#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MXI1	4601	broad.mit.edu	37	10	112044663	112044663	+	Missense_Mutation	SNP	T	T	A	rs149224630	byFrequency	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr10:112044663T>A	ENST00000239007.7	+	6	823	c.605T>A	c.(604-606)aTt>aAt	p.I202N	MXI1_ENST00000485566.1_3'UTR|MXI1_ENST00000332674.5_Missense_Mutation_p.I269N|MXI1_ENST00000369612.1_Missense_Mutation_p.I166N|MXI1_ENST00000393134.1_Missense_Mutation_p.I192N|MXI1_ENST00000361248.4_Missense_Mutation_p.I156N	NM_005962.4	NP_005953.4	P50539	MXI1_HUMAN	MAX interactor 1, dimerization protein	202					cytoplasmic sequestering of transcription factor (GO:0042994)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)	p.I269N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(1)	10		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)		ATCAGTGACATTGATGACCAC	0.453																																					p.I269N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T806A	10						.						139.0	111.0	121.0					10																	112044663		2203	4300	6503	112034653	SO:0001583	missense	4601	exon6			BC016678	CCDS7563.1, CCDS7564.2, CCDS31284.1	10q24-q25	2012-11-15	2012-11-15		ENSG00000119950	ENSG00000119950		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7534	protein-coding gene	gene with protein product		600020	"""MAX interacting protein 1"", ""MAX interactor 1"""			7959753	Standard	NM_130439		Approved	MXD2, MAD2, MXI, bHLHc11	uc001kyy.3	P50539	OTTHUMG00000019033	ENST00000239007.7:c.605T>A	10.37:g.112044663T>A	ENSP00000239007:p.Ile202Asn	Somatic		Capture	Illumina HiSeq	Phase_I	112034653	NM_130439	B1ANN7|D3DR25|D3DRA9|Q15887|Q6FHW2|Q96E53	Missense_Mutation	SNP	ENST00000239007.7	37	CCDS7564.2	.	.	.	.	.	.	.	.	.	.	T	11.77	1.737977	0.30774	.	.	ENSG00000119950	ENST00000332674;ENST00000361248;ENST00000239007;ENST00000369619;ENST00000393134;ENST00000369614;ENST00000369613;ENST00000369612	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	5.97	5.97	0.96955	.	0.171433	0.51477	D	0.000091	T	0.32971	0.0847	N	0.08118	0	0.44643	D	0.997626	D;P;D;D	0.67145	0.996;0.892;0.996;0.986	P;P;P;P	0.56700	0.804;0.542;0.804;0.742	T	0.19418	-1.0306	10	0.17369	T	0.5	-25.0709	16.4439	0.83910	0.0:0.0:0.0:1.0	.	192;166;202;269	B1ANN8;P50539-2;P50539;P50539-3	.;.;MXI1_HUMAN;.	N	269;156;202;192;192;166;166;166	ENSP00000331152:I269N;ENSP00000354606:I156N;ENSP00000239007:I202N;ENSP00000376842:I192N;ENSP00000358625:I166N	ENSP00000239007:I202N	I	+	2	0	MXI1	112034653	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.957000	0.70323	2.282000	0.76494	0.533000	0.62120	ATT		0.453	MXI1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050316.1	NM_130439	
SFMBT2	57713	broad.mit.edu	37	10	7239527	7239527	+	Missense_Mutation	SNP	C	C	T	rs145231461		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr10:7239527C>T	ENST00000361972.4	-	15	1771	c.1681G>A	c.(1681-1683)Gtg>Atg	p.V561M	SFMBT2_ENST00000397167.1_Missense_Mutation_p.V561M	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	561					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.V561M(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						AGAACCAGCACGCATTTGCCC	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		20960	0.0		0.001	False		,,,				2504	0.0				p.V561M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1681A	10						.	C	MET/VAL,MET/VAL	0,4406		0,0,2203	112.0	107.0	109.0		1681,1681	5.1	1.0	10	dbSNP_134	109	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	SFMBT2	NM_001018039.1,NM_001029880.2	21,21	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	561/895,561/895	7239527	2,13004	2203	4300	6503	7279533	SO:0001583	missense	57713	exon15			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1681G>A	10.37:g.7239527C>T	ENSP00000355109:p.Val561Met	Somatic		Capture	Illumina HiSeq	Phase_I	7279533	NM_001029880	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023581	0.75390	0.0	2.33E-4	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.43688	0.94;0.94	5.07	5.07	0.68467	.	0.116939	0.64402	D	0.000016	T	0.62380	0.2423	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62310	-0.6881	10	0.46703	T	0.11	.	18.4708	0.90774	0.0:1.0:0.0:0.0	.	561	Q5VUG0	SMBT2_HUMAN	M	561	ENSP00000355109:V561M;ENSP00000380353:V561M	ENSP00000355109:V561M	V	-	1	0	SFMBT2	7279533	0.998000	0.40836	1.000000	0.80357	0.950000	0.60333	3.783000	0.55409	2.355000	0.79922	0.557000	0.71058	GTG		0.478	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
KIAA1217	56243	broad.mit.edu	37	10	24833235	24833235	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr10:24833235C>T	ENST00000376454.3	+	19	5066	c.5036C>T	c.(5035-5037)aCa>aTa	p.T1679I	KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000376451.2_Missense_Mutation_p.T1362I|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000396445.1_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1679					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.T1679I(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CTCGAAAATACAATCAGTGAA	0.428																																					p.T1679I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5036T	10						.						125.0	120.0	122.0					10																	24833235		2203	4300	6503	24873241	SO:0001583	missense	56243	exon19			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.5036C>T	10.37:g.24833235C>T	ENSP00000365637:p.Thr1679Ile	Somatic		Capture	Illumina HiSeq	Phase_I	24873241	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.209998	0.39003	.	.	ENSG00000120549	ENST00000442879;ENST00000376454;ENST00000376451	T;T	0.37584	1.6;1.19	5.21	5.21	0.72293	.	0.134019	0.48286	D	0.000192	T	0.53270	0.1786	M	0.61703	1.905	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.65140	0.91;0.91;0.932	T	0.53739	-0.8396	10	0.54805	T	0.06	.	12.15	0.54044	0.0:0.9212:0.0:0.0788	.	1362;1362;1679	C9JRK3;Q5T5P2-3;Q5T5P2	.;.;SKT_HUMAN	I	1362;1679;1362	ENSP00000365637:T1679I;ENSP00000365634:T1362I	ENSP00000365634:T1362I	T	+	2	0	KIAA1217	24873241	1.000000	0.71417	0.120000	0.21714	0.201000	0.24016	5.732000	0.68563	2.437000	0.82529	0.655000	0.94253	ACA		0.428	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
SFTPD	6441	broad.mit.edu	37	10	81697823	81697823	+	Missense_Mutation	SNP	C	C	T	rs548930059		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr10:81697823C>T	ENST00000372292.3	-	8	953	c.913G>A	c.(913-915)Gta>Ata	p.V305I		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	305	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)	p.V305I(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			TTCTTAGCTACGACCAGCTGT	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19753	0.0		0.0	False		,,,				2504	0.0				p.V305I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G913A	10						.						133.0	128.0	130.0					10																	81697823		2203	4300	6503	81687803	SO:0001583	missense	6441	exon8			L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.913G>A	10.37:g.81697823C>T	ENSP00000361366:p.Val305Ile	Somatic		Capture	Illumina HiSeq	Phase_I	81687803	NM_003019	Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Missense_Mutation	SNP	ENST00000372292.3	37	CCDS7362.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.472240	0.26423	.	.	ENSG00000133661	ENST00000372292	T	0.18960	2.18	5.63	-7.42	0.01388	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.613880	0.03415	N	0.205430	T	0.10680	0.0261	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21381	-1.0247	10	0.14656	T	0.56	1.8802	3.832	0.08877	0.1145:0.4231:0.2169:0.2456	.	305	P35247	SFTPD_HUMAN	I	305	ENSP00000361366:V305I	ENSP00000361366:V305I	V	-	1	0	SFTPD	81687803	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-1.949000	0.01532	-1.458000	0.01916	-0.383000	0.06682	GTA		0.562	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049011.1		
GFRA1	2674	broad.mit.edu	37	10	117856227	117856227	+	Silent	SNP	A	A	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr10:117856227A>T	ENST00000355422.6	-	7	1369	c.819T>A	c.(817-819)tcT>tcA	p.S273S	GFRA1_ENST00000439649.3_Silent_p.S268S|GFRA1_ENST00000369236.1_Silent_p.S268S|GFRA1_ENST00000544592.1_Silent_p.S152S	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	273					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)	p.S268S(1)		endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		AGCTGCTGACAGACCTTGACT	0.493																																					p.S268S	Ovarian(128;329 1725 45498 46808 50759)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T804A	10						.						59.0	58.0	59.0					10																	117856227		2203	4300	6503	117846217	SO:0001819	synonymous_variant	2674	exon6			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.819T>A	10.37:g.117856227A>T		Somatic		Capture	Illumina HiSeq	Phase_I	117846217	NM_001145453	A8KA21|O15507|O43912	Silent	SNP	ENST00000355422.6	37	CCDS44481.1																																																																																				0.493	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	
RAB3IL1	5866	broad.mit.edu	37	11	61669973	61669973	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr11:61669973G>A	ENST00000394836.2	-	8	1097	c.940C>T	c.(940-942)Cga>Tga	p.R314*	RAB3IL1_ENST00000301773.5_Nonsense_Mutation_p.R288*	NM_013401.2	NP_037533.2	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	314					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R314*(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(4)|skin(3)|urinary_tract(1)	14						AGCCGGATTCGGTGGCGGCAG	0.632																																					p.R314X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C940T	11						.						40.0	39.0	39.0					11																	61669973		2200	4299	6499	61426549	SO:0001587	stop_gained	5866	exon8			AF084557	CCDS8014.1, CCDS60809.1	11q12.2	2008-02-01			ENSG00000167994	ENSG00000167994			9780	protein-coding gene	gene with protein product							Standard	NM_013401		Approved		uc001nso.4	Q8TBN0	OTTHUMG00000167524	ENST00000394836.2:c.940C>T	11.37:g.61669973G>A	ENSP00000378313:p.Arg314*	Somatic		Capture	Illumina HiSeq	Phase_I	61426549	NM_013401	Q86V32|Q9P1Q8	Nonsense_Mutation	SNP	ENST00000394836.2	37	CCDS8014.1	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775649	0.70107	.	.	ENSG00000167994	ENST00000394836;ENST00000301773	.	.	.	4.25	4.25	0.50352	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.49	17.1542	0.86785	0.0:0.0:1.0:0.0	.	.	.	.	X	314;288	.	ENSP00000301773:R288X	R	-	1	2	RAB3IL1	61426549	1.000000	0.71417	1.000000	0.80357	0.346000	0.29079	4.451000	0.60047	2.304000	0.77564	0.561000	0.74099	CGA		0.632	RAB3IL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394917.1	NM_013401	
INCENP	3619	broad.mit.edu	37	11	61906404	61906404	+	Silent	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr11:61906404G>A	ENST00000394818.3	+	7	1420	c.1218G>A	c.(1216-1218)acG>acA	p.T406T	INCENP_ENST00000278849.4_Silent_p.T406T	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	406					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)		p.T406T(2)		breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						ACAATGACACGGAGATTGCCA	0.582																																					p.T406T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1218A	11						.						134.0	122.0	126.0					11																	61906404		2202	4299	6501	61662980	SO:0001819	synonymous_variant	3619	exon7			AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.1218G>A	11.37:g.61906404G>A		Somatic		Capture	Illumina HiSeq	Phase_I	61662980	NM_001040694	A8MQD2|Q5Y192	Silent	SNP	ENST00000394818.3	37	CCDS44624.1																																																																																				0.582	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
MBD6	114785	broad.mit.edu	37	12	57921001	57921002	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr12:57921001_57921002insC	ENST00000355673.3	+	7	2429_2430	c.2073_2074insC	c.(2074-2076)cccfs	p.P692fs	MBD6_ENST00000431731.2_Frame_Shift_Ins_p.P692fs	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	692	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.Q694fs*23(2)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						CCTCGGGGACACCCCCCCAGGT	0.559																																					p.T691fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.2073_2074insC	12						.																																			56207269	SO:0001589	frameshift_variant	114785	exon7			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.2080dupC	12.37:g.57921008_57921008dupC	ENSP00000347896:p.Pro692fs	Somatic		Capture	Illumina HiSeq	Phase_I	56207268	NM_052897	Q8N3M0|Q8NA81|Q96Q00	Frame_Shift_Ins	INS	ENST00000355673.3	37	CCDS8944.1																																																																																				0.559	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1		
ERP29	10961	broad.mit.edu	37	12	112457580	112457580	+	Silent	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr12:112457580C>T	ENST00000261735.3	+	2	315	c.165C>T	c.(163-165)ttC>ttT	p.F55F	ERP29_ENST00000455836.1_Intron|ERP29_ENST00000546477.1_5'UTR	NM_006817.3	NP_006808.1	P30040	ERP29_HUMAN	endoplasmic reticulum protein 29	55					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)|protein secretion (GO:0009306)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein disulfide isomerase activity (GO:0003756)	p.F55F(1)		cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						AAAGCAAGTTCGTCTTGGTGA	0.532																																					p.F55F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C165T	12						.						108.0	93.0	98.0					12																	112457580		2203	4300	6503	110941963	SO:0001819	synonymous_variant	10961	exon2			X94910	CCDS9158.1, CCDS44977.1	12q24.13	2011-10-19	2005-10-05	2005-10-05		ENSG00000089248		"""Protein disulfide isomerases"""	13799	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 9"""	602287	"""chromosome 12 open reading frame 8"""	C12orf8		9738895, 9037184	Standard	NM_006817		Approved	ERp28, ERp31, ERp29, PDI-DB, PDIA9	uc001ttk.1	P30040	OTTHUMG00000169637	ENST00000261735.3:c.165C>T	12.37:g.112457580C>T		Somatic		Capture	Illumina HiSeq	Phase_I	110941963	NM_006817	C9J183|Q3MJC3|Q6FHT4	Silent	SNP	ENST00000261735.3	37	CCDS9158.1																																																																																				0.532	ERP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405200.1		
VWF	7450	broad.mit.edu	37	12	6127614	6127614	+	Missense_Mutation	SNP	A	A	G	rs61750593		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr12:6127614A>G	ENST00000261405.5	-	28	5224	c.4970T>C	c.(4969-4971)cTc>cCc	p.L1657P		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1657	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.L1657P(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CTCTCGGGGGAGCGTCTCAAA	0.632																																					p.L1657P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4970C	12						.						39.0	36.0	37.0					12																	6127614		2203	4300	6503	5997875	SO:0001583	missense	7450	exon28				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.4970T>C	12.37:g.6127614A>G	ENSP00000261405:p.Leu1657Pro	Somatic		Capture	Illumina HiSeq	Phase_I	5997875	NM_000552	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	.	11.63	1.695671	0.30052	.	.	ENSG00000110799	ENST00000261405	D	0.84146	-1.81	5.03	5.03	0.67393	von Willebrand factor, type A (2);	0.000000	0.40064	N	0.001199	D	0.93785	0.8013	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95101	0.8230	10	0.87932	D	0	.	14.1023	0.65065	1.0:0.0:0.0:0.0	.	1657	P04275	VWF_HUMAN	P	1657	ENSP00000261405:L1657P	ENSP00000261405:L1657P	L	-	2	0	VWF	5997875	0.999000	0.42202	0.391000	0.26233	0.169000	0.22640	4.745000	0.62125	2.114000	0.64651	0.454000	0.30748	CTC		0.632	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
ST8SIA1	6489	broad.mit.edu	37	12	22487107	22487107	+	Silent	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr12:22487107C>T	ENST00000396037.4	-	1	541	c.60G>A	c.(58-60)gcG>gcA	p.A20A	ST8SIA1_ENST00000539510.1_De_novo_Start_OutOfFrame|ST8SIA1_ENST00000381424.3_Silent_p.A20A|ST8SIA1_ENST00000404299.3_Silent_p.A20A|ST8SIA1_ENST00000536558.1_Intron	NM_003034.3	NP_003025.1	Q92185	SIA8A_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1	20					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|glycosphingolipid biosynthetic process (GO:0006688)|positive regulation of cell proliferation (GO:0008284)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)	p.A20A(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25						GGAACTTCCACGCCAGTACAG	0.716																																					p.A20A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G60A	12						.						65.0	65.0	65.0					12																	22487107		2203	4300	6503	22378374	SO:0001819	synonymous_variant	6489	exon1			L32867	CCDS8697.1	12p12.1-p11.2	2013-03-01	2003-01-14	2005-02-07	ENSG00000111728	ENSG00000111728	2.4.99.8	"""Sialyltransferases"""	10869	protein-coding gene	gene with protein product	"""ST8Sia I"""	601123	"""sialyltransferase 8 (alpha-N-acetylneuraminate: alpha-2,8-sialytransferase, GD3 synthase) A"""	SIAT8, SIAT8A		7901202	Standard	NM_003034		Approved		uc001rfo.4	Q92185	OTTHUMG00000169098	ENST00000396037.4:c.60G>A	12.37:g.22487107C>T		Somatic		Capture	Illumina HiSeq	Phase_I	22378374	NM_003034	A8K4H6|Q17RL0|Q6PZN5|Q93064	De_novo_Start_OutOfFrame	SNP	ENST00000396037.4	37	CCDS8697.1																																																																																				0.716	ST8SIA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402245.2	NM_003034	
