#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARMC3	219681	broad.mit.edu	37	10	23270545	23270545	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr10:23270545T>A	ENST00000298032.5	+	10	1175	c.1091T>A	c.(1090-1092)tTg>tAg	p.L364*	ARMC3_ENST00000376528.4_Nonsense_Mutation_p.L101*|ARMC3_ENST00000409983.3_Nonsense_Mutation_p.L364*|ARMC3_ENST00000409049.3_Nonsense_Mutation_p.L364*	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	364						extracellular vesicular exosome (GO:0070062)		p.L364*(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TTAATTCAGTTGCTAAAAAGT	0.408																																					p.L364X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T1091A	10						.						87.0	76.0	80.0					10																	23270545		2203	4300	6503	23310551	SO:0001587	stop_gained	219681	exon10			AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1091T>A	10.37:g.23270545T>A	ENSP00000298032:p.Leu364*	Somatic		Capture	Illumina HiSeq	Phase_I	23310551	NM_173081	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Nonsense_Mutation	SNP	ENST00000298032.5	37	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	T	32	5.108158	0.94292	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049;ENST00000376528	.	.	.	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.8633	15.1784	0.72934	0.0:0.0:0.0:1.0	.	.	.	.	X	364;364;300;364;101	.	ENSP00000298032:L364X	L	+	2	0	ARMC3	23310551	1.000000	0.71417	0.978000	0.43139	0.982000	0.71751	3.428000	0.52792	1.981000	0.57761	0.459000	0.35465	TTG		0.408	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081	
ZEB1	6935	broad.mit.edu	37	10	31810442	31810442	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr10:31810442C>A	ENST00000320985.10	+	7	2289	c.2179C>A	c.(2179-2181)Caa>Aaa	p.Q727K	ZEB1_ENST00000361642.5_Missense_Mutation_p.Q728K|ZEB1_ENST00000542815.3_Missense_Mutation_p.Q660K|ZEB1_ENST00000446923.2_Missense_Mutation_p.Q711K|ZEB1_ENST00000560721.2_Missense_Mutation_p.Q707K|ZEB1_ENST00000559858.1_3'UTR			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	727					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.Q727K(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				TGAGGGTGCACAAGAAGAGCC	0.433																																					p.Q707K	Ovarian(40;423 959 14296 36701 49589)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2119A	10						.						91.0	85.0	87.0					10																	31810442		2203	4300	6503	31850448	SO:0001583	missense	6935	exon6			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.2179C>A	10.37:g.31810442C>A	ENSP00000319248:p.Gln727Lys	Somatic		Capture	Illumina HiSeq	Phase_I	31850448	NM_001174093	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.837381	0.32513	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000543514;ENST00000446923	T;T;T;T;T	0.11604	3.08;2.76;2.8;2.76;2.83	5.19	5.19	0.71726	.	0.320500	0.26867	N	0.022098	T	0.12817	0.0311	L	0.57536	1.79	0.37932	D	0.932039	B;B;B;B;B;B;B;B	0.29716	0.004;0.241;0.156;0.255;0.156;0.002;0.255;0.255	B;B;B;B;B;B;B;B	0.27262	0.01;0.058;0.054;0.078;0.054;0.004;0.078;0.078	T	0.08994	-1.0695	10	0.23302	T	0.38	-5.6872	14.6715	0.68948	0.0:0.855:0.145:0.0	.	660;727;711;727;727;707;728;727	F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.;.;.;.;.;.;.;ZEB1_HUMAN	K	509;727;728;727;660;727;707;586;618;711	ENSP00000444282:Q509K;ENSP00000354487:Q728K;ENSP00000444891:Q660K;ENSP00000319248:Q727K;ENSP00000391612:Q711K	ENSP00000319248:Q727K	Q	+	1	0	ZEB1	31850448	0.311000	0.24536	0.918000	0.36340	0.998000	0.95712	1.919000	0.40015	2.575000	0.86900	0.650000	0.86243	CAA		0.433	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
TBATA	219793	broad.mit.edu	37	10	72532280	72532280	+	Silent	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr10:72532280G>A	ENST00000299290.1	-	10	1349	c.960C>T	c.(958-960)agC>agT	p.S320S	TBATA_ENST00000394982.2_5'Flank	NM_152710.2	NP_689923	Q96M53	TBATA_HUMAN	thymus, brain and testes associated	320					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.S320S(1)									CTGGTTTTTCGCTTTTTGTAA	0.488																																					p.S320S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C960T	10						.						206.0	200.0	202.0					10																	72532280		2203	4300	6503	72202286	SO:0001819	synonymous_variant	219793	exon10			AK057382	CCDS7308.1	10q22.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166220	ENSG00000166220			23511	protein-coding gene	gene with protein product		612640	"""chromosome 10 open reading frame 27"""	C10orf27		20937703	Standard	NM_152710		Approved	FLJ32820, spatial	uc001jrj.1	Q96M53	OTTHUMG00000018413	ENST00000299290.1:c.960C>T	10.37:g.72532280G>A		Somatic		Capture	Illumina HiSeq	Phase_I	72202286	NM_152710	A4QPA8|B2RPQ2|Q5T4G2	Silent	SNP	ENST00000299290.1	37	CCDS7308.1																																																																																				0.488	TBATA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048519.1	NM_152710	
LDB3	11155	broad.mit.edu	37	10	88485964	88485964	+	Silent	SNP	C	C	T	rs377178682		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr10:88485964C>T	ENST00000361373.4	+	12	2070	c.2049C>T	c.(2047-2049)atC>atT	p.I683I	LDB3_ENST00000429277.2_Silent_p.I688I|LDB3_ENST00000352360.5_Silent_p.I426I|LDB3_ENST00000263066.6_Silent_p.I573I|LDB3_ENST00000458213.2_Silent_p.I573I	NM_007078.2	NP_009009.1			LIM domain binding 3									p.I683I(1)|p.I688I(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						ACAAGTTTATCGAAGCCCTGG	0.542																																					p.I688I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2064T	10						.	C	,,	0,4406		0,0,2203	127.0	101.0	110.0		1719,2064,2049	-7.9	0.8	10		110	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	LDB3	NM_001080114.1,NM_001171610.1,NM_007078.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	573/618,688/733,683/728	88485964	1,13005	2203	4300	6503	88475944	SO:0001819	synonymous_variant	11155	exon13			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.2049C>T	10.37:g.88485964C>T		Somatic		Capture	Illumina HiSeq	Phase_I	88475944	NM_001171610		Silent	SNP	ENST00000361373.4	37	CCDS7377.1																																																																																				0.542	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2		
ZRANB1	54764	broad.mit.edu	37	10	126631445	126631445	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr10:126631445G>C	ENST00000359653.4	+	1	754	c.383G>C	c.(382-384)aGa>aCa	p.R128T	RP11-298J20.4_ENST00000508096.1_RNA|RP11-298J20.3_ENST00000449984.1_RNA	NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	128					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.R128T(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		TCTGGCTCAAGACCAGTTGCT	0.443																																					p.R128T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G383C	10						.						105.0	100.0	102.0					10																	126631445		2203	4300	6503	126621435	SO:0001583	missense	54764	exon1			AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.383G>C	10.37:g.126631445G>C	ENSP00000352676:p.Arg128Thr	Somatic		Capture	Illumina HiSeq	Phase_I	126621435	NM_017580	B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Missense_Mutation	SNP	ENST00000359653.4	37	CCDS7642.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319114	0.41096	.	.	ENSG00000019995	ENST00000359653	T	0.17213	2.29	5.78	5.78	0.91487	.	0.223520	0.49305	D	0.000159	T	0.19485	0.0468	L	0.51422	1.61	0.58432	D	0.999992	B	0.17038	0.02	B	0.17433	0.018	T	0.10109	-1.0644	10	0.12430	T	0.62	-1.782	19.9991	0.97403	0.0:0.0:1.0:0.0	.	128	Q9UGI0	ZRAN1_HUMAN	T	128	ENSP00000352676:R128T	ENSP00000352676:R128T	R	+	2	0	ZRANB1	126621435	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	6.778000	0.75043	2.724000	0.93272	0.655000	0.94253	AGA		0.443	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050898.1	NM_017580	
NELL1	4745	broad.mit.edu	37	11	20940798	20940798	+	Splice_Site	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr11:20940798C>T	ENST00000357134.5	+	7	829	c.677C>T	c.(676-678)aCt>aTt	p.T226I	NELL1_ENST00000532434.1_Splice_Site_p.T226I|NELL1_ENST00000298925.5_Splice_Site_p.T254I|NELL1_ENST00000325319.5_Splice_Site_p.T169I	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	226	Laminin G-like.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.T226I(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						CTTTATTGAGCTTGCCCAACC	0.308																																					p.T226I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C677T	11						.						82.0	79.0	80.0					11																	20940798		2203	4299	6502	20897374	SO:0001630	splice_region_variant	4745	exon7			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.677-1C>T	11.37:g.20940798C>T		Somatic		Capture	Illumina HiSeq	Phase_I	20897374	NM_006157	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534034	0.85812	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.79845	-1.31;-1.29;-1.2;-1.2	5.84	5.84	0.93424	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.89553	0.6748	M	0.71036	2.16	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;0.998;1.0;0.995	D;D;D;D	0.85130	0.994;0.986;0.997;0.979	D	0.88237	0.2907	9	.	.	.	.	19.7616	0.96321	0.0:1.0:0.0:0.0	.	169;254;226;226	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	I	254;226;169;226	ENSP00000298925:T254I;ENSP00000349654:T226I;ENSP00000317837:T169I;ENSP00000437170:T226I	.	T	+	2	0	NELL1	20897374	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.219000	0.78000	2.757000	0.94681	0.650000	0.86243	ACT		0.308	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	Missense_Mutation
OR51V1	283111	broad.mit.edu	37	11	5221512	5221512	+	Missense_Mutation	SNP	C	C	T	rs368941887		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr11:5221512C>T	ENST00000321255.1	-	1	418	c.419G>A	c.(418-420)cGt>cAt	p.R140H		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	140					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R140H(1)		endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGGAATAACGTAGTGGATT	0.423																																					p.R140H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G419A	11						.	C	HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	58.0	59.0	58.0		419	1.2	0.0	11		58	0,8596		0,0,4298	no	missense	OR51V1	NM_001004760.2	29	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	benign	140/322	5221512	1,12997	2201	4298	6499	5178088	SO:0001583	missense	283111	exon1			BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.419G>A	11.37:g.5221512C>T	ENSP00000321729:p.Arg140His	Somatic		Capture	Illumina HiSeq	Phase_I	5178088	NM_001004760		Missense_Mutation	SNP	ENST00000321255.1	37	CCDS31375.1	.	.	.	.	.	.	.	.	.	.	C	8.029	0.761313	0.15914	2.27E-4	0.0	ENSG00000176742	ENST00000321255	T	0.01854	4.6	5.07	1.19	0.21007	GPCR, rhodopsin-like superfamily (1);	0.139828	0.26352	N	0.024872	T	0.02047	0.0064	N	0.25890	0.77	0.09310	N	1	B	0.30973	0.302	B	0.34180	0.177	T	0.47971	-0.9075	10	0.30854	T	0.27	.	9.0323	0.36267	0.0:0.6939:0.0:0.3061	.	140	Q9H2C8	O51V1_HUMAN	H	140	ENSP00000321729:R140H	ENSP00000321729:R140H	R	-	2	0	OR51V1	5178088	0.000000	0.05858	0.000000	0.03702	0.530000	0.34684	0.056000	0.14256	0.068000	0.16574	-0.142000	0.14014	CGT		0.423	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142965.1	NM_001004760	
OR52N1	79473	broad.mit.edu	37	11	5809863	5809863	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr11:5809863A>G	ENST00000317078.1	-	1	183	c.184T>C	c.(184-186)Tat>Cat	p.Y62H	TRIM5_ENST00000380027.1_Intron	NM_001001913.1	NP_001001913.1	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N, member 1	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y62H(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(15)|prostate(2)|skin(3)	31		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		AGGAAGACATACATAGGTCTG	0.458																																					p.Y62H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T184C	11						.						153.0	128.0	136.0					11																	5809863		2201	4296	6497	5766439	SO:0001583	missense	79473	exon1			AB065538	CCDS31398.1	11p15.4	2012-08-09			ENSG00000181001	ENSG00000181001		"""GPCR / Class A : Olfactory receptors"""	14853	protein-coding gene	gene with protein product							Standard	NM_001001913		Approved		uc010qzo.2	Q8NH53	OTTHUMG00000168800	ENST00000317078.1:c.184T>C	11.37:g.5809863A>G	ENSP00000322823:p.Tyr62His	Somatic		Capture	Illumina HiSeq	Phase_I	5766439	NM_001001913	Q6IFF6	Missense_Mutation	SNP	ENST00000317078.1	37	CCDS31398.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.569023	0.45798	.	.	ENSG00000181001	ENST00000317078	T	0.15487	2.42	4.59	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	0.149661	0.30920	N	0.008610	T	0.30792	0.0776	M	0.93638	3.44	0.28923	N	0.892012	B	0.26602	0.154	B	0.29440	0.102	T	0.34800	-0.9814	10	0.72032	D	0.01	.	9.2981	0.37829	0.9128:0.0:0.0872:0.0	.	62	Q8NH53	O52N1_HUMAN	H	62	ENSP00000322823:Y62H	ENSP00000322823:Y62H	Y	-	1	0	OR52N1	5766439	1.000000	0.71417	0.986000	0.45419	0.939000	0.58152	4.805000	0.62561	0.886000	0.36113	0.496000	0.49642	TAT		0.458	OR52N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401142.1	NM_001001913	
SLC1A2	6506	broad.mit.edu	37	11	35287253	35287253	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr11:35287253T>A	ENST00000278379.3	-	10	1756	c.1474A>T	c.(1474-1476)Ata>Tta	p.I492L	SLC1A2_ENST00000606205.1_Missense_Mutation_p.I492L|SLC1A2_ENST00000479543.1_5'UTR|SLC1A2_ENST00000395753.1_Missense_Mutation_p.I483L|SLC1A2_ENST00000395750.1_Missense_Mutation_p.I483L	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	492					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.I492L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			TGATAGACTATCCCAGCCCCA	0.448																																					p.I492L	NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1474T	11						.						170.0	156.0	161.0					11																	35287253		2202	4298	6500	35243829	SO:0001583	missense	6506	exon10			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.1474A>T	11.37:g.35287253T>A	ENSP00000278379:p.Ile492Leu	Somatic		Capture	Illumina HiSeq	Phase_I	35243829	NM_004171	B4DQE9|Q14417|Q541G6|U3KQQ4	Missense_Mutation	SNP	ENST00000278379.3	37	CCDS31459.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.932011	0.92389	.	.	ENSG00000110436	ENST00000278379;ENST00000395750;ENST00000395753;ENST00000464522	T;T;T	0.61274	0.12;0.12;0.12	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.70430	0.3223	L	0.60012	1.86	0.80722	D	1	D;P	0.55385	0.971;0.94	P;P	0.62014	0.874;0.897	T	0.68988	-0.5264	10	0.38643	T	0.18	-17.8726	16.2484	0.82467	0.0:0.0:0.0:1.0	.	492;492	B4DQE9;P43004	.;EAA2_HUMAN	L	492;483;483;14	ENSP00000278379:I492L;ENSP00000379099:I483L;ENSP00000379102:I483L	ENSP00000278379:I492L	I	-	1	0	SLC1A2	35243829	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.655000	0.83696	2.291000	0.77112	0.533000	0.62120	ATA		0.448	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258181.1	NM_004171	
NUMA1	4926	broad.mit.edu	37	11	71725601	71725601	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr11:71725601C>T	ENST00000393695.3	-	15	3279	c.2948G>A	c.(2947-2949)cGg>cAg	p.R983Q	RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000351960.6_Intron|NUMA1_ENST00000358965.6_Missense_Mutation_p.R983Q	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.R983Q(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						GGCCCGCAGCCGTTCCAGCTC	0.687			T	RARA	APL																																p.R983Q			Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2948A	11						.						65.0	72.0	69.0					11																	71725601		2200	4293	6493	71403249	SO:0001583	missense	4926	exon15			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.2948G>A	11.37:g.71725601C>T	ENSP00000377298:p.Arg983Gln	Somatic		Capture	Illumina HiSeq	Phase_I	71403249	NM_006185		Missense_Mutation	SNP	ENST00000393695.3	37	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322836	0.41096	.	.	ENSG00000137497	ENST00000358965;ENST00000393695;ENST00000359652	T;T	0.11930	2.73;2.73	5.6	2.27	0.28462	.	0.217622	0.33075	N	0.005307	T	0.08492	0.0211	L	0.40543	1.245	0.09310	N	0.999999	B;B;B;B	0.29716	0.068;0.255;0.028;0.068	B;B;B;B	0.19148	0.014;0.024;0.01;0.014	T	0.26608	-1.0098	9	.	.	.	.	5.273	0.15634	0.0:0.5198:0.1484:0.3318	.	989;467;983;983	Q4LE64;Q59HB8;Q14980-2;Q14980	.;.;.;NUMA1_HUMAN	Q	983;983;546	ENSP00000351851:R983Q;ENSP00000377298:R983Q	.	R	-	2	0	NUMA1	71403249	0.000000	0.05858	1.000000	0.80357	0.936000	0.57629	-0.066000	0.11598	0.735000	0.32537	0.655000	0.94253	CGG		0.687	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		
ARAP1	116985	broad.mit.edu	37	11	72407631	72407631	+	Missense_Mutation	SNP	G	G	A	rs146883151		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr11:72407631G>A	ENST00000393609.3	-	23	3437	c.3235C>T	c.(3235-3237)Cgg>Tgg	p.R1079W	ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000429686.1_Missense_Mutation_p.R773W|ARAP1_ENST00000334211.8_Missense_Mutation_p.R834W|ARAP1_ENST00000393605.3_Missense_Mutation_p.R839W|ARAP1_ENST00000455638.2_Missense_Mutation_p.R1079W|ARAP1_ENST00000359373.5_Missense_Mutation_p.R1079W|ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000426523.1_Missense_Mutation_p.R834W	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1079	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.R839W(1)|p.R1079W(1)		cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						ACTGTGGCCCGGTTGACAGGG	0.567																																					p.R1079W	Ovarian(102;1198 1520 13195 17913 37529)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3235T	11						.	G	TRP/ARG,TRP/ARG,TRP/ARG	1,4399	2.1+/-5.4	0,1,2199	61.0	57.0	59.0		3235,2317,2500	2.9	1.0	11	dbSNP_134	59	0,8586		0,0,4293	no	missense,missense,missense	ARAP1	NM_001040118.2,NM_001135190.1,NM_015242.4	101,101,101	0,1,6492	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	1079/1451,773/1134,834/1206	72407631	1,12985	2200	4293	6493	72085279	SO:0001583	missense	116985	exon23			AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3235C>T	11.37:g.72407631G>A	ENSP00000377233:p.Arg1079Trp	Somatic		Capture	Illumina HiSeq	Phase_I	72085279	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908351	0.72868	2.27E-4	0.0	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686	T;T;T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75;1.75;1.75	4.81	2.9	0.33743	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.202497	0.40144	N	0.001175	T	0.51618	0.1685	M	0.82193	2.58	0.43426	D	0.995582	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.994;0.989;0.999;0.999	T	0.55147	-0.8186	10	0.87932	D	0	.	11.8148	0.52204	0.0:0.0:0.5428:0.4572	.	834;773;1079;1079;839	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	W	1079;1079;839;834;1079;834;773	ENSP00000352332:R1079W;ENSP00000390461:R1079W;ENSP00000377230:R839W;ENSP00000335506:R834W;ENSP00000377233:R1079W;ENSP00000392264:R834W;ENSP00000403127:R773W	ENSP00000335506:R834W	R	-	1	2	ARAP1	72085279	1.000000	0.71417	0.985000	0.45067	0.969000	0.65631	1.826000	0.39092	0.428000	0.26173	-0.493000	0.04662	CGG		0.567	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
FOLR4	390243	broad.mit.edu	37	11	94040408	94040408	+	Silent	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr11:94040408C>T	ENST00000440961.2	+	3	449	c.405C>T	c.(403-405)gaC>gaT	p.D135D		NM_001199206.1	NP_001186135.1	A6ND01	JUNO_HUMAN	folate receptor 4, delta (putative)	142					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.D136D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14						GGTGGGAAGACTGTCGCATGT	0.602																																					p.D142D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C426T	11						.						102.0	111.0	108.0					11																	94040408		2197	4294	6491	93680056	SO:0001819	synonymous_variant	390243	exon3					11q14	2014-07-23	2012-12-07		ENSG00000183560	ENSG00000183560			32565	protein-coding gene	gene with protein product		615737	"""folate receptor 4 (delta) homolog (mouse)"""			11111049, 24739963	Standard	NM_001199206		Approved	Folbp3, JUNO	uc021qou.1	A6ND01		ENST00000440961.2:c.405C>T	11.37:g.94040408C>T		Somatic		Capture	Illumina HiSeq	Phase_I	93680056	NM_001199206		Silent	SNP	ENST00000440961.2	37		.	.	.	.	.	.	.	.	.	.	C	11.21	1.573032	0.28092	.	.	ENSG00000183560	ENST00000328458	.	.	.	4.67	1.76	0.24704	.	.	.	.	.	T	0.52058	0.1711	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38845	-0.9642	4	.	.	.	0.2104	5.3826	0.16199	0.1629:0.6588:0.0:0.1783	.	.	.	.	I	136	.	.	T	+	2	0	FOLR4	93680056	1.000000	0.71417	0.596000	0.28811	0.610000	0.37248	1.279000	0.33191	0.291000	0.22468	0.491000	0.48974	ACT		0.602	FOLR4-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000396420.1	NM_001080486	
CHD4	1108	broad.mit.edu	37	12	6702646	6702646	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr12:6702646C>T	ENST00000357008.2	-	16	2613	c.2450G>A	c.(2449-2451)cGa>cAa	p.R817Q	CHD4_ENST00000544040.1_Missense_Mutation_p.R810Q|CHD4_ENST00000544484.1_Missense_Mutation_p.R814Q|CHD4_ENST00000309577.6_Missense_Mutation_p.R817Q	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	817	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.R817Q(2)		central_nervous_system(2)	2						CTCATTCTCTCGGATGATGGC	0.517																																					p.R817Q	Colon(32;586 792 4568 16848 45314)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2450A	12						.						189.0	158.0	168.0					12																	6702646		2203	4300	6503	6572907	SO:0001583	missense	1108	exon16			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2450G>A	12.37:g.6702646C>T	ENSP00000349508:p.Arg817Gln	Somatic		Capture	Illumina HiSeq	Phase_I	6572907	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	C	35	5.428477	0.96131	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27	4.9	4.9	0.64082	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.64402	D	0.000001	D	0.96103	0.8730	M	0.64080	1.96	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.91635	0.993;0.999;0.986	D	0.96529	0.9391	10	0.87932	D	0	-6.7785	18.278	0.90089	0.0:1.0:0.0:0.0	.	817;817;810	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	Q	814;810;817;817;791	ENSP00000440392:R814Q;ENSP00000440542:R810Q;ENSP00000312419:R817Q;ENSP00000349508:R817Q	ENSP00000312419:R817Q	R	-	2	0	CHD4	6572907	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.625000	0.83145	2.550000	0.86006	0.591000	0.81541	CGA		0.517	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
ACSM4	341392	broad.mit.edu	37	12	7469871	7469871	+	Silent	SNP	C	C	T	rs200562081		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr12:7469871C>T	ENST00000399422.4	+	4	807	c.759C>T	c.(757-759)tgC>tgT	p.C253C		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	253					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						TCACCCTCTGCGGAAGGTAGG	0.463													C|||	1	0.000199681	0.0	0.0014	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0				p.C253C												.	.	0			c.C759T	12						.	C		0,3840		0,0,1920	31.0	33.0	32.0		759	-0.3	1.0	12		32	1,8221		0,1,4110	no	coding-synonymous	ACSM4	NM_001080454.1		0,1,6030	TT,TC,CC		0.0122,0.0,0.0083		253/581	7469871	1,12061	1920	4111	6031	7361138	SO:0001819	synonymous_variant	341392	exon4				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.759C>T	12.37:g.7469871C>T		Somatic		Capture	Illumina HiSeq	Phase_I	7361138	NM_001080454	A8MTI6	Silent	SNP	ENST00000399422.4	37	CCDS44825.1																																																																																				0.463	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337866.2	NM_001080454	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	G	rs121913529		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr12:25398284C>G	ENST00000256078.4	-	2	98	c.35G>C	c.(34-36)gGt>gCt	p.G12A	KRAS_ENST00000311936.3_Missense_Mutation_p.G12A|KRAS_ENST00000556131.1_Missense_Mutation_p.G12A|KRAS_ENST00000557334.1_Missense_Mutation_p.G12A	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12A	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35C	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>C	12.37:g.25398284C>G	ENSP00000256078:p.Gly12Ala	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996285	0.93167	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85643	0.5744	M	0.74546	2.27	0.80722	D	1	P;P	0.52842	0.898;0.956	P;P	0.55303	0.658;0.773	D	0.87064	0.2155	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	A	12	ENSP00000308495:G12A;ENSP00000452512:G12A;ENSP00000256078:G12A;ENSP00000451856:G12A	ENSP00000256078:G12A	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
SLC17A8	246213	broad.mit.edu	37	12	100811861	100811861	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr12:100811861G>T	ENST00000323346.5	+	11	1665	c.1352G>T	c.(1351-1353)gGg>gTg	p.G451V	SLC17A8_ENST00000552697.1_3'UTR|SLC17A8_ENST00000392989.3_Missense_Mutation_p.G401V	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	451					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.G451V(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						ATTCTCATGGGGATCTCAAAC	0.488																																					p.G451V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1352T	12						.						180.0	165.0	170.0					12																	100811861		2203	4300	6503	99335992	SO:0001583	missense	246213	exon11			AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.1352G>T	12.37:g.100811861G>T	ENSP00000316909:p.Gly451Val	Somatic		Capture	Illumina HiSeq	Phase_I	99335992	NM_139319	B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	37	CCDS9077.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.867787	0.91587	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.70631	-0.5;-0.5	5.55	5.55	0.83447	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.91129	0.7207	H	0.98525	4.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94044	0.7312	10	0.87932	D	0	.	19.8667	0.96806	0.0:0.0:1.0:0.0	.	451;401	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	V	451;401	ENSP00000316909:G451V;ENSP00000376715:G401V	ENSP00000316909:G451V	G	+	2	0	SLC17A8	99335992	1.000000	0.71417	0.985000	0.45067	0.946000	0.59487	9.813000	0.99286	2.773000	0.95371	0.655000	0.94253	GGG		0.488	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319	
KNTC1	9735	broad.mit.edu	37	12	123067398	123067398	+	Silent	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr12:123067398G>A	ENST00000333479.7	+	34	3306	c.3129G>A	c.(3127-3129)gtG>gtA	p.V1043V	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1043					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.V1043V(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		CTGCTGAGGTGAGGAGCCCAA	0.552																																					p.V1043V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3129A	12						.						37.0	38.0	38.0					12																	123067398		1999	4167	6166	121633351	SO:0001819	synonymous_variant	9735	exon34				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.3129G>A	12.37:g.123067398G>A		Somatic		Capture	Illumina HiSeq	Phase_I	121633351	NM_014708	A7E2C4|B3KSG2	Silent	SNP	ENST00000333479.7	37	CCDS45002.1																																																																																				0.552	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
MYCBP2	23077	broad.mit.edu	37	13	77664369	77664369	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr13:77664369T>C	ENST00000544440.2	-	60	10300	c.10283A>G	c.(10282-10284)gAt>gGt	p.D3428G	MYCBP2-AS1_ENST00000448470.2_RNA|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.D3428G|MYCBP2-AS1_ENST00000450627.2_RNA|MYCBP2_ENST00000407578.2_Missense_Mutation_p.D3466G|MYCBP2-AS1_ENST00000422231.2_RNA					MYC binding protein 2, E3 ubiquitin protein ligase									p.D3428G(1)|p.D3466G(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CTTTGCAAGATCAGTATCAGT	0.358																																					p.D3466G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A10397G	13						.						115.0	106.0	109.0					13																	77664369		2203	4300	6503	76562370	SO:0001583	missense	23077	exon60			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10283A>G	13.37:g.77664369T>C	ENSP00000444596:p.Asp3428Gly	Somatic		Capture	Illumina HiSeq	Phase_I	76562370	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	37		.	.	.	.	.	.	.	.	.	.	T	19.85	3.904073	0.72754	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.32988	1.44;1.43;1.44	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.32102	0.0818	N	0.08118	0	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	T	0.19844	-1.0293	10	0.17832	T	0.49	.	15.0908	0.72192	0.0:0.0:0.0:1.0	.	3428	O75592	MYCB2_HUMAN	G	3428;3466;3428	ENSP00000349892:D3428G;ENSP00000384288:D3466G;ENSP00000444596:D3428G	ENSP00000349892:D3428G	D	-	2	0	MYCBP2	76562370	1.000000	0.71417	0.985000	0.45067	0.948000	0.59901	7.798000	0.85924	2.018000	0.59344	0.528000	0.53228	GAT		0.358	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
SLITRK5	26050	broad.mit.edu	37	13	88329425	88329425	+	Silent	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr13:88329425G>A	ENST00000325089.6	+	2	2001	c.1782G>A	c.(1780-1782)gcG>gcA	p.A594A	SLITRK5_ENST00000400028.3_Silent_p.A353A	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	594	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.A594A(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TCTGTAAGGCGCCCAAAAAAT	0.527																																					p.A594A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1782A	13						.						163.0	147.0	153.0					13																	88329425		2203	4300	6503	87127426	SO:0001819	synonymous_variant	26050	exon2			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1782G>A	13.37:g.88329425G>A		Somatic		Capture	Illumina HiSeq	Phase_I	87127426	NM_015567	B3KNB8|B4DSH5|Q5VT81	Silent	SNP	ENST00000325089.6	37	CCDS9465.1																																																																																				0.527	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
