#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF22	7570	broad.mit.edu	37	10	45499897	45499898	+	3'UTR	INS	-	-	AAAATT	rs57376331|rs112642104|rs67383081	byFrequency	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	-	-	-	AAAATT	-	AAAATT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr10:45499897_45499898insAAAATT	ENST00000298299.3	+	0	1674_1675				CEP164P1_ENST00000456938.2_RNA	NM_006963.4	NP_008894.2	P17026	ZNF22_HUMAN	zinc finger protein 22						odontogenesis (GO:0042476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(2)|lung(2)	8		Prostate(175;0.0352)|all_neural(218;0.202)				CTGTGGAAGAAAAAAGGGAGAA	0.337														3720	0.742812	0.7761	0.8112	5008	,	,		17508	0.619		0.7624	False		,,,				2504	0.7566				.												.	.	0			.	10						.																																			44819904	SO:0001624	3_prime_UTR_variant	7570	.			BC041139	CCDS7211.1	10q11	2013-01-08	2012-07-12		ENSG00000165512	ENSG00000165512		"""Zinc fingers, C2H2-type"""	13012	protein-coding gene	gene with protein product		194529					Standard	NM_006963		Approved	KOX15, HKR-T1, ZNF422, Zfp422	uc001jbw.3	P17026	OTTHUMG00000018064	ENST00000298299.3:c.*407->AAAATT	10.37:g.45499897_45499898insAAAATT		Germline		Capture	Illumina HiSeq	Phase_I	44819903	.	Q5T741|Q96FM4	Splice_Site	INS	ENST00000298299.3	37	CCDS7211.1																																																																																				0.337	ZNF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047761.1	NM_006963	
TACC2	10579	broad.mit.edu	37	10	123847146	123847146	+	Silent	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr10:123847146C>T	ENST00000369005.1	+	4	5471	c.5131C>T	c.(5131-5133)Ctg>Ttg	p.L1711L	TACC2_ENST00000515273.1_Silent_p.L1711L|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000334433.3_Silent_p.L1711L|TACC2_ENST00000453444.2_Silent_p.L1711L|TACC2_ENST00000515603.1_Silent_p.L1711L|TACC2_ENST00000513429.1_Intron	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1711					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.L1711L(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				TGACATCACCCTGAGCACAGC	0.617																																					p.L1711L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5131T	10						.						60.0	46.0	51.0					10																	123847146		2203	4300	6503	123837136	SO:0001819	synonymous_variant	10579	exon4			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.5131C>T	10.37:g.123847146C>T		Somatic		Capture	Illumina HiSeq	Phase_I	123837136	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	ENST00000369005.1	37	CCDS7626.1																																																																																				0.617	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
CUBN	8029	broad.mit.edu	37	10	16916407	16916407	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr10:16916407T>A	ENST00000377833.4	-	58	9267	c.9202A>T	c.(9202-9204)Atc>Ttc	p.I3068F		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3068	CUB 23. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.I3068F(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTAACGGTGATGGTATACAGA	0.418																																					p.I3068F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A9202T	10						.						223.0	181.0	195.0					10																	16916407		2203	4300	6503	16956413	SO:0001583	missense	8029	exon58			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9202A>T	10.37:g.16916407T>A	ENSP00000367064:p.Ile3068Phe	Somatic		Capture	Illumina HiSeq	Phase_I	16956413	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.666412	0.47677	.	.	ENSG00000107611	ENST00000377833	T	0.46819	0.86	5.23	4.07	0.47477	CUB (5);	0.171581	0.27725	N	0.018104	T	0.44414	0.1292	M	0.77406	2.37	0.80722	D	1	P	0.39624	0.681	B	0.36289	0.221	T	0.41998	-0.9477	10	0.48119	T	0.1	.	6.2146	0.20648	0.0:0.0843:0.1707:0.745	.	3068	O60494	CUBN_HUMAN	F	3068	ENSP00000367064:I3068F	ENSP00000367064:I3068F	I	-	1	0	CUBN	16956413	1.000000	0.71417	0.145000	0.22337	0.061000	0.15899	2.005000	0.40864	0.905000	0.36596	0.533000	0.62120	ATC		0.418	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
FRMPD2	143162	broad.mit.edu	37	10	49386192	49386192	+	Silent	SNP	A	A	C	rs201577264		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr10:49386192A>C	ENST00000374201.3	-	22	3095	c.2793T>G	c.(2791-2793)ggT>ggG	p.G931G	FRMPD2_ENST00000463706.1_5'UTR|FRMPD2_ENST00000407470.4_Silent_p.G899G|FRMPD2_ENST00000474573.1_5'Flank|FRMPD2_ENST00000305531.3_Silent_p.G906G	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	931					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.G931G(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		AAGAACCAGCACCCTGCCATA	0.443																																					p.G931G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2793G	10						.						4.0	5.0	5.0					10																	49386192		1988	3969	5957	49056198	SO:0001819	synonymous_variant	143162	exon22			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2793T>G	10.37:g.49386192A>C		Somatic		Capture	Illumina HiSeq	Phase_I	49056198	NM_001018071	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	ENST00000374201.3	37	CCDS31195.1																																																																																				0.443	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428	
GHITM	27069	broad.mit.edu	37	10	85903785	85903785	+	Silent	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr10:85903785G>A	ENST00000372134.3	+	4	457	c.264G>A	c.(262-264)ggG>ggA	p.G88G		NM_014394.2	NP_055209.2	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein	88					apoptotic process (GO:0006915)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.G88G(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(2)	10						TTGCTGGAGGGGCTGCTGTTG	0.413																																					p.G88G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G264A	10						.						248.0	253.0	251.0					10																	85903785		2012	4173	6185	85893765	SO:0001819	synonymous_variant	27069	exon4			AB009685	CCDS41542.1	10q23.1	2008-02-01			ENSG00000165678	ENSG00000165678			17281	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 5"""					8619474, 9110174	Standard	NM_014394		Approved	HSPC282, PTD010, DERP2, My021, TMBIM5	uc001kcs.1	Q9H3K2	OTTHUMG00000018637	ENST00000372134.3:c.264G>A	10.37:g.85903785G>A		Somatic		Capture	Illumina HiSeq	Phase_I	85893765	NM_014394	A8K9Z9|D3DWE0|O95894|Q5VT95|Q9H0P2	Silent	SNP	ENST00000372134.3	37	CCDS41542.1																																																																																				0.413	GHITM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049125.1	NM_014394	
ZNF518A	9849	broad.mit.edu	37	10	97918490	97918490	+	RNA	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr10:97918490C>T	ENST00000534948.1	+	0	3268							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TCTAGTAACACTCCAAATAAA	0.388																																					p.T804I												.	.	0			c.C2411T	10						.						47.0	46.0	46.0					10																	97918490		1853	4084	5937	97908480			9849	exon6			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97918490C>T		Somatic		Capture	Illumina HiSeq	Phase_I	97908480	NM_014803	A0PJI5|O15044|Q32MP4	Missense_Mutation	SNP	ENST00000534948.1	37																																																																																					0.388	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803	
ADAM12	8038	broad.mit.edu	37	10	127789672	127789672	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr10:127789672G>A	ENST00000368679.4	-	9	1198	c.889C>T	c.(889-891)Cgc>Tgc	p.R297C	ADAM12_ENST00000368676.4_Missense_Mutation_p.R297C	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	297	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.R297C(2)		biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TGGGATTTGCGAGGTAGAAGC	0.488																																					p.R297C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C889T	10						.						100.0	84.0	90.0					10																	127789672		2203	4300	6503	127779662	SO:0001583	missense	8038	exon9			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.889C>T	10.37:g.127789672G>A	ENSP00000357668:p.Arg297Cys	Somatic		Capture	Illumina HiSeq	Phase_I	127779662	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	37	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452607	0.84209	.	.	ENSG00000148848	ENST00000368679;ENST00000368676	D;D	0.88975	-2.45;-2.45	5.32	4.39	0.52855	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.272209	0.34435	N	0.003962	D	0.96021	0.8704	H	0.96301	3.8	0.58432	D	0.999991	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;P;P;P;D	0.69479	0.91;0.854;0.854;0.854;0.964	D	0.97354	0.9965	10	0.87932	D	0	.	15.0955	0.72232	0.0:0.0:0.8573:0.1427	.	294;294;297;294;297	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	C	297	ENSP00000357668:R297C;ENSP00000357665:R297C	ENSP00000357665:R297C	R	-	1	0	ADAM12	127779662	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.381000	0.73163	1.405000	0.46838	0.655000	0.94253	CGC		0.488	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
TBC1D10C	374403	broad.mit.edu	37	11	67177158	67177159	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr11:67177158_67177159insC	ENST00000542590.1	+	9	1288_1289	c.1274_1275insC	c.(1273-1278)ggccccfs	p.GP425fs	TBC1D10C_ENST00000312390.5_Frame_Shift_Ins_p.GP425fs|TBC1D10C_ENST00000526387.1_3'UTR			Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	425	Interaction with calcineurin.				retrograde transport, endosome to Golgi (GO:0042147)	filopodium membrane (GO:0031527)|membrane (GO:0016020)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CGGGCCCGGGGCCCCCCCATCG	0.683																																					p.G425fs												.	.	0			c.1274_1275insC	11						.																																			66933735	SO:0001589	frameshift_variant	374403	exon10			BC035630	CCDS8162.1, CCDS58150.1	11q13.1	2013-07-09			ENSG00000175463	ENSG00000175463			24702	protein-coding gene	gene with protein product		610831				17230191, 20404108	Standard	NM_001256508		Approved	FLJ00332, Carabin, EPI64C	uc001ola.4	Q8IV04	OTTHUMG00000167139	ENST00000542590.1:c.1281dupC	11.37:g.67177165_67177165dupC	ENSP00000443654:p.Gly425fs	None		Capture	Illumina HiSeq	Phase_I	66933734	NM_198517	G3V1D6	Frame_Shift_Ins	INS	ENST00000542590.1	37	CCDS8162.1																																																																																				0.683	TBC1D10C-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395492.2	NM_198517	
SLC43A3	29015	broad.mit.edu	37	11	57188794	57188794	+	Silent	SNP	G	G	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr11:57188794G>T	ENST00000395123.2	-	6	718	c.414C>A	c.(412-414)atC>atA	p.I138I	SLC43A3_ENST00000529554.1_Silent_p.I138I|SLC43A3_ENST00000533524.1_Silent_p.I151I|SLC43A3_ENST00000352187.1_Silent_p.I138I|SLC43A3_ENST00000528098.1_5'UTR|SLC43A3_ENST00000395124.1_Silent_p.I138I	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	138					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.I138I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						TGAGAAACAGGATTCCCCCAA	0.562																																					p.I138I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C414A	11						.						76.0	74.0	75.0					11																	57188794		2201	4296	6497	56945370	SO:0001819	synonymous_variant	5553	exon6			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.414C>A	11.37:g.57188794G>T		Somatic		Capture	Illumina HiSeq	Phase_I	56945370	NM_199329	B4DNR8|E7EQD2|Q9NSS4	Silent	SNP	ENST00000395123.2	37	CCDS7956.1																																																																																				0.562	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611	
GANAB	23193	broad.mit.edu	37	11	62406878	62406878	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr11:62406878G>C	ENST00000356638.3	-	3	221	c.205C>G	c.(205-207)Ctt>Gtt	p.L69V	GANAB_ENST00000540933.1_Intron|GANAB_ENST00000534779.1_Intron|GANAB_ENST00000534422.1_5'UTR|GANAB_ENST00000346178.4_Missense_Mutation_p.L69V	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	69					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)	p.L69V(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	TCAGGACCAAGCTGTAGAGAG	0.572																																					p.L69V	Melanoma(23;1005 1074 15747 18937)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C205G	11						.						107.0	99.0	102.0					11																	62406878		2202	4299	6501	62163454	SO:0001583	missense	23193	exon3			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.205C>G	11.37:g.62406878G>C	ENSP00000349053:p.Leu69Val	Somatic		Capture	Illumina HiSeq	Phase_I	62163454	NM_198335	A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	ENST00000356638.3	37	CCDS8026.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065556	0.36470	.	.	ENSG00000089597	ENST00000346178;ENST00000356638	D;D	0.88431	-2.38;-2.29	4.79	3.84	0.44239	Glycoside hydrolase-type carbohydrate-binding (1);	0.203514	0.43919	D	0.000513	D	0.82614	0.5075	L	0.37800	1.135	0.80722	D	1	B;B	0.31790	0.066;0.34	B;B	0.32928	0.028;0.155	T	0.77811	-0.2449	10	0.24483	T	0.36	-10.0341	11.8687	0.52509	0.0:0.0:0.824:0.176	.	69;69	Q14697;Q14697-2	GANAB_HUMAN;.	V	69	ENSP00000340466:L69V;ENSP00000349053:L69V	ENSP00000340466:L69V	L	-	1	0	GANAB	62163454	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.895000	0.63214	1.192000	0.43071	0.556000	0.70494	CTT		0.572	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334	
TRPC6	7225	broad.mit.edu	37	11	101347215	101347215	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr11:101347215A>G	ENST00000344327.3	-	6	1985	c.1561T>C	c.(1561-1563)Tat>Cat	p.Y521H	TRPC6_ENST00000348423.4_Missense_Mutation_p.Y405H|TRPC6_ENST00000532133.1_Intron|TRPC6_ENST00000360497.4_Missense_Mutation_p.Y466H	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	521					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.Y521H(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TCAAACAAATATTCCTTGGGG	0.413																																					p.Y521H	Colon(166;1315 1927 11094 12848 34731)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1561C	11						.						78.0	74.0	76.0					11																	101347215		2203	4299	6502	100852425	SO:0001583	missense	7225	exon6			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1561T>C	11.37:g.101347215A>G	ENSP00000340913:p.Tyr521His	Somatic		Capture	Illumina HiSeq	Phase_I	100852425	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.589052	0.86851	.	.	ENSG00000137672	ENST00000344327;ENST00000348423;ENST00000360497	D;D;D	0.99353	-5.77;-5.77;-5.77	5.67	5.67	0.87782	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99435	0.9800	M	0.84511	2.7	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.91635	0.999;0.958;0.999	D	0.98727	1.0711	10	0.87932	D	0	-16.9274	16.2147	0.82198	1.0:0.0:0.0:0.0	.	466;405;521	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	H	521;405;466	ENSP00000340913:Y521H;ENSP00000343672:Y405H;ENSP00000353687:Y466H	ENSP00000340913:Y521H	Y	-	1	0	TRPC6	100852425	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.279000	0.95777	2.284000	0.76573	0.523000	0.50628	TAT		0.413	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
TP53AIP1	63970	broad.mit.edu	37	11	128807493	128807493	+	Intron	SNP	T	T	C			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr11:128807493T>C	ENST00000531399.1	-	2	351				TP53AIP1_ENST00000458238.2_Intron|TP53AIP1_ENST00000530777.1_Intron|TP53AIP1_ENST00000602346.1_Missense_Mutation_p.D74G	NM_022112.2	NP_071395.2	Q9HCN2	TPIP1_HUMAN	tumor protein p53 regulated apoptosis inducing protein 1						apoptotic process (GO:0006915)	mitochondrion (GO:0005739)		p.D74G(1)		large_intestine(1)|lung(1)|skin(1)	3						ACTTGGGATGTCGGCACCACG	0.592																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	11						.						75.0	71.0	72.0					11																	128807493		2201	4297	6498	128312703	SO:0001627	intron_variant	63970	.			AB045831	CCDS8480.1, CCDS8480.2, CCDS55797.1, CCDS55798.1, CCDS58195.1	11q24.3	2011-01-26	2009-03-09		ENSG00000120471	ENSG00000120471			29984	protein-coding gene	gene with protein product		605426				11030628, 12019168	Standard	NM_022112		Approved	p53AIP1	uc021qsd.1	Q9HCN2		ENST00000531399.1:c.141+79A>G	11.37:g.128807493T>C		Somatic		Capture	Illumina HiSeq	Phase_I	128312703	.	Q6NT40|Q7Z6F7|Q9HCN0|Q9HCN1	Missense_Mutation	SNP	ENST00000531399.1	37	CCDS8480.2	.	.	.	.	.	.	.	.	.	.	T	9.200	1.028208	0.19512	.	.	ENSG00000120471	ENST00000263583	.	.	.	1.85	0.694	0.18062	.	.	.	.	.	T	0.29126	0.0724	.	.	.	0.09310	N	0.999999	B	0.28850	0.225	B	0.28849	0.095	T	0.30179	-0.9987	7	0.87932	D	0	.	3.6617	0.08241	0.0:0.2072:0.0:0.7928	.	74	Q9HCN2-3	.	G	74	.	ENSP00000263583:D74G	D	-	2	0	TP53AIP1	128312703	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	0.033000	0.13754	0.187000	0.20147	0.383000	0.25322	GAC		0.592	TP53AIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386244.1	NM_022112	
PRMT8	56341	broad.mit.edu	37	12	3659225	3659225	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr12:3659225G>A	ENST00000382622.3	+	3	775	c.385G>A	c.(385-387)Gct>Act	p.A129T	PRMT8_ENST00000261252.4_3'UTR|PRMT8_ENST00000452611.2_Missense_Mutation_p.A120T	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	129	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.A129T(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			TTCCATGTTCGCTGCCAAGGC	0.577																																					p.A129T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G385A	12						.						176.0	147.0	157.0					12																	3659225		2203	4300	6503	3529486	SO:0001583	missense	56341	exon3			AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.385G>A	12.37:g.3659225G>A	ENSP00000372067:p.Ala129Thr	Somatic		Capture	Illumina HiSeq	Phase_I	3529486	NM_019854	B2RDP0|Q8TBJ8	Missense_Mutation	SNP	ENST00000382622.3	37	CCDS8521.2	.	.	.	.	.	.	.	.	.	.	G	18.21	3.573940	0.65765	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	T;T	0.30182	1.54;1.54	5.79	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.69360	0.3102	H	0.98333	4.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.68943	0.953;0.961	T	0.81134	-0.1071	10	0.87932	D	0	.	12.61	0.56546	0.08:0.0:0.92:0.0	.	120;129	Q9NR22-2;Q9NR22	.;ANM8_HUMAN	T	120;129	ENSP00000414507:A120T;ENSP00000372067:A129T	ENSP00000372067:A129T	A	+	1	0	PRMT8	3529486	1.000000	0.71417	0.991000	0.47740	0.162000	0.22319	9.813000	0.99286	1.451000	0.47736	-0.136000	0.14681	GCT		0.577	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854	
TAS2R30	259293	broad.mit.edu	37	12	11286467	11286467	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr12:11286467T>C	ENST00000539585.1	-	1	776	c.377A>G	c.(376-378)aAg>aGg	p.K126R	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	126					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.K126R(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						AACAACACTCTTAACTCTCCT	0.388																																					p.K126R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A377G	12						.						120.0	125.0	123.0					12																	11286467		2078	4243	6321	11177734	SO:0001583	missense	259293	exon1			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.377A>G	12.37:g.11286467T>C	ENSP00000444736:p.Lys126Arg	Somatic		Capture	Illumina HiSeq	Phase_I	11177734	NM_001097643	Q645X7	Missense_Mutation	SNP	ENST00000539585.1	37	CCDS53750.1	.	.	.	.	.	.	.	.	.	.	-	7.119	0.577557	0.13686	.	.	ENSG00000256188	ENST00000539585	T	0.37584	1.19	2.6	-0.0792	0.13711	.	.	.	.	.	T	0.29491	0.0735	L	0.52905	1.665	0.09310	N	1	B	0.20459	0.045	B	0.26614	0.071	T	0.34700	-0.9818	9	0.46703	T	0.11	.	3.0474	0.06158	0.0:0.1518:0.2525:0.5957	.	126	P59541	T2R30_HUMAN	R	126	ENSP00000444736:K126R	ENSP00000444736:K126R	K	-	2	0	TAS2R30	11177734	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	-0.133000	0.10451	-0.137000	0.11455	-0.940000	0.02684	AAG		0.388	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