KRAS	3845	broad.mit.edu	37	12	25398281	25398281	+	Missense_Mutation	SNP	C	C	T	rs112445441		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr12:25398281C>T	ENST00000256078.4	-	2	101	c.38G>A	c.(37-39)gGc>gAc	p.G13D	KRAS_ENST00000556131.1_Missense_Mutation_p.G13D|KRAS_ENST00000311936.3_Missense_Mutation_p.G13D|KRAS_ENST00000557334.1_Missense_Mutation_p.G13D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	13			G -> D (in a breast carcinoma cell line and GASC; somatic mutation). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:3627975}.|G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway). {ECO:0000269|PubMed:16247081}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G13D(3223)|p.G13V(33)|p.G13A(28)|p.G13E(3)|p.G13I(1)|p.G13N(1)|p.G13_V14>DI(1)|p.G13R(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGCCTACGCCACCAGCTCC	0.338	G13D(DLD1_LARGE_INTESTINE)|G13D(DV90_LUNG)|G13D(HCT116_LARGE_INTESTINE)|G13D(HCT15_LARGE_INTESTINE)|G13D(LOVO_LARGE_INTESTINE)|G13D(MDAMB231_BREAST)|G13D(NCIH647_LUNG)|G13D(NCIH747_LARGE_INTESTINE)|G13D(NOMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G13D(T84_LARGE_INTESTINE)|G13D(TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G13D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,lung,NS,Substitution - Missense,-1 	.	3291	Substitution - Missense(3290)|Complex - compound substitution(1)	large_intestine(2808)|haematopoietic_and_lymphoid_tissue(94)|lung(92)|endometrium(54)|soft_tissue(38)|ovary(38)|stomach(32)|pancreas(30)|thyroid(27)|biliary_tract(21)|prostate(20)|breast(10)|cervix(4)|gastrointestinal_tract_(site_indeterminate)(3)|upper_aerodigestive_tract(3)|urinary_tract(3)|liver(3)|salivary_gland(3)|small_intestine(3)|oesophagus(2)|skin(1)|genital_tract(1)|bone(1)	c.G38A	12						.						88.0	78.0	82.0					12																	25398281		2203	4300	6503	25289548	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.38G>A	12.37:g.25398281C>T	ENSP00000256078:p.Gly13Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289548	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867862	0.91587	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	D;T;T;T	0.82803	-1.65;-0.7;-0.7;-0.7	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.93062	3.375	0.80722	D	1	B;P	0.43314	0.215;0.803	B;P	0.46172	0.175;0.506	D	0.92106	0.5692	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	13;13	P01116-2;P01116	.;RASK_HUMAN	D	13	ENSP00000308495:G13D;ENSP00000452512:G13D;ENSP00000256078:G13D;ENSP00000451856:G13D	ENSP00000256078:G13D	G	-	2	0	KRAS	25289548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGC		0.338	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TMEM132D	121256	broad.mit.edu	37	12	129558801	129558801	+	Silent	SNP	C	C	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr12:129558801C>A	ENST00000422113.2	-	9	3245	c.2919G>T	c.(2917-2919)ctG>ctT	p.L973L	TMEM132D_ENST00000389441.4_Silent_p.L511L	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	973					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.L973L(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GATTCTCCAACAGCTCTGTCC	0.473																																					p.L973L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2919T	12						.						124.0	111.0	115.0					12																	129558801		2203	4300	6503	128124754	SO:0001819	synonymous_variant	121256	exon9			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2919G>T	12.37:g.129558801C>A		Somatic		Capture	Illumina HiSeq	Phase_I	128124754	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	CCDS9266.1																																																																																				0.473	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
RXFP2	122042	broad.mit.edu	37	13	32356873	32356873	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr13:32356873T>A	ENST00000298386.2	+	11	989	c.918T>A	c.(916-918)aaT>aaA	p.N306K	RXFP2_ENST00000380314.1_Intron	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	306					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)	p.N306K(1)		cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		CATTAAAAAATTTAGGAGAAC	0.368																																					p.N306K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T918A	13						.						57.0	58.0	58.0					13																	32356873		2203	4300	6503	31254873	SO:0001583	missense	122042	exon11			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.918T>A	13.37:g.32356873T>A	ENSP00000298386:p.Asn306Lys	Somatic		Capture	Illumina HiSeq	Phase_I	31254873	NM_130806	B1ALE9|Q3KU23	Missense_Mutation	SNP	ENST00000298386.2	37	CCDS9342.1	.	.	.	.	.	.	.	.	.	.	T	2.890	-0.229905	0.06022	.	.	ENSG00000133105	ENST00000298386	T	0.59502	0.26	5.82	3.39	0.38822	.	0.349343	0.36815	N	0.002394	T	0.26231	0.0640	N	0.04686	-0.185	0.80722	D	1	B	0.10296	0.003	B	0.14023	0.01	T	0.18429	-1.0337	10	0.02654	T	1	.	5.0695	0.14600	0.0:0.1503:0.1599:0.6898	.	306	Q8WXD0	RXFP2_HUMAN	K	306	ENSP00000298386:N306K	ENSP00000298386:N306K	N	+	3	2	RXFP2	31254873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.097000	0.30988	1.014000	0.39417	0.533000	0.62120	AAT		0.368	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
PCDH9	5101	broad.mit.edu	37	13	67799911	67799911	+	Missense_Mutation	SNP	C	C	T	rs147427572		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr13:67799911C>T	ENST00000377865.2	-	1	2796	c.2662G>A	c.(2662-2664)Gaa>Aaa	p.E888K	PCDH9_ENST00000456367.1_Missense_Mutation_p.E888K|PCDH9_ENST00000328454.5_Missense_Mutation_p.E888K|PCDH9_ENST00000544246.1_Missense_Mutation_p.E888K|PCDH9_ENST00000377861.3_Missense_Mutation_p.E888K			Q9HC56	PCDH9_HUMAN	protocadherin 9	888					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E888K(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TTGGACTCTTCGATAGTAACA	0.433																																					p.E888K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2662A	13						.	C	LYS/GLU,LYS/GLU	0,4406		0,0,2203	99.0	105.0	103.0		2662,2662	5.9	1.0	13	dbSNP_134	103	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PCDH9	NM_020403.4,NM_203487.2	56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	888/1204,888/1238	67799911	1,13005	2203	4300	6503	66697912	SO:0001583	missense	5101	exon2			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.2662G>A	13.37:g.67799911C>T	ENSP00000367096:p.Glu888Lys	Somatic		Capture	Illumina HiSeq	Phase_I	66697912	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.716261	0.68844	0.0	1.16E-4	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	5.87	5.87	0.94306	Protocadherin (1);	0.000000	0.85682	D	0.000000	T	0.54464	0.1860	M	0.64997	1.995	0.80722	D	1	D;D;D;D	0.76494	0.999;0.995;0.999;0.999	D;P;P;D	0.65573	0.936;0.887;0.894;0.936	T	0.49428	-0.8941	10	0.52906	T	0.07	.	20.1957	0.98242	0.0:1.0:0.0:0.0	.	888;888;888;888	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	K	888	ENSP00000442186:E888K;ENSP00000367096:E888K;ENSP00000401699:E888K;ENSP00000332060:E888K;ENSP00000367092:E888K	ENSP00000332060:E888K	E	-	1	0	PCDH9	66697912	1.000000	0.71417	0.984000	0.44739	0.959000	0.62525	7.815000	0.86186	2.780000	0.95670	0.655000	0.94253	GAA		0.433	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
DMXL2	23312	broad.mit.edu	37	15	51778315	51778315	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr15:51778315C>T	ENST00000251076.5	-	23	5724	c.5437G>A	c.(5437-5439)Gac>Aac	p.D1813N	DMXL2_ENST00000543779.2_Missense_Mutation_p.D1813N|DMXL2_ENST00000449909.3_Missense_Mutation_p.D1177N|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1813						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.D1813N(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		AGTAATGTGTCCAAGGCTCGG	0.398																																					p.D1813N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5437A	15						.						106.0	99.0	101.0					15																	51778315		2196	4293	6489	49565607	SO:0001583	missense	23312	exon23			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.5437G>A	15.37:g.51778315C>T	ENSP00000251076:p.Asp1813Asn	Somatic		Capture	Illumina HiSeq	Phase_I	49565607	NM_015263	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.567333	0.28003	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.40756	1.02;1.02;1.02	5.51	4.58	0.56647	.	0.042971	0.85682	D	0.000000	T	0.25344	0.0616	N	0.19112	0.55	0.58432	D	0.999999	B;B;B	0.25048	0.003;0.117;0.049	B;B;B	0.22601	0.008;0.04;0.024	T	0.05750	-1.0866	10	0.05721	T	0.95	.	15.2413	0.73471	0.0:0.9289:0.0:0.0711	.	1813;1177;1813	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	N	1813;1813;1177	ENSP00000251076:D1813N;ENSP00000441858:D1813N;ENSP00000400855:D1177N	ENSP00000251076:D1813N	D	-	1	0	DMXL2	49565607	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.852000	0.69488	2.734000	0.93682	0.650000	0.86243	GAC		0.398	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
HOMER2	9455	broad.mit.edu	37	15	83523443	83523443	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr15:83523443T>C	ENST00000304231.8	-	6	829	c.637A>G	c.(637-639)Agg>Ggg	p.R213G	HOMER2_ENST00000399166.2_Intron|HOMER2_ENST00000426485.1_Intron|HOMER2_ENST00000450735.2_Missense_Mutation_p.R202G	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	213					behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.R213G(1)		cervix(1)|endometrium(2)|lung(6)	9						GAGAACTGCCTCTTCCACTGC	0.617																																					p.R202G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A604G	15						.						47.0	53.0	51.0					15																	83523443		2179	4272	6451	81320497	SO:0001583	missense	9455	exon6			AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.637A>G	15.37:g.83523443T>C	ENSP00000305632:p.Arg213Gly	Somatic		Capture	Illumina HiSeq	Phase_I	81320497	NM_004839	O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Missense_Mutation	SNP	ENST00000304231.8	37	CCDS45334.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.448835	0.63178	.	.	ENSG00000103942	ENST00000304231;ENST00000450735	T;D	0.82255	1.94;-1.59	5.47	-4.05	0.03998	.	0.228496	0.41823	D	0.000804	T	0.79028	0.4377	L	0.54323	1.7	0.80722	D	1	B;B	0.22604	0.066;0.072	B;B	0.21708	0.036;0.02	T	0.62153	-0.6914	10	0.59425	D	0.04	.	20.3578	0.98842	0.0:0.0:0.7703:0.2297	.	202;213	Q9NSB8-2;Q9NSB8	.;HOME2_HUMAN	G	213;202	ENSP00000305632:R213G;ENSP00000407634:R202G	ENSP00000305632:R213G	R	-	1	2	HOMER2	81320497	0.975000	0.34042	0.608000	0.28969	0.995000	0.86356	1.193000	0.32162	-1.070000	0.03149	-0.313000	0.08912	AGG		0.617	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418689.1		
PHKB	5257	broad.mit.edu	37	16	47533770	47533770	+	Silent	SNP	C	C	T	rs139431568	byFrequency	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr16:47533770C>T	ENST00000323584.5	+	3	294	c.270C>T	c.(268-270)tgC>tgT	p.C90C	PHKB_ENST00000299167.8_Silent_p.C90C|PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000455779.1_Silent_p.C83C|PHKB_ENST00000566044.1_Silent_p.C83C	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	90					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.C90C(2)|p.C83C(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GCCTATACTGCGCTGCTGGGG	0.507													C|||	3	0.000599042	0.0	0.0014	5008	,	,		19579	0.0		0.002	False		,,,				2504	0.0				p.C83C												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C249T	16						.	C	,	0,4402		0,0,2201	137.0	124.0	128.0		270,249	0.2	1.0	16	dbSNP_134	128	12,8588	8.4+/-32.0	0,12,4288	no	coding-synonymous,coding-synonymous	PHKB	NM_000293.2,NM_001031835.2	,	0,12,6489	TT,TC,CC		0.1395,0.0,0.0923	,	90/1094,83/1087	47533770	12,12990	2201	4300	6501	46091271	SO:0001819	synonymous_variant	5257	exon4				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.270C>T	16.37:g.47533770C>T		Somatic		Capture	Illumina HiSeq	Phase_I	46091271	NM_001031835	Q8N4T5	Silent	SNP	ENST00000323584.5	37	CCDS10729.1																																																																																				0.507	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
GNAO1	2775	broad.mit.edu	37	16	56370728	56370728	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr16:56370728G>A	ENST00000262493.6	+	6	1525	c.679G>A	c.(679-681)Gcg>Acg	p.A227T	GNAO1_ENST00000262494.7_Missense_Mutation_p.A227T	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O	227					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)	p.A227T(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				TTTCTGTGTCGCGCTCAGCGG	0.632																																					p.A227T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G679A	16						.						84.0	63.0	70.0					16																	56370728		2197	4300	6497	54928229	SO:0001583	missense	2775	exon6				CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.679G>A	16.37:g.56370728G>A	ENSP00000262493:p.Ala227Thr	Somatic		Capture	Illumina HiSeq	Phase_I	54928229	NM_138736	P29777|Q8TD72|Q9UMV4	Missense_Mutation	SNP	ENST00000262493.6	37	CCDS10756.1	.	.	.	.	.	.	.	.	.	.	G	36	5.716481	0.96830	.	.	ENSG00000087258	ENST00000262493;ENST00000262494	D;D	0.83335	-1.71;-1.71	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.94958	0.8369	H	0.98594	4.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.955	D	0.97007	0.9733	10	0.87932	D	0	.	18.9579	0.92665	0.0:0.0:1.0:0.0	.	227;227	P09471;P09471-2	GNAO_HUMAN;.	T	227	ENSP00000262493:A227T;ENSP00000262494:A227T	ENSP00000262493:A227T	A	+	1	0	GNAO1	54928229	1.000000	0.71417	0.997000	0.53966	0.948000	0.59901	9.856000	0.99531	2.465000	0.83290	0.563000	0.77884	GCG		0.632	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256981.2	NM_020988	
CDH13	1012	broad.mit.edu	37	16	83065765	83065765	+	Missense_Mutation	SNP	C	C	T	rs199539898		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr16:83065765C>T	ENST00000566620.1	+	3	598	c.308C>T	c.(307-309)gCg>gTg	p.A103V	CDH13_ENST00000428848.3_Missense_Mutation_p.A103V|CDH13_ENST00000268613.10_Missense_Mutation_p.A150V|CDH13_ENST00000565636.1_Missense_Mutation_p.A103V|CDH13_ENST00000431540.3_Missense_Mutation_p.A103V|CDH13_ENST00000446376.2_Missense_Mutation_p.A103V|CDH13_ENST00000569454.1_3'UTR	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	103			A -> V (in a patient with amyotrophic lateral sclerosis). {ECO:0000269|PubMed:21220648}.		adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)	p.A103V(3)		large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		ACCCCCCATGCGGAAGATATG	0.512																																					p.A103V												.	.	3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)	c.C308T	16						.						60.0	60.0	60.0					16																	83065765		1942	4124	6066	81623266	SO:0001583	missense	1012	exon3			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.308C>T	16.37:g.83065765C>T	ENSP00000454435:p.Ala103Val	Somatic		Capture	Illumina HiSeq	Phase_I	81623266	NM_001257	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	ENST00000566620.1	37	CCDS58486.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.142393	0.37825	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143;ENST00000431540;ENST00000446376	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.49	3.54	0.40534	Cadherin prodomain-like (1);Cadherin-like (1);	.	.	.	.	T	0.32164	0.0820	L	0.33485	1.01	0.23043	N	0.998384	B;B;B;B	0.32731	0.137;0.382;0.028;0.202	B;B;B;B	0.33690	0.041;0.168;0.021;0.034	T	0.12941	-1.0528	9	0.24483	T	0.36	.	11.3132	0.49377	0.0:0.8524:0.0:0.1476	.	103;150;103;103	B7Z590;B7Z9B1;A8W477;P55290	.;.;.;CAD13_HUMAN	V	150;103;103;103;103	ENSP00000268613:A150V;ENSP00000394557:A103V;ENSP00000408632:A103V;ENSP00000388804:A103V	ENSP00000268613:A150V	A	+	2	0	CDH13	81623266	0.985000	0.35326	0.651000	0.29564	0.101000	0.19017	2.800000	0.47900	0.800000	0.34041	0.491000	0.48974	GCG		0.512	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257	
USP6	9098	broad.mit.edu	37	17	5035617	5035618	+	Intron	INS	-	-	G			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr17:5035617_5035618insG	ENST00000574788.1	+	12	2385				USP6_ENST00000250066.6_Intron|USP6_ENST00000304328.5_Intron|USP6_ENST00000572429.1_3'UTR|USP6_ENST00000332776.4_Intron			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6						cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CAGTCCTTTCTGGGGGTCGGCT	0.649			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																.			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	.	0			.	17						.																																			4976342	SO:0001627	intron_variant	9098	.			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.156-73->G	17.37:g.5035622_5035622dupG		None		Capture	Illumina HiSeq	Phase_I	4976341	.	Q15634|Q86WP6|Q8IWT4	Frame_Shift_Ins	INS	ENST00000574788.1	37	CCDS11069.2																																																																																				0.649	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
