00000424082.2_Splice_Site_p.H440H	NM_014636.2	NP_055451.1	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1	482	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Required for stimulation of nucleotide exchange by RALA.				intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ral GTPase activity (GO:0032852)|regulation of Ral protein signal transduction (GO:0032485)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.H440H(1)|p.H482H(1)		kidney(2)|large_intestine(6)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						ACAGAAAACACGTAAGTCCCT	0.552																																					p.H482H												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1446T	9						.	C	,,	3,4403	4.2+/-10.8	0,3,2200	77.0	62.0	67.0		1320,1320,1446	-2.0	1.0	9	dbSNP_134	67	0,8600		0,0,4300	yes	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice	RALGPS1	NM_001190728.1,NM_001190729.1,NM_014636.2	,,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,,	440/530,440/538,482/558	129974998	3,13003	2203	4300	6503	129014819	SO:0001630	splice_region_variant	9649	exon16			AB002349	CCDS35143.1, CCDS55344.1, CCDS55345.1, CCDS55346.1	9q33.3	2013-01-10			ENSG00000136828	ENSG00000136828		"""Pleckstrin homology (PH) domain containing"""	16851	protein-coding gene	gene with protein product		614444				9205841, 10747847	Standard	NM_001190728		Approved	RALGPS1A, RALGEF2, KIAA0351	uc004bqo.2	Q5JS13	OTTHUMG00000020696	ENST00000259351.5:c.1446+1C>T	9.37:g.129974998C>T		Somatic		Capture	Illumina HiSeq	Phase_I	129014819	NM_014636	B4DR86|E9PBQ5|O15059|Q5JT60|Q5JT65|Q5JUG5|Q8N4S6|Q8N5H4|Q8WUV7|Q9NZ16	Silent	SNP	ENST00000259351.5	37	CCDS35143.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.531338	0.27387	6.81E-4	0.0	ENSG00000136828	ENST00000438723	.	.	.	5.19	-2.01	0.07410	.	.	.	.	.	T	0.57315	0.2045	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55270	-0.8167	4	.	.	.	.	11.3275	0.49456	0.0:0.1895:0.0:0.8105	.	.	.	.	I	78	.	.	T	+	2	0	RALGPS1	129014819	0.853000	0.29707	0.993000	0.49108	0.919000	0.55068	-0.111000	0.10807	-0.263000	0.09378	-0.137000	0.14449	ACT		0.552	RALGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054133.1	NM_014636	Silent
FAM129B	64855	broad.mit.edu	37	9	130286012	130286012	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:130286012C>T	ENST00000373312.3	-	5	748	c.535G>A	c.(535-537)Gag>Aag	p.E179K	FAM129B_ENST00000468379.1_Intron|FAM129B_ENST00000373314.3_Missense_Mutation_p.E166K	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	179	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E179K(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						TTGTCCTGCTCGGCTTCTGTC	0.617											OREG0019507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E179K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G535A	9						.						102.0	84.0	90.0					9																	130286012		2203	4300	6503	129325833	SO:0001583	missense	64855	exon5			AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.535G>A	9.37:g.130286012C>T	ENSP00000362409:p.Glu179Lys	Somatic	1579	Capture	Illumina HiSeq	Phase_I	129325833	NM_022833	Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	ENST00000373312.3	37	CCDS35145.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830174	0.91036	.	.	ENSG00000136830	ENST00000373314;ENST00000373312	T;T	0.25250	1.81;1.81	5.24	5.24	0.73138	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.44644	0.1303	L	0.46614	1.455	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.989	T	0.20706	-1.0267	10	0.45353	T	0.12	-40.7393	16.3295	0.83004	0.0:1.0:0.0:0.0	.	166;179	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	K	166;179	ENSP00000362411:E166K;ENSP00000362409:E179K	ENSP00000362409:E179K	E	-	1	0	FAM129B	129325833	1.000000	0.71417	0.949000	0.38748	0.922000	0.55478	7.378000	0.79679	2.448000	0.82819	0.561000	0.74099	GAG		0.617	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054196.1	NM_022833	
CCBL1	883	broad.mit.edu	37	9	131597853	131597853	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:131597853G>A	ENST00000302586.3	-	10	1111	c.949C>T	c.(949-951)Cgt>Tgt	p.R317C	CCBL1_ENST00000436267.2_Missense_Mutation_p.R411C|CCBL1_ENST00000320665.6_Missense_Mutation_p.R267C|CCBL1_ENST00000483599.1_5'UTR	NM_001122671.1|NM_004059.4	NP_001116143.1|NP_004050.3	Q16773	KAT1_HUMAN	cysteine conjugate-beta lyase, cytoplasmic	317					cellular amino acid biosynthetic process (GO:0008652)|cellular modified amino acid metabolic process (GO:0006575)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine catabolic process (GO:0097053)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|glutamine-phenylpyruvate transaminase activity (GO:0047316)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-glutamine:pyruvate aminotransferase activity (GO:0047945)|L-phenylalanine-oxaloacetate transaminase activity (GO:0036141)|L-phenylalanine:pyruvate aminotransferase activity (GO:0047312)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.R317C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)	18					L-Glutamine(DB00130)	ATGTGGTCACGGCAGCGCTGC	0.582																																					p.R267C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C799T	9						.						71.0	73.0	72.0					9																	131597853		2107	4222	6329	130637674	SO:0001583	missense	883	exon9			Y17448	CCDS43884.1, CCDS48038.1, CCDS75915.1	9q34.11	2008-03-11	2008-03-11		ENSG00000171097	ENSG00000171097	2.6.1.64		1564	protein-coding gene	gene with protein product	"""glutamine transaminase K"", ""kyneurenine aminotransferase"""	600547	"""cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)"""			7883047	Standard	NM_001122671		Approved	KATI, GTK	uc004bwh.3	Q16773	OTTHUMG00000020767	ENST00000302586.3:c.949C>T	9.37:g.131597853G>A	ENSP00000302227:p.Arg317Cys	Somatic		Capture	Illumina HiSeq	Phase_I	130637674	NM_001122672	Q5T275|Q8N191	Missense_Mutation	SNP	ENST00000302586.3	37	CCDS43884.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.276326	0.40294	.	.	ENSG00000171097	ENST00000302586;ENST00000320665;ENST00000436267	D;D;D	0.92545	-3.06;-3.06;-3.06	5.36	4.45	0.53987	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.049098	0.85682	D	0.000000	D	0.96842	0.8969	H	0.96080	3.765	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.99;1.0	D	0.96760	0.9560	10	0.87932	D	0	-19.8874	9.2682	0.37654	0.0796:0.0:0.7689:0.1514	.	411;317;267;317	B7Z4W5;A8K563;Q16773-2;Q16773	.;.;.;KAT1_HUMAN	C	317;267;411	ENSP00000302227:R317C;ENSP00000317342:R267C;ENSP00000399415:R411C	ENSP00000302227:R317C	R	-	1	0	CCBL1	130637674	0.717000	0.27966	0.113000	0.21522	0.066000	0.16364	0.992000	0.29667	2.504000	0.84457	0.436000	0.28706	CGT		0.582	CCBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054521.2		
USP20	10868	broad.mit.edu	37	9	132630354	132630354	+	Missense_Mutation	SNP	C	C	T	rs200755344		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:132630354C>T	ENST00000315480.4	+	11	919	c.761C>T	c.(760-762)aCg>aTg	p.T254M	USP20_ENST00000372429.3_Missense_Mutation_p.T254M|USP20_ENST00000358355.1_Missense_Mutation_p.T254M			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	254	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.T254M(3)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				GTGGTGGCCACGGTGGCGCTG	0.607																																					p.T254M												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C761T	9						.	C	MET/THR,MET/THR,MET/THR	0,4314		0,0,2157	55.0	68.0	64.0		761,761,761	0.6	0.0	9		64	1,8523		0,1,4261	yes	missense,missense,missense	USP20	NM_001008563.3,NM_001110303.2,NM_006676.6	81,81,81	0,1,6418	TT,TC,CC		0.0117,0.0,0.0078	benign,benign,benign	254/915,254/915,254/915	132630354	1,12837	2157	4262	6419	131670175	SO:0001583	missense	10868	exon11			AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.761C>T	9.37:g.132630354C>T	ENSP00000313811:p.Thr254Met	Somatic		Capture	Illumina HiSeq	Phase_I	131670175	NM_001008563	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	37	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	C	4.861	0.159985	0.09287	0.0	1.17E-4	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.02863	4.13;4.13;4.13	3.55	0.59	0.17458	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.167910	0.06445	N	0.726707	T	0.01905	0.0060	N	0.04508	-0.205	0.09310	N	1	B	0.31174	0.311	B	0.36289	0.221	T	0.50083	-0.8869	10	0.31617	T	0.26	.	5.505	0.16848	0.0:0.6082:0.0:0.3918	.	254	Q9Y2K6	UBP20_HUMAN	M	254	ENSP00000361506:T254M;ENSP00000313811:T254M;ENSP00000351122:T254M	ENSP00000313811:T254M	T	+	2	0	USP20	131670175	0.289000	0.24334	0.000000	0.03702	0.009000	0.06853	0.835000	0.27531	0.123000	0.18342	0.561000	0.74099	ACG		0.607	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