LARP4	113251	broad.mit.edu	37	12	50860773	50860773	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr12:50860773C>T	ENST00000398473.2	+	13	1527	c.1415C>T	c.(1414-1416)gCt>gTt	p.A472V	LARP4_ENST00000429001.3_Missense_Mutation_p.A478V|LARP4_ENST00000518444.1_Missense_Mutation_p.A471V|LARP4_ENST00000293618.8_Missense_Mutation_p.A401V|LARP4_ENST00000347328.5_Missense_Mutation_p.A401V	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	472					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.A472V(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						GAATCAAAGGCTCCAACACCA	0.403																																					p.A472V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1415T	12						.						131.0	118.0	122.0					12																	50860773		1856	4099	5955	49147040	SO:0001583	missense	113251	exon13			AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.1415C>T	12.37:g.50860773C>T	ENSP00000381490:p.Ala472Val	Somatic		Capture	Illumina HiSeq	Phase_I	49147040	NM_052879	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	ENST00000398473.2	37	CCDS41782.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975466	0.34848	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000398473;ENST00000518444;ENST00000520064;ENST00000347328	T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73	4.99	4.1	0.47936	.	0.674956	0.15265	N	0.271563	T	0.16257	0.0391	N	0.16478	0.41	0.09310	N	0.999991	B;B;B;B;B;B	0.20550	0.007;0.0;0.0;0.0;0.0;0.046	B;B;B;B;B;B	0.15484	0.013;0.007;0.003;0.003;0.002;0.012	T	0.15780	-1.0425	10	0.26408	T	0.33	.	12.4711	0.55787	0.0:0.9201:0.0:0.0799	.	373;471;401;401;472;478	Q71RC2-2;Q71RC2-3;G3XAA8;G5E976;Q71RC2;Q71RC2-4	.;.;.;.;LARP4_HUMAN;.	V	401;478;472;471;373;401	ENSP00000293618:A401V;ENSP00000415464:A478V;ENSP00000381490:A472V;ENSP00000429077:A471V;ENSP00000340901:A401V	ENSP00000293618:A401V	A	+	2	0	LARP4	49147040	1.000000	0.71417	0.978000	0.43139	0.966000	0.64601	3.018000	0.49625	1.428000	0.47296	0.455000	0.32223	GCT		0.403	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	NM_052879	
GPR12	2835	broad.mit.edu	37	13	27333899	27333899	+	Silent	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr13:27333899C>T	ENST00000381436.2	-	1	528	c.66G>A	c.(64-66)gcG>gcA	p.A22A	GPR12_ENST00000405846.3_Silent_p.A22A			P47775	GPR12_HUMAN	G protein-coupled receptor 12	22					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)	p.A22A(1)		endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		AGATGTTCTCCGCAGCAGCGG	0.537																																					p.A22A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G66A	13						.						50.0	56.0	54.0					13																	27333899		2203	4300	6503	26231899	SO:0001819	synonymous_variant	2835	exon2			U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.66G>A	13.37:g.27333899C>T		Somatic		Capture	Illumina HiSeq	Phase_I	26231899	NM_005288	Q5T8P3	Silent	SNP	ENST00000381436.2	37	CCDS9319.1																																																																																				0.537	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044257.2		
PCDH17	27253	broad.mit.edu	37	13	58240617	58240617	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr13:58240617G>A	ENST00000377918.3	+	2	2607	c.2581G>A	c.(2581-2583)Gca>Aca	p.A861T		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	861					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A861T(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CAATTTTCCCGCAGAGCCCAA	0.408																																					p.A861T	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2581A	13						.						79.0	80.0	79.0					13																	58240617		2203	4300	6503	57138618	SO:0001583	missense	27253	exon2			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2581G>A	13.37:g.58240617G>A	ENSP00000367151:p.Ala861Thr	Somatic		Capture	Illumina HiSeq	Phase_I	57138618	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	7.662	0.685117	0.14973	.	.	ENSG00000118946	ENST00000377918	T	0.52295	0.67	5.83	5.83	0.93111	.	0.052108	0.85682	D	0.000000	T	0.25457	0.0619	N	0.04203	-0.255	0.43267	D	0.995214	B;B	0.14012	0.009;0.003	B;B	0.10450	0.005;0.001	T	0.16158	-1.0412	9	.	.	.	.	13.3298	0.60479	0.0719:0.0:0.9281:0.0	.	861;861	O14917-2;O14917	.;PCD17_HUMAN	T	861	ENSP00000367151:A861T	.	A	+	1	0	PCDH17	57138618	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.267000	0.58877	2.761000	0.94854	0.650000	0.86243	GCA		0.408	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
DOCK9	23348	broad.mit.edu	37	13	99536084	99536084	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr13:99536084A>T	ENST00000376460.1	-	22	2532	c.2452T>A	c.(2452-2454)Tct>Act	p.S818T	DOCK9_ENST00000442173.1_Missense_Mutation_p.S818T|DOCK9_ENST00000448493.2_Missense_Mutation_p.S830T|DOCK9_ENST00000339416.2_Missense_Mutation_p.S819T	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	819	DHR-1.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S819T(1)		breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TACACTGTAGAAACCAGATGA	0.383																																					p.S818T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2452A	13						.						70.0	70.0	70.0					13																	99536084		1856	4090	5946	98334085	SO:0001583	missense	23348	exon22			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.2452T>A	13.37:g.99536084A>T	ENSP00000365643:p.Ser818Thr	Somatic		Capture	Illumina HiSeq	Phase_I	98334085	NM_001130050	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	37	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.570580	0.86542	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	T;T;T;T	0.34072	1.38;1.38;1.38;1.38	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.59595	0.2205	M	0.71581	2.175	0.58432	D	0.999999	P;D;D;D;D	0.76494	0.87;0.985;0.988;0.998;0.999	P;D;D;D;D	0.76575	0.855;0.926;0.939;0.95;0.988	T	0.63269	-0.6675	10	0.62326	D	0.03	.	15.4651	0.75394	1.0:0.0:0.0:0.0	.	819;818;818;818;819	A6H8Z6;E9PFM9;B3KX25;Q9BZ29-5;Q9BZ29	.;.;.;.;DOCK9_HUMAN	T	818;819;819;819;818;819;830;818	ENSP00000365643:S818T;ENSP00000341086:S819T;ENSP00000401958:S830T;ENSP00000406883:S818T	ENSP00000341086:S819T	S	-	1	0	DOCK9	98334085	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.910000	0.92685	2.112000	0.64535	0.533000	0.62120	TCT		0.383	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
MIR337	442905	broad.mit.edu	37	14	101340842	101340843	+	RNA	INS	-	-	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr14:101340842_101340843insG	ENST00000362281.1	+	0	13_14				MIR665_ENST00000606903.1_RNA	NR_029889.1				microRNA 337																		AGTCAGTAGTTGGGGGGTGGGA	0.599																																					.												.	.	0			.	14						.																																			100410596			442905	.					14q32.2	2011-09-12		2008-12-18	ENSG00000199151	ENSG00000199151		"""ncRNAs / Micro RNAs"""	31774	non-coding RNA	RNA, micro				MIRN337			Standard	NR_029889		Approved	hsa-mir-337	uc010txi.2				14.37:g.101340848_101340848dupG		Somatic		Capture	Illumina HiSeq	Phase_I	100410595	.		RNA	INS	ENST00000362281.1	37																																																																																					0.599	MIR337-201	KNOWN	basic	miRNA	miRNA		NR_029889	
FNTB	2342	broad.mit.edu	37	14	65499349	65499349	+	Silent	SNP	C	C	G	rs148288483		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr14:65499349C>G	ENST00000246166.2	+	7	861	c.627C>G	c.(625-627)tcC>tcG	p.S209S	FNTB_ENST00000542227.1_Silent_p.S163S|FNTB_ENST00000447296.2_Silent_p.S243S|MAX_ENST00000341653.2_Intron|CHURC1-FNTB_ENST00000549987.1_Silent_p.S244S	NM_002028.3	NP_002019.1	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	209					negative regulation of cell proliferation (GO:0008285)|phototransduction, visible light (GO:0007603)|positive regulation of cell cycle (GO:0045787)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|protein farnesylation (GO:0018343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to cytokine (GO:0034097)|response to inorganic substance (GO:0010035)|response to organic cyclic compound (GO:0014070)|rhodopsin mediated signaling pathway (GO:0016056)|wound healing (GO:0042060)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	farnesyltranstransferase activity (GO:0004311)|protein farnesyltransferase activity (GO:0004660)|zinc ion binding (GO:0008270)	p.S209S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GTGCTGCCTCCGTAGCCTCGC	0.542																																					p.S209S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C627G	14						.						109.0	84.0	92.0					14																	65499349		2203	4300	6503	64569102	SO:0001819	synonymous_variant	2342	exon7				CCDS9769.1	14q23.3	2011-09-28			ENSG00000257365	ENSG00000257365			3785	protein-coding gene	gene with protein product		134636				8276393	Standard	NM_002028		Approved	FPTB		P49356	OTTHUMG00000142811	ENST00000246166.2:c.627C>G	14.37:g.65499349C>G		Somatic		Capture	Illumina HiSeq	Phase_I	64569102	NM_002028	B2RDX6|B4E1A0	Silent	SNP	ENST00000246166.2	37	CCDS9769.1																																																																																				0.542	FNTB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000286392.1	NM_002028	
VASH1	22846	broad.mit.edu	37	14	77229329	77229329	+	Silent	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr14:77229329C>T	ENST00000167106.4	+	1	798	c.165C>T	c.(163-165)gaC>gaT	p.D55D	RP11-99E15.2_ENST00000556271.1_lincRNA|VASH1_ENST00000554237.1_Silent_p.D55D	NM_014909.4	NP_055724.1	Q7L8A9	VASH1_HUMAN	vasohibin 1	55					angiogenesis (GO:0001525)|cell cycle arrest (GO:0007050)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of lymphangiogenesis (GO:1901491)|regulation of cellular senescence (GO:2000772)|response to wounding (GO:0009611)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)		p.D55D(2)		breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|urinary_tract(3)	10			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0283)		ACCTGCGAGACGGAGGCGTCC	0.622																																					p.D55D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C165T	14						.						57.0	41.0	47.0					14																	77229329		2153	4254	6407	76299082	SO:0001819	synonymous_variant	22846	exon1			AB028959	CCDS9851.1	14q24.3	2006-09-25	2005-08-16	2005-08-16		ENSG00000071246			19964	protein-coding gene	gene with protein product		609011	"""KIAA1036"""	KIAA1036			Standard	NM_014909		Approved		uc001xst.2	Q7L8A9		ENST00000167106.4:c.165C>T	14.37:g.77229329C>T		Somatic		Capture	Illumina HiSeq	Phase_I	76299082	NM_014909	Q96H02|Q9UBF4|Q9Y629	Silent	SNP	ENST00000167106.4	37	CCDS9851.1																																																																																				0.622	VASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413706.1	NM_014909	
CTD-2524L6.3	0	broad.mit.edu	37	15	72109940	72109940	+	RNA	SNP	C	C	T	rs561915025		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr15:72109940C>T	ENST00000563041.1	+	0	0				CTD-2524L6.3_ENST00000561834.1_RNA|NR2E3_ENST00000398840.2_RNA|CTD-2524L6.3_ENST00000562658.1_RNA														p.A295V(1)									TTTATCACTGCGGAACGCATC	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		17529	0.0		0.0	False		,,,				2504	0.001				p.C383C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1149T	15						.						114.0	114.0	114.0					15																	72109940		1915	4123	6038	69896994			10002	exon8																															15.37:g.72109940C>T		Somatic		Capture	Illumina HiSeq	Phase_I	69896994	NM_014249		Missense_Mutation	SNP	ENST00000563041.1	37		.	.	.	.	.	.	.	.	.	.	C	14.54	2.565185	0.45694	.	.	ENSG00000031544	ENST00000326995	.	.	.	5.3	5.3	0.74995	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.173798	0.52532	D	0.000065	T	0.64316	0.2587	.	.	.	0.28037	N	0.933915	P	0.51791	0.948	P	0.50270	0.636	T	0.66196	-0.5984	7	0.34782	T	0.22	.	17.7463	0.88422	0.0:1.0:0.0:0.0	.	383	Q9Y5X4	NR2E3_HUMAN	V	295	.	ENSP00000317199:A295V	A	+	2	0	NR2E3	69896994	0.999000	0.42202	0.299000	0.25016	0.942000	0.58702	7.322000	0.79097	2.474000	0.83562	0.563000	0.77884	GCG		0.493	CTD-2524L6.3-002	KNOWN	basic	antisense	antisense	OTTHUMT00000420826.1		
SNUPN	10073	broad.mit.edu	37	15	75902272	75902272	+	Missense_Mutation	SNP	C	C	T	rs377184433		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr15:75902272C>T	ENST00000564644.1	-	5	945	c.367G>A	c.(367-369)Gtg>Atg	p.V123M	SNUPN_ENST00000567134.1_Missense_Mutation_p.V123M|SNUPN_ENST00000371091.5_Missense_Mutation_p.V165M|SNUPN_ENST00000308588.5_Missense_Mutation_p.V123M|SNUPN_ENST00000564675.1_Missense_Mutation_p.V123M			O95149	SPN1_HUMAN	snurportin 1	123	Necessary for interaction with XPO1.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein import into nucleus (GO:0006606)|RNA metabolic process (GO:0016070)|snRNA import into nucleus (GO:0061015)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	protein transporter activity (GO:0008565)|RNA cap binding (GO:0000339)	p.V123M(1)		endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)	8						ACAGGGCACACGACCACAATC	0.498																																					p.V123M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G367A	15						.		MET/VAL,MET/VAL,MET/VAL	1,4393		0,1,2196	94.0	78.0	83.0		367,367,367	4.6	1.0	15		83	0,8588		0,0,4294	no	missense,missense,missense	SNUPN	NM_001042581.1,NM_001042588.1,NM_005701.3	21,21,21	0,1,6490	TT,TC,CC		0.0,0.0228,0.0077	benign,benign,benign	123/361,123/361,123/361	75902272	1,12981	2197	4294	6491	73689327	SO:0001583	missense	10073	exon4			AF039029	CCDS10281.1	15q24.2	2008-02-05	2006-07-14	2006-07-14	ENSG00000169371	ENSG00000169371			14245	protein-coding gene	gene with protein product		607902	"""RNA, U transporter 1"""	RNUT1		9670026	Standard	NM_005701		Approved	SNURPORTIN-1, Snurportin1	uc002bas.3	O95149	OTTHUMG00000142833	ENST00000564644.1:c.367G>A	15.37:g.75902272C>T	ENSP00000454852:p.Val123Met	Somatic		Capture	Illumina HiSeq	Phase_I	73689327	NM_001042581	A6NE34|A8K0B0|D3DW76	Missense_Mutation	SNP	ENST00000564644.1	37	CCDS10281.1	.	.	.	.	.	.	.	.	.	.	N	21.8	4.195745	0.78902	2.28E-4	0.0	ENSG00000169371	ENST00000308588;ENST00000371091	T;T	0.63255	-0.03;-0.03	5.51	4.56	0.56223	.	0.116409	0.56097	D	0.000021	T	0.64692	0.2621	L	0.49126	1.545	0.58432	D	0.999998	D;D	0.64830	0.963;0.994	B;P	0.50352	0.159;0.638	T	0.66056	-0.6018	10	0.45353	T	0.12	-14.5938	15.2446	0.73497	0.0:0.8596:0.1404:0.0	.	165;123	C9K0X5;O95149	.;SPN1_HUMAN	M	123;165	ENSP00000309831:V123M;ENSP00000360132:V165M	ENSP00000309831:V123M	V	-	1	0	SNUPN	73689327	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.741000	0.55090	2.622000	0.88805	0.531000	0.56144	GTG		0.498	SNUPN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420332.1	NM_005701	
ADAMTSL3	57188	broad.mit.edu	37	15	84651614	84651614	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr15:84651614G>T	ENST00000286744.5	+	21	3458	c.3234G>T	c.(3232-3234)aaG>aaT	p.K1078N	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.K1078N	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1078						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.K1078N(1)		NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGAAGAATAAGCAGTTTGAAG	0.463																																					p.K1078N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3234T	15						.						76.0	75.0	75.0					15																	84651614		2203	4300	6503	82442618	SO:0001583	missense	57188	exon21			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3234G>T	15.37:g.84651614G>T	ENSP00000286744:p.Lys1078Asn	Somatic		Capture	Illumina HiSeq	Phase_I	82442618	NM_207517	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030037	0.54790	.	.	ENSG00000156218	ENST00000286744	T	0.65732	-0.17	5.43	1.94	0.25998	.	0.468250	0.16183	N	0.225759	T	0.71108	0.3301	M	0.64997	1.995	0.09310	N	1	P;D	0.76494	0.935;0.999	P;D	0.66084	0.723;0.941	T	0.59193	-0.7500	10	0.66056	D	0.02	.	8.29	0.31952	0.2332:0.1309:0.6359:0.0	.	1078;1078	P82987-2;P82987	.;ATL3_HUMAN	N	1078	ENSP00000286744:K1078N	ENSP00000286744:K1078N	K	+	3	2	ADAMTSL3	82442618	0.992000	0.36948	0.806000	0.32338	0.948000	0.59901	1.342000	0.33919	0.609000	0.30018	0.557000	0.71058	AAG		0.463	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
PTX4	390667	broad.mit.edu	37	16	1537746	1537746	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr16:1537746G>C	ENST00000447419.2	-	2	392	c.367C>G	c.(367-369)Cgg>Ggg	p.R123G	PTX4_ENST00000293922.1_Missense_Mutation_p.R118G|PTX4_ENST00000440447.2_Intron			Q96A99	PTX4_HUMAN	pentraxin 4, long	123						extracellular region (GO:0005576)	metal ion binding (GO:0046872)	p.R118G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						TCCAAGGCCCGCAGCCGCGTG	0.692																																					p.R118G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C352G	16						.																																			1477747	SO:0001583	missense	390667	exon2				CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.367C>G	16.37:g.1537746G>C	ENSP00000445277:p.Arg123Gly	Somatic		Capture	Illumina HiSeq	Phase_I	1477747	NM_001013658		Missense_Mutation	SNP	ENST00000447419.2	37		.	.	.	.	.	.	.	.	.	.	G	5.061	0.196936	0.09599	.	.	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.05319	3.61;3.46	5.58	4.63	0.57726	.	0.707266	0.12337	N	0.477831	T	0.05777	0.0151	L	0.36672	1.1	0.09310	N	1	B	0.30973	0.302	B	0.24848	0.056	T	0.22312	-1.0220	10	0.48119	T	0.1	.	7.571	0.27907	0.1759:0.0:0.8241:0.0	.	118	Q96A99-2	.	G	123;118	ENSP00000445277:R123G;ENSP00000293922:R118G	ENSP00000293922:R118G	R	-	1	2	PTX4	1477747	0.810000	0.29049	0.908000	0.35775	0.008000	0.06430	1.064000	0.30579	2.638000	0.89438	0.655000	0.94253	CGG		0.692	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658	
HYDIN	54768	broad.mit.edu	37	16	71094481	71094481	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr16:71094481C>T	ENST00000393567.2	-	18	2605	c.2455G>A	c.(2455-2457)Gtc>Atc	p.V819I	HYDIN_ENST00000448089.2_Missense_Mutation_p.V819I|HYDIN_ENST00000541601.1_Missense_Mutation_p.V836I|HYDIN_ENST00000448691.1_Missense_Mutation_p.V819I|HYDIN_ENST00000538248.1_Missense_Mutation_p.V846I|HYDIN_ENST00000321489.5_Missense_Mutation_p.V819I	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	819					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.V819I(3)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TCTTTTAGGACGTAGATATTC	0.473																																					p.V819I												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G2455A	16						.						3.0	3.0	3.0					16																	71094481		1676	3544	5220	69651982	SO:0001583	missense	54768	exon18			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2455G>A	16.37:g.71094481C>T	ENSP00000377197:p.Val819Ile	Somatic		Capture	Illumina HiSeq	Phase_I	69651982	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297051	0.60086	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601	T;T;T;T;T;T	0.06687	4.89;3.27;3.35;3.35;3.34;3.34	4.69	4.69	0.59074	.	0.000000	0.30109	U	0.010394	T	0.31638	0.0803	M	0.85041	2.73	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.987	D;D;D;B	0.71870	0.975;0.975;0.975;0.377	T	0.11299	-1.0593	10	0.33141	T	0.24	.	16.4729	0.84119	0.0:1.0:0.0:0.0	.	846;836;819;819	B4DRN4;F5H6V3;Q4G0P3-5;F8WD23	.;.;.;.	I	819;819;819;819;819;846;836	ENSP00000377197:V819I;ENSP00000398544:V819I;ENSP00000394826:V819I;ENSP00000314736:V819I;ENSP00000444970:V846I;ENSP00000437341:V836I	ENSP00000313052:V819I	V	-	1	0	HYDIN	69651982	0.999000	0.42202	0.946000	0.38457	0.282000	0.26991	5.245000	0.65405	2.168000	0.68352	0.603000	0.83216	GTC		0.473	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