KRTAP1-3	81850	broad.mit.edu	37	17	39190779	39190779	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr17:39190779T>C	ENST00000344363.5	-	1	328	c.295A>G	c.(295-297)Agt>Ggt	p.S99G		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	109						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)	p.S99G(2)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ACAGCTCCACTGCTGCCCTCC	0.652																																					p.S99G												.	.	2	Substitution - Missense(2)	lung(1)|kidney(1)	c.A295G	17						.						17.0	22.0	21.0					17																	39190779		2007	4147	6154	36444305	SO:0001583	missense	81850	exon1			AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.295A>G	17.37:g.39190779T>C	ENSP00000344420:p.Ser99Gly	None		Capture	Illumina HiSeq	Phase_I	36444305	NM_030966	Q07628|Q8IUG0|Q9BYS2	Missense_Mutation	SNP	ENST00000344363.5	37	CCDS42323.1	.	.	.	.	.	.	.	.	.	.	T	12.64	1.997470	0.35226	.	.	ENSG00000221880	ENST00000344363	T	0.38077	1.16	4.93	-9.87	0.00470	.	.	.	.	.	T	0.25754	0.0627	.	.	.	0.09310	N	0.999999	B	0.29253	0.239	B	0.34038	0.174	T	0.43956	-0.9359	8	0.59425	D	0.04	.	10.9204	0.47161	0.1862:0.0:0.0722:0.7416	.	109	Q8IUG1	KRA13_HUMAN	G	99	ENSP00000344420:S99G	ENSP00000344420:S99G	S	-	1	0	KRTAP1-3	36444305	0.028000	0.19301	0.006000	0.13384	0.225000	0.24961	0.193000	0.17116	-1.956000	0.01022	-0.302000	0.09304	AGT		0.652	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257687.1		
TP53	7157	broad.mit.edu	37	17	7574023	7574023	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr17:7574023delC	ENST00000269305.4	-	10	1193	c.1004delG	c.(1003-1005)cgtfs	p.R335fs	TP53_ENST00000359597.4_Intron|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000445888.2_Frame_Shift_Del_p.R335fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	335	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> G (in a sporadic cancer; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R335fs*2(2)|p.R335fs*10(2)|p.R335L(1)|p.?(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAGCGCTCACGCCCACGGAT	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R335fs	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	15	Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - Frameshift(2)|Substitution - Missense(1)|Unknown(1)	large_intestine(5)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|upper_aerodigestive_tract(1)|stomach(1)	c.1004delG	17						.						53.0	42.0	46.0					17																	7574023		2203	4300	6503	7514748	SO:0001589	frameshift_variant	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1004delG	17.37:g.7574023delC	ENSP00000269305:p.Arg335fs	Somatic		Capture	Illumina HiSeq	Phase_I	7514748	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																				0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRTAP4-3	85290	broad.mit.edu	37	17	39324104	39324104	+	Silent	SNP	A	A	G	rs368619075		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr17:39324104A>G	ENST00000391356.2	-	1	320	c.321T>C	c.(319-321)tcT>tcC	p.S107S		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	107	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].		Missing (in allele KAP3-v2). {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S107S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			TGCAGCAACTAGAAATGCAGC	0.597																																					p.S107S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T321C	17						.						18.0	23.0	21.0					17																	39324104		2109	4252	6361	36577630	SO:0001819	synonymous_variant	85290	exon1			AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.321T>C	17.37:g.39324104A>G		Somatic		Capture	Illumina HiSeq	Phase_I	36577630	NM_033187		Silent	SNP	ENST00000391356.2	37	CCDS42331.1																																																																																				0.597	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
SMAD2	4087	broad.mit.edu	37	18	45371712	45371712	+	Splice_Site	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr18:45371712G>A	ENST00000402690.2	-	10	1673	c.1279C>T	c.(1279-1281)Cga>Tga	p.R427*	SMAD2_ENST00000591214.1_Missense_Mutation_p.R397W|SMAD2_ENST00000262160.6_Splice_Site_p.R427*|SMAD2_ENST00000586040.1_Splice_Site_p.R397*|SMAD2_ENST00000356825.4_Splice_Site_p.R397*	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	427	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.R427*(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						ATTTCATACCGGTATTCTGCT	0.368																																					p.R397X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1189T	18						.						105.0	102.0	103.0					18																	45371712		2203	4300	6503	43625710	SO:0001630	splice_region_variant	4087	exon9			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.1280+1C>T	18.37:g.45371712G>A		Somatic		Capture	Illumina HiSeq	Phase_I	43625710	NM_001135937		Nonsense_Mutation	SNP	ENST00000402690.2	37	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	G	40	8.182190	0.98693	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	.	.	.	5.53	2.32	0.28847	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2651	0.60128	0.0:0.0:0.298:0.702	.	.	.	.	X	427;397;427	.	ENSP00000262160:R427X	R	-	1	2	SMAD2	43625710	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	2.215000	0.42862	0.636000	0.30508	0.650000	0.86243	CGA		0.368	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901	Nonsense_Mutation
DCC	1630	broad.mit.edu	37	18	50432615	50432615	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr18:50432615G>A	ENST00000442544.2	+	3	1230	c.614G>A	c.(613-615)gGg>gAg	p.G205E	DCC_ENST00000412726.1_Missense_Mutation_p.G53E	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	205	Ig-like C2-type 2.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.G205E(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CTCCAACCGGGGGACATTGGA	0.502																																					p.G205E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G614A	18						.						82.0	79.0	80.0					18																	50432615		2203	4300	6503	48686613	SO:0001583	missense	1630	exon3			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.614G>A	18.37:g.50432615G>A	ENSP00000389140:p.Gly205Glu	Somatic		Capture	Illumina HiSeq	Phase_I	48686613	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420892	0.42918	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.34667	1.35;1.35	5.71	5.71	0.89125	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.152214	0.46758	D	0.000266	T	0.18800	0.0451	N	0.02854	-0.475	0.80722	D	1	B;B	0.26483	0.018;0.15	B;B	0.31290	0.019;0.127	T	0.19031	-1.0318	10	0.19590	T	0.45	.	14.2616	0.66088	0.0:0.1493:0.8507:0.0	.	53;205	E7EQM8;P43146	.;DCC_HUMAN	E	205;138;53	ENSP00000389140:G205E;ENSP00000397322:G53E	ENSP00000304146:G138E	G	+	2	0	DCC	48686613	1.000000	0.71417	0.636000	0.29352	0.862000	0.49288	5.272000	0.65559	2.688000	0.91661	0.655000	0.94253	GGG		0.502	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
DSEL	92126	broad.mit.edu	37	18	65180919	65180919	+	Silent	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr18:65180919C>T	ENST00000310045.7	-	2	2430	c.957G>A	c.(955-957)aaG>aaA	p.K319K	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	309					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.K319K(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				AAAAGTGCATCTTTAACCAGT	0.408																																					p.K319K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G957A	18						.						71.0	77.0	75.0					18																	65180919		2203	4299	6502	63331899	SO:0001819	synonymous_variant	92126	exon2			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.957G>A	18.37:g.65180919C>T		Somatic		Capture	Illumina HiSeq	Phase_I	63331899	NM_032160	Q17RH1|Q6P5Z3	Silent	SNP	ENST00000310045.7	37	CCDS11995.1																																																																																				0.408	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
CIC	23152	broad.mit.edu	37	19	42796882	42796883	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:42796882_42796883insC	ENST00000575354.2	+	14	3380_3381	c.3340_3341insC	c.(3340-3342)gccfs	p.A1114fs	CIC_ENST00000572681.2_Frame_Shift_Ins_p.A2022fs|CIC_ENST00000160740.3_Frame_Shift_Ins_p.A1113fs	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	1114	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S1117fs*34(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				GCCATCCCAGGCCCCCCCAAGC	0.683			"""Mis, F, S"""		oligodendroglioma																																p.A1114fs			Rec	yes		19	19q13.2	23152	capicua homolog		O	.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3340_3341insC	19						.																																			47488723	SO:0001589	frameshift_variant	23152	exon14			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.3347dupC	19.37:g.42796889_42796889dupC	ENSP00000458663:p.Ala1114fs	Somatic		Capture	Illumina HiSeq	Phase_I	47488722	NM_015125	Q7LGI1|Q9UEG5|Q9Y6T1	Frame_Shift_Ins	INS	ENST00000575354.2	37	CCDS12601.1																																																																																				0.683	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2		
ZNF439	90594	broad.mit.edu	37	19	11979195	11979195	+	Silent	SNP	G	G	A	rs150203756		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:11979195G>A	ENST00000304030.2	+	3	1511	c.1311G>A	c.(1309-1311)ccG>ccA	p.P437P	ZNF439_ENST00000455282.1_Silent_p.P301P|ZNF439_ENST00000592534.1_Intron	NM_152262.2	NP_689475.1	Q8NDP4	ZN439_HUMAN	zinc finger protein 439	437					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P437P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(7)|pancreas(1)|skin(2)	27						GAGAGAAACCGTATCAATGTA	0.438																																					p.P437P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1311A	19						.	G		1,4405	2.1+/-5.4	0,1,2202	68.0	64.0	65.0		1311	-1.5	0.0	19	dbSNP_134	65	0,8600		0,0,4300	no	coding-synonymous	ZNF439	NM_152262.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		437/500	11979195	1,13005	2203	4300	6503	11840195	SO:0001819	synonymous_variant	90594	exon3			AL833935	CCDS12268.1	19p13.13	2013-01-08			ENSG00000171291	ENSG00000171291		"""Zinc fingers, C2H2-type"", ""-"""	20873	protein-coding gene	gene with protein product							Standard	NM_152262		Approved	DKFZp571K0837	uc002mss.3	Q8NDP4	OTTHUMG00000156527	ENST00000304030.2:c.1311G>A	19.37:g.11979195G>A		Somatic		Capture	Illumina HiSeq	Phase_I	11840195	NM_152262	Q8IYZ7|Q96SU1	Silent	SNP	ENST00000304030.2	37	CCDS12268.1																																																																																				0.438	ZNF439-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344513.1		
MYO9B	4650	broad.mit.edu	37	19	17317576	17317576	+	Silent	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:17317576C>T	ENST00000594824.1	+	34	5622	c.5475C>T	c.(5473-5475)ctC>ctT	p.L1825L	CTD-3032J10.3_ENST00000601929.1_RNA|MYO9B_ENST00000397274.2_Silent_p.L1825L|MYO9B_ENST00000595618.1_Silent_p.L1825L			Q13459	MYO9B_HUMAN	myosin IXB	1825	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.|Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.L1825L(1)		breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						TGGAGAGACTCATCTTCCACC	0.617																																					p.L1825L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5475T	19						.						74.0	80.0	78.0					19																	17317576		2131	4228	6359	17178576	SO:0001819	synonymous_variant	4650	exon34				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.5475C>T	19.37:g.17317576C>T		Somatic		Capture	Illumina HiSeq	Phase_I	17178576	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37																																																																																					0.617	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
DPY19L3	147991	broad.mit.edu	37	19	32972987	32972987	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:32972987G>A	ENST00000342179.5	+	19	2207	c.1992G>A	c.(1990-1992)atG>atA	p.M664I	DPY19L3_ENST00000392250.2_Missense_Mutation_p.M664I|DPY19L3_ENST00000586987.1_Missense_Mutation_p.D682N	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	664						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.M664I(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					GGTTTTAGATGATGGATGGCC	0.433																																					p.M664I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1992A	19						.						128.0	128.0	128.0					19																	32972987		2203	4300	6503	37664827	SO:0001583	missense	147991	exon19				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1992G>A	19.37:g.32972987G>A	ENSP00000344937:p.Met664Ile	Somatic		Capture	Illumina HiSeq	Phase_I	37664827	NM_001172774	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	37	CCDS12422.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.776562	0.31411	.	.	ENSG00000178904	ENST00000392250;ENST00000342179	T;T	0.54279	0.58;0.58	5.93	0.947	0.19555	.	0.761679	0.13064	N	0.416616	T	0.16257	0.0391	N	0.00823	-1.155	0.26671	N	0.971733	B	0.02656	0.0	B	0.01281	0.0	T	0.18241	-1.0343	10	0.22706	T	0.39	-0.647	1.6231	0.02717	0.441:0.1464:0.2798:0.1328	.	664	Q6ZPD9	D19L3_HUMAN	I	664	ENSP00000376081:M664I;ENSP00000344937:M664I	ENSP00000344937:M664I	M	+	3	0	DPY19L3	37664827	1.000000	0.71417	0.816000	0.32577	0.985000	0.73830	0.676000	0.25247	0.356000	0.24157	0.591000	0.81541	ATG		0.433	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325	
ERF	2077	broad.mit.edu	37	19	42753848	42753848	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:42753848C>A	ENST00000222329.4	-	4	573	c.416G>T	c.(415-417)gGt>gTt	p.G139V	ERF_ENST00000440177.2_Missense_Mutation_p.G64V|ERF_ENST00000595941.1_5'Flank|AC006486.9_ENST00000594664.1_Intron	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	139					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)	p.G139V(1)		central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				GAAGTGGCTACCACCCGACGG	0.662																																					p.G139V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G416T	19						.						38.0	41.0	40.0					19																	42753848		2202	4299	6501	47445688	SO:0001583	missense	2077	exon4			U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.416G>T	19.37:g.42753848C>A	ENSP00000222329:p.Gly139Val	Somatic		Capture	Illumina HiSeq	Phase_I	47445688	NM_006494	B2RAP1|B7Z4R0|Q59G38|Q9UPI7	Missense_Mutation	SNP	ENST00000222329.4	37	CCDS12600.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.213388	0.58452	.	.	ENSG00000105722	ENST00000222329;ENST00000440177	T;T	0.56776	0.44;0.44	4.72	4.72	0.59763	.	0.058034	0.64402	D	0.000002	T	0.51346	0.1669	L	0.40543	1.245	0.80722	D	1	P	0.52842	0.956	P	0.47528	0.549	T	0.55250	-0.8170	10	0.56958	D	0.05	.	15.565	0.76284	0.0:1.0:0.0:0.0	.	139	P50548	ERF_HUMAN	V	139;64	ENSP00000222329:G139V;ENSP00000388173:G64V	ENSP00000222329:G139V	G	-	2	0	ERF	47445688	0.339000	0.24784	1.000000	0.80357	0.781000	0.44180	1.725000	0.38074	2.627000	0.88993	0.561000	0.74099	GGT		0.662	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463684.1	NM_006494	
IGFL3	388555	broad.mit.edu	37	19	46627189	46627189	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:46627189T>A	ENST00000341415.2	-	3	328	c.304A>T	c.(304-306)Atg>Ttg	p.M102L	AC007193.6_ENST00000597989.1_lincRNA	NM_207393.1	NP_997276.1	Q6UXB1	IGFL3_HUMAN	IGF-like family member 3	102						extracellular region (GO:0005576)		p.M102L(1)		endometrium(1)|large_intestine(1)|lung(5)	7		Ovarian(192;0.0175)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)		TGAGACTTCATACCCAGAACC	0.527																																					p.M102L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A304T	19						.						127.0	151.0	143.0					19																	46627189		2189	4300	6489	51319029	SO:0001583	missense	388555	exon3			AY358434	CCDS33058.1	19q13.32	2006-07-14				ENSG00000188624			32930	protein-coding gene	gene with protein product		610546				14702039	Standard	NM_207393		Approved	UNQ483	uc002pea.1	Q6UXB1		ENST00000341415.2:c.304A>T	19.37:g.46627189T>A	ENSP00000344860:p.Met102Leu	Somatic		Capture	Illumina HiSeq	Phase_I	51319029	NM_207393		Missense_Mutation	SNP	ENST00000341415.2	37	CCDS33058.1	.	.	.	.	.	.	.	.	.	.	T	0.346	-0.947786	0.02304	.	.	ENSG00000188624	ENST00000341415	T	0.21191	2.02	1.24	-2.32	0.06745	.	.	.	.	.	T	0.09423	0.0232	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33727	-0.9857	9	0.27082	T	0.32	-0.2635	4.3502	0.11151	0.0:0.53:0.0:0.47	.	102	Q6UXB1	IGFL3_HUMAN	L	102	ENSP00000344860:M102L	ENSP00000344860:M102L	M	-	1	0	IGFL3	51319029	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.738000	0.04871	-0.445000	0.07159	-0.526000	0.04340	ATG		0.527	IGFL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421323.1	NM_207393	
GRIN2D	2906	broad.mit.edu	37	19	48908177	48908177	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:48908177C>T	ENST00000263269.3	+	3	740	c.652C>T	c.(652-654)Cgc>Tgc	p.R218C		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	218					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.R218C(1)		autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CTGGGAGCACCGCGGAGCGCT	0.682																																					p.R218C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C652T	19						.						83.0	81.0	81.0					19																	48908177		2203	4300	6503	53599989	SO:0001583	missense	2906	exon3			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.652C>T	19.37:g.48908177C>T	ENSP00000263269:p.Arg218Cys	Somatic		Capture	Illumina HiSeq	Phase_I	53599989	NM_000836		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977526	0.74360	.	.	ENSG00000105464	ENST00000263269	D	0.93953	-3.32	4.94	3.84	0.44239	Extracellular ligand-binding receptor (1);	0.141001	0.45606	D	0.000348	D	0.93697	0.7986	L	0.29908	0.895	0.50813	D	0.99989	D	0.89917	1.0	D	0.73708	0.981	D	0.94066	0.7331	10	0.66056	D	0.02	.	14.2129	0.65776	0.1492:0.8508:0.0:0.0	.	218	O15399	NMDE4_HUMAN	C	218	ENSP00000263269:R218C	ENSP00000263269:R218C	R	+	1	0	GRIN2D	53599989	0.996000	0.38824	1.000000	0.80357	0.895000	0.52256	3.145000	0.50623	2.457000	0.83068	0.561000	0.74099	CGC		0.682	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