OLFM1	10439	broad.mit.edu	37	9	138011625	138011625	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:138011625G>A	ENST00000371793.3	+	6	1310	c.1059G>A	c.(1057-1059)tcG>tcA	p.S353S	OLFM1_ENST00000371796.3_Silent_p.S326S|OLFM1_ENST00000252854.4_Silent_p.S335S	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	353	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)	p.S335S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		GTGGCCACTCGGACATCGACC	0.597																																					p.S335S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1005A	9						.						78.0	66.0	70.0					9																	138011625		2203	4300	6503	137151446	SO:0001819	synonymous_variant	10439	exon6			AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.1059G>A	9.37:g.138011625G>A		Somatic		Capture	Illumina HiSeq	Phase_I	137151446	NM_014279	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Silent	SNP	ENST00000371793.3	37																																																																																					0.597	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	NM_014279	
CER1	9350	broad.mit.edu	37	9	14720297	14720297	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:14720297C>T	ENST00000380911.3	-	2	639	c.595G>A	c.(595-597)Gcg>Acg	p.A199T		NM_005454.2	NP_005445.1	O95813	CER1_HUMAN	cerberus 1, DAN family BMP antagonist	199	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|bone mineralization (GO:0030282)|cell migration involved in gastrulation (GO:0042074)|cellular response to BMP stimulus (GO:0071773)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|growth plate cartilage chondrocyte proliferation (GO:0003419)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mesoderm development (GO:2000381)|nervous system development (GO:0007399)|sequestering of BMP in extracellular matrix (GO:0035582)|signal transduction involved in regulation of gene expression (GO:0023019)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)	p.A199T(2)		endometrium(2)|large_intestine(3)|lung(6)	11				GBM - Glioblastoma multiforme(50;3.16e-06)		GAGTGCTGCGCGGCTCCAGGA	0.488																																					p.A199T												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G595A	9						.						108.0	90.0	96.0					9																	14720297		2203	4300	6503	14710297	SO:0001583	missense	9350	exon2			AF090189	CCDS6476.1	9p23-p22	2013-02-26	2013-02-26		ENSG00000147869	ENSG00000147869			1862	protein-coding gene	gene with protein product		603777	"""cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)"", ""cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"""			10049596	Standard	NM_005454		Approved	DAND4	uc003zlj.3	O95813	OTTHUMG00000021022	ENST00000380911.3:c.595G>A	9.37:g.14720297C>T	ENSP00000370297:p.Ala199Thr	Somatic		Capture	Illumina HiSeq	Phase_I	14710297	NM_005454	Q6ISJ1|Q6ISJ6|Q6ISQ2|Q6ISS1	Missense_Mutation	SNP	ENST00000380911.3	37	CCDS6476.1	.	.	.	.	.	.	.	.	.	.	C	3.777	-0.046453	0.07407	.	.	ENSG00000147869	ENST00000380911	T	0.29917	1.55	5.52	3.58	0.41010	DAN (1);Cystine knot, C-terminal (2);	0.999489	0.08096	N	0.998638	T	0.19525	0.0469	L	0.27053	0.805	0.09310	N	1	B	0.25169	0.119	B	0.18561	0.022	T	0.23655	-1.0182	10	0.15499	T	0.54	-0.548	6.8321	0.23915	0.1297:0.6744:0.1257:0.0701	.	199	O95813	CER1_HUMAN	T	199	ENSP00000370297:A199T	ENSP00000370297:A199T	A	-	1	0	CER1	14710297	0.000000	0.05858	0.092000	0.20876	0.224000	0.24922	0.717000	0.25851	1.480000	0.48289	0.655000	0.94253	GCG		0.488	CER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055453.1	NM_005454	
CNTLN	54875	broad.mit.edu	37	9	17340874	17340874	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:17340874G>A	ENST00000380647.3	+	11	1778	c.1694G>A	c.(1693-1695)cGg>cAg	p.R565Q	CNTLN_ENST00000262360.5_Missense_Mutation_p.R565Q|CNTLN_ENST00000425824.1_Missense_Mutation_p.R565Q			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	565					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.R565Q(1)		breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		CGCAAGGAACGGCTACAGATG	0.373																																					p.R565Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1694A	9						.						88.0	85.0	86.0					9																	17340874		1908	4127	6035	17330874	SO:0001583	missense	54875	exon11			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.1694G>A	9.37:g.17340874G>A	ENSP00000370021:p.Arg565Gln	Somatic		Capture	Illumina HiSeq	Phase_I	17330874	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	G	33	5.277998	0.95459	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.13657	2.57;2.57;2.57	5.4	5.4	0.78164	.	.	.	.	.	T	0.37839	0.1018	M	0.71581	2.175	0.42879	D	0.994166	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.04347	-1.0958	9	0.25106	T	0.35	.	19.1457	0.93467	0.0:0.0:1.0:0.0	.	565;565;565	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	Q	565	ENSP00000370021:R565Q;ENSP00000392798:R565Q;ENSP00000262360:R565Q	ENSP00000262360:R565Q	R	+	2	0	CNTLN	17330874	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.384000	0.79751	2.518000	0.84900	0.591000	0.81541	CGG		0.373	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
LINGO2	158038	broad.mit.edu	37	9	27950324	27950324	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:27950324G>A	ENST00000379992.2	-	6	795	c.346C>T	c.(346-348)Cgt>Tgt	p.R116C	LINGO2_ENST00000308675.3_Missense_Mutation_p.R116C	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	116						integral component of membrane (GO:0016021)		p.R116C(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		AGCTTTAGACGATTGCCTTTT	0.438																																					p.R116C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C346T	9						.						131.0	129.0	130.0					9																	27950324		2203	4300	6503	27940324	SO:0001583	missense	158038	exon7			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.346C>T	9.37:g.27950324G>A	ENSP00000369328:p.Arg116Cys	Somatic		Capture	Illumina HiSeq	Phase_I	27940324	NM_152570	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	37	CCDS6524.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.046018	0.93685	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.60672	0.17;0.17	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.74253	0.3692	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	T	0.70245	-0.4925	9	.	.	.	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	116	Q7L985	LIGO2_HUMAN	C	116	ENSP00000369328:R116C;ENSP00000310126:R116C	.	R	-	1	0	LINGO2	27940324	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.766000	0.98957	2.941000	0.99782	0.655000	0.94253	CGT		0.438	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570	
GBA2	57704	broad.mit.edu	37	9	35740287	35740287	+	Missense_Mutation	SNP	C	C	T	rs112979503		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:35740287C>T	ENST00000378103.3	-	7	1725	c.1202G>A	c.(1201-1203)cGa>cAa	p.R401Q	GBA2_ENST00000378088.1_5'Flank|GBA2_ENST00000378094.4_Missense_Mutation_p.R401Q|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000545786.1_Missense_Mutation_p.R407Q	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	401					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)	p.R401Q(1)		NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCACTGGCCTCGAGGTCGCAA	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21813	0.0		0.0	False		,,,				2504	0.0				p.R401Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1202A	9						.						63.0	54.0	57.0					9																	35740287		2203	4300	6503	35730287	SO:0001583	missense	57704	exon7			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1202G>A	9.37:g.35740287C>T	ENSP00000367343:p.Arg401Gln	Somatic		Capture	Illumina HiSeq	Phase_I	35730287	NM_020944	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	C	8.116	0.779941	0.16120	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.6	2.68	0.31781	Beta-glucosidase, GBA2 type, N-terminal (1);	0.574491	0.18980	N	0.125910	T	0.14787	0.0357	N	0.04297	-0.235	0.26044	N	0.981565	B;B;B	0.25169	0.098;0.038;0.119	B;B;B	0.21546	0.021;0.006;0.035	T	0.16129	-1.0413	9	0.27785	T	0.31	-0.2565	6.1943	0.20542	0.0:0.6383:0.1472:0.2145	.	407;401;401	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	Q	401;401;407	.	ENSP00000367334:R401Q	R	-	2	0	GBA2	35730287	0.582000	0.26749	0.998000	0.56505	0.983000	0.72400	0.454000	0.21827	0.811000	0.34303	-0.145000	0.13849	CGA		0.537	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
PGM5	5239	broad.mit.edu	37	9	71094403	71094403	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:71094403G>A	ENST00000396396.1	+	8	1458	c.1229G>A	c.(1228-1230)cGg>cAg	p.R410Q		NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	410					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)	p.R410Q(2)		endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						ATTGCTGCCCGGAAGCAGAGT	0.532																																					p.R410Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.G1229A	9						.						114.0	116.0	115.0					9																	71094403		2203	4300	6503	70284223	SO:0001583	missense	5239	exon8			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1229G>A	9.37:g.71094403G>A	ENSP00000379678:p.Arg410Gln	Somatic		Capture	Illumina HiSeq	Phase_I	70284223	NM_021965	B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	ENST00000396396.1	37	CCDS6622.2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470453	0.84533	.	.	ENSG00000154330	ENST00000396396	T	0.41400	1.0	5.49	5.49	0.81192	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (1);	0.057554	0.64402	D	0.000002	T	0.63462	0.2513	M	0.85099	2.735	0.80722	D	1	D	0.71674	0.998	P	0.54815	0.761	T	0.68044	-0.5513	10	0.52906	T	0.07	.	18.4944	0.90860	0.0:0.0:1.0:0.0	.	410	Q15124	PGM5_HUMAN	Q	410	ENSP00000379678:R410Q	ENSP00000379678:R410Q	R	+	2	0	PGM5	70284223	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.539000	0.73856	2.739000	0.93911	0.563000	0.77884	CGG		0.532	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052548.2	NM_021965	