ZFHX3	463	broad.mit.edu	37	16	72984709	72984709	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr16:72984709C>A	ENST00000268489.5	-	3	3547	c.2875G>T	c.(2875-2877)Gac>Tac	p.D959Y	ZFHX3_ENST00000397992.5_Missense_Mutation_p.D45Y	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	959					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.D959Y(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCCAGCATGTCCAGGTTGTCC	0.602																																					p.D959Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2875T	16						.						101.0	86.0	91.0					16																	72984709		2198	4300	6498	71542210	SO:0001583	missense	463	exon3			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2875G>T	16.37:g.72984709C>A	ENSP00000268489:p.Asp959Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	71542210	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.549622	0.65311	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.53423	0.62;0.62	5.08	5.08	0.68730	.	0.000000	0.52532	D	0.000064	T	0.62998	0.2474	L	0.43923	1.385	0.80722	D	1	D	0.65815	0.995	D	0.74348	0.983	T	0.66320	-0.5953	10	0.87932	D	0	.	18.4867	0.90831	0.0:1.0:0.0:0.0	.	959	Q15911	ZFHX3_HUMAN	Y	959;45	ENSP00000268489:D959Y;ENSP00000438926:D45Y	ENSP00000268489:D959Y	D	-	1	0	ZFHX3	71542210	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.767000	0.85331	2.349000	0.79799	0.561000	0.74099	GAC		0.602	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
BLMH	642	broad.mit.edu	37	17	28599766	28599766	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr17:28599766T>A	ENST00000261714.6	-	8	1127	c.953A>T	c.(952-954)gAt>gTt	p.D318V	BLMH_ENST00000582669.1_5'Flank|BLMH_ENST00000394819.3_Missense_Mutation_p.D231V	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	318					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.D318V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	AACCTCTCCATCTTTGATGGA	0.383																																					p.D318V	Pancreas(127;628 1772 12912 33293 36203)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A953T	17						.						169.0	162.0	164.0					17																	28599766		2203	4300	6503	25623892	SO:0001583	missense	642	exon8			X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.953A>T	17.37:g.28599766T>A	ENSP00000261714:p.Asp318Val	Somatic		Capture	Illumina HiSeq	Phase_I	25623892	NM_000386	B2R796|Q53F86|Q9UER9	Missense_Mutation	SNP	ENST00000261714.6	37	CCDS32604.1	.	.	.	.	.	.	.	.	.	.	T	15.68	2.906463	0.52333	.	.	ENSG00000108578	ENST00000261714;ENST00000394819	T;T	0.49720	0.77;0.77	5.71	5.71	0.89125	.	0.270600	0.42964	D	0.000621	T	0.55449	0.1921	M	0.83312	2.635	0.80722	D	1	B;B	0.28998	0.138;0.23	B;B	0.35859	0.154;0.212	T	0.54892	-0.8225	10	0.30078	T	0.28	-26.8469	13.7279	0.62769	0.0:0.0:0.0:1.0	.	231;318	E7EMN3;Q13867	.;BLMH_HUMAN	V	318;231	ENSP00000261714:D318V;ENSP00000378296:D231V	ENSP00000261714:D318V	D	-	2	0	BLMH	25623892	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.795000	0.62489	2.171000	0.68590	0.533000	0.62120	GAT		0.383	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447940.1	NM_000386	
KRT37	8688	broad.mit.edu	37	17	39580623	39580623	+	Silent	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr17:39580623G>A	ENST00000225550.3	-	1	152	c.153C>T	c.(151-153)caC>caT	p.H51H	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	51	Head.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.H51H(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				CTCTGTTGGCGTGTGCCACGT	0.612																																					p.H51H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C153T	17						.						48.0	48.0	48.0					17																	39580623		2203	4300	6503	36834149	SO:0001819	synonymous_variant	8688	exon1			Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.153C>T	17.37:g.39580623G>A		Somatic		Capture	Illumina HiSeq	Phase_I	36834149	NM_003770		Silent	SNP	ENST00000225550.3	37	CCDS32653.1																																																																																				0.612	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770	
WNT3	7473	broad.mit.edu	37	17	44846126	44846126	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr17:44846126C>T	ENST00000225512.5	-	4	790	c.628G>A	c.(628-630)Ggg>Agg	p.G210R		NM_030753.4	NP_110380.1	P56703	WNT3_HUMAN	wingless-type MMTV integration site family, member 3	210					anterior/posterior axis specification (GO:0009948)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell fate commitment (GO:0045165)|cell morphogenesis (GO:0000902)|cellular response to retinoic acid (GO:0071300)|dorsal/ventral axis specification (GO:0009950)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|gamete generation (GO:0007276)|head morphogenesis (GO:0060323)|limb bud formation (GO:0060174)|mammary gland epithelium development (GO:0061180)|mesoderm formation (GO:0001707)|negative regulation of axon extension involved in axon guidance (GO:0048843)|neuron differentiation (GO:0030182)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of gene expression (GO:0010628)|Spemann organizer formation at the anterior end of the primitive streak (GO:0060064)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.G210R(1)		endometrium(2)|large_intestine(6)|lung(4)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(9;0.0257)			CCCGACAGCCCGTGGCACTTG	0.622																																					p.G210R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G628A	17						.						70.0	73.0	72.0					17																	44846126		2203	4300	6503	42201295	SO:0001583	missense	7473	exon4			AY009397	CCDS11505.1	17q21-q22	2013-02-28				ENSG00000108379		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12782	protein-coding gene	gene with protein product	"""WNT-3 proto-oncogene protein"""	165330		INT4		8244403	Standard	NM_030753		Approved	MGC131950, MGC138321, MGC138323	uc002ikv.3	P56703		ENST00000225512.5:c.628G>A	17.37:g.44846126C>T	ENSP00000225512:p.Gly210Arg	Somatic		Capture	Illumina HiSeq	Phase_I	42201295	NM_030753	Q2M237|Q9H1J9	Missense_Mutation	SNP	ENST00000225512.5	37	CCDS11505.1	.	.	.	.	.	.	.	.	.	.	C	30	5.057147	0.93846	.	.	ENSG00000108379	ENST00000225512	D	0.84370	-1.84	5.16	5.16	0.70880	Secreted growth factor Wnt protein, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.95671	0.8592	H	0.97852	4.09	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97183	0.9852	10	0.87932	D	0	.	18.8438	0.92196	0.0:1.0:0.0:0.0	.	210	P56703	WNT3_HUMAN	R	210	ENSP00000225512:G210R	ENSP00000225512:G210R	G	-	1	0	WNT3	42201295	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	7.651000	0.83577	2.676000	0.91093	0.561000	0.74099	GGG		0.622	WNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440427.1	NM_030753	
KIF2B	84643	broad.mit.edu	37	17	51901675	51901675	+	Silent	SNP	A	A	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr17:51901675A>T	ENST00000268919.4	+	1	1437	c.1281A>T	c.(1279-1281)gcA>gcT	p.A427A		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	427	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A427A(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GGAGCCATGCAGTGTTCCAGA	0.498																																					p.A427A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1281T	17						.						84.0	66.0	72.0					17																	51901675		2203	4300	6503	49256674	SO:0001819	synonymous_variant	84643	exon1			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1281A>T	17.37:g.51901675A>T		Somatic		Capture	Illumina HiSeq	Phase_I	49256674	NM_032559	Q96MA2|Q9BXG6	Silent	SNP	ENST00000268919.4	37	CCDS32685.1																																																																																				0.498	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559	
CYB5D1	124637	broad.mit.edu	37	17	7762865	7762865	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr17:7762865A>G	ENST00000332439.4	+	4	774	c.622A>G	c.(622-624)Atg>Gtg	p.M208V	LSMD1_ENST00000575071.1_5'Flank|LSMD1_ENST00000570555.1_Intron|CYB5D1_ENST00000570446.1_Missense_Mutation_p.M80V|LSMD1_ENST00000575208.1_5'Flank|LSMD1_ENST00000335155.5_5'Flank|LSMD1_ENST00000576384.1_5'Flank|LSMD1_ENST00000333775.5_5'Flank|CYB5D1_ENST00000571846.1_3'UTR|LSMD1_ENST00000575771.1_5'Flank|LSMD1_ENST00000576861.1_Intron	NM_144607.4	NP_653208.2	Q6P9G0	CB5D1_HUMAN	cytochrome b5 domain containing 1	208							heme binding (GO:0020037)|metal ion binding (GO:0046872)	p.M208V(1)		breast(1)|endometrium(1)|large_intestine(2)|skin(2)	6		all_cancers(10;0.11)|Prostate(122;0.219)				CTATCTCAGTATGGACGGTAC	0.453																																					p.M208V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A622G	17						.						183.0	158.0	167.0					17																	7762865		2203	4300	6503	7703590	SO:0001583	missense	124637	exon4			AK057061	CCDS11123.1	17p13.1	2006-01-12	2006-01-12						26516	protein-coding gene	gene with protein product						12477932	Standard	NM_144607		Approved	FLJ32499	uc002gjb.4	Q6P9G0		ENST00000332439.4:c.622A>G	17.37:g.7762865A>G	ENSP00000331479:p.Met208Val	Somatic		Capture	Illumina HiSeq	Phase_I	7703590	NM_144607	D3DTQ8|Q96DM7	Missense_Mutation	SNP	ENST00000332439.4	37	CCDS11123.1	.	.	.	.	.	.	.	.	.	.	A	10.99	1.507230	0.27036	.	.	ENSG00000182224	ENST00000332439	T	0.39592	1.07	5.27	4.19	0.49359	.	0.176420	0.51477	N	0.000091	T	0.31949	0.0813	L	0.39898	1.24	0.30104	N	0.807172	B	0.02656	0.0	B	0.04013	0.001	T	0.21042	-1.0257	10	0.25751	T	0.34	-25.3709	10.2245	0.43216	0.9197:0.0:0.0803:0.0	.	208	Q6P9G0	CB5D1_HUMAN	V	208	ENSP00000331479:M208V	ENSP00000331479:M208V	M	+	1	0	CYB5D1	7703590	0.190000	0.23276	0.700000	0.30305	0.867000	0.49689	0.787000	0.26858	0.828000	0.34709	0.379000	0.24179	ATG		0.453	CYB5D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440841.1	NM_144607	
SAP30BP	29115	broad.mit.edu	37	17	73699911	73699911	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr17:73699911G>A	ENST00000584667.1	+	8	830	c.573G>A	c.(571-573)tgG>tgA	p.W191*	SAP30BP_ENST00000355423.3_Nonsense_Mutation_p.W175*	NM_013260.6	NP_037392.1			SAP30 binding protein									p.W191*(1)		kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)	17	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCCATGGCTGGTCTGAGGACT	0.498																																					p.W191X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G573A	17						.						261.0	224.0	237.0					17																	73699911		2203	4300	6503	71211506	SO:0001587	stop_gained	29115	exon8			AY082382	CCDS11726.1	17q25.1	2006-01-05				ENSG00000161526			30785	protein-coding gene	gene with protein product		610218				15496587	Standard	NM_013260		Approved	HCNGP, HTRG, HTRP	uc002jpe.3	Q9UHR5		ENST00000584667.1:c.573G>A	17.37:g.73699911G>A	ENSP00000462116:p.Trp191*	Somatic		Capture	Illumina HiSeq	Phase_I	71211506	NM_013260		Nonsense_Mutation	SNP	ENST00000584667.1	37	CCDS11726.1	.	.	.	.	.	.	.	.	.	.	G	37	6.263439	0.97421	.	.	ENSG00000161526	ENST00000355423;ENST00000293208	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	.	.	.	X	191;175	.	ENSP00000293208:W175X	W	+	3	0	SAP30BP	71211506	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.982000	0.93471	2.879000	0.98667	0.650000	0.86243	TGG		0.498	SAP30BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448227.1	NM_013260	
CCBE1	147372	broad.mit.edu	37	18	57136726	57136726	+	Missense_Mutation	SNP	G	G	A	rs368235813		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr18:57136726G>A	ENST00000439986.4	-	4	416	c.379C>T	c.(379-381)Cgg>Tgg	p.R127W	CCBE1_ENST00000398179.2_5'UTR	NM_133459.3	NP_597716.1	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	127					lymphangiogenesis (GO:0001946)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of protein processing (GO:0010954)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|positive regulation vascular endothelial growth factor production (GO:0010575)|sprouting angiogenesis (GO:0002040)|venous blood vessel morphogenesis (GO:0048845)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|protease binding (GO:0002020)	p.R127W(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(3)	24		Colorectal(73;0.175)				GGCTTCTCCCGCTTCCGGTGT	0.537																																					p.R127W	NSCLC(137;1340 1860 15773 39604 51087)|Esophageal Squamous(139;339 1777 2926 19691 38524)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C379T	18						.						229.0	185.0	200.0					18																	57136726		2203	4300	6503	55287706	SO:0001583	missense	147372	exon4			AB075863	CCDS32838.1	18q21.32	2005-01-18				ENSG00000183287			29426	protein-coding gene	gene with protein product		612753				11853319, 12975309	Standard	NM_133459		Approved	FLJ30681, KIAA1983	uc002lib.3	Q6UXH8		ENST00000439986.4:c.379C>T	18.37:g.57136726G>A	ENSP00000404464:p.Arg127Trp	Somatic		Capture	Illumina HiSeq	Phase_I	55287706	NM_133459	Q6MZX5|Q86SS2|Q8TF19	Missense_Mutation	SNP	ENST00000439986.4	37	CCDS32838.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303234	0.81136	.	.	ENSG00000183287	ENST00000439986	D	0.85861	-2.04	5.7	4.75	0.60458	Epidermal growth factor-like (1);	0.108147	0.64402	D	0.000012	T	0.79528	0.4461	N	0.19112	0.55	0.80722	D	1	D	0.65815	0.995	P	0.49387	0.609	T	0.81504	-0.0903	10	0.72032	D	0.01	-17.0467	10.8995	0.47043	0.0:0.0:0.6435:0.3565	.	127	Q6UXH8	CCBE1_HUMAN	W	127	ENSP00000404464:R127W	ENSP00000404464:R127W	R	-	1	2	CCBE1	55287706	1.000000	0.71417	0.997000	0.53966	0.739000	0.42172	3.032000	0.49736	2.683000	0.91414	0.650000	0.86243	CGG		0.537	CCBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449685.2	NM_133459	
RTTN	25914	broad.mit.edu	37	18	67725026	67725026	+	Silent	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr18:67725026G>A	ENST00000255674.6	-	37	5269	c.4983C>T	c.(4981-4983)ctC>ctT	p.L1661L	RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1661					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.L1661L(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				GCAGGGCTCTGAGTTCCTGGA	0.418																																					p.L1661L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4983T	18						.						97.0	97.0	97.0					18																	67725026		1998	4180	6178	65876006	SO:0001819	synonymous_variant	25914	exon37			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.4983C>T	18.37:g.67725026G>A		Somatic		Capture	Illumina HiSeq	Phase_I	65876006	NM_173630	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Silent	SNP	ENST00000255674.6	37	CCDS42443.1																																																																																				0.418	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630	
NUMBL	9253	broad.mit.edu	37	19	41192897	41192897	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr19:41192897C>T	ENST00000252891.4	-	2	195	c.28G>A	c.(28-30)Gga>Aga	p.G10R	NUMBL_ENST00000598779.1_Intron|NUMBL_ENST00000540131.1_Intron|NUMBL_ENST00000599594.1_5'UTR	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	10					adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)		p.G10R(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			CTCCGGGGTCCGCCCTGCCCG	0.682																																					p.G10R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G28A	19						.						2.0	3.0	3.0					19																	41192897		1483	3006	4489	45884737	SO:0001583	missense	9253	exon2			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.28G>A	19.37:g.41192897C>T	ENSP00000252891:p.Gly10Arg	Somatic		Capture	Illumina HiSeq	Phase_I	45884737	NM_004756	Q7Z4J9	Missense_Mutation	SNP	ENST00000252891.4	37	CCDS12561.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.001154	0.35320	.	.	ENSG00000105245	ENST00000252891	T	0.55930	0.49	4.49	2.09	0.27110	.	4.618180	0.00575	N	0.000315	T	0.34687	0.0906	N	0.08118	0	0.80722	D	1	B;B	0.13145	0.007;0.007	B;B	0.08055	0.003;0.003	T	0.46707	-0.9172	10	0.87932	D	0	-1.5755	5.1296	0.14903	0.0:0.6897:0.0:0.3103	.	10;10	A8K033;Q9Y6R0	.;NUMBL_HUMAN	R	10	ENSP00000252891:G10R	ENSP00000252891:G10R	G	-	1	0	NUMBL	45884737	0.933000	0.31639	1.000000	0.80357	0.826000	0.46750	0.482000	0.22276	0.989000	0.38761	0.313000	0.20887	GGA		0.682	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
MEGF8	1954	broad.mit.edu	37	19	42873065	42873065	+	Silent	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr19:42873065C>T	ENST00000251268.6	+	37	6552	c.6552C>T	c.(6550-6552)aaC>aaT	p.N2184N	MEGF8_ENST00000378073.4_5'Flank|MEGF8_ENST00000334370.4_Silent_p.N2117N	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2184	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)	p.N2184N(1)|p.N2117N(1)|p.N1725N(1)		breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				AGTGTGCAAACGGGCACCACG	0.622																																					p.N2117N												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C6351T	19						.						87.0	91.0	90.0					19																	42873065		2203	4300	6503	47564905	SO:0001819	synonymous_variant	1954	exon36			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.6552C>T	19.37:g.42873065C>T		Somatic		Capture	Illumina HiSeq	Phase_I	47564905	NM_001410	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	37																																																																																					0.622	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
SYMPK	8189	broad.mit.edu	37	19	46334689	46334689	+	Silent	SNP	C	C	T	rs566434106		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr19:46334689C>T	ENST00000245934.7	-	12	1795	c.1551G>A	c.(1549-1551)ccG>ccA	p.P517P	AC092301.3_ENST00000601618.1_RNA	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	517					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.P517P(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TCTTGGCCTGCGGTGCCTCTT	0.642													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17337	0.0		0.0	False		,,,				2504	0.0				p.P517P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1551A	19						.						75.0	57.0	63.0					19																	46334689		2203	4300	6503	51026529	SO:0001819	synonymous_variant	8189	exon12			U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.1551G>A	19.37:g.46334689C>T		Somatic		Capture	Illumina HiSeq	Phase_I	51026529	NM_004819	O00521|O00689|O00733|Q59GT5|Q8N2U5	Silent	SNP	ENST00000245934.7	37	CCDS12676.2																																																																																				0.642	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
FPR1	2357	broad.mit.edu	37	19	52249826	52249826	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr19:52249826A>T	ENST00000595042.1	-	3	563	c.422T>A	c.(421-423)cTg>cAg	p.L141Q	FPR1_ENST00000304748.4_Missense_Mutation_p.L141Q	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	141					activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)	p.L141Q(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	CTTCTTGGCCAGGCTCACGGT	0.547																																					p.L141Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T422A	19						.						77.0	68.0	71.0					19																	52249826		2203	4300	6503	56941638	SO:0001583	missense	2357	exon3			M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.422T>A	19.37:g.52249826A>T	ENSP00000471493:p.Leu141Gln	Somatic		Capture	Illumina HiSeq	Phase_I	56941638	NM_001193306	Q14939|Q7Z6A4|Q86U52|Q9NS48	Missense_Mutation	SNP	ENST00000595042.1	37	CCDS12839.1	.	.	.	.	.	.	.	.	.	.	.	11.67	1.707138	0.30232	.	.	ENSG00000171051	ENST00000304748	T	0.38887	1.11	3.66	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.424877	0.21108	N	0.080039	T	0.54271	0.1848	M	0.74546	2.27	0.26769	N	0.969835	P	0.45902	0.868	P	0.56648	0.803	T	0.43196	-0.9406	10	0.59425	D	0.04	.	7.9695	0.30119	0.7935:0.2064:0.0:0.0	.	141	P21462	FPR1_HUMAN	Q	141	ENSP00000302707:L141Q	ENSP00000302707:L141Q	L	-	2	0	FPR1	56941638	0.978000	0.34361	0.790000	0.31976	0.075000	0.17131	1.827000	0.39102	1.596000	0.50062	0.533000	0.62120	CTG		0.547	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466905.1	NM_002029	
GPR108	56927	broad.mit.edu	37	19	6733590	6733590	+	Silent	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr19:6733590G>A	ENST00000264080.7	-	8	740	c.714C>T	c.(712-714)ttC>ttT	p.F238F	GPR108_ENST00000598626.1_5'Flank|GPR108_ENST00000430424.4_5'UTR	NM_001080452.1	NP_001073921.1	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108	238						integral component of membrane (GO:0016021)		p.F238F(1)		breast(2)|cervix(1)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						CCGTGATGTCGAATGGATGCT	0.622																																					p.F238F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C714T	19						.						90.0	87.0	88.0					19																	6733590		2053	4200	6253	6684590	SO:0001819	synonymous_variant	56927	exon8				CCDS42479.1	19p13.3	2014-01-30				ENSG00000125734		"""GPCR / Unclassified : 7TM orphan receptors"""	17829	protein-coding gene	gene with protein product							Standard	NM_001080452		Approved	LUSTR2	uc002mfp.3	Q9NPR9	OTTHUMG00000170129	ENST00000264080.7:c.714C>T	19.37:g.6733590G>A		Somatic		Capture	Illumina HiSeq	Phase_I	6684590	NM_001080452	B9EJD7	Silent	SNP	ENST00000264080.7	37	CCDS42479.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.058215	0.36277	.	.	ENSG00000125734	ENST00000549846	.	.	.	3.92	-4.52	0.03472	.	.	.	.	.	.	.	.	.	.	.	0.26610	N	0.972859	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.0426	9.8805	0.41231	0.7222:0.0:0.2778:0.0	.	.	.	.	X	221	.	.	R	-	1	2	GPR108	6684590	0.011000	0.17503	0.391000	0.26233	0.884000	0.51177	-0.362000	0.07602	-0.628000	0.05582	0.555000	0.69702	CGA		0.622	GPR108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407508.2		