LRRC4B	94030	broad.mit.edu	37	19	51021288	51021288	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:51021288G>A	ENST00000599957.1	-	3	1879	c.1682C>T	c.(1681-1683)aCg>aTg	p.T561M	LRRC4B_ENST00000389201.3_Missense_Mutation_p.T561M			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	561					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.T561M(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GGCGTTCTCCGTCACATCCGT	0.657																																					p.T561M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1682T	19						.						42.0	45.0	44.0					19																	51021288		2143	4263	6406	55713100	SO:0001583	missense	94030	exon3			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1682C>T	19.37:g.51021288G>A	ENSP00000471502:p.Thr561Met	Somatic		Capture	Illumina HiSeq	Phase_I	55713100	NM_001080457	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	CCDS42595.1	.	.	.	.	.	.	.	.	.	.	G	17.65	3.442721	0.63067	.	.	ENSG00000131409	ENST00000389201	T	0.33865	1.39	3.27	3.27	0.37495	.	0.000000	0.34531	U	0.003890	T	0.35566	0.0936	L	0.34521	1.04	0.39453	D	0.967435	D	0.67145	0.996	P	0.51550	0.673	T	0.18967	-1.0320	10	0.39692	T	0.17	.	12.3875	0.55340	0.0:0.0:1.0:0.0	.	561	Q9NT99	LRC4B_HUMAN	M	561	ENSP00000373853:T561M	ENSP00000373853:T561M	T	-	2	0	LRRC4B	55713100	0.979000	0.34478	1.000000	0.80357	0.971000	0.66376	1.940000	0.40223	1.823000	0.53134	0.462000	0.41574	ACG		0.657	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
LILRB5	10990	broad.mit.edu	37	19	54760553	54760553	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:54760553G>T	ENST00000316219.5	-	3	261	c.154C>A	c.(154-156)Ccc>Acc	p.P52T	LILRB5_ENST00000449561.2_Missense_Mutation_p.P52T|LILRB5_ENST00000345866.6_Missense_Mutation_p.P52T|LILRB5_ENST00000450632.1_Missense_Mutation_p.P52T	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	52	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.P52T(2)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTCTCCAGGGGCCCCTGACAC	0.617																																					p.P52T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C154A	19						.						97.0	100.0	99.0					19																	54760553		2203	4300	6503	59452365	SO:0001583	missense	10990	exon3			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.154C>A	19.37:g.54760553G>T	ENSP00000320390:p.Pro52Thr	Somatic		Capture	Illumina HiSeq	Phase_I	59452365	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	G	0.302	-0.973224	0.02215	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.13196	2.61;2.61;2.61;2.61	3.18	-3.87	0.04218	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.987220	0.08238	N	0.976454	T	0.05044	0.0135	N	0.05351	-0.065	0.09310	N	0.999997	B;B;B;B;B	0.21071	0.005;0.032;0.005;0.051;0.004	B;B;B;B;B	0.19666	0.017;0.01;0.002;0.026;0.007	T	0.43621	-0.9380	10	0.15066	T	0.55	.	4.1324	0.10156	0.4147:0.0:0.1496:0.4358	.	52;43;52;52;52	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	T	52	ENSP00000320390:P52T;ENSP00000414225:P52T;ENSP00000406478:P52T;ENSP00000263430:P52T	ENSP00000320390:P52T	P	-	1	0	LILRB5	59452365	0.000000	0.05858	0.040000	0.18447	0.016000	0.09150	-4.116000	0.00292	-0.876000	0.04017	-1.640000	0.00773	CCC		0.617	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
ZNF530	348327	broad.mit.edu	37	19	58117895	58117895	+	Silent	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:58117895C>T	ENST00000332854.6	+	3	1222	c.1002C>T	c.(1000-1002)caC>caT	p.H334H	ZNF530_ENST00000597864.1_Intron	NM_020880.3	NP_065931.3	Q6P9A1	ZN530_HUMAN	zinc finger protein 530	334					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H334H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(6)|skin(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CTTTTAGCCACAGCACTAACC	0.463																																					p.H334H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1002T	19						.						108.0	100.0	103.0					19																	58117895		2203	4300	6503	62809707	SO:0001819	synonymous_variant	348327	exon3			AK096831	CCDS12955.1	19q13.43	2013-01-08				ENSG00000183647		"""Zinc fingers, C2H2-type"", ""-"""	29297	protein-coding gene	gene with protein product						10819331	Standard	NM_020880		Approved	KIAA1508	uc002qpk.2	Q6P9A1		ENST00000332854.6:c.1002C>T	19.37:g.58117895C>T		Somatic		Capture	Illumina HiSeq	Phase_I	62809707	NM_020880	O43340|Q9P220	Silent	SNP	ENST00000332854.6	37	CCDS12955.1																																																																																				0.463	ZNF530-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466797.1	NM_020880	
ZNF135	7694	broad.mit.edu	37	19	58579676	58579676	+	Silent	SNP	T	T	C			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:58579676T>C	ENST00000313434.5	+	5	1925	c.1824T>C	c.(1822-1824)tgT>tgC	p.C608C	ZNF135_ENST00000511556.1_Silent_p.C620C|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000439855.2_Silent_p.C608C|ZNF135_ENST00000359978.6_Intron|ZNF135_ENST00000401053.4_Silent_p.C632C|ZNF135_ENST00000506786.1_Silent_p.C566C	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	608					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C608C(1)		breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CCTATGAGTGTCACGATTGCG	0.552																																					p.C620C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1860C	19						.						96.0	89.0	91.0					19																	58579676		2203	4300	6503	63271488	SO:0001819	synonymous_variant	7694	exon5			U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.1824T>C	19.37:g.58579676T>C		Somatic		Capture	Illumina HiSeq	Phase_I	63271488	NM_003436	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Silent	SNP	ENST00000313434.5	37		.	.	.	.	.	.	.	.	.	.	T	0.033	-1.322130	0.01320	.	.	ENSG00000176293	ENST00000391699	.	.	.	3.37	1.17	0.20885	.	.	.	.	.	T	0.52058	0.1711	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.37197	-0.9716	4	.	.	.	.	5.7754	0.18277	0.0:0.4231:0.0:0.5769	.	.	.	.	A	626	.	.	V	+	2	0	ZNF135	63271488	0.000000	0.05858	0.035000	0.18076	0.020000	0.10135	-0.537000	0.06128	0.082000	0.17018	0.455000	0.32223	GTC		0.552	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	
MZF1	7593	broad.mit.edu	37	19	59082475	59082475	+	Silent	SNP	G	G	A	rs374998042		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr19:59082475G>A	ENST00000215057.2	-	2	842	c.282C>T	c.(280-282)ggC>ggT	p.G94G	AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|MZF1_ENST00000599369.1_Silent_p.G94G|AC016629.8_ENST00000600534.1_RNA|MZF1_ENST00000594108.1_Silent_p.G94G|MZF1_ENST00000594234.1_Silent_p.G94G	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	94	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G94G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		GGGGCAGTGCGCCCAGGAACT	0.701																																					p.G94G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C282T	19						.	G	,	0,4402		0,0,2201	23.0	22.0	22.0		282,282	-3.8	0.0	19		22	1,8595		0,1,4297	no	coding-synonymous,coding-synonymous	MZF1	NM_003422.2,NM_198055.1	,	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	,	94/735,94/735	59082475	1,12997	2201	4298	6499	63774287	SO:0001819	synonymous_variant	7593	exon2			M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.282C>T	19.37:g.59082475G>A		Somatic		Capture	Illumina HiSeq	Phase_I	63774287	NM_198055	M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Silent	SNP	ENST00000215057.2	37	CCDS12988.1																																																																																				0.701	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467112.1	NM_198055	
OBSCN	84033	broad.mit.edu	37	1	228561674	228561675	+	Frame_Shift_Ins	INS	-	-	CTAC			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:228561674_228561675insCTAC	ENST00000422127.1	+	95	22389_22390	c.22345_22346insCTAC	c.(22345-22347)gctfs	p.-7449fs	OBSCN_ENST00000570156.2_Frame_Shift_Ins_p.-8406fs|OBSCN_ENST00000366707.4_Frame_Shift_Ins_p.-5083fs	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCCAGGCCTTGCTTCCTTCCGG	0.653																																					p.A7449fs												.	.	0			c.22345_22346insCTAC	1						.																																			226628298	SO:0001589	frameshift_variant	84033	exon95			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	Exception_encountered	1.37:g.228561674_228561675insCTAC	ENSP00000409493:p.Ala7449fs	None		Capture	Illumina HiSeq	Phase_I	226628297	NM_001098623	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Ins	INS	ENST00000422127.1	37	CCDS58065.1																																																																																				0.653	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
DHRS3	9249	broad.mit.edu	37	1	12639324	12639324	+	Silent	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:12639324G>A	ENST00000376223.2	-	3	839	c.456C>T	c.(454-456)ttC>ttT	p.F152F	DHRS3_ENST00000482265.1_5'Flank	NM_004753.4	NP_004744.2	O75911	DHRS3_HUMAN	dehydrogenase/reductase (SDR family) member 3	152					bone morphogenesis (GO:0060349)|cardiac septum morphogenesis (GO:0060411)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|phototransduction, visible light (GO:0007603)|regulation of ossification (GO:0030278)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|photoreceptor outer segment membrane (GO:0042622)	electron carrier activity (GO:0009055)|NADP-retinol dehydrogenase activity (GO:0052650)|nucleotide binding (GO:0000166)|retinol dehydrogenase activity (GO:0004745)	p.F152F(1)		cervix(1)|large_intestine(4)|lung(2)|prostate(1)|skin(1)	9	Ovarian(185;0.249)	Lung NSC(185;4.11e-05)|all_lung(284;4.58e-05)|Renal(390;0.000147)|Colorectal(325;0.000585)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;9.25e-07)|COAD - Colon adenocarcinoma(227;0.000326)|BRCA - Breast invasive adenocarcinoma(304;0.000344)|Kidney(185;0.00235)|KIRC - Kidney renal clear cell carcinoma(229;0.00656)|STAD - Stomach adenocarcinoma(313;0.00798)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	CCCTTACCCAGAACTGGCCCA	0.627																																					p.F152F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C456T	1						.						100.0	80.0	87.0					1																	12639324		2203	4300	6503	12561911	SO:0001819	synonymous_variant	9249	exon3			AF061741	CCDS146.1	1p36.1	2011-09-20			ENSG00000162496	ENSG00000162496	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	17693	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 1"""	612830				9705317, 12226107, 19027726	Standard	XM_005263533		Approved	retSDR1, Rsdr1, SDR1, RDH17, SDR16C1	uc001auc.3	O75911	OTTHUMG00000001885	ENST00000376223.2:c.456C>T	1.37:g.12639324G>A		Somatic		Capture	Illumina HiSeq	Phase_I	12561911	NM_004753	B2R7F3|Q5VUY3|Q6UY38|Q9BUC8	Silent	SNP	ENST00000376223.2	37	CCDS146.1																																																																																				0.627	DHRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005318.1	NM_004753	
ATP1A1	476	broad.mit.edu	37	1	116940623	116940623	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:116940623A>G	ENST00000295598.5	+	15	2339	c.2087A>G	c.(2086-2088)cAg>cGg	p.Q696R	ATP1A1_ENST00000369496.4_Missense_Mutation_p.Q665R|ATP1A1_ENST00000537345.1_Missense_Mutation_p.Q696R	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	696					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.Q696R(1)		NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	ACCTCCCCTCAGCAGAAGCTC	0.512																																					p.Q696R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2087G	1						.						122.0	105.0	110.0					1																	116940623		2203	4300	6503	116742146	SO:0001583	missense	476	exon15			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.2087A>G	1.37:g.116940623A>G	ENSP00000295598:p.Gln696Arg	Somatic		Capture	Illumina HiSeq	Phase_I	116742146	NM_000701	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.883979	0.91814	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000369496	D;D;D	0.95980	-3.87;-3.87;-3.87	5.15	5.15	0.70609	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95717	0.8607	L	0.41236	1.265	0.80722	D	1	D;D	0.63880	0.983;0.993	D;D	0.87578	0.998;0.998	D	0.96884	0.9648	10	0.87932	D	0	.	15.1447	0.72641	1.0:0.0:0.0:0.0	.	696;696	F5H3A1;P05023	.;AT1A1_HUMAN	R	696;696;665	ENSP00000295598:Q696R;ENSP00000445306:Q696R;ENSP00000358508:Q665R	ENSP00000295598:Q696R	Q	+	2	0	ATP1A1	116742146	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.139000	0.94554	2.159000	0.67721	0.533000	0.62120	CAG		0.512	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
NPR1	4881	broad.mit.edu	37	1	153661759	153661759	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:153661759C>T	ENST00000368680.3	+	17	3132	c.2660C>T	c.(2659-2661)gCg>gTg	p.A887V		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	887	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)	p.A887V(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	GGTTTCACAGCGCTGTCGGCG	0.587																																					p.A887V	Pancreas(141;1349 1870 15144 15830 40702)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2660T	1						.						137.0	120.0	126.0					1																	153661759		2203	4300	6503	151928383	SO:0001583	missense	4881	exon17			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2660C>T	1.37:g.153661759C>T	ENSP00000357669:p.Ala887Val	Somatic		Capture	Illumina HiSeq	Phase_I	151928383	NM_000906	B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	ENST00000368680.3	37	CCDS1051.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.517034	0.85495	.	.	ENSG00000169418	ENST00000368680;ENST00000428723;ENST00000368677	D	0.85484	-1.99	3.35	3.35	0.38373	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000001	D	0.82440	0.5037	L	0.58101	1.795	0.80722	D	1	P;D	0.57899	0.884;0.981	P;P	0.51079	0.563;0.658	D	0.83790	0.0230	10	0.52906	T	0.07	.	13.0177	0.58768	0.0:1.0:0.0:0.0	.	366;887	B7Z4Y7;P16066	.;ANPRA_HUMAN	V	887;366;68	ENSP00000357669:A887V	ENSP00000357666:A68V	A	+	2	0	NPR1	151928383	1.000000	0.71417	0.999000	0.59377	0.725000	0.41563	7.609000	0.82925	2.175000	0.68902	0.462000	0.41574	GCG		0.587	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906	
PYHIN1	149628	broad.mit.edu	37	1	158911971	158911971	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:158911971A>G	ENST00000368140.1	+	5	1029	c.784A>G	c.(784-786)Aaa>Gaa	p.K262E	PYHIN1_ENST00000485134.1_3'UTR|PYHIN1_ENST00000392252.3_Missense_Mutation_p.K253E|PYHIN1_ENST00000368138.3_Missense_Mutation_p.K253E|PYHIN1_ENST00000392254.2_Missense_Mutation_p.K262E	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	262	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				cell cycle (GO:0007049)	nucleus (GO:0005634)		p.K262E(1)		breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					CTTGAAGAGGAAATTCATTAA	0.363																																					p.K253E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A757G	1						.						51.0	55.0	54.0					1																	158911971		2203	4300	6503	157178595	SO:0001583	missense	149628	exon5			AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.784A>G	1.37:g.158911971A>G	ENSP00000357122:p.Lys262Glu	Somatic		Capture	Illumina HiSeq	Phase_I	157178595	NM_198930	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.989873	0.35131	.	.	ENSG00000163564	ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	2.85	0.0332	0.14179	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.34279	0.0892	M	0.81341	2.54	0.09310	N	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.75484	0.964;0.973;0.976;0.986	T	0.07443	-1.0772	9	0.72032	D	0.01	.	3.0647	0.06211	0.4984:0.2542:0.0:0.2474	.	253;262;253;262	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9	.;.;.;IFIX_HUMAN	E	262;253;262;253	ENSP00000357122:K262E;ENSP00000357120:K253E;ENSP00000376083:K262E;ENSP00000376082:K253E	ENSP00000357120:K253E	K	+	1	0	PYHIN1	157178595	0.006000	0.16342	0.001000	0.08648	0.000000	0.00434	0.708000	0.25719	0.289000	0.22422	-0.313000	0.08912	AAA		0.363	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501	