RASEF	158158	broad.mit.edu	37	9	85611962	85611962	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:85611962A>C	ENST00000376447.3	-	14	2145	c.1885T>G	c.(1885-1887)Ttt>Gtt	p.F629V		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	629					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)	p.F629V(1)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						ATGTTAAGAAAGCTTTTCTCA	0.368																																					p.F629V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1885G	9						.						177.0	162.0	167.0					9																	85611962		2203	4300	6503	84801782	SO:0001583	missense	158158	exon14			AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.1885T>G	9.37:g.85611962A>C	ENSP00000365630:p.Phe629Val	Somatic		Capture	Illumina HiSeq	Phase_I	84801782	NM_152573	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	37	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.554509	0.86231	.	.	ENSG00000165105	ENST00000376447	D	0.82167	-1.58	5.65	5.65	0.86999	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.93311	0.7868	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94902	0.8057	10	0.87932	D	0	.	15.5535	0.76173	1.0:0.0:0.0:0.0	.	629	Q8IZ41	RASEF_HUMAN	V	629	ENSP00000365630:F629V	ENSP00000365630:F629V	F	-	1	0	RASEF	84801782	1.000000	0.71417	0.998000	0.56505	0.771000	0.43674	9.270000	0.95690	2.166000	0.68216	0.460000	0.39030	TTT		0.368	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
RASEF	158158	broad.mit.edu	37	9	85615460	85615460	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:85615460G>A	ENST00000376447.3	-	11	1723	c.1463C>T	c.(1462-1464)aCa>aTa	p.T488I		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	488					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)	p.T488I(1)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						TAAACCAAATGTCTCTTCATC	0.368																																					p.T488I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1463T	9						.						65.0	67.0	66.0					9																	85615460		2203	4300	6503	84805280	SO:0001583	missense	158158	exon11			AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.1463C>T	9.37:g.85615460G>A	ENSP00000365630:p.Thr488Ile	Somatic		Capture	Illumina HiSeq	Phase_I	84805280	NM_152573	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	37	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	G	10.22	1.290353	0.23478	.	.	ENSG00000165105	ENST00000376447	T	0.60548	0.18	5.91	4.09	0.47781	.	0.414632	0.27245	N	0.020246	T	0.42899	0.1223	L	0.36672	1.1	0.80722	D	1	B	0.27450	0.179	B	0.19148	0.024	T	0.31724	-0.9933	10	0.48119	T	0.1	.	7.5677	0.27890	0.2933:0.0:0.7067:0.0	.	488	Q8IZ41	RASEF_HUMAN	I	488	ENSP00000365630:T488I	ENSP00000365630:T488I	T	-	2	0	RASEF	84805280	0.084000	0.21492	0.664000	0.29753	0.332000	0.28634	1.183000	0.32041	0.856000	0.35383	0.462000	0.41574	ACA		0.368	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
ARRDC1	92714	broad.mit.edu	37	9	140508564	140508564	+	Silent	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chr9:140508564T>C	ENST00000371421.4	+	5	580	c.516T>C	c.(514-516)acT>acC	p.T172T	ARRDC1_ENST00000491911.1_3'UTR|C9orf37_ENST00000496793.1_5'Flank	NM_152285.2	NP_689498.1	Q8N5I2	ARRD1_HUMAN	arrestin domain containing 1	172						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.T172T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000273)|Epithelial(140;0.000464)		CAGCCAGCACTGATCTCCGCG	0.632																																					p.T172T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T516C	9						.						126.0	117.0	120.0					9																	140508564		2203	4300	6503	139628385	SO:0001819	synonymous_variant	92714	exon5			AJ420420	CCDS7049.1	9q34.3	2013-10-11			ENSG00000197070	ENSG00000197070			28633	protein-coding gene	gene with protein product	"""alpha-arrestin 1"""					23886940	Standard	XM_005266119		Approved	MGC40555	uc004cns.3	Q8N5I2	OTTHUMG00000020993	ENST00000371421.4:c.516T>C	9.37:g.140508564T>C		Somatic		Capture	Illumina HiSeq	Phase_I	139628385	NM_152285		Silent	SNP	ENST00000371421.4	37	CCDS7049.1																																																																																				0.632	ARRDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055358.1	NM_152285	
WWC3	55841	broad.mit.edu	37	X	10062212	10062212	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:10062212C>T	ENST00000380861.4	+	7	939	c.548C>T	c.(547-549)tCc>tTc	p.S183F	WWC3_ENST00000454666.1_Missense_Mutation_p.S183F	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	183					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.S183F(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						AACAGCTGCTCCGTTACCGAC	0.552																																					p.S183F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C548T	X						.						165.0	145.0	151.0					X																	10062212		2203	4300	6503	10022212	SO:0001583	missense	55841	exon7			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.548C>T	X.37:g.10062212C>T	ENSP00000370242:p.Ser183Phe	Somatic		Capture	Illumina HiSeq	Phase_I	10022212	NM_015691	A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	CCDS14136.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180611	0.57800	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000398613	T;T	0.05513	3.43;3.43	5.83	4.95	0.65309	.	0.219469	0.52532	D	0.000078	T	0.13030	0.0316	L	0.44542	1.39	0.40109	D	0.976468	P	0.47604	0.898	P	0.54499	0.754	T	0.00555	-1.1673	10	0.62326	D	0.03	-23.7398	12.2299	0.54482	0.0:0.5414:0.4585:0.0	.	183	Q9ULE0	WWC3_HUMAN	F	183	ENSP00000370242:S183F;ENSP00000399584:S183F	ENSP00000370242:S183F	S	+	2	0	WWC3	10022212	0.995000	0.38212	0.874000	0.34290	0.278000	0.26855	2.561000	0.45905	2.465000	0.83290	0.600000	0.82982	TCC		0.552	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
NRK	203447	broad.mit.edu	37	X	105132334	105132334	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:105132334C>T	ENST00000243300.9	+	5	603	c.300C>T	c.(298-300)taC>taT	p.Y100Y	NRK_ENST00000428173.2_Silent_p.Y100Y|NRK_ENST00000536164.1_Silent_p.Y100Y	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	100	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.Y100Y(2)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TGAGGAAGTACTCTTTCCACA	0.418										HNSCC(51;0.14)																											p.Y100Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C300T	X						.						113.0	95.0	101.0					X																	105132334		1898	4098	5996	105018990	SO:0001819	synonymous_variant	203447	exon5			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.300C>T	X.37:g.105132334C>T		Somatic		Capture	Illumina HiSeq	Phase_I	105018990	NM_198465	Q32ND6|Q5H9K2|Q6ZMP2	Silent	SNP	ENST00000243300.9	37																																																																																					0.418	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
ATG4A	115201	broad.mit.edu	37	X	107377624	107377624	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:107377624A>G	ENST00000372232.3	+	6	609	c.450A>G	c.(448-450)acA>acG	p.T150T	ATG4A_ENST00000545696.1_Silent_p.T73T|ATG4A_ENST00000345734.3_Silent_p.T150T|ATG4A_ENST00000372254.3_Silent_p.T126T	NM_052936.3	NP_443168.2	Q8WYN0	ATG4A_HUMAN	autophagy related 4A, cysteine peptidase	150					autophagy (GO:0006914)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)	p.T150T(2)		endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)	11						GACCAAATACAGTTGCACAGG	0.403																																					p.T150T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A450G	X						.						161.0	138.0	145.0					X																	107377624		2203	4300	6503	107264280	SO:0001819	synonymous_variant	115201	exon6			AJ320508	CCDS14538.1, CCDS14539.1	Xq22.1-q22.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000101844	ENSG00000101844			16489	protein-coding gene	gene with protein product		300663	"""AUT-like 2, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog A (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog A (S. cerevisiae)"""	AUTL2, APG4A		12446702, 12473658	Standard	NM_052936		Approved		uc004enr.3	Q8WYN0	OTTHUMG00000022176	ENST00000372232.3:c.450A>G	X.37:g.107377624A>G		Somatic		Capture	Illumina HiSeq	Phase_I	107264280	NM_178270	A6NCH2|B2RAZ7|D3DUY0|O95534|Q5JYY9|Q5JYZ0|Q86VE5|Q96KQ0|Q96KQ1	Silent	SNP	ENST00000372232.3	37	CCDS14538.1	.	.	.	.	.	.	.	.	.	.	A	8.969	0.972442	0.18736	.	.	ENSG00000101844	ENST00000394892	.	.	.	5.85	4.68	0.58851	.	.	.	.	.	T	0.57460	0.2055	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53464	-0.8435	4	.	.	.	-9.9447	6.8014	0.23754	0.7888:0.0:0.0735:0.1377	.	.	.	.	R	123	.	.	Q	+	2	0	ATG4A	107264280	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.669000	0.61575	0.809000	0.34255	0.417000	0.27973	CAG		0.403	ATG4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057860.1	NM_052936	