PPP2R1A	5518	broad.mit.edu	37	19	52715982	52715982	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr19:52715982C>T	ENST00000322088.6	+	5	605	c.547C>T	c.(547-549)Cgg>Tgg	p.R183W	PPP2R1A_ENST00000462990.1_Missense_Mutation_p.R4W|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.R128W	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	183	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.|SV40 small T antigen binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.R183W(22)|p.R183G(2)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CATGGTGCGGCGGGCCGCAGC	0.617			Mis		clear cell ovarian carcinoma																																p.R183W			Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	.	24	Substitution - Missense(24)	ovary(16)|endometrium(4)|large_intestine(3)|pancreas(1)	c.C547T	19						.						69.0	57.0	61.0					19																	52715982		2203	4300	6503	57407794	SO:0001583	missense	5518	exon5				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.547C>T	19.37:g.52715982C>T	ENSP00000324804:p.Arg183Trp	Somatic		Capture	Illumina HiSeq	Phase_I	57407794	NM_014225	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360081	0.82353	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.06528	3.29;3.29	4.5	4.5	0.54988	Armadillo-like helical (1);Armadillo-type fold (1);	0.114427	0.37136	N	0.002231	T	0.34193	0.0889	H	0.96333	3.805	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	T	0.40459	-0.9562	10	0.87932	D	0	-15.4468	10.2034	0.43099	0.1981:0.8019:0.0:0.0	.	128;183;183	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	W	173;103;183;128	ENSP00000324804:R183W;ENSP00000415067:R128W	ENSP00000324804:R183W	R	+	1	2	PPP2R1A	57407794	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.933000	0.63484	2.503000	0.84419	0.655000	0.94253	CGG		0.617	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
AMIGO1	57463	broad.mit.edu	37	1	110050127	110050127	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr1:110050127C>T	ENST00000369864.4	-	2	1757	c.1408G>A	c.(1408-1410)Ggc>Agc	p.G470S	AMIGO1_ENST00000369862.1_Missense_Mutation_p.G470S					adhesion molecule with Ig-like domain 1									p.G470S(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0182)|Epithelial(280;0.046)|all cancers(265;0.0492)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)		TGGCCCTTGCCTGTGGCCTCA	0.592																																					p.G470S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1408A	1						.						123.0	106.0	112.0					1																	110050127		2203	4300	6503	109851650	SO:0001583	missense	57463	exon2				CCDS30795.1	1p13.3	2013-01-11			ENSG00000181754	ENSG00000181754		"""Immunoglobulin superfamily / V-set domain containing"""	20824	protein-coding gene	gene with protein product	"""amphoterin-induced gene and open reading frame"""	615689				12629050	Standard	NM_020703		Approved	AMIGO, KIAA1163	uc001dxx.4	Q86WK6	OTTHUMG00000011653	ENST00000369864.4:c.1408G>A	1.37:g.110050127C>T	ENSP00000358880:p.Gly470Ser	Somatic		Capture	Illumina HiSeq	Phase_I	109851650	NM_020703		Missense_Mutation	SNP	ENST00000369864.4	37	CCDS30795.1	.	.	.	.	.	.	.	.	.	.	C	8.943	0.966275	0.18659	.	.	ENSG00000181754	ENST00000369864;ENST00000369862	T;T	0.47528	0.84;0.84	6.17	5.27	0.74061	.	0.171407	0.36444	N	0.002600	T	0.22781	0.0550	L	0.44542	1.39	0.47374	D	0.999402	B	0.09022	0.002	B	0.06405	0.002	T	0.09862	-1.0655	10	0.16896	T	0.51	-8.7529	14.308	0.66397	0.0:0.9285:0.0:0.0715	.	470	Q86WK6	AMGO1_HUMAN	S	470	ENSP00000358880:G470S;ENSP00000358878:G470S	ENSP00000358878:G470S	G	-	1	0	AMIGO1	109851650	0.000000	0.05858	0.589000	0.28718	0.930000	0.56654	0.297000	0.19101	1.631000	0.50456	0.655000	0.94253	GGC		0.592	AMIGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032247.1	NM_020703	
CREB3L4	148327	broad.mit.edu	37	1	153941424	153941424	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr1:153941424C>G	ENST00000368607.3	+	3	459	c.193C>G	c.(193-195)Cct>Gct	p.P65A	CREB3L4_ENST00000405694.3_Intron|CREB3L4_ENST00000368600.3_Missense_Mutation_p.P45A|CREB3L4_ENST00000368603.1_Missense_Mutation_p.P65A|RP11-422P24.10_ENST00000608147.1_RNA|CREB3L4_ENST00000368601.1_Missense_Mutation_p.P65A|CREB3L4_ENST00000271889.4_Missense_Mutation_p.P65A|SLC39A1_ENST00000310483.6_5'Flank	NM_001255978.1|NM_001255980.1|NM_130898.3	NP_001242907.1|NP_001242909.1|NP_570968.1	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like 4	65					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(3)	13	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGAGAGTGAGCCTGAAGATTT	0.458																																					p.P65A												.	.	0			c.C193G	1						.						67.0	66.0	66.0					1																	153941424		2203	4300	6503	152208048	SO:0001583	missense	148327	exon3			AF394167	CCDS1056.1, CCDS58029.1	1q21.2	2013-01-10			ENSG00000143578	ENSG00000143578		"""basic leucine zipper proteins"""	18854	protein-coding gene	gene with protein product		607138					Standard	NM_130898		Approved	AIbZIP, CREB4, CREB3, hJAL, ATCE1	uc001fdr.3	Q8TEY5	OTTHUMG00000037159	ENST00000368607.3:c.193C>G	1.37:g.153941424C>G	ENSP00000357596:p.Pro65Ala	None		Capture	Illumina HiSeq	Phase_I	152208048	NM_130898	D3DV62|Q5T4L0|Q86YW6	Missense_Mutation	SNP	ENST00000368607.3	37	CCDS1056.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599628	0.46318	.	.	ENSG00000143578	ENST00000449724;ENST00000368607;ENST00000271889;ENST00000368601;ENST00000368603;ENST00000368600;ENST00000431292	T;T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36;1.36	4.85	-0.133	0.13485	.	0.501510	0.20450	N	0.092120	T	0.16599	0.0399	L	0.54323	1.7	0.80722	D	1	P;B;P	0.48294	0.86;0.243;0.908	B;B;B	0.41271	0.352;0.079;0.277	T	0.04281	-1.0963	10	0.51188	T	0.08	.	8.8432	0.35155	0.0:0.6172:0.0:0.3828	.	65;45;65	B4E2G3;Q5T4L0;Q8TEY5	.;.;CR3L4_HUMAN	A	45;65;65;65;65;45;65	ENSP00000391847:P45A;ENSP00000357596:P65A;ENSP00000271889:P65A;ENSP00000357590:P65A;ENSP00000357592:P65A;ENSP00000357589:P45A;ENSP00000402308:P65A	ENSP00000271889:P65A	P	+	1	0	CREB3L4	152208048	0.973000	0.33851	0.540000	0.28089	0.963000	0.63663	0.797000	0.26999	-0.100000	0.12241	0.561000	0.74099	CCT		0.458	CREB3L4-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090291.1	NM_130898	
TNN	63923	broad.mit.edu	37	1	175063135	175063135	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr1:175063135G>T	ENST00000239462.4	+	7	1447	c.1334G>T	c.(1333-1335)aGt>aTt	p.S445I		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	445	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.S445I(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GAAATTGACAGTCCAACCAAT	0.423																																					p.S445I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1334T	1						.						87.0	81.0	83.0					1																	175063135		2203	4300	6503	173329758	SO:0001583	missense	63923	exon7			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1334G>T	1.37:g.175063135G>T	ENSP00000239462:p.Ser445Ile	Somatic		Capture	Illumina HiSeq	Phase_I	173329758	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.320413	0.60634	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.58210	0.35	5.4	4.47	0.54385	Fibronectin, type III (5);Immunoglobulin-like fold (1);	0.386006	0.24925	N	0.034514	T	0.72486	0.3466	M	0.85197	2.74	0.26393	N	0.976543	D;D	0.61080	0.989;0.989	D;D	0.66602	0.912;0.945	T	0.67280	-0.5710	10	0.45353	T	0.12	.	13.3226	0.60440	0.0:0.0:0.8416:0.1584	.	445;445	B3KXB6;Q9UQP3	.;TENN_HUMAN	I	445	ENSP00000239462:S445I	ENSP00000239462:S445I	S	+	2	0	TNN	173329758	1.000000	0.71417	0.983000	0.44433	0.876000	0.50452	3.940000	0.56599	1.224000	0.43551	0.563000	0.77884	AGT		0.423	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
BRINP2	57795	broad.mit.edu	37	1	177247890	177247890	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr1:177247890C>T	ENST00000361539.4	+	7	1516	c.1204C>T	c.(1204-1206)Cgc>Tgc	p.R402C	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	402					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)		p.R402C(2)									GCGCTGCCATCGCCAGCCTCG	0.617																																					p.R402C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1204T	1						.						53.0	55.0	54.0					1																	177247890		2203	4300	6503	175514513	SO:0001583	missense	57795	exon7				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1204C>T	1.37:g.177247890C>T	ENSP00000354481:p.Arg402Cys	Somatic		Capture	Illumina HiSeq	Phase_I	175514513	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	37	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.607974	0.66558	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.15372	2.43	5.39	3.36	0.38483	.	0.230912	0.38436	N	0.001681	T	0.26521	0.0648	L	0.44542	1.39	0.33909	D	0.639466	B;D;B	0.89917	0.038;1.0;0.029	B;P;B	0.62184	0.017;0.899;0.003	T	0.35201	-0.9798	10	0.72032	D	0.01	-26.6843	7.9241	0.29863	0.2778:0.6323:0.0:0.09	.	152;297;402	F5H8E0;Q9C0B6-2;Q9C0B6	.;.;FAM5B_HUMAN	C	152;402	ENSP00000354481:R402C	ENSP00000354481:R402C	R	+	1	0	FAM5B	175514513	0.943000	0.32029	0.997000	0.53966	0.983000	0.72400	2.108000	0.41854	1.278000	0.44430	0.655000	0.94253	CGC		0.617	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
USH2A	7399	broad.mit.edu	37	1	215848822	215848822	+	Missense_Mutation	SNP	G	G	A	rs574981142		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr1:215848822G>A	ENST00000307340.3	-	63	12817	c.12431C>T	c.(12430-12432)gCg>gTg	p.A4144V	USH2A_ENST00000366943.2_Missense_Mutation_p.A4144V	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4144	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.A4144V(1)|p.A4144G(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGCTGAGGCGCCGAGTGTGC	0.572										HNSCC(13;0.011)																											p.A4144V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C12431T	1						.						45.0	46.0	46.0					1																	215848822		2203	4300	6503	213915445	SO:0001583	missense	7399	exon63			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12431C>T	1.37:g.215848822G>A	ENSP00000305941:p.Ala4144Val	Somatic		Capture	Illumina HiSeq	Phase_I	213915445	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	3.656	-0.070602	0.07228	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.54675	0.56;0.56	5.25	-1.52	0.08637	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.201570	0.06293	N	0.699559	T	0.33411	0.0862	N	0.25647	0.755	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.12451	-1.0547	10	0.30078	T	0.28	.	2.3063	0.04174	0.4514:0.1227:0.3003:0.1256	.	4144	O75445	USH2A_HUMAN	V	4144	ENSP00000305941:A4144V;ENSP00000355910:A4144V	ENSP00000305941:A4144V	A	-	2	0	USH2A	213915445	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-0.362000	0.07602	-0.641000	0.05487	-0.142000	0.14014	GCG		0.572	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
CCNL2	81669	broad.mit.edu	37	1	1334053	1334057	+	Splice_Site	DEL	TAGAG	TAGAG	-	rs368050244|rs3831366	byFrequency	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	TAGAG	TAGAG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr1:1334053_1334057delTAGAG	ENST00000400809.3	-	2	294		c.e2-2		RP4-758J18.2_ENST00000576232.1_5'Flank|RP4-758J18.2_ENST00000444362.1_5'Flank|CCNL2_ENST00000408918.4_Splice_Site|CCNL2_ENST00000408952.5_5'Flank|RP4-758J18.2_ENST00000448629.2_5'Flank	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.?(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		CATGGCCACCTAGAGTAGAAGAAAG	0.507														371	0.0740815	0.1021	0.0331	5008	,	,		15997	0.0843		0.0487	False		,,,				2504	0.0808				.												.	.	1	Unknown(1)	large_intestine(1)	.	1						.		,	315,3951		16,283,1834					,	4.8	1.0		dbSNP_107	96	304,7940		10,284,3828	no	splice-3,splice-3	CCNL2	NM_030937.4,NM_001039577.3	,	26,567,5662	A1A1,A1R,RR		3.6875,7.384,4.948	,	,		619,11891				1323920	SO:0001630	splice_region_variant	81669	.			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.289-2CTCTA>-	1.37:g.1334053_1334057delTAGAG		Somatic		Capture	Illumina HiSeq	Phase_I	1323916	.	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Splice_Site	DEL	ENST00000400809.3	37	CCDS30557.1																																																																																				0.507	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937	Intron
ZMYM6	9204	broad.mit.edu	37	1	35485095	35485095	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr1:35485095T>G	ENST00000357182.4	-	4	514	c.287A>C	c.(286-288)aAa>aCa	p.K96T	ZMYM6_ENST00000487874.1_Missense_Mutation_p.K96T|ZMYM6_ENST00000493328.1_Intron|ZMYM6_ENST00000373333.1_Missense_Mutation_p.K96T|ZMYM6_ENST00000373340.2_Missense_Mutation_p.K96T|ZMYM6_ENST00000317538.5_Missense_Mutation_p.K96T	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	96					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K96T(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				AAGCATTTTTTTACAACCAGA	0.438																																					p.K96T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A287C	1						.						115.0	108.0	110.0					1																	35485095		2203	4300	6503	35257682	SO:0001583	missense	9204	exon4			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.287A>C	1.37:g.35485095T>G	ENSP00000349708:p.Lys96Thr	Somatic		Capture	Illumina HiSeq	Phase_I	35257682	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	ENST00000357182.4	37	CCDS387.2	.	.	.	.	.	.	.	.	.	.	T	23.0	4.364476	0.82463	.	.	ENSG00000163867	ENST00000373340;ENST00000357182;ENST00000415531;ENST00000317538;ENST00000373333	T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75	5.15	5.15	0.70609	TRASH (1);Zinc finger, MYM-type (1);	0.100723	0.64402	D	0.000003	T	0.64068	0.2565	L	0.60455	1.87	0.44030	D	0.996756	D;P;P	0.76494	0.999;0.891;0.721	D;P;P	0.67382	0.951;0.758;0.476	T	0.67496	-0.5656	10	0.87932	D	0	-12.3762	15.4212	0.75011	0.0:0.0:0.0:1.0	.	96;96;96	O95789-4;O95789;O95789-1	.;ZMYM6_HUMAN;.	T	96	ENSP00000362437:K96T;ENSP00000349708:K96T;ENSP00000391337:K96T;ENSP00000326695:K96T;ENSP00000362430:K96T	ENSP00000326695:K96T	K	-	2	0	ZMYM6	35257682	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.015000	0.57152	2.285000	0.76669	0.477000	0.44152	AAA		0.438	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
DMRTB1	63948	broad.mit.edu	37	1	53927172	53927172	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr1:53927172C>T	ENST00000371445.3	+	2	659	c.604C>T	c.(604-606)Cgt>Tgt	p.R202C	DMRTB1_ENST00000463126.1_3'UTR	NM_033067.1	NP_149056.1	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal, 1	202	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R202C(1)		large_intestine(3)|lung(5)|ovary(1)|skin(1)	10						CAACCCGGACCGTGCACTGGG	0.662																																					p.R202C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C604T	1						.						120.0	101.0	108.0					1																	53927172		2203	4300	6503	53699760	SO:0001583	missense	63948	exon2			AJ291671	CCDS581.1	1p32	2008-08-29			ENSG00000143006	ENSG00000143006			13913	protein-coding gene	gene with protein product		614805					Standard	NM_033067		Approved		uc001cvq.1	Q96MA1	OTTHUMG00000008080	ENST00000371445.3:c.604C>T	1.37:g.53927172C>T	ENSP00000360500:p.Arg202Cys	Somatic		Capture	Illumina HiSeq	Phase_I	53699760	NM_033067	Q96SD2	Missense_Mutation	SNP	ENST00000371445.3	37	CCDS581.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.314021	0.23908	.	.	ENSG00000143006	ENST00000371445;ENST00000431335	.	.	.	5.11	-10.2	0.00374	.	1.376760	0.04321	N	0.350693	T	0.13030	0.0316	N	0.02142	-0.665	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32481	-0.9905	9	0.30078	T	0.28	8.6675	11.6759	0.51430	0.0:0.5405:0.3041:0.1554	.	202	Q96MA1	DMRTB_HUMAN	C	202;49	.	ENSP00000360500:R202C	R	+	1	0	DMRTB1	53699760	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-1.440000	0.02412	-2.693000	0.00403	-0.302000	0.09304	CGT		0.662	DMRTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022110.1		
PPAP2B	8613	broad.mit.edu	37	1	57002639	57002639	+	Silent	SNP	A	A	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr1:57002639A>T	ENST00000371250.3	-	2	836	c.285T>A	c.(283-285)atT>atA	p.I95I		NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	95					Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)	p.I95I(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						CGAGGATGGCAATGACGATCC	0.473																																					p.I95I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T285A	1						.						231.0	190.0	204.0					1																	57002639		2203	4300	6503	56775227	SO:0001819	synonymous_variant	8613	exon2			AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.285T>A	1.37:g.57002639A>T		Somatic		Capture	Illumina HiSeq	Phase_I	56775227	NM_003713	B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	Silent	SNP	ENST00000371250.3	37	CCDS604.1																																																																																				0.473	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022334.2	NM_003713	
OBSCN	84033	broad.mit.edu	37	1	228509747	228509747	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr1:228509747C>T	ENST00000422127.1	+	55	15249	c.15205C>T	c.(15205-15207)Cgc>Tgc	p.R5069C	OBSCN_ENST00000570156.2_Missense_Mutation_p.R6026C|OBSCN_ENST00000366709.4_Missense_Mutation_p.R2188C|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2703C|OBSCN_ENST00000284548.11_Missense_Mutation_p.R5069C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5069					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.R5651C(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CACTGAGGCCCGCCAGGCGGT	0.602																																					p.R5069C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C15205T	1						.						28.0	32.0	31.0					1																	228509747		2010	4168	6178	226576370	SO:0001583	missense	84033	exon55			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15205C>T	1.37:g.228509747C>T	ENSP00000409493:p.Arg5069Cys	Somatic		Capture	Illumina HiSeq	Phase_I	226576370	NM_052843	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.785838	0.49997	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.63255	0.39;-0.03;-0.03;0.47	5.06	2.14	0.27477	.	1.499260	0.03898	N	0.279814	T	0.43656	0.1257	N	0.19112	0.55	0.20196	N	0.999924	B;B	0.28026	0.198;0.128	B;B	0.15870	0.006;0.014	T	0.36768	-0.9734	10	0.66056	D	0.02	.	1.2882	0.02055	0.1892:0.4462:0.1222:0.2425	.	5069;5069	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	C	5069;5069;2703;2188	ENSP00000284548:R5069C;ENSP00000409493:R5069C;ENSP00000355668:R2703C;ENSP00000355670:R2188C	ENSP00000284548:R5069C	R	+	1	0	OBSCN	226576370	0.761000	0.28439	0.023000	0.16930	0.489000	0.33432	2.622000	0.46427	0.169000	0.19679	-0.142000	0.14014	CGC		0.602	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ESF1	51575	broad.mit.edu	37	20	13714404	13714404	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr20:13714404C>G	ENST00000202816.1	-	10	2021	c.1914G>C	c.(1912-1914)aaG>aaC	p.K638N		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	638	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K638N(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						TCTCTTTCTTCTTCTCTAAAA	0.348																																					p.K638N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1914C	20						.						143.0	146.0	145.0					20																	13714404		2203	4299	6502	13662404	SO:0001583	missense	51575	exon10				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.1914G>C	20.37:g.13714404C>G	ENSP00000202816:p.Lys638Asn	Somatic		Capture	Illumina HiSeq	Phase_I	13662404	NM_016649	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	ENST00000202816.1	37	CCDS13117.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727529	0.48833	.	.	ENSG00000089048	ENST00000202816	T	0.77358	-1.09	5.32	2.28	0.28536	.	0.101862	0.64402	D	0.000004	D	0.87896	0.6293	M	0.89287	3.02	0.49687	D	0.999815	D	0.76494	0.999	D	0.78314	0.991	D	0.87004	0.2118	10	0.62326	D	0.03	.	10.5057	0.44832	0.0:0.6538:0.0:0.3462	.	638	Q9H501	ESF1_HUMAN	N	638	ENSP00000202816:K638N	ENSP00000202816:K638N	K	-	3	2	ESF1	13662404	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	0.766000	0.26560	0.249000	0.21456	-1.761000	0.00669	AAG		0.348	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078049.1	NM_016649	
