#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TUBAL3	79861	broad.mit.edu	37	10	5435682	5435682	+	Missense_Mutation	SNP	C	C	T	rs368080202		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr10:5435682C>T	ENST00000380419.3	-	4	1176	c.1139G>A	c.(1138-1140)cGg>cAg	p.R380Q	TUBAL3_ENST00000479328.1_Missense_Mutation_p.R340Q	NM_024803.2	NP_079079.1	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	380					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R380Q(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(7)|prostate(2)|skin(3)	25						GCAGATGGACCGGTGGACTTT	0.577													c|||	1	0.000199681	0.0	0.0	5008	,	,		19946	0.001		0.0	False		,,,				2504	0.0				p.R380Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1139A	10						.						76.0	66.0	69.0					10																	5435682		2203	4300	6503	5425682	SO:0001583	missense	79861	exon4			AK025318	CCDS7066.2, CCDS53491.1	10p15.1	2007-03-15			ENSG00000178462	ENSG00000178462		"""Tubulins"""	23534	protein-coding gene	gene with protein product							Standard	NM_024803		Approved	FLJ21665	uc001ihy.3	A6NHL2	OTTHUMG00000017595	ENST00000380419.3:c.1139G>A	10.37:g.5435682C>T	ENSP00000369784:p.Arg380Gln	Somatic		Capture	Illumina HiSeq	Phase_I	5425682	NM_024803	B4DKL2|Q4QQJ5|Q9H6Z0	Missense_Mutation	SNP	ENST00000380419.3	37	CCDS7066.2	.	.	.	.	.	.	.	.	.	.	c	10.71	1.426456	0.25726	.	.	ENSG00000178462	ENST00000380419;ENST00000479328	D;D	0.84660	-1.88;-1.88	4.41	0.458	0.16670	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.727832	0.12180	N	0.492161	D	0.84293	0.5440	M	0.89095	3.005	0.23254	N	0.998038	B;B	0.33739	0.422;0.029	B;B	0.25884	0.064;0.006	T	0.75408	-0.3328	10	0.87932	D	0	.	8.9928	0.36035	0.0:0.6791:0.0:0.3209	.	340;380	A6NHL2-2;A6NHL2	.;TBAL3_HUMAN	Q	380;340	ENSP00000369784:R380Q;ENSP00000418799:R340Q	ENSP00000369784:R380Q	R	-	2	0	TUBAL3	5425682	0.222000	0.23652	0.009000	0.14445	0.009000	0.06853	1.288000	0.33296	-0.014000	0.14175	-0.755000	0.03482	CGG		0.577	TUBAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046548.2	NM_024803	
CCAR1	55749	broad.mit.edu	37	10	70514525	70514525	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr10:70514525C>G	ENST00000265872.6	+	12	1518	c.1399C>G	c.(1399-1401)Ctt>Gtt	p.L467V	CCAR1_ENST00000535016.1_Missense_Mutation_p.L452V|SNORD98_ENST00000408255.1_RNA|CCAR1_ENST00000543719.1_Missense_Mutation_p.L452V	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	467					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)	p.L467V(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						GTCATGTGCTCTTGCTGAGGA	0.358																																					p.L467V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1399G	10						.						167.0	166.0	166.0					10																	70514525		2203	4300	6503	70184531	SO:0001583	missense	55749	exon12			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.1399C>G	10.37:g.70514525C>G	ENSP00000265872:p.Leu467Val	Somatic		Capture	Illumina HiSeq	Phase_I	70184531	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	ENST00000265872.6	37	CCDS7282.1	.	.	.	.	.	.	.	.	.	.	C	17.33	3.361618	0.61403	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012	T;T;T;T;T;T	0.28069	1.64;1.63;1.63;1.65;1.67;1.63	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.51363	0.1670	L	0.46157	1.445	0.58432	D	0.999999	D;D;B	0.69078	0.996;0.997;0.136	D;D;B	0.75484	0.986;0.978;0.028	T	0.18366	-1.0339	10	0.33940	T	0.23	-14.358	20.6013	0.99457	0.0:1.0:0.0:0.0	.	452;467;441	Q8IX12-2;Q8IX12;F5H2E6	.;CCAR1_HUMAN;.	V	467;452;452;452;441;272	ENSP00000265872:L467V;ENSP00000441820:L452V;ENSP00000445254:L452V;ENSP00000439252:L452V;ENSP00000438610:L441V;ENSP00000439642:L272V	ENSP00000265872:L467V	L	+	1	0	CCAR1	70184531	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.997000	0.70646	2.878000	0.98634	0.650000	0.86243	CTT		0.358	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	
KNDC1	85442	broad.mit.edu	37	10	135027609	135027609	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr10:135027609A>C	ENST00000304613.3	+	26	4681	c.4660A>C	c.(4660-4662)Acc>Ccc	p.T1554P	KNDC1_ENST00000368572.2_Missense_Mutation_p.T1556P			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1554	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		AGAGATTGTGACCAGCCACAC	0.587																																					p.T1554P												.	.	0			c.A4660C	10						.						54.0	55.0	55.0					10																	135027609		2203	4300	6503	134877599	SO:0001583	missense	85442	exon26			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.4660A>C	10.37:g.135027609A>C	ENSP00000304437:p.Thr1554Pro	None		Capture	Illumina HiSeq	Phase_I	134877599	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	A	18.22	3.575763	0.65878	.	.	ENSG00000171798	ENST00000304613;ENST00000368572	T;T	0.30448	1.53;1.53	4.0	4.0	0.46444	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.368381	0.26106	N	0.026306	T	0.41096	0.1144	L	0.40543	1.245	0.47862	D	0.999537	D	0.67145	0.996	D	0.63381	0.914	T	0.21930	-1.0231	10	0.51188	T	0.08	-15.9856	11.1354	0.48370	1.0:0.0:0.0:0.0	.	1554	Q76NI1	VKIND_HUMAN	P	1554;1556	ENSP00000304437:T1554P;ENSP00000357561:T1556P	ENSP00000304437:T1554P	T	+	1	0	KNDC1	134877599	1.000000	0.71417	0.978000	0.43139	0.775000	0.43874	5.931000	0.70113	1.579000	0.49836	0.260000	0.18958	ACC		0.587	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
CEP164	22897	broad.mit.edu	37	11	117280455	117280455	+	Silent	SNP	G	G	A	rs371367995		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr11:117280455G>A	ENST00000278935.3	+	30	4017	c.3870G>A	c.(3868-3870)ccG>ccA	p.P1290P	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1290					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.P1290P(1)		breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		CTCAGTCGCCGCCGCCGCTCC	0.672																																					p.P1290P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3870A	11						.	G		1,4401		0,1,2200	98.0	108.0	105.0		3870	-8.2	0.0	11		105	0,8592		0,0,4296	no	coding-synonymous	CEP164	NM_014956.4		0,1,6496	AA,AG,GG		0.0,0.0227,0.0077		1290/1461	117280455	1,12993	2201	4296	6497	116785665	SO:0001819	synonymous_variant	22897	exon30			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.3870G>A	11.37:g.117280455G>A		Somatic		Capture	Illumina HiSeq	Phase_I	116785665	NM_014956	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Silent	SNP	ENST00000278935.3	37	CCDS31683.1																																																																																				0.672	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
GRIK4	2900	broad.mit.edu	37	11	120823645	120823645	+	Missense_Mutation	SNP	G	G	T	rs377225028		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr11:120823645G>T	ENST00000527524.2	+	15	1959	c.1672G>T	c.(1672-1674)Gtc>Ttc	p.V558F	GRIK4_ENST00000438375.2_Missense_Mutation_p.V558F	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	558					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.V558F(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		CTATCTGGCCGTCAGCTGTGT	0.572											OREG0021429	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V558F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1672T	11						.						152.0	132.0	139.0					11																	120823645		2203	4299	6502	120328855	SO:0001583	missense	2900	exon13			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1672G>T	11.37:g.120823645G>T	ENSP00000435648:p.Val558Phe	Somatic	1506	Capture	Illumina HiSeq	Phase_I	120328855	NM_014619	A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	37	CCDS8433.1	.	.	.	.	.	.	.	.	.	.	G	33	5.280998	0.95489	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.59906	0.23;0.23	5.61	5.61	0.85477	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	D	0.84188	0.5417	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88261	0.2923	10	0.87932	D	0	.	19.5968	0.95544	0.0:0.0:1.0:0.0	.	558;558	A6H8K8;Q16099	.;GRIK4_HUMAN	F	558	ENSP00000435648:V558F;ENSP00000404063:V558F	ENSP00000404063:V558F	V	+	1	0	GRIK4	120328855	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.813000	0.99286	2.793000	0.96121	0.655000	0.94253	GTC		0.572	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
DNHD1	144132	broad.mit.edu	37	11	6540836	6540836	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr11:6540836G>A	ENST00000527990.2	+	6	1399	c.1399G>A	c.(1399-1401)Gag>Aag	p.E467K	DNHD1_ENST00000254579.6_Missense_Mutation_p.E467K|DNHD1_ENST00000354685.3_Missense_Mutation_p.E467K			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	467					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)	p.E467K(2)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ACAGGTTCACGAGGACACATA	0.522																																					p.E467K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1399A	11						.						134.0	130.0	131.0					11																	6540836		2201	4296	6497	6497412	SO:0001583	missense	144132	exon8			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.1399G>A	11.37:g.6540836G>A	ENSP00000436180:p.Glu467Lys	Somatic		Capture	Illumina HiSeq	Phase_I	6497412	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427219	0.83667	.	.	ENSG00000179532	ENST00000254579;ENST00000354685;ENST00000527990	T;T;T	0.27256	1.68;2.69;1.68	5.71	5.71	0.89125	.	0.516808	0.16330	N	0.219177	T	0.30510	0.0767	N	0.24115	0.695	0.35090	D	0.764181	D;D	0.67145	0.993;0.996	P;P	0.60886	0.762;0.88	T	0.02471	-1.1154	10	0.07644	T	0.81	.	15.3546	0.74418	0.0:0.0:1.0:0.0	.	467;467	Q96M86;Q96M86-4	DNHD1_HUMAN;.	K	467	ENSP00000254579:E467K;ENSP00000346716:E467K;ENSP00000436180:E467K	ENSP00000254579:E467K	E	+	1	0	DNHD1	6497412	0.991000	0.36638	0.989000	0.46669	0.839000	0.47603	2.386000	0.44380	2.695000	0.91970	0.563000	0.77884	GAG		0.522	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
TSG101	7251	broad.mit.edu	37	11	18524118	18524118	+	Nonsense_Mutation	SNP	G	G	T	rs202060916		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr11:18524118G>T	ENST00000251968.3	-	7	970	c.555C>A	c.(553-555)taC>taA	p.Y185*	TSG101_ENST00000536719.1_Nonsense_Mutation_p.Y185*|TSG101_ENST00000543087.1_5'UTR|TSG101_ENST00000357193.3_Nonsense_Mutation_p.Y80*	NM_006292.3	NP_006283.1	Q99816	TS101_HUMAN	tumor susceptibility 101	185					cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cellular protein modification process (GO:0006464)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|keratinocyte differentiation (GO:0030216)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell growth (GO:0001558)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral budding (GO:0046755)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transcription corepressor activity (GO:0003714)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.Y185*(2)		kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	22						GACAGCCTGGGTAACCACTAA	0.428																																					p.Y185X	GBM(99;1348 1396 8611 26475 50572)											.	.	2	Substitution - Nonsense(2)	large_intestine(1)|prostate(1)	c.C555A	11						.						76.0	71.0	73.0					11																	18524118		2199	4293	6492	18480694	SO:0001587	stop_gained	7251	exon7			U82130	CCDS7842.1	11p15	2013-08-22	2013-08-22		ENSG00000074319	ENSG00000074319			15971	protein-coding gene	gene with protein product		601387	"""tumor susceptibility gene 10"", ""tumor susceptibility gene 101"""	TSG10		9019400, 9241264	Standard	NM_006292		Approved	VPS23	uc001mor.3	Q99816	OTTHUMG00000167725	ENST00000251968.3:c.555C>A	11.37:g.18524118G>T	ENSP00000251968:p.Tyr185*	Somatic		Capture	Illumina HiSeq	Phase_I	18480694	NM_006292	Q9BUM5	Nonsense_Mutation	SNP	ENST00000251968.3	37	CCDS7842.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089354	0.76756	.	.	ENSG00000074319	ENST00000536719;ENST00000251968;ENST00000357193	.	.	.	5.07	-0.243	0.13035	.	0.304511	0.32343	N	0.006229	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5976	9.2494	0.37547	0.4826:0.0:0.5174:0.0	.	.	.	.	X	185;185;80	.	ENSP00000251968:Y185X	Y	-	3	2	TSG101	18480694	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	1.045000	0.30341	-0.220000	0.09988	0.491000	0.48974	TAC		0.428	TSG101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395906.1	NM_006292	
LRRC4C	57689	broad.mit.edu	37	11	40137377	40137377	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr11:40137377G>A	ENST00000278198.2	-	2	2429	c.466C>T	c.(466-468)Cga>Tga	p.R156*	LRRC4C_ENST00000530763.1_Nonsense_Mutation_p.R156*|LRRC4C_ENST00000528697.1_Nonsense_Mutation_p.R156*|LRRC4C_ENST00000527150.1_Nonsense_Mutation_p.R156*			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	156					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.R156*(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GGGTTGTTTCGCAACCAGAGC	0.428																																					p.R156X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C466T	11						.						79.0	81.0	80.0					11																	40137377		2203	4300	6503	40093953	SO:0001587	stop_gained	57689	exon2			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.466C>T	11.37:g.40137377G>A	ENSP00000278198:p.Arg156*	Somatic		Capture	Illumina HiSeq	Phase_I	40093953	NM_020929	A8K0T1|Q7L0N3	Nonsense_Mutation	SNP	ENST00000278198.2	37	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	G	38	6.980294	0.97979	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	.	.	.	5.82	1.48	0.22813	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3731	0.83371	0.0:0.0:0.2955:0.7045	.	.	.	.	X	156	.	ENSP00000278198:R156X	R	-	1	2	LRRC4C	40093953	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.690000	0.25451	0.303000	0.22785	0.650000	0.86243	CGA		0.428	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
RBM14	10432	broad.mit.edu	37	11	66391809	66391809	+	Silent	SNP	G	G	T	rs534878980		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr11:66391809G>T	ENST00000310137.4	+	2	601	c.462G>T	c.(460-462)ggG>ggT	p.G154G	RBM14_ENST00000461478.1_3'UTR|RBM14_ENST00000409738.4_Intron|RBM14_ENST00000443702.1_3'UTR|RBM4_ENST00000503028.2_Intron|RBM14_ENST00000409372.1_3'UTR|RBM14-RBM4_ENST00000511114.1_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Intron|RBM14_ENST00000393979.3_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	154					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.G154G(1)	RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						AGAAGAAGGGGCCTGGCCTGG	0.592																																					p.G154G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G462T	11						.						59.0	60.0	60.0					11																	66391809		2200	4295	6495	66148385	SO:0001819	synonymous_variant	10432	exon2			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.462G>T	11.37:g.66391809G>T		Somatic		Capture	Illumina HiSeq	Phase_I	66148385	NM_006328	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Silent	SNP	ENST00000310137.4	37	CCDS8147.1																																																																																				0.592	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328	
FOLR3	2352	broad.mit.edu	37	11	71850470	71850472	+	In_Frame_Del	DEL	GTC	GTC	-			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	GTC	GTC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr11:71850470_71850472delGTC	ENST00000445078.2	+	4	628_630	c.557_559delGTC	c.(556-561)tgtcgc>tgc	p.R187del	FOLR3_ENST00000456237.1_In_Frame_Del_p.R189del|FOLR3_ENST00000442948.2_In_Frame_Del_p.R146del			P41439	FOLR3_HUMAN	folate receptor 3 (gamma)	145					folic acid transport (GO:0015884)	extracellular region (GO:0005576)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	folic acid binding (GO:0005542)	p.R189delR(1)		large_intestine(3)|lung(8)|prostate(2)	13					Folic Acid(DB00158)	TGGGAGGACTGTCGCACCTCCTA	0.571																																					p.145_146del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.435_437del	11						.																																			71528120	SO:0001651	inframe_deletion	2352	exon4			U08471	CCDS73344.1	11q13.4	2012-11-14			ENSG00000110203	ENSG00000110203			3795	protein-coding gene	gene with protein product		602469				8110752	Standard	NM_000804		Approved	FR-G	uc001orx.1	P41439	OTTHUMG00000167870	ENST00000445078.2:c.557_559delGTC	11.37:g.71850470_71850472delGTC	ENSP00000390338:p.Arg187del	Somatic		Capture	Illumina HiSeq	Phase_I	71528118	NM_000804	J3KQ90|Q05C14	In_Frame_Del	DEL	ENST00000445078.2	37																																																																																					0.571	FOLR3-001	NOVEL	upstream_ATG|basic	protein_coding	protein_coding	OTTHUMT00000396739.1	NM_000804	
CCDC90B	60492	broad.mit.edu	37	11	82976973	82976973	+	Missense_Mutation	SNP	C	C	T	rs559028746	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr11:82976973C>T	ENST00000529689.1	-	8	1077	c.643G>A	c.(643-645)Gct>Act	p.A215T	CCDC90B_ENST00000525503.1_Missense_Mutation_p.A114T|CCDC90B_ENST00000529611.1_Missense_Mutation_p.A114T|CCDC90B_ENST00000529073.1_Silent_p.T203T|CCDC90B_ENST00000525504.1_5'UTR|CCDC90B_ENST00000455220.2_Missense_Mutation_p.A206T			Q9GZT6	CC90B_HUMAN	coiled-coil domain containing 90B	215						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.A215T(1)		kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Acute lymphoblastic leukemia(157;0.103)				GCAATTTCAGCGTCAATTTTA	0.338													C|||	2	0.000399361	0.0	0.0014	5008	,	,		18128	0.0		0.0	False		,,,				2504	0.001				p.A215T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G643A	11						.						144.0	140.0	141.0					11																	82976973		2202	4298	6500	82654621	SO:0001583	missense	60492	exon8			BC048795	CCDS8266.1, CCDS66190.1, CCDS66191.1	11q14.1	2006-10-23			ENSG00000137500	ENSG00000137500			28108	protein-coding gene	gene with protein product						11230166	Standard	XM_005274154		Approved	MDS025, MDS011	uc001pae.3	Q9GZT6	OTTHUMG00000167078	ENST00000529689.1:c.643G>A	11.37:g.82976973C>T	ENSP00000434724:p.Ala215Thr	Somatic		Capture	Illumina HiSeq	Phase_I	82654621	NM_021825	A8K8I4|B3KP87|B4E3L2|Q3B781|Q9GZU6	Missense_Mutation	SNP	ENST00000529689.1	37	CCDS8266.1	.	.	.	.	.	.	.	.	.	.	C	5.476	0.272852	0.10349	.	.	ENSG00000137500	ENST00000529689;ENST00000455220;ENST00000525503;ENST00000529611	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	5.68	3.4	0.38934	.	0.555489	0.20997	N	0.081931	T	0.08714	0.0216	N	0.00094	-2.165	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.06405	0.002;0.002	T	0.10567	-1.0624	9	.	.	.	-0.0896	9.3162	0.37934	0.0:0.1474:0.0:0.8526	.	206;215	Q9GZT6-2;Q9GZT6	.;CC90B_HUMAN	T	215;206;114;114	ENSP00000434724:A215T;ENSP00000390990:A206T;ENSP00000431424:A114T;ENSP00000431345:A114T	.	A	-	1	0	CCDC90B	82654621	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	1.656000	0.37355	0.445000	0.26639	-0.471000	0.05019	GCT		0.338	CCDC90B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392940.2	NM_021825	