DCAF12L1	139170	broad.mit.edu	37	X	125685439	125685439	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:125685439C>T	ENST00000371126.1	-	1	1395	c.1153G>A	c.(1153-1155)Gaa>Aaa	p.E385K		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	385								p.E385K(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						GAGGCTCTTTCCTCCAGGAAT	0.607																																					p.E385K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1153A	X						.						46.0	48.0	47.0					X																	125685439		2203	4300	6503	125513120	SO:0001583	missense	139170	exon1			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1153G>A	X.37:g.125685439C>T	ENSP00000360167:p.Glu385Lys	Somatic		Capture	Illumina HiSeq	Phase_I	125513120	NM_178470	Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118034	0.37339	.	.	ENSG00000198889	ENST00000371126	T	0.63096	-0.02	3.64	2.77	0.32553	.	0.000000	0.36409	N	0.002613	T	0.53965	0.1829	L	0.55103	1.725	0.29204	N	0.875019	P	0.52316	0.952	P	0.46885	0.53	T	0.50955	-0.8766	10	0.07990	T	0.79	.	8.4392	0.32805	0.0:0.8778:0.0:0.1222	.	385	Q5VU92	DC121_HUMAN	K	385	ENSP00000360167:E385K	ENSP00000360167:E385K	E	-	1	0	DCAF12L1	125513120	1.000000	0.71417	0.707000	0.30419	0.041000	0.13682	4.456000	0.60081	0.920000	0.36970	0.429000	0.28392	GAA		0.607	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470	
FGF13	2258	broad.mit.edu	37	X	137793061	137793061	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:137793061C>A	ENST00000315930.6	-	1	766	c.105G>T	c.(103-105)aaG>aaT	p.K35N	FGF13_ENST00000541469.1_Intron|FGF13-AS1_ENST00000446383.1_RNA|FGF13-AS1_ENST00000438238.1_RNA|FGF13_ENST00000441825.2_Intron|FGF13_ENST00000370603.3_Intron|FGF13_ENST00000305414.4_Intron	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	35	Mediates targeting to the nucleus. {ECO:0000250}.				cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)	p.K35N(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					CGCAGCTGGTCTTGCCTTTGC	0.567																																					p.K35N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G105T	X						.						145.0	132.0	136.0					X																	137793061		2203	4300	6503	137620727	SO:0001583	missense	2258	exon1			BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.105G>T	X.37:g.137793061C>A	ENSP00000322390:p.Lys35Asn	Somatic		Capture	Illumina HiSeq	Phase_I	137620727	NM_004114	B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	ENST00000315930.6	37	CCDS14665.1	.	.	.	.	.	.	.	.	.	.	C	13.21	2.169869	0.38315	.	.	ENSG00000129682	ENST00000315930	T	0.79940	-1.32	4.5	4.5	0.54988	.	.	.	.	.	T	0.73822	0.3636	L	0.43923	1.385	0.80722	D	1	B	0.25850	0.136	B	0.31495	0.131	T	0.70773	-0.4781	9	0.38643	T	0.18	.	9.5943	0.39565	0.0:0.9004:0.0:0.0996	.	35	Q92913	FGF13_HUMAN	N	35	ENSP00000322390:K35N	ENSP00000322390:K35N	K	-	3	2	FGF13	137620727	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.227000	0.42972	1.986000	0.57962	0.529000	0.55759	AAG		0.567	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058534.2	NM_004114	
MAGEC3	139081	broad.mit.edu	37	X	140969257	140969257	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:140969257T>G	ENST00000298296.1	+	4	584	c.584T>G	c.(583-585)cTt>cGt	p.L195R	MAGEC3_ENST00000536088.1_Intron|MAGEC3_ENST00000443323.2_Intron|MAGEC3_ENST00000448920.1_Intron	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	195	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.L195R(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GTGCAGTTTCTTCTCCTCAAA	0.438																																					p.L195R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T584G	X						.						136.0	130.0	132.0					X																	140969257		2203	4300	6503	140796923	SO:0001583	missense	139081	exon4			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.584T>G	X.37:g.140969257T>G	ENSP00000298296:p.Leu195Arg	Somatic		Capture	Illumina HiSeq	Phase_I	140796923	NM_138702	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	T	11.83	1.755845	0.31046	.	.	ENSG00000165509	ENST00000298296	T	0.07021	3.23	2.26	2.26	0.28386	.	.	.	.	.	T	0.27063	0.0663	H	0.94542	3.55	0.09310	N	0.999998	D	0.63880	0.993	P	0.54401	0.751	T	0.14035	-1.0487	9	0.87932	D	0	.	5.7647	0.18219	0.0:0.0:0.0:1.0	.	195	Q8TD91	MAGC3_HUMAN	R	195	ENSP00000298296:L195R	ENSP00000298296:L195R	L	+	2	0	MAGEC3	140796923	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.439000	0.21575	1.145000	0.42336	0.426000	0.28351	CTT		0.438	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
IDS	3423	broad.mit.edu	37	X	148579801	148579801	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:148579801A>T	ENST00000340855.6	-	5	754	c.545T>A	c.(544-546)cTg>cAg	p.L182Q	IDS_ENST00000490775.1_5'UTR|IDS_ENST00000541269.1_5'UTR|IDS_ENST00000422081.2_5'UTR|IDS_ENST00000370443.4_Missense_Mutation_p.L182Q|IDS_ENST00000370441.4_Missense_Mutation_p.L182Q	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	182			L -> P (in MPS2; intermediate form). {ECO:0000269|PubMed:9501270}.		carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)	p.L182Q(1)		NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AGGGCAAAGCAGGTTGGCATG	0.453																																					p.L182Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T545A	X	GRCh37	CM981027	IDS	M		.						100.0	79.0	86.0					X																	148579801		2203	4300	6503	148387706	SO:0001583	missense	3423	exon5			M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.545T>A	X.37:g.148579801A>T	ENSP00000339801:p.Leu182Gln	Somatic		Capture	Illumina HiSeq	Phase_I	148387706	NM_006123	D3DWT4|Q14604|Q9BRM3	Missense_Mutation	SNP	ENST00000340855.6	37	CCDS14685.1	.	.	.	.	.	.	.	.	.	.	A	16.45	3.125618	0.56721	.	.	ENSG00000010404	ENST00000340855;ENST00000370441;ENST00000370443	D;D;D	0.99900	-7.62;-7.62;-7.62	4.89	4.89	0.63831	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.66506	2.035	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.993;0.997;0.998	D	0.97035	0.9753	10	0.37606	T	0.19	.	13.7225	0.62737	1.0:0.0:0.0:0.0	.	182;92;182	P22304-2;B4DGD7;P22304	.;.;IDS_HUMAN	Q	182	ENSP00000339801:L182Q;ENSP00000359470:L182Q;ENSP00000359472:L182Q	ENSP00000339801:L182Q	L	-	2	0	IDS	148387706	1.000000	0.71417	1.000000	0.80357	0.327000	0.28475	8.923000	0.92808	1.614000	0.50241	0.425000	0.28330	CTG		0.453	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058677.3		
GABRQ	55879	broad.mit.edu	37	X	151815616	151815616	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:151815616C>T	ENST00000370306.2	+	4	534	c.514C>T	c.(514-516)Cgg>Tgg	p.R172W		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	172					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.R172W(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGGAACGGTGCGGTACGGCAT	0.522																																					p.R172W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C514T	X						.						158.0	114.0	129.0					X																	151815616		2203	4300	6503	151566272	SO:0001583	missense	55879	exon4			U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.514C>T	X.37:g.151815616C>T	ENSP00000359329:p.Arg172Trp	Somatic		Capture	Illumina HiSeq	Phase_I	151566272	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.704780	0.30232	.	.	ENSG00000147402	ENST00000370306	T	0.77358	-1.09	5.19	4.33	0.51752	Neurotransmitter-gated ion-channel ligand-binding (3);	0.882556	0.09422	N	0.804240	T	0.73799	0.3633	N	0.13098	0.295	0.26087	N	0.981013	D	0.61697	0.99	P	0.54210	0.745	T	0.63871	-0.6539	10	0.87932	D	0	.	10.7048	0.45948	0.0:0.904:0.0:0.096	.	172	Q9UN88	GBRT_HUMAN	W	172	ENSP00000359329:R172W	ENSP00000359329:R172W	R	+	1	2	GABRQ	151566272	0.221000	0.23642	0.055000	0.19348	0.005000	0.04900	2.095000	0.41729	0.979000	0.38497	-0.296000	0.09543	CGG		0.522	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