RIMS4	140730	broad.mit.edu	37	20	43378885	43378885	+	IGR	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr20:43378885C>T	ENST00000372851.3	-	0	5203				KCNK15_ENST00000372861.3_Silent_p.N133N	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)		p.N133N(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				AACGGCTGAACGCGGTGGTGC	0.687																																					p.N133N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C399T	20						.						31.0	28.0	29.0					20																	43378885		2202	4299	6501	42812299	SO:0001628	intergenic_variant	60598	exon2				CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546		20.37:g.43378885C>T		Somatic		Capture	Illumina HiSeq	Phase_I	42812299	NM_022358	A4FU94|E1P613|Q3MI44|Q5JWT7	Silent	SNP	ENST00000372851.3	37	CCDS13338.1																																																																																				0.687	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970	
DOK5	55816	broad.mit.edu	37	20	53260081	53260081	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr20:53260081C>T	ENST00000262593.5	+	7	1170	c.820C>T	c.(820-822)Cgg>Tgg	p.R274W	DOK5_ENST00000395939.1_Missense_Mutation_p.R166W	NM_018431.3	NP_060901.2	Q9P104	DOK5_HUMAN	docking protein 5	274					MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)	p.R274W(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|skin(1)	19			Colorectal(105;0.202)			GCACATCACACGGCAGCACAG	0.652																																					p.R274W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C820T	20						.						54.0	48.0	50.0					20																	53260081		2203	4300	6503	52693488	SO:0001583	missense	55816	exon7			AF132732	CCDS13446.1, CCDS13447.1	20q13.2	2013-01-10	2002-11-28	2002-11-29	ENSG00000101134	ENSG00000101134		"""Pleckstrin homology (PH) domain containing"""	16173	protein-coding gene	gene with protein product		608334	"""chromosome 20 open reading frame 180"""	C20orf180		11470823	Standard	XM_005260451		Approved	dJ805C22.1	uc002xwy.3	Q9P104	OTTHUMG00000032778	ENST00000262593.5:c.820C>T	20.37:g.53260081C>T	ENSP00000262593:p.Arg274Trp	Somatic		Capture	Illumina HiSeq	Phase_I	52693488	NM_018431	Q5T7Y0|Q5TE53|Q8TEW7|Q96H13|Q9BZ24|Q9NQF4|Q9Y411	Missense_Mutation	SNP	ENST00000262593.5	37	CCDS13446.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.465314	0.63513	.	.	ENSG00000101134	ENST00000262593;ENST00000395939	D;D	0.93659	-2.27;-3.26	5.42	-1.32	0.09201	.	0.000000	0.85682	D	0.000000	D	0.93200	0.7834	L	0.27053	0.805	0.32349	N	0.558736	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.973	D	0.92644	0.6127	10	0.66056	D	0.02	-7.4003	16.721	0.85410	0.7627:0.2373:0.0:0.0	.	166;274	Q9P104-2;Q9P104	.;DOK5_HUMAN	W	274;166	ENSP00000262593:R274W;ENSP00000379270:R166W	ENSP00000262593:R274W	R	+	1	2	DOK5	52693488	0.123000	0.22298	0.098000	0.21074	0.980000	0.70556	0.291000	0.18994	-0.142000	0.11354	-0.122000	0.15005	CGG		0.652	DOK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079777.2		
PCBP3	54039	broad.mit.edu	37	21	47360066	47360066	+	Silent	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr21:47360066G>A	ENST00000400314.1	+	15	1370	c.1032G>A	c.(1030-1032)acG>acA	p.T344T	PCBP3_ENST00000400309.1_Silent_p.T343T|PCBP3_ENST00000449640.1_Silent_p.T344T|PCBP3_ENST00000400308.1_Silent_p.T318T|PCBP3_ENST00000400304.1_Silent_p.T334T|PCBP3_ENST00000400310.1_Silent_p.T324T			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	344	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.T344T(1)|p.T312T(1)		biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		TCACCATCACGGGGACCCCGG	0.577																																					p.T318T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G954A	21						.						62.0	70.0	67.0					21																	47360066		2141	4247	6388	46184494	SO:0001819	synonymous_variant	54039	exon12			AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.1032G>A	21.37:g.47360066G>A		Somatic		Capture	Illumina HiSeq	Phase_I	46184494	NM_001130141	A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Silent	SNP	ENST00000400314.1	37	CCDS42974.2																																																																																				0.577	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2		
CRYBA4	1413	broad.mit.edu	37	22	27021497	27021497	+	Nonsense_Mutation	SNP	C	C	T	rs199635152	byFrequency	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr22:27021497C>T	ENST00000354760.3	+	4	246	c.211C>T	c.(211-213)Cga>Tga	p.R71*	CRYBA4_ENST00000466315.1_3'UTR	NM_001886.2	NP_001877.1	P53673	CRBA4_HUMAN	crystallin, beta A4	71	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.R71*(1)		large_intestine(6)|liver(1)|lung(6)|skin(3)|urinary_tract(2)	18						CATTCTGGAACGAGGCGAATA	0.622													C|||	2	0.000399361	0.0	0.0	5008	,	,		18019	0.001		0.0	False		,,,				2504	0.001				p.R71X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C211T	22						.	C	stop/ARG	0,4406		0,0,2203	133.0	123.0	126.0		211	0.9	1.0	22		126	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	CRYBA4	NM_001886.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		71/197	27021497	1,13005	2203	4300	6503	25351497	SO:0001587	stop_gained	1413	exon4				CCDS13841.1	22q12.1	2008-06-10			ENSG00000196431	ENSG00000196431			2396	protein-coding gene	gene with protein product		123631				8999933, 960806	Standard	NM_001886		Approved		uc003acz.4	P53673	OTTHUMG00000150983	ENST00000354760.3:c.211C>T	22.37:g.27021497C>T	ENSP00000346805:p.Arg71*	Somatic		Capture	Illumina HiSeq	Phase_I	25351497	NM_001886	Q4VB22|Q6ICE4	Nonsense_Mutation	SNP	ENST00000354760.3	37	CCDS13841.1	.	.	.	.	.	.	.	.	.	.	C	13.83	2.355116	0.41700	0.0	1.16E-4	ENSG00000196431	ENST00000354760	.	.	.	4.43	0.906	0.19314	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4781	0.50310	0.6721:0.3279:0.0:0.0	.	.	.	.	X	71	.	ENSP00000346805:R71X	R	+	1	2	CRYBA4	25351497	0.914000	0.31030	0.985000	0.45067	0.004000	0.04260	-0.095000	0.11077	0.072000	0.16694	-0.397000	0.06425	CGA		0.622	CRYBA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320793.1	NM_001886	
TUBGCP6	85378	broad.mit.edu	37	22	50659293	50659293	+	Silent	SNP	G	G	A	rs540310913	byFrequency	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr22:50659293G>A	ENST00000248846.5	-	16	3599	c.3495C>T	c.(3493-3495)tcC>tcT	p.S1165S	TUBGCP6_ENST00000439308.2_Silent_p.S1165S|TUBGCP6_ENST00000491449.1_5'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1165	9 X 27 AA tandem repeats.				G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.S1165S(2)		breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TGCTGGCATCGGACACGTGTC	0.637													N|||	2	0.000399361	0.0008	0.0	5008	,	,		22548	0.0		0.0	False		,,,				2504	0.001				p.S1165S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C3495T	22						.						90.0	83.0	85.0					22																	50659293		2203	4300	6503	49001420	SO:0001819	synonymous_variant	85378	exon16			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.3495C>T	22.37:g.50659293G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49001420	NM_020461	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Silent	SNP	ENST00000248846.5	37	CCDS14087.1																																																																																				0.637	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461	
IL1R2	7850	broad.mit.edu	37	2	102644771	102644771	+	Missense_Mutation	SNP	C	C	T	rs148258277	byFrequency	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:102644771C>T	ENST00000332549.3	+	9	1343	c.1114C>T	c.(1114-1116)Cgg>Tgg	p.R372W	IL1R2_ENST00000393414.2_Missense_Mutation_p.R372W|IL1R2_ENST00000485335.1_3'UTR	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	372					cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.R372W(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						GATGCACAGACGGTGCAAACA	0.488													C|||	15	0.00299521	0.0	0.0	5008	,	,		20484	0.0149		0.0	False		,,,				2504	0.0				p.R372W	Pancreas(106;189 1628 2302 5133 12295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1114T	2						.						138.0	116.0	124.0					2																	102644771		2203	4300	6503	102011203	SO:0001583	missense	7850	exon9			X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.1114C>T	2.37:g.102644771C>T	ENSP00000330959:p.Arg372Trp	Somatic		Capture	Illumina HiSeq	Phase_I	102011203	NM_173343	D3DVJ5|Q6LCE6|Q9UE68	Missense_Mutation	SNP	ENST00000332549.3	37	CCDS2054.1	8	0.003663003663003663	0	0.0	0	0.0	8	0.013986013986013986	0	0.0	C	7.315	0.615853	0.14129	.	.	ENSG00000115590	ENST00000332549;ENST00000393414	T;T	0.33216	1.42;1.42	5.88	-0.845	0.10737	.	0.701867	0.13214	N	0.404895	T	0.12518	0.0304	L	0.32530	0.975	0.09310	N	1	B	0.15719	0.014	B	0.08055	0.003	T	0.16100	-1.0414	10	0.37606	T	0.19	.	3.4816	0.07605	0.2966:0.3765:0.0:0.3269	.	372	P27930	IL1R2_HUMAN	W	372	ENSP00000330959:R372W;ENSP00000377066:R372W	ENSP00000330959:R372W	R	+	1	2	IL1R2	102011203	0.342000	0.24809	0.000000	0.03702	0.288000	0.27193	-0.293000	0.08320	0.095000	0.17434	0.655000	0.94253	CGG		0.488	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253191.1	NM_004633	
GALNT5	11227	broad.mit.edu	37	2	158115936	158115936	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:158115936C>A	ENST00000259056.4	+	1	1827	c.1342C>A	c.(1342-1344)Ccc>Acc	p.P448T		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	448					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.P448T(1)		breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						TGTAGTTGTCCCCCATGGAAA	0.488																																					p.P448T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1342A	2						.						78.0	75.0	76.0					2																	158115936		2203	4300	6503	157824182	SO:0001583	missense	11227	exon1			AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.1342C>A	2.37:g.158115936C>A	ENSP00000259056:p.Pro448Thr	Somatic		Capture	Illumina HiSeq	Phase_I	157824182	NM_014568	A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	37	CCDS2203.1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.866276	0.71949	.	.	ENSG00000136542	ENST00000259056	T	0.59083	0.29	5.96	5.96	0.96718	.	0.788892	0.11832	N	0.525112	T	0.67924	0.2945	L	0.48642	1.525	0.42388	D	0.992516	D	0.60575	0.988	P	0.53912	0.737	T	0.66131	-0.6000	10	0.52906	T	0.07	.	19.989	0.97359	0.0:1.0:0.0:0.0	.	448	Q7Z7M9	GALT5_HUMAN	T	448	ENSP00000259056:P448T	ENSP00000259056:P448T	P	+	1	0	GALNT5	157824182	1.000000	0.71417	0.983000	0.44433	0.709000	0.40893	3.638000	0.54332	2.830000	0.97506	0.585000	0.79938	CCC		0.488	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568	
TTC21B	79809	broad.mit.edu	37	2	166747103	166747103	+	Missense_Mutation	SNP	C	C	T	rs144103331		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:166747103C>T	ENST00000243344.7	-	24	3286	c.3149G>A	c.(3148-3150)cGg>cAg	p.R1050Q	TTC21B_ENST00000536175.1_5'UTR	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	1050					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)		p.R1050Q(1)		breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						ACGATCTTTCCGAGCTTTATT	0.343																																					p.R1050Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3149A	2						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	77.0	75.0	76.0		3149	5.7	1.0	2	dbSNP_134	76	0,8600		0,0,4300	no	missense	TTC21B	NM_024753.3	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	1050/1317	166747103	1,13005	2203	4300	6503	166455349	SO:0001583	missense	79809	exon24			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.3149G>A	2.37:g.166747103C>T	ENSP00000243344:p.Arg1050Gln	Somatic		Capture	Illumina HiSeq	Phase_I	166455349	NM_024753	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	ENST00000243344.7	37	CCDS33315.1	.	.	.	.	.	.	.	.	.	.	C	35	5.550226	0.96501	2.27E-4	0.0	ENSG00000123607	ENST00000243344	T	0.63255	-0.03	5.69	5.69	0.88448	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.84019	0.5380	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86464	0.1781	10	0.72032	D	0.01	-17.9488	19.8361	0.96658	0.0:1.0:0.0:0.0	.	1050	Q7Z4L5	TT21B_HUMAN	Q	1050	ENSP00000243344:R1050Q	ENSP00000243344:R1050Q	R	-	2	0	TTC21B	166455349	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.802000	0.85969	2.703000	0.92315	0.637000	0.83480	CGG		0.343	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753	
SCN1A	6323	broad.mit.edu	37	2	166848084	166848084	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:166848084C>G	ENST00000303395.4	-	26	5700	c.5701G>C	c.(5701-5703)Gtc>Ctc	p.V1901L	SCN1A_ENST00000409050.1_Missense_Mutation_p.V1873L|SCN1A_ENST00000423058.2_Missense_Mutation_p.V1901L|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.V1890L|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1901					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.V1890L(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGATAGGAGACCTTGGAAGGA	0.433																																					p.V1873L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5617C	2						.						98.0	92.0	94.0					2																	166848084		2203	4300	6503	166556330	SO:0001583	missense	6323	exon26			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5701G>C	2.37:g.166848084C>G	ENSP00000303540:p.Val1901Leu	Somatic		Capture	Illumina HiSeq	Phase_I	166556330	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392037	0.25118	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.96232	-3.95;-3.95;-3.9;-3.89	5.6	4.66	0.58398	.	0.520749	0.17598	N	0.168533	D	0.95937	0.8677	M	0.80183	2.485	0.39046	D	0.960235	B	0.06786	0.001	B	0.12837	0.008	D	0.94613	0.7806	10	0.66056	D	0.02	.	16.3059	0.82848	0.0:0.8679:0.1321:0.0	.	1890	P35498-2	.	L	1901;1901;1890;1873	ENSP00000407030:V1901L;ENSP00000303540:V1901L;ENSP00000364554:V1890L;ENSP00000386312:V1873L	ENSP00000303540:V1901L	V	-	1	0	SCN1A	166556330	0.443000	0.25641	1.000000	0.80357	0.865000	0.49528	2.002000	0.40835	2.788000	0.95919	0.650000	0.86243	GTC		0.433	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
SCN1A	6323	broad.mit.edu	37	2	166894607	166894607	+	Silent	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:166894607C>T	ENST00000303395.4	-	15	2624	c.2625G>A	c.(2623-2625)acG>acA	p.T875T	SCN1A_ENST00000409050.1_Silent_p.T847T|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000423058.2_Silent_p.T875T|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Silent_p.T864T|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	875			T -> K (in EIEE6; dbSNP:rs121918623). {ECO:0000269|PubMed:20522430}.|T -> M (in GEFS+2; dbSNP:rs121918623). {ECO:0000269|PubMed:10742094}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.T864T(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCATATTTAACGTTGGCCAAG	0.378																																					p.T847T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2541A	2						.						45.0	47.0	46.0					2																	166894607		2202	4300	6502	166602853	SO:0001819	synonymous_variant	6323	exon15			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2625G>A	2.37:g.166894607C>T		Somatic		Capture	Illumina HiSeq	Phase_I	166602853	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																				0.378	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
TTN	7273	broad.mit.edu	37	2	179644742	179644742	+	Silent	SNP	A	A	C			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:179644742A>C	ENST00000591111.1	-	22	3938	c.3714T>G	c.(3712-3714)acT>acG	p.T1238T	TTN_ENST00000359218.5_Silent_p.T1192T|TTN_ENST00000460472.2_Silent_p.T1192T|TTN_ENST00000360870.5_Silent_p.T1238T|TTN_ENST00000342175.6_Silent_p.T1192T|TTN_ENST00000342992.6_Silent_p.T1238T|TTN_ENST00000589042.1_Silent_p.T1238T|RP11-88L24.4_ENST00000582038.2_RNA			Q8WZ42	TITIN_HUMAN	titin	33443					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T1192T(5)|p.T1238T(4)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTCTACATAAGTTCTGACCA	0.308																																					p.T1238T												.	.	9	Substitution - coding silent(9)	large_intestine(5)|stomach(4)	c.T3714G	2						.						126.0	115.0	119.0					2																	179644742		2203	4300	6503	179352987	SO:0001819	synonymous_variant	7273	exon22			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3714T>G	2.37:g.179644742A>C		Somatic		Capture	Illumina HiSeq	Phase_I	179352987	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.308	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
COL3A1	1281	broad.mit.edu	37	2	189856934	189856934	+	Nonsense_Mutation	SNP	C	C	T	rs587779607		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:189856934C>T	ENST00000304636.3	+	14	1146	c.976C>T	c.(976-978)Cga>Tga	p.R326*	COL3A1_ENST00000317840.5_Nonsense_Mutation_p.R326*	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	326	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.R326*(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TGACGGTGCTCGAGGCAGTGA	0.348																																					p.R326X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C976T	2						.						147.0	145.0	145.0					2																	189856934		2203	4300	6503	189565179	SO:0001587	stop_gained	1281	exon14			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.976C>T	2.37:g.189856934C>T	ENSP00000304408:p.Arg326*	Somatic		Capture	Illumina HiSeq	Phase_I	189565179	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Nonsense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.536231|7.536231	0.98345|0.98345	.|.	.|.	ENSG00000168542|ENSG00000168542	ENST00000304636;ENST00000317840|ENST00000450867	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	0.174703|.	0.26623|.	N|.	0.023352|.	.|T	.|0.76278	.|0.3965	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73369	.|-0.4004	.|3	0.28530|.	T|.	0.3|.	.|.	18.8014|18.8014	0.92018|0.92018	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	326|25	.|.	ENSP00000304408:R326X|.	R|S	+|+	1|2	2|0	COL3A1|COL3A1	189565179|189565179	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.923000|0.923000	0.55619|0.55619	3.208000|3.208000	0.51114|0.51114	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	CGA|TCG		0.348	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
TNS1	7145	broad.mit.edu	37	2	218683372	218683372	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:218683372C>T	ENST00000171887.4	-	24	3823	c.3371G>A	c.(3370-3372)aGc>aAc	p.S1124N	TNS1_ENST00000419504.1_Missense_Mutation_p.S1111N|TNS1_ENST00000430930.1_Missense_Mutation_p.S1103N	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1124	Ser-rich.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.S1124N(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGCAGACGGGCTGGGCTGTCC	0.627																																					p.S1124N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3371A	2						.						43.0	48.0	47.0					2																	218683372		2203	4300	6503	218391617	SO:0001583	missense	7145	exon24			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.3371G>A	2.37:g.218683372C>T	ENSP00000171887:p.Ser1124Asn	Somatic		Capture	Illumina HiSeq	Phase_I	218391617	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	C	12.67	2.008472	0.35415	.	.	ENSG00000079308	ENST00000171887;ENST00000446688;ENST00000419504;ENST00000430930	D;T;D;D	0.91631	-2.88;2.15;-2.87;-2.87	5.27	4.37	0.52481	.	0.542019	0.20121	N	0.098815	D	0.85500	0.5711	L	0.40543	1.245	0.20403	N	0.999904	B;B;B	0.29341	0.201;0.201;0.242	B;B;B	0.24541	0.054;0.034;0.047	T	0.74396	-0.3679	10	0.33940	T	0.23	.	7.1189	0.25433	0.2412:0.4542:0.3047:0.0	.	1124;1103;1111	Q9HBL0;E9PGF5;E9PF55	TENS1_HUMAN;.;.	N	1124;262;1111;1103	ENSP00000171887:S1124N;ENSP00000394171:S262N;ENSP00000408724:S1111N;ENSP00000406016:S1103N	ENSP00000171887:S1124N	S	-	2	0	TNS1	218391617	0.108000	0.22018	0.976000	0.42696	0.880000	0.50808	1.348000	0.33987	2.472000	0.83506	0.655000	0.94253	AGC		0.627	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