COL4A2	1284	broad.mit.edu	37	13	111132728	111132728	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr13:111132728G>A	ENST00000360467.5	+	31	3055	c.2749G>A	c.(2749-2751)Ggg>Agg	p.G917R		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	917	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)	p.G917R(1)		NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TGGGACCCCCGGGCTAAAAGG	0.562																																					p.G917R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2749A	13						.						38.0	42.0	41.0					13																	111132728		1877	4102	5979	109930729	SO:0001583	missense	1284	exon31			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.2749G>A	13.37:g.111132728G>A	ENSP00000353654:p.Gly917Arg	Somatic		Capture	Illumina HiSeq	Phase_I	109930729	NM_001846	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	37	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	G	13.73	2.323315	0.41096	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.99637	-6.29	4.84	4.84	0.62591	.	0.234080	0.29707	N	0.011416	D	0.99802	0.9915	H	0.98507	4.25	0.54753	D	0.999989	D	0.89917	1.0	D	0.91635	0.999	D	0.96795	0.9585	10	0.87932	D	0	.	14.8672	0.70425	0.0:0.0:1.0:0.0	.	917	P08572	CO4A2_HUMAN	R	917	ENSP00000353654:G917R	ENSP00000257309:G917R	G	+	1	0	COL4A2	109930729	1.000000	0.71417	0.159000	0.22649	0.066000	0.16364	5.991000	0.70602	2.220000	0.72140	0.462000	0.41574	GGG		0.562	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
SIPA1L1	26037	broad.mit.edu	37	14	72128103	72128104	+	Frame_Shift_Ins	INS	-	-	A	rs79690878|rs369992908		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr14:72128103_72128104insA	ENST00000555818.1	+	7	2522_2523	c.2174_2175insA	c.(2173-2178)ccaaaafs	p.PK725fs	SIPA1L1_ENST00000381232.3_Frame_Shift_Ins_p.PK725fs|SIPA1L1_ENST00000537413.1_Frame_Shift_Ins_p.PK200fs|SIPA1L1_ENST00000358550.2_Frame_Shift_Ins_p.PK725fs	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	725	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CCATTCAGCCCAAAAAACATCC	0.47																																					p.P725fs												.	.	0			c.2174_2175insA	14						.																																			71197857	SO:0001589	frameshift_variant	26037	exon7			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.2180dupA	14.37:g.72128109_72128109dupA	ENSP00000450832:p.Pro725fs	None		Capture	Illumina HiSeq	Phase_I	71197856	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Frame_Shift_Ins	INS	ENST00000555818.1	37	CCDS9807.1																																																																																				0.470	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
SUPT16H	11198	broad.mit.edu	37	14	21827652	21827653	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	AT	AT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr14:21827652_21827653delAT	ENST00000216297.2	-	19	2629_2630	c.2291_2292delAT	c.(2290-2292)tatfs	p.Y764fs		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	764					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.Y764fs*2(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		CCTGCTCAGCATAGAGGTCATC	0.46																																					p.764_764del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2291_2292del	14						.																																			20897493	SO:0001589	frameshift_variant	11198	exon19			AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.2291_2292delAT	14.37:g.21827652_21827653delAT	ENSP00000216297:p.Tyr764fs	Somatic		Capture	Illumina HiSeq	Phase_I	20897492	NM_007192	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Frame_Shift_Del	DEL	ENST00000216297.2	37	CCDS9569.1																																																																																				0.460	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074025.2		
OR10G3	26533	broad.mit.edu	37	14	22038134	22038134	+	Missense_Mutation	SNP	C	C	T	rs142649226	byFrequency	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr14:22038134C>T	ENST00000303532.1	-	1	741	c.742G>A	c.(742-744)Gtg>Atg	p.V248M		NM_001005465.1	NP_001005465.1	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G, member 3	248						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V248M(1)|p.V248L(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)	15	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		ACGGTGACCACGGTTACATGG	0.577													C|||	8	0.00159744	0.0045	0.0014	5008	,	,		17010	0.001		0.0	False		,,,				2504	0.0				p.V248M												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G742A	14						.	C	MET/VAL	17,4389	25.3+/-52.1	0,17,2186	80.0	86.0	84.0		742	0.8	0.6	14	dbSNP_134	84	0,8600		0,0,4300	yes	missense	OR10G3	NM_001005465.1	21	0,17,6486	TT,TC,CC		0.0,0.3858,0.1307	benign	248/314	22038134	17,12989	2203	4300	6503	21107974	SO:0001583	missense	26533	exon1				CCDS32046.1	14q11.2	2013-09-24			ENSG00000169208	ENSG00000169208		"""GPCR / Class A : Olfactory receptors"""	8171	protein-coding gene	gene with protein product						8188290	Standard	NM_001005465		Approved		uc010tmb.2	Q8NGC4	OTTHUMG00000168886	ENST00000303532.1:c.742G>A	14.37:g.22038134C>T	ENSP00000302437:p.Val248Met	Somatic		Capture	Illumina HiSeq	Phase_I	21107974	NM_001005465	Q6IET7|Q96R77	Missense_Mutation	SNP	ENST00000303532.1	37	CCDS32046.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.454128	0.26161	0.003858	0.0	ENSG00000169208	ENST00000303532	T	0.00277	8.34	5.11	0.809	0.18725	GPCR, rhodopsin-like superfamily (1);	0.418145	0.17713	N	0.164506	T	0.00328	0.0010	M	0.89601	3.045	0.27113	N	0.962321	B	0.29378	0.243	B	0.34452	0.183	T	0.30090	-0.9990	10	0.62326	D	0.03	-0.2701	4.7223	0.12924	0.2979:0.5262:0.0:0.1759	.	248	Q8NGC4	O10G3_HUMAN	M	248	ENSP00000302437:V248M	ENSP00000302437:V248M	V	-	1	0	OR10G3	21107974	0.002000	0.14202	0.615000	0.29064	0.627000	0.37826	0.178000	0.16820	0.237000	0.21200	-0.291000	0.09656	GTG		0.577	OR10G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401521.1		
SYNJ2BP	55333	broad.mit.edu	37	14	70839769	70839769	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr14:70839769G>A	ENST00000256366.4	-	4	458	c.377C>T	c.(376-378)cCa>cTa	p.P126L	SYNJ2BP-COX16_ENST00000555276.1_RNA|SYNJ2BP_ENST00000554216.1_5'UTR	NM_018373.2	NP_060843.2	P57105	SYJ2B_HUMAN	synaptojanin 2 binding protein	126					intracellular distribution of mitochondria (GO:0048312)|negative regulation of activin receptor signaling pathway (GO:0032926)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of receptor internalization (GO:0002092)	cell surface (GO:0009986)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)		p.P126L(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.00367)|BRCA - Breast invasive adenocarcinoma(234;0.00716)|OV - Ovarian serous cystadenocarcinoma(108;0.0377)		GGCAAACACTGGCACCAGCAC	0.458																																					p.P126L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C377T	14						.						167.0	146.0	153.0					14																	70839769		2203	4300	6503	69909522	SO:0001583	missense	55333	exon4			AK002133	CCDS9803.1	14q24.2	2013-05-10			ENSG00000213463	ENSG00000213463			18955	protein-coding gene	gene with protein product	"""activin receptor interacting protein 5"""	609411				11882656	Standard	NM_018373		Approved	Arip2		P57105	OTTHUMG00000171240	ENST00000256366.4:c.377C>T	14.37:g.70839769G>A	ENSP00000256366:p.Pro126Leu	Somatic		Capture	Illumina HiSeq	Phase_I	69909522	NM_018373	Q49SH3|Q96IA4	Missense_Mutation	SNP	ENST00000256366.4	37	CCDS9803.1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.764345	0.69878	.	.	ENSG00000213463	ENST00000256366	T	0.20598	2.06	5.45	5.45	0.79879	.	0.105623	0.42821	D	0.000660	T	0.24314	0.0589	M	0.62723	1.935	0.58432	D	0.999994	P	0.44816	0.844	B	0.36666	0.23	T	0.04165	-1.0972	10	0.62326	D	0.03	-9.9015	17.0485	0.86511	0.0:0.0:1.0:0.0	.	126	P57105	SYJ2B_HUMAN	L	126	ENSP00000256366:P126L	ENSP00000256366:P126L	P	-	2	0	SYNJ2BP	69909522	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.476000	0.66793	2.941000	0.99782	0.655000	0.94253	CCA		0.458	SYNJ2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412472.1	NM_018373	
AHNAK2	113146	broad.mit.edu	37	14	105414671	105414671	+	Missense_Mutation	SNP	C	C	T	rs200387258		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr14:105414671C>T	ENST00000333244.5	-	7	7236	c.7117G>A	c.(7117-7119)Gct>Act	p.A2373T	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2373						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.A2373T(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCAGGTCAGCGGAAGGGGGC	0.652																																					p.A2373T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7117A	14						.	C	THR/ALA	8,3876		0,8,1934	120.0	133.0	129.0		7117	-4.3	0.0	14		129	2,8274		0,2,4136	no	missense	AHNAK2	NM_138420.2	58	0,10,6070	TT,TC,CC		0.0242,0.206,0.0822	possibly-damaging	2373/5796	105414671	10,12150	1942	4138	6080	104485716	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7117G>A	14.37:g.105414671C>T	ENSP00000353114:p.Ala2373Thr	Somatic		Capture	Illumina HiSeq	Phase_I	104485716	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	14.39	2.520036	0.44866	0.00206	2.42E-4	ENSG00000185567	ENST00000333244	T	0.00682	5.86	3.79	-4.27	0.03744	.	.	.	.	.	T	0.00815	0.0027	M	0.62266	1.93	0.09310	N	1	P	0.41080	0.737	B	0.39152	0.292	T	0.40887	-0.9539	9	0.10902	T	0.67	.	4.4015	0.11388	0.2527:0.2708:0.0:0.4765	.	2373	Q8IVF2	AHNK2_HUMAN	T	2373	ENSP00000353114:A2373T	ENSP00000353114:A2373T	A	-	1	0	AHNAK2	104485716	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.976000	0.01497	-1.044000	0.03254	-2.710000	0.00134	GCT		0.652	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
RYR3	6263	broad.mit.edu	37	15	33954588	33954588	+	Silent	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr15:33954588G>A	ENST00000389232.4	+	35	4927	c.4857G>A	c.(4855-4857)aaG>aaA	p.K1619K	RYR3_ENST00000415757.3_Silent_p.K1619K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1619	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.K1619K(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCAGCGCCAAGGAGAGGAAGC	0.547																																					p.K1619K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4857A	15						.						63.0	61.0	62.0					15																	33954588		2020	4176	6196	31741880	SO:0001819	synonymous_variant	6263	exon35				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.4857G>A	15.37:g.33954588G>A		Somatic		Capture	Illumina HiSeq	Phase_I	31741880	NM_001036	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1																																																																																				0.547	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
RNF111	54778	broad.mit.edu	37	15	59368258	59368258	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr15:59368258C>T	ENST00000557998.1	+	7	2079	c.1792C>T	c.(1792-1794)Cga>Tga	p.R598*	RNF111_ENST00000559209.1_Nonsense_Mutation_p.R598*|RNF111_ENST00000434298.1_Nonsense_Mutation_p.R598*|RNF111_ENST00000561186.1_Nonsense_Mutation_p.R598*|RNF111_ENST00000348370.4_Nonsense_Mutation_p.R598*	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	598					gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R598*(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		TTCTTCCTCCCGAGCTGCAAT	0.532																																					p.R598X	NSCLC(72;983 1365 10746 34387 47081)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1792T	15						.						92.0	83.0	86.0					15																	59368258		2192	4291	6483	57155550	SO:0001587	stop_gained	54778	exon7			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1792C>T	15.37:g.59368258C>T	ENSP00000452732:p.Arg598*	Somatic		Capture	Illumina HiSeq	Phase_I	57155550	NM_017610	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Nonsense_Mutation	SNP	ENST00000557998.1	37	CCDS58366.1	.	.	.	.	.	.	.	.	.	.	C	43	10.451598	0.99407	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.2176	20.1225	0.97967	0.0:1.0:0.0:0.0	.	.	.	.	X	598	.	ENSP00000288199:R598X	R	+	1	2	RNF111	57155550	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.414000	0.66405	2.831000	0.97527	0.650000	0.86243	CGA		0.532	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610	
TSPAN3	10099	broad.mit.edu	37	15	77348422	77348422	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr15:77348422C>T	ENST00000267970.4	-	2	512	c.239G>A	c.(238-240)cGc>cAc	p.R80H	TSPAN3_ENST00000561277.1_5'UTR|TSPAN3_ENST00000559494.1_Intron|TSPAN3_ENST00000558394.1_5'UTR|TSPAN3_ENST00000346495.2_Missense_Mutation_p.R80H|TSPAN3_ENST00000424443.3_Intron|TSPAN3_ENST00000558745.1_5'UTR	NM_001168412.1|NM_005724.5|NM_198902.2	NP_001161884.1|NP_005715.1|NP_944492.1	O60637	TSN3_HUMAN	tetraspanin 3	80						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R80H(1)		kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	10				all cancers(203;1.14e-19)		AAGTCCACAGCGACTTTCCCG	0.483																																					p.R80H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G239A	15						.						131.0	118.0	122.0					15																	77348422		2196	4294	6490	75135477	SO:0001583	missense	10099	exon2				CCDS10292.1, CCDS10293.1, CCDS53963.1	15q23	2013-02-14	2005-03-21	2005-03-21	ENSG00000140391	ENSG00000140391		"""Tetraspanins"""	17752	protein-coding gene	gene with protein product		613134	"""transmembrane 4 superfamily member 8"""	TM4SF8			Standard	NM_005724		Approved	TM4-A, TSPAN-3	uc002bcj.3	O60637	OTTHUMG00000143728	ENST00000267970.4:c.239G>A	15.37:g.77348422C>T	ENSP00000267970:p.Arg80His	Somatic		Capture	Illumina HiSeq	Phase_I	75135477	NM_005724	A6NEH4|B3KQQ2|B4DP19|Q9BW22|Q9NVX9	Missense_Mutation	SNP	ENST00000267970.4	37	CCDS10292.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087296	0.55968	.	.	ENSG00000140391	ENST00000267970;ENST00000423920;ENST00000346495	T;T	0.80393	-1.37;-1.37	5.9	1.22	0.21188	Tetraspanin, conserved site (1);	0.207799	0.52532	N	0.000080	T	0.74756	0.3758	L	0.57536	1.79	0.80722	D	1	B;B	0.27853	0.191;0.191	B;B	0.30782	0.12;0.12	T	0.64537	-0.6384	10	0.23302	T	0.38	.	11.8673	0.52501	0.0:0.7663:0.0:0.2337	.	80;80	A6NEH4;O60637	.;TSN3_HUMAN	H	80;42;80	ENSP00000267970:R80H;ENSP00000341329:R80H	ENSP00000267970:R80H	R	-	2	0	TSPAN3	75135477	0.998000	0.40836	0.998000	0.56505	0.982000	0.71751	0.713000	0.25794	0.050000	0.15949	0.561000	0.74099	CGC		0.483	TSPAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289792.3	NM_005724	
LRRK1	79705	broad.mit.edu	37	15	101593249	101593249	+	Missense_Mutation	SNP	G	G	C	rs199804667		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr15:101593249G>C	ENST00000388948.3	+	25	4171	c.3812G>C	c.(3811-3813)cGc>cCc	p.R1271P	LRRK1_ENST00000284395.5_Missense_Mutation_p.R1268P|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GCCGTCAAGCGCTTCCACATC	0.602																																					p.R1271P												.	.	0			c.G3812C	15						.						42.0	51.0	48.0					15																	101593249		2058	4223	6281	99410772	SO:0001583	missense	79705	exon25			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3812G>C	15.37:g.101593249G>C	ENSP00000373600:p.Arg1271Pro	None		Capture	Illumina HiSeq	Phase_I	99410772	NM_024652		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.541078	0.65085	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	D;D	0.93953	-3.32;-3.32	5.12	5.12	0.69794	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95262	0.8463	M	0.64170	1.965	0.38415	D	0.946027	D	0.71674	0.998	D	0.67382	0.951	D	0.94888	0.8045	10	0.37606	T	0.19	.	13.8348	0.63402	0.0:0.0:0.847:0.153	.	1271	Q38SD2	LRRK1_HUMAN	P	1271;1268	ENSP00000373600:R1271P;ENSP00000284395:R1268P	ENSP00000284395:R1268P	R	+	2	0	LRRK1	99410772	1.000000	0.71417	0.969000	0.41365	0.832000	0.47134	4.568000	0.60857	2.526000	0.85167	0.650000	0.86243	CGC		0.602	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
TMC7	79905	broad.mit.edu	37	16	19027902	19027902	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:19027902G>A	ENST00000304381.5	+	3	572	c.442G>A	c.(442-444)Gac>Aac	p.D148N	TMC7_ENST00000569532.1_Missense_Mutation_p.D148N|TMC7_ENST00000421369.3_Missense_Mutation_p.D38N	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	148					ion transport (GO:0006811)	integral component of membrane (GO:0016021)		p.D148N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						GTGGCGGGAGGACATCCGCAG	0.567																																					p.D38N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G112A	16						.						93.0	73.0	80.0					16																	19027902		2197	4300	6497	18935403	SO:0001583	missense	79905	exon3			AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.442G>A	16.37:g.19027902G>A	ENSP00000304710:p.Asp148Asn	Somatic		Capture	Illumina HiSeq	Phase_I	18935403	NM_001160364	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	ENST00000304381.5	37	CCDS10573.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.606830	0.46527	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	T;T	0.50548	0.74;0.74	5.53	3.55	0.40652	.	0.240515	0.42420	D	0.000717	T	0.48447	0.1500	L	0.46157	1.445	0.38188	D	0.939831	D;B;B	0.62365	0.991;0.353;0.192	P;B;B	0.55824	0.785;0.106;0.067	T	0.45948	-0.9226	10	0.17832	T	0.49	.	8.033	0.30476	0.0821:0.0:0.7594:0.1585	.	148;148;148	B4DF02;Q7Z402;B3KSZ3	.;TMC7_HUMAN;.	N	148;38	ENSP00000304710:D148N;ENSP00000397081:D38N	ENSP00000304710:D148N	D	+	1	0	TMC7	18935403	1.000000	0.71417	0.628000	0.29241	0.938000	0.57974	3.919000	0.56439	0.689000	0.31550	0.448000	0.29417	GAC		0.567	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	
PRKCB	5579	broad.mit.edu	37	16	24196785	24196785	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:24196785C>A	ENST00000321728.7	+	15	1794	c.1619C>A	c.(1618-1620)cCc>cAc	p.P540H	PRKCB_ENST00000303531.7_Missense_Mutation_p.P540H	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	540	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.P540H(2)		central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	ATACAGGCACCCTTTGAAGGG	0.557																																					p.P540H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1619A	16						.						97.0	81.0	87.0					16																	24196785		2197	4300	6497	24104286	SO:0001583	missense	5579	exon15			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1619C>A	16.37:g.24196785C>A	ENSP00000318315:p.Pro540His	Somatic		Capture	Illumina HiSeq	Phase_I	24104286	NM_212535	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	37	CCDS10618.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.027296	0.93518	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.39592	1.07;1.07	5.71	5.71	0.89125	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79227	0.4410	H	0.98155	4.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86364	0.1719	10	0.87932	D	0	.	19.2123	0.93760	0.0:1.0:0.0:0.0	.	540;540	P05771-2;P05771	.;KPCB_HUMAN	H	540	ENSP00000318315:P540H;ENSP00000305355:P540H	ENSP00000305355:P540H	P	+	2	0	PRKCB	24104286	1.000000	0.71417	0.978000	0.43139	0.938000	0.57974	7.487000	0.81328	2.861000	0.98227	0.650000	0.86243	CCC		0.557	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535	
KIAA0556	23247	broad.mit.edu	37	16	27710874	27710874	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:27710874C>A	ENST00000261588.4	+	10	1152	c.1133C>A	c.(1132-1134)gCa>gAa	p.A378E	KIAA0556_ENST00000567894.1_3'UTR|CTD-2049O4.1_ENST00000564893.1_RNA	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	378						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A378E(2)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GGACCACCAGCAAAACCATGG	0.517																																					p.A378E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1133A	16						.						137.0	104.0	115.0					16																	27710874		2197	4300	6497	27618375	SO:0001583	missense	23247	exon10			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.1133C>A	16.37:g.27710874C>A	ENSP00000261588:p.Ala378Glu	Somatic		Capture	Illumina HiSeq	Phase_I	27618375	NM_015202	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.567509	0.28003	.	.	ENSG00000047578	ENST00000261588;ENST00000327217	T	0.10573	2.86	4.32	-0.637	0.11504	.	1.400750	0.04595	N	0.397497	T	0.19685	0.0473	L	0.60455	1.87	0.09310	N	1	D;P	0.61080	0.989;0.557	P;B	0.57776	0.827;0.368	T	0.20840	-1.0263	10	0.31617	T	0.26	-6.5029	3.1301	0.06420	0.1863:0.4687:0.0:0.3449	.	286;378	Q8N803;O60303	.;K0556_HUMAN	E	378;285	ENSP00000261588:A378E	ENSP00000261588:A378E	A	+	2	0	KIAA0556	27618375	0.001000	0.12720	0.004000	0.12327	0.963000	0.63663	0.265000	0.18515	0.109000	0.17891	-0.367000	0.07326	GCA		0.517	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
PPL	5493	broad.mit.edu	37	16	4934854	4934854	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:4934854C>T	ENST00000345988.2	-	22	3891	c.3802G>A	c.(3802-3804)Gag>Aag	p.E1268K	PPL_ENST00000590782.2_Missense_Mutation_p.E1266K	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1268					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.E1268K(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TGGTAGATCTCTAAATCACAC	0.498																																					p.E1268K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3802A	16						.						184.0	180.0	181.0					16																	4934854		2197	4300	6497	4874855	SO:0001583	missense	5493	exon22			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.3802G>A	16.37:g.4934854C>T	ENSP00000340510:p.Glu1268Lys	Somatic		Capture	Illumina HiSeq	Phase_I	4874855	NM_002705	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	c	23.7	4.452829	0.84209	.	.	ENSG00000118898	ENST00000345988	T	0.41400	1.0	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.63931	0.2553	M	0.66939	2.045	0.80722	D	1	D	0.69078	0.997	D	0.66196	0.942	T	0.64334	-0.6432	10	0.59425	D	0.04	.	19.6749	0.95928	0.0:1.0:0.0:0.0	.	1268	O60437	PEPL_HUMAN	K	1268	ENSP00000340510:E1268K	ENSP00000340510:E1268K	E	-	1	0	PPL	4874855	1.000000	0.71417	0.962000	0.40283	0.715000	0.41141	6.057000	0.71119	2.666000	0.90696	0.651000	0.88453	GAG		0.498	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
ZNF423	23090	broad.mit.edu	37	16	49670279	49670279	+	Silent	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:49670279G>T	ENST00000561648.1	-	4	2837	c.2784C>A	c.(2782-2784)ggC>ggA	p.G928G	ZNF423_ENST00000535559.1_Silent_p.G811G|ZNF423_ENST00000563137.2_Silent_p.G868G|ZNF423_ENST00000562520.1_Silent_p.G868G|ZNF423_ENST00000567169.1_Silent_p.G811G|ZNF423_ENST00000562871.1_Silent_p.G868G|ZNF423_ENST00000262383.2_Silent_p.G928G	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	928					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G928G(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				ACTTGTGACTGCCCTTGATAA	0.587																																					p.G928G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2784A	16						.						76.0	66.0	69.0					16																	49670279		2198	4299	6497	48227780	SO:0001819	synonymous_variant	23090	exon5			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2784C>A	16.37:g.49670279G>T		Somatic		Capture	Illumina HiSeq	Phase_I	48227780	NM_015069	O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	CCDS32445.1																																																																																				0.587	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
BRD7	29117	broad.mit.edu	37	16	50388383	50388383	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:50388383C>G	ENST00000394688.3	-	4	558	c.399G>C	c.(397-399)caG>caC	p.Q133H	BRD7_ENST00000394689.2_Missense_Mutation_p.Q133H|BRD7_ENST00000401491.3_5'UTR|snoU13_ENST00000459559.1_RNA			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	133					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q133H(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				GAAGGGGTGTCTGTTCTACTT	0.299																																					p.Q133H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G399C	16						.						128.0	146.0	140.0					16																	50388383		2197	4296	6493	48945884	SO:0001583	missense	29117	exon4			AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.399G>C	16.37:g.50388383C>G	ENSP00000378180:p.Gln133His	Somatic		Capture	Illumina HiSeq	Phase_I	48945884	NM_013263	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Missense_Mutation	SNP	ENST00000394688.3	37	CCDS10742.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.857743	0.51376	.	.	ENSG00000166164	ENST00000394688;ENST00000394689;ENST00000401491	T;T	0.18657	2.2;2.2	5.78	4.75	0.60458	Bromodomain (3);	0.000000	0.85682	D	0.000000	T	0.37517	0.1006	M	0.66939	2.045	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.76575	0.972;0.988	T	0.05289	-1.0894	10	0.23302	T	0.38	-3.3925	7.6534	0.28360	0.0:0.76:0.0:0.24	.	133;133	Q9NPI1;Q9NPI1-2	BRD7_HUMAN;.	H	133	ENSP00000378180:Q133H;ENSP00000378181:Q133H	ENSP00000378180:Q133H	Q	-	3	2	BRD7	48945884	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.444000	0.35068	2.730000	0.93505	0.655000	0.94253	CAG		0.299	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
CES3	23491	broad.mit.edu	37	16	66998324	66998324	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:66998324G>A	ENST00000303334.4	+	5	696	c.625G>A	c.(625-627)Gtg>Atg	p.V209M	RP11-361L15.4_ENST00000566869.1_RNA|CES3_ENST00000394037.1_Missense_Mutation_p.V209M	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	209						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)	p.V209M(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		TTTGCGCTGGGTGCAAGAAAA	0.572																																					p.V209M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G625A	16						.						86.0	85.0	85.0					16																	66998324		2200	4300	6500	65555825	SO:0001583	missense	23491	exon5			AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.625G>A	16.37:g.66998324G>A	ENSP00000304782:p.Val209Met	Somatic		Capture	Illumina HiSeq	Phase_I	65555825	NM_001185177	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	ENST00000303334.4	37	CCDS10826.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292545	0.59976	.	.	ENSG00000172828	ENST00000303334;ENST00000394037	T;T	0.80033	-1.33;-1.33	4.07	0.841	0.18918	Carboxylesterase, type B (1);	0.430026	0.17090	N	0.187432	D	0.90041	0.6890	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.87233	0.2261	10	0.87932	D	0	.	6.8557	0.24040	0.1714:0.1439:0.6846:0.0	.	209	Q6UWW8	EST3_HUMAN	M	209	ENSP00000304782:V209M;ENSP00000377602:V209M	ENSP00000304782:V209M	V	+	1	0	CES3	65555825	1.000000	0.71417	0.684000	0.30055	0.032000	0.12392	1.714000	0.37961	0.090000	0.17273	-0.222000	0.12452	GTG		0.572	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	NM_024922	
EXOC3L1	283849	broad.mit.edu	37	16	67221162	67221162	+	Missense_Mutation	SNP	C	C	T	rs571286410		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:67221162C>T	ENST00000314586.6	-	5	1246	c.1006G>A	c.(1006-1008)Gcc>Acc	p.A336T	EXOC3L1_ENST00000562887.1_Intron	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	336	Mediates interaction with EXOC2, EXOC4 and EXOC5. {ECO:0000250}.				exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)		p.A336T(2)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						TGCAGCAAGGCGAAGGCATCC	0.632													c|||	1	0.000199681	0.0	0.0	5008	,	,		20533	0.0		0.0	False		,,,				2504	0.001				p.A336T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1006A	16						.						41.0	37.0	38.0					16																	67221162		2198	4300	6498	65778663	SO:0001583	missense	283849	exon5			AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.1006G>A	16.37:g.67221162C>T	ENSP00000325674:p.Ala336Thr	Somatic		Capture	Illumina HiSeq	Phase_I	65778663	NM_178516	A8K7I9|Q8NAD2|Q8TEN2	Missense_Mutation	SNP	ENST00000314586.6	37	CCDS10832.1	.	.	.	.	.	.	.	.	.	.	c	0.738	-0.777374	0.02929	.	.	ENSG00000179044	ENST00000314586;ENST00000545725;ENST00000314553	T;T	0.18338	3.09;2.22	5.44	-0.326	0.12698	.	0.688796	0.14773	N	0.299287	T	0.04588	0.0125	N	0.02539	-0.55	0.25226	N	0.989867	B;B;B	0.16802	0.002;0.019;0.002	B;B;B	0.11329	0.001;0.006;0.002	T	0.37979	-0.9682	10	0.17369	T	0.5	-2.9961	2.2378	0.04012	0.1226:0.3296:0.1229:0.4249	.	275;275;336	F5H4W1;B7Z6U0;Q86VI1	.;.;EX3L1_HUMAN	T	336;275;280	ENSP00000325674:A336T;ENSP00000439910:A275T	ENSP00000325008:A280T	A	-	1	0	EXOC3L1	65778663	0.013000	0.17824	0.967000	0.41034	0.168000	0.22595	-0.502000	0.06390	-0.269000	0.09298	-1.467000	0.01014	GCC		0.632	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268827.2	NM_178516	