MPP1	4354	broad.mit.edu	37	X	154014611	154014611	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:154014611G>A	ENST00000369534.3	-	6	692	c.545C>T	c.(544-546)gCg>gTg	p.A182V	MPP1_ENST00000462825.1_5'UTR|MPP1_ENST00000413259.3_Missense_Mutation_p.A152V|MPP1_ENST00000393531.1_Missense_Mutation_p.A162V	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	182	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.A182V(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTTCAGTCCCGCCTCCTTGCA	0.493																																					p.A182V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C545T	X						.						340.0	317.0	325.0					X																	154014611		2203	4300	6503	153667805	SO:0001583	missense	4354	exon6				CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.545C>T	X.37:g.154014611G>A	ENSP00000358547:p.Ala182Val	Somatic		Capture	Illumina HiSeq	Phase_I	153667805	NM_002436	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	ENST00000369534.3	37	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	G	32	5.187080	0.94923	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531;ENST00000453245;ENST00000393529;ENST00000428488	D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.3	5.3	0.74995	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	D	0.91064	0.7188	M	0.77820	2.39	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.994;0.999;0.99;0.994	D	0.92282	0.5834	10	0.87932	D	0	.	16.4752	0.84130	0.0:0.0:1.0:0.0	.	165;152;56;162;182	B4E325;B4DZV5;C9J9J4;G3XAI1;Q00013	.;.;.;.;EM55_HUMAN	V	182;152;162;56;136;79	ENSP00000358547:A182V;ENSP00000400155:A152V;ENSP00000377165:A162V;ENSP00000410888:A56V;ENSP00000377163:A136V;ENSP00000391701:A79V	ENSP00000358547:A182V	A	-	2	0	MPP1	153667805	1.000000	0.71417	0.902000	0.35471	0.950000	0.60333	9.822000	0.99363	2.195000	0.70347	0.513000	0.50165	GCG		0.493	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436	
ARSE	415	broad.mit.edu	37	X	2856245	2856245	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:2856245G>A	ENST00000381134.3	-	9	1246	c.1180C>T	c.(1180-1182)Cgc>Tgc	p.R394C	ARSE_ENST00000540563.1_Missense_Mutation_p.R349C|ARSE_ENST00000545496.1_Missense_Mutation_p.R419C	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	394					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.R394C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CCGGGCCAGCGGAAGATCCCG	0.632																																					p.R394C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1180T	X						.						30.0	33.0	32.0					X																	2856245		2201	4299	6500	2866245	SO:0001583	missense	415	exon9			X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.1180C>T	X.37:g.2856245G>A	ENSP00000370526:p.Arg394Cys	Somatic		Capture	Illumina HiSeq	Phase_I	2866245	NM_000047	Q53FT2|Q53FU8	Missense_Mutation	SNP	ENST00000381134.3	37	CCDS14122.1	.	.	.	.	.	.	.	.	.	.	g	12.55	1.972788	0.34848	.	.	ENSG00000157399	ENST00000540563;ENST00000545496;ENST00000381134	D;D;D	0.98876	-5.2;-5.2;-5.2	3.46	3.46	0.39613	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99143	0.9704	M	0.93763	3.455	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.74023	0.982;0.96;0.962	D	0.99466	1.0944	10	0.87932	D	0	.	8.797	0.34885	0.0:0.0:0.5657:0.4343	.	349;419;394	F5H324;F5GYY5;P51690	.;.;ARSE_HUMAN	C	349;419;394	ENSP00000438198:R349C;ENSP00000441417:R419C;ENSP00000370526:R394C	ENSP00000370526:R394C	R	-	1	0	ARSE	2866245	1.000000	0.71417	0.086000	0.20670	0.327000	0.28475	2.046000	0.41260	1.355000	0.45865	0.540000	0.68198	CGC		0.632	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055643.1	NM_000047	
MXRA5	25878	broad.mit.edu	37	X	3240232	3240232	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:3240232C>T	ENST00000217939.6	-	5	3648	c.3494G>A	c.(3493-3495)cGg>cAg	p.R1165Q		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1165						extracellular vesicular exosome (GO:0070062)		p.R1165Q(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTGCTTGTGCCGGTGGCGGAA	0.502													C|||	2	0.000529801	0.0	0.0	3775	,	,		13697	0.0		0.0	False		,,,				2504	0.002				p.R1165Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3494A	X						.						123.0	125.0	124.0					X																	3240232		2203	4300	6503	3250232	SO:0001583	missense	25878	exon5			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.3494G>A	X.37:g.3240232C>T	ENSP00000217939:p.Arg1165Gln	Somatic		Capture	Illumina HiSeq	Phase_I	3250232	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	c	16.95	3.262425	0.59431	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.67523	-0.27	3.61	2.73	0.32206	.	0.207028	0.23740	U	0.045025	T	0.45816	0.1361	L	0.32530	0.975	0.09310	N	1	P	0.43169	0.8	B	0.26202	0.067	T	0.40040	-0.9584	10	0.72032	D	0.01	.	9.1315	0.36848	0.0:0.8919:0.0:0.1081	.	1165	Q9NR99	MXRA5_HUMAN	Q	1165	ENSP00000217939:R1165Q	ENSP00000217939:R1165Q	R	-	2	0	MXRA5	3250232	0.018000	0.18449	0.005000	0.12908	0.281000	0.26958	1.648000	0.37271	0.413000	0.25759	0.519000	0.50382	CGG		0.502	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
SAT1	6303	broad.mit.edu	37	X	23802147	23802147	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:23802147delA	ENST00000379253.3	+	3	528	c.349delA	c.(349-351)aaafs	p.K119fs	Y_RNA_ENST00000365402.1_RNA|SAT1_ENST00000379254.1_Intron|RP13-314C10.5_ENST00000366134.2_RNA|SAT1_ENST00000379270.4_Intron|SAT1_ENST00000379251.3_Frame_Shift_Del_p.K149fs|SAT1_ENST00000489394.1_Intron			Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1	0					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.N150fs*13(3)		breast(1)|endometrium(3)|kidney(3)|lung(3)	10						ACTACTGAGGAAAAAAAAAAA	0.398																																					.												.	.	3	Deletion - Frameshift(3)	large_intestine(3)	.	X						.																																			23712068	SO:0001589	frameshift_variant	6303	.			M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	ENST00000379253.3:c.349delA	X.37:g.23802147delA	ENSP00000368555:p.Lys119fs	Somatic		Capture	Illumina HiSeq	Phase_I	23712068	.	A8K9N2|Q7Z5R3|Q96BK0	Frame_Shift_Del	DEL	ENST00000379253.3	37																																																																																					0.398	SAT1-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000056058.1	NM_002970	
MAGEB4	4115	broad.mit.edu	37	X	30260982	30260982	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:30260982C>T	ENST00000378982.2	+	1	926	c.730C>T	c.(730-732)Ctc>Ttc	p.L244F	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	244	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.L244F(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						ACCCCGAAAGCTCATCACCCA	0.493																																					p.L244F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C730T	X						.						65.0	62.0	63.0					X																	30260982		2202	4300	6502	30170903	SO:0001583	missense	4115	exon1				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.730C>T	X.37:g.30260982C>T	ENSP00000368266:p.Leu244Phe	Somatic		Capture	Illumina HiSeq	Phase_I	30170903	NM_002367	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	37	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.807975	0.31961	.	.	ENSG00000120289	ENST00000378982	T	0.07114	3.22	3.31	-2.1	0.07210	.	0.212197	0.27816	U	0.017728	T	0.09818	0.0241	L	0.55481	1.735	0.09310	N	1	P	0.46220	0.874	P	0.51324	0.666	T	0.16600	-1.0397	10	0.49607	T	0.09	.	0.3059	0.00280	0.3395:0.2693:0.1654:0.2259	.	244	O15481	MAGB4_HUMAN	F	244	ENSP00000368266:L244F	ENSP00000368266:L244F	L	+	1	0	MAGEB4	30170903	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.213000	0.09305	-0.706000	0.05028	-1.349000	0.01238	CTC		0.493	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367	
MAGEB1	4112	broad.mit.edu	37	X	30268664	30268664	+	Silent	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:30268664G>A	ENST00000378981.3	+	4	375	c.54G>A	c.(52-54)gcG>gcA	p.A18A	MAGEB1_ENST00000397550.1_Silent_p.A18A|MAGEB1_ENST00000397548.2_Silent_p.A18A	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	18								p.A18A(1)		NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						GCCGCAAGGCGCGAGAGGAGA	0.577																																					p.A18A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G54A	X						.						42.0	33.0	36.0					X																	30268664		2202	4300	6502	30178585	SO:0001819	synonymous_variant	4112	exon4				CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.54G>A	X.37:g.30268664G>A		Somatic		Capture	Illumina HiSeq	Phase_I	30178585	NM_002363	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Silent	SNP	ENST00000378981.3	37	CCDS14222.1																																																																																				0.577	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	NM_002363	