CXCR2	3579	broad.mit.edu	37	2	219000587	219000587	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:219000587C>A	ENST00000318507.2	+	3	1490	c.1063C>A	c.(1063-1065)Cac>Aac	p.H355N		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	355					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)	p.H355N(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						TTCTTCAGGGCACACTTCCAC	0.532																																					p.H355N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1063A	2						.						98.0	95.0	96.0					2																	219000587		2203	4299	6502	218708832	SO:0001583	missense	3579	exon3			U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.1063C>A	2.37:g.219000587C>A	ENSP00000319635:p.His355Asn	Somatic		Capture	Illumina HiSeq	Phase_I	218708832	NM_001557	Q8IUZ1|Q9P2T6|Q9P2T7	Missense_Mutation	SNP	ENST00000318507.2	37	CCDS2408.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.100737	0.00360	.	.	ENSG00000180871	ENST00000318507	T	0.64618	-0.11	5.09	3.94	0.45596	.	0.900332	0.09707	N	0.766242	T	0.22282	0.0537	N	0.00116	-2.08	0.23776	N	0.996875	B	0.02656	0.0	B	0.01281	0.0	T	0.15665	-1.0429	9	.	.	.	.	9.8739	0.41191	0.8182:0.1818:0.0:0.0	.	355	P25025	CXCR2_HUMAN	N	355	ENSP00000319635:H355N	.	H	+	1	0	CXCR2	218708832	0.998000	0.40836	0.950000	0.38849	0.265000	0.26407	3.300000	0.51834	0.797000	0.33971	-0.538000	0.04264	CAC		0.532	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256772.2	NM_001557	
HEATR5B	54497	broad.mit.edu	37	2	37297467	37297467	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:37297467A>T	ENST00000233099.5	-	7	928	c.833T>A	c.(832-834)tTt>tAt	p.F278Y	HEATR5B_ENST00000354531.2_Missense_Mutation_p.F278Y	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	278						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.F278Y(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TCCACGCAGAAATCCTGTGGC	0.403																																					p.F278Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T833A	2						.						126.0	122.0	123.0					2																	37297467		2203	4300	6503	37150971	SO:0001583	missense	54497	exon7			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.833T>A	2.37:g.37297467A>T	ENSP00000233099:p.Phe278Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	37150971	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.008076	0.93287	.	.	ENSG00000008869	ENST00000233099;ENST00000354531;ENST00000424416	T;T	0.08193	3.12;3.12	4.98	4.98	0.66077	Armadillo-like helical (1);Armadillo-type fold (1);	0.051429	0.85682	D	0.000000	T	0.32882	0.0844	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.15723	-1.0427	10	0.34782	T	0.22	-20.4522	14.9509	0.71074	1.0:0.0:0.0:0.0	.	278	Q9P2D3	HTR5B_HUMAN	Y	278	ENSP00000233099:F278Y;ENSP00000346531:F278Y	ENSP00000233099:F278Y	F	-	2	0	HEATR5B	37150971	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.105000	0.94246	1.975000	0.57531	0.460000	0.39030	TTT		0.403	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
SPTBN1	6711	broad.mit.edu	37	2	54844824	54844824	+	Splice_Site	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:54844824C>T	ENST00000356805.4	+	6	927	c.646C>T	c.(646-648)Cgg>Tgg	p.R216W	SPTBN1_ENST00000333896.5_Splice_Site_p.R203W	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	216	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.R216W(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			ACACAAACACCGGTAAGTCCA	0.468																																					p.R216W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C646T	2						.						157.0	128.0	137.0					2																	54844824		2203	4300	6503	54698328	SO:0001630	splice_region_variant	6711	exon6				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.647+1C>T	2.37:g.54844824C>T		Somatic		Capture	Illumina HiSeq	Phase_I	54698328	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648579	0.87958	.	.	ENSG00000115306	ENST00000356805;ENST00000389980;ENST00000333896	D;D;D	0.95238	-3.65;-3.65;-3.65	5.07	5.07	0.68467	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.98413	0.9472	H	0.99182	4.46	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98667	1.0686	10	0.87932	D	0	.	12.0882	0.53710	0.2901:0.7099:0.0:0.0	.	203;216	Q01082-3;Q01082	.;SPTB2_HUMAN	W	216;216;203	ENSP00000349259:R216W;ENSP00000374630:R216W;ENSP00000334156:R203W	ENSP00000334156:R203W	R	+	1	2	SPTBN1	54698328	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.528000	0.60580	2.523000	0.85059	0.655000	0.94253	CGG		0.468	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		Missense_Mutation
TET3	200424	broad.mit.edu	37	2	74326428	74326428	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:74326428A>G	ENST00000409262.3	+	8	2888	c.2888A>G	c.(2887-2889)aAt>aGt	p.N963S		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	963					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)	p.N240S(1)|p.N963S(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AAGGAAGACAATCGCTGCGTG	0.592																																					p.N963S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2888G	2						.						38.0	44.0	42.0					2																	74326428		2089	4212	6301	74179936	SO:0001583	missense	200424	exon8				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.2888A>G	2.37:g.74326428A>G	ENSP00000386869:p.Asn963Ser	Somatic		Capture	Illumina HiSeq	Phase_I	74179936	NM_144993	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	CCDS46339.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.512687	0.85389	.	.	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.15603	2.41	5.06	5.06	0.68205	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	0.101679	0.64402	D	0.000002	T	0.44159	0.1280	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.46925	-0.9156	10	0.72032	D	0.01	.	13.9262	0.63964	1.0:0.0:0.0:0.0	.	963	O43151	TET3_HUMAN	S	963	ENSP00000386869:N963S	ENSP00000233310:N963S	N	+	2	0	TET3	74179936	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.139000	0.94554	2.127000	0.65507	0.533000	0.62120	AAT		0.592	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
TCF7L1	83439	broad.mit.edu	37	2	85532463	85532463	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:85532463C>A	ENST00000282111.3	+	8	1201	c.926C>A	c.(925-927)gCc>gAc	p.A309D		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	309	Pro-rich.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A309D(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						CCCCACCCTGCCATCGTCTCC	0.642																																					p.A309D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C926A	2						.						68.0	67.0	68.0					2																	85532463		2203	4300	6503	85385974	SO:0001583	missense	83439	exon8			X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.926C>A	2.37:g.85532463C>A	ENSP00000282111:p.Ala309Asp	Somatic		Capture	Illumina HiSeq	Phase_I	85385974	NM_031283	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000282111.3	37	CCDS1971.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.681863	0.68042	.	.	ENSG00000152284	ENST00000282111	D	0.98822	-5.16	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.98504	0.9501	M	0.81497	2.545	0.53688	D	0.99997	D	0.53619	0.961	P	0.49637	0.617	D	0.99577	1.0972	10	0.87932	D	0	.	16.1893	0.81975	0.0:1.0:0.0:0.0	.	309	Q9HCS4	TF7L1_HUMAN	D	309	ENSP00000282111:A309D	ENSP00000282111:A309D	A	+	2	0	TCF7L1	85385974	1.000000	0.71417	1.000000	0.80357	0.081000	0.17604	7.787000	0.85759	2.401000	0.81631	0.591000	0.81541	GCC		0.642	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283	
SPHKAP	80309	broad.mit.edu	37	2	228884103	228884103	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr2:228884103G>T	ENST00000392056.3	-	7	1513	c.1467C>A	c.(1465-1467)agC>agA	p.S489R	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S489R	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	489						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.S489R(1)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGGGTTGTCTGCTGGAGTTCT	0.532																																					p.S489R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1467A	2						.						53.0	53.0	53.0					2																	228884103		2203	4300	6503	228592347	SO:0001583	missense	80309	exon7				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1467C>A	2.37:g.228884103G>T	ENSP00000375909:p.Ser489Arg	Somatic		Capture	Illumina HiSeq	Phase_I	228592347	NM_001142644	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	9.786	1.176542	0.21704	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.49720	0.77;0.77	5.39	2.54	0.30619	.	1.016570	0.07807	N	0.957444	T	0.39091	0.1065	L	0.42245	1.32	0.25548	N	0.987117	B;B	0.12630	0.001;0.006	B;B	0.13407	0.002;0.009	T	0.31613	-0.9937	10	0.41790	T	0.15	.	6.0144	0.19594	0.1315:0.0:0.4465:0.422	.	489;489	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	R	489	ENSP00000375909:S489R;ENSP00000339886:S489R	ENSP00000339886:S489R	S	-	3	2	SPHKAP	228592347	0.000000	0.05858	0.707000	0.30419	0.904000	0.53231	-0.278000	0.08490	0.361000	0.24292	0.655000	0.94253	AGC		0.532	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
FSTL1	11167	broad.mit.edu	37	3	120122101	120122101	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr3:120122101G>A	ENST00000295633.3	-	8	1038	c.682C>T	c.(682-684)Cct>Tct	p.P228S	FSTL1_ENST00000424703.2_Missense_Mutation_p.P193S	NM_007085.4	NP_009016.1	Q12841	FSTL1_HUMAN	follistatin-like 1	228	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				BMP signaling pathway (GO:0030509)|response to starvation (GO:0042594)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.P228S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(1)	20				GBM - Glioblastoma multiforme(114;0.189)		TTCTCAGGAGGGTTGAAAGAT	0.448																																					p.P228S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C682T	3						.						98.0	99.0	99.0					3																	120122101		2203	4300	6503	121604791	SO:0001583	missense	11167	exon8			U06863	CCDS2998.1	3q13.33	2013-01-10			ENSG00000163430	ENSG00000163430		"""EF-hand domain containing"""	3972	protein-coding gene	gene with protein product		605547				7957230, 9786430	Standard	NM_007085		Approved	FRP, FSL1	uc003eds.3	Q12841	OTTHUMG00000159440	ENST00000295633.3:c.682C>T	3.37:g.120122101G>A	ENSP00000295633:p.Pro228Ser	Somatic		Capture	Illumina HiSeq	Phase_I	121604791	NM_007085	A8K523|B4DTT5|D3DN90|Q549Z0	Missense_Mutation	SNP	ENST00000295633.3	37	CCDS2998.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.73|15.73	2.920230|2.920230	0.52653|0.52653	.|.	.|.	ENSG00000163430|ENSG00000163430	ENST00000480823|ENST00000295633;ENST00000539471;ENST00000424703	.|T;T	.|0.70045	.|-0.45;-0.45	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.044285|0.044285	0.85682|0.85682	D|N	0.000000|0.000000	T|T	0.80138|0.80138	0.4568|0.4568	L|L	0.61218|0.61218	1.895|1.895	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.999;1.0	.|P;D	.|0.91635	.|0.904;0.999	T|T	0.75755|0.75755	-0.3206|-0.3206	6|10	.|0.33940	.|T	.|0.23	-12.6116|-12.6116	18.0158|18.0158	0.89239|0.89239	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|193;228	.|B4DTT5;Q12841	.|.;FSTL1_HUMAN	L|S	15|228;171;193	.|ENSP00000295633:P228S;ENSP00000394355:P193S	.|ENSP00000295633:P228S	P|P	-|-	2|1	0|0	FSTL1|FSTL1	121604791|121604791	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.414000|9.414000	0.97362|0.97362	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	CCC|CCT		0.448	FSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355399.1	NM_007085	
WDR5B	54554	broad.mit.edu	37	3	122134076	122134076	+	Silent	SNP	A	A	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr3:122134076A>T	ENST00000330689.4	-	1	806	c.300T>A	c.(298-300)tcT>tcA	p.S100S	RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	100								p.S100S(1)		kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		CATCTGAGGCAGAAACAAGAC	0.368																																					p.S100S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T300A	3						.						109.0	111.0	110.0					3																	122134076		2203	4300	6503	123616766	SO:0001819	synonymous_variant	54554	exon1			AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.300T>A	3.37:g.122134076A>T		Somatic		Capture	Illumina HiSeq	Phase_I	123616766	NM_019069	B2RCM9|Q9NUL4	Silent	SNP	ENST00000330689.4	37	CCDS3012.1																																																																																				0.368	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355753.1	NM_019069	
LRRC2	79442	broad.mit.edu	37	3	46586740	46586740	+	Silent	SNP	T	T	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr3:46586740T>A	ENST00000395905.3	-	3	521	c.129A>T	c.(127-129)atA>atT	p.I43I	LRRC2_ENST00000496388.1_5'UTR|LRRC2_ENST00000296144.3_Silent_p.I43I	NM_024512.4	NP_078788.2	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2	43								p.I43I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	17		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		ACTCCTCCTTTATCCTAAAAC	0.557																																					p.I43I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A129T	3						.						49.0	49.0	49.0					3																	46586740		2203	4300	6503	46561744	SO:0001819	synonymous_variant	79442	exon3			AJ308569	CCDS2741.1	3p21.3	2014-07-30	2003-11-19		ENSG00000163827	ENSG00000163827			14676	protein-coding gene	gene with protein product		607180	"""leucine-rich repeat-containing 2"""			11896456	Standard	NM_024512		Approved		uc010hji.3	Q9BYS8	OTTHUMG00000133479	ENST00000395905.3:c.129A>T	3.37:g.46586740T>A		Somatic		Capture	Illumina HiSeq	Phase_I	46561744	NM_024512	B2RDQ7|Q96LT5	Silent	SNP	ENST00000395905.3	37	CCDS2741.1																																																																																				0.557	LRRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257375.2		
LEPREL1	55214	broad.mit.edu	37	3	189692415	189692415	+	Missense_Mutation	SNP	T	T	C	rs116425590		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr3:189692415T>C	ENST00000319332.5	-	9	1581	c.1384A>G	c.(1384-1386)Act>Gct	p.T462A	LEPREL1_ENST00000427335.2_Missense_Mutation_p.T281A	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	462					collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)	p.T462A(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	ACCCGCTGAGTCCCGTTCAGC	0.557																																					p.T281A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A841G	3						.						82.0	67.0	72.0					3																	189692415		2203	4300	6503	191175109	SO:0001583	missense	55214	exon9				CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.1384A>G	3.37:g.189692415T>C	ENSP00000316881:p.Thr462Ala	Somatic		Capture	Illumina HiSeq	Phase_I	191175109	NM_001134418	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Missense_Mutation	SNP	ENST00000319332.5	37	CCDS3294.1	.	.	.	.	.	.	.	.	.	.	T	33	5.204008	0.95033	.	.	ENSG00000090530	ENST00000319332;ENST00000427335	T;T	0.62498	0.02;0.02	5.81	5.81	0.92471	Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.61553	0.2356	L	0.59436	1.845	0.58432	D	0.999999	P	0.42483	0.781	B	0.41466	0.358	T	0.62210	-0.6902	9	.	.	.	-14.5115	15.3481	0.74359	0.0:0.0:0.0:1.0	.	462	Q8IVL5	P3H2_HUMAN	A	462;281	ENSP00000316881:T462A;ENSP00000408947:T281A	.	T	-	1	0	LEPREL1	191175109	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.818000	0.55678	2.210000	0.71456	0.533000	0.62120	ACT		0.557	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343855.1	NM_018192	
PCDH10	57575	broad.mit.edu	37	4	134072544	134072544	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr4:134072544A>G	ENST00000264360.5	+	1	2075	c.1249A>G	c.(1249-1251)Acc>Gcc	p.T417A	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	417	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T417A(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CACCATCGTTACCGAAGCCCC	0.602																																					p.T417A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1249G	4						.						153.0	166.0	161.0					4																	134072544		2203	4300	6503	134291994	SO:0001583	missense	57575	exon1			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1249A>G	4.37:g.134072544A>G	ENSP00000264360:p.Thr417Ala	Somatic		Capture	Illumina HiSeq	Phase_I	134291994	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	A	18.25	3.583243	0.65992	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.56444	0.46	4.68	4.68	0.58851	Cadherin (4);Cadherin-like (1);	0.000000	0.46758	D	0.000278	T	0.74215	0.3687	M	0.85945	2.785	0.58432	D	0.999999	D;D	0.71674	0.998;0.975	D;D	0.81914	0.995;0.919	T	0.79383	-0.1826	10	0.72032	D	0.01	.	13.979	0.64291	1.0:0.0:0.0:0.0	.	417;417	Q9P2E7;Q96SF0	PCD10_HUMAN;.	A	417	ENSP00000264360:T417A	ENSP00000264360:T417A	T	+	1	0	PCDH10	134291994	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.139000	0.94554	1.963000	0.57068	0.459000	0.35465	ACC		0.602	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
FSTL5	56884	broad.mit.edu	37	4	163032431	163032431	+	Nonsense_Mutation	SNP	G	G	A	rs141917472	byFrequency	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr4:163032431G>A	ENST00000306100.5	-	2	554	c.118C>T	c.(118-120)Cga>Tga	p.R40*	FSTL5_ENST00000427802.2_Nonsense_Mutation_p.R40*|FSTL5_ENST00000379164.4_Nonsense_Mutation_p.R40*|FSTL5_ENST00000536695.1_Nonsense_Mutation_p.R40*	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	40						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R40*(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		ACCTTATGTCGCAATCTCATT	0.393																																					p.R40X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C118T	4						.						181.0	176.0	178.0					4																	163032431		2203	4300	6503	163251881	SO:0001587	stop_gained	56884	exon2			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.118C>T	4.37:g.163032431G>A	ENSP00000305334:p.Arg40*	Somatic		Capture	Illumina HiSeq	Phase_I	163251881	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Nonsense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	G	42	9.453883	0.99175	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	.	.	.	5.51	1.36	0.22044	.	0.211970	0.31010	N	0.008436	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.4628	0.55741	0.0:0.0:0.4387:0.5613	.	.	.	.	X	40	.	ENSP00000305334:R40X	R	-	1	2	FSTL5	163251881	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.642000	0.46596	0.311000	0.23014	0.585000	0.79938	CGA		0.393	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
APC	324	broad.mit.edu	37	5	112175423	112175423	+	Nonsense_Mutation	SNP	C	C	T	rs121913329		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr5:112175423C>T	ENST00000457016.1	+	16	4512	c.4132C>T	c.(4132-4134)Cag>Tag	p.Q1378*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1378*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1378*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1378	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1378*(47)|p.Q1378fs*7(2)|p.Y1376fs*41(1)|p.?(1)|p.Q1378fs*5(1)|p.Q1378fs*8(1)|p.K1192fs*3(1)|p.Y1376fs*5(1)|p.Y1376fs*1(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACACTATGTTCAGGAGACCCC	0.468		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1360X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	56	Substitution - Nonsense(47)|Deletion - Frameshift(6)|Unknown(1)|Complex - frameshift(1)|Insertion - Frameshift(1)	large_intestine(49)|stomach(5)|soft_tissue(1)|skin(1)	c.C4078T	5						.						91.0	87.0	88.0					5																	112175423		2202	4300	6502	112203322	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4132C>T	5.37:g.112175423C>T	ENSP00000413133:p.Gln1378*	Somatic		Capture	Illumina HiSeq	Phase_I	112203322	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.764727	0.98945	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.1139	20.4898	0.99202	0.0:1.0:0.0:0.0	.	.	.	.	X	1378	.	.	Q	+	1	0	APC	112203322	1.000000	0.71417	0.999000	0.59377	0.831000	0.47069	5.761000	0.68801	2.941000	0.99782	0.655000	0.94253	CAG		0.468	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