PPP1R12B	4660	broad.mit.edu	37	1	202418206	202418206	+	Missense_Mutation	SNP	G	G	A	rs369793804		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:202418206G>A	ENST00000608999.1	+	13	1910	c.1757G>A	c.(1756-1758)cGc>cAc	p.R586H	PPP1R12B_ENST00000336894.4_Missense_Mutation_p.R586H	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	586					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)	p.R586H(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			ATCACCAATCGCCCTCTTCCT	0.502																																					p.R586H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1757A	1						.	G	HIS/ARG	0,4406		0,0,2203	126.0	107.0	113.0		1757	4.7	1.0	1		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	PPP1R12B	NM_002481.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	586/983	202418206	1,13005	2203	4300	6503	200684829	SO:0001583	missense	4660	exon13			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1757G>A	1.37:g.202418206G>A	ENSP00000476755:p.Arg586His	Somatic		Capture	Illumina HiSeq	Phase_I	200684829	NM_002481	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	ENST00000608999.1	37	CCDS1426.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807145	0.50421	0.0	1.16E-4	ENSG00000077157	ENST00000406302;ENST00000336894	T;T	0.39406	1.08;1.09	5.65	4.74	0.60224	.	0.000000	0.64402	D	0.000009	T	0.51822	0.1697	M	0.72479	2.2	0.80722	D	1	D;D	0.71674	0.987;0.998	B;P	0.60068	0.431;0.868	T	0.53099	-0.8486	10	0.14252	T	0.57	.	7.2693	0.26248	0.1455:0.0:0.7172:0.1374	.	586;586	O60237;F8W8M3	MYPT2_HUMAN;.	H	586	ENSP00000384496:R586H;ENSP00000337897:R586H	ENSP00000337897:R586H	R	+	2	0	PPP1R12B	200684829	0.989000	0.36119	0.992000	0.48379	0.726000	0.41606	2.512000	0.45485	1.533000	0.49186	-0.137000	0.14449	CGC		0.502	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099166.3	NM_032105	
MYBPH	4608	broad.mit.edu	37	1	203138049	203138049	+	Missense_Mutation	SNP	G	G	A	rs201112460		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:203138049G>A	ENST00000255416.4	-	9	1459	c.1402C>T	c.(1402-1404)Cgg>Tgg	p.R468W		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	468					cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.R468W(1)		endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		ACCTCCAGCCGGCAGTCCACA	0.557																																					p.R468W	NSCLC(32;174 1025 14462 23899 42933)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1402T	1						.	G	TRP/ARG	0,4406		0,0,2203	132.0	143.0	140.0		1402	3.3	1.0	1		140	2,8598	2.2+/-6.3	0,2,4298	yes	missense	MYBPH	NM_004997.2	101	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	468/478	203138049	2,13004	2203	4300	6503	201404672	SO:0001583	missense	4608	exon9			BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.1402C>T	1.37:g.203138049G>A	ENSP00000255416:p.Arg468Trp	Somatic		Capture	Illumina HiSeq	Phase_I	201404672	NM_004997	Q16886|Q86YC5	Missense_Mutation	SNP	ENST00000255416.4	37	CCDS30975.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040203	0.75732	0.0	2.33E-4	ENSG00000133055	ENST00000255416	T	0.68025	-0.3	5.36	3.3	0.37823	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.151282	0.31177	N	0.008119	T	0.76941	0.4058	L	0.60904	1.88	0.37208	D	0.904671	D	0.89917	1.0	D	0.91635	0.999	T	0.81782	-0.0775	10	0.87932	D	0	.	11.9477	0.52938	0.0:0.0:0.4476:0.5524	.	468	Q13203	MYBPH_HUMAN	W	468	ENSP00000255416:R468W	ENSP00000255416:R468W	R	-	1	2	MYBPH	201404672	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.995000	0.49441	1.189000	0.43028	0.655000	0.94253	CGG		0.557	MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100264.1	NM_004997	
CDK18	5129	broad.mit.edu	37	1	205498652	205498652	+	Silent	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:205498652G>A	ENST00000360066.2	+	13	1483	c.1182G>A	c.(1180-1182)ttG>ttA	p.L394L	CDK18_ENST00000509056.1_3'UTR|CDK18_ENST00000429964.2_Silent_p.L394L|CDK18_ENST00000506784.1_Silent_p.L424L	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18	392	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.L394L(1)|p.L424L(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						CTTGCAGGTTGGATACGGATG	0.697											OREG0014157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L424L	Pancreas(180;489 2072 28461 40831 44265)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1272A	1						.						53.0	50.0	51.0					1																	205498652		2203	4300	6503	203765275	SO:0001819	synonymous_variant	5129	exon13			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.1182G>A	1.37:g.205498652G>A		Somatic	2152	Capture	Illumina HiSeq	Phase_I	203765275	NM_212503	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	Silent	SNP	ENST00000360066.2	37	CCDS44300.1																																																																																				0.697	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090407.2	NM_002596	
PSEN2	5664	broad.mit.edu	37	1	227077740	227077740	+	Silent	SNP	C	C	T	rs77875620	byFrequency	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:227077740C>T	ENST00000366783.3	+	9	1228	c.792C>T	c.(790-792)ctC>ctT	p.L264L	PSEN2_ENST00000340188.4_Intron|PSEN2_ENST00000366782.1_Silent_p.L297L|PSEN2_ENST00000422240.2_Silent_p.L264L|PSEN2_ENST00000391872.2_Silent_p.L297L|PSEN2_ENST00000472139.2_Silent_p.L120L	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	264					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)	p.L264L(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				TCCTAGATCTCGTGGCTGTGC	0.557																																					p.L264L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C792T	1						.						128.0	112.0	117.0					1																	227077740		2203	4300	6503	225144363	SO:0001819	synonymous_variant	5664	exon9			BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.792C>T	1.37:g.227077740C>T		Somatic		Capture	Illumina HiSeq	Phase_I	225144363	NM_000447	A8K8D4|B1AP21|Q96P32	Silent	SNP	ENST00000366783.3	37	CCDS1556.1																																																																																				0.557	PSEN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091539.1	NM_000447	
C1orf198	84886	broad.mit.edu	37	1	230979346	230979346	+	Silent	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:230979346G>A	ENST00000366663.5	-	3	821	c.681C>T	c.(679-681)ccC>ccT	p.P227P	C1orf198_ENST00000427697.2_Silent_p.P10P|C1orf198_ENST00000470540.1_Silent_p.P189P|C1orf198_ENST00000523410.1_Silent_p.P97P	NM_032800.2	NP_116189.1	Q9H425	CA198_HUMAN	chromosome 1 open reading frame 198	227						cytoplasm (GO:0005737)		p.P227P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	17	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				GCCGGTAGCAGGGAGGCAAGA	0.647																																					p.P189P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C567T	1						.						71.0	70.0	70.0					1																	230979346		2203	4300	6503	229045969	SO:0001819	synonymous_variant	84886	exon5			BC066649	CCDS1587.1, CCDS44330.1, CCDS44331.1	1q42.2	2008-02-05			ENSG00000119280	ENSG00000119280			25900	protein-coding gene	gene with protein product							Standard	NM_032800		Approved	FLJ14525, MGC10710, FLJ16283, DKFZp667D152, FLJ38847	uc001hub.3	Q9H425	OTTHUMG00000037790	ENST00000366663.5:c.681C>T	1.37:g.230979346G>A		Somatic		Capture	Illumina HiSeq	Phase_I	229045969	NM_001136494	A8K8R8|B3KTW1|G5EA08	Silent	SNP	ENST00000366663.5	37	CCDS1587.1																																																																																				0.647	C1orf198-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092236.2	NM_032800	
MAN1C1	57134	broad.mit.edu	37	1	26075749	26075749	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:26075749G>A	ENST00000374332.4	+	4	1087	c.757G>A	c.(757-759)Gga>Aga	p.G253R	MAN1C1_ENST00000374329.1_Missense_Mutation_p.G24R|MAN1C1_ENST00000473891.1_3'UTR|MAN1C1_ENST00000263979.3_Missense_Mutation_p.G73R	NM_020379.2	NP_065112.1	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	253					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.G253R(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(7)|pancreas(1)|prostate(1)|skin(2)	25		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		CCTGCAGAGCGGAGAAGCATC	0.557																																					p.G253R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G757A	1						.						103.0	81.0	88.0					1																	26075749		2203	4300	6503	25948336	SO:0001583	missense	57134	exon4			AF261655	CCDS265.1	1p35	2008-02-05			ENSG00000117643	ENSG00000117643			19080	protein-coding gene	gene with protein product						10915796	Standard	XM_005245945		Approved	HMIC	uc001bkm.2	Q9NR34	OTTHUMG00000004417	ENST00000374332.4:c.757G>A	1.37:g.26075749G>A	ENSP00000363452:p.Gly253Arg	Somatic		Capture	Illumina HiSeq	Phase_I	25948336	NM_020379	A6NNE2|B2RNP2|Q9Y545	Missense_Mutation	SNP	ENST00000374332.4	37	CCDS265.1	.	.	.	.	.	.	.	.	.	.	g	24.9	4.580057	0.86645	.	.	ENSG00000117643	ENST00000374332;ENST00000374331;ENST00000263979;ENST00000374329	T;T;T	0.70869	-0.52;-0.52;-0.52	4.98	4.98	0.66077	.	0.058626	0.64402	D	0.000002	T	0.78317	0.4264	L	0.48362	1.52	0.51233	D	0.999918	D	0.89917	1.0	D	0.79108	0.992	T	0.71663	-0.4525	10	0.12430	T	0.62	.	18.0681	0.89397	0.0:0.0:1.0:0.0	.	253	Q9NR34	MA1C1_HUMAN	R	253;73;73;24	ENSP00000363452:G253R;ENSP00000263979:G73R;ENSP00000363449:G24R	ENSP00000263979:G73R	G	+	1	0	MAN1C1	25948336	1.000000	0.71417	0.967000	0.41034	0.843000	0.47879	8.186000	0.89706	2.582000	0.87167	0.556000	0.70494	GGA		0.557	MAN1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012828.3	NM_020379	
ELAVL4	1996	broad.mit.edu	37	1	50663131	50663131	+	Silent	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:50663131C>T	ENST00000371823.4	+	6	989	c.765C>T	c.(763-765)ggC>ggT	p.G255G	ELAVL4_ENST00000371821.1_Silent_p.G260G|ELAVL4_ENST00000371827.1_Silent_p.G255G|ELAVL4_ENST00000371824.1_Silent_p.G255G|ELAVL4_ENST00000448907.2_Silent_p.G258G|ELAVL4_ENST00000357083.4_Silent_p.G272G|ELAVL4_ENST00000371819.1_Silent_p.G260G	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4	255					mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G255G(1)|p.G272G(1)		NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						TGGCCTATGGCGTAAAGAGGT	0.393																																					p.G255G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C765T	1						.						141.0	146.0	144.0					1																	50663131		2203	4300	6503	50435718	SO:0001819	synonymous_variant	1996	exon6			AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.765C>T	1.37:g.50663131C>T		Somatic		Capture	Illumina HiSeq	Phase_I	50435718	NM_001144774	B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Silent	SNP	ENST00000371823.4	37	CCDS553.1																																																																																				0.393	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000021712.1	NM_021952	
USP24	23358	broad.mit.edu	37	1	55537581	55537581	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:55537581G>A	ENST00000294383.6	-	67	7705	c.7706C>T	c.(7705-7707)gCc>gTc	p.A2569V	USP24_ENST00000484447.1_5'UTR|USP24_ENST00000407756.1_Missense_Mutation_p.A2409V	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2569					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.A2569V(1)|p.A2486V(1)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CAAAGCTGTGGCATACGCTAA	0.483											OREG0013507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A2569V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C7706T	1						.						87.0	83.0	85.0					1																	55537581		2064	4208	6272	55310169	SO:0001583	missense	23358	exon67			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.7706C>T	1.37:g.55537581G>A	ENSP00000294383:p.Ala2569Val	Somatic	1008	Capture	Illumina HiSeq	Phase_I	55310169	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	G	27.8	4.863807	0.91511	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.09630	2.96;3.03	4.56	4.56	0.56223	.	0.000000	0.64402	D	0.000001	T	0.31231	0.0790	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.02617	-1.1133	10	0.54805	T	0.06	.	17.5474	0.87866	0.0:0.0:1.0:0.0	.	2409	B7WPF4	.	V	2569;2409	ENSP00000294383:A2569V;ENSP00000385700:A2409V	ENSP00000294383:A2569V	A	-	2	0	USP24	55310169	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.024000	0.93689	2.374000	0.81015	0.655000	0.94253	GCC		0.483	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
ERICH3	127254	broad.mit.edu	37	1	75038878	75038878	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:75038878G>T	ENST00000326665.5	-	14	2734	c.2516C>A	c.(2515-2517)gCa>gAa	p.A839E	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		839	Glu-rich.							p.A839E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TGCTCCCTCTGCCCCCCTTTC	0.557																																					p.A839E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2516A	1						.						101.0	95.0	97.0					1																	75038878		2203	4300	6503	74811466	SO:0001583	missense	127254	exon14																														ENST00000326665.5:c.2516C>A	1.37:g.75038878G>T	ENSP00000322609:p.Ala839Glu	Somatic		Capture	Illumina HiSeq	Phase_I	74811466	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.722679	0.48728	.	.	ENSG00000178965	ENST00000326665	T	0.12147	2.71	4.81	0.405	0.16361	.	.	.	.	.	T	0.02193	0.0068	L	0.36672	1.1	0.09310	N	1	B	0.17667	0.023	B	0.24541	0.054	T	0.47407	-0.9120	9	0.02654	T	1	-1.2442	6.0765	0.19919	0.1562:0.0:0.4949:0.3489	.	839	Q5RHP9	CA173_HUMAN	E	839	ENSP00000322609:A839E	ENSP00000322609:A839E	A	-	2	0	C1orf173	74811466	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.141000	0.16076	0.402000	0.25451	0.655000	0.94253	GCA		0.557	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
OR2T1	26696	broad.mit.edu	37	1	248570144	248570144	+	Silent	SNP	C	C	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr1:248570144C>A	ENST00000366474.1	+	1	849	c.849C>A	c.(847-849)ggC>ggA	p.G283G		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G283G(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAGTGGAGGGCAGGAAGAAGG	0.502																																					p.G283G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C849A	1						.						240.0	195.0	210.0					1																	248570144		2203	4300	6503	246636767	SO:0001819	synonymous_variant	26696	exon1			U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.849C>A	1.37:g.248570144C>A		Somatic		Capture	Illumina HiSeq	Phase_I	246636767	NM_030904	Q6IEZ9	Silent	SNP	ENST00000366474.1	37	CCDS31115.1																																																																																				0.502	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097346.2		
NOL4L	140688	broad.mit.edu	37	20	31043942	31043942	+	Silent	SNP	G	G	A	rs371387659		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr20:31043942G>A	ENST00000359676.5	-	3	508	c.366C>T	c.(364-366)taC>taT	p.Y122Y	RP5-1184F4.5_ENST00000442179.1_RNA|C20orf112_ENST00000475781.1_5'UTR	NM_001256798.1|NM_080616.4	NP_001243727.1|NP_542183.2	Q96MY1	NOL4L_HUMAN		122						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Y122Y(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(5)	15						TCTTCACCCCGTATTTGACGC	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		18385	0.0		0.001	False		,,,				2504	0.0				p.Y122Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C366T	20						.	G		0,4406		0,0,2203	71.0	78.0	76.0		366	-2.6	1.0	20		76	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C20orf112	NM_080616.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		122/437	31043942	1,13005	2203	4300	6503	30507603	SO:0001819	synonymous_variant	140688	exon3																														ENST00000359676.5:c.366C>T	20.37:g.31043942G>A		Somatic		Capture	Illumina HiSeq	Phase_I	30507603	NM_080616	Q5JYB7|Q6P0Y4|Q9BR34|Q9NQF6	De_novo_Start_InFrame	SNP	ENST00000359676.5	37	CCDS13202.1																																																																																				0.627	C20orf112-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078628.2		
CLDN8	9073	broad.mit.edu	37	21	31587982	31587982	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr21:31587982A>T	ENST00000399899.1	-	1	409	c.262T>A	c.(262-264)Tcc>Acc	p.S88T	CLDN8_ENST00000286809.1_Missense_Mutation_p.S88T	NM_199328.2	NP_955360.1	P56748	CLD8_HUMAN	claudin 8	88					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.S88T(1)		NS(1)|endometrium(2)|large_intestine(6)|lung(6)	15						GACATCACGGAAGCAGCACAC	0.532																																					p.S88T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T262A	21						.						112.0	90.0	98.0					21																	31587982		2203	4300	6503	30509853	SO:0001583	missense	9073	exon1			AJ250711	CCDS13587.1	21q22.1	2008-07-31			ENSG00000156284	ENSG00000156284		"""Claudins"""	2050	protein-coding gene	gene with protein product		611231				9892664	Standard	NM_199328		Approved		uc002ynu.2	P56748	OTTHUMG00000081872	ENST00000399899.1:c.262T>A	21.37:g.31587982A>T	ENSP00000382783:p.Ser88Thr	Somatic		Capture	Illumina HiSeq	Phase_I	30509853	NM_199328	D3DSE3|Q53EX7	Missense_Mutation	SNP	ENST00000399899.1	37	CCDS13587.1	.	.	.	.	.	.	.	.	.	.	A	9.913	1.210129	0.22289	.	.	ENSG00000156284	ENST00000399899;ENST00000286809;ENST00000536721	D;D	0.87887	-2.31;-2.31	5.05	3.87	0.44632	.	0.420434	0.24143	N	0.041155	D	0.85301	0.5665	L	0.56769	1.78	0.09310	N	1	B	0.24317	0.101	B	0.32022	0.139	T	0.78244	-0.2279	10	0.62326	D	0.03	.	11.0726	0.48012	0.8609:0.0:0.0:0.1391	.	88	P56748	CLD8_HUMAN	T	88	ENSP00000382783:S88T;ENSP00000286809:S88T	ENSP00000286809:S88T	S	-	1	0	CLDN8	30509853	0.000000	0.05858	0.003000	0.11579	0.504000	0.33889	0.626000	0.24492	1.015000	0.39444	0.528000	0.53228	TCC		0.532	CLDN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000182260.1	NM_199328	