DMD	1756	broad.mit.edu	37	X	31224774	31224774	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:31224774C>A	ENST00000357033.4	-	66	9780	c.9574G>T	c.(9574-9576)Ggg>Tgg	p.G3192W	DMD_ENST00000359836.1_Missense_Mutation_p.G732W|DMD_ENST00000474231.1_Missense_Mutation_p.G732W|DMD_ENST00000541735.1_Missense_Mutation_p.G732W|DMD_ENST00000343523.2_Missense_Mutation_p.G732W|DMD_ENST00000378677.2_Missense_Mutation_p.G3188W|DMD_ENST00000378680.2_Missense_Mutation_p.G124W|DMD_ENST00000378702.4_Missense_Mutation_p.G124W|DMD_ENST00000378723.3_Missense_Mutation_p.G124W|DMD_ENST00000378707.3_Missense_Mutation_p.G732W|DMD_ENST00000361471.4_Missense_Mutation_p.G124W	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3192	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.G3188W(1)|p.G732W(1)|p.G3187W(1)|p.G1851W(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CGGATCCTCCCTGTTCGTCCC	0.383																																					p.G124W												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G370T	X						.						84.0	71.0	76.0					X																	31224774		2202	4300	6502	31134695	SO:0001583	missense	1756	exon5			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9574G>T	X.37:g.31224774C>A	ENSP00000354923:p.Gly3192Trp	Somatic		Capture	Illumina HiSeq	Phase_I	31134695	NM_004015	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.6|21.6	4.170157|4.170157	0.78452|0.78452	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680|ENST00000465285	D;D;D;D;D;D;D;D;D;D;D;D|.	0.85629|.	-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01|.	5.21|5.21	5.21|5.21	0.72293|0.72293	EF-hand domain, type 1 (1);|.	0.000000|.	0.37577|.	U|.	0.002039|.	D|D	0.86736|0.86736	0.6004|0.6004	M|M	0.93283|0.93283	3.4|3.4	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D|D	0.90316|0.90316	0.4341|0.4341	10|5	0.87932|.	D|.	0|.	.|.	17.8941|17.8941	0.88881|0.88881	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	124;3184;3192;3188;1851;1848;732;732;732;732;732;3069;124;124;124;124|.	B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1|.	.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.|.	W|M	3184;1851;1848;124;888;3188;3192;732;732;3192;3069;732;732;124;732;124;124|920	ENSP00000367997:G124W;ENSP00000350765:G888W;ENSP00000367948:G3188W;ENSP00000354923:G3192W;ENSP00000352894:G732W;ENSP00000340057:G732W;ENSP00000367979:G732W;ENSP00000444119:G732W;ENSP00000367974:G124W;ENSP00000417123:G732W;ENSP00000354464:G124W;ENSP00000367951:G124W|.	ENSP00000340057:G732W|.	G|R	-|-	1|2	0|0	DMD|DMD	31134695|31134695	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.984000|0.984000	0.73092|0.73092	7.458000|7.458000	0.80787|0.80787	2.415000|2.415000	0.81967|0.81967	0.600000|0.600000	0.82982|0.82982	GGG|AGG		0.383	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
SSX6	280657	broad.mit.edu	37	X	47978954	47978954	+	RNA	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:47978954C>T	ENST00000509958.1	+	0	103							Q7RTT6	SSX6_HUMAN	synovial sarcoma, X breakpoint 6 (pseudogene)						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.R169C(1)		large_intestine(6)|lung(4)|skin(2)|stomach(1)	13						CCACAGACTGCGTGAGAGAAA	0.507													.|||	1	0.000264901	0.0	0.0	3775	,	,		15787	0.0		0.0	False		,,,				2504	0.001				.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	X						.						229.0	222.0	225.0					X																	47978954		2198	4289	6487	47863898			280657	.			BK000686		Xp11.23	2009-09-11	2009-08-26		ENSG00000171483	ENSG00000171483			19652	pseudogene	pseudogene		300541	"""SSX family pseudogene 2"", ""synovial sarcoma, X breakpoint 6"""	SSXP2		12216073	Standard	NR_028366		Approved	psiSSX2	uc011mlv.2	Q7RTT6	OTTHUMG00000021464		X.37:g.47978954C>T		Somatic		Capture	Illumina HiSeq	Phase_I	47863898	.		Missense_Mutation	SNP	ENST00000509958.1	37		.	.	.	.	.	.	.	.	.	.	.	8.275	0.814309	0.16537	.	.	ENSG00000171483	ENST00000376932;ENST00000319275	T;T	0.69926	1.62;-0.44	2.11	1.14	0.20703	SSXRD motif (1);	0.198740	0.24965	N	0.034189	T	0.61413	0.2345	.	.	.	0.09310	N	1	P	0.47191	0.891	P	0.47376	0.545	T	0.54964	-0.8214	9	0.66056	D	0.02	.	5.1012	0.14760	0.3473:0.6527:0.0:0.0	.	169	Q7RTT6	SSX6_HUMAN	C	169;71	ENSP00000366131:R169C;ENSP00000325176:R71C	ENSP00000325176:R71C	R	+	1	0	SSX6	47863898	0.062000	0.20869	0.002000	0.10522	0.094000	0.18550	0.224000	0.17738	0.297000	0.22615	0.279000	0.19357	CGT		0.507	SSX6-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000362117.1	NR_028366	
TBC1D25	4943	broad.mit.edu	37	X	48403397	48403397	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:48403397G>A	ENST00000376771.4	+	3	715	c.374G>A	c.(373-375)cGg>cAg	p.R125Q	TBC1D25_ENST00000476141.1_Intron|TBC1D25_ENST00000537536.1_5'UTR	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	125					autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)	p.R125Q(1)		large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						GTAGATATTCGGCCCTCGGAG	0.542																																					p.R125Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G374A	X						.						79.0	66.0	70.0					X																	48403397		2203	4300	6503	48288341	SO:0001583	missense	4943	exon3			L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.374G>A	X.37:g.48403397G>A	ENSP00000365962:p.Arg125Gln	Somatic		Capture	Illumina HiSeq	Phase_I	48288341	NM_002536	Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	ENST00000376771.4	37	CCDS35242.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559346	0.65538	.	.	ENSG00000068354	ENST00000376771;ENST00000418627	T;T	0.50001	0.76;0.76	5.64	4.77	0.60923	.	0.084250	0.56097	D	0.000038	T	0.29389	0.0732	L	0.36672	1.1	0.80722	D	1	P;P;P	0.46784	0.884;0.697;0.884	B;B;B	0.29862	0.108;0.076;0.108	T	0.21280	-1.0250	10	0.62326	D	0.03	-1.5533	8.3976	0.32566	0.1055:0.0:0.8945:0.0	.	129;67;125	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	Q	125;141	ENSP00000365962:R125Q;ENSP00000402268:R141Q	ENSP00000365962:R125Q	R	+	2	0	TBC1D25	48288341	1.000000	0.71417	0.945000	0.38365	0.946000	0.59487	5.152000	0.64882	2.360000	0.80028	0.523000	0.50628	CGG		0.542	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060764.2	NM_002536	
ERAS	3266	broad.mit.edu	37	X	48687823	48687823	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:48687823C>T	ENST00000338270.1	+	1	541	c.290C>T	c.(289-291)gCa>gTa	p.A97V	PCSK1N_ENST00000478242.1_5'Flank	NM_181532.2	NP_853510.1	Q7Z444	RASE_HUMAN	ES cell expressed Ras	97					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.A97V(1)		endometrium(2)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	14						CTGGACACAGCAGGGCAGGCC	0.602																																					p.A97V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C290T	X						.						92.0	73.0	80.0					X																	48687823		2203	4300	6503	48572767	SO:0001583	missense	3266	exon1			X00419	CCDS35246.1	Xp11.23	2014-05-09	2003-07-14	2003-07-16	ENSG00000187682	ENSG00000187682			5174	protein-coding gene	gene with protein product		300437	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog pseudogene"""	HRAS2, HRASP		12774123	Standard	NM_181532		Approved		uc031tjl.1	Q7Z444	OTTHUMG00000059533	ENST00000338270.1:c.290C>T	X.37:g.48687823C>T	ENSP00000339136:p.Ala97Val	Somatic		Capture	Illumina HiSeq	Phase_I	48572767	NM_181532		Missense_Mutation	SNP	ENST00000338270.1	37	CCDS35246.1	.	.	.	.	.	.	.	.	.	.	c	11.07	1.530160	0.27387	.	.	ENSG00000187682	ENST00000338270	D	0.88818	-2.43	4.84	3.97	0.46021	Small GTP-binding protein domain (1);	0.211901	0.23969	N	0.042781	D	0.93966	0.8068	M	0.87381	2.88	0.46609	D	0.99912	D	0.76494	0.999	D	0.64595	0.927	D	0.94160	0.7413	10	0.87932	D	0	.	11.4069	0.49902	0.1818:0.8182:0.0:0.0	.	97	Q7Z444	RASE_HUMAN	V	97	ENSP00000339136:A97V	ENSP00000339136:A97V	A	+	2	0	ERAS	48572767	1.000000	0.71417	0.066000	0.19879	0.022000	0.10575	5.380000	0.66202	1.152000	0.42452	-0.229000	0.12294	GCA		0.602	ERAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132402.1	NM_181532	
KCND1	3750	broad.mit.edu	37	X	48823473	48823473	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:48823473A>C	ENST00000218176.3	-	2	2459	c.1162T>G	c.(1162-1164)Ttc>Gtc	p.F388V	KCND1_ENST00000376477.1_Missense_Mutation_p.F11V	NM_004979.4	NP_004970.3	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 1	388					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|metal ion binding (GO:0046872)	p.F388V(1)		endometrium(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	24					Dalfampridine(DB06637)	ATGGACCCGAAAATCTTGCCA	0.582																																					p.F388V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1162G	X						.						117.0	82.0	94.0					X																	48823473		2203	4300	6503	48708417	SO:0001583	missense	3750	exon2			AF166003	CCDS14314.1	Xp11.23	2012-07-05			ENSG00000102057	ENSG00000102057		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6237	protein-coding gene	gene with protein product		300281				10729221, 16382104	Standard	NM_004979		Approved	Kv4.1	uc004dlx.1	Q9NSA2	OTTHUMG00000024127	ENST00000218176.3:c.1162T>G	X.37:g.48823473A>C	ENSP00000218176:p.Phe388Val	Somatic		Capture	Illumina HiSeq	Phase_I	48708417	NM_004979	A6NEF1|B2RCG0|O75671	Missense_Mutation	SNP	ENST00000218176.3	37	CCDS14314.1	.	.	.	.	.	.	.	.	.	.	A	12.59	1.983897	0.35036	.	.	ENSG00000102057	ENST00000376477;ENST00000218176	T;D	0.98835	1.76;-5.17	5.67	4.49	0.54785	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.90242	0.6949	N	0.00473	-1.45	0.58432	D	0.999997	B	0.13145	0.007	B	0.17098	0.017	D	0.85961	0.1470	10	0.02654	T	1	.	11.0457	0.47857	0.846:0.154:0.0:0.0	.	388	Q9NSA2	KCND1_HUMAN	V	11;388	ENSP00000365660:F11V;ENSP00000218176:F388V	ENSP00000218176:F388V	F	-	1	0	KCND1	48708417	1.000000	0.71417	0.948000	0.38648	0.982000	0.71751	3.275000	0.51639	0.752000	0.32923	0.417000	0.27973	TTC		0.582	KCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060774.1	NM_004979	