NQO1	1728	broad.mit.edu	37	16	69745073	69745073	+	Missense_Mutation	SNP	G	G	A	rs114112422		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:69745073G>A	ENST00000320623.5	-	6	1142	c.631C>T	c.(631-633)Cgc>Tgc	p.R211C	NQO1_ENST00000379047.3_Missense_Mutation_p.R177C|snoU13_ENST00000459361.1_RNA|NQO1_ENST00000439109.2_Missense_Mutation_p.R139C|NQO1_ENST00000564043.1_Missense_Mutation_p.R190C|NQO1_ENST00000379046.2_Missense_Mutation_p.R173C|CTD-2033A16.1_ENST00000562696.1_RNA|NQO1_ENST00000561500.1_Missense_Mutation_p.R173C	NM_000903.2	NP_000894.1	P15559	NQO1_HUMAN	NAD(P)H dehydrogenase, quinone 1	211					aging (GO:0007568)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cellular amino acid metabolic process (GO:0006521)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|NAD(P)H dehydrogenase (quinone) activity (GO:0003955)|poly(A) RNA binding (GO:0044822)|superoxide dismutase activity (GO:0004784)	p.R211C(1)		autonomic_ganglia(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	10					Carboplatin(DB00958)|Cisplatin(DB00515)|Dicoumarol(DB00266)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|Menadione(DB00170)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	TTCTCCAGGCGTTTCTTCCAT	0.453																																					p.R211C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C631T	16						.						157.0	166.0	163.0					16																	69745073		2198	4300	6498	68302574	SO:0001583	missense	1728	exon6			M81600	CCDS10883.1, CCDS32471.1, CCDS32472.1, CCDS67067.1	16q12-q22	2012-10-02	2001-11-30	2001-12-07	ENSG00000181019	ENSG00000181019	1.6.5.2		2874	protein-coding gene	gene with protein product		125860	"""diaphorase (NADH/NADPH) (cytochrome b-5 reductase)"""	NMOR1, DIA4		2843525	Standard	NM_001286137		Approved	DHQU, QR1, DTD	uc002exp.3	P15559	OTTHUMG00000137575	ENST00000320623.5:c.631C>T	16.37:g.69745073G>A	ENSP00000319788:p.Arg211Cys	Somatic		Capture	Illumina HiSeq	Phase_I	68302574	NM_000903	B2R5Y9|B4DNM7|B7ZAD1|Q86UK1	Missense_Mutation	SNP	ENST00000320623.5	37	CCDS10883.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740651	0.89573	.	.	ENSG00000181019	ENST00000320623;ENST00000379047;ENST00000379046;ENST00000439109	T;T;T;T	0.10763	2.84;3.02;3.02;3.02	5.41	5.41	0.78517	Flavodoxin-like fold (1);	0.104150	0.64402	D	0.000004	T	0.46983	0.1421	H	0.94847	3.59	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	T	0.60840	-0.7183	10	0.72032	D	0.01	-11.1227	18.3313	0.90270	0.0:0.0:1.0:0.0	.	139;173;177;211	B4DLR8;B4DNM7;B7ZAD1;P15559	.;.;.;NQO1_HUMAN	C	211;177;173;139	ENSP00000319788:R211C;ENSP00000368335:R177C;ENSP00000368334:R173C;ENSP00000398330:R139C	ENSP00000319788:R211C	R	-	1	0	NQO1	68302574	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.073000	0.76784	2.696000	0.92011	0.655000	0.94253	CGC		0.453	NQO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268956.2		
KARS	3735	broad.mit.edu	37	16	75669975	75669975	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:75669975T>A	ENST00000302445.3	-	5	543	c.504A>T	c.(502-504)gaA>gaT	p.E168D	KARS_ENST00000319410.5_Missense_Mutation_p.E196D|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	168					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)	p.E168D(1)		kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	TATGAATAAATTCTTCTTCTG	0.388																																					p.E196D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A588T	16						.						36.0	33.0	34.0					16																	75669975		2198	4300	6498	74227476	SO:0001583	missense	3735	exon6			AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.504A>T	16.37:g.75669975T>A	ENSP00000303043:p.Glu168Asp	Somatic		Capture	Illumina HiSeq	Phase_I	74227476	NM_001130089	A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Missense_Mutation	SNP	ENST00000302445.3	37	CCDS10923.1	.	.	.	.	.	.	.	.	.	.	T	10.79	1.448750	0.26074	.	.	ENSG00000065427	ENST00000319410;ENST00000302445	T;T	0.22336	1.96;1.96	6.17	3.93	0.45458	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.136356	0.64402	D	0.000004	T	0.10121	0.0248	N	0.11201	0.11	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.15983	-1.0418	10	0.13470	T	0.59	-26.4149	9.9951	0.41893	0.0:0.1379:0.0:0.8621	.	196;168	Q15046-2;Q15046	.;SYK_HUMAN	D	196;168	ENSP00000325448:E196D;ENSP00000303043:E168D	ENSP00000303043:E168D	E	-	3	2	KARS	74227476	0.995000	0.38212	1.000000	0.80357	0.978000	0.69477	0.223000	0.17719	0.558000	0.29135	-0.256000	0.11100	GAA		0.388	KARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269023.1	NM_005548	
USP10	9100	broad.mit.edu	37	16	84792373	84792373	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:84792373G>A	ENST00000219473.7	+	5	1357	c.1244G>A	c.(1243-1245)cGt>cAt	p.R415H	USP10_ENST00000570191.1_Missense_Mutation_p.R419H	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	415	USP.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R415H(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						TTGCAACCCCGTGGGCTGATC	0.478																																					p.R415H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1244A	16						.						164.0	158.0	160.0					16																	84792373		1953	4143	6096	83349874	SO:0001583	missense	9100	exon5			D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.1244G>A	16.37:g.84792373G>A	ENSP00000219473:p.Arg415His	Somatic		Capture	Illumina HiSeq	Phase_I	83349874	NM_005153	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Missense_Mutation	SNP	ENST00000219473.7	37	CCDS45537.1	.	.	.	.	.	.	.	.	.	.	G	35	5.450271	0.96205	.	.	ENSG00000103194	ENST00000219473	T	0.31510	1.49	5.48	5.48	0.80851	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.261183	0.38436	N	0.001697	T	0.57242	0.2040	M	0.70842	2.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.972;0.994	T	0.59043	-0.7528	10	0.87932	D	0	-16.4517	18.7115	0.91658	0.0:0.0:1.0:0.0	.	419;415	Q14694-3;Q14694	.;UBP10_HUMAN	H	415	ENSP00000219473:R415H	ENSP00000219473:R415H	R	+	2	0	USP10	83349874	1.000000	0.71417	0.942000	0.38095	0.991000	0.79684	9.277000	0.95755	2.729000	0.93468	0.650000	0.86243	CGT		0.478	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1		
CNTNAP4	85445	broad.mit.edu	37	16	76572081	76572081	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:76572081delA	ENST00000476707.1	+	18	3212	c.3073delA	c.(3073-3075)aaafs	p.K1025fs	CNTNAP4_ENST00000377504.4_Frame_Shift_Del_p.K973fs|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Frame_Shift_Del_p.K949fs|CNTNAP4_ENST00000307431.8_Frame_Shift_Del_p.K1021fs			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1022					cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.N1022fs*13(1)|p.N950fs*13(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TCTTTTAAGTAAAAACTCCAG	0.328																																					p.V1021fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.3063delA	16						.						37.0	36.0	36.0					16																	76572081		1811	4074	5885	75129582	SO:0001589	frameshift_variant	85445	exon19			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3073delA	16.37:g.76572081delA	ENSP00000417628:p.Lys1025fs	Somatic		Capture	Illumina HiSeq	Phase_I	75129582	NM_033401	E9PFZ6|Q86YZ7	Frame_Shift_Del	DEL	ENST00000476707.1	37																																																																																					0.328	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
FOXL1	2300	broad.mit.edu	37	16	86612596	86612596	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr16:86612596C>A	ENST00000320241.3	+	1	482	c.267C>A	c.(265-267)aaC>aaA	p.N89K		NM_005250.2	NP_005241.1	Q12952	FOXL1_HUMAN	forkhead box L1	89					heart development (GO:0007507)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|Peyer's patch morphogenesis (GO:0061146)|proteoglycan biosynthetic process (GO:0030166)|regulation of Wnt signaling pathway (GO:0030111)|transcription, DNA-templated (GO:0006351)|visceral mesoderm-endoderm interaction involved in midgut development (GO:0007495)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N89K(5)		central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(2)|prostate(3)|skin(1)|urinary_tract(1)	15						ACCACGACAACCGGCAGGGCT	0.637																																					p.N89K	NSCLC(163;308 2020 10889 11476 18208)											.	.	5	Substitution - Missense(5)	endometrium(4)|large_intestine(1)	c.C267A	16						.						100.0	104.0	102.0					16																	86612596		2198	4300	6498	85170097	SO:0001583	missense	2300	exon1			AF315075	CCDS10959.1	16q24	2014-07-15			ENSG00000176678	ENSG00000176678		"""Forkhead boxes"""	3817	protein-coding gene	gene with protein product		603252		FKHL11		7957066	Standard	NM_005250		Approved	FREAC7, FKH6	uc002fjr.3	Q12952	OTTHUMG00000137653	ENST00000320241.3:c.267C>A	16.37:g.86612596C>A	ENSP00000326272:p.Asn89Lys	Somatic		Capture	Illumina HiSeq	Phase_I	85170097	NM_005250	Q17RR1|Q9H242	Missense_Mutation	SNP	ENST00000320241.3	37	CCDS10959.1	.	.	.	.	.	.	.	.	.	.	C	18.99	3.738877	0.69304	.	.	ENSG00000176678	ENST00000320241	D	0.95412	-3.7	4.02	2.05	0.26809	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.96122	0.8736	M	0.64170	1.965	0.51012	D	0.999901	D	0.62365	0.991	D	0.67548	0.952	D	0.94458	0.7673	10	0.56958	D	0.05	.	9.0799	0.36545	0.0:0.8168:0.0:0.1832	.	89	Q12952	FOXL1_HUMAN	K	89	ENSP00000326272:N89K	ENSP00000326272:N89K	N	+	3	2	FOXL1	85170097	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.995000	0.49441	0.358000	0.24211	0.491000	0.48974	AAC		0.637	FOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269105.2	NM_005250	
FAM101B	359845	broad.mit.edu	37	17	293240	293240	+	Silent	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr17:293240G>A	ENST00000329099.4	-	2	149	c.150C>T	c.(148-150)gaC>gaT	p.D50D		NM_182705.2	NP_874364.1	Q8N5W9	F101B_HUMAN	family with sequence similarity 101, member B	120					actin cytoskeleton organization (GO:0030036)|epithelial to mesenchymal transition (GO:0001837)	actin cytoskeleton (GO:0015629)	filamin binding (GO:0031005)	p.D50D(2)		breast(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)|urinary_tract(1)	13		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.0216)		GCTGCACGTCGTCGATGAAGT	0.657																																					p.R51X												.	.	2	Substitution - coding silent(2)	large_intestine(1)|breast(1)	c.C151T	17						.						62.0	69.0	66.0					17																	293240		2154	4253	6407	293468	SO:0001819	synonymous_variant	359845	exon2					17p13	2008-10-23			ENSG00000183688	ENSG00000183688			28705	protein-coding gene	gene with protein product		615928				12477932	Standard	NM_182705		Approved	MGC45871	uc002frj.3	Q8N5W9	OTTHUMG00000132483	ENST00000329099.4:c.150C>T	17.37:g.293240G>A		Somatic		Capture	Illumina HiSeq	Phase_I	293468	NM_182705		Silent	SNP	ENST00000329099.4	37																																																																																					0.657	FAM101B-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255652.1	NM_182705	
SPECC1	92521	broad.mit.edu	37	17	20109066	20109066	+	Silent	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr17:20109066C>T	ENST00000261503.5	+	4	1755	c.1704C>T	c.(1702-1704)gcC>gcT	p.A568A	AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395522.2_Silent_p.A487A|SPECC1_ENST00000395525.3_Silent_p.A487A|SPECC1_ENST00000395527.4_Silent_p.A568A|SPECC1_ENST00000395530.2_Silent_p.A487A|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000395529.3_Silent_p.A568A|SPECC1_ENST00000472876.1_Intron	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	568					cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.A568A(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		CCACAGAGGCCAGTGCTGTGG	0.468																																					p.A487A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1461T	17						.						68.0	70.0	70.0					17																	20109066		2203	4300	6503	20049658	SO:0001819	synonymous_variant	92521	exon2			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.1704C>T	17.37:g.20109066C>T		Somatic		Capture	Illumina HiSeq	Phase_I	20049658	NM_001033555	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Silent	SNP	ENST00000261503.5	37	CCDS32590.1																																																																																				0.468	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
PIP4K2B	8396	broad.mit.edu	37	17	36926702	36926702	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr17:36926702G>A	ENST00000269554.3	-	9	1637	c.1157C>T	c.(1156-1158)aCg>aTg	p.T386M		NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	386	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)	p.T386M(1)		endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						GTGTTTCACCGTTTTGGCAGC	0.557																																					p.T386M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1157T	17						.						250.0	219.0	230.0					17																	36926702		2203	4300	6503	34180228	SO:0001583	missense	8396	exon9			U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.1157C>T	17.37:g.36926702G>A	ENSP00000269554:p.Thr386Met	Somatic		Capture	Illumina HiSeq	Phase_I	34180228	NM_003559	Q5U0E8|Q8TBP2	Missense_Mutation	SNP	ENST00000269554.3	37	CCDS11329.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.615802	0.87359	.	.	ENSG00000141720	ENST00000269554	T	0.36520	1.25	5.11	5.11	0.69529	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.106321	0.64402	D	0.000005	T	0.70081	0.3183	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.78326	-0.2247	10	0.66056	D	0.02	-11.8091	17.3318	0.87267	0.0:0.0:1.0:0.0	.	386	P78356	PI42B_HUMAN	M	386	ENSP00000269554:T386M	ENSP00000269554:T386M	T	-	2	0	PIP4K2B	34180228	1.000000	0.71417	0.879000	0.34478	0.923000	0.55619	9.225000	0.95219	2.660000	0.90430	0.650000	0.86243	ACG		0.557	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256791.1	NM_003559	
MED1	5469	broad.mit.edu	37	17	37566882	37566882	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr17:37566882G>A	ENST00000394287.3	-	17	1797	c.1592C>T	c.(1591-1593)aCa>aTa	p.T531I	MED1_ENST00000300651.6_Missense_Mutation_p.T531I			O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.T531I(2)		NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GTCTTCAACTGTCTCTGCAAT	0.527										HNSCC(31;0.082)																											p.T531I	Pancreas(21;279 768 2492 4877 24026)											.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.C1592T	17						.						100.0	94.0	96.0					17																	37566882		2203	4300	6503	34820408	SO:0001583	missense	5469	exon17			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.1592C>T	17.37:g.37566882G>A	ENSP00000377828:p.Thr531Ile	Somatic		Capture	Illumina HiSeq	Phase_I	34820408	NM_004774	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000394287.3	37		.	.	.	.	.	.	.	.	.	.	G	17.64	3.439744	0.63067	.	.	ENSG00000125686	ENST00000394287;ENST00000300651	T;T	0.51817	0.69;0.69	5.8	5.8	0.92144	.	.	.	.	.	T	0.59074	0.2167	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.80764	0.987;0.994	T	0.58031	-0.7708	9	0.46703	T	0.11	-8.7094	20.0505	0.97625	0.0:0.0:1.0:0.0	.	531;531	Q15648;Q15648-3	MED1_HUMAN;.	I	531	ENSP00000377828:T531I;ENSP00000300651:T531I	ENSP00000300651:T531I	T	-	2	0	MED1	34820408	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.434000	0.97515	2.739000	0.93911	0.561000	0.74099	ACA		0.527	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000256944.1	NM_004774	
KRT25	147183	broad.mit.edu	37	17	38906790	38906790	+	Silent	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr17:38906790C>T	ENST00000312150.4	-	6	1077	c.1017G>A	c.(1015-1017)gcG>gcA	p.A339A		NM_181534.3	NP_853512.1			keratin 25									p.A339A(2)		endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				CCTGGATCTGCGCCAGCTGCG	0.562																																					p.A339A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)	c.G1017A	17						.						139.0	141.0	140.0					17																	38906790		2203	4300	6503	36160316	SO:0001819	synonymous_variant	147183	exon6			AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.1017G>A	17.37:g.38906790C>T		Somatic		Capture	Illumina HiSeq	Phase_I	36160316	NM_181534		Silent	SNP	ENST00000312150.4	37	CCDS11373.1																																																																																				0.562	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257218.1	NM_181534	
SPHK1	8877	broad.mit.edu	37	17	74382947	74382947	+	Silent	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr17:74382947G>A	ENST00000545180.1	+	8	1244	c.435G>A	c.(433-435)cgG>cgA	p.R145R	SPHK1_ENST00000590959.1_Silent_p.R159R|SPHK1_ENST00000392496.3_Silent_p.R145R|SPHK1_ENST00000323374.4_Silent_p.R231R|SPHK1_ENST00000592299.1_Silent_p.R145R			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	145	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)	p.R231R(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	TGTGCCGCCGGCTGCTGTCAC	0.597																																					p.R159R	GBM(90;966 1307 27369 33775 44498)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G477A	17						.						79.0	78.0	78.0					17																	74382947		2203	4300	6503	71894542	SO:0001819	synonymous_variant	8877	exon6			BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.435G>A	17.37:g.74382947G>A		Somatic		Capture	Illumina HiSeq	Phase_I	71894542	NM_021972	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Silent	SNP	ENST00000545180.1	37	CCDS45785.1																																																																																				0.597	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972	
ZBTB7C	201501	broad.mit.edu	37	18	45567019	45567019	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr18:45567019C>T	ENST00000588982.1	-	3	961	c.460G>A	c.(460-462)Gaa>Aaa	p.E154K	ZBTB7C_ENST00000590800.1_Missense_Mutation_p.E154K|ZBTB7C_ENST00000586438.1_Missense_Mutation_p.E154K|ZBTB7C_ENST00000535628.2_Missense_Mutation_p.E154K|ZBTB7C_ENST00000332053.2_Missense_Mutation_p.E154K			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	154	Asp-rich.|Glu-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.E154K(1)		endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						tcctcctcttcgtcctcctca	0.577																																					p.E154K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G460A	18						.						152.0	116.0	128.0					18																	45567019		2203	4300	6503	43821017	SO:0001583	missense	201501	exon2			Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.460G>A	18.37:g.45567019C>T	ENSP00000468782:p.Glu154Lys	Somatic		Capture	Illumina HiSeq	Phase_I	43821017	NM_001039360	O73453	Missense_Mutation	SNP	ENST00000588982.1	37	CCDS32830.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869146	0.51588	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	T;T	0.08370	3.1;3.1	5.27	5.27	0.74061	.	0.736834	0.11988	N	0.510099	T	0.11281	0.0275	N	0.14661	0.345	0.46499	D	0.999078	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.58130	0.768;0.833;0.768	T	0.14172	-1.0482	10	0.06625	T	0.88	.	16.6523	0.85219	0.0:1.0:0.0:0.0	.	154;154;154	B4DKU0;B2RG49;A1YPR0	.;.;ZBT7C_HUMAN	K	154	ENSP00000439781:E154K;ENSP00000328732:E154K	ENSP00000328732:E154K	E	-	1	0	ZBTB7C	43821017	1.000000	0.71417	0.487000	0.27428	0.079000	0.17450	5.211000	0.65219	2.454000	0.82982	0.561000	0.74099	GAA		0.577	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
PTPRM	5797	broad.mit.edu	37	18	8085801	8085801	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr18:8085801A>T	ENST00000332175.8	+	10	2721	c.1684A>T	c.(1684-1686)Acc>Tcc	p.T562S	PTPRM_ENST00000580170.1_Missense_Mutation_p.T562S|PTPRM_ENST00000400053.4_Missense_Mutation_p.T500S|PTPRM_ENST00000400060.4_Missense_Mutation_p.T562S|PTPRM_ENST00000444013.1_Missense_Mutation_p.T349S|PTPRM_ENST00000578571.1_3'UTR	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	562	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T562S(1)|p.T562A(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				ATACTCCTTTACCATCCGAGC	0.423																																					p.T562S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1684T	18						.						104.0	95.0	98.0					18																	8085801		2203	4299	6502	8075801	SO:0001583	missense	5797	exon10			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.1684A>T	18.37:g.8085801A>T	ENSP00000331418:p.Thr562Ser	Somatic		Capture	Illumina HiSeq	Phase_I	8075801	NM_002845	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	12.85	2.062665	0.36373	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	5.86	5.86	0.93980	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.048798	0.85682	N	0.000000	T	0.38904	0.1058	L	0.28400	0.85	0.54753	D	0.999989	B;B;B	0.30793	0.043;0.295;0.295	B;B;B	0.30105	0.067;0.111;0.111	T	0.28073	-1.0055	10	0.05833	T	0.94	.	16.2644	0.82568	1.0:0.0:0.0:0.0	.	349;562;562	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	S	562;562;500;349	ENSP00000331418:T562S;ENSP00000382933:T562S;ENSP00000382927:T500S;ENSP00000387608:T349S	ENSP00000331418:T562S	T	+	1	0	PTPRM	8075801	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.271000	0.78506	2.244000	0.73946	0.528000	0.53228	ACC		0.423	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
CDH20	28316	broad.mit.edu	37	18	59166554	59166554	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr18:59166554G>T	ENST00000262717.4	+	3	780	c.382G>T	c.(382-384)Gcc>Tcc	p.A128S	CDH20_ENST00000538374.1_Missense_Mutation_p.A128S|CDH20_ENST00000536675.2_Missense_Mutation_p.A128S			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	128	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A128S(1)		breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				AGAGGAAAGAGCCCAGTATAC	0.527																																					p.A128S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G382T	18						.						57.0	49.0	51.0					18																	59166554		2203	4300	6503	57317534	SO:0001583	missense	28316	exon2			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.382G>T	18.37:g.59166554G>T	ENSP00000262717:p.Ala128Ser	Somatic		Capture	Illumina HiSeq	Phase_I	57317534	NM_031891	Q495S3	Missense_Mutation	SNP	ENST00000262717.4	37	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.637111	0.29157	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.59638	0.25;0.25;0.25	5.82	3.88	0.44766	Cadherin (4);Cadherin-like (1);	0.238829	0.42420	N	0.000706	T	0.33323	0.0859	N	0.10733	0.035	0.41692	D	0.989358	B	0.02656	0.0	B	0.21708	0.036	T	0.10753	-1.0616	10	0.16896	T	0.51	.	9.0312	0.36260	0.0:0.1171:0.4404:0.4425	.	128	Q9HBT6	CAD20_HUMAN	S	128	ENSP00000444767:A128S;ENSP00000442226:A128S;ENSP00000262717:A128S	ENSP00000262717:A128S	A	+	1	0	CDH20	57317534	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.058000	0.49939	1.417000	0.47077	0.650000	0.86243	GCC		0.527	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
NWD1	284434	broad.mit.edu	37	19	16861197	16861197	+	Missense_Mutation	SNP	G	G	A	rs143795871		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr19:16861197G>A	ENST00000552788.1	+	4	1744	c.1744G>A	c.(1744-1746)Gtg>Atg	p.V582M	NWD1_ENST00000339803.6_Missense_Mutation_p.V447M|NWD1_ENST00000523826.1_Missense_Mutation_p.V376M|NWD1_ENST00000549814.1_Missense_Mutation_p.V582M|NWD1_ENST00000379808.3_Missense_Mutation_p.V582M|NWD1_ENST00000524140.2_Missense_Mutation_p.V582M			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	582	NACHT.						ATP binding (GO:0005524)	p.V447M(1)|p.V582M(1)		NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CGTGGCCCACGTGCTGGGCTA	0.512																																					p.V582M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1744A	19						.	G	MET/VAL	0,4406		0,0,2203	23.0	26.0	25.0		1744	4.0	0.8	19	dbSNP_134	25	1,8599	1.2+/-3.3	0,1,4299	no	missense	NWD1	NM_001007525.3	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	582/1433	16861197	1,13005	2203	4300	6503	16722197	SO:0001583	missense	284434	exon6			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.1744G>A	19.37:g.16861197G>A	ENSP00000447224:p.Val582Met	Somatic		Capture	Illumina HiSeq	Phase_I	16722197	NM_001007525	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	G	13.44	2.238250	0.39598	0.0	1.16E-4	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.58940	0.31;0.37;0.31;0.3;0.37;0.36	5.04	4.0	0.46444	.	0.140744	0.46758	N	0.000261	T	0.73560	0.3602	M	0.78049	2.395	0.33946	D	0.643824	P;P;D	0.89917	0.816;0.934;1.0	B;B;D	0.85130	0.092;0.255;0.997	T	0.80797	-0.1222	10	0.44086	T	0.13	-25.0999	11.2762	0.49168	0.091:0.0:0.909:0.0	.	582;582;447	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	M	447;582;582;582;376;582;447	ENSP00000428579:V582M;ENSP00000447548:V582M;ENSP00000369136:V582M;ENSP00000428955:V376M;ENSP00000447224:V582M;ENSP00000340159:V447M	ENSP00000340159:V447M	V	+	1	0	NWD1	16722197	1.000000	0.71417	0.794000	0.32065	0.079000	0.17450	3.818000	0.55678	1.120000	0.41904	-0.275000	0.10095	GTG		0.512	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
ZNF404	342908	broad.mit.edu	37	19	44377003	44377003	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr19:44377003T>A	ENST00000587539.1	-	3	1362	c.1363A>T	c.(1363-1365)Att>Ttt	p.I455F	ZNF404_ENST00000324394.6_Missense_Mutation_p.I453F	NM_001033719.2	NP_001028891.2	Q494X3	ZN404_HUMAN	zinc finger protein 404	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I453F(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|stomach(2)|urinary_tract(1)	17		Prostate(69;0.0352)				TGATGATAAATTAGTTGAGAA	0.358																																					p.I452F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1354T	19						.						39.0	41.0	40.0					19																	44377003		2151	4270	6421	49068843	SO:0001583	missense	342908	exon2			XM_092027	CCDS59394.1	19q13.31	2013-01-08				ENSG00000176222		"""Zinc fingers, C2H2-type"", ""-"""	19417	protein-coding gene	gene with protein product							Standard	NM_001033719		Approved		uc002oxs.5	Q494X3		ENST00000587539.1:c.1363A>T	19.37:g.44377003T>A	ENSP00000466051:p.Ile455Phe	Somatic		Capture	Illumina HiSeq	Phase_I	49068843	NM_001033719	A4FU30|K7ELF2	Missense_Mutation	SNP	ENST00000587539.1	37	CCDS59394.1	.	.	.	.	.	.	.	.	.	.	T	7.878	0.729567	0.15507	.	.	ENSG00000176222	ENST00000324394	T	0.07567	3.18	2.17	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10208	0.0250	L	0.41356	1.27	0.09310	N	1	P	0.47253	0.892	P	0.49301	0.606	T	0.21827	-1.0234	9	0.52906	T	0.07	.	4.9652	0.14087	0.0:0.3003:0.0:0.6997	.	455	Q494X3	ZN404_HUMAN	F	453	ENSP00000319479:I453F	ENSP00000319479:I453F	I	-	1	0	ZNF404	49068843	0.000000	0.05858	0.714000	0.30535	0.942000	0.58702	-0.250000	0.08830	0.105000	0.17753	0.332000	0.21555	ATT		0.358	ZNF404-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460019.1	NM_001033719	
TMEM143	55260	broad.mit.edu	37	19	48866635	48866635	+	Silent	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr19:48866635G>A	ENST00000293261.3	-	2	493	c.177C>T	c.(175-177)aaC>aaT	p.N59N	TMEM143_ENST00000436660.2_Silent_p.N59N|TMEM143_ENST00000435956.3_Silent_p.N59N|SYNGR4_ENST00000344846.2_5'Flank|TMEM143_ENST00000598012.1_5'UTR|TMEM143_ENST00000377431.2_Silent_p.N59N|TMEM143_ENST00000541566.1_Intron	NM_018273.2	NP_060743.2	Q96AN5	TM143_HUMAN	transmembrane protein 143	59					hematopoietic progenitor cell differentiation (GO:0002244)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.N59N(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	14		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		GCTCCCTGGGGTTCCACATCT	0.662																																					p.N59N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C177T	19						.						35.0	42.0	40.0					19																	48866635		2203	4298	6501	53558447	SO:0001819	synonymous_variant	55260	exon2			AK129801	CCDS12716.1	19q13.32	2008-02-05				ENSG00000161558			25603	protein-coding gene	gene with protein product						12975309	Standard	NM_018273		Approved	FLJ10922	uc002pix.1	Q96AN5		ENST00000293261.3:c.177C>T	19.37:g.48866635G>A		Somatic		Capture	Illumina HiSeq	Phase_I	53558447	NM_018273	A8K656|Q6UXY4|Q9NV49	Silent	SNP	ENST00000293261.3	37	CCDS12716.1																																																																																				0.662	TMEM143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465622.1	NM_018273	
ZFP28	140612	broad.mit.edu	37	19	57065075	57065075	+	Silent	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr19:57065075C>T	ENST00000301318.3	+	8	992	c.921C>T	c.(919-921)acC>acT	p.T307T	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	307					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T307T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		TACATGAGACCCAGGAATTAT	0.388																																					p.T307T	Ovarian(124;554 1662 19430 21141 52494)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C921T	19						.						65.0	61.0	63.0					19																	57065075		2203	4300	6503	61756887	SO:0001819	synonymous_variant	140612	exon8				CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.921C>T	19.37:g.57065075C>T		Somatic		Capture	Illumina HiSeq	Phase_I	61756887	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Silent	SNP	ENST00000301318.3	37	CCDS12946.1																																																																																				0.388	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
PRAMEF4	400735	broad.mit.edu	37	1	12941807	12941807	+	Missense_Mutation	SNP	C	C	T	rs562920609		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:12941807C>T	ENST00000235349.5	-	3	813	c.743G>A	c.(742-744)cGc>cAc	p.R248H		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	248					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.R248H(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGAAACGTAGCGAGAGACATC	0.483																																					p.R248H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G743A	1						.						252.0	302.0	284.0					1																	12941807		1442	2515	3957	12864394	SO:0001583	missense	400735	exon3				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.743G>A	1.37:g.12941807C>T	ENSP00000235349:p.Arg248His	Somatic		Capture	Illumina HiSeq	Phase_I	12864394	NM_001009611	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	c	0.006	-2.056274	0.00390	.	.	ENSG00000243073	ENST00000235349	T	0.50548	0.74	1.02	-2.03	0.07365	.	1.275850	0.05537	N	0.565066	T	0.18257	0.0438	N	0.03050	-0.425	0.09310	N	1	B	0.17268	0.021	B	0.16722	0.016	T	0.04242	-1.0966	10	0.15066	T	0.55	.	0.456	0.00509	0.196:0.2286:0.3292:0.2461	.	248	O60810	PRAM4_HUMAN	H	248	ENSP00000235349:R248H	ENSP00000235349:R248H	R	-	2	0	PRAMEF4	12864394	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.376000	0.02561	-2.157000	0.00789	-1.441000	0.01070	CGC		0.483	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