LPCAT1	79888	broad.mit.edu	37	5	1489863	1489863	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr5:1489863G>C	ENST00000283415.3	-	4	736	c.604C>G	c.(604-606)Cag>Gag	p.Q202E		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	202					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)	p.Q202E(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TGCATTACCTGTGGCCACTTT	0.532																																					p.Q202E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C604G	5						.						185.0	176.0	179.0					5																	1489863		2203	4300	6503	1542863	SO:0001583	missense	79888	exon4			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.604C>G	5.37:g.1489863G>C	ENSP00000283415:p.Gln202Glu	Somatic		Capture	Illumina HiSeq	Phase_I	1542863	NM_024830	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	ENST00000283415.3	37	CCDS3864.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403203	0.62288	.	.	ENSG00000153395	ENST00000283415	D	0.93247	-3.19	4.19	4.19	0.49359	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.97108	0.9055	M	0.91510	3.215	0.80722	D	1	D	0.63880	0.993	D	0.66497	0.944	D	0.98070	1.0398	10	0.62326	D	0.03	-17.2479	16.8802	0.86061	0.0:0.0:1.0:0.0	.	202	Q8NF37	PCAT1_HUMAN	E	202	ENSP00000283415:Q202E	ENSP00000283415:Q202E	Q	-	1	0	LPCAT1	1542863	1.000000	0.71417	0.883000	0.34634	0.047000	0.14425	8.497000	0.90488	2.050000	0.60909	0.561000	0.74099	CAG		0.532	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304032.1	NM_024830	
PCDHB2	56133	broad.mit.edu	37	5	140476014	140476014	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr5:140476014C>T	ENST00000194155.4	+	1	1788	c.1640C>T	c.(1639-1641)gCg>gTg	p.A547V		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	547	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A547V(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCAGCGAGGCGCTGGTGCGC	0.711																																					p.A547V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1640T	5						.						32.0	35.0	34.0					5																	140476014		2200	4296	6496	140456198	SO:0001583	missense	56133	exon1			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1640C>T	5.37:g.140476014C>T	ENSP00000194155:p.Ala547Val	Somatic		Capture	Illumina HiSeq	Phase_I	140456198	NM_018936	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.974410	0.34848	.	.	ENSG00000112852	ENST00000194155	T	0.01787	4.64	4.5	3.63	0.41609	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01523	0.0049	N	0.21617	0.685	0.26804	N	0.969134	P	0.41929	0.765	B	0.40199	0.322	T	0.48917	-0.8992	9	0.15952	T	0.53	.	7.9152	0.29814	0.0:0.7422:0.0:0.2578	.	547	Q9Y5E7	PCDB2_HUMAN	V	547	ENSP00000194155:A547V	ENSP00000194155:A547V	A	+	2	0	PCDHB2	140456198	0.020000	0.18652	0.999000	0.59377	0.989000	0.77384	0.271000	0.18626	1.026000	0.39733	0.556000	0.70494	GCG		0.711	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
ESM1	11082	broad.mit.edu	37	5	54277952	54277952	+	Silent	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr5:54277952C>T	ENST00000381405.4	-	2	469	c.324G>A	c.(322-324)ggG>ggA	p.G108G	ESM1_ENST00000598310.1_Intron|ESM1_ENST00000381403.4_Intron	NM_007036.4	NP_008967.1	Q9NQ30	ESM1_HUMAN	endothelial cell-specific molecule 1	108					angiogenesis (GO:0001525)|positive regulation of cell proliferation (GO:0008284)|positive regulation of hepatocyte growth factor receptor signaling pathway (GO:1902204)|regulation of cell growth (GO:0001558)|sprouting angiogenesis (GO:0002040)	extracellular region (GO:0005576)	hepatocyte growth factor receptor binding (GO:0005171)|integrin binding (GO:0005178)	p.G108G(1)		breast(1)|kidney(1)|large_intestine(4)|lung(4)	10		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.116)	Lung(15;0.23)			TGCAATCCATCCCGAAGGTGC	0.522																																					p.G108G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G324A	5						.						84.0	80.0	81.0					5																	54277952		2203	4300	6503	54313709	SO:0001819	synonymous_variant	11082	exon2			X89426	CCDS3963.1, CCDS47206.1	5q11	2008-02-05			ENSG00000164283	ENSG00000164283			3466	protein-coding gene	gene with protein product		601521				8702785	Standard	NM_001135604		Approved		uc003jpk.3	Q9NQ30	OTTHUMG00000097010	ENST00000381405.4:c.324G>A	5.37:g.54277952C>T		Somatic		Capture	Illumina HiSeq	Phase_I	54313709	NM_007036	B2R4G3|Q15330|Q3V4E3|Q96ES3	Silent	SNP	ENST00000381405.4	37	CCDS3963.1																																																																																				0.522	ESM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214099.2	NM_007036	
ITK	3702	broad.mit.edu	37	5	156608010	156608010	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr5:156608010G>A	ENST00000422843.3	+	1	174	c.22G>A	c.(22-24)Gaa>Aaa	p.E8K		NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	8	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.E8K(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	TATCCTCCTGGAAGAACAGCT	0.438			T	SYK	peripheral T-cell lymphoma																																p.E8K	Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G22A	5						.						94.0	87.0	89.0					5																	156608010		2203	4300	6503	156540588	SO:0001583	missense	3702	exon1			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.22G>A	5.37:g.156608010G>A	ENSP00000398655:p.Glu8Lys	Somatic		Capture	Illumina HiSeq	Phase_I	156540588	NM_005546	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.042604	0.55003	.	.	ENSG00000113263	ENST00000422843	D	0.94793	-3.52	5.27	5.27	0.74061	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.052344	0.85682	D	0.000000	D	0.90868	0.7131	L	0.31065	0.9	0.43678	D	0.996111	B	0.18013	0.025	B	0.14023	0.01	D	0.87110	0.2184	10	0.51188	T	0.08	.	17.4416	0.87566	0.0:0.0:1.0:0.0	.	8	Q08881	ITK_HUMAN	K	8	ENSP00000398655:E8K	ENSP00000398655:E8K	E	+	1	0	ITK	156540588	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.368000	0.59505	2.614000	0.88457	0.655000	0.94253	GAA		0.438	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2		
HLA-DPB1	3115	broad.mit.edu	37	6	33048603	33048603	+	Silent	SNP	G	G	A	rs80330773	byFrequency	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr6:33048603G>A	ENST00000418931.2	+	2	371	c.255G>A	c.(253-255)gcG>gcA	p.A85A	HLA-DPB1_ENST00000471184.1_3'UTR|HLA-DPB1_ENST00000535465.1_Silent_p.A85A|HLA-DPA1_ENST00000419277.1_5'Flank	NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1	85	Beta-1.		A -> E (in allele DPB1*02:01, allele DPB1*03:01, allele DPB1*04:02, allele DPB1*05:02, allele DPB1*06:01, allele DPB1*06:02, allele DPB1*08:01, allele DPB1*09:01, allele DPB1*10:01, allele DPB1*10:02, allele DPB1*11:02, allele DPB1*14:01, allele DPB1*14:02, allele DPB1*16:01, allele DPB1*16:02, allele DPB1*17:01, allele DPB1*18:01, allele DPB1*18:02, allele DPB1*19:02, allele DPB1*20:01, allele DPB1*22:02, allele DPB1*25:01, allele DPB1*25:02, allele DPB1*26:02, allele DPB1*28:01, allele DPB1*29:01, allele DPB1*32:01, allele DPB1*35:01, allele DPB1*37:01, allele DPB1*41:01, allele DPB1*44:01, allele DPB1*45:01, allele DPB1*46:01, allele DPB1*48:01, allele DPB1*49:01, allele DPB1*50:01, allele DPB1*51:01, allele DPB1*53:01, allele DPB1*57:01, allele DPB1*59:01, allele DPB1*60:01, allele DPB1*68:01, allele DPB1*69:01, allele DPB1*70:01, allele DPB1*73:01, allele DPB1*75:01, allele DPB1*76:01, allele DPB1*77:01, allele DPB1*78:01, allele DPB1*79:01, allele DPB1*80:01, allele DPB1*81:01, allele DPB1*82:01, allele DPB1*83:01, allele DPB1*84:01, allele DPB1*86:01, allele DPB1*88:01, allele DPB1*91:01, allele DPB1*92:01, allele DPB1*93:01, allele DPB1*94:01 and allele DPB1*98:01; dbSNP:rs1042131).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)	p.A85A(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						GGCCTGCTGCGGAGTACTGGA	0.647																																					p.E85E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G255A	6						.						55.0	56.0	56.0					6																	33048603		1511	2709	4220	33156581	SO:0001819	synonymous_variant	3115	exon2				CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	ENST00000418931.2:c.255G>A	6.37:g.33048603G>A		Somatic		Capture	Illumina HiSeq	Phase_I	33156581	NM_002121	A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	Silent	SNP	ENST00000418931.2	37	CCDS4765.1	.	.	.	.	.	.	.	.	.	.	G	7.144	0.582411	0.13749	.	.	ENSG00000223865	ENST00000416804	.	.	.	4.02	-0.211	0.13172	.	.	.	.	.	T	0.30386	0.0763	.	.	.	0.28184	N	0.928058	.	.	.	.	.	.	T	0.35699	-0.9778	4	.	.	.	.	16.2887	0.82737	0.0:0.286:0.714:0.0	.	.	.	.	Q	52	.	.	R	+	2	0	HLA-DPB1	33156581	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.443000	0.02405	-0.152000	0.11156	-0.159000	0.13428	CGG		0.647	HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076106.2	NM_002121	
ITPR3	3710	broad.mit.edu	37	6	33662828	33662828	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr6:33662828A>G	ENST00000374316.5	+	58	8973	c.7913A>G	c.(7912-7914)cAc>cGc	p.H2638R	ITPR3_ENST00000605930.1_Missense_Mutation_p.H2638R			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2638					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.H2638R(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CTGGTGTCCCACCTCACTGCC	0.612																																					p.H2638R												.	.	1	Substitution - Missense(1)	ovary(1)	c.A7913G	6						.						95.0	65.0	75.0					6																	33662828		2203	4300	6503	33770806	SO:0001583	missense	3710	exon57			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.7913A>G	6.37:g.33662828A>G	ENSP00000363435:p.His2638Arg	None		Capture	Illumina HiSeq	Phase_I	33770806	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	A	15.17	2.755464	0.49362	.	.	ENSG00000096433	ENST00000374316	T	0.39229	1.09	5.67	5.67	0.87782	.	0.157744	0.56097	D	0.000026	T	0.13756	0.0333	N	0.08118	0	0.40372	D	0.979357	B	0.29936	0.262	B	0.27380	0.079	T	0.07751	-1.0756	10	0.40728	T	0.16	-41.3018	15.9154	0.79512	1.0:0.0:0.0:0.0	.	2638	Q14573	ITPR3_HUMAN	R	2638	ENSP00000363435:H2638R	ENSP00000363435:H2638R	H	+	2	0	ITPR3	33770806	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	4.225000	0.58600	2.178000	0.69098	0.533000	0.62120	CAC		0.612	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
EEF1A1	1915	broad.mit.edu	37	6	74229160	74229160	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr6:74229160A>G	ENST00000316292.9	-	2	1215	c.224T>C	c.(223-225)aTc>aCc	p.I75T	EEF1A1_ENST00000309268.6_Missense_Mutation_p.I75T|EEF1A1_ENST00000491404.1_5'Flank|EEF1A1_ENST00000331523.2_Missense_Mutation_p.I75T	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	75	tr-type G.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)	p.I75T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						CCACAAGGAGATATCAATGGT	0.433											OREG0003890	type=REGULATORY REGION|Gene=LOC477388|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.I75T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T224C	6						.						76.0	86.0	83.0					6																	74229160		2202	4295	6497	74285881	SO:0001583	missense	1915	exon3			BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.224T>C	6.37:g.74229160A>G	ENSP00000339063:p.Ile75Thr	Somatic	1151	Capture	Illumina HiSeq	Phase_I	74285881	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	37	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	A	13.80	2.344027	0.41498	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977;ENST00000456206;ENST00000356303;ENST00000455918	T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56	3.97	3.97	0.46021	Protein synthesis factor, GTP-binding (6);	0.000000	0.64402	U	0.000001	T	0.73329	0.3573	L	0.48935	1.535	0.80722	D	1	P;D;D;D;D	0.89917	0.793;1.0;1.0;1.0;0.998	P;D;D;D;D	0.97110	0.63;1.0;1.0;1.0;0.972	T	0.77464	-0.2578	10	0.72032	D	0.01	.	13.3318	0.60492	1.0:0.0:0.0:0.0	.	75;75;75;75;75	A6PW80;P68104;Q53HR5;Q6IPS9;Q5VTE0	.;EF1A1_HUMAN;.;.;EF1A3_HUMAN	T	75	ENSP00000339063:I75T;ENSP00000339053:I75T;ENSP00000330054:I75T;ENSP00000348651:I75T;ENSP00000392366:I75T	ENSP00000339053:I75T	I	-	2	0	EEF1A1	74285881	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.764000	0.91719	1.792000	0.52537	0.454000	0.30748	ATC		0.433	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
FUT9	10690	broad.mit.edu	37	6	96651362	96651362	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr6:96651362C>T	ENST00000302103.5	+	3	657	c.331C>T	c.(331-333)Cga>Tga	p.R111*		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	111					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)	p.R111*(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		GATCCATCACCGAGACATCAG	0.468																																					p.R111X	Melanoma(98;1369 1476 6592 22940 26587)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C331T	6						.						127.0	110.0	116.0					6																	96651362		2203	4300	6503	96758083	SO:0001587	stop_gained	10690	exon3			AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.331C>T	6.37:g.96651362C>T	ENSP00000302599:p.Arg111*	Somatic		Capture	Illumina HiSeq	Phase_I	96758083	NM_006581	Q5T0W4	Nonsense_Mutation	SNP	ENST00000302103.5	37	CCDS5033.1	.	.	.	.	.	.	.	.	.	.	C	34	5.312426	0.95655	.	.	ENSG00000172461	ENST00000302103	.	.	.	5.3	4.41	0.53225	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5419	12.0198	0.53337	0.4533:0.5467:0.0:0.0	.	.	.	.	X	111	.	ENSP00000302599:R111X	R	+	1	2	FUT9	96758083	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.662000	0.46766	1.309000	0.44985	0.655000	0.94253	CGA		0.468	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581	
C6orf118	168090	broad.mit.edu	37	6	165712979	165712979	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr6:165712979G>A	ENST00000230301.8	-	4	909	c.889C>T	c.(889-891)Ctc>Ttc	p.L297F	C6orf118_ENST00000543069.1_Missense_Mutation_p.L193F	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	297								p.L297F(1)		breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		GCCATGTAGAGTTCATATTCA	0.468																																					p.L297F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C889T	6						.						96.0	86.0	89.0					6																	165712979		2203	4300	6503	165632969	SO:0001583	missense	168090	exon4				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.889C>T	6.37:g.165712979G>A	ENSP00000230301:p.Leu297Phe	Somatic		Capture	Illumina HiSeq	Phase_I	165632969	NM_144980	Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	37	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.266635	0.40095	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.14766	2.48;2.48	5.21	3.39	0.38822	.	0.099573	0.43260	D	0.000585	T	0.14700	0.0355	M	0.67397	2.05	0.31234	N	0.696012	P	0.46987	0.888	P	0.56788	0.806	T	0.03068	-1.1076	10	0.72032	D	0.01	.	8.1774	0.31289	0.0855:0.1579:0.7566:0.0	.	297	Q5T5N4	CF118_HUMAN	F	297;193	ENSP00000230301:L297F;ENSP00000439288:L193F	ENSP00000230301:L297F	L	-	1	0	C6orf118	165632969	0.994000	0.37717	0.875000	0.34327	0.102000	0.19082	0.856000	0.27818	0.557000	0.29117	0.561000	0.74099	CTC		0.468	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980	
AC005013.5	0	broad.mit.edu	37	7	28996481	28996482	+	lincRNA	INS	-	-	G			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr7:28996481_28996482insG	ENST00000436594.1	+	0	0				TRIL_ENST00000322982.3_RNA																							CTCGCAGGGCCGGGGGGTGGCG	0.658																																					p.P394fs												.	.	0			c.1182_1183insC	7						.																																			28963007			9865	exon1																															7.37:g.28996487_28996487dupG		Somatic		Capture	Illumina HiSeq	Phase_I	28963006	NM_014817		Frame_Shift_Ins	INS	ENST00000436594.1	37																																																																																					0.658	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000327953.3		
ZNF786	136051	broad.mit.edu	37	7	148769444	148769444	+	Silent	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr7:148769444G>A	ENST00000491431.1	-	4	484	c.420C>T	c.(418-420)agC>agT	p.S140S	ZNF786_ENST00000451334.3_Silent_p.S103S|ZNF786_ENST00000316286.9_Silent_p.S54S	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S139S(1)		breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GTCTCTGTGGGCTCCCGAGGG	0.522																																					p.S140S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C420T	7						.						49.0	50.0	50.0					7																	148769444		1927	4131	6058	148400377	SO:0001819	synonymous_variant	136051	exon4			AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.420C>T	7.37:g.148769444G>A		Somatic		Capture	Illumina HiSeq	Phase_I	148400377	NM_152411	A1A568|B4DMI1	Silent	SNP	ENST00000491431.1	37	CCDS47738.1																																																																																				0.522	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352751.1	NM_152411	
CAMK2B	816	broad.mit.edu	37	7	44260425	44260425	+	Splice_Site	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr7:44260425G>A	ENST00000395749.2	-	21	1749	c.1673C>T	c.(1672-1674)gCg>gTg	p.A558V	CAMK2B_ENST00000489429.1_5'UTR|CAMK2B_ENST00000395747.2_Splice_Site_p.A410V|CAMK2B_ENST00000502837.2_Missense_Mutation_p.A305V|CAMK2B_ENST00000440254.2_Splice_Site_p.A434V|CAMK2B_ENST00000258682.6_Splice_Site_p.A409V|CAMK2B_ENST00000457475.1_Splice_Site_p.A410V|CAMK2B_ENST00000347193.4_Splice_Site_p.A410V|CAMK2B_ENST00000350811.3_Splice_Site_p.A434V|CAMK2B_ENST00000346990.4_Splice_Site_p.A341V|CAMK2B_ENST00000353625.4_Splice_Site_p.A371V|CAMK2B_ENST00000358707.3_Splice_Site_p.A395V	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	558					activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)	p.A558V(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						AGGGACTCACGCGTAGGCCTC	0.647																																					p.A434V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1301T	7						.						56.0	47.0	50.0					7																	44260425		2195	4288	6483	44226950	SO:0001630	splice_region_variant	816	exon18			U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.1673+1C>T	7.37:g.44260425G>A		Somatic		Capture	Illumina HiSeq	Phase_I	44226950	NM_172078	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	ENST00000395749.2	37	CCDS5483.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537433	0.65085	.	.	ENSG00000058404	ENST00000350811;ENST00000457475;ENST00000395749;ENST00000502837;ENST00000425809;ENST00000440254;ENST00000358707;ENST00000353625;ENST00000347193;ENST00000346990;ENST00000258682;ENST00000395747	T;T;T;T;T;T;T;T;T;T;T;T	0.59364	0.87;0.87;0.87;0.27;0.87;0.87;0.87;0.87;0.96;0.87;0.87;0.87	4.04	4.04	0.47022	Calcium/calmodulin-dependent protein kinase II, association-domain (1);	.	.	.	.	T	0.65386	0.2686	L	0.34521	1.04	0.28072	N	0.932538	B;B;B;B;P;B;B;D;P;D	0.76494	0.125;0.416;0.053;0.278;0.905;0.151;0.125;0.999;0.796;0.999	B;B;B;B;B;B;B;D;B;D	0.70016	0.073;0.093;0.073;0.146;0.254;0.12;0.029;0.967;0.157;0.967	T	0.58983	-0.7539	8	.	.	.	.	15.0948	0.72226	0.0:0.0:1.0:0.0	.	409;341;371;395;410;409;410;558;434;558	Q13554-8;Q13554-7;Q13554-4;Q13554-3;Q13554-6;A4D2K5;Q13554-5;Q13554;Q13554-2;A4D2J9	.;.;.;.;.;.;.;KCC2B_HUMAN;.;.	V	434;410;558;305;76;434;395;371;410;341;409;410	ENSP00000326375:A434V;ENSP00000390292:A410V;ENSP00000379098:A558V;ENSP00000422416:A305V;ENSP00000410445:A76V;ENSP00000397937:A434V;ENSP00000351542:A395V;ENSP00000326427:A371V;ENSP00000326544:A410V;ENSP00000326518:A341V;ENSP00000258682:A409V;ENSP00000379096:A410V	.	A	-	2	0	CAMK2B	44226950	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.592000	0.82676	2.085000	0.62840	0.313000	0.20887	GCG;GCG;GCG;GCG;GCG;GCG;GCG;GCG;GCA;GCG;GCG;GCG		0.647	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251138.2	NM_172084	Missense_Mutation