TMEM198	130612	broad.mit.edu	37	2	220412522	220412523	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr2:220412522_220412523insG	ENST00000344458.2	+	4	1046_1047	c.461_462insG	c.(460-465)ctggggfs	p.LG154fs	TMEM198_ENST00000373883.3_Frame_Shift_Ins_p.LG154fs|RP11-256I23.1_ENST00000596829.1_RNA|MIR3132_ENST00000581997.1_RNA			Q66K66	TM198_HUMAN	transmembrane protein 198	154	Leu-rich.				multicellular organismal development (GO:0007275)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	16		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GGGCTGTTGCTGGGGGGCGGCC	0.723																																					p.L154fs												.	.	0			c.461_462insG	2						.																																			220120767	SO:0001589	frameshift_variant	130612	exon3			BC068567	CCDS33385.1	2q35	2011-12-06			ENSG00000188760	ENSG00000188760			33704	protein-coding gene	gene with protein product							Standard	NM_001005209		Approved	MGC99813, TMEM198A	uc002vmf.3	Q66K66	OTTHUMG00000059156	ENST00000344458.2:c.467dupG	2.37:g.220412528_220412528dupG	ENSP00000343507:p.Leu154fs	None		Capture	Illumina HiSeq	Phase_I	220120766	NM_001005209		Frame_Shift_Ins	INS	ENST00000344458.2	37	CCDS33385.1																																																																																				0.723	TMEM198-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131063.1	NM_001005209	
KCNK3	3777	broad.mit.edu	37	2	26951060	26951060	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr2:26951060C>T	ENST00000302909.3	+	2	934	c.809C>T	c.(808-810)gCg>gTg	p.A270V		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	270					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)	p.A270V(1)		endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	AACGGGCAGGCGGGCGGCGGC	0.726																																					p.A270V	GBM(80;1457 1631 27100 45946)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C809T	2						.						13.0	12.0	13.0					2																	26951060		2131	4109	6240	26804564	SO:0001583	missense	3777	exon2			AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.809C>T	2.37:g.26951060C>T	ENSP00000306275:p.Ala270Val	Somatic		Capture	Illumina HiSeq	Phase_I	26804564	NM_002246	Q53SU2	Missense_Mutation	SNP	ENST00000302909.3	37	CCDS1727.1	.	.	.	.	.	.	.	.	.	.	C	8.366	0.834307	0.16820	.	.	ENSG00000171303	ENST00000538762;ENST00000302909	T	0.20069	2.1	4.59	2.69	0.31865	.	0.693654	0.14280	N	0.329586	T	0.13884	0.0336	L	0.36672	1.1	0.32031	N	0.599452	B	0.17268	0.021	B	0.08055	0.003	T	0.26430	-1.0103	10	0.16420	T	0.52	.	6.5969	0.22679	0.0:0.7565:0.0:0.2435	.	270	O14649	KCNK3_HUMAN	V	147;270	ENSP00000306275:A270V	ENSP00000306275:A270V	A	+	2	0	KCNK3	26804564	0.999000	0.42202	0.999000	0.59377	0.335000	0.28730	1.621000	0.36986	0.410000	0.25675	-0.350000	0.07774	GCG		0.726	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246861.2	NM_002246	
HAAO	23498	broad.mit.edu	37	2	42994742	42994742	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr2:42994742C>A	ENST00000294973.6	-	9	830	c.775G>T	c.(775-777)Ggg>Tgg	p.G259W		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase									p.G259W(1)		breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						CACGAGGTCCCAGCTAGCACC	0.622																																					p.G259W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G775T	2						.						46.0	36.0	40.0					2																	42994742		2197	4297	6494	42848246	SO:0001583	missense	23498	exon9			Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.775G>T	2.37:g.42994742C>A	ENSP00000294973:p.Gly259Trp	Somatic		Capture	Illumina HiSeq	Phase_I	42848246	NM_012205		Missense_Mutation	SNP	ENST00000294973.6	37	CCDS33187.1	.	.	.	.	.	.	.	.	.	.	c	17.73	3.462131	0.63513	.	.	ENSG00000162882	ENST00000294973	T	0.40476	1.03	4.71	0.617	0.17619	Cupin, RmlC-type (1);	0.646427	0.15358	N	0.266598	T	0.51432	0.1674	M	0.64997	1.995	0.09310	N	1	D	0.76494	0.999	D	0.65987	0.94	T	0.36601	-0.9741	10	0.66056	D	0.02	.	3.8998	0.09155	0.0:0.5142:0.1795:0.3063	.	259	P46952	3HAO_HUMAN	W	259	ENSP00000294973:G259W	ENSP00000294973:G259W	G	-	1	0	HAAO	42848246	0.000000	0.05858	0.090000	0.20809	0.713000	0.41058	0.182000	0.16900	0.105000	0.17753	-0.273000	0.10243	GGG		0.622	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325948.2		
AQP12A	375318	broad.mit.edu	37	2	241631754	241631754	+	Silent	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr2:241631754C>T	ENST00000337801.4	+	2	456	c.387C>T	c.(385-387)caC>caT	p.H129H	AQP12A_ENST00000429564.1_Silent_p.H141H|AC011298.2_ENST00000407635.2_lincRNA	NM_198998.2	NP_945349.1	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	129						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.H129H(1)		endometrium(2)|kidney(3)|large_intestine(2)|lung(7)	14		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GTGACCTGCACCTGCTGCAGA	0.687																																					p.H129H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C387T	2						.						11.0	17.0	15.0					2																	241631754		2028	4231	6259	241280427	SO:0001819	synonymous_variant	375318	exon2			AB040748		2q37.3	2013-06-03	2005-05-26	2005-05-26	ENSG00000184945	ENSG00000184945		"""Ion channels / Aquaporins"""	19941	protein-coding gene	gene with protein product		609789	"""aquaporin 12"""	AQP12			Standard	NM_198998		Approved		uc002vzu.3	Q8IXF9	OTTHUMG00000183906	ENST00000337801.4:c.387C>T	2.37:g.241631754C>T		Somatic		Capture	Illumina HiSeq	Phase_I	241280427	NM_198998		Silent	SNP	ENST00000337801.4	37																																																																																					0.687	AQP12A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257185.2	NM_198998	
NLGN1	22871	broad.mit.edu	37	3	173998301	173998301	+	Silent	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr3:173998301G>A	ENST00000457714.1	+	7	2109	c.1680G>A	c.(1678-1680)acG>acA	p.T560T	NLGN1_ENST00000545397.1_Silent_p.T560T|NLGN1_ENST00000361589.4_Silent_p.T560T|NLGN1_ENST00000401917.3_Silent_p.T600T	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	577					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)	p.T560T(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CTCAAGACACGAAATTCATTC	0.338																																					p.T560T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1680A	3						.						82.0	77.0	78.0					3																	173998301		2203	4300	6503	175480995	SO:0001819	synonymous_variant	22871	exon7			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1680G>A	3.37:g.173998301G>A		Somatic		Capture	Illumina HiSeq	Phase_I	175480995	NM_014932	Q9UPT2	Silent	SNP	ENST00000457714.1	37	CCDS3222.1																																																																																				0.338	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
LAMP3	27074	broad.mit.edu	37	3	182871686	182871686	+	Silent	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr3:182871686G>A	ENST00000265598.3	-	2	798	c.543C>T	c.(541-543)acC>acT	p.T181T	LAMP3_ENST00000466939.1_Silent_p.T157T	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	181	Thr-rich.				cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)		p.T181T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			GCTTCTGACCGGTTGTGCTTT	0.572																																					p.T181T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C543T	3						.						289.0	281.0	284.0					3																	182871686		2203	4300	6503	184354380	SO:0001819	synonymous_variant	27074	exon2			AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.543C>T	3.37:g.182871686G>A		Somatic		Capture	Illumina HiSeq	Phase_I	184354380	NM_014398	D3DNS4|O94781|Q8NEC8	Silent	SNP	ENST00000265598.3	37	CCDS3242.1																																																																																				0.572	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350863.1		
MASP1	5648	broad.mit.edu	37	3	186978653	186978653	+	Silent	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr3:186978653G>A	ENST00000337774.5	-	4	812	c.423C>T	c.(421-423)gaC>gaT	p.D141D	MASP1_ENST00000169293.6_Silent_p.D141D|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000392472.2_Silent_p.D28D|MASP1_ENST00000296280.6_Silent_p.D141D|MASP1_ENST00000392470.2_Silent_p.D115D	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	141	EGF-like; calcium-binding.|Homodimerization. {ECO:0000250}.|Interaction with FCN2.|Interaction with MBL2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.D141D(2)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CCTTGCACTCGTCCACATCTG	0.517																																					p.D141D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C423T	3						.						159.0	117.0	131.0					3																	186978653		2203	4300	6503	188461347	SO:0001819	synonymous_variant	5648	exon4			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.423C>T	3.37:g.186978653G>A		Somatic		Capture	Illumina HiSeq	Phase_I	188461347	NM_001031849	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	ENST00000337774.5	37	CCDS33907.1																																																																																				0.517	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
SYNPO2	171024	broad.mit.edu	37	4	119978983	119978983	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr4:119978983G>T	ENST00000307142.4	+	5	3876	c.3680G>T	c.(3679-3681)aGa>aTa	p.R1227I	SYNPO2_ENST00000448416.2_3'UTR	NM_133477.2	NP_597734.2	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	0						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.R1227I(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CAGGCTTCAAGAAATGATTCT	0.438																																					p.R1227I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3680T	4						.						84.0	79.0	81.0					4																	119978983		2203	4300	6503	120198431	SO:0001583	missense	171024	exon5			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000307142.4:c.3680G>T	4.37:g.119978983G>T	ENSP00000306015:p.Arg1227Ile	Somatic		Capture	Illumina HiSeq	Phase_I	120198431	NM_133477	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000307142.4	37	CCDS34054.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.34|14.34	2.505275|2.505275	0.44558|0.44558	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142	.|T	.|0.09350	.|2.99	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|0.000000	.|0.47455	.|D	.|0.000233	T|T	0.07279|0.07279	0.0184|0.0184	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|B;P	.|0.34462	.|0.325;0.454	.|B;B	.|0.34452	.|0.089;0.183	T|T	0.36040|0.36040	-0.9764|-0.9764	5|9	.|.	.|.	.|.	-17.4777|-17.4777	6.3935|6.3935	0.21599|0.21599	0.0712:0.1322:0.6596:0.137|0.0712:0.1322:0.6596:0.137	.|.	.|1227;1227	.|B9EG60;Q9UMS6-2	.|.;.	N|I	1120|1227	.|ENSP00000306015:R1227I	.|.	K|R	+|+	3|2	2|0	SYNPO2|SYNPO2	120198431|120198431	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.174000|0.174000	0.22865|0.22865	0.836000|0.836000	0.27545|0.27545	2.736000|2.736000	0.93811|0.93811	0.655000|0.655000	0.94253|0.94253	AAG|AGA		0.438	SYNPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364018.1		
RXFP1	59350	broad.mit.edu	37	4	159526228	159526228	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr4:159526228A>T	ENST00000307765.5	+	5	652	c.401A>T	c.(400-402)cAg>cTg	p.Q134L	RXFP1_ENST00000343542.5_Missense_Mutation_p.Q134L|RXFP1_ENST00000423548.1_Missense_Mutation_p.Q134L|RXFP1_ENST00000470033.1_Missense_Mutation_p.Q101L|RXFP1_ENST00000460056.2_Missense_Mutation_p.Q53L|RXFP1_ENST00000448688.2_Missense_Mutation_p.Q53L	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	134					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)	p.Q134L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		AGGTCACTTCAGTGGAACTTA	0.274																																					p.Q134L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A401T	4						.						45.0	44.0	44.0					4																	159526228		1792	4061	5853	159745678	SO:0001583	missense	59350	exon5			AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.401A>T	4.37:g.159526228A>T	ENSP00000303248:p.Gln134Leu	Somatic		Capture	Illumina HiSeq	Phase_I	159745678	NM_021634	B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	37	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	A	12.37	1.918682	0.33908	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000423548;ENST00000448688;ENST00000343542;ENST00000470033	T;T;D;T;T;T	0.90385	0.36;0.36;-2.66;0.36;0.36;0.36	5.75	2.0	0.26442	.	0.294437	0.38897	N	0.001529	D	0.89294	0.6674	M	0.61703	1.905	0.41226	D	0.986548	B;P;B;B;B;B	0.34699	0.152;0.464;0.066;0.026;0.053;0.254	B;B;B;B;B;B	0.43155	0.232;0.41;0.099;0.015;0.096;0.297	T	0.82983	-0.0186	10	0.31617	T	0.26	.	9.0621	0.36440	0.785:0.0:0.215:0.0	.	145;161;53;134;101;134	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;Q9HBX9	.;.;.;.;.;RXFP1_HUMAN	L	53;134;134;53;134;101	ENSP00000423306:Q53L;ENSP00000303248:Q134L;ENSP00000405841:Q134L;ENSP00000414885:Q53L;ENSP00000345889:Q134L;ENSP00000420712:Q101L	ENSP00000303248:Q134L	Q	+	2	0	RXFP1	159745678	0.963000	0.33076	0.405000	0.26409	0.574000	0.36063	3.118000	0.50414	0.123000	0.18342	-0.385000	0.06624	CAG		0.274	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634	
WDFY3	23001	broad.mit.edu	37	4	85704149	85704149	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr4:85704149G>A	ENST00000295888.4	-	25	4548	c.4141C>T	c.(4141-4143)Cgg>Tgg	p.R1381W	WDFY3_ENST00000322366.6_Missense_Mutation_p.R1381W	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1381					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.R1381W(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCAATTGTCCGTGCAGATCCA	0.413																																					p.R1381W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4141T	4						.						154.0	145.0	148.0					4																	85704149		2203	4300	6503	85923173	SO:0001583	missense	23001	exon25			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.4141C>T	4.37:g.85704149G>A	ENSP00000295888:p.Arg1381Trp	Somatic		Capture	Illumina HiSeq	Phase_I	85923173	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753030	0.69648	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.69926	-0.44;-0.44	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.83468	0.5261	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	D	0.84310	0.0510	10	0.62326	D	0.03	.	19.9664	0.97271	0.0:0.0:1.0:0.0	.	1381	Q8IZQ1	WDFY3_HUMAN	W	1381	ENSP00000318466:R1381W;ENSP00000295888:R1381W	ENSP00000295888:R1381W	R	-	1	2	WDFY3	85923173	1.000000	0.71417	0.945000	0.38365	0.459000	0.32528	5.335000	0.65929	2.724000	0.93272	0.650000	0.86243	CGG		0.413	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
VEGFC	7424	broad.mit.edu	37	4	177650771	177650771	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr4:177650771T>C	ENST00000280193.2	-	2	692	c.277A>G	c.(277-279)Aac>Gac	p.N93D	VEGFC_ENST00000507638.1_5'Flank	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	93					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)	p.N93D(1)		biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		TGTTCTCTGTTATGTTGCCAG	0.403																																					p.N93D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A277G	4						.						154.0	142.0	146.0					4																	177650771		1936	4136	6072	177887765	SO:0001583	missense	7424	exon2			BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.277A>G	4.37:g.177650771T>C	ENSP00000280193:p.Asn93Asp	Somatic		Capture	Illumina HiSeq	Phase_I	177887765	NM_005429	B2R9Q8	Missense_Mutation	SNP	ENST00000280193.2	37	CCDS43285.1	.	.	.	.	.	.	.	.	.	.	T	1.640	-0.516697	0.04200	.	.	ENSG00000150630	ENST00000280193	.	.	.	4.69	0.365	0.16131	.	0.588133	0.17826	N	0.160713	T	0.30759	0.0775	L	0.47716	1.5	0.09310	N	1	B	0.19817	0.039	B	0.14023	0.01	T	0.17961	-1.0352	9	0.34782	T	0.22	-4.4006	7.5811	0.27965	0.1317:0.0:0.2747:0.5935	.	93	P49767	VEGFC_HUMAN	D	93	.	ENSP00000280193:N93D	N	-	1	0	VEGFC	177887765	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.017000	0.12590	0.245000	0.21373	-0.535000	0.04281	AAC		0.403	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429	
DNAH5	1767	broad.mit.edu	37	5	13830256	13830256	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr5:13830256G>A	ENST00000265104.4	-	37	6232	c.6128C>T	c.(6127-6129)tCg>tTg	p.S2043L		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2043	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S2043L(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGCTGCAACCGAGAGAACTGG	0.378									Kartagener syndrome																												p.S2043L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6128T	5						.						80.0	80.0	80.0					5																	13830256		2203	4300	6503	13883256	SO:0001583	missense	1767	exon37	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6128C>T	5.37:g.13830256G>A	ENSP00000265104:p.Ser2043Leu	Somatic		Capture	Illumina HiSeq	Phase_I	13883256	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	32	5.176977	0.94846	.	.	ENSG00000039139	ENST00000265104	T	0.45668	0.89	6.17	6.17	0.99709	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.81654	0.4868	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88263	0.2924	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	2043	Q8TE73	DYH5_HUMAN	L	2043	ENSP00000265104:S2043L	ENSP00000265104:S2043L	S	-	2	0	DNAH5	13883256	1.000000	0.71417	0.322000	0.25334	0.977000	0.68977	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	TCG		0.378	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