FAT3	120114	broad.mit.edu	37	11	92532365	92532365	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr11:92532365T>A	ENST00000298047.6	+	9	6203	c.6186T>A	c.(6184-6186)caT>caA	p.H2062Q	FAT3_ENST00000525166.1_Missense_Mutation_p.H1912Q|FAT3_ENST00000409404.2_Missense_Mutation_p.H2062Q			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2062	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H2062Q(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGCTGGACCATCTGCGTGTGG	0.502										TCGA Ovarian(4;0.039)																											p.H2062Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T6186A	11						.						65.0	69.0	68.0					11																	92532365		1991	4177	6168	92172013	SO:0001583	missense	120114	exon9			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6186T>A	11.37:g.92532365T>A	ENSP00000298047:p.His2062Gln	Somatic		Capture	Illumina HiSeq	Phase_I	92172013	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	T	10.89	1.479405	0.26511	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.48836	0.8;0.8;0.8	5.9	-2.7	0.06004	.	.	.	.	.	T	0.23965	0.0580	N	0.04880	-0.145	0.54753	D	0.999983	B	0.32071	0.355	B	0.33568	0.166	T	0.05767	-1.0865	9	0.45353	T	0.12	.	9.8786	0.41220	0.0:0.5323:0.1178:0.3498	.	2062	Q8TDW7-3	.	Q	2062;2062;1912	ENSP00000298047:H2062Q;ENSP00000387040:H2062Q;ENSP00000432586:H1912Q	ENSP00000298047:H2062Q	H	+	3	2	FAT3	92172013	0.153000	0.22777	0.987000	0.45799	0.986000	0.74619	-0.247000	0.08866	-0.113000	0.11958	0.533000	0.62120	CAT		0.502	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
SORL1	6653	broad.mit.edu	37	11	121490504	121490504	+	Missense_Mutation	SNP	G	G	A	rs144747223		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr11:121490504G>A	ENST00000260197.7	+	43	5896	c.5767G>A	c.(5767-5769)Gtt>Att	p.V1923I	SORL1_ENST00000527934.1_Missense_Mutation_p.V538I|SORL1_ENST00000534286.1_Missense_Mutation_p.V833I|SORL1_ENST00000532694.1_Missense_Mutation_p.V769I|SORL1_ENST00000525532.1_Missense_Mutation_p.V867I	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1923	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.V1923I(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CTCTGACTACGTTGTAGTGAA	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		17571	0.001		0.0	False		,,,				2504	0.0				p.V1923I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5767A	11						.						203.0	174.0	184.0					11																	121490504		2202	4299	6501	120995714	SO:0001583	missense	6653	exon43			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.5767G>A	11.37:g.121490504G>A	ENSP00000260197:p.Val1923Ile	Somatic		Capture	Illumina HiSeq	Phase_I	120995714	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	8.796	0.931625	0.18131	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	D;D;T;D;D	0.91740	-2.9;-2.65;0.53;-2.33;-2.21	5.77	3.69	0.42338	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.325204	0.29307	N	0.012521	T	0.80138	0.4568	N	0.04508	-0.205	0.24585	N	0.993851	B;B	0.13145	0.007;0.002	B;B	0.06405	0.002;0.0	T	0.68202	-0.5471	10	0.28530	T	0.3	.	10.0645	0.42295	0.2461:0.0:0.7539:0.0	.	538;1923	E9PKB0;Q92673	.;SORL_HUMAN	I	1923;867;769;833;538	ENSP00000260197:V1923I;ENSP00000434634:V867I;ENSP00000432131:V769I;ENSP00000436447:V833I;ENSP00000435405:V538I	ENSP00000260197:V1923I	V	+	1	0	SORL1	120995714	0.994000	0.37717	0.940000	0.37924	0.034000	0.12701	2.952000	0.49097	1.446000	0.47643	0.561000	0.74099	GTT		0.512	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
PWP1	11137	broad.mit.edu	37	12	108105908	108105908	+	Nonsense_Mutation	SNP	C	C	T	rs199564672		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:108105908C>T	ENST00000412830.3	+	15	1585	c.1417C>T	c.(1417-1419)Cga>Tga	p.R473*	PWP1_ENST00000541166.1_Nonsense_Mutation_p.R411*	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	473					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.R473*(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						ATTTGGAAGACGAGAGAGGCT	0.368													C|||	1	0.000199681	0.0	0.0	5008	,	,		18794	0.0		0.001	False		,,,				2504	0.0				p.R473X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1417T	12						.	C	stop/ARG	2,4404	4.2+/-10.8	0,2,2201	126.0	125.0	125.0		1417	4.0	1.0	12		125	0,8600		0,0,4300	yes	stop-gained	PWP1	NM_007062.1		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		473/502	108105908	2,13004	2203	4300	6503	106630038	SO:0001587	stop_gained	11137	exon15			BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.1417C>T	12.37:g.108105908C>T	ENSP00000387365:p.Arg473*	Somatic		Capture	Illumina HiSeq	Phase_I	106630038	NM_007062	A8K3R6|Q7Z3X9	Nonsense_Mutation	SNP	ENST00000412830.3	37	CCDS9114.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	37	6.273941	0.97431	4.54E-4	0.0	ENSG00000136045	ENST00000412830;ENST00000541166	.	.	.	5.86	3.99	0.46301	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3857	0.66942	0.4925:0.5075:0.0:0.0	.	.	.	.	X	473;411	.	ENSP00000387365:R473X	R	+	1	2	PWP1	106630038	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.563000	0.36364	0.876000	0.35872	-0.175000	0.13238	CGA		0.368	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406539.1	NM_007062	
NCAPD2	9918	broad.mit.edu	37	12	6637402	6637402	+	Silent	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:6637402C>T	ENST00000315579.5	+	25	4006	c.3207C>T	c.(3205-3207)ccC>ccT	p.P1069P	NCAPD2_ENST00000545962.1_Silent_p.P1024P	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	1069					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)	p.P1069P(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						CTCCACTTCCCATTGTCCGGT	0.522																																					p.P1069P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3207T	12						.						242.0	245.0	244.0					12																	6637402		2203	4300	6503	6507663	SO:0001819	synonymous_variant	9918	exon25			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.3207C>T	12.37:g.6637402C>T		Somatic		Capture	Illumina HiSeq	Phase_I	6507663	NM_014865	D3DUR4|Q8N6U3	Silent	SNP	ENST00000315579.5	37	CCDS8548.1																																																																																				0.522	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
LEPREL2	10536	broad.mit.edu	37	12	6940435	6940435	+	RNA	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:6940435G>A	ENST00000538102.1	+	0	259				LEPREL2_ENST00000251761.8_RNA|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000396725.2_RNA			Q8IVL6	P3H3_HUMAN	leprecan-like 2						extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)	endoplasmic reticulum lumen (GO:0005788)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)	p.P346P(1)		breast(1)|cervix(1)|endometrium(2)|lung(6)	10					L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TCTTCTACCCGGAGGATGAGG	0.587																																					p.R347Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1040A	12						.						97.0	102.0	100.0					12																	6940435		1973	4146	6119	6810696			10536	exon5			U47926	CCDS61027.1	12p13.31	2014-03-25			ENSG00000110811	ENSG00000110811			19318	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 3"""	610342				15063763	Standard	NM_014262		Approved	GRCB, HSU47926, P3H3		Q8IVL6	OTTHUMG00000168516		12.37:g.6940435G>A		Somatic		Capture	Illumina HiSeq	Phase_I	6810696	NM_014262	Q13512|Q15740|Q66K32|Q6NX61|Q7L2T1	Silent	SNP	ENST00000538102.1	37																																																																																					0.587	LEPREL2-006	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000399998.1	NM_014262	
PRB4	5545	broad.mit.edu	37	12	11461178	11461178	+	Missense_Mutation	SNP	G	G	T	rs200327304		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:11461178G>T	ENST00000535904.1	-	3	772	c.739C>A	c.(739-741)Cag>Aag	p.Q247K	PRB4_ENST00000445719.2_Missense_Mutation_p.Q178K|PRB4_ENST00000279575.1_Missense_Mutation_p.Q247K			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	0						extracellular region (GO:0005576)		p.Q247K(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						CTAGATTACTGGGGAGGCTGT	0.522										HNSCC(22;0.051)			G|||	1	0.000199681	0.0	0.0	5008	,	,		17720	0.001		0.0	False		,,,				2504	0.0				p.Q247K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C739A	12						.						103.0	114.0	110.0					12																	11461178		2203	4300	6503	11352445	SO:0001583	missense	5545	exon3				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.739C>A	12.37:g.11461178G>T	ENSP00000442834:p.Gln247Lys	Somatic		Capture	Illumina HiSeq	Phase_I	11352445	NM_002723	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	CCDS8641.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	.	7.270	0.606882	0.14002	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.04603	3.59;3.59;4.02	1.11	1.11	0.20524	.	.	.	.	.	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	D	0.54772	0.968	P	0.56563	0.801	T	0.41998	-0.9477	9	0.87932	D	0	.	5.5667	0.17175	0.0:0.0:1.0:0.0	.	247	E9PAL0	.	K	247;247;178	ENSP00000279575:Q247K;ENSP00000442834:Q247K;ENSP00000412740:Q178K	ENSP00000279575:Q247K	Q	-	1	0	PRB4	11352445	0.000000	0.05858	0.157000	0.22605	0.073000	0.16967	-0.387000	0.07361	0.895000	0.36342	0.400000	0.26472	CAG		0.522	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
CNTN1	1272	broad.mit.edu	37	12	41316228	41316228	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:41316228G>T	ENST00000551295.2	+	5	515	c.398G>T	c.(397-399)gGa>gTa	p.G133V	CNTN1_ENST00000360099.3_Missense_Mutation_p.G133V|CNTN1_ENST00000347616.1_Missense_Mutation_p.G133V|CNTN1_ENST00000547849.1_Missense_Mutation_p.G133V|CNTN1_ENST00000348761.2_Missense_Mutation_p.G122V|CNTN1_ENST00000547702.1_Missense_Mutation_p.G133V	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	133					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.G133V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CTGAGCTTTGGATGTAAGTAA	0.403																																					p.G122V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G365T	12						.						93.0	85.0	88.0					12																	41316228		2203	4300	6503	39602495	SO:0001583	missense	1272	exon4			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.398G>T	12.37:g.41316228G>T	ENSP00000447006:p.Gly133Val	Somatic		Capture	Illumina HiSeq	Phase_I	39602495	NM_175038	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400940	0.83120	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.65916	-0.18;0.21;-0.18;0.21;-0.18;0.19	5.41	4.5	0.54988	.	0.054690	0.64402	N	0.000001	T	0.79975	0.4539	M	0.80982	2.52	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.83402	0.0023	10	0.72032	D	0.01	.	15.6767	0.77332	0.0:0.0:0.8619:0.1381	.	133;122;133	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	V	133;133;133;133;133;122	ENSP00000448004:G133V;ENSP00000447006:G133V;ENSP00000448653:G133V;ENSP00000325660:G133V;ENSP00000353213:G133V;ENSP00000261160:G122V	ENSP00000325660:G133V	G	+	2	0	CNTN1	39602495	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.230000	0.95299	1.384000	0.46424	0.585000	0.79938	GGA		0.403	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
SPATS2	65244	broad.mit.edu	37	12	49884513	49884513	+	Splice_Site	SNP	A	A	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:49884513A>C	ENST00000553127.1	+	7	776	c.263A>C	c.(262-264)aAg>aCg	p.K88T	SPATS2_ENST00000552557.1_3'UTR|SPATS2_ENST00000321898.6_Splice_Site_p.K88T|SPATS2_ENST00000552918.1_Splice_Site_p.K88T			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	88	Poly-Lys.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K88T(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						GGCAAGAAAAAGGTAAAATGA	0.323																																					p.K88T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A263C	12						.						111.0	102.0	105.0					12																	49884513		2203	4300	6503	48170780	SO:0001630	splice_region_variant	65244	exon6			AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.264+1A>C	12.37:g.49884513A>C		Somatic		Capture	Illumina HiSeq	Phase_I	48170780	NM_023071	A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Missense_Mutation	SNP	ENST00000553127.1	37	CCDS31794.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.585617	0.86748	.	.	ENSG00000123352	ENST00000550997;ENST00000553127;ENST00000321898;ENST00000552918;ENST00000395063	.	.	.	5.16	5.16	0.70880	UBA-like (1);	0.051904	0.85682	D	0.000000	T	0.75700	0.3885	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78140	-0.2320	9	0.72032	D	0.01	-16.3747	11.4028	0.49880	1.0:0.0:0.0:0.0	.	88	Q86XZ4	SPAS2_HUMAN	T	88	.	ENSP00000326841:K88T	K	+	2	0	SPATS2	48170780	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.714000	0.84703	1.943000	0.56356	0.482000	0.46254	AAG		0.323	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404023.1	NM_023071	Missense_Mutation
BAZ2A	11176	broad.mit.edu	37	12	57003905	57003905	+	Missense_Mutation	SNP	G	G	A	rs559867064		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:57003905G>A	ENST00000551812.1	-	9	2073	c.1880C>T	c.(1879-1881)aCg>aTg	p.T627M	BAZ2A_ENST00000379441.3_Missense_Mutation_p.T597M|BAZ2A_ENST00000179765.5_Missense_Mutation_p.T595M|BAZ2A_ENST00000549884.1_Missense_Mutation_p.T625M	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	627					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.T627M(1)		breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						CACCTCTGGCGTGTCTCTTTC	0.527													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19170	0.0		0.0	False		,,,				2504	0.0				p.T627M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1880T	12						.						96.0	98.0	97.0					12																	57003905		1948	4130	6078	55290172	SO:0001583	missense	11176	exon9			AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.1880C>T	12.37:g.57003905G>A	ENSP00000446880:p.Thr627Met	Somatic		Capture	Illumina HiSeq	Phase_I	55290172	NM_013449	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	37	CCDS44924.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.55|15.55	2.865757|2.865757	0.51588|0.51588	.|.	.|.	ENSG00000076108|ENSG00000076108	ENST00000547650|ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549884	.|T;T;T;T	.|0.68181	.|-0.31;-0.31;-0.31;-0.31	4.89|4.89	4.89|4.89	0.63831|0.63831	.|Methyl-CpG DNA binding (1);DNA-binding, integrase-type (1);	.|0.111429	.|0.56097	.|D	.|0.000022	T|T	0.73187|0.73187	0.3555|0.3555	L|L	0.29908|0.29908	0.895|0.895	0.48511|0.48511	D|D	0.999661|0.999661	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.71414	.|0.973;0.939	T|T	0.75671|0.75671	-0.3237|-0.3237	5|10	.|0.62326	.|D	.|0.03	.|.	17.3705|17.3705	0.87376|0.87376	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|625;627	.|F8VU39;Q9UIF9	.|.;BAZ2A_HUMAN	C|M	56|597;595;627;625	.|ENSP00000368754:T597M;ENSP00000179765:T595M;ENSP00000446880:T627M;ENSP00000447941:T625M	.|ENSP00000179765:T595M	R|T	-|-	1|2	0|0	BAZ2A|BAZ2A	55290172|55290172	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.372000|0.372000	0.29890|0.29890	4.278000|4.278000	0.58946|0.58946	2.715000|2.715000	0.92844|0.92844	0.655000|0.655000	0.94253|0.94253	CGC|ACG		0.527	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
TAC3	6866	broad.mit.edu	37	12	57406184	57406184	+	Silent	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:57406184C>T	ENST00000458521.2	-	6	504	c.345G>A	c.(343-345)aaG>aaA	p.K115K	TAC3_ENST00000415231.1_Silent_p.K115K|TAC3_ENST00000441881.1_Silent_p.K97K	NM_013251.3	NP_037383.1	Q9UHF0	TKNK_HUMAN	tachykinin 3	115					female pregnancy (GO:0007565)|neuropeptide signaling pathway (GO:0007218)|tachykinin receptor signaling pathway (GO:0007217)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)	p.K115K(1)		cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7						TCGGGGGATACTTGAGGATGC	0.522																																					p.K97K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G291A	12						.						79.0	71.0	74.0					12																	57406184		2203	4300	6503	55692451	SO:0001819	synonymous_variant	6866	exon5			AF186112	CCDS8928.1, CCDS53803.1	12q13-q21	2013-02-26	2008-07-31		ENSG00000166863	ENSG00000166863		"""Endogenous ligands"""	11521	protein-coding gene	gene with protein product	"""preprotachykinin-B"""	162330	"""neuromedin K"", ""neurokinin beta"""	NKNB		3479225, 10866201	Standard	NM_013251		Approved	ZNEUROK1, NKB	uc001smp.3	Q9UHF0	OTTHUMG00000156958	ENST00000458521.2:c.345G>A	12.37:g.57406184C>T		Somatic		Capture	Illumina HiSeq	Phase_I	55692451	NM_001178054	Q6IAG2|Q71BC6|Q71BC9	Silent	SNP	ENST00000458521.2	37	CCDS8928.1																																																																																				0.522	TAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346793.1	NM_001006667	