GRIPAP1	56850	broad.mit.edu	37	X	48838222	48838222	+	Silent	SNP	G	G	A	rs369687653		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:48838222G>A	ENST00000376441.1	-	18	1696	c.1662C>T	c.(1660-1662)caC>caT	p.H554H	GRIPAP1_ENST00000376425.3_Silent_p.H523H|GRIPAP1_ENST00000376444.3_Silent_p.H509H|GRIPAP1_ENST00000376423.4_Intron|GRIPAP1_ENST00000473581.1_5'UTR	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	554						blood microparticle (GO:0072562)|endosome (GO:0005768)		p.H197H(1)|p.H554H(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GCTCGGCAGCGTGCTGCTCCC	0.612													N|||	2	0.000529801	0.0008	0.0	3775	,	,		13176	0.001		0.0	False		,,,				2504	0.0				p.H554H												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1662T	X						.		,	1,3830		0,1,1630,569	98.0	62.0	74.0		1662,	-10.6	0.0	X		74	0,6714		0,0,2427,1860	no	coding-synonymous,intron	GRIPAP1	NM_020137.3,NM_207672.1	,	0,1,4057,2429	AA,AG,GG,G		0.0,0.0261,0.0095	,	554/842,	48838222	1,10544	2200	4287	6487	48723166	SO:0001819	synonymous_variant	56850	exon18			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1662C>T	X.37:g.48838222G>A		Somatic		Capture	Illumina HiSeq	Phase_I	48723166	NM_020137	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Silent	SNP	ENST00000376441.1	37	CCDS35248.1																																																																																				0.612	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
AKAP4	8852	broad.mit.edu	37	X	49958792	49958792	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:49958792G>A	ENST00000376056.2	-	5	695	c.545C>T	c.(544-546)cCt>cTt	p.P182L	AKAP4_ENST00000358526.2_Missense_Mutation_p.P191L|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron|AKAP4_ENST00000376064.3_Missense_Mutation_p.P182L					A kinase (PRKA) anchor protein 4									p.P191L(1)		NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					AGGAGCTGAAGGACTTTGATT	0.428																																					p.P191L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C572T	X						.						291.0	255.0	267.0					X																	49958792		2203	4300	6503	49845532	SO:0001583	missense	8852	exon5			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.545C>T	X.37:g.49958792G>A	ENSP00000365224:p.Pro182Leu	Somatic		Capture	Illumina HiSeq	Phase_I	49845532	NM_003886		Missense_Mutation	SNP	ENST00000376056.2	37	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842769	0.51057	.	.	ENSG00000147081	ENST00000376056;ENST00000358526;ENST00000376064;ENST00000437370	T;T;T;T	0.49720	1.99;1.97;1.99;0.77	4.7	4.7	0.59300	.	0.000000	0.45867	D	0.000325	T	0.64316	0.2587	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.65125	-0.6244	9	.	.	.	-12.2375	12.1858	0.54239	0.0:0.0:1.0:0.0	.	191	Q5JQC9	AKAP4_HUMAN	L	182;191;182;182	ENSP00000365224:P182L;ENSP00000351327:P191L;ENSP00000365232:P182L;ENSP00000412279:P182L	.	P	-	2	0	AKAP4	49845532	1.000000	0.71417	0.972000	0.41901	0.849000	0.48306	4.422000	0.59854	1.920000	0.55613	0.292000	0.19580	CCT		0.428	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
MAGED1	9500	broad.mit.edu	37	X	51637809	51637809	+	Intron	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:51637809C>T	ENST00000375722.1	+	3	297				MAGED1_ENST00000494718.1_Intron|MAGED1_ENST00000326587.7_Intron|MAGED1_ENST00000375772.3_Intron|MAGED1_ENST00000375695.2_Silent_p.C44C			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)	p.C44C(1)		breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CCACTCTGTGCGACCCCCCTT	0.602										Multiple Myeloma(10;0.10)																											p.C44C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C132T	X						.						72.0	62.0	66.0					X																	51637809		2203	4300	6503	51654549	SO:0001627	intron_variant	9500	exon3			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.46-340C>T	X.37:g.51637809C>T		Somatic		Capture	Illumina HiSeq	Phase_I	51654549	NM_001005333	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Silent	SNP	ENST00000375722.1	37	CCDS14337.1																																																																																				0.602	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332	
IQSEC2	23096	broad.mit.edu	37	X	53279790	53279790	+	Silent	SNP	T	T	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:53279790T>G	ENST00000375368.5	-	4	2138	c.1938A>C	c.(1936-1938)ccA>ccC	p.P646P	IQSEC2_ENST00000375365.2_Silent_p.P451P|IQSEC2_ENST00000396435.3_Silent_p.P656P			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	646	Pro-rich.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						ctggtggggctggggctgggc	0.711																																					p.P656P												.	.	0			c.A1968C	X						.						13.0	16.0	15.0					X																	53279790		2173	4221	6394	53296515	SO:0001819	synonymous_variant	23096	exon5			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1938A>C	X.37:g.53279790T>G		None		Capture	Illumina HiSeq	Phase_I	53296515	NM_001111125	B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	ENST00000375368.5	37																																																																																					0.711	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
WNK3	65267	broad.mit.edu	37	X	54321245	54321245	+	Silent	SNP	T	T	C			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:54321245T>C	ENST00000375159.2	-	7	1433	c.1434A>G	c.(1432-1434)aaA>aaG	p.K478K	WNK3_ENST00000375169.3_Silent_p.K478K|WNK3_ENST00000354646.2_Silent_p.K478K			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	478					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.K478K(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						TAGCAACAGCTTTGGAATCAC	0.378																																					p.K478K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1434G	X						.						61.0	57.0	58.0					X																	54321245		2203	4300	6503	54337970	SO:0001819	synonymous_variant	65267	exon8			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1434A>G	X.37:g.54321245T>C		Somatic		Capture	Illumina HiSeq	Phase_I	54337970	NM_001002838	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Silent	SNP	ENST00000375159.2	37	CCDS14357.1																																																																																				0.378	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
AMER1	139285	broad.mit.edu	37	X	63411229	63411229	+	Silent	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:63411229C>T	ENST00000330258.3	-	2	2210	c.1938G>A	c.(1936-1938)cgG>cgA	p.R646R	AMER1_ENST00000403336.1_Silent_p.R646R|AMER1_ENST00000374869.3_Silent_p.R646R	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	646					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.R646R(2)									GCTTCTCCTGCCGGGCCTGGG	0.612																																					p.R646R												.	.	69	Whole gene deletion(67)|Substitution - coding silent(2)	kidney(65)|large_intestine(3)|ovary(1)	c.G1938A	X						.						26.0	25.0	25.0					X																	63411229		2203	4299	6502	63327954	SO:0001819	synonymous_variant	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1938G>A	X.37:g.63411229C>T		Somatic		Capture	Illumina HiSeq	Phase_I	63327954	NM_152424	A2IB86|Q8N885	Silent	SNP	ENST00000330258.3	37	CCDS14377.2																																																																																				0.612	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
ZC4H2	55906	broad.mit.edu	37	X	64141741	64141741	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:64141741C>T	ENST00000374839.3	-	2	287	c.181G>A	c.(181-183)Gcc>Acc	p.A61T	ZC4H2_ENST00000488608.1_5'UTR|ZC4H2_ENST00000337990.2_Missense_Mutation_p.A38T|ZC4H2_ENST00000545618.1_Missense_Mutation_p.A56T|ZC4H2_ENST00000447788.2_Missense_Mutation_p.A61T	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	61					nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)	p.A61T(1)		endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						TCCACATGGGCCATCTTCTCC	0.512																																					p.A38T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G112A	X						.						182.0	109.0	134.0					X																	64141741		2203	4300	6503	64058466	SO:0001583	missense	55906	exon2			AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.181G>A	X.37:g.64141741C>T	ENSP00000363972:p.Ala61Thr	Somatic		Capture	Illumina HiSeq	Phase_I	64058466	NM_001178032	B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	Missense_Mutation	SNP	ENST00000374839.3	37	CCDS14380.1	.	.	.	.	.	.	.	.	.	.	C	34	5.377368	0.95945	.	.	ENSG00000126970	ENST00000447788;ENST00000545618;ENST00000374839;ENST00000337990	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.77130	0.4085	M	0.62723	1.935	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.83275	0.996;0.994	T	0.78671	-0.2113	9	0.66056	D	0.02	.	16.1289	0.81412	0.0:1.0:0.0:0.0	.	61;61	B4DED0;Q9NQZ6	.;ZC4H2_HUMAN	T	61;56;61;38	.	ENSP00000338650:A38T	A	-	1	0	ZC4H2	64058466	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.555000	0.82223	2.499000	0.84300	0.529000	0.55759	GCC		0.512	ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056958.1	NM_018684	