MRPL9	65005	broad.mit.edu	37	1	151735603	151735603	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:151735603C>T	ENST00000368830.3	-	2	257	c.173G>A	c.(172-174)cGc>cAc	p.R58H	MRPL9_ENST00000467306.1_5'UTR|RP11-98D18.2_ENST00000420382.1_RNA|MRPL9_ENST00000368829.3_Missense_Mutation_p.R58H|OAZ3_ENST00000479764.1_5'Flank|OAZ3_ENST00000321531.5_5'UTR|OAZ3_ENST00000315067.8_5'UTR|OAZ3_ENST00000453029.2_5'Flank|RP11-98D18.3_ENST00000512280.1_RNA	NM_031420.2	NP_113608.1	Q9BYD2	RM09_HUMAN	mitochondrial ribosomal protein L9	58					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.R58H(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTTCCACCAGCGCTCCACGAT	0.667																																					p.R58H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G173A	1						.						28.0	31.0	30.0					1																	151735603		2203	4299	6502	150002227	SO:0001583	missense	65005	exon2			AK026363	CCDS1003.1, CCDS72916.1	1q21	2012-09-13			ENSG00000143436	ENSG00000143436		"""Mitochondrial ribosomal proteins / large subunits"""	14277	protein-coding gene	gene with protein product		611824					Standard	XM_005245455		Approved		uc001eyv.3	Q9BYD2	OTTHUMG00000013063	ENST00000368830.3:c.173G>A	1.37:g.151735603C>T	ENSP00000357823:p.Arg58His	Somatic		Capture	Illumina HiSeq	Phase_I	150002227	NM_031420	B2RD99|Q5SZR2|Q9BSW8	Missense_Mutation	SNP	ENST00000368830.3	37	CCDS1003.1	.	.	.	.	.	.	.	.	.	.	C	36	5.678530	0.96764	.	.	ENSG00000143436	ENST00000368830;ENST00000368829	T;T	0.53206	0.63;0.8	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.59101	0.2169	M	0.66939	2.045	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.63125	-0.6707	10	0.87932	D	0	-6.5342	13.3491	0.60591	0.0:1.0:0.0:0.0	.	58;58;58	B4DDZ7;B4DUJ1;Q9BYD2	.;.;RM09_HUMAN	H	58	ENSP00000357823:R58H;ENSP00000357822:R58H	ENSP00000357822:R58H	R	-	2	0	MRPL9	150002227	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.129000	0.71657	2.518000	0.84900	0.655000	0.94253	CGC		0.667	MRPL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036653.2	NM_031420	
ASH1L	55870	broad.mit.edu	37	1	155316231	155316231	+	Silent	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:155316231C>A	ENST00000368346.3	-	21	8487	c.7848G>T	c.(7846-7848)gtG>gtT	p.V2616V	MIR555_ENST00000384987.1_RNA|ASH1L_ENST00000392403.3_Silent_p.V2611V			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2616					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.V2611V(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CATCTGAGTTCACTCCCATAC	0.468																																					p.V2611V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G7833T	1						.						169.0	142.0	151.0					1																	155316231		2203	4300	6503	153582855	SO:0001819	synonymous_variant	55870	exon21			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.7848G>T	1.37:g.155316231C>A		Somatic		Capture	Illumina HiSeq	Phase_I	153582855	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	ENST00000368346.3	37																																																																																					0.468	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
TAS1R2	80834	broad.mit.edu	37	1	19180923	19180923	+	Silent	SNP	C	C	T	rs377629361		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:19180923C>T	ENST00000375371.3	-	3	1062	c.1041G>A	c.(1039-1041)ccG>ccA	p.P347P	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	347					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.P347P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TGAGGGGTGGCGGCCCAGCCT	0.637																																					p.P347P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1041A	1						.						75.0	72.0	73.0					1																	19180923		2203	4300	6503	19053510	SO:0001819	synonymous_variant	80834	exon3				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1041G>A	1.37:g.19180923C>T		Somatic		Capture	Illumina HiSeq	Phase_I	19053510	NM_152232	Q5TZ19	Silent	SNP	ENST00000375371.3	37	CCDS187.1																																																																																				0.637	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
TOR1AIP1	26092	broad.mit.edu	37	1	179887310	179887310	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:179887310G>A	ENST00000606911.2	+	10	1879	c.1688G>A	c.(1687-1689)cGt>cAt	p.R563H	TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.R442H|TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.R564H|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.R579H			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	563	Interaction with TOR1A.				positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)	p.R563H(1)		breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						CTCTGGAGCCGTATTTCTCAC	0.413																																					p.R563H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1688A	1						.						57.0	60.0	59.0					1																	179887310		2203	4300	6503	178153933	SO:0001583	missense	26092	exon10				CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.1688G>A	1.37:g.179887310G>A	ENSP00000476687:p.Arg563His	Somatic		Capture	Illumina HiSeq	Phase_I	178153933	NM_015602	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	ENST00000606911.2	37	CCDS1335.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950747	0.92660	.	.	ENSG00000143337	ENST00000325993;ENST00000271583;ENST00000435319	T;T	0.37584	1.19;1.19	5.96	5.05	0.67936	.	0.052402	0.64402	N	0.000001	T	0.58018	0.2093	M	0.81497	2.545	0.58432	D	0.999992	D	0.69078	0.997	P	0.59889	0.865	T	0.63175	-0.6696	9	.	.	.	-4.4773	14.9501	0.71067	0.0689:0.0:0.9311:0.0	.	563	Q5JTV8	TOIP1_HUMAN	H	358;579;563	ENSP00000271583:R579H;ENSP00000393292:R563H	.	R	+	2	0	TOR1AIP1	178153933	1.000000	0.71417	0.884000	0.34674	0.978000	0.69477	9.091000	0.94151	1.536000	0.49237	0.655000	0.94253	CGT		0.413	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000100313.4	NM_015602	
TRIM67	440730	broad.mit.edu	37	1	231342460	231342460	+	Silent	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:231342460C>T	ENST00000366653.5	+	7	1743	c.1743C>T	c.(1741-1743)taC>taT	p.Y581Y	TRIM67_ENST00000449018.3_Silent_p.Y519Y|TRIM67_ENST00000444294.3_Silent_p.Y579Y|TRIM67_ENST00000366652.2_Silent_p.Y581Y			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	581	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)	p.Y581Y(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				ACAGCACCTACAACGCCCGAG	0.517																																					p.Y581Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1743T	1						.						79.0	86.0	83.0					1																	231342460		2069	4223	6292	229409083	SO:0001819	synonymous_variant	440730	exon7			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1743C>T	1.37:g.231342460C>T		Somatic		Capture	Illumina HiSeq	Phase_I	229409083	NM_001004342	Q5TER7|Q5TER8|Q7Z4K7	Silent	SNP	ENST00000366653.5	37	CCDS44333.1																																																																																				0.517	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	NM_001004342	
BAI2	576	broad.mit.edu	37	1	32196453	32196453	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:32196453C>T	ENST00000373658.3	-	29	4669	c.4328G>A	c.(4327-4329)cGg>cAg	p.R1443Q	BAI2_ENST00000440175.2_Missense_Mutation_p.R1052Q|BAI2_ENST00000527361.1_Missense_Mutation_p.R1410Q|BAI2_ENST00000373655.2_Missense_Mutation_p.R1443Q|BAI2_ENST00000398538.1_Missense_Mutation_p.R1431Q|BAI2_ENST00000257070.4_Missense_Mutation_p.R1410Q|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000398547.1_Missense_Mutation_p.R1376Q|BAI2_ENST00000398556.3_Missense_Mutation_p.R1358Q|BAI2_ENST00000398542.1_Missense_Mutation_p.R1343Q	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1443					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R1443Q(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		AGGCATGGTCCGGCTGCGCTC	0.632																																					p.R1443Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4328A	1						.						40.0	51.0	47.0					1																	32196453		2202	4299	6501	31969040	SO:0001583	missense	576	exon29			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.4328G>A	1.37:g.32196453C>T	ENSP00000362762:p.Arg1443Gln	Somatic		Capture	Illumina HiSeq	Phase_I	31969040	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	C	26.3	4.729029	0.89390	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.47528	1.52;1.76;0.92;0.92;1.89;0.84;0.84;1.55;0.95	5.74	5.74	0.90152	.	0.000000	0.39274	N	0.001419	T	0.61763	0.2373	L	0.48642	1.525	0.51767	D	0.999934	D;D;D;D;D;D;D	0.89917	0.996;0.996;0.999;1.0;0.996;0.994;1.0	P;P;P;D;P;P;D	0.63957	0.883;0.77;0.743;0.92;0.883;0.594;0.92	T	0.52902	-0.8513	10	0.31617	T	0.26	.	19.9066	0.97010	0.0:1.0:0.0:0.0	.	1410;1431;1052;1358;1443;1443;1431	O60241-4;O60241-3;B4DKC3;A2A3C6;O60241-2;O60241;A2A3C2	.;.;.;.;.;BAI2_HUMAN;.	Q	1358;1376;1443;1443;1343;1410;1410;1052;1431	ENSP00000381564:R1358Q;ENSP00000381555:R1376Q;ENSP00000362762:R1443Q;ENSP00000362759:R1443Q;ENSP00000381550:R1343Q;ENSP00000257070:R1410Q;ENSP00000435397:R1410Q;ENSP00000391071:R1052Q;ENSP00000381548:R1431Q	ENSP00000257070:R1410Q	R	-	2	0	BAI2	31969040	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.447000	0.60020	2.884000	0.98904	0.655000	0.94253	CGG		0.632	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
ZSCAN20	7579	broad.mit.edu	37	1	33960301	33960301	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:33960301G>T	ENST00000361328.3	+	8	2510	c.2357G>T	c.(2356-2358)aGa>aTa	p.R786I		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	786					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R786I(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				ACTCACCAGAGAATTCACACG	0.438																																					p.R786I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2357T	1						.						77.0	81.0	80.0					1																	33960301		2076	4248	6324	33732888	SO:0001583	missense	7579	exon8			X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.2357G>T	1.37:g.33960301G>T	ENSP00000355053:p.Arg786Ile	Somatic		Capture	Illumina HiSeq	Phase_I	33732888	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	ENST00000361328.3	37	CCDS41300.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143586	0.57044	.	.	ENSG00000121903	ENST00000326544;ENST00000361328;ENST00000401072	.	.	.	5.9	4.98	0.66077	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000006	T	0.74718	0.3753	M	0.62723	1.935	0.50467	D	0.99987	D;D	0.76494	0.999;0.996	D;P	0.67382	0.951;0.882	T	0.77574	-0.2537	9	0.87932	D	0	-12.6913	13.1341	0.59399	0.0781:0.0:0.9219:0.0	.	785;786	P17040-3;P17040	.;ZSC20_HUMAN	I	786;720;720	.	ENSP00000324450:R786I	R	+	2	0	ZSCAN20	33732888	0.717000	0.27966	0.986000	0.45419	0.970000	0.65996	3.804000	0.55568	1.469000	0.48083	0.561000	0.74099	AGA		0.438	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
GRIK3	2899	broad.mit.edu	37	1	37267511	37267511	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:37267511G>A	ENST00000373091.3	-	16	2717	c.2701C>T	c.(2701-2703)Cgg>Tgg	p.R901W		NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	901					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.R901W(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CCGGGAAGCCGGCGGTCATTG	0.612																																					p.R901W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2701T	1						.						107.0	86.0	93.0					1																	37267511		2203	4300	6503	37040098	SO:0001583	missense	2899	exon16			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2701C>T	1.37:g.37267511G>A	ENSP00000362183:p.Arg901Trp	Somatic		Capture	Illumina HiSeq	Phase_I	37040098	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.784148	0.70222	.	.	ENSG00000163873	ENST00000373091	T	0.13089	2.62	5.86	2.64	0.31445	.	0.000000	0.64402	D	0.000003	T	0.28532	0.0706	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	D	0.66602	0.945	T	0.01549	-1.1327	10	0.87932	D	0	.	9.0272	0.36236	0.0771:0.0:0.5106:0.4123	.	901	Q13003	GRIK3_HUMAN	W	901	ENSP00000362183:R901W	ENSP00000362183:R901W	R	-	1	2	GRIK3	37040098	0.912000	0.30974	1.000000	0.80357	0.998000	0.95712	1.063000	0.30567	0.766000	0.33244	0.643000	0.83706	CGG		0.612	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
USP33	23032	broad.mit.edu	37	1	78201825	78201825	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:78201825T>C	ENST00000370793.1	-	7	809	c.463A>G	c.(463-465)Aat>Gat	p.N155D	USP33_ENST00000357428.1_Missense_Mutation_p.N155D|USP33_ENST00000370792.3_Missense_Mutation_p.N155D|USP33_ENST00000370794.3_Missense_Mutation_p.N124D	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	155					axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.N155D(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						AATGTTGTATTACTGGGTATT	0.303																																					p.N155D	Melanoma(152;72 1870 11110 26780 42647)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A463G	1						.						87.0	88.0	87.0					1																	78201825		2203	4300	6503	77974413	SO:0001583	missense	23032	exon7			AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.463A>G	1.37:g.78201825T>C	ENSP00000359829:p.Asn155Asp	Somatic		Capture	Illumina HiSeq	Phase_I	77974413	NM_015017	Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	ENST00000370793.1	37	CCDS678.1	.	.	.	.	.	.	.	.	.	.	T	14.43	2.533193	0.45073	.	.	ENSG00000077254	ENST00000370794;ENST00000370793;ENST00000357428;ENST00000370792;ENST00000524536	T;T;T;T;T	0.34472	2.78;2.77;2.77;2.77;1.36	5.17	3.97	0.46021	.	0.746330	0.12597	N	0.455065	T	0.13457	0.0326	N	0.22421	0.69	0.32242	N	0.572584	B;B	0.28291	0.206;0.001	B;B	0.31614	0.133;0.004	T	0.10382	-1.0632	10	0.31617	T	0.26	.	12.6462	0.56735	0.0:0.0:0.1371:0.8629	.	155;155	Q8TEY7-3;Q8TEY7	.;UBP33_HUMAN	D	124;155;155;155;155	ENSP00000359830:N124D;ENSP00000359829:N155D;ENSP00000350009:N155D;ENSP00000359828:N155D;ENSP00000434441:N155D	ENSP00000350009:N155D	N	-	1	0	USP33	77974413	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	4.173000	0.58249	2.092000	0.63282	0.402000	0.26972	AAT		0.303	USP33-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026923.2	NM_015017	
SH3GLB1	51100	broad.mit.edu	37	1	87207968	87207968	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:87207968G>A	ENST00000370558.4	+	8	1163	c.839G>A	c.(838-840)gGt>gAt	p.G280D	SH3GLB1_ENST00000535010.1_Missense_Mutation_p.G180D|SH3GLB1_ENST00000482504.1_Missense_Mutation_p.G301D	NM_001206651.1|NM_001206653.1|NM_016009.4	NP_001193580.1|NP_001193582.1|NP_057093.1	Q9Y371	SHLB1_HUMAN	SH3-domain GRB2-like endophilin B1	280					'de novo' posttranslational protein folding (GO:0051084)|apoptotic process (GO:0006915)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	fatty acid binding (GO:0005504)|identical protein binding (GO:0042802)|lysophosphatidic acid acyltransferase activity (GO:0042171)|protein homodimerization activity (GO:0042803)	p.G280D(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|stomach(1)	11		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		AATGCGATTGGTTCTTCTGCC	0.443																																					p.G280D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G839A	1						.						157.0	135.0	142.0					1																	87207968		2203	4300	6503	86980556	SO:0001583	missense	51100	exon8			AF263293	CCDS710.1, CCDS55612.1, CCDS55613.1, CCDS72819.1	1p22.3	2012-04-17	2001-12-04		ENSG00000097033	ENSG00000097033		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	10833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 70"""	609287	"""SH3-domain, GRB2-like, endophilin B1"""			11161816, 11259440	Standard	NM_016009		Approved	CGI-61, KIAA0491, Bif-1, PPP1R70	uc001dly.3	Q9Y371	OTTHUMG00000010257	ENST00000370558.4:c.839G>A	1.37:g.87207968G>A	ENSP00000473267:p.Gly280Asp	Somatic		Capture	Illumina HiSeq	Phase_I	86980556	NM_016009	B4E182|Q5H8U5|Q9H3Z0|Q9NR47|Q9NYA9	Missense_Mutation	SNP	ENST00000370558.4	37	CCDS710.1	.	.	.	.	.	.	.	.	.	.	G	9.764	1.170867	0.21621	.	.	ENSG00000097033	ENST00000212369;ENST00000535010;ENST00000482504	T;T	0.31247	1.51;1.5	5.83	0.15	0.14883	Src homology-3 domain (1);	0.406223	0.28803	N	0.014083	T	0.04048	0.0113	N	0.08118	0	0.27443	N	0.95367	B;B;B	0.32071	0.242;0.355;0.136	B;B;B	0.32980	0.054;0.156;0.042	T	0.45086	-0.9285	10	0.12766	T	0.61	0.1624	8.514	0.33235	0.0:0.2684:0.2468:0.4848	.	180;301;280	B4E182;Q9Y371-2;Q9Y371	.;.;SHLB1_HUMAN	D	280;180;301	ENSP00000441355:G180D;ENSP00000418744:G301D	ENSP00000212369:G280D	G	+	2	0	SH3GLB1	86980556	0.999000	0.42202	0.954000	0.39281	0.607000	0.37147	1.573000	0.36472	0.055000	0.16094	-0.319000	0.08680	GGT		0.443	SH3GLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028287.2	NM_016009	
GBP1	2633	broad.mit.edu	37	1	89522645	89522645	+	Silent	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:89522645G>T	ENST00000370473.4	-	7	1266	c.1047C>A	c.(1045-1047)acC>acA	p.T349T	GBP1_ENST00000484970.1_5'Flank	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	349			T -> S (in dbSNP:rs1048425). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:1715024, ECO:0000269|Ref.2}.		cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.T349T(1)		endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		GCTCCTGGAGGGTTTCTGTGG	0.527																																					p.T349T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1047A	1						.						96.0	93.0	94.0					1																	89522645		2203	4300	6503	89295233	SO:0001819	synonymous_variant	2633	exon7			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.1047C>A	1.37:g.89522645G>T		Somatic		Capture	Illumina HiSeq	Phase_I	89295233	NM_002053	D3DT26|Q5T8M1	Silent	SNP	ENST00000370473.4	37	CCDS718.1																																																																																				0.527	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029289.3	NM_002053	
LRRC8D	55144	broad.mit.edu	37	1	90400034	90400034	+	Silent	SNP	G	G	A	rs371125847		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:90400034G>A	ENST00000337338.5	+	3	1814	c.1407G>A	c.(1405-1407)caG>caA	p.Q469Q	LRRC8D_ENST00000394593.3_Silent_p.Q469Q	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	469					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.Q469Q(1)|p.Q469H(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		GCAACGCCCAGGACAAGCAGG	0.453																																					p.Q469Q												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.G1407A	1						.	G	,	0,4406		0,0,2203	55.0	55.0	55.0		1407,1407	1.8	1.0	1		55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	LRRC8D	NM_001134479.1,NM_018103.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	469/859,469/859	90400034	1,13005	2203	4300	6503	90172622	SO:0001819	synonymous_variant	55144	exon3			AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.1407G>A	1.37:g.90400034G>A		Somatic		Capture	Illumina HiSeq	Phase_I	90172622	NM_001134479	D3DT29|Q6UWB2|Q9NVW3	Silent	SNP	ENST00000337338.5	37	CCDS726.1																																																																																				0.453	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
OR2G6	391211	broad.mit.edu	37	1	248685401	248685401	+	Missense_Mutation	SNP	G	G	A	rs80333026	byFrequency	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr1:248685401G>A	ENST00000343414.4	+	1	486	c.454G>A	c.(454-456)Ggc>Agc	p.G152S		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G152S(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATGGCTCAGCGGCCTCATCAC	0.577													.|||	58	0.0115815	0.0257	0.0029	5008	,	,		19403	0.001		0.0	False		,,,				2504	0.0215				p.G152S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G454A	1						.	G	SER/GLY	86,4320		1,84,2118	77.0	60.0	66.0		454	2.5	0.2	1	dbSNP_131	66	1,8599		0,1,4299	yes	missense	OR2G6	NM_001013355.1	56	1,85,6417	AA,AG,GG		0.0116,1.9519,0.6689	probably-damaging	152/317	248685401	87,12919	2203	4300	6503	246752024	SO:0001583	missense	391211	exon1				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.454G>A	1.37:g.248685401G>A	ENSP00000341291:p.Gly152Ser	Somatic		Capture	Illumina HiSeq	Phase_I	246752024	NM_001013355	B2RP33	Missense_Mutation	SNP	ENST00000343414.4	37	CCDS31119.1	9	0.004120879120879121	7	0.014227642276422764	2	0.0055248618784530384	0	0.0	0	0.0	N	10.29	1.309313	0.23821	0.019519	1.16E-4	ENSG00000188558	ENST00000343414	T	0.32988	1.43	3.46	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42053	U	0.000776	T	0.28433	0.0703	L	0.57536	1.79	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.02411	-1.1163	10	0.59425	D	0.04	.	6.3004	0.21109	0.1115:0.1874:0.7011:0.0	.	152	Q5TZ20	OR2G6_HUMAN	S	152	ENSP00000341291:G152S	ENSP00000341291:G152S	G	+	1	0	OR2G6	246752024	0.130000	0.22417	0.188000	0.23233	0.063000	0.16089	1.545000	0.36169	1.747000	0.51819	0.400000	0.26472	GGC		0.577	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842	
GZF1	64412	broad.mit.edu	37	20	23346300	23346300	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr20:23346300G>A	ENST00000338121.5	+	2	1357	c.1280G>A	c.(1279-1281)cGc>cAc	p.R427H	GZF1_ENST00000377051.2_Missense_Mutation_p.R427H|GZF1_ENST00000544236.1_Intron|GZF1_ENST00000542987.1_Intron|GZF1_ENST00000461789.1_3'UTR			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	427					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)	p.R427H(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					CTGCACGAGCGCACACACACG	0.716																																					p.R427H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1280A	20						.						25.0	25.0	25.0					20																	23346300		2200	4286	6486	23294300	SO:0001583	missense	64412	exon1			AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.1280G>A	20.37:g.23346300G>A	ENSP00000338290:p.Arg427His	Somatic		Capture	Illumina HiSeq	Phase_I	23294300	NM_022482	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	ENST00000338121.5	37	CCDS13151.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279856	0.59758	.	.	ENSG00000125812	ENST00000338121;ENST00000377051	T;T	0.25749	1.78;1.78	4.58	3.64	0.41730	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000027	T	0.49915	0.1585	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.54715	-0.8252	10	0.87932	D	0	.	11.7688	0.51945	0.085:0.0:0.915:0.0	.	427	Q9H116	GZF1_HUMAN	H	427	ENSP00000338290:R427H;ENSP00000366250:R427H	ENSP00000338290:R427H	R	+	2	0	GZF1	23294300	1.000000	0.71417	1.000000	0.80357	0.094000	0.18550	9.651000	0.98493	1.166000	0.42689	-0.142000	0.14014	CGC		0.716	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078333.1	NM_022482	
EDEM2	55741	broad.mit.edu	37	20	33703597	33703597	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr20:33703597G>T	ENST00000374492.3	-	11	1481	c.1376C>A	c.(1375-1377)aCc>aAc	p.T459N	SNORD56_ENST00000364281.1_RNA|EDEM2_ENST00000374491.3_Missense_Mutation_p.T422N|EDEM2_ENST00000542871.1_Missense_Mutation_p.T183N|EDEM2_ENST00000541621.1_Missense_Mutation_p.T238N	NM_018217.2	NP_060687.2	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like 2	459					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.T459N(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	22			BRCA - Breast invasive adenocarcinoma(18;0.00936)			CCCATAGGGGGTGATCACCGC	0.582																																					p.T459N	Esophageal Squamous(51;906 1021 24535 36410 39145)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1376A	20						.						64.0	57.0	59.0					20																	33703597		2203	4300	6503	33167258	SO:0001583	missense	55741	exon11			AK001645	CCDS13247.1, CCDS46592.1	20q11.22	2006-03-31	2006-03-31	2006-03-31	ENSG00000088298	ENSG00000088298			15877	protein-coding gene	gene with protein product		610302	"""chromosome 20 open reading frame 31"""	C20orf49, C20orf31		15537790, 15579471	Standard	NM_018217		Approved	FLJ10783, bA4204.1	uc002xbo.2	Q9BV94	OTTHUMG00000032322	ENST00000374492.3:c.1376C>A	20.37:g.33703597G>T	ENSP00000363616:p.Thr459Asn	Somatic		Capture	Illumina HiSeq	Phase_I	33167258	NM_018217	B4DTG9|Q6GU33|Q6IA89|Q6UWZ4|Q9H4U0|Q9H886|Q9NTL9|Q9NVE6	Missense_Mutation	SNP	ENST00000374492.3	37	CCDS13247.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.184959	0.78677	.	.	ENSG00000088298	ENST00000374491;ENST00000374492;ENST00000541621;ENST00000542871	T;T;T;T	0.58797	0.31;0.32;1.87;1.87	5.51	5.51	0.81932	.	0.095711	0.64402	D	0.000001	T	0.70868	0.3273	L	0.52905	1.665	0.80722	D	1	D;D;D	0.57899	0.981;0.981;0.957	P;P;P	0.60949	0.881;0.809;0.841	T	0.69217	-0.5203	10	0.49607	T	0.09	-22.5641	19.614	0.95622	0.0:0.0:1.0:0.0	.	238;422;459	G3V1Q0;Q9BV94-2;Q9BV94	.;.;EDEM2_HUMAN	N	422;459;238;183	ENSP00000363615:T422N;ENSP00000363616:T459N;ENSP00000443528:T238N;ENSP00000441642:T183N	ENSP00000363615:T422N	T	-	2	0	EDEM2	33167258	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	4.294000	0.59043	2.873000	0.98535	0.561000	0.74099	ACC		0.582	EDEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078842.2	NM_018217	
SLC32A1	140679	broad.mit.edu	37	20	37353748	37353748	+	Silent	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr20:37353748C>T	ENST00000217420.1	+	1	644	c.381C>T	c.(379-381)aaC>aaT	p.N127N		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	127					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.N127N(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	ACGTGACCAACGCCATCCAGG	0.682																																					p.N127N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C381T	20						.						37.0	39.0	38.0					20																	37353748		2142	4215	6357	36787162	SO:0001819	synonymous_variant	140679	exon1			AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.381C>T	20.37:g.37353748C>T		Somatic		Capture	Illumina HiSeq	Phase_I	36787162	NM_080552	Q8N489	Silent	SNP	ENST00000217420.1	37	CCDS13307.1																																																																																				0.682	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
DSCAM	1826	broad.mit.edu	37	21	41725663	41725663	+	Silent	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr21:41725663C>T	ENST00000400454.1	-	5	1140	c.663G>A	c.(661-663)gcG>gcA	p.A221A		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	221					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A221A(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GGGCTGAGTTCGCTGGGTCTG	0.498																																					p.A221A	Melanoma(134;970 1778 1785 21664 32388)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G663A	21						.						19.0	18.0	18.0					21																	41725663		1872	4115	5987	40647533	SO:0001819	synonymous_variant	1826	exon5			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.663G>A	21.37:g.41725663C>T		Somatic		Capture	Illumina HiSeq	Phase_I	40647533	NM_001389	O60468	Silent	SNP	ENST00000400454.1	37	CCDS42929.1																																																																																				0.498	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
CDPF1	150383	broad.mit.edu	37	22	46644085	46644086	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr22:46644085_46644086insG	ENST00000314567.3	-	2	519_520	c.96_97insC	c.(94-99)cccaacfs	p.N33fs	CDPF1_ENST00000404583.1_Frame_Shift_Ins_p.N33fs|CDPF1_ENST00000404744.1_Frame_Shift_Ins_p.N33fs|CDPF1_ENST00000475605.1_Intron	NM_207327.4	NP_997210.3	Q6NVV7	CDPF1_HUMAN	cysteine-rich, DPF motif domain containing 1	33								p.N33fs*>92(2)									GACTGGGTGTTGGGGGGCTTCT	0.589																																					p.N33fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.97_98insC	22						.			2,4262		0,2,2130						-2.6	0.0			67	0,8254		0,0,4127	no	frameshift	C22orf40	NM_207327.4		0,2,6257	A1A1,A1R,RR		0.0,0.0469,0.016				2,12516				45022750	SO:0001589	frameshift_variant	150383	exon2				CCDS33670.1	22q13.31	2012-07-18	2012-07-18	2012-07-18	ENSG00000205643	ENSG00000205643			33710	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 40"""	C22orf40			Standard	NM_207327		Approved	LOC150383	uc003bhe.3	Q6NVV7	OTTHUMG00000030672	ENST00000314567.3:c.97dupC	22.37:g.46644091_46644091dupG	ENSP00000325301:p.Asn33fs	Somatic		Capture	Illumina HiSeq	Phase_I	45022749	NM_207327	A6NCA1|A9IU12|A9IU16|Q3ZCR8	Frame_Shift_Ins	INS	ENST00000314567.3	37	CCDS33670.1																																																																																				0.589	CDPF1-001	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075560.4	NM_207327	