TMEM5	10329	broad.mit.edu	37	12	64199056	64199056	+	Silent	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:64199056G>A	ENST00000261234.6	+	5	944	c.786G>A	c.(784-786)ctG>ctA	p.L262L	TMEM5_ENST00000537373.1_Silent_p.L2L	NM_014254.1	NP_055069.1	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	262						integral component of plasma membrane (GO:0005887)		p.L262L(1)		breast(1)|large_intestine(3)|liver(2)|lung(7)|prostate(1)|skin(1)	15		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		GGTCAATGCTGCATGATGAGA	0.333																																					p.L262L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G786A	12						.						136.0	134.0	135.0					12																	64199056		2203	4300	6503	62485323	SO:0001819	synonymous_variant	10329	exon5			AB015633	CCDS8966.1, CCDS61179.1	12q14.1	2013-05-07			ENSG00000118600	ENSG00000118600			13530	protein-coding gene	gene with protein product		605862				10072769, 23217329	Standard	NM_014254		Approved	HP10481	uc001srq.2	Q9Y2B1	OTTHUMG00000168730	ENST00000261234.6:c.786G>A	12.37:g.64199056G>A		Somatic		Capture	Illumina HiSeq	Phase_I	62485323	NM_014254	A8K017|Q6PKD6	Silent	SNP	ENST00000261234.6	37	CCDS8966.1																																																																																				0.333	TMEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400821.1	NM_014254	
KERA	11081	broad.mit.edu	37	12	91450050	91450050	+	Silent	SNP	G	G	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:91450050G>C	ENST00000266719.3	-	2	256	c.9C>G	c.(7-9)ggC>ggG	p.G3G		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	3					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.G3G(1)		breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						AACAGATTGTGCCTGCCATTA	0.358																																					p.G3G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C9G	12						.						51.0	44.0	46.0					12																	91450050		2200	4296	6496	89974181	SO:0001819	synonymous_variant	11081	exon2			AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.9C>G	12.37:g.91450050G>C		Somatic		Capture	Illumina HiSeq	Phase_I	89974181	NM_007035		Silent	SNP	ENST00000266719.3	37	CCDS9037.1																																																																																				0.358	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407149.2	NM_007035	
OAS3	4940	broad.mit.edu	37	12	113384617	113384617	+	Missense_Mutation	SNP	G	G	A	rs376430790		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr12:113384617G>A	ENST00000228928.7	+	4	885	c.706G>A	c.(706-708)Gcc>Acc	p.A236T	OAS3_ENST00000546638.1_3'UTR|RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	236	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)	p.A236T(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						GACCATCTTCGCCTGGGAGCA	0.587																																					p.A236T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G706A	12						.	G	THR/ALA	0,4302		0,0,2151	55.0	58.0	57.0		706	3.3	1.0	12		57	1,8531		0,1,4265	no	missense	OAS3	NM_006187.2	58	0,1,6416	AA,AG,GG		0.0117,0.0,0.0078	probably-damaging	236/1088	113384617	1,12833	2151	4266	6417	111869000	SO:0001583	missense	4940	exon4			AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.706G>A	12.37:g.113384617G>A	ENSP00000228928:p.Ala236Thr	Somatic		Capture	Illumina HiSeq	Phase_I	111869000	NM_006187	Q2HJ14|Q9H3P5	Missense_Mutation	SNP	ENST00000228928.7	37	CCDS44981.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239643	0.79800	0.0	1.17E-4	ENSG00000111331	ENST00000228928;ENST00000323881	T	0.59083	0.29	4.23	3.3	0.37823	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	.	.	.	.	T	0.69387	0.3105	M	0.70595	2.14	0.80722	D	1	D	0.76494	0.999	D	0.63877	0.919	T	0.71178	-0.4669	9	0.87932	D	0	.	9.1594	0.37012	0.0:0.0:0.7821:0.2179	.	236	Q9Y6K5	OAS3_HUMAN	T	236	ENSP00000228928:A236T	ENSP00000228928:A236T	A	+	1	0	OAS3	111869000	0.989000	0.36119	0.993000	0.49108	0.989000	0.77384	2.321000	0.43805	1.051000	0.40369	0.655000	0.94253	GCC		0.587	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405920.1		
ATP8A2	51761	broad.mit.edu	37	13	26133142	26133142	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr13:26133142C>T	ENST00000381655.2	+	14	1437	c.1295C>T	c.(1294-1296)aCg>aTg	p.T432M	ATP8A2_ENST00000255283.8_Missense_Mutation_p.T392M	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	392					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T432M(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AAGACTGGAACGCTTACATGC	0.333																																					p.T432M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1295T	13						.						161.0	148.0	152.0					13																	26133142		1876	4124	6000	25031142	SO:0001583	missense	51761	exon14			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1295C>T	13.37:g.26133142C>T	ENSP00000371070:p.Thr432Met	Somatic		Capture	Illumina HiSeq	Phase_I	25031142	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000408	0.74818	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	D;D	0.96651	-4.08;-4.08	4.47	4.47	0.54385	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.232358	0.43919	D	0.000504	D	0.99036	0.9670	H	0.99404	4.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.999	D	0.98737	1.0715	10	0.87932	D	0	.	15.4903	0.75600	0.0:1.0:0.0:0.0	.	392;392;392	B7Z880;Q9NTI2-3;Q9NTI2	.;.;AT8A2_HUMAN	M	432;392;212	ENSP00000371070:T432M;ENSP00000255283:T392M	ENSP00000255283:T392M	T	+	2	0	ATP8A2	25031142	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	7.601000	0.82783	2.326000	0.78906	0.542000	0.68232	ACG		0.333	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
RXFP2	122042	broad.mit.edu	37	13	32371378	32371378	+	Silent	SNP	T	T	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr13:32371378T>C	ENST00000298386.2	+	17	1898	c.1827T>C	c.(1825-1827)taT>taC	p.Y609Y	RXFP2_ENST00000380314.1_Silent_p.Y585Y	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	609					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)	p.Y609Y(1)		cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		TGTTTTCCTATATTACTATGT	0.378																																					p.Y585Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1755C	13						.						156.0	155.0	155.0					13																	32371378		2203	4300	6503	31269378	SO:0001819	synonymous_variant	122042	exon16			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.1827T>C	13.37:g.32371378T>C		Somatic		Capture	Illumina HiSeq	Phase_I	31269378	NM_001166058	B1ALE9|Q3KU23	Silent	SNP	ENST00000298386.2	37	CCDS9342.1																																																																																				0.378	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
NEK5	341676	broad.mit.edu	37	13	52661489	52661489	+	Silent	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr13:52661489G>A	ENST00000355568.4	-	15	1516	c.1377C>T	c.(1375-1377)aaC>aaT	p.N459N		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	459					positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.N516N(1)|p.N459N(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		CCTTCATTTCGTTTTTCCTAA	0.393																																					p.N459N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1377T	13						.						153.0	145.0	148.0					13																	52661489		2203	4300	6503	51559490	SO:0001819	synonymous_variant	341676	exon15			BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.1377C>T	13.37:g.52661489G>A		Somatic		Capture	Illumina HiSeq	Phase_I	51559490	NM_199289	Q5TAP5	Silent	SNP	ENST00000355568.4	37	CCDS31979.1																																																																																				0.393	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045045.3	NM_199289	
PCDH17	27253	broad.mit.edu	37	13	58208794	58208794	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr13:58208794C>T	ENST00000377918.3	+	1	2140	c.2114C>T	c.(2113-2115)tCg>tTg	p.S705L		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	705					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S705L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TGGGACATGTCGCTGCCGCTC	0.612																																					p.S705L	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2114T	13						.						73.0	71.0	72.0					13																	58208794		2203	4300	6503	57106795	SO:0001583	missense	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2114C>T	13.37:g.58208794C>T	ENSP00000367151:p.Ser705Leu	Somatic		Capture	Illumina HiSeq	Phase_I	57106795	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502085	0.85176	.	.	ENSG00000118946	ENST00000377918	T	0.54479	0.57	5.46	5.46	0.80206	.	0.109676	0.64402	D	0.000004	T	0.69672	0.3137	M	0.66939	2.045	0.80722	D	1	D;D	0.69078	0.997;0.994	P;P	0.62491	0.903;0.803	T	0.68693	-0.5341	9	.	.	.	.	19.3157	0.94213	0.0:1.0:0.0:0.0	.	705;705	O14917-2;O14917	.;PCD17_HUMAN	L	705	ENSP00000367151:S705L	.	S	+	2	0	PCDH17	57106795	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.551000	0.86045	0.655000	0.94253	TCG		0.612	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
MIPOL1	145282	broad.mit.edu	37	14	37969285	37969285	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr14:37969285G>T	ENST00000327441.7	+	13	1670	c.1204G>T	c.(1204-1206)Gaa>Taa	p.E402*	MIPOL1_ENST00000545536.1_Nonsense_Mutation_p.E371*|MIPOL1_ENST00000396294.2_Nonsense_Mutation_p.E402*|MIPOL1_ENST00000537471.1_Nonsense_Mutation_p.E402*|MIPOL1_ENST00000539062.2_Nonsense_Mutation_p.E371*|MIPOL1_ENST00000536774.1_Nonsense_Mutation_p.E221*|MIPOL1_ENST00000556451.1_Nonsense_Mutation_p.E371*	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	402						nucleus (GO:0005634)		p.E402*(1)		breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		AGCAAATATGGAATTACAACT	0.373																																					p.E402X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1204T	14						.						96.0	92.0	94.0					14																	37969285		2203	4300	6503	37039036	SO:0001587	stop_gained	145282	exon14			AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.1204G>T	14.37:g.37969285G>T	ENSP00000333539:p.Glu402*	Somatic		Capture	Illumina HiSeq	Phase_I	37039036	NM_001195297	D3DSA4|Q7Z3J0|Q8IV14	Nonsense_Mutation	SNP	ENST00000327441.7	37	CCDS9664.1	.	.	.	.	.	.	.	.	.	.	G	41	8.691563	0.98916	.	.	ENSG00000151338	ENST00000327441;ENST00000536774;ENST00000539062;ENST00000556451;ENST00000396294;ENST00000537471;ENST00000545536	.	.	.	5.14	4.23	0.50019	.	0.255129	0.31082	N	0.008291	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-6.054	9.6366	0.39811	0.0731:0.2658:0.6612:0.0	.	.	.	.	X	402;221;371;371;402;402;371	.	ENSP00000333539:E402X	E	+	1	0	MIPOL1	37039036	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.270000	0.51600	1.260000	0.44134	0.655000	0.94253	GAA		0.373	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276734.1	NM_138731	
DCAF4	26094	broad.mit.edu	37	14	73425458	73425458	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr14:73425458C>T	ENST00000358377.2	+	14	1653	c.1433C>T	c.(1432-1434)gCg>gTg	p.A478V	DCAF4_ENST00000394234.2_Missense_Mutation_p.A378V|DCAF4_ENST00000509153.1_Missense_Mutation_p.A418V|DCAF4_ENST00000555042.1_Missense_Mutation_p.A472V|DCAF4_ENST00000353777.3_Missense_Mutation_p.A308V	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	478					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)		p.A478V(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						TCCCGGGGCGCGCCGGGGCTG	0.632																																					p.A418V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1253T	14						.						44.0	54.0	50.0					14																	73425458		2203	4300	6503	72495211	SO:0001583	missense	26094	exon12			BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.1433C>T	14.37:g.73425458C>T	ENSP00000351147:p.Ala478Val	Somatic		Capture	Illumina HiSeq	Phase_I	72495211	NM_181341	B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Missense_Mutation	SNP	ENST00000358377.2	37	CCDS9809.1	.	.	.	.	.	.	.	.	.	.	C	1.280	-0.610510	0.03690	.	.	ENSG00000119599	ENST00000358377;ENST00000353777;ENST00000394234;ENST00000509153;ENST00000555042	T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03	5.02	0.18	0.15068	.	0.491314	0.23096	N	0.051968	T	0.07818	0.0196	N	0.17674	0.51	0.29065	N	0.88366	B;B;B;B;B	0.33345	0.022;0.04;0.066;0.409;0.04	B;B;B;B;B	0.15052	0.005;0.007;0.011;0.012;0.005	T	0.31194	-0.9952	10	0.17369	T	0.5	.	4.6519	0.12599	0.0:0.21:0.3903:0.3998	.	418;457;472;308;478	B4DUT6;B4DN30;G3V522;Q86SY2;Q8WV16	.;.;.;.;DCAF4_HUMAN	V	478;308;378;418;472	ENSP00000351147:A478V;ENSP00000345176:A308V;ENSP00000377781:A378V;ENSP00000426178:A418V;ENSP00000452131:A472V	ENSP00000345176:A308V	A	+	2	0	DCAF4	72495211	0.952000	0.32445	0.005000	0.12908	0.005000	0.04900	1.885000	0.39678	0.039000	0.15632	-1.263000	0.01449	GCG		0.632	DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361058.1	NM_015604	
DICER1	23405	broad.mit.edu	37	14	95590693	95590693	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr14:95590693G>A	ENST00000526495.1	-	10	1507	c.1216C>T	c.(1216-1218)Cag>Tag	p.Q406*	DICER1_ENST00000541352.1_Nonsense_Mutation_p.Q406*|DICER1_ENST00000343455.3_Nonsense_Mutation_p.Q406*|DICER1_ENST00000527414.1_Nonsense_Mutation_p.Q406*|DICER1_ENST00000393063.1_Nonsense_Mutation_p.Q406*			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	406	Required for interaction with PRKRA and TARBP2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)	p.Q406*(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TAATTATCCTGATTTCTATTA	0.353			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.Q406X		yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1216T	14						.						128.0	130.0	129.0					14																	95590693		2203	4300	6503	94660446	SO:0001587	stop_gained	23405	exon7	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.1216C>T	14.37:g.95590693G>A	ENSP00000437256:p.Gln406*	Somatic		Capture	Illumina HiSeq	Phase_I	94660446	NM_001195573	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Nonsense_Mutation	SNP	ENST00000526495.1	37	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	G	42	9.282021	0.99123	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-20.3727	19.4888	0.95042	0.0:0.0:1.0:0.0	.	.	.	.	X	406	.	ENSP00000343745:Q406X	Q	-	1	0	DICER1	94660446	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	7.258000	0.78371	2.607000	0.88179	0.585000	0.79938	CAG		0.353	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
NPAP1	23742	broad.mit.edu	37	15	24921893	24921893	+	Silent	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr15:24921893G>A	ENST00000329468.2	+	1	1353	c.879G>A	c.(877-879)ccG>ccA	p.P293P		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	293	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P293P(1)									TAGGCTTGCCGATTCCGCTGA	0.622																																					p.P293P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G879A	15						.						47.0	47.0	47.0					15																	24921893		2203	4300	6503	22472986	SO:0001819	synonymous_variant	23742	exon1			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.879G>A	15.37:g.24921893G>A		Somatic		Capture	Illumina HiSeq	Phase_I	22472986	NM_018958		Silent	SNP	ENST00000329468.2	37	CCDS10015.1																																																																																				0.622	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
PLA2G4D	283748	broad.mit.edu	37	15	42379523	42379523	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr15:42379523C>T	ENST00000290472.3	-	3	324	c.230G>A	c.(229-231)cGt>cAt	p.R77H		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	77	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)	p.R77H(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		GATAAGGAAACGGAAGGCCTC	0.567																																					p.R77H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G230A	15						.						208.0	189.0	196.0					15																	42379523		2203	4299	6502	40166815	SO:0001583	missense	283748	exon3			AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.230G>A	15.37:g.42379523C>T	ENSP00000290472:p.Arg77His	Somatic		Capture	Illumina HiSeq	Phase_I	40166815	NM_178034	Q8N176	Missense_Mutation	SNP	ENST00000290472.3	37	CCDS32203.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-2.015556	0.00422	.	.	ENSG00000159337	ENST00000290472	T	0.69040	-0.37	5.21	-1.5	0.08691	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.751666	0.12690	N	0.447247	T	0.28928	0.0718	N	0.01771	-0.73	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31420	-0.9944	10	0.05351	T	0.99	1.7186	6.3896	0.21579	0.0:0.3997:0.2574:0.3429	.	77	Q86XP0	PA24D_HUMAN	H	77	ENSP00000290472:R77H	ENSP00000290472:R77H	R	-	2	0	PLA2G4D	40166815	0.141000	0.22595	0.196000	0.23383	0.054000	0.15201	-0.397000	0.07269	-0.470000	0.06901	-1.736000	0.00690	CGT		0.567	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1	NM_178034	
NRG4	145957	broad.mit.edu	37	15	76254214	76254214	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr15:76254214G>A	ENST00000394907.3	-	4	387	c.206C>T	c.(205-207)gCg>gTg	p.A69V	NRG4_ENST00000535975.1_Missense_Mutation_p.A69V	NM_138573.3	NP_612640.1	Q8WWG1	NRG4_HUMAN	neuregulin 4	69					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A69V(1)		large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	5						TACTAGGACCGCCAATGCCAC	0.393																																					p.A69V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C206T	15						.						115.0	122.0	120.0					15																	76254214		2197	4294	6491	74041269	SO:0001583	missense	145957	exon4			BC017568	CCDS10288.1	15q23	2005-10-30			ENSG00000169752	ENSG00000169752			29862	protein-coding gene	gene with protein product		610894				12477932	Standard	NM_138573		Approved	HRG4	uc002bbo.3	Q8WWG1	OTTHUMG00000142917	ENST00000394907.3:c.206C>T	15.37:g.76254214G>A	ENSP00000378367:p.Ala69Val	Somatic		Capture	Illumina HiSeq	Phase_I	74041269	NM_138573	A6NIE8	Missense_Mutation	SNP	ENST00000394907.3	37	CCDS10288.1	.	.	.	.	.	.	.	.	.	.	G	5.968	0.362575	0.11296	.	.	ENSG00000169752	ENST00000394907;ENST00000535975	T;T	0.16897	2.31;2.31	5.02	2.14	0.27477	.	0.274243	0.18251	U	0.146951	T	0.10380	0.0254	L	0.31845	0.965	0.09310	N	1	B	0.17465	0.022	B	0.12837	0.008	T	0.40270	-0.9572	10	0.10902	T	0.67	0.001	7.1142	0.25407	0.3669:0.0:0.6331:0.0	.	69	Q8WWG1	NRG4_HUMAN	V	69	ENSP00000378367:A69V;ENSP00000441129:A69V	ENSP00000378367:A69V	A	-	2	0	NRG4	74041269	0.005000	0.15991	0.001000	0.08648	0.006000	0.05464	1.431000	0.34925	0.164000	0.19529	-0.262000	0.10625	GCG		0.393	NRG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286632.1	NM_138573	