PCDHGA2	56113	broad.mit.edu	37	5	140720317	140720317	+	Silent	SNP	G	G	A	rs147764693	byFrequency	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr5:140720317G>A	ENST00000394576.2	+	1	1779	c.1779G>A	c.(1777-1779)gcG>gcA	p.A593A	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	593	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A593A(1)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGGTGGCGGTGGACAGAG	0.677													g|||	2	0.000399361	0.0015	0.0	5008	,	,		15185	0.0		0.0	False		,,,				2504	0.0				p.A593A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1779A	5						.						61.0	71.0	68.0					5																	140720317		2203	4298	6501	140700501	SO:0001819	synonymous_variant	56113	exon1			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1779G>A	5.37:g.140720317G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140700501	NM_032009	Q52LL6|Q9Y5D5	Silent	SNP	ENST00000394576.2	37	CCDS47289.1																																																																																				0.677	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
CDH12	1010	broad.mit.edu	37	5	21752211	21752211	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr5:21752211C>T	ENST00000382254.1	-	15	3106	c.2020G>A	c.(2020-2022)Gac>Aac	p.D674N	RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000504376.2_Missense_Mutation_p.D674N|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Missense_Mutation_p.D634N	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	674					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D674N(2)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GCCCCGATGTCGAAAGCCTGG	0.463										HNSCC(59;0.17)																											p.D674N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2020A	5						.						127.0	113.0	118.0					5																	21752211		2203	4300	6503	21787968	SO:0001583	missense	1010	exon15			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2020G>A	5.37:g.21752211C>T	ENSP00000371689:p.Asp674Asn	Somatic		Capture	Illumina HiSeq	Phase_I	21787968	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.698642	0.88830	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	D;D;D	0.82526	-1.62;-1.62;-1.62	5.27	5.27	0.74061	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.92760	0.7698	M	0.88570	2.965	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.995;0.996	D	0.93920	0.7205	10	0.87932	D	0	.	18.8936	0.92414	0.0:1.0:0.0:0.0	.	634;674	B7Z2U6;P55289	.;CAD12_HUMAN	N	674;674;634	ENSP00000423577:D674N;ENSP00000371689:D674N;ENSP00000428786:D634N	ENSP00000371689:D674N	D	-	1	0	CDH12	21787968	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.487000	0.81328	2.477000	0.83638	0.467000	0.42956	GAC		0.463	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
NIM1K	167359	broad.mit.edu	37	5	43246004	43246004	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr5:43246004C>T	ENST00000512796.1	+	2	1626	c.127C>T	c.(127-129)Cgc>Tgc	p.R43C	NIM1_ENST00000326035.2_Missense_Mutation_p.R43C			Q8IY84	NIM1_HUMAN		43					protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.R43S(1)|p.R43C(1)									GGGACAGCCCCGCCAGCTGAC	0.597																																					p.R43C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C127T	5						.						113.0	106.0	108.0					5																	43246004		2203	4300	6503	43281761	SO:0001583	missense	167359	exon2																														ENST00000512796.1:c.127C>T	5.37:g.43246004C>T	ENSP00000420849:p.Arg43Cys	Somatic		Capture	Illumina HiSeq	Phase_I	43281761	NM_153361	B3KVM1	Missense_Mutation	SNP	ENST00000512796.1	37	CCDS3943.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.084137	0.55861	.	.	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.72835	-0.69;-0.69	5.83	5.83	0.93111	.	0.482602	0.21647	N	0.071255	T	0.68449	0.3002	L	0.55481	1.735	0.29377	N	0.863584	D	0.53151	0.958	B	0.40009	0.316	T	0.68606	-0.5364	9	.	.	.	.	20.1356	0.98028	0.0:1.0:0.0:0.0	.	43	Q8IY84	NIM1_HUMAN	C	43	ENSP00000313572:R43C;ENSP00000420849:R43C	.	R	+	1	0	AC114947.1	43281761	0.016000	0.18221	0.054000	0.19295	0.650000	0.38633	1.989000	0.40707	2.755000	0.94549	0.650000	0.86243	CGC		0.597	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1		
ISL1	3670	broad.mit.edu	37	5	50683538	50683538	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr5:50683538G>A	ENST00000230658.7	+	3	1018	c.433G>A	c.(433-435)Gac>Aac	p.D145N	ISL1_ENST00000505475.2_3'UTR|ISL1_ENST00000511384.1_Missense_Mutation_p.D145N	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	145					atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)	p.D145N(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				AGGCGCTGGCGACCCGCTCAG	0.662																																					p.D145N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G433A	5						.						36.0	39.0	38.0					5																	50683538		2065	4198	6263	50719295	SO:0001583	missense	3670	exon3			BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.433G>A	5.37:g.50683538G>A	ENSP00000230658:p.Asp145Asn	Somatic		Capture	Illumina HiSeq	Phase_I	50719295	NM_002202	P20663|P47894	Missense_Mutation	SNP	ENST00000230658.7	37	CCDS43314.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.292|8.292	0.818002|0.818002	0.16607|0.16607	.|.	.|.	ENSG00000016082|ENSG00000016082	ENST00000230658;ENST00000503187;ENST00000511384|ENST00000505475	D;D|.	0.85171|.	-1.95;-1.88|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.224121|.	0.43416|.	D|.	0.000561|.	T|T	0.59335|0.59335	0.2186|0.2186	N|N	0.22421|0.22421	0.69|0.69	0.42723|0.42723	D|D	0.993682|0.993682	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.64495|0.64495	-0.6394|-0.6394	10|6	0.16420|0.87932	T|D	0.52|0	.|.	18.8508|18.8508	0.92227|0.92227	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	145|.	P61371|.	ISL1_HUMAN|.	N|Q	145|91	ENSP00000230658:D145N;ENSP00000422676:D145N|.	ENSP00000230658:D145N|ENSP00000421737:R91Q	D|R	+|+	1|2	0|0	ISL1|ISL1	50719295|50719295	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.296000|0.296000	0.27459|0.27459	6.025000|6.025000	0.70864|0.70864	2.538000|2.538000	0.85594|0.85594	0.456000|0.456000	0.33151|0.33151	GAC|CGA		0.662	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
GRIA1	2890	broad.mit.edu	37	5	153065877	153065877	+	Silent	SNP	C	C	T	rs140876127		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr5:153065877C>T	ENST00000285900.5	+	8	1465	c.1122C>T	c.(1120-1122)gaC>gaT	p.D374D	GRIA1_ENST00000448073.4_Silent_p.D384D|GRIA1_ENST00000340592.5_Silent_p.D374D|GRIA1_ENST00000518142.1_Silent_p.D294D|GRIA1_ENST00000521843.2_Silent_p.D305D|GRIA1_ENST00000518783.1_Silent_p.D384D	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	374					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.D374D(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TGAAACATGACGGCATCCGAA	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		17294	0.001		0.0	False		,,,				2504	0.0				p.D374D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1122T	5						.	C	,	0,4406		0,0,2203	116.0	104.0	108.0		1122,1122	-10.5	0.8	5	dbSNP_134	108	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GRIA1	NM_000827.3,NM_001114183.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	374/907,374/907	153065877	1,13005	2203	4300	6503	153046070	SO:0001819	synonymous_variant	2890	exon8				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1122C>T	5.37:g.153065877C>T		Somatic		Capture	Illumina HiSeq	Phase_I	153046070	NM_001114183	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	ENST00000285900.5	37	CCDS4322.1																																																																																				0.502	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
PDE10A	10846	broad.mit.edu	37	6	165827121	165827121	+	Silent	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr6:165827121G>A	ENST00000366882.1	-	14	1270	c.1116C>T	c.(1114-1116)atC>atT	p.I372I	PDE10A_ENST00000354448.4_Silent_p.I372I|PDE10A_ENST00000539869.2_Silent_p.I382I			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	372	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.I372I(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	CTCGGCTGACGATGGGCATGC	0.478																																					p.I372I	Esophageal Squamous(22;308 615 5753 12038 40624)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1116T	6						.						96.0	79.0	85.0					6																	165827121		2203	4300	6503	165747111	SO:0001819	synonymous_variant	10846	exon14			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1116C>T	6.37:g.165827121G>A		Somatic		Capture	Illumina HiSeq	Phase_I	165747111	NM_006661	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Silent	SNP	ENST00000366882.1	37																																																																																					0.478	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
ME1	4199	broad.mit.edu	37	6	83938647	83938647	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr6:83938647G>A	ENST00000369705.3	-	10	1146	c.1030C>T	c.(1030-1032)Cgt>Tgt	p.R344C	ME1_ENST00000543031.1_Missense_Mutation_p.R269C|ME1_ENST00000541327.1_Missense_Mutation_p.R178C	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	344					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)	p.R344C(1)		NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		AAGGAAGCACGTCCCTAAGTA	0.343																																					p.R344C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1030T	6						.						176.0	167.0	170.0					6																	83938647		2203	4300	6503	83995366	SO:0001583	missense	4199	exon10			X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.1030C>T	6.37:g.83938647G>A	ENSP00000358719:p.Arg344Cys	Somatic		Capture	Illumina HiSeq	Phase_I	83995366	NM_002395	B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Missense_Mutation	SNP	ENST00000369705.3	37	CCDS34492.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422268	0.62622	.	.	ENSG00000065833	ENST00000369705;ENST00000540036;ENST00000541327;ENST00000543031	T;T;T	0.36157	1.27;1.27;1.27	5.86	5.86	0.93980	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.73281	0.3567	H	0.99273	4.495	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.83703	0.0183	10	0.87932	D	0	-16.1536	15.3004	0.73945	0.0:0.0:0.8601:0.1399	.	344	P48163	MAOX_HUMAN	C	344;4;178;269	ENSP00000358719:R344C;ENSP00000439912:R178C;ENSP00000446114:R269C	ENSP00000358719:R344C	R	-	1	0	ME1	83995366	0.978000	0.34361	0.998000	0.56505	0.608000	0.37181	1.819000	0.39022	2.937000	0.99478	0.650000	0.86243	CGT		0.343	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041350.1		
SLC35A1	10559	broad.mit.edu	37	6	88218765	88218765	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr6:88218765C>A	ENST00000369552.4	+	7	785	c.758C>A	c.(757-759)gCa>gAa	p.A253E	SLC35A1_ENST00000369557.5_Missense_Mutation_p.Q172K|SLC35A1_ENST00000369556.3_Missense_Mutation_p.A194E|SLC35A1_ENST00000544441.1_Missense_Mutation_p.A119E|C6orf165_ENST00000506888.1_3'UTR|SLC35A1_ENST00000464978.1_3'UTR	NM_006416.4	NP_006407.1	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid transporter), member A1	253					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|CMP-N-acetylneuraminate transport (GO:0015782)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	CMP-N-acetylneuraminate transmembrane transporter activity (GO:0005456)|sugar:proton symporter activity (GO:0005351)	p.A253E(1)		breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CAAGTTCTTGCAAGTGTTGGT	0.398																																					p.A253E	NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C758A	6						.						134.0	122.0	126.0					6																	88218765		2203	4300	6503	88275484	SO:0001583	missense	10559	exon7			D87969	CCDS5010.1, CCDS55043.1	6q15	2013-05-22			ENSG00000164414	ENSG00000164414		"""Solute carriers"""	11021	protein-coding gene	gene with protein product		605634	"""solute carrier family 35 (UDP-galactose transporter), member 1"""			9010752, 9644260	Standard	NM_006416		Approved	CMPST, hCST	uc011dzj.2	P78382	OTTHUMG00000015177	ENST00000369552.4:c.758C>A	6.37:g.88218765C>A	ENSP00000358565:p.Ala253Glu	Somatic		Capture	Illumina HiSeq	Phase_I	88275484	NM_006416	Q5W1L8	Missense_Mutation	SNP	ENST00000369552.4	37	CCDS5010.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.5|23.5	4.419163|4.419163	0.83559|0.83559	.|.	.|.	ENSG00000164414|ENSG00000164414	ENST00000369556;ENST00000544441;ENST00000369552|ENST00000369557	T;T;T|.	0.41400|.	1.0;1.0;1.0|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.061259|.	0.64402|.	U|.	0.000004|.	T|T	0.46054|0.46054	0.1373|0.1373	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	P;P;B|.	0.46457|.	0.772;0.878;0.051|.	B;P;B|.	0.49361|.	0.345;0.608;0.043|.	T|T	0.50457|0.50457	-0.8826|-0.8826	10|6	0.54805|0.02654	T|T	0.06|1	-31.3172|-31.3172	19.8278|19.8278	0.96624|0.96624	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	253;194;119|.	P78382;Q5W1L8;B4DEM1|.	S35A1_HUMAN;.;.|.	E|K	194;119;253|172	ENSP00000358569:A194E;ENSP00000438603:A119E;ENSP00000358565:A253E|.	ENSP00000358565:A253E|ENSP00000358570:Q172K	A|Q	+|+	2|1	0|0	SLC35A1|SLC35A1	88275484|88275484	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.940000|0.940000	0.58332|0.58332	7.487000|7.487000	0.81328|0.81328	2.690000|2.690000	0.91761|0.91761	0.460000|0.460000	0.39030|0.39030	GCA|CAA		0.398	SLC35A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041446.1		
MDN1	23195	broad.mit.edu	37	6	90503600	90503600	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr6:90503600G>A	ENST00000369393.3	-	5	851	c.736C>T	c.(736-738)Cgt>Tgt	p.R246C	MDN1_ENST00000428876.1_Missense_Mutation_p.R246C			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	246					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.R246C(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTCTGCTTACGCCAAAGGGAG	0.522																																					p.R246C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C736T	6						.						83.0	73.0	76.0					6																	90503600		2203	4300	6503	90560321	SO:0001583	missense	23195	exon5			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.736C>T	6.37:g.90503600G>A	ENSP00000358400:p.Arg246Cys	Somatic		Capture	Illumina HiSeq	Phase_I	90560321	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	1.186	-0.636829	0.03557	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.18174	3.99;3.99;2.23	5.17	2.18	0.27775	.	0.802743	0.11773	N	0.530941	T	0.03220	0.0094	N	0.14661	0.345	0.30547	N	0.765882	B;B	0.12630	0.004;0.006	B;B	0.08055	0.002;0.003	T	0.39231	-0.9624	10	0.56958	D	0.05	.	7.2212	0.25988	0.0661:0.107:0.6076:0.2193	.	246;246	Q6ZVV6;Q9NU22	.;MDN1_HUMAN	C	246	ENSP00000358400:R246C;ENSP00000413970:R246C;ENSP00000409664:R246C	ENSP00000358400:R246C	R	-	1	0	MDN1	90560321	0.994000	0.37717	0.693000	0.30195	0.053000	0.15095	2.171000	0.42453	0.198000	0.20407	-2.696000	0.00138	CGT		0.522	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
THBS2	7058	broad.mit.edu	37	6	169648945	169648945	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr6:169648945C>T	ENST00000366787.3	-	4	425	c.176G>A	c.(175-177)cGc>cAc	p.R59H		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	59	Heparin-binding. {ECO:0000255}.|Laminin G-like.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R59H(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GTAGTCAAAGCGCACGAAGCG	0.592																																					p.R59H	Esophageal Squamous(91;219 1934 18562 44706)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G176A	6						.						126.0	104.0	111.0					6																	169648945		2203	4300	6503	169390870	SO:0001583	missense	7058	exon4				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.176G>A	6.37:g.169648945C>T	ENSP00000355751:p.Arg59His	Somatic		Capture	Illumina HiSeq	Phase_I	169390870	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173667	0.78452	.	.	ENSG00000186340	ENST00000366787;ENST00000435791	T;T	0.02258	4.37;4.37	4.42	4.42	0.53409	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.37530	U	0.002054	T	0.07413	0.0187	M	0.72894	2.215	0.51012	D	0.999903	D	0.89917	1.0	D	0.87578	0.998	T	0.21008	-1.0258	10	0.49607	T	0.09	-51.1463	17.4031	0.87466	0.0:1.0:0.0:0.0	.	59	P35442	TSP2_HUMAN	H	59	ENSP00000355751:R59H;ENSP00000398928:R59H	ENSP00000355751:R59H	R	-	2	0	THBS2	169390870	1.000000	0.71417	0.405000	0.26409	0.389000	0.30415	7.304000	0.78882	2.180000	0.69256	0.462000	0.41574	CGC		0.592	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
CARD11	84433	broad.mit.edu	37	7	2966389	2966389	+	Silent	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr7:2966389G>A	ENST00000396946.4	-	14	2194	c.1791C>T	c.(1789-1791)gaC>gaT	p.D597D		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	597					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.D590D(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GATCTAAGGCGTCAAACCCGC	0.577			Mis		DLBCL																																p.D597D			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1791T	7						.						84.0	64.0	71.0					7																	2966389		2203	4300	6503	2932915	SO:0001819	synonymous_variant	84433	exon14			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1791C>T	7.37:g.2966389G>A		Somatic		Capture	Illumina HiSeq	Phase_I	2932915	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	ENST00000396946.4	37	CCDS5336.2																																																																																				0.577	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