ABCA13	154664	broad.mit.edu	37	7	48506563	48506563	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr7:48506563G>A	ENST00000435803.1	+	44	12850	c.12826G>A	c.(12826-12828)Gac>Aac	p.D4276N	ABCA13_ENST00000544596.1_Intron	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4276					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.D4221N(1)|p.D4276N(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CAGTGGGGGCGACAACTTGGA	0.498																																					p.A4221A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G12663A	7						.						104.0	113.0	110.0					7																	48506563		2073	4215	6288	48477109	SO:0001583	missense	154664	exon42			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12826G>A	7.37:g.48506563G>A	ENSP00000411096:p.Asp4276Asn	Somatic		Capture	Illumina HiSeq	Phase_I	48477109	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.741603	0.30865	.	.	ENSG00000179869	ENST00000435803	D	0.85411	-1.98	5.29	2.33	0.28932	.	0.303370	0.23235	N	0.050413	T	0.76521	0.3999	L	0.42245	1.32	0.09310	N	1	B;D	0.61080	0.196;0.989	B;B	0.41646	0.011;0.362	T	0.67106	-0.5754	10	0.41790	T	0.15	.	7.2431	0.26107	0.0922:0.3442:0.5635:0.0	.	1978;4276	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	N	4276	ENSP00000411096:D4276N	ENSP00000411096:D4276N	D	+	1	0	ABCA13	48477109	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.598000	0.24074	0.258000	0.21686	0.655000	0.94253	GAC		0.498	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ZNF479	90827	broad.mit.edu	37	7	57200027	57200027	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr7:57200027G>T	ENST00000331162.4	-	2	275	c.5C>A	c.(4-6)gCt>gAt	p.A2D		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A2D(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TGGTCTTTTAGCCATAAATCT	0.557																																					p.A2D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5A	7						.						54.0	53.0	53.0					7																	57200027		2053	4226	6279	57203969	SO:0001583	missense	90827	exon2			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.5C>A	7.37:g.57200027G>T	ENSP00000333776:p.Ala2Asp	Somatic		Capture	Illumina HiSeq	Phase_I	57203969	NM_033273		Missense_Mutation	SNP	ENST00000331162.4	37	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	g	10.09	1.255571	0.22965	.	.	ENSG00000185177	ENST00000331162	T	0.07444	3.19	0.109	0.109	0.14578	.	.	.	.	.	T	0.11196	0.0273	N	0.12182	0.205	0.09310	N	1	D	0.71674	0.998	D	0.77557	0.99	T	0.28713	-1.0035	8	0.87932	D	0	.	.	.	.	.	2	Q96JC4	ZN479_HUMAN	D	2	ENSP00000333776:A2D	ENSP00000333776:A2D	A	-	2	0	ZNF479	57203969	0.055000	0.20627	0.098000	0.21074	0.099000	0.18886	0.233000	0.17911	0.181000	0.19994	0.184000	0.17185	GCT		0.557	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	
KMT2C	58508	broad.mit.edu	37	7	151879325	151879325	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr7:151879325A>C	ENST00000262189.6	-	36	5838	c.5620T>G	c.(5620-5622)Tct>Gct	p.S1874A	KMT2C_ENST00000355193.2_Missense_Mutation_p.S1874A	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1874	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.S1874A(2)									GGTGGCTGAGAAGTCTGAGCC	0.517																																					p.S1874A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T5620G	7						.						88.0	89.0	88.0					7																	151879325		2203	4300	6503	151510258	SO:0001583	missense	58508	exon36			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5620T>G	7.37:g.151879325A>C	ENSP00000262189:p.Ser1874Ala	Somatic		Capture	Illumina HiSeq	Phase_I	151510258	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	10.30	1.310852	0.23821	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.53640	0.61;0.61	5.3	2.78	0.32641	.	0.335587	0.21418	N	0.074870	T	0.30479	0.0766	L	0.32530	0.975	0.80722	D	1	B;B	0.30914	0.199;0.3	B;B	0.31442	0.061;0.13	T	0.03784	-1.1004	10	0.16896	T	0.51	.	5.806	0.18440	0.7326:0.0:0.1396:0.1278	.	1874;935	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	A	1874	ENSP00000262189:S1874A;ENSP00000347325:S1874A	ENSP00000262189:S1874A	S	-	1	0	MLL3	151510258	0.828000	0.29307	0.703000	0.30354	0.917000	0.54804	1.321000	0.33678	0.789000	0.33779	0.460000	0.39030	TCT		0.517	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
GPR124	25960	broad.mit.edu	37	8	37695287	37695287	+	Missense_Mutation	SNP	G	G	A	rs377569553		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr8:37695287G>A	ENST00000412232.2	+	14	2102	c.2089G>A	c.(2089-2091)Gtt>Att	p.V697I	GPR124_ENST00000315215.7_Intron	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	697					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V690I(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCCAGTGGCCGTTTCGCTGCG	0.692																																					p.V697I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2089A	8						.	G	ILE/VAL	0,4314		0,0,2157	14.0	14.0	14.0		2089	3.4	0.1	8		14	1,8415		0,1,4207	no	missense	GPR124	NM_032777.9	29	0,1,6364	AA,AG,GG		0.0119,0.0,0.0079	benign	697/1339	37695287	1,12729	2157	4208	6365	37814445	SO:0001583	missense	25960	exon14			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2089G>A	8.37:g.37695287G>A	ENSP00000406367:p.Val697Ile	Somatic		Capture	Illumina HiSeq	Phase_I	37814445	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	G	12.63	1.994588	0.35226	0.0	1.19E-4	ENSG00000020181	ENST00000416514;ENST00000412232	T	0.53640	0.61	5.22	3.43	0.39272	.	0.146450	0.45126	N	0.000397	T	0.31358	0.0794	L	0.37800	1.135	0.49130	D	0.999759	B	0.13594	0.008	B	0.08055	0.003	T	0.07083	-1.0791	10	0.09590	T	0.72	-13.0245	8.2499	0.31710	0.3047:0.0:0.6953:0.0	.	697	Q96PE1	GP124_HUMAN	I	690;697	ENSP00000406367:V697I	ENSP00000406367:V697I	V	+	1	0	GPR124	37814445	0.988000	0.35896	0.074000	0.20217	0.995000	0.86356	1.981000	0.40628	0.607000	0.29982	0.603000	0.83216	GTT		0.692	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
VPS13B	157680	broad.mit.edu	37	8	100733269	100733269	+	Silent	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr8:100733269G>A	ENST00000358544.2	+	39	7230	c.7119G>A	c.(7117-7119)gtG>gtA	p.V2373V	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Silent_p.V2348V	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2373					protein transport (GO:0015031)			p.V2348V(1)|p.V2373V(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTGGTGATGTGCTACAGGTAT	0.383																																					p.V2348V	Colon(161;2205 2542 7338 31318)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G7044A	8						.						107.0	100.0	102.0					8																	100733269		2203	4300	6503	100802445	SO:0001819	synonymous_variant	157680	exon39			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.7119G>A	8.37:g.100733269G>A		Somatic		Capture	Illumina HiSeq	Phase_I	100802445	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	CCDS6280.1																																																																																				0.383	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
ZER1	10444	broad.mit.edu	37	9	131495736	131495736	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr9:131495736T>A	ENST00000291900.2	-	15	2618	c.2212A>T	c.(2212-2214)Acc>Tcc	p.T738S	RP11-545E17.3_ENST00000443631.1_RNA	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	738					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)	p.T738S(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						TGCCGTGCGGTCGCCATCTTA	0.567											OREG0019523	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T738S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2212T	9						.						86.0	69.0	75.0					9																	131495736		2203	4300	6503	130535557	SO:0001583	missense	10444	exon15			X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.2212A>T	9.37:g.131495736T>A	ENSP00000291900:p.Thr738Ser	Somatic	1588	Capture	Illumina HiSeq	Phase_I	130535557	NM_006336	O00156|Q5T272|Q5T273	Missense_Mutation	SNP	ENST00000291900.2	37	CCDS6910.1	.	.	.	.	.	.	.	.	.	.	T	5.487	0.274893	0.10403	.	.	ENSG00000160445	ENST00000291900	T	0.61742	0.08	5.77	4.51	0.55191	Armadillo-like helical (1);Armadillo-type fold (1);	0.254270	0.46145	D	0.000320	T	0.24044	0.0582	N	0.01705	-0.755	0.36764	D	0.883435	B	0.02656	0.0	B	0.04013	0.001	T	0.31752	-0.9932	10	0.05833	T	0.94	-25.7928	8.5564	0.33483	0.3221:0.0:0.0:0.6779	.	738	Q7Z7L7	ZER1_HUMAN	S	738	ENSP00000291900:T738S	ENSP00000291900:T738S	T	-	1	0	ZER1	130535557	1.000000	0.71417	0.113000	0.21522	0.893000	0.52053	3.734000	0.55037	2.326000	0.78906	0.533000	0.62120	ACC		0.567	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	NM_006336	
LAMC3	10319	broad.mit.edu	37	9	133952673	133952673	+	Silent	SNP	C	C	T	rs199639870		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr9:133952673C>T	ENST00000361069.4	+	22	3862	c.3729C>T	c.(3727-3729)ggC>ggT	p.G1243G	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1243	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.G1243G(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		AGCAAGTTGGCGCAGATACAG	0.622																																					p.G1243G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3729T	9						.						77.0	69.0	72.0					9																	133952673		2203	4300	6503	132942494	SO:0001819	synonymous_variant	10319	exon22			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3729C>T	9.37:g.133952673C>T		Somatic		Capture	Illumina HiSeq	Phase_I	132942494	NM_006059	B1APX9|B1APY0|Q59H72	Silent	SNP	ENST00000361069.4	37	CCDS6938.1																																																																																				0.622	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
DIRAS2	54769	broad.mit.edu	37	9	93375994	93375994	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr9:93375994G>A	ENST00000375765.3	-	2	504	c.116C>T	c.(115-117)aCg>aTg	p.T39M		NM_017594.3	NP_060064.2	Q96HU8	DIRA2_HUMAN	DIRAS family, GTP-binding RAS-like 2	39					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.T39M(1)		kidney(1)|large_intestine(6)|lung(3)|skin(2)	12						GTCTTCCACCGTCGGGATGTA	0.582																																					p.T39M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C116T	9						.						183.0	157.0	166.0					9																	93375994		2203	4300	6503	92415814	SO:0001583	missense	54769	exon2			AB076889	CCDS6687.1	9q22.32	2014-05-09			ENSG00000165023	ENSG00000165023			19323	protein-coding gene	gene with protein product		607863				12194967	Standard	NM_017594		Approved	Di-Ras2, DKFZp761C07121	uc004aqx.1	Q96HU8	OTTHUMG00000020196	ENST00000375765.3:c.116C>T	9.37:g.93375994G>A	ENSP00000364919:p.Thr39Met	Somatic		Capture	Illumina HiSeq	Phase_I	92415814	NM_017594	B3KVM2	Missense_Mutation	SNP	ENST00000375765.3	37	CCDS6687.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475931	0.84640	.	.	ENSG00000165023	ENST00000375765	D	0.88046	-2.33	5.06	5.06	0.68205	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95906	0.8667	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.97000	0.9728	10	0.87932	D	0	.	17.9796	0.89137	0.0:0.0:1.0:0.0	.	39	Q96HU8	DIRA2_HUMAN	M	39	ENSP00000364919:T39M	ENSP00000364919:T39M	T	-	2	0	DIRAS2	92415814	1.000000	0.71417	0.703000	0.30354	0.982000	0.71751	9.427000	0.97472	2.808000	0.96608	0.655000	0.94253	ACG		0.582	DIRAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053012.1		
PNPLA7	375775	broad.mit.edu	37	9	140437888	140437888	+	Missense_Mutation	SNP	C	C	T	rs200256242		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chr9:140437888C>T	ENST00000277531.4	-	5	613	c.427G>A	c.(427-429)Gtt>Att	p.V143I	AL365502.1_ENST00000580317.1_RNA|PNPLA7_ENST00000406427.1_Missense_Mutation_p.V168I	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	143					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)	p.V143I(1)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		TCTTACCGAACGTTTTTCAGC	0.642													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17495	0.0		0.0	False		,,,				2504	0.0				p.V143I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G427A	9						.						58.0	62.0	61.0					9																	140437888		2203	4300	6503	139557709	SO:0001583	missense	375775	exon5			AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.427G>A	9.37:g.140437888C>T	ENSP00000277531:p.Val143Ile	Somatic		Capture	Illumina HiSeq	Phase_I	139557709	NM_152286	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	37	CCDS7045.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	12.57	1.978369	0.34942	.	.	ENSG00000130653	ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090;ENST00000371450	T;T;T	0.42900	0.96;0.96;0.96	4.19	4.19	0.49359	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.067458	0.64402	D	0.000016	T	0.43456	0.1248	L	0.40543	1.245	0.80722	D	1	D;D	0.71674	0.983;0.998	P;P	0.54590	0.508;0.756	T	0.25813	-1.0121	10	0.06494	T	0.89	.	15.8635	0.79043	0.0:1.0:0.0:0.0	.	168;143	Q6ZV29-5;Q6ZV29	.;PLPL7_HUMAN	I	143;168;143;134;168	ENSP00000277531:V143I;ENSP00000384610:V168I;ENSP00000400582:V134I	ENSP00000277531:V143I	V	-	1	0	PNPLA7	139557709	1.000000	0.71417	0.080000	0.20451	0.142000	0.21351	7.514000	0.81750	2.042000	0.60477	0.563000	0.77884	GTT		0.642	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286	
COL4A6	1288	broad.mit.edu	37	X	107464601	107464601	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chrX:107464601G>A	ENST00000372216.4	-	4	251	c.151C>T	c.(151-153)Cga>Tga	p.R51*	COL4A6_ENST00000394872.2_Nonsense_Mutation_p.R50*|COL4A6_ENST00000538570.1_Nonsense_Mutation_p.R50*|COL4A6_ENST00000545689.1_Nonsense_Mutation_p.R50*|COL4A6_ENST00000334504.7_Nonsense_Mutation_p.R50*	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	51	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.R50*(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GGTCCAGGTCGTCCCTAAGGT	0.468									Alport syndrome with Diffuse Leiomyomatosis																												p.R50X	Melanoma(87;1895 1945 2589 7165)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C148T	X						.						103.0	88.0	93.0					X																	107464601		2203	4300	6503	107351257	SO:0001587	stop_gained	1288	exon4	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.151C>T	X.37:g.107464601G>A	ENSP00000361290:p.Arg51*	Somatic		Capture	Illumina HiSeq	Phase_I	107351257	NM_033641	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Nonsense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	G	34	5.356583	0.95854	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	.	.	.	4.76	2.9	0.33743	.	0.922924	0.08816	N	0.889462	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	10.7963	0.46461	0.0:0.0:0.6566:0.3434	.	.	.	.	X	51;50;50;50;50;50	.	ENSP00000334733:R50X	R	-	1	2	COL4A6	107351257	0.808000	0.29022	0.038000	0.18304	0.975000	0.68041	3.352000	0.52239	0.475000	0.27415	0.523000	0.50628	CGA		0.468	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
DMD	1756	broad.mit.edu	37	X	32380918	32380918	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chrX:32380918A>T	ENST00000357033.4	-	37	5518	c.5312T>A	c.(5311-5313)aTt>aAt	p.I1771N	DMD_ENST00000378677.2_Missense_Mutation_p.I1767N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1771	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.I1766N(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCCAGTCTTAATTCTGTGTGA	0.483																																					p.I430N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1289A	X						.						184.0	144.0	158.0					X																	32380918		2202	4300	6502	32290839	SO:0001583	missense	1756	exon9			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5312T>A	X.37:g.32380918A>T	ENSP00000354923:p.Ile1771Asn	Somatic		Capture	Illumina HiSeq	Phase_I	32290839	NM_004011	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.048855	0.75846	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.53206	0.63;0.63	5.36	5.36	0.76844	.	0.000000	0.35407	U	0.003232	T	0.67757	0.2927	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D	0.76494	0.997;0.999;0.998;0.998;0.998	D;D;D;D;D	0.71184	0.944;0.972;0.967;0.967;0.967	T	0.72411	-0.4302	10	0.87932	D	0	.	14.385	0.66938	1.0:0.0:0.0:0.0	.	1763;1771;1767;430;427	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	N	1763;430;427;1767;1771;1771;1648	ENSP00000367948:I1767N;ENSP00000354923:I1771N	ENSP00000354923:I1771N	I	-	2	0	DMD	32290839	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.054000	0.89451	1.776000	0.52262	0.441000	0.28932	ATT		0.483	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
BRWD3	254065	broad.mit.edu	37	X	79965043	79965043	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chrX:79965043G>A	ENST00000373275.4	-	21	2575	c.2359C>T	c.(2359-2361)Cgc>Tgc	p.R787C	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	787					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)			p.R787C(2)		breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TGTGTCCTGCGTAAAGAACGC	0.388																																					p.R787C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2359T	X						.						148.0	103.0	119.0					X																	79965043		2203	4300	6503	79851699	SO:0001583	missense	254065	exon21				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.2359C>T	X.37:g.79965043G>A	ENSP00000362372:p.Arg787Cys	Somatic		Capture	Illumina HiSeq	Phase_I	79851699	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747300	0.69418	.	.	ENSG00000165288	ENST00000373275	T	0.30714	1.52	5.47	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.48259	0.1490	M	0.79258	2.445	0.54753	D	0.999988	D	0.71674	0.998	P	0.55260	0.772	T	0.49263	-0.8958	9	.	.	.	-8.7575	13.5268	0.61599	0.0:0.0:0.4681:0.5319	.	787	Q6RI45	BRWD3_HUMAN	C	787	ENSP00000362372:R787C	.	R	-	1	0	BRWD3	79851699	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.281000	0.33214	0.439000	0.26476	0.600000	0.82982	CGC		0.388	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
AFF2	2334	broad.mit.edu	37	X	148037296	148037296	+	Missense_Mutation	SNP	C	C	T	rs200099351		TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3846-01A-01W-0995-10	TCGA-AA-3846-10A-01W-0995-10	g.chrX:148037296C>T	ENST00000370460.2	+	11	2200	c.1721C>T	c.(1720-1722)aCg>aTg	p.T574M	AFF2_ENST00000370457.5_Missense_Mutation_p.T541M|AFF2_ENST00000286437.5_Missense_Mutation_p.T215M|AFF2_ENST00000342251.3_Missense_Mutation_p.T541M	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	574					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.T574M(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					AAAGTGAAGACGAATGCCAGT	0.473													C|||	1	0.000264901	0.0	0.0	3775	,	,		13324	0.0		0.001	False		,,,				2504	0.0				p.T574M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1721T	X						.	C	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	2,3833		0,1,1,1631,570	168.0	172.0	171.0		1622,1691,1616,1604,644,1721	3.5	0.0	X		171	1,6727		0,1,0,2427,1872	yes	missense,missense,missense,missense,missense,missense	AFF2	NM_001169122.1,NM_001169123.1,NM_001169124.1,NM_001169125.1,NM_001170628.1,NM_002025.3	81,81,81,81,81,81	0,2,1,4058,2442	TT,TC,T,CC,C		0.0149,0.0522,0.0284	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	541/1277,564/1302,539/1277,535/1273,215/953,574/1312	148037296	3,10560	2203	4300	6503	147844996	SO:0001583	missense	2334	exon11			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1721C>T	X.37:g.148037296C>T	ENSP00000359489:p.Thr574Met	Somatic		Capture	Illumina HiSeq	Phase_I	147844996	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	1	6.027727546714888E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.75	1.439020	0.25900	5.22E-4	1.49E-4	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.56	3.45	0.39498	.	1.587850	0.03325	N	0.192486	T	0.57460	0.2055	L	0.36672	1.1	0.09310	N	1	P;P;P;P;P;P	0.43477	0.808;0.771;0.771;0.771;0.771;0.808	B;B;B;B;B;B	0.43251	0.413;0.195;0.195;0.195;0.289;0.413	T	0.48328	-0.9045	10	0.49607	T	0.09	.	6.5682	0.22523	0.0:0.6505:0.1856:0.1639	.	215;539;541;535;564;574	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	M	574;541;541;215	ENSP00000359489:T574M;ENSP00000359486:T541M;ENSP00000345459:T541M;ENSP00000286437:T215M	ENSP00000286437:T215M	T	+	2	0	AFF2	147844996	0.007000	0.16637	0.011000	0.14972	0.455000	0.32408	1.691000	0.37721	1.104000	0.41587	0.600000	0.82982	ACG		0.473	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