NR2F2	7026	broad.mit.edu	37	15	96877379	96877379	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr15:96877379A>T	ENST00000394166.3	+	2	1906	c.517A>T	c.(517-519)Aac>Tac	p.N173Y	NR2F2_ENST00000421109.2_Missense_Mutation_p.N40Y|MIR1469_ENST00000410719.1_RNA|NR2F2_ENST00000394171.2_Missense_Mutation_p.N20Y|NR2F2_ENST00000453270.2_Missense_Mutation_p.N20Y	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	173	Interaction with ZFPM2. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.N173Y(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			GGATCCCCTCAACTGCCACTC	0.642																																					p.N40Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A118T	15						.						126.0	121.0	123.0					15																	96877379		2197	4298	6495	94678383	SO:0001583	missense	7026	exon2			M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.517A>T	15.37:g.96877379A>T	ENSP00000377721:p.Asn173Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	94678383	NM_001145155	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Missense_Mutation	SNP	ENST00000394166.3	37	CCDS10375.1	.	.	.	.	.	.	.	.	.	.	A	16.61	3.170726	0.57584	.	.	ENSG00000185551	ENST00000421109;ENST00000394166;ENST00000394171;ENST00000453270	D;D;D;D	0.93859	-3.3;-3.26;-3.3;-3.3	4.87	4.87	0.63330	Nuclear hormone receptor, ligand-binding (2);	0.048251	0.85682	D	0.000000	D	0.94248	0.8153	M	0.80847	2.515	0.58432	D	0.999999	B;B	0.28605	0.002;0.217	B;B	0.38296	0.003;0.27	D	0.93836	0.7132	10	0.59425	D	0.04	.	14.4595	0.67440	1.0:0.0:0.0:0.0	.	173;40	P24468;Q3KQR7	COT2_HUMAN;.	Y	40;173;20;20	ENSP00000401674:N40Y;ENSP00000377721:N173Y;ENSP00000377726:N20Y;ENSP00000389853:N20Y	ENSP00000377721:N173Y	N	+	1	0	NR2F2	94678383	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.574000	0.74014	1.822000	0.53115	0.379000	0.24179	AAC		0.642	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
VWA3A	146177	broad.mit.edu	37	16	22157664	22157664	+	Splice_Site	SNP	C	C	T	rs377486149	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr16:22157664C>T	ENST00000389398.5	+	27	2934	c.2838C>T	c.(2836-2838)tcC>tcT	p.S946S	VWA3A_ENST00000563755.1_Splice_Site_p.S24S|VWA3A_ENST00000389397.4_Splice_Site_p.S24S	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	946						extracellular region (GO:0005576)		p.S142S(1)|p.S24S(1)|p.S946S(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		GGCTGCTGTCCGGTGAGCCTG	0.602													C|||	2	0.000399361	0.0008	0.0	5008	,	,		15252	0.0		0.0	False		,,,				2504	0.001				p.S946S												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C2838T	16						.	C		1,4223		0,1,2111	61.0	64.0	63.0		2838	-4.1	1.0	16		63	0,8460		0,0,4230	no	coding-synonymous-near-splice	VWA3A	NM_173615.3		0,1,6341	TT,TC,CC		0.0,0.0237,0.0079		946/1185	22157664	1,12683	2112	4230	6342	22065165	SO:0001630	splice_region_variant	146177	exon27			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2839+1C>T	16.37:g.22157664C>T		Somatic		Capture	Illumina HiSeq	Phase_I	22065165	NM_173615	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Silent	SNP	ENST00000389398.5	37	CCDS45441.1																																																																																				0.602	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		Silent
PRR14	78994	broad.mit.edu	37	16	30667434	30667434	+	Silent	SNP	T	T	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr16:30667434T>C	ENST00000542965.2	+	11	2016	c.1560T>C	c.(1558-1560)gcT>gcC	p.A520A	FBRS_ENST00000356166.6_5'Flank|PRR14_ENST00000300835.4_Silent_p.A520A			Q9BWN1	PRR14_HUMAN	proline rich 14	520								p.A520A(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	18			Colorectal(24;0.103)			TCCGGCGGGCTGTGGAATTTC	0.617																																					p.A520A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1560C	16						.						83.0	88.0	86.0					16																	30667434		2197	4300	6497	30574935	SO:0001819	synonymous_variant	78994	exon12			AK074783	CCDS10687.1	16p11.2	2008-02-05			ENSG00000156858	ENSG00000156858			28458	protein-coding gene	gene with protein product						12477932	Standard	NM_024031		Approved	MGC3121	uc002dyy.3	Q9BWN1	OTTHUMG00000132414	ENST00000542965.2:c.1560T>C	16.37:g.30667434T>C		Somatic		Capture	Illumina HiSeq	Phase_I	30574935	NM_024031	Q8WTX2	Silent	SNP	ENST00000542965.2	37	CCDS10687.1																																																																																				0.617	PRR14-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434433.1	NM_024031	
CMTM4	146223	broad.mit.edu	37	16	66670389	66670389	+	Silent	SNP	C	C	T	rs376800910		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr16:66670389C>T	ENST00000330687.4	-	2	463	c.282G>A	c.(280-282)gcG>gcA	p.A94A	CMTM4_ENST00000394106.2_Silent_p.A94A|CMTM4_ENST00000563952.1_Silent_p.A65A	NM_178818.2|NM_181521.2	NP_848933.1|NP_852662.1	Q8IZR5	CKLF4_HUMAN	CKLF-like MARVEL transmembrane domain containing 4	94	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.A94A(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0811)|Epithelial(162;0.214)		TCACCACAAACGCACTGCAGC	0.502																																					p.A94A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G282A	16						.	C	,	0,4402		0,0,2201	113.0	93.0	100.0		282,282	-6.7	0.8	16		100	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CMTM4	NM_178818.2,NM_181521.2	,	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	,	94/235,94/209	66670389	1,13001	2201	4300	6501	65227890	SO:0001819	synonymous_variant	146223	exon2			AF479814	CCDS10817.1, CCDS42170.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000183723	ENSG00000183723			19175	protein-coding gene	gene with protein product		607887	"""chemokine-like factor super family 4"", ""chemokine-like factor superfamily 4"""	CKLFSF4		12782130	Standard	NM_178818		Approved		uc002epz.3	Q8IZR5	OTTHUMG00000137500	ENST00000330687.4:c.282G>A	16.37:g.66670389C>T		Somatic		Capture	Illumina HiSeq	Phase_I	65227890	NM_181521	Q52M40|Q8IZR4|Q8IZV1	Silent	SNP	ENST00000330687.4	37	CCDS10817.1																																																																																				0.502	CMTM4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268807.1		
BCO1	53630	broad.mit.edu	37	16	81303878	81303878	+	Missense_Mutation	SNP	G	G	A	rs570126506		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr16:81303878G>A	ENST00000258168.2	+	7	1419	c.958G>A	c.(958-960)Gtg>Atg	p.V320M	BCMO1_ENST00000425577.2_Missense_Mutation_p.V251M	NM_017429.2	NP_059125.2												p.V320M(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						CGGCTGCATCGTGTTTGACGT	0.552													G|||	1	0.000199681	0.0	0.0	5008	,	,		18977	0.0		0.0	False		,,,				2504	0.001				p.V320M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G958A	16						.						186.0	137.0	154.0					16																	81303878		2202	4300	6502	79861379	SO:0001583	missense	53630	exon7																														ENST00000258168.2:c.958G>A	16.37:g.81303878G>A	ENSP00000258168:p.Val320Met	Somatic		Capture	Illumina HiSeq	Phase_I	79861379	NM_017429		Missense_Mutation	SNP	ENST00000258168.2	37	CCDS10934.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881124	0.33255	.	.	ENSG00000135697	ENST00000258168;ENST00000425577	D;D	0.96232	-3.95;-3.95	5.62	-2.09	0.07232	.	0.432303	0.24076	N	0.041767	D	0.94571	0.8251	M	0.79343	2.45	0.37085	D	0.899185	D;P	0.63046	0.992;0.875	P;B	0.44897	0.463;0.344	D	0.92091	0.5680	10	0.62326	D	0.03	-4.5565	9.1771	0.37118	0.1574:0.1476:0.6236:0.0714	.	251;320	E7EM88;Q9HAY6	.;BCDO1_HUMAN	M	320;251	ENSP00000258168:V320M;ENSP00000400586:V251M	ENSP00000258168:V320M	V	+	1	0	BCMO1	79861379	0.000000	0.05858	0.198000	0.23420	0.306000	0.27790	-0.226000	0.09139	-0.197000	0.10350	-0.171000	0.13296	GTG		0.552	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269056.1		
SH2B1	25970	broad.mit.edu	37	16	28856758	28856760	+	5'Flank	DEL	CTC	CTC	-	rs147246330		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	CTC	CTC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr16:28856758_28856760delCTC	ENST00000322610.8	+	0	0				MIR4721_ENST00000577590.1_RNA|TUFM_ENST00000313511.3_In_Frame_Del_p.E97del			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1						blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.E97delE(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						CATTGTCAATCTCCTCGTACTTC	0.547																																					p.97_97del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.289_291del	16						.																																			28764261	SO:0001631	upstream_gene_variant	7284	exon3			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2			16.37:g.28856761_28856763delCTC	Exception_encountered	Somatic		Capture	Illumina HiSeq	Phase_I	28764259	NM_003321	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	In_Frame_Del	DEL	ENST00000322610.8	37	CCDS53996.1																																																																																				0.547	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503	
PLCG2	5336	broad.mit.edu	37	16	81953228	81953228	+	Missense_Mutation	SNP	C	C	T	rs369760877		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr16:81953228C>T	ENST00000359376.3	+	20	2408	c.2194C>T	c.(2194-2196)Cgc>Tgc	p.R732C		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	732	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.R732C(2)		NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						GATGAGACTGCGCTACCCCGT	0.542																																					p.R732C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2194T	16						.	C	CYS/ARG	0,3896		0,0,1948	68.0	72.0	71.0		2194	5.2	1.0	16		71	1,8249		0,1,4124	no	missense	PLCG2	NM_002661.3	180	0,1,6072	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging	732/1266	81953228	1,12145	1948	4125	6073	80510729	SO:0001583	missense	5336	exon20				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.2194C>T	16.37:g.81953228C>T	ENSP00000352336:p.Arg732Cys	Somatic		Capture	Illumina HiSeq	Phase_I	80510729	NM_002661	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	37	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.008706	0.93346	0.0	1.21E-4	ENSG00000197943	ENST00000359376	T	0.67523	-0.27	5.16	5.16	0.70880	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);SH2 motif (2);	0.000000	0.85682	D	0.000000	T	0.80623	0.4658	M	0.64170	1.965	0.80722	D	1	P;D	0.89917	0.896;1.0	B;D	0.87578	0.137;0.998	T	0.81475	-0.0916	10	0.54805	T	0.06	.	18.6548	0.91448	0.0:1.0:0.0:0.0	.	599;732	B4E3H3;P16885	.;PLCG2_HUMAN	C	732	ENSP00000352336:R732C	ENSP00000352336:R732C	R	+	1	0	PLCG2	80510729	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.665000	0.83852	2.392000	0.81423	0.655000	0.94253	CGC		0.542	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
NATD1	256302	broad.mit.edu	37	17	21147502	21147502	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr17:21147502C>T	ENST00000399011.2	-	3	140	c.139G>A	c.(139-141)Gtg>Atg	p.V47M	C17orf103_ENST00000468196.1_Silent_p.T47T	NM_152914.2	NP_690878.2	Q8N6N6	NATD1_HUMAN		48	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.							p.T47T(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6						CGCTTGCCCACGTACTCATAG	0.627																																					p.T47T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G141A	17						.						44.0	48.0	47.0					17																	21147502		2160	4257	6417	21088095	SO:0001583	missense	256302	exon2																														ENST00000399011.2:c.139G>A	17.37:g.21147502C>T	ENSP00000454565:p.Val47Met	Somatic		Capture	Illumina HiSeq	Phase_I	21088095	NM_152914	A8MWQ7|B3KX70	Missense_Mutation	SNP	ENST00000399011.2	37																																																																																					0.627	C17orf103-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
C17orf75	64149	broad.mit.edu	37	17	30669055	30669055	+	Missense_Mutation	SNP	C	C	G	rs116565498	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr17:30669055C>G	ENST00000577809.1	-	1	153	c.104G>C	c.(103-105)aGc>aCc	p.S35T	RP11-227G15.3_ENST00000581915.1_RNA|C17orf75_ENST00000225805.4_Missense_Mutation_p.S35T	NM_022344.3	NP_071739.2	Q9HAS0	NJMU_HUMAN	chromosome 17 open reading frame 75	35								p.S35T(1)		ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			GTAGTGGCTGCTGGACGGCGG	0.682																																					p.S35T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G104C	17						.						10.0	18.0	16.0					17																	30669055		1902	4075	5977	27693168	SO:0001583	missense	64149	exon1			AB062437	CCDS58537.1	17q11.2	2013-01-21			ENSG00000108666	ENSG00000108666			30173	protein-coding gene	gene with protein product							Standard	NM_022344		Approved	NJMU-R1	uc002hhg.3	Q9HAS0		ENST00000577809.1:c.104G>C	17.37:g.30669055C>G	ENSP00000464275:p.Ser35Thr	Somatic		Capture	Illumina HiSeq	Phase_I	27693168	NM_022344	Q7Z2H4	Missense_Mutation	SNP	ENST00000577809.1	37	CCDS58537.1	390	0.17857142857142858	72	0.14634146341463414	64	0.17679558011049723	138	0.24125874125874125	116	0.15303430079155672	C	13.95	2.388750	0.42308	.	.	ENSG00000108666	ENST00000225805	.	.	.	4.86	4.86	0.63082	.	0.092204	0.85682	D	0.000000	T	0.00012	0.0000	L	0.28274	0.84	0.29134	P	0.879472	B	0.15473	0.013	B	0.17979	0.02	T	0.05402	-1.0887	8	0.33141	T	0.24	-9.9049	10.5178	0.44900	0.0:0.9097:0.0:0.0903	.	35	Q9HAS0	NJMU_HUMAN	T	35	.	ENSP00000225805:S35T	S	-	2	0	C17orf75	27693168	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	0.841000	0.27613	2.522000	0.85027	0.455000	0.32223	AGC		0.682	C17orf75-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447204.1	NM_022344	
ATP2A3	489	broad.mit.edu	37	17	3839620	3839620	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr17:3839620C>T	ENST00000352011.3	-	16	2519	c.2465G>A	c.(2464-2466)cGg>cAg	p.R822Q	ATP2A3_ENST00000397043.3_Missense_Mutation_p.R822Q|ATP2A3_ENST00000309890.7_Missense_Mutation_p.R822Q|ATP2A3_ENST00000397039.1_Missense_Mutation_p.R6Q|ATP2A3_ENST00000397035.3_Missense_Mutation_p.R822Q|ATP2A3_ENST00000359983.3_Missense_Mutation_p.R822Q|ATP2A3_ENST00000397041.3_Missense_Mutation_p.R822Q			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	822					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.R822Q(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		TCGGGGGCTCCGGGGCAGCTT	0.627																																					p.R822Q	GBM(32;29 774 15719 37967)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2465A	17						.						60.0	65.0	63.0					17																	3839620		2203	4300	6503	3786369	SO:0001583	missense	489	exon16				CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.2465G>A	17.37:g.3839620C>T	ENSP00000301387:p.Arg822Gln	Somatic		Capture	Illumina HiSeq	Phase_I	3786369	NM_174955	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Missense_Mutation	SNP	ENST00000352011.3	37	CCDS11041.1	.	.	.	.	.	.	.	.	.	.	C	35	5.429345	0.96131	.	.	ENSG00000074370	ENST00000397043;ENST00000397039;ENST00000352011;ENST00000359983;ENST00000397041;ENST00000397045;ENST00000309890;ENST00000397035	D;D;D;D;D;D;D	0.96940	-4.18;-4.18;-4.18;-4.18;-4.18;-4.18;-4.18	4.43	4.43	0.53597	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98943	0.9641	H	0.98629	4.285	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.992;0.995;0.998;0.997;0.997;0.997	D	0.98883	1.0770	10	0.87932	D	0	.	17.3058	0.87194	0.0:1.0:0.0:0.0	.	822;822;822;822;822;822	Q93084-4;Q93084-2;Q93084;Q93084-6;G3XAE1;Q93084-3	.;.;AT2A3_HUMAN;.;.;.	Q	822;6;822;822;822;822;822;822	ENSP00000380236:R822Q;ENSP00000380232:R6Q;ENSP00000301387:R822Q;ENSP00000353072:R822Q;ENSP00000380234:R822Q;ENSP00000312577:R822Q;ENSP00000380229:R822Q	ENSP00000312577:R822Q	R	-	2	0	ATP2A3	3786369	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.651000	0.83577	2.756000	0.94617	0.561000	0.74099	CGG		0.627	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953	
KRTAP4-4	84616	broad.mit.edu	37	17	39316640	39316640	+	Missense_Mutation	SNP	G	G	A	rs73983195	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr17:39316640G>A	ENST00000390661.3	-	1	343	c.304C>T	c.(304-306)Cgc>Tgc	p.R102C		NM_032524.1	NP_115913.1	Q9BYR3	KRA44_HUMAN	keratin associated protein 4-4	102	26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].		Missing (in allele KAP4.4-v1).			keratin filament (GO:0045095)		p.R102C(1)		kidney(1)|large_intestine(1)|lung(5)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CAGCTGGGGCGGCAGCAGGTG	0.662													G|||	51	0.0101837	0.0371	0.0029	5008	,	,		17649	0.0		0.0	False		,,,				2504	0.0				p.R102C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C304T	17						.	G	CYS/ARG	118,4282		2,114,2084	40.0	48.0	45.0		304	-10.9	0.0	17	dbSNP_130	45	3,8591		0,3,4294	no	missense	KRTAP4-4	NM_032524.1	180	2,117,6378	AA,AG,GG		0.0349,2.6818,0.9312	probably-damaging	102/167	39316640	121,12873	2200	4297	6497	36570166	SO:0001583	missense	84616	exon1			AJ406936	CCDS11383.1	17q21.2	2013-06-25			ENSG00000171396	ENSG00000171396		"""Keratin associated proteins"""	16928	protein-coding gene	gene with protein product			"""keratin associated protein 4-13"""	KRTAP4-13		11279113	Standard	NM_032524		Approved	KAP4.4, KAP4.13	uc002hwc.3	Q9BYR3	OTTHUMG00000133428	ENST00000390661.3:c.304C>T	17.37:g.39316640G>A	ENSP00000375076:p.Arg102Cys	Somatic		Capture	Illumina HiSeq	Phase_I	36570166	NM_032524	Q9BYU7	Missense_Mutation	SNP	ENST00000390661.3	37	CCDS11383.1	21	0.009615384615384616	20	0.04065040650406504	1	0.0027624309392265192	0	0.0	0	0.0	.	14.04	2.415776	0.42817	0.026818	3.49E-4	ENSG00000171396	ENST00000390661	T	0.01430	4.9	5.47	-10.9	0.00192	.	3.094940	0.03345	U	0.195326	T	0.00754	0.0025	M	0.69823	2.125	0.19945	N	0.999941	D	0.76494	0.999	P	0.51229	0.663	T	0.31280	-0.9949	10	0.54805	T	0.06	.	11.4363	0.50070	0.0:0.1129:0.4846:0.4025	.	102	Q9BYR3	KRA44_HUMAN	C	102	ENSP00000375076:R102C	ENSP00000375076:R102C	R	-	1	0	KRTAP4-4	36570166	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.033000	0.01425	-1.585000	0.01634	-0.867000	0.03001	CGC		0.662	KRTAP4-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257291.1		