SDK1	221935	broad.mit.edu	37	7	4051759	4051759	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr7:4051759C>G	ENST00000404826.2	+	16	2451	c.2312C>G	c.(2311-2313)cCc>cGc	p.P771R	SDK1_ENST00000389531.3_Missense_Mutation_p.P771R	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	771	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.P771R(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCCAGTGCTCCCCCGAAAAAT	0.512																																					p.P771R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2312G	7						.						150.0	167.0	161.0					7																	4051759		2203	4300	6503	4018285	SO:0001583	missense	221935	exon16			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2312C>G	7.37:g.4051759C>G	ENSP00000385899:p.Pro771Arg	Somatic		Capture	Illumina HiSeq	Phase_I	4018285	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305236	0.60305	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.59083	0.29;0.29	5.28	5.28	0.74379	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.81389	0.4812	H	0.95917	3.74	0.80722	D	1	D;P	0.52996	0.957;0.955	P;P	0.55667	0.781;0.677	D	0.87826	0.2641	10	0.87932	D	0	.	18.9486	0.92632	0.0:1.0:0.0:0.0	.	771;771	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	R	771	ENSP00000385899:P771R;ENSP00000374182:P771R	ENSP00000374182:P771R	P	+	2	0	SDK1	4018285	1.000000	0.71417	1.000000	0.80357	0.553000	0.35397	7.389000	0.79806	2.479000	0.83701	0.655000	0.94253	CCC		0.512	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
GNAI1	2770	broad.mit.edu	37	7	79840317	79840317	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr7:79840317G>A	ENST00000351004.3	+	6	996	c.623G>A	c.(622-624)cGg>cAg	p.R208Q	GNAI1_ENST00000457358.2_Missense_Mutation_p.R156Q	NM_002069.5	NP_002060.4	P63096	GNAI1_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	208					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|response to peptide hormone (GO:0043434)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R208Q(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	19						AGATCTGAGCGGAAGAAGTGG	0.423																																					p.R208Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G623A	7						.						164.0	139.0	148.0					7																	79840317		2203	4300	6503	79678253	SO:0001583	missense	2770	exon6			AL049933	CCDS5595.1, CCDS59061.1	7q21-q22	2008-07-18			ENSG00000127955	ENSG00000127955			4384	protein-coding gene	gene with protein product	"""Gi1 protein alpha subunit"""	139310				3110783	Standard	NM_002069		Approved		uc003uhb.1	P63096	OTTHUMG00000023523	ENST00000351004.3:c.623G>A	7.37:g.79840317G>A	ENSP00000343027:p.Arg208Gln	Somatic		Capture	Illumina HiSeq	Phase_I	79678253	NM_002069	A8KA88|B4E2V1|C9J3A4|P04898|P11015|P31871|Q5U074|Q8TAN5|Q9UGA4	Missense_Mutation	SNP	ENST00000351004.3	37	CCDS5595.1	.	.	.	.	.	.	.	.	.	.	G	36	5.888254	0.97068	.	.	ENSG00000127955	ENST00000351004;ENST00000457358	D;D	0.92752	-3.1;-3.1	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.97620	0.9220	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.69654	0.965	D	0.98457	1.0594	9	.	.	.	.	19.8478	0.96722	0.0:0.0:1.0:0.0	.	208	P63096	GNAI1_HUMAN	Q	208;156	ENSP00000343027:R208Q;ENSP00000410572:R156Q	.	R	+	2	0	GNAI1	79678253	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.685000	0.91497	0.650000	0.86243	CGG		0.423	GNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253254.1	NM_002069	
NOM1	64434	broad.mit.edu	37	7	156752548	156752548	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr7:156752548G>A	ENST00000275820.3	+	4	1327	c.1312G>A	c.(1312-1314)Ggt>Agt	p.G438S	NOM1_ENST00000460332.1_3'UTR	NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	438	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G438S(1)		endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CTTTCAGGTCGGTGCCCACTT	0.443																																					p.G438S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1312A	7						.						75.0	68.0	70.0					7																	156752548		2203	4300	6503	156445309	SO:0001583	missense	64434	exon4			AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.1312G>A	7.37:g.156752548G>A	ENSP00000275820:p.Gly438Ser	Somatic		Capture	Illumina HiSeq	Phase_I	156445309	NM_138400	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.139368	0.56936	.	.	ENSG00000146909	ENST00000275820	T	0.23348	1.91	4.93	4.03	0.46877	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.54565	0.1866	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61387	-0.7073	10	0.52906	T	0.07	-22.0765	14.5674	0.68188	0.0:0.0:0.8524:0.1476	.	438	Q5C9Z4	NOM1_HUMAN	S	438	ENSP00000275820:G438S	ENSP00000275820:G438S	G	+	1	0	NOM1	156445309	1.000000	0.71417	0.669000	0.29828	0.084000	0.17831	8.866000	0.92307	1.052000	0.40392	-0.291000	0.09656	GGT		0.443	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
OPRK1	4986	broad.mit.edu	37	8	54163467	54163467	+	Missense_Mutation	SNP	G	G	A	rs199804328		TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr8:54163467G>A	ENST00000265572.3	-	2	428	c.131C>T	c.(130-132)tCg>tTg	p.S44L	OPRK1_ENST00000520287.1_Missense_Mutation_p.S44L	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	44					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)	p.S44L(1)		NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CGCGTCCTCCGAGCCGGCGCT	0.721																																					p.S44L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C131T	8						.						17.0	15.0	16.0					8																	54163467		2179	4267	6446	54326020	SO:0001583	missense	4986	exon2				CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.131C>T	8.37:g.54163467G>A	ENSP00000265572:p.Ser44Leu	Somatic		Capture	Illumina HiSeq	Phase_I	54326020	NM_000912	E5RHC9|Q499G4	Missense_Mutation	SNP	ENST00000265572.3	37	CCDS6152.1	.	.	.	.	.	.	.	.	.	.	g	13.22	2.173526	0.38413	.	.	ENSG00000082556	ENST00000265572;ENST00000520287;ENST00000396798	T;T	0.36699	1.24;1.24	4.96	1.93	0.25924	.	1.849860	0.01921	N	0.040481	T	0.29684	0.0741	L	0.47716	1.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13308	-1.0514	10	0.10377	T	0.69	.	4.3053	0.10944	0.1797:0.0:0.4081:0.4122	.	44	P41145	OPRK_HUMAN	L	44;44;30	ENSP00000265572:S44L;ENSP00000429706:S44L	ENSP00000265572:S44L	S	-	2	0	OPRK1	54326020	0.001000	0.12720	0.000000	0.03702	0.793000	0.44817	0.844000	0.27654	0.690000	0.31570	0.457000	0.33378	TCG		0.721	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
RP1	6101	broad.mit.edu	37	8	55541260	55541260	+	Silent	SNP	A	A	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr8:55541260A>T	ENST00000220676.1	+	4	4966	c.4818A>T	c.(4816-4818)acA>acT	p.T1606T		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1606					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.T1606T(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CATATAAAACATCCAGTGATG	0.408																																					p.T1606T	Colon(91;1014 1389 7634 14542 40420)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A4818T	8						.						70.0	69.0	69.0					8																	55541260		2203	4300	6503	55703813	SO:0001819	synonymous_variant	6101	exon4			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.4818A>T	8.37:g.55541260A>T		Somatic		Capture	Illumina HiSeq	Phase_I	55703813	NM_006269		Silent	SNP	ENST00000220676.1	37	CCDS6160.1																																																																																				0.408	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
DCAF4L2	138009	broad.mit.edu	37	8	88886022	88886022	+	Nonsense_Mutation	SNP	G	G	A	rs148443990	byFrequency	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr8:88886022G>A	ENST00000319675.3	-	1	274	c.178C>T	c.(178-180)Cag>Tag	p.Q60*		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	60								p.Q60*(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						CTATGAATCTGGACCTTTTTC	0.502																																					p.Q60X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C178T	8						.						127.0	117.0	120.0					8																	88886022		2203	4300	6503	88955138	SO:0001587	stop_gained	138009	exon1			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.178C>T	8.37:g.88886022G>A	ENSP00000316496:p.Gln60*	Somatic		Capture	Illumina HiSeq	Phase_I	88955138	NM_152418		Nonsense_Mutation	SNP	ENST00000319675.3	37	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652805	0.47362	.	.	ENSG00000176566	ENST00000319675	.	.	.	1.92	-0.681	0.11342	.	0.631337	0.17424	N	0.174718	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.054	0.06179	0.0:0.2929:0.4121:0.295	.	.	.	.	X	60	.	ENSP00000316496:Q60X	Q	-	1	0	DCAF4L2	88955138	0.989000	0.36119	0.020000	0.16555	0.042000	0.13812	0.088000	0.14979	0.750000	0.32877	0.467000	0.42956	CAG		0.502	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
DOCK8	81704	broad.mit.edu	37	9	339009	339009	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr9:339009G>A	ENST00000453981.1	+	13	1538	c.1426G>A	c.(1426-1428)Gga>Aga	p.G476R	DOCK8_ENST00000432829.2_Missense_Mutation_p.G408R|DOCK8_ENST00000469391.1_Missense_Mutation_p.G408R			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	476					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.G408R(1)		breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TTGGCAGGAAGGAGATCGCCT	0.393																																					p.G408R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1222A	9						.						114.0	94.0	101.0					9																	339009		2203	4300	6503	329009	SO:0001583	missense	81704	exon12			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.1426G>A	9.37:g.339009G>A	ENSP00000408464:p.Gly476Arg	Somatic		Capture	Illumina HiSeq	Phase_I	329009	NM_001190458	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	37	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	G	34	5.358716	0.95854	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391	T;T;T	0.43688	0.94;0.94;0.94	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.68787	0.3039	M	0.81497	2.545	0.80722	D	1	D;D	0.67145	0.996;0.992	D;D	0.70487	0.969;0.954	T	0.68542	-0.5381	10	0.56958	D	0.05	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	408;476	E9PH09;Q8NF50	.;DOCK8_HUMAN	R	476;476;408;408	ENSP00000408464:G476R;ENSP00000394888:G408R;ENSP00000419438:G408R	ENSP00000287364:G476R	G	+	1	0	DOCK8	329009	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.086000	0.76885	2.894000	0.99253	0.655000	0.94253	GGA		0.393	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
DAPK1	1612	broad.mit.edu	37	9	90265000	90265000	+	Silent	SNP	C	C	T			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chr9:90265000C>T	ENST00000408954.3	+	16	1928	c.1593C>T	c.(1591-1593)gcC>gcT	p.A531A	DAPK1_ENST00000469640.2_Silent_p.A531A|DAPK1_ENST00000472284.1_Silent_p.A531A|DAPK1_ENST00000491893.1_Silent_p.A531A|DAPK1_ENST00000358077.5_Silent_p.A531A	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	531					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A531A(1)|p.A532A(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						AGTGTCTGGCCGAACATGGAG	0.562									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.A531A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1593T	9						.						50.0	52.0	51.0					9																	90265000		1960	4143	6103	89454820	SO:0001819	synonymous_variant	1612	exon16	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.1593C>T	9.37:g.90265000C>T		Somatic		Capture	Illumina HiSeq	Phase_I	89454820	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	ENST00000408954.3	37	CCDS43842.1																																																																																				0.562	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
PDZD11	51248	broad.mit.edu	37	X	69508315	69508315	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chrX:69508315G>A	ENST00000239666.4	-	3	268	c.136C>T	c.(136-138)Cga>Tga	p.R46*	KIF4A_ENST00000374388.3_5'Flank|PDZD11_ENST00000374454.1_Nonsense_Mutation_p.R46*|PDZD11_ENST00000473667.1_5'UTR|KIF4A_ENST00000374403.3_5'Flank	NM_016484.4	NP_057568.1	Q5EBL8	PDZ11_HUMAN	PDZ domain containing 11	46						basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	protein C-terminus binding (GO:0008022)	p.R46*(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)	9						GTGATGGTTCGGGGCAGAAAC	0.488																																					p.R46X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C136T	X						.						122.0	97.0	106.0					X																	69508315		2203	4300	6503	69425040	SO:0001587	stop_gained	51248	exon3			AF151061	CCDS14400.1	Xq13.1	2008-02-05		2006-01-24	ENSG00000120509	ENSG00000120509			28034	protein-coding gene	gene with protein product		300632		PDZK11		11042152, 12975309	Standard	NM_016484		Approved		uc004dyd.1	Q5EBL8	OTTHUMG00000021771	ENST00000239666.4:c.136C>T	X.37:g.69508315G>A	ENSP00000239666:p.Arg46*	Somatic		Capture	Illumina HiSeq	Phase_I	69425040	NM_016484	D3DVU3|Q6UWE1|Q9P0Q1	Nonsense_Mutation	SNP	ENST00000239666.4	37	CCDS14400.1	.	.	.	.	.	.	.	.	.	.	G	36	5.665705	0.96745	.	.	ENSG00000120509	ENST00000239666;ENST00000374454	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4144	0.83729	0.0:0.0:1.0:0.0	.	.	.	.	X	46	.	ENSP00000239666:R46X	R	-	1	2	PDZD11	69425040	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	5.521000	0.67086	2.336000	0.79503	0.600000	0.82982	CGA		0.488	PDZD11-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057060.1	NM_016484	
CPXCR1	53336	broad.mit.edu	37	X	88009170	88009170	+	Missense_Mutation	SNP	G	G	A	rs41307393	byFrequency	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chrX:88009170G>A	ENST00000276127.4	+	3	1014	c.755G>A	c.(754-756)gGt>gAt	p.G252D	CPXCR1_ENST00000373111.1_Missense_Mutation_p.G252D	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	252							metal ion binding (GO:0046872)	p.G252D(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						AATATAAAAGGTTTTGTGGAT	0.333																																					p.G252D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G755A	X						.						31.0	29.0	30.0					X																	88009170		2202	4294	6496	87895826	SO:0001583	missense	53336	exon3			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.755G>A	X.37:g.88009170G>A	ENSP00000276127:p.Gly252Asp	Somatic		Capture	Illumina HiSeq	Phase_I	87895826	NM_001184771	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.338410	0.24253	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.24350	1.86;1.86	3.43	-1.32	0.09201	.	1.642850	0.03711	N	0.250142	T	0.11707	0.0285	N	0.12182	0.205	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.14476	-1.0471	9	.	.	.	-0.039	0.3507	0.00348	0.1885:0.2811:0.1995:0.3309	.	252	Q8N123	CPXCR_HUMAN	D	252	ENSP00000276127:G252D;ENSP00000362203:G252D	.	G	+	2	0	CPXCR1	87895826	0.002000	0.14202	0.003000	0.11579	0.014000	0.08584	-1.610000	0.02064	-0.419000	0.07439	-0.223000	0.12442	GGT		0.333	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048	
PAK3	5063	broad.mit.edu	37	X	110437580	110437580	+	Silent	SNP	C	C	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chrX:110437580C>A	ENST00000372010.1	+	15	1531	c.1089C>A	c.(1087-1089)ggC>ggA	p.G363G	PAK3_ENST00000360648.4_Silent_p.G384G|PAK3_ENST00000372007.5_Silent_p.G348G|PAK3_ENST00000417227.1_Silent_p.G369G|PAK3_ENST00000446737.1_Silent_p.G348G|PAK3_ENST00000519681.1_Silent_p.G369G|PAK3_ENST00000425146.1_Silent_p.G348G|PAK3_ENST00000262836.4_Silent_p.G363G|PAK3_ENST00000518291.1_Silent_p.G384G			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	363	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.G348G(1)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						TGGCTGGTGGCTCTCTGACTG	0.448										TSP Lung(19;0.15)																											p.G348G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1044A	X						.						245.0	202.0	217.0					X																	110437580		2203	4300	6503	110324236	SO:0001819	synonymous_variant	5063	exon12			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1089C>A	X.37:g.110437580C>A		Somatic		Capture	Illumina HiSeq	Phase_I	110324236	NM_001128166	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Silent	SNP	ENST00000372010.1	37	CCDS48153.1																																																																																				0.448	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
NLGN4Y	22829	broad.mit.edu	37	Y	16941909	16941909	+	3'UTR	SNP	G	G	A			TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3842-01A-01W-0995-10	TCGA-AA-3842-10A-01W-0995-10	g.chrY:16941909G>A	ENST00000476359.1	+	0	1656							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.V371I(1)		large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						CATGCTGGGCGTCAACCAAGG	0.582																																					p.V371I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1111A	Y						.						28.0	23.0	24.0					Y																	16941909		606	1929	2535	15451303	SO:0001624	3_prime_UTR_variant	22829	exon5				CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*1653G>A	Y.37:g.16941909G>A		Somatic		Capture	Illumina HiSeq	Phase_I	15451303	NM_014893	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Missense_Mutation	SNP	ENST00000476359.1	37																																																																																					0.582	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893	