UBE2L3	7332	broad.mit.edu	37	22	21965165	21965165	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr22:21965165A>C	ENST00000342192.4	+	3	341	c.143A>C	c.(142-144)aAg>aCg	p.K48T	UBE2L3_ENST00000545681.1_Missense_Mutation_p.K16T|UBE2L3_ENST00000458578.2_Missense_Mutation_p.K106T	NM_003347.3	NP_003338.1	P68036	UB2L3_HUMAN	ubiquitin-conjugating enzyme E2L 3	48					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to steroid hormone stimulus (GO:0071383)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein K11-linked ubiquitination (GO:0070979)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)|ubiquitin-protein transferase activity (GO:0004842)	p.K48T(1)	UBE2L3/KRAS(2)	large_intestine(4)	4	Colorectal(54;0.105)					CCATATGATAAGGGAGCCTTC	0.398																																					p.K48T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A143C	22						.						45.0	41.0	42.0					22																	21965165		2203	4300	6503	20295165	SO:0001583	missense	7332	exon3			AJ000519	CCDS13790.1, CCDS58795.1, CCDS58796.1	22q11.2	2007-02-05			ENSG00000185651	ENSG00000185651		"""Ubiquitin-conjugating enzymes E2"""	12488	protein-coding gene	gene with protein product		603721				8672131, 9693040	Standard	NM_001256356		Approved	UBCH7	uc031rxe.1	P68036	OTTHUMG00000150823	ENST00000342192.4:c.143A>C	22.37:g.21965165A>C	ENSP00000344259:p.Lys48Thr	Somatic		Capture	Illumina HiSeq	Phase_I	20295165	NM_003347	B2R4A7|B4DDG1|B4DSZ4|E7EWS7|P51966|P70653|Q9HAV1	Missense_Mutation	SNP	ENST00000342192.4	37	CCDS13790.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.325432	0.81580	.	.	ENSG00000185651	ENST00000458578;ENST00000342192;ENST00000545681	T;T;T	0.72167	-0.63;-0.63;1.15	5.43	5.43	0.79202	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.054782	0.64402	D	0.000001	D	0.85995	0.5827	M	0.90145	3.09	0.80722	D	1	D;P;P	0.55172	0.97;0.907;0.907	D;D;D	0.68621	0.959;0.945;0.945	D	0.88768	0.3262	10	0.87932	D	0	.	13.7229	0.62740	1.0:0.0:0.0:0.0	.	16;48;48	B4DDG1;P68036;A8K4W8	.;UB2L3_HUMAN;.	T	106;48;16	ENSP00000400906:K106T;ENSP00000344259:K48T;ENSP00000445931:K16T	ENSP00000344259:K48T	K	+	2	0	UBE2L3	20295165	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.176000	0.94839	2.198000	0.70561	0.533000	0.62120	AAG		0.398	UBE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320219.1	NM_198157	
NIPSNAP1	8508	broad.mit.edu	37	22	29956799	29956799	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr22:29956799G>T	ENST00000216121.7	-	8	884	c.630C>A	c.(628-630)taC>taA	p.Y210*		NM_001202502.1|NM_003634.3	NP_001189431.1|NP_003625.2	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1 (C. elegans)	210					sensory perception of pain (GO:0019233)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|synaptic membrane (GO:0097060)	neurotransmitter binding (GO:0042165)	p.Y210*(1)|p.?(1)		large_intestine(2)|lung(2)|skin(1)	5						TCTCCTGCCGGTACTTGATGG	0.582																																					p.Y210X												.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|lung(1)	c.C630A	22						.						101.0	99.0	100.0					22																	29956799		2203	4300	6503	28286799	SO:0001587	stop_gained	8508	exon8			AJ001258	CCDS13860.1	22q12	2013-09-12	2001-11-28		ENSG00000184117	ENSG00000184117			7827	protein-coding gene	gene with protein product	"""4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 1"""	603249	"""NIPSNAP, C. elegans, homolog 1"""			9661659	Standard	NM_003634		Approved		uc003afx.4	Q9BPW8	OTTHUMG00000151294	ENST00000216121.7:c.630C>A	22.37:g.29956799G>T	ENSP00000216121:p.Tyr210*	Somatic		Capture	Illumina HiSeq	Phase_I	28286799	NM_003634	B2RAY3|O43800	Nonsense_Mutation	SNP	ENST00000216121.7	37	CCDS13860.1	.	.	.	.	.	.	.	.	.	.	G	36	5.962080	0.97151	.	.	ENSG00000184117	ENST00000216121	.	.	.	4.91	4.91	0.64330	.	0.116865	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.6528	0.91437	0.0:0.0:1.0:0.0	.	.	.	.	X	210	.	ENSP00000216121:Y210X	Y	-	3	2	NIPSNAP1	28286799	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.077000	0.41557	2.716000	0.92895	0.561000	0.74099	TAC		0.582	NIPSNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322117.1		
DDX17	10521	broad.mit.edu	37	22	38895405	38895405	+	Splice_Site	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr22:38895405G>A	ENST00000396821.3	-	3	637	c.538C>T	c.(538-540)Caa>Taa	p.Q180*	DDX17_ENST00000381633.3_Splice_Site_p.Q101*|DDX17_ENST00000432525.1_5'UTR	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	180					ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)	p.Q180*(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					GAACACTTACGTGGGAAGTTA	0.443																																					p.Q180X	Ovarian(55;1085 1454 6392 21425)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C538T	22						.						125.0	116.0	119.0					22																	38895405		2203	4300	6503	37225351	SO:0001630	splice_region_variant	10521	exon3			U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.538+1C>T	22.37:g.38895405G>A		Somatic		Capture	Illumina HiSeq	Phase_I	37225351	NM_001098504	B1AHM0|Q69YT1|Q6ICD6	Nonsense_Mutation	SNP	ENST00000396821.3	37	CCDS46706.1	.	.	.	.	.	.	.	.	.	.	G	35	5.537716	0.96460	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.2402	19.2542	0.93940	0.0:0.0:1.0:0.0	.	.	.	.	X	180;101;180;182	.	.	Q	-	1	0	DDX17	37225351	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.391000	0.59652	2.554000	0.86153	0.491000	0.48974	CAA		0.443	DDX17-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321476.2	NM_030881	Nonsense_Mutation
FBLN7	129804	broad.mit.edu	37	2	112942839	112942839	+	Silent	SNP	C	C	T	rs370641244		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:112942839C>T	ENST00000331203.2	+	7	1141	c.870C>T	c.(868-870)acC>acT	p.T290T	FBLN7_ENST00000409450.3_Silent_p.T244T|FBLN7_ENST00000409903.1_Silent_p.T290T|FBLN7_ENST00000409667.3_Silent_p.T156T	NM_001128165.1|NM_153214.2	NP_001121637.1|NP_694946.2	Q53RD9	FBLN7_HUMAN	fibulin 7	290	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.T290T(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GCATCAACACCGGTGGAAGCT	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20171	0.0		0.0	False		,,,				2504	0.0				p.T290T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C870T	2						.	C	,	1,4405	2.1+/-5.4	0,1,2202	157.0	135.0	142.0		732,870	-8.4	0.2	2		142	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	FBLN7	NM_001128165.1,NM_153214.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	244/394,290/440	112942839	1,13005	2203	4300	6503	112659310	SO:0001819	synonymous_variant	129804	exon7				CCDS2095.1, CCDS46391.1	2q13	2010-06-15			ENSG00000144152	ENSG00000144152		"""Fibulins"""	26740	protein-coding gene	gene with protein product		611551				17699513	Standard	NM_153214		Approved	FLJ37440, TM14	uc002tho.1	Q53RD9	OTTHUMG00000153267	ENST00000331203.2:c.870C>T	2.37:g.112942839C>T		Somatic		Capture	Illumina HiSeq	Phase_I	112659310	NM_153214	A0JNV1|A0JNV2|Q5H9P5|Q8N9G0	Silent	SNP	ENST00000331203.2	37	CCDS2095.1																																																																																				0.582	FBLN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330505.1	NM_153214	
PXDN	7837	broad.mit.edu	37	2	1653212	1653212	+	Silent	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:1653212G>T	ENST00000252804.4	-	17	2390	c.2340C>A	c.(2338-2340)ggC>ggA	p.G780G		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	780					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.G780G(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GGGGGTTGATGCCCCGAGGGG	0.647																																					p.G780G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2340A	2						.						80.0	97.0	91.0					2																	1653212		2089	4197	6286	1632219	SO:0001819	synonymous_variant	7837	exon17			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2340C>A	2.37:g.1653212G>T		Somatic		Capture	Illumina HiSeq	Phase_I	1632219	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1																																																																																				0.647	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
PSMD14	10213	broad.mit.edu	37	2	162242082	162242082	+	Splice_Site	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:162242082G>A	ENST00000409682.3	+	8	1274	c.570G>A	c.(568-570)caG>caA	p.Q190Q		NM_005805.5	NP_005796.1	O00487	PSDE_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 14	190					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K63-linked deubiquitination (GO:0070536)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, lid subcomplex (GO:0008541)	endopeptidase activator activity (GO:0061133)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|proteasome binding (GO:0070628)|ubiquitin thiolesterase activity (GO:0004221)	p.Q190Q(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	12						CATCTATCCAGGTATTGCCTA	0.318																																					p.Q190Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G570A	2						.						68.0	63.0	65.0					2																	162242082		1832	4082	5914	161950328	SO:0001630	splice_region_variant	10213	exon8			U86782	CCDS46437.1	2q14.3	2008-05-22			ENSG00000115233	ENSG00000115233		"""Proteasome (prosome, macropain) subunits"""	16889	protein-coding gene	gene with protein product		607173				9374539	Standard	NM_005805		Approved	POH1, pad1, Rpn11	uc002ubu.3	O00487	OTTHUMG00000153882	ENST00000409682.3:c.570+1G>A	2.37:g.162242082G>A		Somatic		Capture	Illumina HiSeq	Phase_I	161950328	NM_005805	B3KNW2|O00176	Silent	SNP	ENST00000409682.3	37	CCDS46437.1																																																																																				0.318	PSMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332833.1	NM_005805	Silent
CSRNP3	80034	broad.mit.edu	37	2	166451585	166451585	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:166451585A>G	ENST00000342316.4	+	2	282	c.10A>G	c.(10-12)Att>Gtt	p.I4V	CSRNP3_ENST00000409420.1_Missense_Mutation_p.I36V|CSRNP3_ENST00000314499.7_Missense_Mutation_p.I4V	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	4					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I4V(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						GATGAGTGGAATTTTAAAGAG	0.478																																					p.I4V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A10G	2						.						93.0	87.0	89.0					2																	166451585		2203	4300	6503	166159831	SO:0001583	missense	80034	exon4			AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.10A>G	2.37:g.166451585A>G	ENSP00000344042:p.Ile4Val	Somatic		Capture	Illumina HiSeq	Phase_I	166159831	NM_001172173	B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	ENST00000342316.4	37	CCDS2225.1	.	.	.	.	.	.	.	.	.	.	A	19.00	3.740956	0.69304	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000409664;ENST00000342316;ENST00000409420	T	0.15372	2.43	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.15912	0.0383	L	0.27053	0.805	0.40155	D	0.976994	B	0.28178	0.202	B	0.33392	0.163	T	0.10683	-1.0619	10	0.27785	T	0.31	-15.9498	16.3631	0.83280	1.0:0.0:0.0:0.0	.	4	Q8WYN3	CSRN3_HUMAN	V	4;11;4;4;4;36	ENSP00000387195:I36V	ENSP00000318258:I4V	I	+	1	0	CSRNP3	166159831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.336000	0.79245	2.266000	0.75297	0.533000	0.62120	ATT		0.478	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255191.2	NM_024969	
MAP2	4133	broad.mit.edu	37	2	210559490	210559490	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:210559490G>T	ENST00000360351.4	+	7	3102	c.2596G>T	c.(2596-2598)Gac>Tac	p.D866Y	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.D862Y|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	866					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.D866Y(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TCAGCTCGAAGACCTGGGCTA	0.473																																					p.D866Y	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2596T	2						.						83.0	74.0	77.0					2																	210559490		2203	4300	6503	210267735	SO:0001583	missense	4133	exon7				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2596G>T	2.37:g.210559490G>T	ENSP00000353508:p.Asp866Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	210267735	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964321	0.74131	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.27890	1.64;1.64	5.8	5.8	0.92144	MAP2/Tau projection (1);	0.000000	0.64402	D	0.000006	T	0.55305	0.1912	L	0.56769	1.78	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.79784	0.988;0.993	T	0.54132	-0.8339	10	0.87932	D	0	-20.9972	20.0567	0.97653	0.0:0.0:1.0:0.0	.	862;866	P11137-3;P11137	.;MAP2_HUMAN	Y	866;862	ENSP00000353508:D866Y;ENSP00000392164:D862Y	ENSP00000353508:D866Y	D	+	1	0	MAP2	210267735	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.229000	0.95273	2.752000	0.94435	0.650000	0.86243	GAC		0.473	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
FN1	2335	broad.mit.edu	37	2	216237096	216237096	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:216237096C>T	ENST00000359671.1	-	39	6242	c.5977G>A	c.(5977-5979)Gag>Aag	p.E1993K	FN1_ENST00000432072.2_Intron|FN1_ENST00000421182.1_Intron|FN1_ENST00000354785.4_Missense_Mutation_p.E2084K|FN1_ENST00000357867.4_Intron|FN1_ENST00000345488.5_Intron|FN1_ENST00000446046.1_Intron|FN1_ENST00000443816.1_Missense_Mutation_p.E1903K|FN1_ENST00000336916.4_Missense_Mutation_p.E1993K|FN1_ENST00000323926.6_Missense_Mutation_p.E2084K|FN1_ENST00000356005.4_Missense_Mutation_p.E1903K|FN1_ENST00000357009.2_Intron|FN1_ENST00000346544.3_Intron			P02751	FINC_HUMAN	fibronectin 1	1993	Connecting strand 3 (CS-3) (V region).|Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.E1993K(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TGGGGAAGCTCGTCTAGCCGA	0.478																																					p.E1903K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5707A	2						.						57.0	54.0	55.0					2																	216237096		2203	4300	6503	215945341	SO:0001583	missense	2335	exon38				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.5977G>A	2.37:g.216237096C>T	ENSP00000352696:p.Glu1993Lys	Somatic		Capture	Illumina HiSeq	Phase_I	215945341	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	C	26.4	4.732913	0.89482	.	.	ENSG00000115414	ENST00000323926;ENST00000336916;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000443816;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T	0.48201	2.17;2.37;2.4;2.04;1.61;1.48;0.82	6.16	6.16	0.99307	Immunoglobulin-like fold (1);	0.078641	0.52532	D	0.000064	T	0.64360	0.2591	L	0.53249	1.67	0.80722	D	1	D;P;D;D;D;P;D	0.69078	0.97;0.589;0.974;0.984;0.997;0.762;0.996	P;B;P;P;P;B;P	0.61940	0.449;0.157;0.507;0.635;0.896;0.3;0.717	T	0.56697	-0.7936	9	.	.	.	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	1784;2084;1903;1993;1903;2084;1993	Q68CX6;P02751-7;P02751-8;P02751-3;P02751-14;P02751-15;P02751	.;.;.;.;.;.;FINC_HUMAN	K	2084;1993;2084;1994;1993;1903;1903;710	ENSP00000323534:E2084K;ENSP00000338200:E1993K;ENSP00000346839:E2084K;ENSP00000352696:E1993K;ENSP00000415018:E1903K;ENSP00000348285:E1903K;ENSP00000416139:E710K	.	E	-	1	0	FN1	215945341	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.765000	0.55272	2.937000	0.99478	0.650000	0.86243	GAG		0.478	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
RUFY4	285180	broad.mit.edu	37	2	218940120	218940120	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:218940120C>A	ENST00000344321.7	+	9	1423	c.905C>A	c.(904-906)gCt>gAt	p.A302D	RUFY4_ENST00000463872.1_3'UTR|RUFY4_ENST00000374155.3_Missense_Mutation_p.A322D|RUFY4_ENST00000441828.2_3'UTR	NM_198483.3	NP_940885.2	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4	302							metal ion binding (GO:0046872)	p.A322D(1)		endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(1)	10		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGGAAGGGGGCTATGGGCACT	0.567																																					p.A302D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C905A	2						.						31.0	30.0	31.0					2																	218940120		1970	4160	6130	218648365	SO:0001583	missense	285180	exon9			AK128393		2q35	2007-01-29			ENSG00000188282	ENSG00000188282		"""Zinc fingers, FYVE domain containing"""	24804	protein-coding gene	gene with protein product							Standard	NM_198483		Approved	FLJ46536	uc010fvl.2	Q6ZNE9	OTTHUMG00000155235	ENST00000344321.7:c.905C>A	2.37:g.218940120C>A	ENSP00000345900:p.Ala302Asp	Somatic		Capture	Illumina HiSeq	Phase_I	218648365	NM_198483	Q6ZR96	Missense_Mutation	SNP	ENST00000344321.7	37		.	.	.	.	.	.	.	.	.	.	C	15.39	2.820525	0.50633	.	.	ENSG00000188282	ENST00000344321;ENST00000374155	T;T	0.49432	1.43;0.78	4.46	-0.819	0.10829	.	0.827100	0.10406	N	0.678564	T	0.31009	0.0783	L	0.27053	0.805	0.09310	N	1	P	0.50528	0.936	P	0.48571	0.582	T	0.17167	-1.0378	10	0.12766	T	0.61	-0.0263	1.2936	0.02065	0.1644:0.3136:0.3218:0.2001	.	302	Q6ZNE9	RUFY4_HUMAN	D	302;322	ENSP00000345900:A302D;ENSP00000363270:A322D	ENSP00000345900:A302D	A	+	2	0	RUFY4	218648365	0.000000	0.05858	0.001000	0.08648	0.044000	0.14063	-0.416000	0.07097	0.141000	0.18875	0.467000	0.42956	GCT		0.567	RUFY4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198483	
SPEG	10290	broad.mit.edu	37	2	220333707	220333707	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:220333707G>A	ENST00000312358.7	+	12	3560	c.3428G>A	c.(3427-3429)gGc>gAc	p.G1143D	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1143	Ig-like 5.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G1143D(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AACACCCATGGCCAGGCCCAC	0.657																																					p.G1143D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3428A	2						.						45.0	54.0	51.0					2																	220333707		2060	4190	6250	220041951	SO:0001583	missense	10290	exon12			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.3428G>A	2.37:g.220333707G>A	ENSP00000311684:p.Gly1143Asp	Somatic		Capture	Illumina HiSeq	Phase_I	220041951	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234618	0.58886	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.81330	-1.48	4.77	4.77	0.60923	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.42964	D	0.000639	D	0.93367	0.7885	H	0.96748	3.875	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95573	0.8640	10	0.87932	D	0	.	17.989	0.89163	0.0:0.0:1.0:0.0	.	1143	Q15772	SPEG_HUMAN	D	1143	ENSP00000311684:G1143D	ENSP00000265327:G1143D	G	+	2	0	SPEG	220041951	1.000000	0.71417	0.998000	0.56505	0.516000	0.34256	9.536000	0.98067	2.490000	0.84030	0.655000	0.94253	GGC		0.657	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
SUPT7L	9913	broad.mit.edu	37	2	27880243	27880243	+	Missense_Mutation	SNP	C	C	T	rs372248888		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:27880243C>T	ENST00000337768.5	-	4	1282	c.713G>A	c.(712-714)cGc>cAc	p.R238H	SUPT7L_ENST00000404798.2_Missense_Mutation_p.R103H|SUPT7L_ENST00000406540.1_Missense_Mutation_p.R236H|SUPT7L_ENST00000405491.1_Missense_Mutation_p.R236H|SUPT7L_ENST00000464789.2_Missense_Mutation_p.R236H	NM_001282729.1|NM_014860.1	NP_001269658.1|NP_055675.1	O94864	ST65G_HUMAN	suppressor of Ty 7 (S. cerevisiae)-like	238					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|maintenance of protein location in nucleus (GO:0051457)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)	p.R238H(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)					GTCCTTGATGCGGTGCTGCCA	0.537																																					p.R238H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G713A	2						.	C	HIS/ARG	0,4144		0,0,2072	78.0	80.0	79.0		713	5.6	1.0	2		79	1,8407		0,1,4203	no	missense	SUPT7L	NM_014860.1	29	0,1,6275	TT,TC,CC		0.0119,0.0,0.0080	probably-damaging	238/415	27880243	1,12551	2072	4204	6276	27733747	SO:0001583	missense	9913	exon4			AF197954	CCDS42667.1, CCDS62885.1, CCDS62886.1	2p23.3	2008-02-05			ENSG00000119760	ENSG00000119760			30632	protein-coding gene	gene with protein product		612762				9872452, 11564863	Standard	NM_001282732		Approved	STAF65, gamma, KIAA0764, SPT7L	uc002rli.1	O94864	OTTHUMG00000151947	ENST00000337768.5:c.713G>A	2.37:g.27880243C>T	ENSP00000336750:p.Arg238His	Somatic		Capture	Illumina HiSeq	Phase_I	27733747	NM_014860	B4E3W3|Q6IB21|Q9H2T6	Missense_Mutation	SNP	ENST00000337768.5	37	CCDS42667.1	.	.	.	.	.	.	.	.	.	.	C	35	5.437401	0.96168	0.0	1.19E-4	ENSG00000119760	ENST00000337768;ENST00000406540;ENST00000405491;ENST00000464789;ENST00000404798	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.67107	0.2858	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.996	D;P;P	0.69654	0.965;0.83;0.68	T	0.67837	-0.5567	9	0.51188	T	0.08	-12.5104	19.5422	0.95278	0.0:1.0:0.0:0.0	.	103;236;238	B4E3W3;O94864-2;O94864	.;.;ST65G_HUMAN	H	238;236;236;236;103	.	ENSP00000336750:R238H	R	-	2	0	SUPT7L	27733747	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.604000	0.88044	0.561000	0.74099	CGC		0.537	SUPT7L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324568.1	NM_014860	
VIT	5212	broad.mit.edu	37	2	37014392	37014392	+	Missense_Mutation	SNP	G	G	T	rs386352378		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:37014392G>T	ENST00000389975.3	+	11	1288	c.986G>T	c.(985-987)gGt>gTt	p.G329V	VIT_ENST00000404084.1_Missense_Mutation_p.G281V|VIT_ENST00000379242.3_Missense_Mutation_p.G344V|VIT_ENST00000379241.3_Missense_Mutation_p.G307V|VIT_ENST00000497382.1_5'UTR|VIT_ENST00000401530.1_Missense_Mutation_p.G308V	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	329	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)	p.G344V(10)		autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				GGCCCTGCCGGTCCACTGATG	0.478																																					p.G329V												.	.	10	Substitution - Missense(10)	endometrium(10)	c.G986T	2						.						78.0	60.0	66.0					2																	37014392		2203	4300	6503	36867896	SO:0001583	missense	5212	exon11			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.986G>T	2.37:g.37014392G>T	ENSP00000374625:p.Gly329Val	None		Capture	Illumina HiSeq	Phase_I	36867896	NM_001177969	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	ENST00000389975.3	37	CCDS54347.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.853420|4.853420	0.91355|0.91355	.|.	.|.	ENSG00000205221|ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000404084;ENST00000379241;ENST00000401530|ENST00000464309	D;D;D;D;D|.	0.84298|.	-1.83;-1.83;-1.83;-1.83;-1.83|.	5.68|5.68	5.68|5.68	0.88126|0.88126	von Willebrand factor, type A (3);|.	0.047829|.	0.85682|.	D|.	0.000000|.	D|D	0.83151|0.83151	0.5192|0.5192	M|M	0.87547|0.87547	2.89|2.89	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;1.0;1.0;0.999|.	D|D	0.85132|0.85132	0.0975|0.0975	10|5	0.59425|.	D|.	0.04|.	-15.4435|-15.4435	17.2927|17.2927	0.87162|0.87162	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	308;307;329;344|.	E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4|.	.;.;VITRN_HUMAN;.|.	V|F	344;329;281;307;308|96	ENSP00000368544:G344V;ENSP00000374625:G329V;ENSP00000384154:G281V;ENSP00000368543:G307V;ENSP00000385658:G308V|.	ENSP00000368543:G307V|.	G|V	+|+	2|1	0|0	VIT|VIT	36867896|36867896	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.947000|0.947000	0.59692|0.59692	8.705000|8.705000	0.91357|0.91357	2.683000|2.683000	0.91414|0.91414	0.561000|0.561000	0.74099|0.74099	GGT|GTC		0.478	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			
UGP2	7360	broad.mit.edu	37	2	64113006	64113006	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:64113006C>T	ENST00000337130.5	+	6	1335	c.859C>T	c.(859-861)Cgt>Tgt	p.R287C	UGP2_ENST00000467648.2_Missense_Mutation_p.R276C|UGP2_ENST00000487469.1_3'UTR|UGP2_ENST00000445915.2_Missense_Mutation_p.R296C|ACA59_ENST00000515966.1_RNA|UGP2_ENST00000394417.2_Missense_Mutation_p.R276C	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	287					carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)	p.R287C(2)		endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						AAATAAAACACGTGCAGATGT	0.358																																					p.R276C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C826T	2						.						74.0	76.0	75.0					2																	64113006		2203	4300	6503	63966510	SO:0001583	missense	7360	exon6				CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.859C>T	2.37:g.64113006C>T	ENSP00000338703:p.Arg287Cys	Somatic		Capture	Illumina HiSeq	Phase_I	63966510	NM_001001521	Q07131|Q0P6K2|Q86Y81|Q9BU15	Missense_Mutation	SNP	ENST00000337130.5	37	CCDS1875.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727063	0.69074	.	.	ENSG00000169764	ENST00000394417;ENST00000467648;ENST00000337130;ENST00000445915	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.73	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.48429	0.1499	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.56074	-0.8039	10	0.72032	D	0.01	-20.8135	13.5835	0.61917	0.2886:0.7114:0.0:0.0	.	296;287	E7EUC7;Q16851	.;UGPA_HUMAN	C	276;276;287;296	ENSP00000377939:R276C;ENSP00000420793:R276C;ENSP00000338703:R287C;ENSP00000411803:R296C	ENSP00000338703:R287C	R	+	1	0	UGP2	63966510	0.798000	0.28890	1.000000	0.80357	0.994000	0.84299	0.972000	0.29409	2.710000	0.92621	0.650000	0.86243	CGT		0.358	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251688.1	NM_006759	
MXD1	4084	broad.mit.edu	37	2	70148881	70148881	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:70148881G>T	ENST00000264444.2	+	3	447	c.187G>T	c.(187-189)Gaa>Taa	p.E63*	MXD1_ENST00000540449.1_Intron	NM_001202513.1|NM_001202514.1|NM_002357.3	NP_001189442.1|NP_001189443.1|NP_002348.1	Q05195	MAD1_HUMAN	MAX dimerization protein 1	63	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)	p.E63*(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						AACTCACAATGAAATGGAGAA	0.378																																					p.E63X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G187T	2						.						107.0	96.0	100.0					2																	70148881		2203	4300	6503	70002385	SO:0001587	stop_gained	4084	exon3				CCDS1896.1, CCDS56123.1	2p13-p12	2010-07-07		2005-02-11	ENSG00000059728	ENSG00000059728		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	6761	protein-coding gene	gene with protein product		600021		MAD		7829091	Standard	NM_002357		Approved	MAD1, bHLHc58	uc002sfy.3	Q05195	OTTHUMG00000129646	ENST00000264444.2:c.187G>T	2.37:g.70148881G>T	ENSP00000264444:p.Glu63*	Somatic		Capture	Illumina HiSeq	Phase_I	70002385	NM_002357	B2R6V8|B7ZLI6|D6W5G2|Q6FI41	Nonsense_Mutation	SNP	ENST00000264444.2	37	CCDS1896.1	.	.	.	.	.	.	.	.	.	.	G	38	6.806927	0.97853	.	.	ENSG00000059728	ENST00000435990;ENST00000264444	.	.	.	5.25	5.25	0.73442	.	0.112182	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.7339	0.85442	0.0:0.0:1.0:0.0	.	.	.	.	X	31;63	.	ENSP00000264444:E63X	E	+	1	0	MXD1	70002385	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.195000	0.72088	2.894000	0.99253	0.591000	0.81541	GAA		0.378	MXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251845.3	NM_002357	
HDLBP	3069	broad.mit.edu	37	2	242202308	242202308	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr2:242202308T>C	ENST00000391975.1	-	5	495	c.268A>G	c.(268-270)Aag>Gag	p.K90E	HDLBP_ENST00000427183.2_Missense_Mutation_p.K126E|HDLBP_ENST00000310931.4_Missense_Mutation_p.K90E|HDLBP_ENST00000391976.2_Missense_Mutation_p.K90E	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	90					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)	p.K90E(1)		breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		TTCATATCCTTGTATTTTCTC	0.423																																					p.K90E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A268G	2						.						171.0	141.0	151.0					2																	242202308		2203	4300	6503	241850981	SO:0001583	missense	3069	exon5				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.268A>G	2.37:g.242202308T>C	ENSP00000375836:p.Lys90Glu	Somatic		Capture	Illumina HiSeq	Phase_I	241850981	NM_005336	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	37	CCDS2547.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.360001	0.61403	.	.	ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000422933;ENST00000428482;ENST00000442714;ENST00000452065;ENST00000444092;ENST00000430918;ENST00000441124;ENST00000426343	T;T;T;T;T;T;T;T;T;T;T;T	0.51817	2.21;2.21;2.21;2.14;1.38;0.8;0.69;0.77;0.74;0.74;0.73;0.7	6.17	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.46983	0.1421	M	0.76002	2.32	0.58432	D	0.999998	B;B	0.34241	0.402;0.444	B;B	0.35607	0.119;0.206	T	0.37753	-0.9692	10	0.11794	T	0.64	-35.1676	12.3678	0.55238	0.0:0.0652:0.0:0.9348	.	126;90	E7EM71;Q00341	.;VIGLN_HUMAN	E	90;90;90;126;90;90;90;90;90;90;90;90	ENSP00000375836:K90E;ENSP00000375837:K90E;ENSP00000312042:K90E;ENSP00000399139:K126E;ENSP00000403807:K90E;ENSP00000405109:K90E;ENSP00000413891:K90E;ENSP00000387782:K90E;ENSP00000416559:K90E;ENSP00000403913:K90E;ENSP00000396964:K90E;ENSP00000394205:K90E	ENSP00000312042:K90E	K	-	1	0	HDLBP	241850981	1.000000	0.71417	0.995000	0.50966	0.721000	0.41392	6.162000	0.71874	1.159000	0.42565	0.533000	0.62120	AAG		0.423	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
SLC6A11	6538	broad.mit.edu	37	3	10971011	10971011	+	Missense_Mutation	SNP	G	G	A	rs548624556		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr3:10971011G>A	ENST00000254488.2	+	10	1423	c.1357G>A	c.(1357-1359)Gtg>Atg	p.V453M		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	453					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)	p.V453M(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	TCTGGGCCTCGTGATGTTAAC	0.577																																					p.V453M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1357A	3						.						215.0	194.0	201.0					3																	10971011		2203	4300	6503	10946011	SO:0001583	missense	6538	exon10			S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.1357G>A	3.37:g.10971011G>A	ENSP00000254488:p.Val453Met	Somatic		Capture	Illumina HiSeq	Phase_I	10946011	NM_014229	B2R6U6|Q8IYC9	Missense_Mutation	SNP	ENST00000254488.2	37	CCDS2602.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.205351	0.58234	.	.	ENSG00000132164	ENST00000254488	T	0.75154	-0.91	5.12	4.23	0.50019	.	0.057923	0.64402	D	0.000004	T	0.73783	0.3631	M	0.63169	1.94	0.80722	D	1	P	0.51791	0.948	P	0.52066	0.689	T	0.72679	-0.4220	10	0.36615	T	0.2	.	4.8115	0.13345	0.304:0.0:0.696:0.0	.	453	P48066	S6A11_HUMAN	M	453	ENSP00000254488:V453M	ENSP00000254488:V453M	V	+	1	0	SLC6A11	10946011	0.982000	0.34865	0.997000	0.53966	0.508000	0.34012	2.346000	0.44027	2.376000	0.81061	0.462000	0.41574	GTG		0.577	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229	