NBR1	4077	broad.mit.edu	37	17	41352520	41352520	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr17:41352520A>C	ENST00000422280.1	+	17	2822	c.2363A>C	c.(2362-2364)aAc>aCc	p.N788T	NBR1_ENST00000341165.6_Missense_Mutation_p.N788T|NBR1_ENST00000589872.1_Missense_Mutation_p.N788T|NBR1_ENST00000542611.1_Missense_Mutation_p.N767T|NBR1_ENST00000590996.1_Missense_Mutation_p.N788T|NBR1_ENST00000389312.4_Missense_Mutation_p.N788T	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	788					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		GGAGGGGAGAACCAGCCACAG	0.602																																					p.N788T												.	.	0			c.A2363C	17						.						40.0	36.0	37.0					17																	41352520		1568	3582	5150	38708046	SO:0001583	missense	4077	exon17			X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.2363A>C	17.37:g.41352520A>C	ENSP00000411250:p.Asn788Thr	None		Capture	Illumina HiSeq	Phase_I	38708046	NM_005899	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	37	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	A	5.744	0.321680	0.10845	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000537493;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.41758	1.58;0.99;1.58;1.58	5.97	2.07	0.26955	.	.	.	.	.	T	0.32526	0.0832	L	0.51422	1.61	0.22500	N	0.99905	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.24764	-1.0151	9	0.34782	T	0.22	-4.7658	4.5997	0.12347	0.4952:0.1625:0.3423:0.0	.	767;788;788	B7Z5R6;Q14596-2;Q14596	.;.;NBR1_HUMAN	T	788;767;39;788;788;788	ENSP00000411250:N788T;ENSP00000437545:N767T;ENSP00000343479:N788T;ENSP00000373963:N788T	ENSP00000343479:N788T	N	+	2	0	NBR1	38708046	0.000000	0.05858	0.325000	0.25375	0.576000	0.36127	0.270000	0.18607	0.365000	0.24400	0.533000	0.62120	AAC		0.602	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
KANSL1	284058	broad.mit.edu	37	17	44144025	44144025	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr17:44144025G>A	ENST00000262419.6	-	6	2196	c.1726C>T	c.(1726-1728)Cga>Tga	p.R576*	KANSL1_ENST00000572904.1_Nonsense_Mutation_p.R576*|KANSL1_ENST00000393476.3_De_novo_Start_OutOfFrame|KANSL1_ENST00000574590.1_Nonsense_Mutation_p.R576*|KANSL1_ENST00000432791.1_Nonsense_Mutation_p.R576*|KANSL1_ENST00000575318.1_Nonsense_Mutation_p.R576*	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	576					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R576*(1)									AGATTCAGTCGTTGCTTCTTA	0.502																																					p.R576X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1726T	17						.						118.0	96.0	103.0					17																	44144025		2203	4300	6503	41499847	SO:0001587	stop_gained	284058	exon6			BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.1726C>T	17.37:g.44144025G>A	ENSP00000262419:p.Arg576*	Somatic		Capture	Illumina HiSeq	Phase_I	41499847	NM_015443	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Nonsense_Mutation	SNP	ENST00000262419.6	37	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	G	37	6.489738	0.97607	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	.	.	.	4.93	0.331	0.15933	.	0.447428	0.22051	N	0.065302	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.3542	12.5995	0.56489	0.0:0.0:0.4048:0.5952	.	.	.	.	X	576	.	ENSP00000262419:R576X	R	-	1	2	KIAA1267	41499847	0.992000	0.36948	0.979000	0.43373	0.990000	0.78478	1.238000	0.32707	-0.164000	0.10927	0.555000	0.69702	CGA		0.502	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	
RPL38	6169	broad.mit.edu	37	17	72205953	72205953	+	Silent	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr17:72205953G>A	ENST00000311111.6	+	5	329	c.198G>A	c.(196-198)gtG>gtA	p.V66V	CTD-2514K5.2_ENST00000499670.2_RNA|RPL38_ENST00000584577.1_Splice_Site_p.V63V|RPL38_ENST00000439590.2_Silent_p.V66V|CTD-2514K5.2_ENST00000532794.1_RNA|RPL38_ENST00000533498.1_Silent_p.V66V|CTD-2514K5.2_ENST00000531617.1_RNA			P63173	RL38_HUMAN	ribosomal protein L38	66					90S preribosome assembly (GO:0034463)|axial mesoderm development (GO:0048318)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|middle ear morphogenesis (GO:0042474)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ossification (GO:0001503)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|eukaryotic 80S initiation complex (GO:0033291)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.V66V(1)		large_intestine(1)|pancreas(1)	2						GTTTGGCAGTGAAGGAACTGA	0.388																																					p.V66V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G198A	17						.						134.0	132.0	133.0					17																	72205953		2203	4300	6503	69717548	SO:0001819	synonymous_variant	6169	exon5			AB007185	CCDS11696.1	17q25.1	2013-06-19			ENSG00000172809	ENSG00000172809		"""L ribosomal proteins"""	10349	protein-coding gene	gene with protein product		604182				9582194	Standard	NM_000999		Approved	L38	uc002jka.3	P63173	OTTHUMG00000166016	ENST00000311111.6:c.198G>A	17.37:g.72205953G>A		Somatic		Capture	Illumina HiSeq	Phase_I	69717548	NM_000999	B2R5A8|P23411	Silent	SNP	ENST00000311111.6	37	CCDS11696.1																																																																																				0.388	RPL38-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387450.2	NM_000999	
GPRC5C	55890	broad.mit.edu	37	17	72436049	72436049	+	Missense_Mutation	SNP	G	G	A	rs551384896		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr17:72436049G>A	ENST00000481232.1	+	2	780	c.269G>A	c.(268-270)cGc>cAc	p.R90H	GPRC5C_ENST00000342648.5_Intron|GPRC5C_ENST00000392627.1_Missense_Mutation_p.R90H|GPRC5C_ENST00000392629.2_Missense_Mutation_p.R57H			Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	45					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)	p.R90H(1)		central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						CTGTGTGACCGCTCTGGGGCG	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		17492	0.001		0.0	False		,,,				2504	0.0				p.R57H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G170A	17						.						63.0	59.0	61.0					17																	72436049		2203	4299	6502	69947644	SO:0001583	missense	55890	exon2			AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000481232.1:c.269G>A	17.37:g.72436049G>A	ENSP00000462147:p.Arg90His	Somatic		Capture	Illumina HiSeq	Phase_I	69947644	NM_018653	B5BUN4|Q2NL85|Q9NZG5	Missense_Mutation	SNP	ENST00000481232.1	37		.	.	.	.	.	.	.	.	.	.	G	11.30	1.598078	0.28445	.	.	ENSG00000170412	ENST00000392627;ENST00000342648;ENST00000392629;ENST00000392628	T;T	0.23950	1.88;2.2	5.55	5.55	0.83447	.	0.116516	0.64402	D	0.000018	T	0.40791	0.1131	L	0.56769	1.78	0.43091	D	0.994766	D;D;D;D	0.76494	0.998;0.994;0.999;0.999	P;P;D;P	0.63113	0.818;0.719;0.911;0.902	T	0.08513	-1.0718	10	0.19590	T	0.45	-3.6851	12.1894	0.54261	0.0:0.0:0.7303:0.2697	.	45;45;57;45	A8MXZ4;Q9NQ84;Q9NQ84-2;Q9BSP0	.;GPC5C_HUMAN;.;.	H	45;90;57;45	ENSP00000376403:R45H;ENSP00000376405:R57H	ENSP00000340595:R90H	R	+	2	0	GPRC5C	69947644	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	3.780000	0.55386	2.616000	0.88540	0.561000	0.74099	CGC		0.662	GPRC5C-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000145095.2		
ST8SIA3	51046	broad.mit.edu	37	18	55024523	55024523	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr18:55024523C>T	ENST00000324000.3	+	3	2716	c.682C>T	c.(682-684)Cgt>Tgt	p.R228C		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	228					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.R228C(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		TATTCAGGACCGTAACAACTT	0.418																																					p.R228C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C682T	18						.						52.0	54.0	53.0					18																	55024523		2203	4299	6502	53175521	SO:0001583	missense	51046	exon3			AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.682C>T	18.37:g.55024523C>T	ENSP00000320431:p.Arg228Cys	Somatic		Capture	Illumina HiSeq	Phase_I	53175521	NM_015879	A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	ENST00000324000.3	37	CCDS32834.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684543	0.68157	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.33438	1.41	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.66781	0.2824	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73139	-0.4077	10	0.72032	D	0.01	-17.7308	19.7585	0.96304	0.0:1.0:0.0:0.0	.	228	O43173	SIA8C_HUMAN	C	335;228	ENSP00000320431:R228C	ENSP00000320431:R228C	R	+	1	0	ST8SIA3	53175521	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.583000	0.60964	2.773000	0.95371	0.655000	0.94253	CGT		0.418	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449765.1	NM_015879	
NARS	4677	broad.mit.edu	37	18	55274479	55274479	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr18:55274479C>A	ENST00000256854.5	-	9	1343	c.888G>T	c.(886-888)ttG>ttT	p.L296F	NARS_ENST00000423481.2_Missense_Mutation_p.L47F	NM_004539.3	NP_004530.1	O43776	SYNC_HUMAN	asparaginyl-tRNA synthetase	296					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)	p.L296F(1)		breast(1)|endometrium(5)|large_intestine(5)|lung(8)|skin(1)	20		Colorectal(73;0.227)			L-Asparagine(DB00174)	AGGATTGAGTCAAAAATGCCT	0.468																																					p.L296F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G888T	18						.						103.0	98.0	99.0					18																	55274479		2203	4300	6503	53425477	SO:0001583	missense	4677	exon9			D84273	CCDS32837.1	18q21.31	2014-05-06			ENSG00000134440	ENSG00000134440	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	7643	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 1, cytoplasmic"""	108410				6836455, 9421509	Standard	NM_004539		Approved	NARS1	uc002lgs.2	O43776	OTTHUMG00000180125	ENST00000256854.5:c.888G>T	18.37:g.55274479C>A	ENSP00000256854:p.Leu296Phe	Somatic		Capture	Illumina HiSeq	Phase_I	53425477	NM_004539	B4DG16|Q53GU6	Missense_Mutation	SNP	ENST00000256854.5	37	CCDS32837.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238270	0.79800	.	.	ENSG00000134440	ENST00000256854;ENST00000423481	D;D	0.95885	-3.84;-3.84	5.91	5.04	0.67666	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.98419	0.9474	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.991;0.996	D	0.98321	1.0528	10	0.87932	D	0	-13.3092	10.1394	0.42725	0.0:0.8028:0.0:0.1972	.	47;296	B4DN60;O43776	.;SYNC_HUMAN	F	296;47	ENSP00000256854:L296F;ENSP00000407919:L47F	ENSP00000256854:L296F	L	-	3	2	NARS	53425477	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	1.795000	0.38784	2.808000	0.96608	0.655000	0.94253	TTG		0.468	NARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449872.2	NM_004539	
RAX	30062	broad.mit.edu	37	18	56940230	56940230	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr18:56940230C>T	ENST00000334889.3	-	1	395	c.209G>A	c.(208-210)cGg>cAg	p.R70Q	RAX_ENST00000256852.7_Missense_Mutation_p.R70Q	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	70					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R70Q(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GCAGGCGGGCCGCGCGCCCAG	0.766																																					p.R70Q	GBM(150;770 1898 17679 24325 37807)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G209A	18						.						3.0	3.0	3.0					18																	56940230		1530	2957	4487	55091210	SO:0001583	missense	30062	exon1			AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.209G>A	18.37:g.56940230C>T	ENSP00000334813:p.Arg70Gln	Somatic		Capture	Illumina HiSeq	Phase_I	55091210	NM_013435	Q86V11	Missense_Mutation	SNP	ENST00000334889.3	37	CCDS11972.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.164598	0.38217	.	.	ENSG00000134438	ENST00000256852;ENST00000334889;ENST00000555288	T;D;T	0.89415	-0.55;-2.51;-0.4	5.4	3.57	0.40892	.	0.678240	0.14870	N	0.293589	D	0.82342	0.5016	N	0.24115	0.695	0.09310	N	1	B;P	0.52692	0.113;0.955	B;P	0.44811	0.027;0.461	T	0.71567	-0.4554	10	0.41790	T	0.15	.	9.8294	0.40932	0.1392:0.7855:0.0:0.0753	.	70;70	Q86V11;Q9Y2V3	.;RX_HUMAN	Q	70	ENSP00000256852:R70Q;ENSP00000334813:R70Q;ENSP00000450583:R70Q	ENSP00000256852:R70Q	R	-	2	0	RAX	55091210	0.000000	0.05858	0.005000	0.12908	0.403000	0.30841	0.942000	0.29017	0.619000	0.30197	-0.314000	0.08810	CGG		0.766	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
ZNF536	9745	broad.mit.edu	37	19	30936378	30936378	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr19:30936378G>A	ENST00000355537.3	+	2	2056	c.1909G>A	c.(1909-1911)Ggc>Agc	p.G637S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	637					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.G637S(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCCCGACTGCGGCCGGGTGTT	0.622																																					p.G637S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1909A	19						.						82.0	94.0	90.0					19																	30936378		2203	4300	6503	35628218	SO:0001583	missense	9745	exon2				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1909G>A	19.37:g.30936378G>A	ENSP00000347730:p.Gly637Ser	Somatic		Capture	Illumina HiSeq	Phase_I	35628218	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754706	0.69648	.	.	ENSG00000198597	ENST00000355537	T	0.58358	0.34	5.68	4.62	0.57501	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.049558	0.85682	D	0.000000	T	0.67822	0.2934	L	0.59436	1.845	0.54753	D	0.999984	D;D	0.76494	0.999;0.999	D;D	0.64595	0.927;0.927	T	0.71935	-0.4442	10	0.72032	D	0.01	-33.1419	16.434	0.83869	0.0:0.1316:0.8684:0.0	.	637;637	A7E228;O15090	.;ZN536_HUMAN	S	637	ENSP00000347730:G637S	ENSP00000347730:G637S	G	+	1	0	ZNF536	35628218	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	9.435000	0.97529	1.324000	0.45282	0.655000	0.94253	GGC		0.622	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
UPK1A	11045	broad.mit.edu	37	19	36166854	36166854	+	Missense_Mutation	SNP	C	C	T	rs377645091		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr19:36166854C>T	ENST00000222275.2	+	5	581	c.581C>T	c.(580-582)aCg>aTg	p.T194M	UPK1A_ENST00000379013.2_Missense_Mutation_p.T194M|UPK1A-AS1_ENST00000443196.1_RNA	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A	194					epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)	p.T194M(1)		breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGTCGCCGGACGGGAAACTTC	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		17782	0.001		0.0	False		,,,				2504	0.0				p.T194M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C581T	19						.	C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	62.0	60.0	61.0		581	2.7	0.5	19		61	0,8600		0,0,4300	no	missense	UPK1A	NM_007000.2	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	194/259	36166854	1,13005	2203	4300	6503	40858694	SO:0001583	missense	11045	exon5			AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.581C>T	19.37:g.36166854C>T	ENSP00000222275:p.Thr194Met	Somatic		Capture	Illumina HiSeq	Phase_I	40858694	NM_007000	Q3KNU5|Q3KNU6	Missense_Mutation	SNP	ENST00000222275.2	37	CCDS12470.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.083318	0.55861	2.27E-4	0.0	ENSG00000105668	ENST00000222275;ENST00000379013	D;D	0.87491	-2.26;-2.26	4.98	2.72	0.32119	Tetraspanin, EC2 domain (1);	0.494612	0.20184	N	0.097442	T	0.78007	0.4216	N	0.08118	0	0.22468	N	0.99908	D;D	0.64830	0.994;0.988	P;P	0.48770	0.578;0.589	T	0.70223	-0.4931	10	0.42905	T	0.14	-2.8844	10.8552	0.46794	0.6488:0.3512:0.0:0.0	.	194;194	O00322-2;O00322	.;UPK1A_HUMAN	M	194	ENSP00000222275:T194M;ENSP00000368298:T194M	ENSP00000222275:T194M	T	+	2	0	UPK1A	40858694	0.882000	0.30256	0.454000	0.27019	0.889000	0.51656	1.576000	0.36504	0.468000	0.27243	0.549000	0.68633	ACG		0.642	UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109486.3		
SARS2	54938	broad.mit.edu	37	19	39421321	39421321	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr19:39421321C>T	ENST00000221431.6	-	1	215	c.56G>A	c.(55-57)cGg>cAg	p.R19Q	MRPS12_ENST00000308018.4_5'UTR|SARS2_ENST00000448145.2_Intron|SARS2_ENST00000430193.3_Missense_Mutation_p.R19Q|SARS2_ENST00000600042.1_Missense_Mutation_p.R19Q|SARS2_ENST00000594171.1_5'Flank|MRPS12_ENST00000407800.2_5'Flank|CTC-360G5.8_ENST00000599996.1_Intron|MRPS12_ENST00000402029.3_5'Flank	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	19					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)	p.R19Q(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TCCCCGGGGCCGGAACCCCCG	0.627											OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R19Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G56A	19						.						46.0	41.0	43.0					19																	39421321		2203	4300	6503	44113161	SO:0001583	missense	54938	exon1			AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.56G>A	19.37:g.39421321C>T	ENSP00000221431:p.Arg19Gln	Somatic	885	Capture	Illumina HiSeq	Phase_I	44113161	NM_001145901	A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	37	CCDS33017.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.235190	0.58886	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000455102	T;T;T	0.55930	0.49;0.49;1.3	5.35	0.93	0.19454	.	0.298320	0.33144	N	0.005232	T	0.40694	0.1127	M	0.65975	2.015	.	.	.	B;B;B	0.30068	0.079;0.267;0.267	B;B;B	0.15870	0.014;0.01;0.01	T	0.45381	-0.9265	9	0.62326	D	0.03	.	3.7433	0.08539	0.1711:0.5653:0.0:0.2636	.	19;19;19	B4DJP6;B4DE10;Q9NP81	.;.;SYSM_HUMAN	Q	19	ENSP00000406754:R19Q;ENSP00000221431:R19Q;ENSP00000414954:R19Q	ENSP00000221431:R19Q	R	-	2	0	FBXO17	44113161	0.002000	0.14202	0.001000	0.08648	0.054000	0.15201	1.018000	0.30002	0.485000	0.27652	0.655000	0.94253	CGG		0.627	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
ZNF233	353355	broad.mit.edu	37	19	44777071	44777071	+	Silent	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr19:44777071G>A	ENST00000391958.2	+	5	385	c.258G>A	c.(256-258)gaG>gaA	p.E86E	ZNF233_ENST00000334152.1_Intron|ZNF233_ENST00000592581.1_3'UTR|ZNF235_ENST00000589799.1_Intron	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E86E(1)		breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				ATCAAAATGAGATAGATACCC	0.303																																					p.E86E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G258A	19						.						54.0	59.0	58.0					19																	44777071		2201	4299	6500	49468911	SO:0001819	synonymous_variant	353355	exon5			AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.258G>A	19.37:g.44777071G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49468911	NM_181756	B2RN78|B2RN79|Q86WL8	Silent	SNP	ENST00000391958.2	37	CCDS33047.1																																																																																				0.303	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