IGBP1	3476	broad.mit.edu	37	X	69354495	69354495	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:69354495G>A	ENST00000342206.6	+	2	810	c.311G>A	c.(310-312)cGg>cAg	p.R104Q	IGBP1_ENST00000356413.4_Missense_Mutation_p.R104Q			P78318	IGBP1_HUMAN	immunoglobulin (CD79A) binding protein 1	104	Interaction with PPP2CA.				B cell activation (GO:0042113)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein dephosphorylation (GO:0035308)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dephosphorylation (GO:0035306)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microtubule-based movement (GO:0060632)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	protein phosphatase type 2A regulator activity (GO:0008601)	p.R104Q(1)		kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(2)	11						CATTTGCAGCGGGCTCGAGAA	0.473																																					p.R104Q	NSCLC(167;1189 1558 6576 8216 30387 37980 41450)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G311A	X						.						64.0	57.0	59.0					X																	69354495		2203	4300	6503	69271220	SO:0001583	missense	3476	exon3			Y08915	CCDS14396.1	Xq13.1-q13.3	2008-02-05			ENSG00000089289	ENSG00000089289			5461	protein-coding gene	gene with protein product	"""alpha 4"""	300139		IBP1		9441740	Standard	NM_001551		Approved		uc004dxw.3	P78318	OTTHUMG00000021767	ENST00000342206.6:c.311G>A	X.37:g.69354495G>A	ENSP00000363661:p.Arg104Gln	Somatic		Capture	Illumina HiSeq	Phase_I	69271220	NM_001551	Q8TAB2	Missense_Mutation	SNP	ENST00000342206.6	37	CCDS14396.1	.	.	.	.	.	.	.	.	.	.	.	5.945	0.358456	0.11239	.	.	ENSG00000089289	ENST00000342206;ENST00000356413	T;T	0.42131	0.98;0.98	4.91	-4.19	0.03835	.	1.348490	0.04536	N	0.387298	T	0.21509	0.0518	N	0.20986	0.625	0.09310	N	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.11251	-1.0595	10	0.12766	T	0.61	.	1.461	0.02395	0.4428:0.1059:0.2178:0.2335	.	104	P78318	IGBP1_HUMAN	Q	104	ENSP00000363661:R104Q;ENSP00000348784:R104Q	ENSP00000363661:R104Q	R	+	2	0	IGBP1	69271220	0.001000	0.12720	0.008000	0.14137	0.756000	0.42949	-1.278000	0.02809	-1.423000	0.02002	-1.682000	0.00735	CGG		0.473	IGBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057052.1		
ACRC	93953	broad.mit.edu	37	X	70823719	70823719	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:70823719G>A	ENST00000373695.1	+	7	1129	c.592G>A	c.(592-594)Gac>Aac	p.D198N	ACRC_ENST00000373696.3_Missense_Mutation_p.D198N			Q96QF7	ACRC_HUMAN	acidic repeat containing	198	Asp/Ser-rich.					nucleus (GO:0005634)		p.D198N(1)		autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					TGATTCATCCGACGACAACAG	0.498																																					p.D198N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G592A	X						.						320.0	257.0	278.0					X																	70823719		2203	4300	6503	70740444	SO:0001583	missense	93953	exon8			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.592G>A	X.37:g.70823719G>A	ENSP00000362799:p.Asp198Asn	Somatic		Capture	Illumina HiSeq	Phase_I	70740444	NM_052957	B9EG62	Missense_Mutation	SNP	ENST00000373695.1	37	CCDS35326.1	.	.	.	.	.	.	.	.	.	.	G	8.925	0.961998	0.18583	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.41400	1.0;1.0	.	.	.	.	.	.	.	.	T	0.18257	0.0438	N	0.03608	-0.345	0.18873	N	0.999984	D	0.65815	0.995	P	0.45310	0.476	T	0.12218	-1.0556	7	0.15066	T	0.55	.	.	.	.	.	198	Q96QF7	ACRC_HUMAN	N	198	ENSP00000362800:D198N;ENSP00000362799:D198N	ENSP00000362799:D198N	D	+	1	0	ACRC	70740444	0.322000	0.24634	0.040000	0.18447	0.040000	0.13550	1.281000	0.33214	0.054000	0.16065	0.054000	0.15206	GAC		0.498	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1		
Unknown	0	broad.mit.edu	37	X	71379770	71379770	+	IGR	SNP	G	G	A	rs201809828		TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:71379770G>A								BX119917.1 (7506 upstream) : PIN4 (21755 downstream)														p.G31R(1)									AATTGCAGACGGGCTGCGCCT	0.517																																					p.G31R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G91A	X						.	G	ARG/GLY	1,3830		0,1,1629,571	76.0	71.0	73.0		91	-0.9	0.0	X		73	0,6723		0,0,2428,1867	yes	missense	FLJ44635	NM_207422.2	125	0,1,4057,2438	AA,AG,GG,G		0.0,0.0261,0.0095	benign	31/141	71379770	1,10553	2201	4295	6496	71296495	SO:0001628	intergenic_variant	392490	exon2																															X.37:g.71379770G>A		Somatic		Capture	Illumina HiSeq	Phase_I	71296495	NM_207422		Missense_Mutation	SNP		37																																																																																				0	0.517								
RPS6KA6	27330	broad.mit.edu	37	X	83357082	83357082	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:83357082A>T	ENST00000262752.2	-	18	1746	c.1739T>A	c.(1738-1740)tTa>tAa	p.L580*	RPS6KA6_ENST00000543399.1_Nonsense_Mutation_p.L580*|RPS6KA6_ENST00000495332.1_5'UTR	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	580	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L580*(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						GCATGGAGTTAAGAGAAGTCC	0.358																																					p.L580X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T1739A	X						.						136.0	117.0	123.0					X																	83357082		2203	4300	6503	83243738	SO:0001587	stop_gained	27330	exon18			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1739T>A	X.37:g.83357082A>T	ENSP00000262752:p.Leu580*	Somatic		Capture	Illumina HiSeq	Phase_I	83243738	NM_014496	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Nonsense_Mutation	SNP	ENST00000262752.2	37	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	A	39	7.290391	0.98189	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	.	.	.	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	14.2511	0.66021	1.0:0.0:0.0:0.0	.	.	.	.	X	580	.	ENSP00000262752:L580X	L	-	2	0	RPS6KA6	83243738	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	9.069000	0.93967	1.812000	0.52913	0.425000	0.28330	TTA		0.358	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496	
CSTF2	1478	broad.mit.edu	37	X	100077309	100077309	+	Silent	SNP	A	A	G			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:100077309A>G	ENST00000372972.2	+	3	223	c.207A>G	c.(205-207)acA>acG	p.T69T	SNORA9_ENST00000365361.1_RNA|CSTF2_ENST00000415585.2_Silent_p.T69T	NM_001325.2	NP_001316.1	P33240	CSTF2_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	69	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cleavage body (GO:0071920)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.T69T(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	13						ACCAAGAGACAGCACTTAGTG	0.478																																					p.T69T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A207G	X						.						97.0	74.0	82.0					X																	100077309		2203	4300	6503	99963965	SO:0001819	synonymous_variant	1478	exon3			BC017712	CCDS14473.1	Xq22.1	2013-02-12	2002-08-29		ENSG00000101811	ENSG00000101811		"""RNA binding motif (RRM) containing"""	2484	protein-coding gene	gene with protein product		300907	"""cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD"""			1741396	Standard	XM_006724622		Approved		uc004egh.3	P33240	OTTHUMG00000022709	ENST00000372972.2:c.207A>G	X.37:g.100077309A>G		Somatic		Capture	Illumina HiSeq	Phase_I	99963965	NM_001325	Q5H951|Q6LA74|Q8N502	Silent	SNP	ENST00000372972.2	37	CCDS14473.1																																																																																				0.478	CSTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058926.1	NM_001325	
SPRY3	10251	broad.mit.edu	37	X	155004018	155004018	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina			Illumina GAIIx	TCGA-AA-3833-01A-01W-0900-09	TCGA-AA-3833-10A-01W-0900-09	g.chrX:155004018G>A	ENST00000302805.2	+	2	916	c.485G>A	c.(484-486)cGc>cAc	p.R162H		NM_005840.1	NP_005831.1	O43610	SPY3_HUMAN	sprouty homolog 3 (Drosophila)	162	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				multicellular organismal development (GO:0007275)|regulation of signal transduction (GO:0009966)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.R162H(1)				all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ACAGCAGCTCGCCCTCTCCCC	0.597																																					p.R162H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G485A	X						.						148.0	147.0	147.0					X																	155004018		2203	4296	6499	154657212	SO:0001583	missense	10251	exon2			AF041038	CCDS14769.4	Xq28 and Yq12	2008-02-05	2001-11-28		ENSG00000168939	ENSG00000168939		"""Pseudoautosomal regions / PAR2"""	11271	protein-coding gene	gene with protein product	"""antagonist of FGF signaling"""	300531	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005840		Approved	HSPRY3	uc004fnq.1	O43610	OTTHUMG00000022675	ENST00000302805.2:c.485G>A	X.37:g.155004018G>A	ENSP00000302978:p.Arg162His	Somatic		Capture	Illumina HiSeq	Phase_I	154657212	NM_005840	A8K0H8	Missense_Mutation	SNP	ENST00000302805.2	37	CCDS14769.4	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239429	0.58995	.	.	ENSG00000168939	ENST00000302805	T	0.68025	-0.3	2.71	2.71	0.32032	.	0.132292	0.52532	N	0.000073	T	0.77315	0.4112	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.71870	0.975	T	0.66862	-0.5816	9	0.72032	D	0.01	-3.7371	10.5274	0.44957	0.0:0.0:1.0:0.0	.	162	O43610	SPY3_HUMAN	H	162	ENSP00000302978:R162H	ENSP00000302978:R162H	R	+	2	0	SPRY3	154657212	1.000000	0.71417	0.993000	0.49108	0.851000	0.48451	5.092000	0.64511	1.366000	0.46076	0.279000	0.19357	CGC		0.597	SPRY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058823.2	NM_005840	