TM4SF4	7104	broad.mit.edu	37	3	149193623	149193623	+	Missense_Mutation	SNP	C	C	T	rs188249785		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr3:149193623C>T	ENST00000305354.4	+	2	1092	c.188C>T	c.(187-189)gCg>gTg	p.A63V		NM_004617.3	NP_004608.1	P48230	T4S4_HUMAN	transmembrane 4 L six family member 4	63					tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)		p.A63V(1)		large_intestine(3)|lung(4)|ovary(1)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ATCTTCCCTGCGCTGGTGTTC	0.587																																					p.A63V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C188T	3						.	C	VAL/ALA	0,4066		0,0,2033	50.0	52.0	52.0		188	2.3	0.0	3		52	1,8367		0,1,4183	no	missense	TM4SF4	NM_004617.3	64	0,1,6216	TT,TC,CC		0.012,0.0,0.0080	benign	63/203	149193623	1,12433	2033	4184	6217	150676313	SO:0001583	missense	7104	exon2				CCDS46932.1	3q25	2005-03-21	2005-03-21		ENSG00000169903	ENSG00000169903			11856	protein-coding gene	gene with protein product		606567	"""transmembrane 4 superfamily member 4"""			7665614	Standard	NM_004617		Approved	il-TMP	uc003exd.2	P48230	OTTHUMG00000159619	ENST00000305354.4:c.188C>T	3.37:g.149193623C>T	ENSP00000305852:p.Ala63Val	Somatic		Capture	Illumina HiSeq	Phase_I	150676313	NM_004617	B2RDA4	Missense_Mutation	SNP	ENST00000305354.4	37	CCDS46932.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625541	0.46840	0.0	1.2E-4	ENSG00000169903	ENST00000305354	T	0.37411	1.2	5.09	2.29	0.28610	.	0.154508	0.64402	N	0.000019	T	0.39627	0.1085	M	0.82923	2.615	0.40378	D	0.979417	B	0.29766	0.256	B	0.29524	0.103	T	0.42932	-0.9422	10	0.72032	D	0.01	-5.4206	9.1766	0.37116	0.0:0.7046:0.0:0.2954	.	63	P48230	T4S4_HUMAN	V	63	ENSP00000305852:A63V	ENSP00000305852:A63V	A	+	2	0	TM4SF4	150676313	0.904000	0.30761	0.045000	0.18777	0.838000	0.47535	1.881000	0.39638	0.655000	0.30866	0.655000	0.94253	GCG		0.587	TM4SF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356528.1		
PIK3CA	5290	broad.mit.edu	37	3	178916854	178916854	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr3:178916854G>A	ENST00000263967.3	+	2	398	c.241G>A	c.(241-243)Gaa>Aaa	p.E81K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	81	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.		E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E81K(8)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AGAAAGGGAAGAATTTTTTGA	0.358		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E81K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,large_intestine,right,Substitution - Missense,0 	.	8	Substitution - Missense(8)	endometrium(4)|large_intestine(3)|breast(1)	c.G241A	3						.						107.0	101.0	103.0					3																	178916854		1820	4081	5901	180399548	SO:0001583	missense	5290	exon2				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.241G>A	3.37:g.178916854G>A	ENSP00000263967:p.Glu81Lys	Somatic		Capture	Illumina HiSeq	Phase_I	180399548	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983574	0.93044	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.77620	-1.11;-1.11	5.44	5.44	0.79542	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.89305	0.6677	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89493	0.3758	9	.	.	.	-5.0909	19.2635	0.93977	0.0:0.0:1.0:0.0	.	81	P42336	PK3CA_HUMAN	K	81	ENSP00000263967:E81K;ENSP00000417479:E81K	.	E	+	1	0	PIK3CA	180399548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.571000	0.82399	2.547000	0.85894	0.555000	0.69702	GAA		0.358	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PIK3CA	5290	broad.mit.edu	37	3	178916929	178916929	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr3:178916929G>C	ENST00000263967.3	+	2	473	c.316G>C	c.(316-318)Ggc>Cgc	p.G106R		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	106			G -> V (in CRC; likely involved in disease pathogenesis; shows an increase in lipid kinase activity).		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.G106R(3)|p.G106_R108delGNR(2)|p.G106_R108del(1)|p.P104_G106>R(1)|p.E103_G106>D(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAACCAGTAGGCAACCGTGA	0.348		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.G106R	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,large_intestine,NS,Substitution - Missense,-1 	.	8	Substitution - Missense(3)|Deletion - In frame(3)|Complex - deletion inframe(2)	large_intestine(3)|breast(3)|lung(1)|endometrium(1)	c.G316C	3						.						90.0	86.0	87.0					3																	178916929		1824	4071	5895	180399623	SO:0001583	missense	5290	exon2				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.316G>C	3.37:g.178916929G>C	ENSP00000263967:p.Gly106Arg	Somatic		Capture	Illumina HiSeq	Phase_I	180399623	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.431029	0.83776	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.75260	0.72;-0.92	5.52	5.52	0.82312	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.86928	0.6051	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86624	0.1881	9	.	.	.	-7.432	19.4271	0.94746	0.0:0.0:1.0:0.0	.	106	P42336	PK3CA_HUMAN	R	106	ENSP00000263967:G106R;ENSP00000417479:G106R	.	G	+	1	0	PIK3CA	180399623	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.471000	0.97696	2.584000	0.87258	0.555000	0.69702	GGC		0.348	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	C	rs104886003		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr3:178936091G>C	ENST00000263967.3	+	10	1790	c.1633G>C	c.(1633-1635)Gag>Cag	p.E545Q		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545Q	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,urinary_tract,bladder,Substitution - Missense,0 	.	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633C	3						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	180418785	SO:0001583	missense	5290	exon10				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>C	3.37:g.178936091G>C	ENSP00000263967:p.Glu545Gln	Somatic		Capture	Illumina HiSeq	Phase_I	180418785	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784998	0.90282	.	.	ENSG00000121879	ENST00000263967	T	0.63913	-0.07	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71247	0.3317	L	0.55990	1.75	0.80722	D	1	D	0.53312	0.959	P	0.53760	0.734	T	0.69709	-0.5072	10	0.45353	T	0.12	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	Q	545	ENSP00000263967:E545Q	ENSP00000263967:E545Q	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
ROBO2	6092	broad.mit.edu	37	3	77629159	77629159	+	Missense_Mutation	SNP	G	G	A	rs201678507		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr3:77629159G>A	ENST00000461745.1	+	16	3290	c.2390G>A	c.(2389-2391)cGg>cAg	p.R797Q	ROBO2_ENST00000332191.8_Missense_Mutation_p.R797Q|ROBO2_ENST00000487694.3_Missense_Mutation_p.R813Q	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	797	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.R813Q(1)|p.R797Q(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GCAGCCATTCGGTCCGTAATA	0.438																																					p.R797Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2390A	3	GRCh37	CM084999	ROBO2	M		.						134.0	130.0	131.0					3																	77629159		1887	4107	5994	77711849	SO:0001583	missense	6092	exon16			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2390G>A	3.37:g.77629159G>A	ENSP00000417164:p.Arg797Gln	Somatic		Capture	Illumina HiSeq	Phase_I	77711849	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.077698	0.76528	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.57273	0.41;0.41;0.41	5.53	5.53	0.82687	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.36972	U	0.002315	T	0.57301	0.2044	N	0.25426	0.745	0.38466	D	0.947338	D;D;D	0.65815	0.995;0.988;0.995	D;P;P	0.63033	0.91;0.854;0.87	T	0.47812	-0.9088	9	0.12103	T	0.63	.	19.0503	0.93041	0.0:0.0:1.0:0.0	.	813;797;797	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	Q	813;813;817;797;797;518	ENSP00000417335:R813Q;ENSP00000417164:R797Q;ENSP00000327536:R797Q	ENSP00000327536:R797Q	R	+	2	0	ROBO2	77711849	1.000000	0.71417	0.996000	0.52242	0.507000	0.33981	9.808000	0.99193	2.591000	0.87537	0.563000	0.77884	CGG		0.438	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
ROBO1	6091	broad.mit.edu	37	3	78700908	78700908	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr3:78700908G>T	ENST00000464233.1	-	19	2899	c.2786C>A	c.(2785-2787)aCt>aAt	p.T929N	ROBO1_ENST00000495273.1_Missense_Mutation_p.T893N|ROBO1_ENST00000467549.1_Missense_Mutation_p.T893N|ROBO1_ENST00000436010.2_Missense_Mutation_p.T890N	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	929					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.T929N(1)|p.T893N(1)|p.T906N(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GTAGGTACTAGTAAGTCCGTT	0.398																																					p.T929N												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C2786A	3						.						75.0	71.0	72.0					3																	78700908		1926	4148	6074	78783598	SO:0001583	missense	6091	exon19			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2786C>A	3.37:g.78700908G>T	ENSP00000420321:p.Thr929Asn	Somatic		Capture	Illumina HiSeq	Phase_I	78783598	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	8.462	0.855465	0.17106	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.60171	0.23;0.21;0.21;0.22	6.08	4.26	0.50523	.	0.237423	0.49305	N	0.000143	T	0.40956	0.1138	N	0.22421	0.69	0.09310	N	0.999998	B;B;B;B;B	0.32717	0.0;0.286;0.381;0.142;0.074	B;B;B;B;B	0.28011	0.002;0.082;0.075;0.028;0.085	T	0.14364	-1.0475	9	.	.	.	.	13.6516	0.62314	0.0:0.1193:0.7564:0.1243	.	893;929;893;893;890	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	N	890;893;929;893;893;933	ENSP00000406043:T890N;ENSP00000420321:T929N;ENSP00000420637:T893N;ENSP00000417992:T893N	.	T	-	2	0	ROBO1	78783598	0.862000	0.29867	0.002000	0.10522	0.001000	0.01503	3.768000	0.55295	0.865000	0.35603	0.655000	0.94253	ACT		0.398	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
ABCF3	55324	broad.mit.edu	37	3	183906051	183906051	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr3:183906051C>A	ENST00000429586.2	+	7	877	c.692C>A	c.(691-693)cCa>cAa	p.P231Q	EIF2B5_ENST00000444495.1_Intron|ABCF3_ENST00000292808.5_Missense_Mutation_p.P225Q	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	231	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.			P -> S (in Ref. 1; BAC03881). {ECO:0000305}.	defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.P231Q(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGCGGGTTCCAGCCCACATT	0.602																																					p.P231Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C692A	3						.						116.0	115.0	116.0					3																	183906051		2203	4300	6503	185388745	SO:0001583	missense	55324	exon7			U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.692C>A	3.37:g.183906051C>A	ENSP00000411471:p.Pro231Gln	Somatic		Capture	Illumina HiSeq	Phase_I	185388745	NM_018358	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	ENST00000429586.2	37	CCDS3254.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470684	0.84533	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.93189	-3.18;-3.18	4.92	4.92	0.64577	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.96012	0.8701	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.96612	0.9453	10	0.87932	D	0	-10.9569	17.1033	0.86655	0.0:1.0:0.0:0.0	.	225;231	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	Q	231;225	ENSP00000411471:P231Q;ENSP00000292808:P225Q	ENSP00000292808:P225Q	P	+	2	0	ABCF3	185388745	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.601000	0.82783	2.262000	0.75019	0.561000	0.74099	CCA		0.602	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346047.1	NM_018358	
ANK2	287	broad.mit.edu	37	4	114262920	114262920	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr4:114262920G>A	ENST00000357077.4	+	33	4023	c.3970G>A	c.(3970-3972)Gta>Ata	p.V1324I	ANK2_ENST00000506722.1_Missense_Mutation_p.V1315I|ANK2_ENST00000394537.3_Missense_Mutation_p.V1324I|ANK2_ENST00000264366.6_Missense_Mutation_p.V1291I|ANK2_ENST00000510275.2_5'Flank|ANK2_ENST00000504887.1_3'UTR|ANK2_ENST00000509550.1_Missense_Mutation_p.V500I	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1324	UPA domain.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.V1324I(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AATTATCTGCGTACCTTATAT	0.383																																					p.V1324I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3970A	4						.						145.0	146.0	146.0					4																	114262920		2203	4300	6503	114482369	SO:0001583	missense	287	exon33			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3970G>A	4.37:g.114262920G>A	ENSP00000349588:p.Val1324Ile	Somatic		Capture	Illumina HiSeq	Phase_I	114482369	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.505499|5.505499	0.96371|0.96371	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000514960;ENST00000504415|ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550	.|T;T;T;T;T;T;T	.|0.27720	.|1.65;1.65;1.65;1.65;1.65;1.65;1.65	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	.|0.000000	.|0.48286	.|D	.|0.000199	T|T	0.59046|0.59046	0.2165|0.2165	M|M	0.76727|0.76727	2.345|2.345	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;0.999;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.91635	.|0.99;0.99;0.99;0.999;0.998;0.996	T|T	0.58752|0.58752	-0.7581|-0.7581	5|10	.|0.54805	.|T	.|0.06	.|.	19.7908|19.7908	0.96456|0.96456	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|500;1291;336;1324;1324;1315	.|E9PCH6;Q01484;Q7Z344;Q01484-2;Q01484-4;Q01484-5	.|.;ANK2_HUMAN;.;.;.;.	H|I	336;18|1237;1315;370;1339;1324;1324;1291;1315;500	.|ENSP00000421011:V1237I;ENSP00000421067:V1315I;ENSP00000424722:V1339I;ENSP00000378044:V1324I;ENSP00000349588:V1324I;ENSP00000264366:V1291I;ENSP00000426944:V500I	.|ENSP00000264366:V1291I	R|V	+|+	2|1	0|0	ANK2|ANK2	114482369|114482369	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.989000|0.989000	0.77384|0.77384	9.869000|9.869000	0.99810|0.99810	2.682000|2.682000	0.91365|0.91365	0.591000|0.591000	0.81541|0.81541	CGT|GTA		0.383	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
NDST4	64579	broad.mit.edu	37	4	115997334	115997334	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr4:115997334C>A	ENST00000264363.2	-	2	1537	c.859G>T	c.(859-861)Gcc>Tcc	p.A287S		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	287	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.A287S(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AAGGAGATGGCATCTATGAAG	0.443																																					p.A287S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G859T	4						.						180.0	163.0	169.0					4																	115997334		2203	4300	6503	116216783	SO:0001583	missense	64579	exon2			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.859G>T	4.37:g.115997334C>A	ENSP00000264363:p.Ala287Ser	Somatic		Capture	Illumina HiSeq	Phase_I	116216783	NM_022569	Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589928	0.66105	.	.	ENSG00000138653	ENST00000264363	T	0.43294	0.95	5.57	4.71	0.59529	.	0.049314	0.85682	N	0.000000	T	0.45054	0.1323	M	0.64404	1.975	0.80722	D	1	B	0.31009	0.303	B	0.37508	0.252	T	0.30416	-0.9979	10	0.18276	T	0.48	.	15.5702	0.76330	0.139:0.861:0.0:0.0	.	287	Q9H3R1	NDST4_HUMAN	S	287	ENSP00000264363:A287S	ENSP00000264363:A287S	A	-	1	0	NDST4	116216783	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.940000	0.70187	1.299000	0.44798	0.591000	0.81541	GCC		0.443	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
FBXW7	55294	broad.mit.edu	37	4	153249384	153249384	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr4:153249384C>T	ENST00000281708.4	-	9	2623	c.1394G>A	c.(1393-1395)cGt>cAt	p.R465H	FBXW7_ENST00000603841.1_Missense_Mutation_p.R465H|FBXW7_ENST00000296555.5_Missense_Mutation_p.R347H|FBXW7_ENST00000263981.5_Missense_Mutation_p.R385H|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465H|FBXW7_ENST00000393956.3_Missense_Mutation_p.R289H	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465H(69)|p.R385H(16)|p.R226H(16)|p.R465L(4)|p.R347H(4)|p.R465Y(2)|p.?(1)|p.R385L(1)|p.R226L(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATGCATACAACGCACAGTGGA	0.408			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R385H			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,large_intestine,NS,Substitution - Missense,0 	.	114	Substitution - Missense(113)|Unknown(1)	haematopoietic_and_lymphoid_tissue(40)|large_intestine(39)|endometrium(24)|lung(5)|ovary(4)|cervix(1)|biliary_tract(1)	c.G1154A	4						.						253.0	218.0	230.0					4																	153249384		2203	4300	6503	153468834	SO:0001583	missense	55294	exon8			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1394G>A	4.37:g.153249384C>T	ENSP00000281708:p.Arg465His	Somatic		Capture	Illumina HiSeq	Phase_I	153468834	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	32	5.178201	0.94846	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63827	0.2544	L	0.56124	1.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.62469	-0.6848	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:1.0:0.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	H	465;347;385;289	ENSP00000281708:R465H;ENSP00000296555:R347H;ENSP00000263981:R385H;ENSP00000377528:R289H	ENSP00000263981:R385H	R	-	2	0	FBXW7	153468834	1.000000	0.71417	0.960000	0.40013	0.996000	0.88848	7.818000	0.86416	2.878000	0.98634	0.650000	0.86243	CGT		0.408	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
NEK1	4750	broad.mit.edu	37	4	170321506	170321506	+	Silent	SNP	A	A	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr4:170321506A>T	ENST00000439128.2	-	33	4273	c.3633T>A	c.(3631-3633)gcT>gcA	p.A1211A	NEK1_ENST00000511633.1_Silent_p.A1195A|NEK1_ENST00000512193.1_Silent_p.A1142A|NEK1_ENST00000507142.1_Silent_p.A1239A|NEK1_ENST00000510533.1_Silent_p.A1167A	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	1211					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.A1239A(2)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		CTTCATGAATAGCCTATACCA	0.249																																					p.A1167A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T3501A	4						.						22.0	19.0	20.0					4																	170321506		1721	3956	5677	170558081	SO:0001819	synonymous_variant	4750	exon32			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.3633T>A	4.37:g.170321506A>T		Somatic		Capture	Illumina HiSeq	Phase_I	170558081	NM_001199400	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Silent	SNP	ENST00000439128.2	37	CCDS47162.1																																																																																				0.249	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3		
CENPC	1060	broad.mit.edu	37	4	68374800	68374800	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr4:68374800C>A	ENST00000273853.6	-	10	1886	c.1636G>T	c.(1636-1638)Gta>Tta	p.V546L		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	546					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)	p.V546L(1)									TCATTTCTTACTGAAGAATTG	0.318																																					p.V546L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1636T	4						.						65.0	57.0	60.0					4																	68374800		1846	4078	5924	68057395	SO:0001583	missense	1060	exon10			M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.1636G>T	4.37:g.68374800C>A	ENSP00000273853:p.Val546Leu	Somatic		Capture	Illumina HiSeq	Phase_I	68057395	NM_001812	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	37	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	C	5.184	0.219472	0.09863	.	.	ENSG00000145241	ENST00000273853	.	.	.	4.76	-5.29	0.02747	.	1.036540	0.07616	N	0.926281	T	0.15782	0.0380	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24333	-1.0163	9	0.26408	T	0.33	-1.6726	0.4402	0.00485	0.2815:0.2846:0.1441:0.2898	.	546;546	Q8IW27;Q03188	.;CENPC_HUMAN	L	546	.	ENSP00000273853:V546L	V	-	1	0	CENPC1	68057395	0.000000	0.05858	0.002000	0.10522	0.352000	0.29268	-0.992000	0.03724	-0.568000	0.06038	-0.295000	0.09555	GTA		0.318	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
FAM149A	25854	broad.mit.edu	37	4	187088244	187088244	+	Silent	SNP	G	G	A	rs145714089	byFrequency	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr4:187088244G>A	ENST00000356371.5	+	12	2160	c.2160G>A	c.(2158-2160)acG>acA	p.T720T	FAM149A_ENST00000389354.5_Silent_p.T429T|FAM149A_ENST00000502970.1_Silent_p.T429T|FAM149A_ENST00000503432.1_Silent_p.T429T|FAM149A_ENST00000514153.1_Silent_p.T429T|FAM149A_ENST00000227065.4_Silent_p.T429T			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	720								p.T429T(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		CAACCCACACGTTCCGGGTGG	0.458													G|||	4	0.000798722	0.003	0.0	5008	,	,		19198	0.0		0.0	False		,,,				2504	0.0				p.T429T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1287A	4						.	G	,	5,4401	11.4+/-27.6	0,5,2198	61.0	58.0	59.0		1287,1287	-11.4	0.0	4	dbSNP_134	59	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	FAM149A	NM_001006655.2,NM_015398.2	,	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	,	429/483,429/483	187088244	5,13001	2203	4300	6503	187325238	SO:0001819	synonymous_variant	25854	exon11			AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.2160G>A	4.37:g.187088244G>A		Somatic		Capture	Illumina HiSeq	Phase_I	187325238	NM_001006655	B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Silent	SNP	ENST00000356371.5	37		1|1	4.578754578754579E-4|4.578754578754579E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	4.787|4.787	0.146380|0.146380	0.09134|0.09134	0.001135|0.001135	0.0|0.0	ENSG00000109794|ENSG00000109794	ENST00000510843|ENST00000512271	.|.	.|.	.|.	5.72|5.72	-11.4|-11.4	0.00090|0.00090	.|.	.|.	.|.	.|.	.|.	T|T	0.28863|0.28863	0.0716|0.0716	.|.	.|.	.|.	0.35916|0.35916	D|D	0.831469|0.831469	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.25950|0.25950	-1.0117|-1.0117	4|4	.|.	.|.	.|.	-5.5083|-5.5083	1.04|1.04	0.01557|0.01557	0.309:0.2149:0.288:0.1882|0.309:0.2149:0.288:0.1882	.|.	.|.	.|.	.|.	H|I	107|107	.|.	.|.	R|V	+|+	2|1	0|0	FAM149A|FAM149A	187325238|187325238	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-1.737000|-1.737000	0.01843|0.01843	-2.354000|-2.354000	0.00614|0.00614	-0.952000|-0.952000	0.02654|0.02654	CGT|GTT		0.458	FAM149A-201	KNOWN	basic	protein_coding	protein_coding		NM_001006655	
PPIP5K2	23262	broad.mit.edu	37	5	102520421	102520421	+	Missense_Mutation	SNP	G	G	A	rs140891481		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:102520421G>A	ENST00000358359.3	+	26	3654	c.3145G>A	c.(3145-3147)Gaa>Aaa	p.E1049K	PPIP5K2_ENST00000414217.1_Missense_Mutation_p.E1049K|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.E1049K|PPIP5K2_ENST00000513500.1_3'UTR	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	1049					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)	p.E1049K(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						AACTCTTGTGGAACAGAAGCA	0.343																																					p.E1049K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3145A	5						.	G	LYS/GLU	0,4406		0,0,2203	108.0	106.0	107.0		3145	5.6	1.0	5	dbSNP_134	107	1,8599	1.2+/-3.3	0,1,4299	no	missense	PPIP5K2	NM_015216.2	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1049/1223	102520421	1,13005	2203	4300	6503	102548320	SO:0001583	missense	23262	exon25			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.3145G>A	5.37:g.102520421G>A	ENSP00000351126:p.Glu1049Lys	Somatic		Capture	Illumina HiSeq	Phase_I	102548320	NM_015216	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37		.	.	.	.	.	.	.	.	.	.	G	15.80	2.940732	0.52972	0.0	1.16E-4	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000509597	T;T;T;T	0.23348	2.41;2.43;2.41;1.91	5.62	5.62	0.85841	.	0.070012	0.64402	D	0.000017	T	0.31482	0.0798	L	0.58810	1.83	0.49051	D	0.999748	B;P;B	0.36712	0.077;0.566;0.319	B;B;B	0.40825	0.103;0.341;0.034	T	0.04737	-1.0930	10	0.10111	T	0.7	-20.3297	19.6528	0.95823	0.0:0.0:1.0:0.0	.	1064;1049;1049	E9PGM8;O43314-2;O43314	.;.;VIP2_HUMAN	K	1049;1049;1064;1049;265	ENSP00000313070:E1049K;ENSP00000351126:E1049K;ENSP00000416016:E1049K;ENSP00000424948:E265K	ENSP00000313070:E1049K	E	+	1	0	PPIP5K2	102548320	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.526000	0.81920	2.646000	0.89796	0.655000	0.94253	GAA		0.343	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
LVRN	206338	broad.mit.edu	37	5	115298858	115298858	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:115298858G>A	ENST00000357872.4	+	1	668	c.544G>A	c.(544-546)Gcg>Acg	p.A182T	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		182						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A182T(1)									CGTGTGGTTCGCGCTGGACAC	0.652																																					p.A182T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G544A	5						.						21.0	21.0	21.0					5																	115298858		2198	4297	6495	115326757	SO:0001583	missense	206338	exon1																														ENST00000357872.4:c.544G>A	5.37:g.115298858G>A	ENSP00000350541:p.Ala182Thr	Somatic		Capture	Illumina HiSeq	Phase_I	115326757	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	37	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	G	3.377	-0.127095	0.06795	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.02552	4.25	4.78	-1.07	0.09968	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.771943	0.11370	N	0.570943	T	0.04861	0.0131	L	0.39514	1.22	0.09310	N	0.999994	D	0.67145	0.996	P	0.58391	0.838	T	0.43442	-0.9391	10	0.23302	T	0.38	.	4.4164	0.11459	0.0902:0.4278:0.3365:0.1455	.	182	Q6Q4G3	AMPQ_HUMAN	T	182;171	ENSP00000350541:A182T	ENSP00000350541:A182T	A	+	1	0	AC010282.1	115326757	0.000000	0.05858	0.384000	0.26145	0.008000	0.06430	0.206000	0.17375	0.095000	0.17434	-0.955000	0.02649	GCG		0.652	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
TRPC7	57113	broad.mit.edu	37	5	135692996	135692996	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:135692996C>T	ENST00000513104.1	-	2	362	c.80G>A	c.(79-81)cGg>cAg	p.R27Q	TRPC7_ENST00000355180.3_Missense_Mutation_p.R27Q|TRPC7_ENST00000426057.2_Missense_Mutation_p.R27Q	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	27					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.R27Q(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGCGGGACCCCGGATGGCCTG	0.617																																					p.R27Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G80A	5						.						52.0	59.0	57.0					5																	135692996		2112	4237	6349	135720895	SO:0001583	missense	57113	exon2			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.80G>A	5.37:g.135692996C>T	ENSP00000426070:p.Arg27Gln	Somatic		Capture	Illumina HiSeq	Phase_I	135720895	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	37	CCDS47267.2	.	.	.	.	.	.	.	.	.	.	C	35	5.454479	0.96223	.	.	ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	T;T;T	0.80393	-1.14;-1.3;-1.37	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.87565	0.6209	L	0.55990	1.75	0.42943	D	0.99435	D;D;D;D	0.76494	0.997;0.999;0.998;0.998	D;D;P;P	0.67725	0.953;0.95;0.871;0.871	D	0.87855	0.2660	10	0.62326	D	0.03	-18.7042	19.3333	0.94303	0.0:1.0:0.0:0.0	.	27;27;27;27	Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.;.;.;TRPC7_HUMAN	Q	27	ENSP00000347312:R27Q;ENSP00000441628:R27Q;ENSP00000426070:R27Q	ENSP00000265193:R27Q	R	-	2	0	TRPC7	135720895	1.000000	0.71417	0.995000	0.50966	0.978000	0.69477	7.462000	0.80851	2.793000	0.96121	0.655000	0.94253	CGG		0.617	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
PCDHB12	56124	broad.mit.edu	37	5	140589016	140589016	+	Silent	SNP	C	C	T	rs200859015		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:140589016C>T	ENST00000239450.2	+	1	726	c.537C>T	c.(535-537)caC>caT	p.H179H	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	179	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.H179H(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCATTTCCACGTTAAAATAA	0.423																																					p.H179H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C537T	5						.						69.0	70.0	69.0					5																	140589016		2203	4300	6503	140569200	SO:0001819	synonymous_variant	56124	exon1			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.537C>T	5.37:g.140589016C>T		Somatic		Capture	Illumina HiSeq	Phase_I	140569200	NM_018932	B4DDU1	Silent	SNP	ENST00000239450.2	37	CCDS4254.1																																																																																				0.423	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
PCDHB15	56121	broad.mit.edu	37	5	140626826	140626826	+	Silent	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:140626826C>T	ENST00000231173.3	+	1	1680	c.1680C>T	c.(1678-1680)ttC>ttT	p.F560F		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	560	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.F560F(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTCGCCCTTCGTGCTGTACC	0.721																																					p.F560F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1680T	5						.						18.0	21.0	20.0					5																	140626826		2195	4286	6481	140607010	SO:0001819	synonymous_variant	56121	exon1			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1680C>T	5.37:g.140626826C>T		Somatic		Capture	Illumina HiSeq	Phase_I	140607010	NM_018935	Q8IUX5	Silent	SNP	ENST00000231173.3	37	CCDS4257.1																																																																																				0.721	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