CLEC4M	10332	broad.mit.edu	37	19	7830936	7830936	+	Silent	SNP	G	G	C	rs59003279	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr19:7830936G>C	ENST00000327325.5	+	4	745	c.627G>C	c.(625-627)acG>acC	p.T209T	CLEC4M_ENST00000359059.5_Silent_p.T165T|CLEC4M_ENST00000357361.2_Silent_p.T209T|CLEC4M_ENST00000334806.5_Silent_p.T158T|CLEC4M_ENST00000595496.1_Intron|CLEC4M_ENST00000596707.1_Silent_p.T188T|CLEC4M_ENST00000596363.1_Silent_p.T181T|CLEC4M_ENST00000597522.1_Intron|CLEC4M_ENST00000394122.2_Silent_p.T197T|CLEC4M_ENST00000248228.4_Silent_p.T187T	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	209	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)	p.T209T(2)|p.T209>?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						AGGAGCTGACGGAGCTGAAGG	0.582													C|||	109	0.0217652	0.003	0.0605	5008	,	,		16122	0.0109		0.0368	False		,,,				2504	0.0153				p.T158T												.	.	3	Substitution - coding silent(2)|Complex(1)	large_intestine(2)|endometrium(1)	c.G474C	19						.						118.0	96.0	104.0					19																	7830936		2194	4024	6218	7736936	SO:0001819	synonymous_variant	10332	exon4			AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.627G>C	19.37:g.7830936G>C		Somatic		Capture	Illumina HiSeq	Phase_I	7736936	NM_001144904	A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Silent	SNP	ENST00000327325.5	37	CCDS12187.1																																																																																				0.582	CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461161.1	NM_014257	
KLK15	55554	broad.mit.edu	37	19	51330197	51330197	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr19:51330197C>G	ENST00000598239.1	-	3	448	c.418G>C	c.(418-420)Gtg>Ctg	p.V140L	KLK15_ENST00000416184.1_Intron|KLK15_ENST00000301421.2_Missense_Mutation_p.V140L|KLK15_ENST00000326856.4_Missense_Mutation_p.V139L|KLK15_ENST00000596931.1_Missense_Mutation_p.V139L	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	140	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.V140L(1)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		CAGCCAGACACCACACAGGCC	0.692																																					p.V140L	Pancreas(140;10 2513 7143 9246)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G418C	19						.						27.0	29.0	28.0					19																	51330197		2203	4298	6501	56022009	SO:0001583	missense	55554	exon3			AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.418G>C	19.37:g.51330197C>G	ENSP00000469315:p.Val140Leu	Somatic		Capture	Illumina HiSeq	Phase_I	56022009	NM_017509	A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Missense_Mutation	SNP	ENST00000598239.1	37	CCDS12805.1	.	.	.	.	.	.	.	.	.	.	c	23.4	4.414038	0.83449	.	.	ENSG00000174562	ENST00000326856;ENST00000301421;ENST00000544946	D	0.94376	-3.41	4.5	4.5	0.54988	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.41938	D	0.000784	D	0.94528	0.8238	M	0.65320	2	0.34535	D	0.7096	D;D;P	0.54207	0.965;0.965;0.94	P;P;P	0.62014	0.749;0.861;0.897	D	0.95755	0.8795	10	0.59425	D	0.04	.	8.6401	0.33972	0.0:0.8967:0.0:0.1033	.	140;139;140	Q6UBM2;Q6ISI0;Q9H2R5	.;.;KLK15_HUMAN	L	140	ENSP00000301421:V140L	ENSP00000301421:V140L	V	-	1	0	KLK15	56022009	0.173000	0.23056	1.000000	0.80357	0.984000	0.73092	0.643000	0.24750	2.514000	0.84764	0.555000	0.69702	GTG		0.692	KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465160.1	NM_017509	
HRNR	388697	broad.mit.edu	37	1	152187551	152187551	+	Missense_Mutation	SNP	C	C	T	rs200451128		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:152187551C>T	ENST00000368801.2	-	3	6629	c.6554G>A	c.(6553-6555)cGc>cAc	p.R2185H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2185					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R2185H(2)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGTCGGCCGCGGCTAGGGGA	0.647																																					p.R2185H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G6554A	1						.						21.0	25.0	24.0					1																	152187551		2166	4278	6444	150454175	SO:0001583	missense	388697	exon3			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6554G>A	1.37:g.152187551C>T	ENSP00000357791:p.Arg2185His	Somatic		Capture	Illumina HiSeq	Phase_I	150454175	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	5.811	0.334004	0.11013	.	.	ENSG00000197915	ENST00000368801	T	0.01599	4.74	3.24	-6.48	0.01896	.	.	.	.	.	T	0.00300	0.0009	N	0.22421	0.69	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.48080	-0.9066	9	0.14252	T	0.57	.	1.9709	0.03406	0.1978:0.2038:0.3952:0.2031	.	2185	Q86YZ3	HORN_HUMAN	H	2185	ENSP00000357791:R2185H	ENSP00000357791:R2185H	R	-	2	0	HRNR	150454175	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-6.876000	0.00051	-2.560000	0.00474	-0.132000	0.14878	CGC		0.647	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
FLG	2312	broad.mit.edu	37	1	152275269	152275269	+	Silent	SNP	A	A	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:152275269A>G	ENST00000368799.1	-	3	12128	c.12093T>C	c.(12091-12093)taT>taC	p.Y4031Y	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	4031					establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.Y4031Y(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTTATTAATATACGTTGCAT	0.348									Ichthyosis																												p.Y4031Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T12093C	1						.						141.0	135.0	137.0					1																	152275269		2203	4300	6503	150541893	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.12093T>C	1.37:g.152275269A>G		Somatic		Capture	Illumina HiSeq	Phase_I	150541893	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																				0.348	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
SPTA1	6708	broad.mit.edu	37	1	158585119	158585119	+	Silent	SNP	G	G	A	rs186647435		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:158585119G>A	ENST00000368147.4	-	48	6855	c.6675C>T	c.(6673-6675)gaC>gaT	p.D2225D		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2225					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.D2225D(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GGATCAGAGCGTCTTCCAAGT	0.502													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18926	0.0		0.0	False		,,,				2504	0.0				p.D2225D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6675T	1						.						188.0	189.0	189.0					1																	158585119		2008	4194	6202	156851743	SO:0001819	synonymous_variant	6708	exon48			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6675C>T	1.37:g.158585119G>A		Somatic		Capture	Illumina HiSeq	Phase_I	156851743	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	CCDS41423.1																																																																																				0.502	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
BRINP3	339479	broad.mit.edu	37	1	190234176	190234176	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:190234176G>A	ENST00000367462.3	-	4	668	c.437C>T	c.(436-438)tCa>tTa	p.S146L	BRINP3_ENST00000534846.1_Missense_Mutation_p.S44L|RP11-547I7.1_ENST00000452178.1_RNA	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	146	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.S146L(1)									AATTGTGAGTGACTCCTCTCC	0.383																																					p.S146L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C437T	1						.						75.0	64.0	68.0					1																	190234176		2203	4300	6503	188500799	SO:0001583	missense	339479	exon4			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.437C>T	1.37:g.190234176G>A	ENSP00000356432:p.Ser146Leu	Somatic		Capture	Illumina HiSeq	Phase_I	188500799	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784800	0.90282	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	D;T	0.84370	-1.84;1.95	5.6	5.6	0.85130	Membrane attack complex component/perforin (MACPF) domain (2);	0.070631	0.64402	D	0.000014	D	0.82838	0.5124	L	0.56769	1.78	0.45867	D	0.998727	P;B	0.36535	0.557;0.44	B;B	0.32090	0.086;0.14	D	0.84709	0.0733	10	0.87932	D	0	.	17.1202	0.86700	0.0:0.0:1.0:0.0	.	44;146	B7Z260;Q76B58	.;FAM5C_HUMAN	L	146;44	ENSP00000356432:S146L;ENSP00000438022:S44L	ENSP00000356432:S146L	S	-	2	0	FAM5C	188500799	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	9.275000	0.95738	2.640000	0.89533	0.585000	0.79938	TCA		0.383	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
ASPM	259266	broad.mit.edu	37	1	197097791	197097791	+	Missense_Mutation	SNP	C	C	T	rs199871272	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:197097791C>T	ENST00000367409.4	-	10	3021	c.2765G>A	c.(2764-2766)aGt>aAt	p.S922N	ASPM_ENST00000294732.7_Missense_Mutation_p.S922N|ASPM_ENST00000367408.1_Missense_Mutation_p.S172N	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	922	CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GATTTCTTTACTAGCCTATAA	0.318																																					p.S922N												.	.	0			c.G2765A	1						.						23.0	24.0	24.0					1																	197097791		2203	4299	6502	195364414	SO:0001583	missense	259266	exon10			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.2765G>A	1.37:g.197097791C>T	ENSP00000356379:p.Ser922Asn	None		Capture	Illumina HiSeq	Phase_I	195364414	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077850	0.76528	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	T;T;T	0.58652	0.32;0.32;0.32	5.77	5.77	0.91146	Calponin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.82379	0.5024	M	0.90870	3.155	0.48762	D	0.999703	D;D	0.89917	1.0;1.0	D;D	0.79784	0.96;0.993	D	0.85154	0.0988	10	0.87932	D	0	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	922;922	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	N	922;922;172	ENSP00000356379:S922N;ENSP00000294732:S922N;ENSP00000356378:S172N	ENSP00000294732:S922N	S	-	2	0	ASPM	195364414	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	3.545000	0.53648	2.885000	0.99019	0.655000	0.94253	AGT		0.318	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
USH2A	7399	broad.mit.edu	37	1	215972300	215972300	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:215972300C>T	ENST00000307340.3	-	50	10293	c.9907G>A	c.(9907-9909)Gat>Aat	p.D3303N	USH2A_ENST00000366943.2_Missense_Mutation_p.D3303N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3303					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.D3303N(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CACTCTAAATCGTTGCTCACA	0.522										HNSCC(13;0.011)																											p.D3303N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9907A	1						.						185.0	156.0	166.0					1																	215972300		2203	4300	6503	214038923	SO:0001583	missense	7399	exon50			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9907G>A	1.37:g.215972300C>T	ENSP00000305941:p.Asp3303Asn	Somatic		Capture	Illumina HiSeq	Phase_I	214038923	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.218614	0.79464	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.13420	2.6;2.59	5.81	5.81	0.92471	Fibronectin, type III (2);	0.156506	0.29253	N	0.012696	T	0.27313	0.0670	M	0.79475	2.455	0.09310	N	1	D	0.60160	0.987	P	0.45377	0.478	T	0.18147	-1.0346	10	0.72032	D	0.01	.	20.0784	0.97758	0.0:1.0:0.0:0.0	.	3303	O75445	USH2A_HUMAN	N	3303	ENSP00000305941:D3303N;ENSP00000355910:D3303N	ENSP00000305941:D3303N	D	-	1	0	USH2A	214038923	0.770000	0.28543	0.035000	0.18076	0.914000	0.54420	3.485000	0.53208	2.736000	0.93811	0.655000	0.94253	GAT		0.522	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
MIA3	375056	broad.mit.edu	37	1	222838891	222838891	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:222838891G>C	ENST00000344922.5	+	28	5679	c.5654G>C	c.(5653-5655)aGa>aCa	p.R1885T	MIA3_ENST00000344441.6_Missense_Mutation_p.R1885T|AIDA_ENST00000474863.1_5'Flank|MIA3_ENST00000344507.1_Intron|MIA3_ENST00000340535.7_Missense_Mutation_p.R763T	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1885	Pro-rich.				chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.R1885K(1)|p.R1885T(1)		breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		TCAGGCTCTAGAGATGAGCCT	0.512																																					p.R1885T												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G5654C	1						.						124.0	128.0	127.0					1																	222838891		1873	4122	5995	220905514	SO:0001583	missense	375056	exon28				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.5654G>C	1.37:g.222838891G>C	ENSP00000340900:p.Arg1885Thr	Somatic		Capture	Illumina HiSeq	Phase_I	220905514	NM_198551	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	37	CCDS41470.1	.	.	.	.	.	.	.	.	.	.	G	9.336	1.061674	0.19987	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000340535;ENST00000284471	T;T;T	0.10860	3.33;3.33;2.83	5.98	3.14	0.36123	.	.	.	.	.	T	0.09069	0.0224	M	0.64997	1.995	0.18873	N	0.999989	P;P	0.41848	0.763;0.501	B;B	0.31101	0.124;0.058	T	0.31081	-0.9956	9	0.41790	T	0.15	.	4.3198	0.11011	0.1344:0.1253:0.6103:0.13	.	763;1885	Q5JRA6-4;Q5JRA6	.;MIA3_HUMAN	T	1885;1885;1826;763;763	ENSP00000340900:R1885T;ENSP00000340587:R1885T;ENSP00000345866:R763T	ENSP00000284471:R763T	R	+	2	0	MIA3	220905514	0.984000	0.35163	0.025000	0.17156	0.315000	0.28087	3.522000	0.53480	0.436000	0.26393	-0.152000	0.13540	AGA		0.512	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
KIF26B	55083	broad.mit.edu	37	1	245850489	245850489	+	Missense_Mutation	SNP	C	C	T	rs184020024		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:245850489C>T	ENST00000407071.2	+	12	4644	c.4204C>T	c.(4204-4206)Cgg>Tgg	p.R1402W	KIF26B_ENST00000366518.4_Missense_Mutation_p.R1021W	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1402					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.R1402W(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CATGAGCCCCCGGAACATCCA	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		15914	0.001		0.0	False		,,,				2504	0.0				p.R1402W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4204T	1						.						38.0	42.0	41.0					1																	245850489		1945	4140	6085	243917112	SO:0001583	missense	55083	exon12			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4204C>T	1.37:g.245850489C>T	ENSP00000385545:p.Arg1402Trp	Somatic		Capture	Illumina HiSeq	Phase_I	243917112	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	CCDS44342.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	7.579	0.668416	0.14776	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.77750	-1.12;-1.12	5.52	3.61	0.41365	.	.	.	.	.	T	0.73644	0.3613	M	0.69823	2.125	0.23371	N	0.997815	D;D	0.62365	0.991;0.978	B;B	0.43623	0.425;0.328	T	0.69124	-0.5228	9	0.72032	D	0.01	.	4.0264	0.09688	0.2197:0.6178:0.0:0.1625	.	1021;1402	B7WPD9;Q2KJY2	.;KI26B_HUMAN	W	1402;1021;1018	ENSP00000385545:R1402W;ENSP00000355475:R1021W	ENSP00000355475:R1021W	R	+	1	2	KIF26B	243917112	0.973000	0.33851	0.975000	0.42487	0.039000	0.13416	1.312000	0.33574	1.442000	0.47568	0.561000	0.74099	CGG		0.572	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
OR2W5	441932	broad.mit.edu	37	1	247654638	247654638	+	RNA	SNP	A	A	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:247654638A>C	ENST00000522351.1	+	0	269							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D70A(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TCTTTCTTAGATCTCTGCTTT	0.537																																					p.D70A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A209C	1						.						114.0	106.0	109.0					1																	247654638		2203	4300	6503	245721261			441932	exon1					1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247654638A>C		Somatic		Capture	Illumina HiSeq	Phase_I	245721261	NM_001004698	B9EH85	Missense_Mutation	SNP	ENST00000522351.1	37																																																																																					0.537	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698	
WASF2	10163	broad.mit.edu	37	1	27741411	27741411	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:27741411T>G	ENST00000430629.2	-	6	799	c.584A>C	c.(583-585)aAa>aCa	p.K195T	WASF2_ENST00000536657.1_Missense_Mutation_p.K195T	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	195					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)	p.K195T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		TGTCTTGATTTTACGTGGGTT	0.393																																					p.K195T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A584C	1						.						228.0	208.0	215.0					1																	27741411		2203	4300	6503	27613998	SO:0001583	missense	10163	exon6			AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.584A>C	1.37:g.27741411T>G	ENSP00000396211:p.Lys195Thr	Somatic		Capture	Illumina HiSeq	Phase_I	27613998	NM_006990	B4DZN0|O60794|Q9UDY7	Missense_Mutation	SNP	ENST00000430629.2	37	CCDS304.1	.	.	.	.	.	.	.	.	.	.	T	16.83	3.231170	0.58777	.	.	ENSG00000158195	ENST00000430629;ENST00000536657	T;T	0.54071	0.59;0.59	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.68686	0.3028	M	0.61703	1.905	0.80722	D	1	D;D	0.76494	0.986;0.999	D;D	0.80764	0.917;0.994	T	0.69483	-0.5133	10	0.48119	T	0.1	-9.8723	14.2232	0.65841	0.0:0.0:0.0:1.0	.	195;195	B4DZN0;Q9Y6W5	.;WASF2_HUMAN	T	195	ENSP00000396211:K195T;ENSP00000439883:K195T	ENSP00000396211:K195T	K	-	2	0	WASF2	27613998	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.516000	0.81772	2.232000	0.73038	0.402000	0.26972	AAA		0.393	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009516.1	NM_006990	
FGR	2268	broad.mit.edu	37	1	27941993	27941993	+	Missense_Mutation	SNP	C	C	T	rs142690351		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:27941993C>T	ENST00000374005.3	-	9	1258	c.970G>A	c.(970-972)Gtg>Atg	p.V324M	FGR_ENST00000374004.1_Missense_Mutation_p.V324M|FGR_ENST00000399173.1_Missense_Mutation_p.V324M|FGR_ENST00000545953.1_Missense_Mutation_p.V258M	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	324	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)	p.V324M(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TCCGACACCACGGCGTACAGC	0.632																																					p.V324M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G970A	1						.	C	MET/VAL,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	84.0	77.0	79.0		970,970,970	4.9	0.9	1	dbSNP_134	79	0,8600		0,0,4300	no	missense,missense,missense	FGR	NM_001042729.1,NM_001042747.1,NM_005248.2	21,21,21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	324/530,324/530,324/530	27941993	1,13005	2203	4300	6503	27814580	SO:0001583	missense	2268	exon9			BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.970G>A	1.37:g.27941993C>T	ENSP00000363117:p.Val324Met	Somatic		Capture	Illumina HiSeq	Phase_I	27814580	NM_001042747	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	37	CCDS305.1	.	.	.	.	.	.	.	.	.	.	C	32	5.140492	0.94560	2.27E-4	0.0	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003	D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89	4.93	4.93	0.64822	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000105	D	0.92694	0.7678	M	0.83483	2.645	0.49051	D	0.999743	D	0.89917	1.0	D	0.81914	0.995	D	0.93663	0.6983	10	0.72032	D	0.01	.	17.097	0.86638	0.0:1.0:0.0:0.0	.	324	P09769	FGR_HUMAN	M	324;258;324;324;324	ENSP00000363117:V324M;ENSP00000445302:V258M;ENSP00000382126:V324M;ENSP00000363116:V324M;ENSP00000363115:V324M	ENSP00000363115:V324M	V	-	1	0	FGR	27814580	1.000000	0.71417	0.945000	0.38365	0.865000	0.49528	7.715000	0.84713	2.451000	0.82905	0.491000	0.48974	GTG		0.632	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
ZFYVE9	9372	broad.mit.edu	37	1	52769557	52769557	+	Missense_Mutation	SNP	G	G	A	rs139791435		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:52769557G>A	ENST00000371591.1	+	12	3529	c.3398G>A	c.(3397-3399)cGg>cAg	p.R1133Q	ZFYVE9_ENST00000357206.2_Missense_Mutation_p.R1074Q|ZFYVE9_ENST00000469134.1_3'UTR|ZFYVE9_ENST00000287727.3_Missense_Mutation_p.R1133Q	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1133					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)	p.R1133Q(1)		breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						ATGGAAGTTCGGAAAACTAGC	0.368													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13338	0.0		0.0	False		,,,				2504	0.0				p.R1074Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3221A	1						.	G	GLN/ARG,GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	139.0	140.0	140.0		3398,3221	4.6	1.0	1	dbSNP_134	140	0,8600		0,0,4300	no	missense,missense	ZFYVE9	NM_004799.2,NM_007324.2	43,43	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging	1133/1426,1074/1367	52769557	2,13004	2203	4300	6503	52542145	SO:0001583	missense	9372	exon12			AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.3398G>A	1.37:g.52769557G>A	ENSP00000360647:p.Arg1133Gln	Somatic		Capture	Illumina HiSeq	Phase_I	52542145	NM_007324	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	ENST00000371591.1	37	CCDS563.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.572137	0.65765	4.54E-4	0.0	ENSG00000157077	ENST00000357206;ENST00000287727;ENST00000371591	T;T;T	0.39787	1.13;1.06;1.06	4.61	4.61	0.57282	Domain of unknown function DUF3480 (1);	0.142736	0.44285	D	0.000470	T	0.39145	0.1067	L	0.38175	1.15	0.48185	D	0.999606	P;P	0.43826	0.645;0.818	B;B	0.42495	0.104;0.389	T	0.32348	-0.9910	10	0.48119	T	0.1	.	17.5807	0.87966	0.0:0.0:1.0:0.0	.	1074;1133	O95405-2;O95405	.;ZFYV9_HUMAN	Q	1074;1133;1133	ENSP00000349737:R1074Q;ENSP00000287727:R1133Q;ENSP00000360647:R1133Q	ENSP00000287727:R1133Q	R	+	2	0	ZFYVE9	52542145	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.549000	0.60726	2.562000	0.86427	0.491000	0.48974	CGG		0.368	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	
NFIA	4774	broad.mit.edu	37	1	61872392	61872392	+	Silent	SNP	G	G	A	rs146012018		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:61872392G>A	ENST00000403491.3	+	9	1897	c.1413G>A	c.(1411-1413)acG>acA	p.T471T	NFIA_ENST00000479364.1_3'UTR|NFIA_ENST00000407417.3_Silent_p.T463T|NFIA_ENST00000485903.2_Silent_p.T428T|NFIA_ENST00000357977.5_Silent_p.T119T|NFIA_ENST00000371185.2_Silent_p.T449T|NFIA_ENST00000371184.2_Silent_p.T342T|NFIA_ENST00000371187.3_Silent_p.T471T|NFIA_ENST00000371191.1_Silent_p.T494T|NFIA_ENST00000371189.4_Silent_p.T516T	NM_001134673.3|NM_005595.4	NP_001128145.1|NP_005586.1	Q12857	NFIA_HUMAN	nuclear factor I/A	471					DNA replication (GO:0006260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to organic cyclic compound (GO:0014070)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.T471T(1)	NFIA/EHF(2)	endometrium(1)|kidney(2)|large_intestine(8)|lung(20)|pancreas(1)|prostate(1)|skin(1)	34						CCTCCCCCACGTCACCAAGTA	0.587																																					p.T516T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1548A	1						.	G	,,,	0,4406		0,0,2203	81.0	45.0	57.0		1413,1389,1548,1413	4.0	1.0	1	dbSNP_134	57	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NFIA	NM_001134673.3,NM_001145511.1,NM_001145512.1,NM_005595.4	,,,	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	,,,	471/510,463/502,516/555,471/499	61872392	4,13002	2203	4300	6503	61644980	SO:0001819	synonymous_variant	4774	exon10			U07809	CCDS615.1, CCDS44156.1, CCDS53322.1, CCDS53321.1	1p31.3-p31.2	2008-02-05			ENSG00000162599	ENSG00000162599			7784	protein-coding gene	gene with protein product		600727				7590749	Standard	NM_001134673		Approved	NFI-L, KIAA1439	uc010oos.2	Q12857	OTTHUMG00000008618	ENST00000403491.3:c.1413G>A	1.37:g.61872392G>A		Somatic		Capture	Illumina HiSeq	Phase_I	61644980	NM_001145512	B4DRJ3|B4DS53|F5H0R0|F8W8W3|Q8TA97|Q9H3X9|Q9P2A9	Silent	SNP	ENST00000403491.3	37	CCDS44156.1																																																																																				0.587	NFIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023799.3	NM_005595	
AK5	26289	broad.mit.edu	37	1	77752757	77752757	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:77752757G>T	ENST00000354567.2	+	2	455	c.192G>T	c.(190-192)aaG>aaT	p.K64N	AK5_ENST00000317704.4_3'UTR|AK5_ENST00000344720.5_Missense_Mutation_p.K38N	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	64					ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)	p.K64N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						GCCAGGAAAAGAAGACCTTAC	0.378																																					p.K38N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G114T	1						.						95.0	93.0	94.0					1																	77752757		2203	4300	6503	77525345	SO:0001583	missense	26289	exon2			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.192G>T	1.37:g.77752757G>T	ENSP00000346577:p.Lys64Asn	Somatic		Capture	Illumina HiSeq	Phase_I	77525345	NM_012093	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	ENST00000354567.2	37	CCDS675.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051404	0.75960	.	.	ENSG00000154027	ENST00000354567;ENST00000344720;ENST00000478407	T;T;D	0.84146	-0.74;-0.88;-1.81	5.59	4.66	0.58398	.	0.000000	0.85682	D	0.000000	D	0.84151	0.5409	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.994;0.999	P;D	0.78314	0.829;0.991	D	0.85959	0.1469	10	0.72032	D	0.01	-24.846	12.9956	0.58644	0.128:0.0:0.872:0.0	.	64;64	Q9Y6K8;Q8N291	KAD5_HUMAN;.	N	64;38;38	ENSP00000346577:K64N;ENSP00000341430:K38N;ENSP00000434409:K38N	ENSP00000341430:K38N	K	+	3	2	AK5	77525345	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.448000	0.60027	2.809000	0.96659	0.650000	0.86243	AAG		0.378	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026993.4	NM_174858	
COL24A1	255631	broad.mit.edu	37	1	86590936	86590936	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:86590936C>T	ENST00000370571.2	-	3	1449	c.1083G>A	c.(1081-1083)atG>atA	p.M361I	COL24A1_ENST00000436319.1_Missense_Mutation_p.M361I	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	361					extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.M361I(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		CTTTGGTATTCATTTTTGCCT	0.403																																					p.M361I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1083A	1						.						152.0	134.0	140.0					1																	86590936		1933	4128	6061	86363524	SO:0001583	missense	255631	exon3			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.1083G>A	1.37:g.86590936C>T	ENSP00000359603:p.Met361Ile	Somatic		Capture	Illumina HiSeq	Phase_I	86363524	NM_152890	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	C	0.030	-1.340956	0.01277	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	T;T	0.16743	2.32;2.32	5.25	3.26	0.37387	.	0.544246	0.15343	N	0.267404	T	0.03136	0.0092	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.43491	-0.9388	10	0.30078	T	0.28	.	6.1162	0.20127	0.0:0.5429:0.0:0.4571	.	361;361	F8WDM8;Q17RW2	.;COOA1_HUMAN	I	361	ENSP00000359603:M361I;ENSP00000392531:M361I	ENSP00000359603:M361I	M	-	3	0	COL24A1	86363524	0.000000	0.05858	0.025000	0.17156	0.094000	0.18550	0.135000	0.15952	0.470000	0.27294	-0.251000	0.11542	ATG		0.403	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890	
OR1C1	26188	broad.mit.edu	37	1	247921335	247921335	+	Missense_Mutation	SNP	G	G	A	rs563143111		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr1:247921335G>A	ENST00000408896.2	-	1	647	c.374C>T	c.(373-375)gCg>gTg	p.A125V		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	125					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A125V(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GTGGCAAATCGCCACATATCT	0.502													g|||	1	0.000199681	0.0008	0.0	5008	,	,		21165	0.0		0.0	False		,,,				2504	0.0				p.A125V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C374T	1						.						71.0	67.0	68.0					1																	247921335		2014	4172	6186	245987958	SO:0001583	missense	26188	exon1			X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.374C>T	1.37:g.247921335G>A	ENSP00000386138:p.Ala125Val	Somatic		Capture	Illumina HiSeq	Phase_I	245987958	NM_012353	B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	37	CCDS41481.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483380	0.63962	.	.	ENSG00000221888	ENST00000408896	T	0.01228	5.14	3.19	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.14960	0.0361	H	0.97707	4.06	0.36358	D	0.860484	D	0.89917	1.0	D	0.91635	0.999	T	0.47032	-0.9148	9	0.87932	D	0	.	14.4931	0.67665	0.0:0.0:1.0:0.0	.	125	Q15619	OR1C1_HUMAN	V	125	ENSP00000386138:A125V	ENSP00000386138:A125V	A	-	2	0	OR1C1	245987958	1.000000	0.71417	0.970000	0.41538	0.273000	0.26683	6.771000	0.74996	1.789000	0.52484	0.580000	0.79431	GCG		0.502	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1		
ZFP64	55734	broad.mit.edu	37	20	50769362	50769362	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr20:50769362C>T	ENST00000216923.4	-	6	1718	c.1369G>A	c.(1369-1371)Gac>Aac	p.D457N	ZFP64_ENST00000477786.1_Intron|ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371515.4_Missense_Mutation_p.D455N|ZFP64_ENST00000346617.4_Missense_Mutation_p.D403N	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D457N(2)		breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						ACGGTCACGTCCGAGTTCTTA	0.602																																					p.D457N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1369A	20						.						76.0	55.0	62.0					20																	50769362		2203	4300	6503	50202769	SO:0001583	missense	55734	exon6			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.1369G>A	20.37:g.50769362C>T	ENSP00000216923:p.Asp457Asn	Somatic		Capture	Illumina HiSeq	Phase_I	50202769	NM_018197	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000216923.4	37	CCDS13440.1	.	.	.	.	.	.	.	.	.	.	C	7.778	0.708822	0.15239	.	.	ENSG00000020256	ENST00000216923;ENST00000346617;ENST00000371515;ENST00000546083;ENST00000371516	T;T;T	0.06849	3.25;3.3;3.26	5.48	4.54	0.55810	.	0.197192	0.34386	N	0.004013	T	0.06781	0.0173	N	0.19112	0.55	0.09310	N	1	B;P;P	0.43094	0.134;0.799;0.799	B;B;B	0.38378	0.041;0.272;0.272	T	0.15636	-1.0430	10	0.66056	D	0.02	-14.877	14.1743	0.65529	0.0:0.9278:0.0:0.0722	.	403;455;457	Q9NPA5-2;Q5JWM1;Q9NPA5	.;.;ZF64A_HUMAN	N	457;403;455;299;610	ENSP00000216923:D457N;ENSP00000344615:D403N;ENSP00000360570:D455N	ENSP00000216923:D457N	D	-	1	0	ZFP64	50202769	0.825000	0.29262	0.154000	0.22540	0.244000	0.25665	4.132000	0.57977	1.306000	0.44926	0.585000	0.79938	GAC		0.602	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
KRTAP13-4	284827	broad.mit.edu	37	21	31802881	31802881	+	Silent	SNP	C	C	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr21:31802881C>A	ENST00000334068.2	+	1	310	c.288C>A	c.(286-288)ggC>ggA	p.G96G		NM_181600.1	NP_853631.1	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	96						intermediate filament (GO:0005882)		p.G96G(1)		NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	15						GCTCCCAGGGCTATGGATCTA	0.552																																					p.G96G	NSCLC(196;2401 3038 18004 35753)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C288A	21						.						93.0	78.0	83.0					21																	31802881		2203	4300	6503	30724752	SO:0001819	synonymous_variant	284827	exon1			AP001708	CCDS13592.1	21q22.1	2006-03-13			ENSG00000186971	ENSG00000186971		"""Keratin associated proteins"""	18926	protein-coding gene	gene with protein product						12359730	Standard	NM_181600		Approved	KAP13.4	uc011acw.2	Q3LI77	OTTHUMG00000057770	ENST00000334068.2:c.288C>A	21.37:g.31802881C>A		Somatic		Capture	Illumina HiSeq	Phase_I	30724752	NM_181600	A2RRL3	Silent	SNP	ENST00000334068.2	37	CCDS13592.1																																																																																				0.552	KRTAP13-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128222.1		
IFNAR1	3454	broad.mit.edu	37	21	34721820	34721820	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr21:34721820A>G	ENST00000270139.3	+	8	1266	c.1114A>G	c.(1114-1116)Att>Gtt	p.I372V	IFNAR1_ENST00000442357.2_Missense_Mutation_p.I372V|IFNAR1_ENST00000416947.2_Missense_Mutation_p.I303V	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	372	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)	p.I372V(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	TTATGAAATTATTTTTTGGGA	0.323																																					p.I372V	Esophageal Squamous(73;817 1211 32990 35667 42746)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1114G	21						.						42.0	41.0	41.0					21																	34721820		2203	4300	6503	33643690	SO:0001583	missense	3454	exon8				CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.1114A>G	21.37:g.34721820A>G	ENSP00000270139:p.Ile372Val	Somatic		Capture	Illumina HiSeq	Phase_I	33643690	NM_000629	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Missense_Mutation	SNP	ENST00000270139.3	37	CCDS13624.1	.	.	.	.	.	.	.	.	.	.	A	5.833	0.337881	0.11013	.	.	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442357	T;T;T	0.28666	1.61;1.61;1.6	5.65	-11.3	0.00108	Fibronectin, type III (2);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	1.419270	0.04182	N	0.326632	T	0.12347	0.0300	N	0.14661	0.345	0.09310	N	1	B	0.17038	0.02	B	0.14578	0.011	T	0.08868	-1.0701	10	0.20046	T	0.44	-2.0E-4	4.2304	0.10601	0.2647:0.3203:0.3356:0.0794	.	372	P17181	INAR1_HUMAN	V	303;372;372	ENSP00000395606:I303V;ENSP00000270139:I372V;ENSP00000407406:I372V	ENSP00000270139:I372V	I	+	1	0	IFNAR1	33643690	0.000000	0.05858	0.000000	0.03702	0.130000	0.20726	-0.863000	0.04259	-3.745000	0.00112	-2.830000	0.00107	ATT		0.323	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139823.4		
ZBTB21	49854	broad.mit.edu	37	21	43413375	43413375	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr21:43413375G>A	ENST00000310826.5	-	3	1013	c.830C>T	c.(829-831)cCa>cTa	p.P277L	ZBTB21_ENST00000398499.1_Missense_Mutation_p.P277L|ZBTB21_ENST00000398505.3_Missense_Mutation_p.P277L|ZBTB21_ENST00000398511.3_Missense_Mutation_p.P277L|ZBTB21_ENST00000465968.1_Intron	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	277					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)	p.P277L(1)									CAAAACAGGTGGCCGTGGTCT	0.423																																					p.P277L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C830T	21						.						56.0	55.0	56.0					21																	43413375		2203	4300	6503	42286444	SO:0001583	missense	49854	exon3			AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.830C>T	21.37:g.43413375G>A	ENSP00000308759:p.Pro277Leu	Somatic		Capture	Illumina HiSeq	Phase_I	42286444	NM_001098403	Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	ENST00000310826.5	37	CCDS13678.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.158984	0.57368	.	.	ENSG00000173276	ENST00000398505;ENST00000310826;ENST00000398499;ENST00000398511	T;T;T;T	0.06068	3.5;3.35;3.35;3.35	5.8	5.8	0.92144	.	0.069468	0.64402	D	0.000013	T	0.26122	0.0637	M	0.65975	2.015	0.58432	D	0.999998	D;B	0.76494	0.999;0.412	D;B	0.72338	0.977;0.084	T	0.00071	-1.2132	10	0.87932	D	0	-21.3203	20.0545	0.97645	0.0:0.0:1.0:0.0	.	277;277	Q9ULJ3-2;Q9ULJ3	.;ZN295_HUMAN	L	277	ENSP00000381517:P277L;ENSP00000308759:P277L;ENSP00000381512:P277L;ENSP00000381523:P277L	ENSP00000308759:P277L	P	-	2	0	ZNF295	42286444	1.000000	0.71417	0.960000	0.40013	0.993000	0.82548	6.338000	0.72963	2.748000	0.94277	0.655000	0.94253	CCA		0.423	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727	
KRTAP10-6	386674	broad.mit.edu	37	21	46011764	46011764	+	Missense_Mutation	SNP	G	G	A	rs199511488	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr21:46011764G>A	ENST00000400368.1	-	1	622	c.602C>T	c.(601-603)aCc>aTc	p.T201I	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	201	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GCAGGAGCTGGTGCAGCCTGA	0.657													.|||	6	0.00119808	0.0	0.0029	5008	,	,		24873	0.0		0.004	False		,,,				2504	0.0				p.T201I												.	.	0			c.C602T	21						.						74.0	101.0	92.0					21																	46011764		2203	4298	6501	44836192	SO:0001583	missense	386674	exon1			AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.602C>T	21.37:g.46011764G>A	ENSP00000383219:p.Thr201Ile	None		Capture	Illumina HiSeq	Phase_I	44836192	NM_198688		Missense_Mutation	SNP	ENST00000400368.1	37	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	-	7.623	0.677161	0.14841	.	.	ENSG00000188155	ENST00000400368	T	0.00792	5.69	0.986	0.986	0.19784	.	.	.	.	.	T	0.01287	0.0042	M	0.88031	2.925	0.09310	N	0.999999	P	0.52061	0.95	B	0.36134	0.218	T	0.47209	-0.9135	9	0.34782	T	0.22	.	5.2363	0.15448	0.0:0.0:1.0:0.0	.	201	P60371	KR106_HUMAN	I	201	ENSP00000383219:T201I	ENSP00000383219:T201I	T	-	2	0	KRTAP10-6	44836192	0.048000	0.20356	0.051000	0.19133	0.276000	0.26787	0.180000	0.16860	0.460000	0.27045	0.194000	0.17425	ACC		0.657	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