MED10	84246	broad.mit.edu	37	5	6372670	6372670	+	Silent	SNP	C	C	T	rs151062073	byFrequency	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:6372670C>T	ENST00000255764.3	-	4	464	c.354G>A	c.(352-354)ccG>ccA	p.P118P		NM_032286.2	NP_115662.2	Q9BTT4	MED10_HUMAN	mediator complex subunit 10	118					gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.P118P(1)		kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|urinary_tract(1)	5						CCATGTCTTCCGGAAATACTT	0.448																																					p.P118P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G354A	5						.	C		1,4405	2.1+/-5.4	0,1,2202	99.0	104.0	102.0		354	-10.3	0.3	5	dbSNP_134	102	0,8600		0,0,4300	no	coding-synonymous	MED10	NM_032286.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		118/136	6372670	1,13005	2203	4300	6503	6425670	SO:0001819	synonymous_variant	84246	exon4				CCDS34134.1	5p15.31	2008-02-05	2007-07-30		ENSG00000133398	ENSG00000133398			28760	protein-coding gene	gene with protein product	"""NUT2 homolog (S. cerevisiae)"""	612382	"""mediator of RNA polymerase II transcription, subunit 10 homolog (NUT2, S. cerevisiae)"""			15657623, 15175163	Standard	NM_032286		Approved	TRG20, L6, MGC5309, NUT2	uc003jdo.3	Q9BTT4	OTTHUMG00000161682	ENST00000255764.3:c.354G>A	5.37:g.6372670C>T		Somatic		Capture	Illumina HiSeq	Phase_I	6425670	NM_032286	C6G491	Silent	SNP	ENST00000255764.3	37	CCDS34134.1																																																																																				0.448	MED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365714.1	NM_032286	
ITGA2	3673	broad.mit.edu	37	5	52285352	52285352	+	Silent	SNP	G	G	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:52285352G>T	ENST00000296585.5	+	1	197	c.54G>T	c.(52-54)gcG>gcT	p.A18A	CTD-2175A23.1_ENST00000503559.1_RNA|CTD-2175A23.1_ENST00000505701.1_RNA	NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	18					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.A18A(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TGGTGTTAGCGCTCAGTCAAG	0.672																																					p.A18A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G54T	5						.						51.0	59.0	56.0					5																	52285352		2203	4300	6503	52321109	SO:0001819	synonymous_variant	3673	exon1				CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.54G>T	5.37:g.52285352G>T		Somatic		Capture	Illumina HiSeq	Phase_I	52321109	NM_002203	Q14595	Silent	SNP	ENST00000296585.5	37	CCDS3957.1																																																																																				0.672	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
MARVELD2	153562	broad.mit.edu	37	5	68715450	68715450	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:68715450C>T	ENST00000325631.5	+	2	312	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C	MARVELD2_ENST00000413223.2_Missense_Mutation_p.R80C	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	80					cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)		p.R80C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		ACCAGTAAGGCGCTTTGTCCC	0.517																																					p.R80C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C238T	5						.						61.0	65.0	64.0					5																	68715450		2203	4300	6503	68751206	SO:0001583	missense	153562	exon2			AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.238C>T	5.37:g.68715450C>T	ENSP00000323264:p.Arg80Cys	Somatic		Capture	Illumina HiSeq	Phase_I	68751206	NM_001038603	A1BQX0|A1BQX1|A8KA97|Q96NM9	Missense_Mutation	SNP	ENST00000325631.5	37	CCDS34175.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826088	0.50739	.	.	ENSG00000152939	ENST00000325631;ENST00000282886;ENST00000454295;ENST00000515844;ENST00000512803;ENST00000436532;ENST00000413223	T;T;T;T;T;T	0.80214	1.15;0.59;-1.35;1.17;1.06;1.06	5.09	4.13	0.48395	.	0.000000	0.85682	D	0.000000	D	0.87845	0.6280	M	0.73962	2.25	0.50813	D	0.99989	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74674	0.959;0.979;0.984	D	0.88863	0.3327	10	0.87932	D	0	-5.3823	11.9882	0.53159	0.2778:0.7222:0.0:0.0	.	80;80;80	Q8N4S9-3;Q8N4S9-2;Q8N4S9	.;.;MALD2_HUMAN	C	80	ENSP00000323264:R80C;ENSP00000396244:R80C;ENSP00000421902:R80C;ENSP00000423490:R80C;ENSP00000414776:R80C;ENSP00000398922:R80C	ENSP00000282886:R80C	R	+	1	0	MARVELD2	68751206	0.998000	0.40836	0.986000	0.45419	0.983000	0.72400	3.546000	0.53656	2.369000	0.80426	0.563000	0.77884	CGC		0.517	MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369583.1	NM_144724	
GPR98	84059	broad.mit.edu	37	5	90072291	90072291	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:90072291G>A	ENST00000405460.2	+	61	12521	c.12425G>A	c.(12424-12426)cGg>cAg	p.R4142Q		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4142	Calx-beta 28. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.R4142Q(2)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATAATTATTCGGGGTGATAAG	0.423																																					p.R4142Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.G12425A	5						.						108.0	107.0	108.0					5																	90072291		1929	4135	6064	90108047	SO:0001583	missense	84059	exon61			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.12425G>A	5.37:g.90072291G>A	ENSP00000384582:p.Arg4142Gln	Somatic		Capture	Illumina HiSeq	Phase_I	90108047	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	7.559	0.664270	0.14710	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.27104	1.69	5.27	1.13	0.20643	.	0.316290	0.31199	N	0.008073	T	0.12475	0.0303	N	0.22421	0.69	0.09310	N	0.999999	B	0.25486	0.127	B	0.12837	0.008	T	0.13124	-1.0521	10	0.38643	T	0.18	.	4.2706	0.10785	0.08:0.1153:0.2817:0.523	.	4142	Q8WXG9	GPR98_HUMAN	Q	4142	ENSP00000384582:R4142Q	ENSP00000296619:R4142Q	R	+	2	0	GPR98	90108047	0.001000	0.12720	0.639000	0.29394	0.143000	0.21401	0.551000	0.23361	0.680000	0.31366	0.637000	0.83480	CGG		0.423	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
APC	324	broad.mit.edu	37	5	112175553	112175553	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:112175553delG	ENST00000457016.1	+	16	4642	c.4262delG	c.(4261-4263)agtfs	p.S1421fs	APC_ENST00000508376.2_Frame_Shift_Del_p.S1421fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.S1421fs			P25054	APC_HUMAN	adenomatous polyposis coli	1421	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.D1422fs*2(2)|p.P1420fs*2(1)|p.Y1376fs*41(1)|p.?(1)|p.S1421fs*52(1)|p.S1411fs*41(1)|p.K1192fs*3(1)|p.D1422fs*1(1)|p.S1421fs*2(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ATAAGCCCCAGTGATCTTCCA	0.473		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1403fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Missense,-2 	.	10	Deletion - Frameshift(8)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(7)|soft_tissue(2)|skin(1)	c.4208delG	5						.						107.0	98.0	101.0					5																	112175553		2202	4300	6502	112203452	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4262delG	5.37:g.112175553delG	ENSP00000413133:p.Ser1421fs	Somatic		Capture	Illumina HiSeq	Phase_I	112203452	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.473	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
TENM2	57451	broad.mit.edu	37	5	167645745	167645745	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr5:167645745T>A	ENST00000518659.1	+	23	4888	c.4849T>A	c.(4849-4851)Ttc>Atc	p.F1617I	TENM2_ENST00000519204.1_Missense_Mutation_p.F1496I|TENM2_ENST00000545108.1_Missense_Mutation_p.F1616I|TENM2_ENST00000520394.1_Missense_Mutation_p.F1378I|TENM2_ENST00000403607.2_Missense_Mutation_p.F1441I	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1617					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.F1617I(1)|p.F1450I(1)									CTTGTACAATTTCACATATAG	0.488																																					p.F1608I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T4822A	5						.						100.0	100.0	100.0					5																	167645745		2008	4182	6190	167578323	SO:0001583	missense	57451	exon23			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4849T>A	5.37:g.167645745T>A	ENSP00000429430:p.Phe1617Ile	Somatic		Capture	Illumina HiSeq	Phase_I	167578323	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	T	24.1	4.497478	0.85069	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.55930	1.83;0.49;1.83;1.83;1.83	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.77538	0.4145	M	0.88310	2.945	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.992	D;D;D	0.91635	0.999;0.998;0.974	T	0.82252	-0.0549	10	0.87932	D	0	.	16.2303	0.82332	0.0:0.0:0.0:1.0	.	1616;1617;1378	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	I	1617;1616;1496;1378;1441	ENSP00000429430:F1617I;ENSP00000438635:F1616I;ENSP00000428964:F1496I;ENSP00000427874:F1378I;ENSP00000384905:F1441I	ENSP00000384905:F1441I	F	+	1	0	ODZ2	167578323	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.040000	0.89188	2.233000	0.73108	0.533000	0.62120	TTC		0.488	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
PLEKHG1	57480	broad.mit.edu	37	6	151153335	151153335	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr6:151153335G>A	ENST00000358517.2	+	15	3299	c.3088G>A	c.(3088-3090)Gcc>Acc	p.A1030T	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.A1030T			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	1030							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A1030T(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		AGGAGGGCCCGCCATTGGTAT	0.527																																					p.A1030T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3088A	6						.						37.0	41.0	39.0					6																	151153335		2189	4271	6460	151195028	SO:0001583	missense	57480	exon16			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.3088G>A	6.37:g.151153335G>A	ENSP00000351318:p.Ala1030Thr	Somatic		Capture	Illumina HiSeq	Phase_I	151195028	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	G	34	5.298273	0.95574	.	.	ENSG00000120278	ENST00000367328;ENST00000358517	T;T	0.34667	1.35;1.35	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.55609	0.1931	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	T	0.56956	-0.7893	10	0.87932	D	0	.	20.0418	0.97594	0.0:0.0:1.0:0.0	.	837;1030;1030	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	T	1030	ENSP00000356297:A1030T;ENSP00000351318:A1030T	ENSP00000351318:A1030T	A	+	1	0	PLEKHG1	151195028	1.000000	0.71417	0.966000	0.40874	0.981000	0.71138	9.466000	0.97665	2.737000	0.93849	0.643000	0.83706	GCC		0.527	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
SYNE1	23345	broad.mit.edu	37	6	152683316	152683316	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr6:152683316C>T	ENST00000367255.5	-	64	10889	c.10288G>A	c.(10288-10290)Gga>Aga	p.G3430R	SYNE1_ENST00000448038.1_Missense_Mutation_p.G3437R|SYNE1_ENST00000423061.1_Missense_Mutation_p.G3437R|SYNE1_ENST00000341594.5_Missense_Mutation_p.G3449R|SYNE1_ENST00000265368.4_Missense_Mutation_p.G3430R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3430					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.G3430R(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTGGCTTTTCCGAGCATCGTT	0.473										HNSCC(10;0.0054)																											p.G3437R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G10309A	6						.						118.0	105.0	110.0					6																	152683316		2203	4300	6503	152725009	SO:0001583	missense	23345	exon64			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10288G>A	6.37:g.152683316C>T	ENSP00000356224:p.Gly3430Arg	Somatic		Capture	Illumina HiSeq	Phase_I	152725009	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	10.75	1.438421	0.25900	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.47528	1.48;1.48;1.48;1.48;0.84	5.46	5.46	0.80206	.	0.109676	0.41396	D	0.000896	T	0.47116	0.1428	L	0.53249	1.67	0.80722	D	1	D;D;D;D	0.76494	0.998;0.998;0.998;0.999	D;D;D;D	0.72982	0.952;0.952;0.952;0.979	T	0.39251	-0.9623	10	0.15952	T	0.53	.	9.9266	0.41496	0.0:0.8437:0.0:0.1563	.	3430;3430;3430;3437	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	R	3430;3437;3430;3437;3449	ENSP00000356224:G3430R;ENSP00000396024:G3437R;ENSP00000265368:G3430R;ENSP00000390975:G3437R;ENSP00000341887:G3449R	ENSP00000265368:G3430R	G	-	1	0	SYNE1	152725009	0.966000	0.33281	0.074000	0.20217	0.241000	0.25554	2.840000	0.48215	2.713000	0.92767	0.655000	0.94253	GGA		0.473	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
LRFN2	57497	broad.mit.edu	37	6	40360117	40360117	+	Silent	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr6:40360117G>A	ENST00000338305.6	-	3	2477	c.1935C>T	c.(1933-1935)tcC>tcT	p.S645S		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	645						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.S645S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGCGCGGGGCGGAGGGTGGGA	0.711																																					p.S645S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1935T	6						.						6.0	7.0	7.0					6																	40360117		2132	4195	6327	40468095	SO:0001819	synonymous_variant	57497	exon3			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1935C>T	6.37:g.40360117G>A		Somatic		Capture	Illumina HiSeq	Phase_I	40468095	NM_020737	A5PKU3|Q5SYP9	Silent	SNP	ENST00000338305.6	37	CCDS34443.1																																																																																				0.711	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
TTBK1	84630	broad.mit.edu	37	6	43222851	43222851	+	Splice_Site	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr6:43222851G>A	ENST00000259750.4	+	7	724	c.641G>A	c.(640-642)cGg>cAg	p.R214Q	TTBK1_ENST00000304139.5_Splice_Site_p.R163Q	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	214	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R214Q(2)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CACAAGAACCGGGTGAGTGGC	0.632																																					p.R214Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G641A	6						.						85.0	69.0	74.0					6																	43222851		2203	4300	6503	43330829	SO:0001630	splice_region_variant	84630	exon7			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.642+1G>A	6.37:g.43222851G>A		Somatic		Capture	Illumina HiSeq	Phase_I	43330829	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816459	0.50527	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	T	0.06218	3.33	3.98	3.98	0.46160	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.257195	0.38326	N	0.001727	T	0.03095	0.0091	L	0.35542	1.07	0.46028	D	0.998828	P	0.42456	0.78	B	0.39531	0.302	T	0.51387	-0.8712	10	0.49607	T	0.09	.	15.0149	0.71576	0.0:0.0:1.0:0.0	.	214	Q5TCY1	TTBK1_HUMAN	Q	163;214;163	ENSP00000259750:R214Q	ENSP00000259750:R214Q	R	+	2	0	TTBK1	43330829	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.642000	0.74329	2.066000	0.61787	0.655000	0.94253	CGG		0.632	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		Missense_Mutation
CYB5R4	51167	broad.mit.edu	37	6	84627781	84627782	+	Missense_Mutation	DNP	CA	CA	AC			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr6:84627781_84627782CA>AC	ENST00000369681.5	+	6	643_644	c.503_504CA>AC	c.(502-504)cCA>cAC	p.P168H		NM_016230.3	NP_057314.2	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	168	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				cell development (GO:0048468)|detection of oxygen (GO:0003032)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NAD(P)H oxidase activity (GO:0016174)|NADPH-hemoprotein reductase activity (GO:0003958)|oxidoreductase activity, acting on NAD(P)H, heme protein as acceptor (GO:0016653)	p.P168>?(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	23		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		CCTAGTTATCCAAGGTATGCAT	0.302																																					.	Esophageal Squamous(86;1289 1332 25971 40349 52675)											.	.	1	Complex(1)	large_intestine(1)	c.503_504AC	6						.																																			84684501	SO:0001583	missense	51167	exon6			AF169803	CCDS5000.2	6q14.2	2012-09-19		2005-07-13	ENSG00000065615	ENSG00000065615	1.6.2.2		20147	protein-coding gene	gene with protein product		608343	"""NADPH cytochrome B5 oxidoreductase"""	NCB5OR		10611283	Standard	NM_016230		Approved	b5+b5R, dJ676J13.1	uc003pkf.3	Q7L1T6	OTTHUMG00000015118	Exception_encountered	6.37:g.84627781_84627782delinsAC	ENSP00000358695:p.Pro168His	Somatic		Capture	Illumina HiSeq	Phase_I	84684500	NM_016230	B1AEM2|Q5TGI9|Q9NUE4|Q9UHI9	Missense_Mutation	DNP	ENST00000369681.5	37	CCDS5000.2																																																																																				0.302	CYB5R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041362.4	NM_016230	
PM20D2	135293	broad.mit.edu	37	6	89862872	89862872	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr6:89862872G>C	ENST00000275072.4	+	3	820	c.725G>C	c.(724-726)aGa>aCa	p.R242T		NM_001010853.1	NP_001010853.1	Q8IYS1	P20D2_HUMAN	peptidase M20 domain containing 2	242						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.R242T(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|skin(1)	12		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)		TCTGTGTTCAGACAGCAAATG	0.373																																					p.R242T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G725C	6						.						101.0	90.0	94.0					6																	89862872		2203	4300	6503	89919591	SO:0001583	missense	135293	exon3			BC035036	CCDS34499.1	6q15	2014-07-14	2007-11-14	2007-11-14	ENSG00000146281	ENSG00000146281			21408	protein-coding gene	gene with protein product	"""&#946;-alanyl-lysine dipeptidase"""	615913	"""aminoacylase 1-like 2"""	ACY1L2		24891507	Standard	NM_001010853		Approved	bA63L7.3	uc003pmz.4	Q8IYS1	OTTHUMG00000015193	ENST00000275072.4:c.725G>C	6.37:g.89862872G>C	ENSP00000275072:p.Arg242Thr	Somatic		Capture	Illumina HiSeq	Phase_I	89919591	NM_001010853	B4DYJ2|Q5T7J9|Q6MZV2|Q86XD9	Missense_Mutation	SNP	ENST00000275072.4	37	CCDS34499.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779503	0.70107	.	.	ENSG00000146281	ENST00000275072	T	0.57107	0.42	5.69	5.69	0.88448	Peptidase M20, dimerisation (2);	0.000000	0.85682	D	0.000000	D	0.83505	0.5269	H	0.98980	4.39	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	D	0.89906	0.4048	10	0.87932	D	0	-13.6986	19.8165	0.96571	0.0:0.0:1.0:0.0	.	242	Q8IYS1	P20D2_HUMAN	T	242	ENSP00000275072:R242T	ENSP00000275072:R242T	R	+	2	0	PM20D2	89919591	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	8.916000	0.92745	2.683000	0.91414	0.655000	0.94253	AGA		0.373	PM20D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041477.1	NM_001010853	
TCP10	6953	broad.mit.edu	37	6	167786657	167786657	+	Nonstop_Mutation	SNP	T	T	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr6:167786657T>C	ENST00000397829.4	-	8	1148	c.981A>G	c.(979-981)tgA>tgG	p.*327W	TCP10_ENST00000366827.2_Intron	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	0						cytosol (GO:0005829)		p.*327W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		GGCCTCCAGGTCAGGGCCCCA	0.507																																					p.X327W												.	.	1	Nonstop extension(1)	large_intestine(1)	c.A981G	6						.						57.0	64.0	62.0					6																	167786657		1854	4097	5951	167706647	SO:0001578	stop_lost	6953	exon8			U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.981A>G	6.37:g.167786657T>C	ENSP00000380929:p.*327Cysext*33	Somatic		Capture	Illumina HiSeq	Phase_I	167706647	NM_004610	Q5JR60|Q6P4F4	Nonstop_Mutation	SNP	ENST00000397829.4	37	CCDS43527.1	.	.	.	.	.	.	.	.	.	.	t	3.150	-0.174466	0.06421	.	.	ENSG00000203690	ENST00000397829	.	.	.	1.64	0.452	0.16634	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.3625	0.07192	0.0:0.2328:0.0:0.7672	.	.	.	.	W	327	.	.	X	-	3	0	TCP10	167706647	0.000000	0.05858	0.002000	0.10522	0.077000	0.17291	-1.026000	0.03596	0.118000	0.18165	0.383000	0.25322	TGA		0.507	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365570.1	NM_004610	
PPP1R3A	5506	broad.mit.edu	37	7	113518560	113518560	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr7:113518560C>A	ENST00000284601.3	-	4	2655	c.2587G>T	c.(2587-2589)Gat>Tat	p.D863Y		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	863					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.D863Y(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						AACTGTAAATCCAGTTTTGAA	0.378																																					p.D863Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2587T	7						.						148.0	142.0	144.0					7																	113518560		2203	4300	6503	113305796	SO:0001583	missense	5506	exon4			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2587G>T	7.37:g.113518560C>A	ENSP00000284601:p.Asp863Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	113305796	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	8.499	0.863708	0.17250	.	.	ENSG00000154415	ENST00000284601	T	0.24723	1.84	5.81	4.03	0.46877	.	0.307453	0.28560	N	0.014902	T	0.41442	0.1159	M	0.64997	1.995	0.20821	N	0.999842	D	0.71674	0.998	P	0.57244	0.816	T	0.29212	-1.0019	10	0.72032	D	0.01	-12.3279	12.559	0.56271	0.0:0.8654:0.0:0.1346	.	863	Q16821	PPR3A_HUMAN	Y	863	ENSP00000284601:D863Y	ENSP00000284601:D863Y	D	-	1	0	PPP1R3A	113305796	0.925000	0.31364	0.494000	0.27515	0.006000	0.05464	1.961000	0.40432	0.803000	0.34113	-0.143000	0.13931	GAT		0.378	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
PRSS58	136541	broad.mit.edu	37	7	141954967	141954967	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr7:141954967T>C	ENST00000552471.1	-	3	663	c.344A>G	c.(343-345)gAc>gGc	p.D115G	PRSS58_ENST00000547058.2_Missense_Mutation_p.D115G			Q8IYP2	PRS58_HUMAN	protease, serine, 58	115	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.D115G(1)		kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						TTTCACATAGTCATTGAGTTC	0.408																																					p.D115G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A344G	7						.						255.0	231.0	239.0					7																	141954967		2203	4300	6503	141601444	SO:0001583	missense	136541	exon4				CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.344A>G	7.37:g.141954967T>C	ENSP00000446916:p.Asp115Gly	Somatic		Capture	Illumina HiSeq	Phase_I	141601444	NM_001001317	B3KVJ6|D3DXD2	Missense_Mutation	SNP	ENST00000552471.1	37	CCDS5871.1	.	.	.	.	.	.	.	.	.	.	T	11.14	1.552384	0.27739	.	.	ENSG00000258223	ENST00000547058;ENST00000552471	D;D	0.82711	-1.64;-1.64	5.04	2.52	0.30459	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.77738	0.4175	M	0.62154	1.92	0.09310	N	1	P	0.39424	0.673	B	0.37550	0.253	T	0.69331	-0.5173	9	0.56958	D	0.05	.	5.398	0.16281	0.0:0.0932:0.272:0.6348	.	115	Q8IYP2	PRS58_HUMAN	G	115	ENSP00000447588:D115G;ENSP00000446916:D115G	ENSP00000307206:D115G	D	-	2	0	PRSS58	141601444	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.404000	0.20999	1.059000	0.40554	-0.256000	0.11100	GAC		0.408	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351328.2	NM_001001317	
ABCB5	340273	broad.mit.edu	37	7	20768012	20768012	+	Missense_Mutation	SNP	C	C	T	rs371459532		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr7:20768012C>T	ENST00000404938.2	+	23	3453	c.2801C>T	c.(2800-2802)gCg>gTg	p.A934V	ABCB5_ENST00000258738.6_Missense_Mutation_p.A489V	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	934	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.A489V(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TTTGCCTATGCGGCAGGGTTT	0.423																																					p.A489V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1466T	7						.	C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	129.0	129.0	129.0		2801,1466	3.9	0.9	7		129	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ABCB5	NM_001163941.1,NM_178559.5	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	934/1258,489/813	20768012	1,13005	2203	4300	6503	20734537	SO:0001583	missense	340273	exon14			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2801C>T	7.37:g.20768012C>T	ENSP00000384881:p.Ala934Val	Somatic		Capture	Illumina HiSeq	Phase_I	20734537	NM_178559	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306909	0.81247	0.0	1.16E-4	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.90133	-2.62;-2.62	3.91	3.91	0.45181	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.52532	D	0.000062	D	0.95689	0.8598	M	0.91300	3.195	0.51012	D	0.999903	D;D;D	0.89917	0.999;1.0;0.995	D;P;P	0.67103	0.949;0.904;0.899	D	0.96323	0.9238	10	0.87932	D	0	.	14.2264	0.65863	0.0:1.0:0.0:0.0	.	934;112;489	A7BKA4;A0ASV4;Q2M3G0	.;.;ABCB5_HUMAN	V	934;489	ENSP00000384881:A934V;ENSP00000258738:A489V	ENSP00000258738:A489V	A	+	2	0	ABCB5	20734537	1.000000	0.71417	0.943000	0.38184	0.979000	0.70002	5.943000	0.70211	2.472000	0.83506	0.655000	0.94253	GCG		0.423	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
BBS9	27241	broad.mit.edu	37	7	33296863	33296863	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr7:33296863G>A	ENST00000242067.6	+	6	979	c.458G>A	c.(457-459)tGc>tAc	p.C153Y	BBS9_ENST00000425508.2_Missense_Mutation_p.C108Y|BBS9_ENST00000354265.4_Missense_Mutation_p.C153Y|BBS9_ENST00000355070.2_Missense_Mutation_p.C153Y|BBS9_ENST00000350941.3_Missense_Mutation_p.C153Y|BBS9_ENST00000396127.2_Missense_Mutation_p.C153Y	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	153					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.C153Y(2)	BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			GATTTAATTTGCATCCAGTCT	0.343									Bardet-Biedl syndrome																												p.C153Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G458A	7						.						123.0	117.0	119.0					7																	33296863		2203	4300	6503	33263388	SO:0001583	missense	27241	exon6	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.458G>A	7.37:g.33296863G>A	ENSP00000242067:p.Cys153Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	33263388	NM_001033605	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	37	CCDS43566.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.639577	0.87760	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000425508;ENST00000442858;ENST00000537775	D;D;D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46	5.86	5.86	0.93980	.	0.088525	0.85682	D	0.000000	D	0.95385	0.8502	M	0.85777	2.775	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.962;1.0;0.962	D;D;D;D;D	0.87578	0.991;0.998;0.941;0.998;0.921	D	0.95314	0.8414	10	0.87932	D	0	-7.5223	20.2019	0.98263	0.0:0.0:1.0:0.0	.	153;153;153;153;153	B3KQ86;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.;.;.;.;PTHB1_HUMAN	Y	153;153;153;153;153;153;153;108;31;31	ENSP00000242067:C153Y;ENSP00000313122:C153Y;ENSP00000379433:C153Y;ENSP00000347182:C153Y;ENSP00000346214:C153Y;ENSP00000405151:C108Y;ENSP00000388646:C31Y	ENSP00000242067:C153Y	C	+	2	0	BBS9	33263388	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.873000	0.87193	2.776000	0.95493	0.655000	0.94253	TGC		0.343	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1		
GTF2IRD1	9569	broad.mit.edu	37	7	73961570	73961570	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr7:73961570C>T	ENST00000265755.3	+	17	2263	c.1870C>T	c.(1870-1872)Cgg>Tgg	p.R624W	GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.R656W|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.R624W|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.R624W|GTF2IRD1_ENST00000489094.1_3'UTR	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	624					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R624W(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CGCCAAGCTCCGGAAGATTCT	0.592																																					p.R624W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1870T	7						.						32.0	29.0	30.0					7																	73961570		2203	4300	6503	73599506	SO:0001583	missense	9569	exon17			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1870C>T	7.37:g.73961570C>T	ENSP00000265755:p.Arg624Trp	Somatic		Capture	Illumina HiSeq	Phase_I	73599506	NM_005685	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973356	0.53614	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	4.32	3.43	0.39272	.	0.060296	0.64402	D	0.000011	T	0.54711	0.1875	L	0.53249	1.67	0.51482	D	0.999928	D;D;P;B	0.89917	1.0;0.999;0.492;0.154	D;D;B;B	0.70935	0.971;0.936;0.118;0.039	T	0.52268	-0.8598	10	0.44086	T	0.13	-4.536	10.4917	0.44754	0.492:0.508:0.0:0.0	.	656;624;624;624	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	W	624;656;624;624	ENSP00000265755:R624W;ENSP00000397566:R656W;ENSP00000408477:R624W;ENSP00000418383:R624W	ENSP00000265755:R624W	R	+	1	2	GTF2IRD1	73599506	0.997000	0.39634	0.998000	0.56505	0.994000	0.84299	2.617000	0.46385	1.002000	0.39104	0.555000	0.69702	CGG		0.592	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
ADAM22	53616	broad.mit.edu	37	7	87795186	87795186	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr7:87795186T>C	ENST00000265727.7	+	24	2195	c.2116T>C	c.(2116-2118)Tgg>Cgg	p.W706R	ADAM22_ENST00000398204.4_Missense_Mutation_p.W706R|ADAM22_ENST00000398209.3_Missense_Mutation_p.W706R|ADAM22_ENST00000315984.7_Missense_Mutation_p.W706R|ADAM22_ENST00000398201.4_Missense_Mutation_p.W706R			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	706	EGF-like.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.W706R(2)		endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TAACAGACACTGGATAGGTTC	0.388																																					p.W706R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2116C	7						.						142.0	132.0	135.0					7																	87795186		1927	4130	6057	87633122	SO:0001583	missense	53616	exon24			AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.2116T>C	7.37:g.87795186T>C	ENSP00000265727:p.Trp706Arg	Somatic		Capture	Illumina HiSeq	Phase_I	87633122	NM_021722	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	ENST00000265727.7	37	CCDS47637.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.0|24.0	4.481140|4.481140	0.84747|0.84747	.|.	.|.	ENSG00000008277|ENSG00000008277	ENST00000413139|ENST00000398204;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203;ENST00000426930	.|T;T;T;T;T;T;T	.|0.44881	.|3.5;3.53;3.54;3.65;3.62;3.56;0.91	5.88|5.88	5.88|5.88	0.94601|0.94601	.|Epidermal growth factor-like (1);EGF-like region, conserved site (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73497|0.73497	0.3594|0.3594	M|M	0.94021|0.94021	3.485|3.485	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.994;0.997;0.994;1.0	T|T	0.81174|0.81174	-0.1053|-0.1053	5|10	.|0.87932	.|D	.|0	.|.	15.2494|15.2494	0.73532|0.73532	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|758;706;706;706	.|E9PBH5;Q9P0K1-5;Q9P0K1;Q9P0K1-2	.|.;.;ADA22_HUMAN;.	P|R	5|706;706;706;706;706;673;64	.|ENSP00000381262:W706R;ENSP00000381260:W706R;ENSP00000265727:W706R;ENSP00000315900:W706R;ENSP00000381267:W706R;ENSP00000381261:W673R;ENSP00000396233:W64R	.|ENSP00000265727:W706R	L|W	+|+	2|1	0|0	ADAM22|ADAM22	87633122|87633122	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.136000|7.136000	0.77285|0.77285	2.244000|2.244000	0.73946|0.73946	0.528000|0.528000	0.53228|0.53228	CTG|TGG		0.388	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	
C7orf62	219557	broad.mit.edu	37	7	88423920	88423920	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr7:88423920C>A	ENST00000297203.2	-	2	522	c.337G>T	c.(337-339)Gat>Tat	p.D113Y	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	113								p.D113Y(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						CCAATATAATCTAAAAGAACT	0.373																																					p.D113Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G337T	7						.						55.0	56.0	56.0					7																	88423920		2203	4300	6503	88261856	SO:0001583	missense	219557	exon2			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.337G>T	7.37:g.88423920C>A	ENSP00000297203:p.Asp113Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	88261856	NM_152706		Missense_Mutation	SNP	ENST00000297203.2	37	CCDS34678.1	.	.	.	.	.	.	.	.	.	.	C	13.42	2.232554	0.39498	.	.	ENSG00000164645	ENST00000297203	T	0.22743	1.94	6.06	6.06	0.98353	.	0.156761	0.53938	D	0.000041	T	0.47857	0.1468	M	0.73598	2.24	0.38627	D	0.951286	D	0.89917	1.0	D	0.74348	0.983	T	0.49447	-0.8939	10	0.87932	D	0	-26.3381	16.1399	0.81515	0.0:1.0:0.0:0.0	.	113	Q8TBZ9	CG062_HUMAN	Y	113	ENSP00000297203:D113Y	ENSP00000297203:D113Y	D	-	1	0	C7orf62	88261856	0.779000	0.28652	0.699000	0.30290	0.026000	0.11368	3.735000	0.55044	2.880000	0.98712	0.650000	0.86243	GAT		0.373	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332714.1	NM_152706	
ZNF804B	219578	broad.mit.edu	37	7	88963479	88963479	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr7:88963479C>A	ENST00000333190.4	+	4	1792	c.1183C>A	c.(1183-1185)Caa>Aaa	p.Q395K		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	395							metal ion binding (GO:0046872)	p.Q395K(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GCCAAGTGAACAAAAGAGTAC	0.383										HNSCC(36;0.09)																											p.Q395K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1183A	7						.						46.0	52.0	50.0					7																	88963479		2203	4300	6503	88801415	SO:0001583	missense	219578	exon4			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1183C>A	7.37:g.88963479C>A	ENSP00000329638:p.Gln395Lys	Somatic		Capture	Illumina HiSeq	Phase_I	88801415	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.339630	0.00224	.	.	ENSG00000182348	ENST00000333190	T	0.04706	3.57	5.19	-0.447	0.12234	.	0.499250	0.18623	N	0.135813	T	0.02767	0.0083	L	0.33485	1.01	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.48210	-0.9055	10	0.05436	T	0.98	-2.3582	5.8442	0.18657	0.4895:0.3349:0.1111:0.0645	.	395	A4D1E1	Z804B_HUMAN	K	395	ENSP00000329638:Q395K	ENSP00000329638:Q395K	Q	+	1	0	ZNF804B	88801415	0.017000	0.18338	0.072000	0.20136	0.138000	0.21146	0.203000	0.17315	0.021000	0.15133	-0.182000	0.12963	CAA		0.383	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
ZNF783	100289678	broad.mit.edu	37	7	148975500	148975500	+	Silent	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr7:148975500G>A	ENST00000434415.1	+	5	847	c.684G>A	c.(682-684)ccG>ccA	p.P228P	ZNF783_ENST00000489518.1_3'UTR	NM_001195220.1	NP_001182149.1	Q6ZMS7	ZN783_HUMAN	zinc finger family member 783	228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P228P(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)	22	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.0014)			GCCTCCCTCCGTATCCAGAGC	0.602																																					p.P228P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G684A	7						.						36.0	41.0	39.0					7																	148975500		2059	4198	6257	148606433	SO:0001819	synonymous_variant	155060	exon5			AK131504	CCDS56519.1	7q36.1	2013-01-08	2008-05-28		ENSG00000204946	ENSG00000204946		"""Zinc fingers, C2H2-type"", ""-"""	27222	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001195220		Approved	DKFZp667J212	uc011kuo.2	Q6ZMS7	OTTHUMG00000158969	ENST00000434415.1:c.684G>A	7.37:g.148975500G>A		Somatic		Capture	Illumina HiSeq	Phase_I	148606433	NM_001195220	C9J9J2	Silent	SNP	ENST00000434415.1	37	CCDS56519.1																																																																																				0.602	ZNF783-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352715.1	NM_001195220	
CSMD1	64478	broad.mit.edu	37	8	2824131	2824131	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr8:2824131C>A	ENST00000520002.1	-	59	9619	c.9064G>T	c.(9064-9066)Gcc>Tcc	p.A3022S	CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000537824.1_Missense_Mutation_p.A3021S|CSMD1_ENST00000602557.1_Missense_Mutation_p.A3022S|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3022	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.A3021S(1)|p.A2750S(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GTCCCATTGGCTGTGCAATGC	0.498																																					p.S3021I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G9062T	8						.						64.0	68.0	67.0					8																	2824131		2075	4222	6297	2811538	SO:0001583	missense	64478	exon58					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9064G>T	8.37:g.2824131C>A	ENSP00000430733:p.Ala3022Ser	Somatic		Capture	Illumina HiSeq	Phase_I	2811538	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.56|14.56	2.572078|2.572078	0.45798|0.45798	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000520002;ENST00000318252;ENST00000537824|ENST00000335551	T;T|.	0.63913|.	-0.07;-0.07|.	5.46|5.46	4.59|4.59	0.56863|0.56863	Complement control module (2);Sushi/SCR/CCP (3);|.	0.140991|.	0.47852|.	D|.	0.000215|.	T|T	0.56470|0.56470	0.1987|0.1987	L|L	0.37466|0.37466	1.105|1.105	0.80722|0.80722	D|D	1|1	B;B|.	0.21606|.	0.058;0.028|.	B;B|.	0.27887|.	0.047;0.084|.	T|T	0.52689|0.52689	-0.8542|-0.8542	10|5	0.30854|.	T|.	0.27|.	.|.	14.3252|14.3252	0.66515|0.66515	0.0:0.9286:0.0:0.0714|0.0:0.9286:0.0:0.0714	.|.	3022;3022|.	E5RIG2;Q96PZ7|.	.;CSMD1_HUMAN|.	S|I	3022;2883;3021|2438	ENSP00000430733:A3022S;ENSP00000441462:A3021S|.	ENSP00000320445:A2883S|.	A|S	-|-	1|2	0|0	CSMD1|CSMD1	2811538|2811538	0.993000|0.993000	0.37304|0.37304	0.856000|0.856000	0.33681|0.33681	0.826000|0.826000	0.46750|0.46750	2.947000|2.947000	0.49058|0.49058	1.303000|1.303000	0.44873|0.44873	0.655000|0.655000	0.94253|0.94253	GCC|AGC		0.498	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
YTHDF3	253943	broad.mit.edu	37	8	64099138	64099138	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr8:64099138G>A	ENST00000539294.1	+	4	882	c.566G>A	c.(565-567)gGc>gAc	p.G189D	YTHDF3_ENST00000542911.2_5'UTR|YTHDF3_ENST00000521674.1_3'UTR|YTHDF3_ENST00000517371.1_Intron	NM_001277817.1|NM_001277818.1|NM_152758.4	NP_001264746.1|NP_001264747.1|NP_689971.4	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	190							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			ATTGAGCAAGGCATGACTGGA	0.458																																					p.A190T												.	.	0			c.G568A	8						.						74.0	78.0	77.0					8																	64099138		2170	4277	6447	64261692	SO:0001583	missense	253943	exon4			BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000539294.1:c.566G>A	8.37:g.64099138G>A	ENSP00000473496:p.Gly189Asp	Somatic		Capture	Illumina HiSeq	Phase_I	64261692	NM_152758	B3KXL4|Q63Z37|Q659A3	Missense_Mutation	SNP	ENST00000539294.1	37																																																																																					0.458	YTHDF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152758	
CYP7B1	9420	broad.mit.edu	37	8	65517325	65517325	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr8:65517325C>T	ENST00000310193.3	-	5	1320	c.1147G>A	c.(1147-1149)Ggg>Agg	p.G383R	CYP7B1_ENST00000523954.1_5'UTR	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	383					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)	p.G383R(1)|p.G383W(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				CAGTAGTCCCCGGTCTCTGAA	0.448																																					p.G383R												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1147A	8						.						125.0	120.0	122.0					8																	65517325		2203	4300	6503	65679879	SO:0001583	missense	9420	exon5			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.1147G>A	8.37:g.65517325C>T	ENSP00000310721:p.Gly383Arg	Somatic		Capture	Illumina HiSeq	Phase_I	65679879	NM_004820	B2RN07|Q9UNF5	Missense_Mutation	SNP	ENST00000310193.3	37	CCDS6180.1	.	.	.	.	.	.	.	.	.	.	C	11.08	1.534762	0.27475	.	.	ENSG00000172817	ENST00000310193	D	0.86432	-2.12	6.17	-1.04	0.10068	.	1.089970	0.06726	N	0.775725	T	0.80696	0.4672	L	0.33137	0.985	0.09310	N	1	B	0.32573	0.376	B	0.33690	0.168	T	0.64521	-0.6388	10	0.33141	T	0.24	1.3718	10.6759	0.45785	0.0:0.2055:0.5563:0.2382	.	383	O75881	CP7B1_HUMAN	R	383	ENSP00000310721:G383R	ENSP00000310721:G383R	G	-	1	0	CYP7B1	65679879	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.950000	0.29122	-0.521000	0.06426	-0.302000	0.09304	GGG		0.448	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1		
ARFGEF1	10565	broad.mit.edu	37	8	68150599	68150599	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr8:68150599C>A	ENST00000262215.3	-	22	3657	c.3268G>T	c.(3268-3270)Gaa>Taa	p.E1090*	ARFGEF1_ENST00000518230.1_5'UTR|ARFGEF1_ENST00000520381.1_Nonsense_Mutation_p.E544*	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1090					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.E1090*(1)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CCCACAAATTCATCAGGAGCC	0.368																																					p.E1090X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G3268T	8						.						98.0	94.0	95.0					8																	68150599		2203	4300	6503	68313153	SO:0001587	stop_gained	10565	exon22			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.3268G>T	8.37:g.68150599C>A	ENSP00000262215:p.Glu1090*	Somatic		Capture	Illumina HiSeq	Phase_I	68313153	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Nonsense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	C	46	12.699951	0.99689	.	.	ENSG00000066777	ENST00000520381;ENST00000262215	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	19.3565	0.94416	0.0:1.0:0.0:0.0	.	.	.	.	X	544;1090	.	ENSP00000262215:E1090X	E	-	1	0	ARFGEF1	68313153	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.487000	0.81328	2.571000	0.86741	0.655000	0.94253	GAA		0.368	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
GDF6	392255	broad.mit.edu	37	8	97172648	97172648	+	Silent	SNP	G	G	A	rs200398313		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr8:97172648G>A	ENST00000287020.5	-	1	372	c.273C>T	c.(271-273)cgC>cgT	p.R91R		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	91					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)		p.R91R(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					GGGGCACCACGCGCGGACCCC	0.657																																					p.R91R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C273T	8						.						57.0	65.0	62.0					8																	97172648		2203	4300	6503	97241824	SO:0001819	synonymous_variant	392255	exon1				CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.273C>T	8.37:g.97172648G>A		Somatic		Capture	Illumina HiSeq	Phase_I	97241824	NM_001001557	Q6PI58	Silent	SNP	ENST00000287020.5	37	CCDS34926.1																																																																																				0.657	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379862.2	NM_001001557	
ARC	23237	broad.mit.edu	37	8	143694941	143694941	+	Missense_Mutation	SNP	A	A	C	rs201562490	byFrequency	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr8:143694941A>C	ENST00000356613.2	-	1	1892	c.692T>G	c.(691-693)gTg>gGg	p.V231G	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)	p.V231G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				AGAGCCGCCCACCTGCCGCAA	0.637																																					p.V231G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T692G	8						.						29.0	30.0	29.0					8																	143694941		2181	4271	6452	143691943	SO:0001583	missense	23237	exon1			AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.692T>G	8.37:g.143694941A>C	ENSP00000349022:p.Val231Gly	Somatic		Capture	Illumina HiSeq	Phase_I	143691943	NM_015193	B4DFL0|O60937	Missense_Mutation	SNP	ENST00000356613.2	37	CCDS34950.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.494271	0.64186	.	.	ENSG00000198576	ENST00000356613	.	.	.	4.77	4.77	0.60923	.	0.289414	0.24211	U	0.040528	T	0.61375	0.2342	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61787	-0.6991	9	0.37606	T	0.19	.	13.4508	0.61169	1.0:0.0:0.0:0.0	.	231	Q7LC44	ARC_HUMAN	G	231	.	ENSP00000349022:V231G	V	-	2	0	ARC	143691943	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	4.078000	0.57606	1.774000	0.52232	0.379000	0.24179	GTG		0.637	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259274.2		
ABCA1	19	broad.mit.edu	37	9	107562230	107562230	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr9:107562230A>C	ENST00000374736.3	-	36	5207	c.4813T>G	c.(4813-4815)Ttc>Gtc	p.F1605V		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1605					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.F1605V(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	ACATTCAGGAAAGAGCTGATT	0.488																																					p.F1605V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4813G	9						.						122.0	114.0	117.0					9																	107562230		2203	4300	6503	106602051	SO:0001583	missense	19	exon36			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.4813T>G	9.37:g.107562230A>C	ENSP00000363868:p.Phe1605Val	Somatic		Capture	Illumina HiSeq	Phase_I	106602051	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.852566	0.91355	.	.	ENSG00000165029	ENST00000374736	D	0.86097	-2.07	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.91439	0.7298	M	0.82517	2.595	0.80722	D	1	P	0.49961	0.93	P	0.56278	0.795	D	0.92636	0.6120	10	0.87932	D	0	.	16.2164	0.82224	1.0:0.0:0.0:0.0	.	1605	O95477	ABCA1_HUMAN	V	1605	ENSP00000363868:F1605V	ENSP00000363868:F1605V	F	-	1	0	ABCA1	106602051	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.289000	0.77006	0.533000	0.62120	TTC		0.488	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
ABCA1	19	broad.mit.edu	37	9	107645431	107645431	+	Missense_Mutation	SNP	G	G	A	rs141348278		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr9:107645431G>A	ENST00000374736.3	-	5	704	c.310C>T	c.(310-312)Cgc>Tgc	p.R104C	ABCA1_ENST00000423487.2_Missense_Mutation_p.R104C|ABCA1_ENST00000374733.1_Missense_Mutation_p.R44C	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	104					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.R104C(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GAGAACAGGCGAGCCACACTG	0.483																																					p.R104C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C310T	9						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	80.0	82.0	81.0		310	5.5	1.0	9	dbSNP_134	81	0,8600		0,0,4300	no	missense	ABCA1	NM_005502.3	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	104/2262	107645431	1,13005	2203	4300	6503	106685252	SO:0001583	missense	19	exon5			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.310C>T	9.37:g.107645431G>A	ENSP00000363868:p.Arg104Cys	Somatic		Capture	Illumina HiSeq	Phase_I	106685252	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738915	0.89573	2.27E-4	0.0	ENSG00000165029	ENST00000374736;ENST00000423487;ENST00000374733	D;D;D	0.96774	-4.12;-4.12;-4.12	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.98340	0.9449	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.985	D	0.98994	1.0809	10	0.87932	D	0	.	19.7296	0.96177	0.0:0.0:1.0:0.0	.	44;104	B1AMI1;O95477	.;ABCA1_HUMAN	C	104;104;44	ENSP00000363868:R104C;ENSP00000416623:R104C;ENSP00000363865:R44C	ENSP00000363865:R44C	R	-	1	0	ABCA1	106685252	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	7.298000	0.78815	2.735000	0.93741	0.655000	0.94253	CGC		0.483	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
TLE1	7088	broad.mit.edu	37	9	84205870	84205870	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr9:84205870G>A	ENST00000376499.3	-	16	2743	c.1679C>T	c.(1678-1680)gCg>gTg	p.A560V		NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	560					multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)	p.A560V(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						GGTTGGAGCCGCCAGGTCCCA	0.587																																					p.A560V	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1679T	9						.						67.0	68.0	68.0					9																	84205870		2203	4300	6503	83395690	SO:0001583	missense	7088	exon16				CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1679C>T	9.37:g.84205870G>A	ENSP00000365682:p.Ala560Val	Somatic		Capture	Illumina HiSeq	Phase_I	83395690	NM_005077	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	37	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	g	29.9	5.043428	0.93685	.	.	ENSG00000196781	ENST00000376499	T	0.11604	2.76	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047616	0.85682	D	0.000000	T	0.29223	0.0727	L	0.46947	1.48	0.80722	D	1	D;D;D	0.76494	0.99;0.999;0.996	P;D;P	0.68943	0.456;0.961;0.456	T	0.00221	-1.1905	10	0.87932	D	0	-18.6466	20.099	0.97865	0.0:0.0:1.0:0.0	.	545;586;560	B4DEF9;Q59EF7;Q04724	.;.;TLE1_HUMAN	V	560	ENSP00000365682:A560V	ENSP00000365682:A560V	A	-	2	0	TLE1	83395690	1.000000	0.71417	0.994000	0.49952	0.942000	0.58702	9.869000	0.99810	2.752000	0.94435	0.655000	0.94253	GCG		0.587	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	
FNBP1	23048	broad.mit.edu	37	9	132665213	132665213	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chr9:132665213C>A	ENST00000446176.2	-	13	1549	c.1363G>T	c.(1363-1365)Gat>Tat	p.D455Y	FNBP1_ENST00000420781.1_Missense_Mutation_p.D446Y|FNBP1_ENST00000355681.3_Missense_Mutation_p.D426Y|FNBP1_ENST00000443566.2_Missense_Mutation_p.D83Y|FNBP1_ENST00000478129.1_5'UTR	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1	455	Interaction with RND2. {ECO:0000250}.|Required for self-association and induction of membrane tubulation.				endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.D455Y(1)					Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		AATTTGTGATCCAAACTGGCT	0.398			T	MLL	AML																																p.D455Y			Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1363T	9						.						115.0	102.0	106.0					9																	132665213		1823	4096	5919	131705034	SO:0001583	missense	23048	exon13			AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.1363G>T	9.37:g.132665213C>A	ENSP00000413625:p.Asp455Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	131705034	NM_015033	O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Missense_Mutation	SNP	ENST00000446176.2	37	CCDS48040.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.7|22.7	4.329462|4.329462	0.81690|0.81690	.|.	.|.	ENSG00000187239|ENSG00000187239	ENST00000372416;ENST00000446176;ENST00000420781;ENST00000372415;ENST00000443566;ENST00000355681|ENST00000449089	T;T;T;T|.	0.30981|.	1.51;1.51;1.51;1.51|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.769922|.	0.12687|.	N|.	0.447468|.	T|T	0.76083|0.76083	0.3938|0.3938	M|M	0.69823|0.69823	2.125|2.125	0.58432|0.58432	D|D	0.999996|0.999996	D;D;D;P;P;D;D;D|.	0.76494|.	0.972;0.972;0.999;0.711;0.809;0.998;0.964;0.972|.	P;P;D;B;B;D;P;P|.	0.67900|.	0.707;0.786;0.954;0.364;0.424;0.928;0.847;0.707|.	T|T	0.74061|0.74061	-0.3786|-0.3786	10|5	0.87932|.	D|.	0|.	-44.0206|-44.0206	18.9453|18.9453	0.92620|0.92620	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	450;445;83;389;426;406;450;455|.	B7ZL12;B7ZL13;E7EPB7;B7ZL14;Q96RU3-3;Q5QP69;Q96RU3-2;Q96RU3|.	.;.;.;.;.;.;.;FNBP1_HUMAN|.	Y|C	455;455;446;455;83;426|406	ENSP00000413625:D455Y;ENSP00000407548:D446Y;ENSP00000389117:D83Y;ENSP00000347907:D426Y|.	ENSP00000347907:D426Y|.	D|W	-|-	1|3	0|0	FNBP1|FNBP1	131705034|131705034	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	4.610000|4.610000	0.61155|0.61155	2.721000|2.721000	0.93114|0.93114	0.655000|0.655000	0.94253|0.94253	GAT|TGG		0.398	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054630.2		
MAP3K15	389840	broad.mit.edu	37	X	19392615	19392615	+	Missense_Mutation	SNP	C	C	T	rs143201437	byFrequency	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chrX:19392615C>T	ENST00000338883.4	-	20	2752	c.2753G>A	c.(2752-2754)cGa>cAa	p.R918Q	Y_RNA_ENST00000365274.1_RNA|MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_Missense_Mutation_p.R353Q|MAP3K15_ENST00000469203.2_Missense_Mutation_p.R750Q	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	918							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.R965Q(1)|p.R393Q(1)		NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					GAAGGCAATTCGGTTCTTCTT	0.577																																					p.R918Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2753A	X						.	C	GLN/ARG	1,3834		0,1,1631,571	128.0	94.0	105.0		2753	2.8	0.0	X	dbSNP_134	105	2,6726		0,2,2426,1872	yes	missense	MAP3K15	NM_001001671.3	43	0,3,4057,2443	TT,TC,CC,C		0.0297,0.0261,0.0284	benign	918/1314	19392615	3,10560	2203	4300	6503	19302536	SO:0001583	missense	389840	exon20			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2753G>A	X.37:g.19392615C>T	ENSP00000345629:p.Arg918Gln	Somatic		Capture	Illumina HiSeq	Phase_I	19302536	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	ENST00000338883.4	37		.	.	.	.	.	.	.	.	.	.	C	12.52	1.961567	0.34659	2.61E-4	2.97E-4	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.24151	1.87;1.87;1.87	5.56	2.79	0.32731	Protein kinase-like domain (1);	0.114361	0.64402	N	0.000014	T	0.11239	0.0274	N	0.19112	0.55	0.31395	N	0.677357	B;B	0.31548	0.068;0.328	B;B	0.22152	0.038;0.033	T	0.23868	-1.0176	10	0.15952	T	0.53	.	5.0565	0.14535	0.137:0.5062:0.0:0.3568	.	393;918	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	Q	918;353;750	ENSP00000345629:R918Q;ENSP00000352093:R353Q;ENSP00000428356:R750Q	ENSP00000345629:R918Q	R	-	2	0	MAP3K15	19302536	0.993000	0.37304	0.004000	0.12327	0.988000	0.76386	0.334000	0.19787	0.229000	0.21039	0.600000	0.82982	CGA		0.577	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
NR0B1	190	broad.mit.edu	37	X	30322934	30322934	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chrX:30322934G>A	ENST00000378970.4	-	2	1409	c.1175C>T	c.(1174-1176)cCg>cTg	p.P392L		NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	392	Ligand-binding. {ECO:0000250}.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.P392L(1)		central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	CTGCAGGCCCGGCACGTCTGG	0.473																																					p.P392L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1175T	X						.						75.0	64.0	68.0					X																	30322934		2202	4300	6502	30232855	SO:0001583	missense	190	exon2			S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.1175C>T	X.37:g.30322934G>A	ENSP00000368253:p.Pro392Leu	Somatic		Capture	Illumina HiSeq	Phase_I	30232855	NM_000475	Q96F69	Missense_Mutation	SNP	ENST00000378970.4	37	CCDS14223.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.037101	0.54896	.	.	ENSG00000169297	ENST00000378970	D	0.99089	-5.41	5.13	5.13	0.70059	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.231022	0.43747	D	0.000524	D	0.99302	0.9756	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	D	0.99157	1.0860	10	0.72032	D	0.01	-15.2099	17.8569	0.88767	0.0:0.0:1.0:0.0	.	392	P51843	NR0B1_HUMAN	L	392	ENSP00000368253:P392L	ENSP00000368253:P392L	P	-	2	0	NR0B1	30232855	1.000000	0.71417	0.995000	0.50966	0.348000	0.29142	6.081000	0.71309	2.149000	0.67028	0.523000	0.50628	CCG		0.473	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	NM_000475	
GAGE12J	729396	broad.mit.edu	37	X	49179717	49179717	+	Silent	SNP	A	A	G	rs79608938		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chrX:49179717A>G	ENST00000442437.2	+	2	141	c.45A>G	c.(43-45)agA>agG	p.R15R		NM_001098406.1	NP_001091876.1	A6NER3	GG12J_HUMAN	G antigen 12J	15								p.R15R(1)		kidney(2)|large_intestine(2)|lung(1)|prostate(1)	6	Ovarian(276;0.236)					CTAGACCAAGACCCTATGTAC	0.448													-|||	3	0.000794702	0.0	0.0	3775	,	,		14131	0.0		0.003	False		,,,				2504	0.0				p.R15R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A45G	X						.						274.0	194.0	223.0					X																	49179717		1485	2588	4073	49066661	SO:0001819	synonymous_variant	729396	exon2				CCDS43939.1	Xp11.23	2008-02-05	2007-07-23	2007-07-23	ENSG00000224659	ENSG00000224659			17778	protein-coding gene	gene with protein product		300733	"""G antigen 11"""	GAGE11			Standard	NM_001098406		Approved	OTTHUMG00000024137		A6NER3	OTTHUMG00000024137	ENST00000442437.2:c.45A>G	X.37:g.49179717A>G		Somatic		Capture	Illumina HiSeq	Phase_I	49066661	NM_001098406		Silent	SNP	ENST00000442437.2	37	CCDS43939.1																																																																																				0.448	GAGE12J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060817.1	NM_001098406	
ITIH6	347365	broad.mit.edu	37	X	54780099	54780099	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chrX:54780099C>T	ENST00000218436.6	-	11	3366	c.3337G>A	c.(3337-3339)Gag>Aag	p.E1113K		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1113					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										TTTGGGTCCTCTATGAGCTGC	0.507																																					p.E1113K												.	.	0			c.G3337A	X						.						113.0	93.0	100.0					X																	54780099		2203	4300	6503	54796824	SO:0001583	missense	347365	exon11			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3337G>A	X.37:g.54780099C>T	ENSP00000218436:p.Glu1113Lys	None		Capture	Illumina HiSeq	Phase_I	54796824	NM_198510	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	C	6.390	0.440127	0.12104	.	.	ENSG00000102313	ENST00000218436	T	0.02323	4.34	3.25	2.03	0.26663	.	1.251870	0.05870	N	0.624499	T	0.02012	0.0063	N	0.14661	0.345	0.09310	N	1	B	0.22003	0.063	B	0.19666	0.026	T	0.46596	-0.9180	10	0.24483	T	0.36	.	3.0529	0.06175	0.2377:0.5014:0.0:0.2609	.	1113	Q6UXX5	ITH5L_HUMAN	K	1113	ENSP00000218436:E1113K	ENSP00000218436:E1113K	E	-	1	0	ITIH5L	54796824	0.560000	0.26570	0.995000	0.50966	0.292000	0.27327	0.669000	0.25142	1.208000	0.43306	0.417000	0.27973	GAG		0.507	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
F9	2158	broad.mit.edu	37	X	138643725	138643725	+	Missense_Mutation	SNP	G	G	A	rs137852249		TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3852-01A-01W-0900-09	TCGA-AA-3852-10A-01W-0900-09	g.chrX:138643725G>A	ENST00000218099.2	+	8	888	c.881G>A	c.(880-882)cGa>cAa	p.R294Q	F9_ENST00000394090.2_Missense_Mutation_p.R256Q	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX	294	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		R -> G (in HEMB; severe).|R -> Q (in HEMB; mild to moderate; Dreihacken, Penafiel and Seattle-4). {ECO:0000269|PubMed:12588353, ECO:0000269|PubMed:1346975, ECO:0000269|PubMed:2472424, ECO:0000269|PubMed:7981722, ECO:0000269|PubMed:8257988}.		blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.R294Q(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	GAGCAAAAGCGAAATGTGATT	0.348																																					p.R294Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G881A	X	GRCh37	CM940591	F9	M	rs137852249	.						159.0	136.0	144.0					X																	138643725		2203	4300	6503	138471391	SO:0001583	missense	2158	exon8			M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.881G>A	X.37:g.138643725G>A	ENSP00000218099:p.Arg294Gln	Somatic		Capture	Illumina HiSeq	Phase_I	138471391	NM_000133	A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Missense_Mutation	SNP	ENST00000218099.2	37	CCDS14666.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006024	0.54361	.	.	ENSG00000101981	ENST00000218099;ENST00000394090	D;D	0.93547	-3.24;-3.24	5.42	5.42	0.78866	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.131690	0.51477	D	0.000082	D	0.94745	0.8304	L	0.57130	1.785	0.09310	N	1	D;D	0.89917	1.0;0.992	D;P	0.69479	0.964;0.541	D	0.88678	0.3200	10	0.31617	T	0.26	.	10.7407	0.46152	0.0887:0.0:0.9113:0.0	.	256;294	Q5FBE1;P00740	.;FA9_HUMAN	Q	294;256	ENSP00000218099:R294Q;ENSP00000377650:R256Q	ENSP00000218099:R294Q	R	+	2	0	F9	138471391	0.009000	0.17119	0.991000	0.47740	0.980000	0.70556	1.847000	0.39299	2.250000	0.74265	0.544000	0.68410	CGA		0.348	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058557.1		