SEZ6L	23544	broad.mit.edu	37	22	26689086	26689086	+	Missense_Mutation	SNP	C	C	T	rs371478865		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr22:26689086C>T	ENST00000248933.6	+	2	904	c.809C>T	c.(808-810)aCg>aTg	p.T270M	SEZ6L_ENST00000402979.1_Missense_Mutation_p.T43M|SEZ6L_ENST00000403121.1_Missense_Mutation_p.T43M|SEZ6L_ENST00000529632.2_Missense_Mutation_p.T270M|SEZ6L_ENST00000404234.3_Missense_Mutation_p.T270M|SEZ6L_ENST00000343706.4_Missense_Mutation_p.T270M|SEZ6L_ENST00000360929.3_Missense_Mutation_p.T270M			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	270					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.T270M(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						atcaccaccacggtcatcacc	0.572																																					p.T270M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C809T	22						.	C	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	0,4390		0,0,2195	64.0	43.0	50.0		809,809,809,809,809,809	5.0	1.0	22		50	1,8591		0,1,4295	no	missense,missense,missense,missense,missense,missense	SEZ6L	NM_001184773.1,NM_001184774.1,NM_001184775.1,NM_001184776.1,NM_001184777.1,NM_021115.4	81,81,81,81,81,81	0,1,6490	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	270/1024,270/1014,270/1012,270/950,270/949,270/1025	26689086	1,12981	2195	4296	6491	25019086	SO:0001583	missense	23544	exon2			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.809C>T	22.37:g.26689086C>T	ENSP00000248933:p.Thr270Met	Somatic		Capture	Illumina HiSeq	Phase_I	25019086	NM_001184776	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981524	0.74474	0.0	1.16E-4	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.37752	1.38;1.5;1.55;1.4;1.18;1.46;1.69	4.98	4.98	0.66077	.	0.000000	0.56097	D	0.000021	T	0.49745	0.1575	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.997;0.997;0.994;0.999;0.999;0.997;0.997	T	0.53136	-0.8481	10	0.72032	D	0.01	.	17.259	0.87064	0.0:1.0:0.0:0.0	.	270;270;43;270;270;270;270	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	M	270;270;270;270;270;43;43	ENSP00000384772:T270M;ENSP00000437037:T270M;ENSP00000354185:T270M;ENSP00000248933:T270M;ENSP00000342661:T270M;ENSP00000384838:T43M;ENSP00000384733:T43M	ENSP00000248933:T270M	T	+	2	0	SEZ6L	25019086	0.997000	0.39634	0.988000	0.46212	0.886000	0.51366	4.582000	0.60957	2.471000	0.83476	0.558000	0.71614	ACG		0.572	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
SUN2	25777	broad.mit.edu	37	22	39132322	39132322	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr22:39132322C>T	ENST00000405510.1	-	19	2462	c.2104G>A	c.(2104-2106)Gag>Aag	p.E702K	RP3-508I15.20_ENST00000609428.1_RNA|SUN2_ENST00000406622.1_Missense_Mutation_p.E702K|SUN2_ENST00000411587.2_Missense_Mutation_p.E691K|RP3-508I15.14_ENST00000416406.1_RNA|SUN2_ENST00000216064.4_Missense_Mutation_p.E702K|RP3-508I15.19_ENST00000418803.1_RNA|SUN2_ENST00000405018.1_Missense_Mutation_p.E723K|RP3-508I15.18_ENST00000420118.1_RNA	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	702	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)	p.E702K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						CAGGTGTACTCGGGGTGGCCC	0.602																																					p.E702K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2104A	22						.						96.0	80.0	86.0					22																	39132322		2203	4300	6503	37462268	SO:0001583	missense	25777	exon18			AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.2104G>A	22.37:g.39132322C>T	ENSP00000385740:p.Glu702Lys	Somatic		Capture	Illumina HiSeq	Phase_I	37462268	NM_015374	B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Missense_Mutation	SNP	ENST00000405510.1	37	CCDS13978.1	.	.	.	.	.	.	.	.	.	.	C	36	5.712657	0.96830	.	.	ENSG00000100242	ENST00000405510;ENST00000216064;ENST00000405018;ENST00000406622;ENST00000411587	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	5.34	5.34	0.76211	Sad1/UNC-like, C-terminal (2);	0.129946	0.49916	D	0.000122	T	0.60612	0.2282	L	0.50993	1.605	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.58284	-0.7663	10	0.44086	T	0.13	-29.3873	18.6524	0.91435	0.0:1.0:0.0:0.0	.	691;737;723;702	B4DIU6;B4E2A6;B0QY62;Q9UH99	.;.;.;SUN2_HUMAN	K	702;702;723;702;691	ENSP00000385740:E702K;ENSP00000216064:E702K;ENSP00000385616:E723K;ENSP00000383992:E702K;ENSP00000395601:E691K	ENSP00000216064:E702K	E	-	1	0	SUN2	37462268	0.999000	0.42202	0.950000	0.38849	0.836000	0.47400	4.029000	0.57253	2.498000	0.84270	0.561000	0.74099	GAG		0.602	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321057.1	XM_039332	
HMGXB4	10042	broad.mit.edu	37	22	35661575	35661576	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	AG	AG	AG	-	AG	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr22:35661575_35661576delAG	ENST00000216106.5	+	5	1322_1323	c.1194_1195delAG	c.(1192-1197)aaagagfs	p.E399fs	HMGXB4_ENST00000444518.2_Frame_Shift_Del_p.E290fs	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	399					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						agaaggacaaagagagagagag	0.465																																					p.398_399del												.	.	0			c.1194_1195del	22						.																																			33991576	SO:0001589	frameshift_variant	10042	exon5			AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1194_1195delAG	22.37:g.35661585_35661586delAG	ENSP00000216106:p.Glu399fs	Germline		Capture	Illumina HiSeq	Phase_I	33991575	NM_001003681	O75672|O75673|Q9UMT5	Frame_Shift_Del	DEL	ENST00000216106.5	37	CCDS33641.1																																																																																				0.465	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	NM_005487	
NUP50	10762	broad.mit.edu	37	22	45574339	45574339	+	Silent	SNP	T	T	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr22:45574339T>C	ENST00000347635.4	+	5	1027	c.561T>C	c.(559-561)ttT>ttC	p.F187F	NUP50_ENST00000407019.2_Silent_p.F159F|CTA-268H5.12_ENST00000610217.1_RNA|NUP50_ENST00000425733.2_5'UTR|NUP50_ENST00000396096.2_Silent_p.F159F	NM_007172.3	NP_009103.2	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa	187	5 X 2 AA repeats of F-G.|Binding to CDKN1B. {ECO:0000250}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intracellular transport (GO:0046907)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.F187F(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CACCTATCTTTAAAGACTATG	0.448																																					p.F187F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T561C	22						.						39.0	40.0	39.0					22																	45574339		2201	4294	6495	43953003	SO:0001819	synonymous_variant	10762	exon5			AF107840	CCDS14062.1, CCDS14063.1	22q13.3	2007-01-22	2002-08-29		ENSG00000093000	ENSG00000093000			8065	protein-coding gene	gene with protein product		604646	"""nucleoporin 50kD"""	NPAP60L		10449902	Standard	XM_005261312		Approved		uc003bfr.3	Q9UKX7	OTTHUMG00000151265	ENST00000347635.4:c.561T>C	22.37:g.45574339T>C		Somatic		Capture	Illumina HiSeq	Phase_I	43953003	NM_007172	B1AHA4|B2RB15|O75644|Q8N6V5|Q9NPM9|Q9NPR6|Q9P1K5	Silent	SNP	ENST00000347635.4	37	CCDS14062.1																																																																																				0.448	NUP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321993.2		
ST6GAL2	84620	broad.mit.edu	37	2	107459776	107459776	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:107459776G>A	ENST00000409382.3	-	2	1268	c.658C>T	c.(658-660)Cgc>Tgc	p.R220C	ST6GAL2_ENST00000409087.3_Missense_Mutation_p.R220C|AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.R220C	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	220					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.R220C(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						TTCTGCAGGCGCGGGTTCAGC	0.647																																					p.R220C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C658T	2						.						41.0	42.0	42.0					2																	107459776		2203	4300	6503	106826208	SO:0001583	missense	84620	exon2			AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.658C>T	2.37:g.107459776G>A	ENSP00000386942:p.Arg220Cys	Somatic		Capture	Illumina HiSeq	Phase_I	106826208	NM_001142351	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044264	0.93685	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.51071	1.81;1.81;0.72	5.14	5.14	0.70334	.	0.234460	0.45361	D	0.000376	T	0.72946	0.3524	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.983	T	0.78319	-0.2250	10	0.87932	D	0	-17.5576	17.59	0.87993	0.0:0.0:1.0:0.0	.	220;220	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	C	220	ENSP00000355273:R220C;ENSP00000386942:R220C;ENSP00000387332:R220C	ENSP00000355273:R220C	R	-	1	0	ST6GAL2	106826208	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	9.267000	0.95665	2.403000	0.81681	0.561000	0.74099	CGC		0.647	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528	
CXCR4	7852	broad.mit.edu	37	2	136872498	136872498	+	Nonsense_Mutation	SNP	G	G	A	rs104893624		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:136872498G>A	ENST00000241393.3	-	2	1104	c.1000C>T	c.(1000-1002)Cga>Tga	p.R334*	CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Nonsense_Mutation_p.R338*	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	334					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)	p.R338*(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	TGTCCACCTCGCTTTCCTTTG	0.438																																					p.R334X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1000T	2	GRCh37	CM030831	CXCR4	M	rs104893624	.						223.0	212.0	216.0					2																	136872498		2203	4300	6503	136588968	SO:0001587	stop_gained	7852	exon2			AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.1000C>T	2.37:g.136872498G>A	ENSP00000241393:p.Arg334*	Somatic		Capture	Illumina HiSeq	Phase_I	136588968	NM_003467	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Nonsense_Mutation	SNP	ENST00000241393.3	37	CCDS46420.1	.	.	.	.	.	.	.	.	.	.	G	31	5.093279	0.94149	.	.	ENSG00000121966	ENST00000409817;ENST00000241393;ENST00000537957	.	.	.	5.95	5.0	0.66597	.	0.000000	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.9075	0.88923	0.0:0.0:0.8704:0.1296	.	.	.	.	X	338;334;204	.	ENSP00000241393:R334X	R	-	1	2	CXCR4	136588968	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.846000	0.48262	2.827000	0.97445	0.650000	0.86243	CGA		0.438	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
ACVR1C	130399	broad.mit.edu	37	2	158406715	158406715	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:158406715C>T	ENST00000243349.8	-	4	1094	c.734G>A	c.(733-735)cGa>cAa	p.R245Q	ACVR1C_ENST00000348328.5_Intron|ACVR1C_ENST00000335450.7_Missense_Mutation_p.R165Q|ACVR1C_ENST00000409680.3_Missense_Mutation_p.R195Q	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC									p.R245Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						GTTTTCATGTCGCAGCATGAC	0.423																																					p.R195Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G584A	2						.						136.0	133.0	134.0					2																	158406715		2203	4300	6503	158114961	SO:0001583	missense	130399	exon4			BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.734G>A	2.37:g.158406715C>T	ENSP00000243349:p.Arg245Gln	Somatic		Capture	Illumina HiSeq	Phase_I	158114961	NM_001111031		Missense_Mutation	SNP	ENST00000243349.8	37	CCDS2205.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535450	0.64972	.	.	ENSG00000123612	ENST00000243349;ENST00000409680;ENST00000335450	D;D;D	0.93763	-3.28;-3.28;-3.28	6.16	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.121554	0.34507	N	0.003902	D	0.96185	0.8756	M	0.76002	2.32	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.68483	0.958;0.936	D	0.96622	0.9460	10	0.87932	D	0	.	15.2647	0.73651	0.0:0.9326:0.0:0.0674	.	165;245	Q8NER5-3;Q8NER5	.;ACV1C_HUMAN	Q	245;195;165	ENSP00000243349:R245Q;ENSP00000387168:R195Q;ENSP00000335178:R165Q	ENSP00000243349:R245Q	R	-	2	0	ACVR1C	158114961	0.990000	0.36364	1.000000	0.80357	0.011000	0.07611	7.818000	0.86416	1.628000	0.50416	-0.145000	0.13849	CGA		0.423	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259	
SCN9A	6335	broad.mit.edu	37	2	167055493	167055493	+	Missense_Mutation	SNP	G	G	A	rs560168893		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:167055493G>A	ENST00000409435.1	-	26	5655	c.5656C>T	c.(5656-5658)Cgg>Tgg	p.R1886W	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Missense_Mutation_p.R1875W|SCN9A_ENST00000375387.4_Missense_Mutation_p.R1887W|SCN9A_ENST00000303354.6_Missense_Mutation_p.R1887W			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1886					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.R1875W(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTGTTTCCGTTTTAGTGTG	0.403													G|||	1	0.000199681	0.0	0.0	5008	,	,		22189	0.001		0.0	False		,,,				2504	0.0				p.R1875W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5623T	2						.						183.0	199.0	194.0					2																	167055493		2202	4300	6502	166763739	SO:0001583	missense	6335	exon27			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.5656C>T	2.37:g.167055493G>A	ENSP00000386330:p.Arg1886Trp	Somatic		Capture	Illumina HiSeq	Phase_I	166763739	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332432	0.41297	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.96587	-4.04;-4.06;-4.06;-4.06	6.17	0.862	0.19056	.	0.000000	0.52532	D	0.000068	D	0.97692	0.9243	M	0.78916	2.43	0.53005	D	0.999965	D	0.89917	1.0	D	0.85130	0.997	D	0.96903	0.9661	10	0.49607	T	0.09	.	16.6386	0.85065	0.0:0.0:0.4447:0.5553	.	1875	E7EUN6	.	W	1875;1887;1887;1886	ENSP00000386306:R1875W;ENSP00000364536:R1887W;ENSP00000304748:R1887W;ENSP00000386330:R1886W	ENSP00000304748:R1887W	R	-	1	2	SCN9A	166763739	1.000000	0.71417	0.971000	0.41717	0.587000	0.36485	1.079000	0.30766	0.132000	0.18615	-0.181000	0.13052	CGG		0.403	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
LRP2	4036	broad.mit.edu	37	2	169995203	169995203	+	Missense_Mutation	SNP	C	C	T	rs201984825		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:169995203C>T	ENST00000263816.3	-	75	13687	c.13402G>A	c.(13402-13404)Gtc>Atc	p.V4468I		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4468					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.V4468I(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GAGGGCTTGACGAGACTGCTT	0.408																																					p.V4468I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13402A	2						.						112.0	92.0	99.0					2																	169995203		2203	4300	6503	169703449	SO:0001583	missense	4036	exon75				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13402G>A	2.37:g.169995203C>T	ENSP00000263816:p.Val4468Ile	Somatic		Capture	Illumina HiSeq	Phase_I	169703449	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.776472	0.49786	.	.	ENSG00000081479	ENST00000263816	D	0.90385	-2.66	5.32	1.4	0.22301	.	0.255443	0.38381	N	0.001718	T	0.76492	0.3995	N	0.24115	0.695	0.80722	D	1	D	0.52996	0.957	B	0.34991	0.193	T	0.68884	-0.5291	10	0.22109	T	0.4	.	6.686	0.23146	0.2557:0.6099:0.0:0.1344	.	4468	P98164	LRP2_HUMAN	I	4468	ENSP00000263816:V4468I	ENSP00000263816:V4468I	V	-	1	0	LRP2	169703449	0.911000	0.30947	0.054000	0.19295	0.965000	0.64279	1.910000	0.39927	0.040000	0.15660	0.650000	0.86243	GTC		0.408	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
SLC39A10	57181	broad.mit.edu	37	2	196548600	196548600	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:196548600C>T	ENST00000409086.3	+	3	1461	c.1186C>T	c.(1186-1188)Cct>Tct	p.P396S	SLC39A10_ENST00000541054.1_5'UTR|SLC39A10_ENST00000359634.5_Missense_Mutation_p.P396S	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	396					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.P396S(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			AAACCTGGTTCCTGAAGATGA	0.323																																					p.P396S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1186T	2						.						57.0	62.0	60.0					2																	196548600		2203	4300	6503	196256845	SO:0001583	missense	57181	exon3				CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.1186C>T	2.37:g.196548600C>T	ENSP00000386766:p.Pro396Ser	Somatic		Capture	Illumina HiSeq	Phase_I	196256845	NM_001127257	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	37	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	C	6.041	0.375828	0.11409	.	.	ENSG00000196950	ENST00000409086;ENST00000359634	T;T	0.66638	-0.22;-0.22	4.84	1.83	0.25207	.	1.226200	0.05271	N	0.517580	T	0.44953	0.1318	N	0.12182	0.205	0.39186	D	0.962874	B	0.10296	0.003	B	0.08055	0.003	T	0.42498	-0.9448	10	0.15499	T	0.54	.	4.8393	0.13481	0.1645:0.5564:0.0:0.279	.	396	Q9ULF5	S39AA_HUMAN	S	396	ENSP00000386766:P396S;ENSP00000352655:P396S	ENSP00000352655:P396S	P	+	1	0	SLC39A10	196256845	0.994000	0.37717	0.997000	0.53966	0.443000	0.32047	0.326000	0.19646	0.639000	0.30564	-0.145000	0.13849	CCT		0.323	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1	XM_047707	
ALS2	57679	broad.mit.edu	37	2	202587823	202587823	+	Silent	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:202587823G>A	ENST00000264276.6	-	23	4017	c.3645C>T	c.(3643-3645)tcC>tcT	p.S1215S	ALS2_ENST00000457679.2_Silent_p.S527S	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1215					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.S1215S(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TATCATCTTCGGAAAGCAAAA	0.353																																					p.S1215S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3645T	2						.						98.0	91.0	93.0					2																	202587823		1815	4081	5896	202296068	SO:0001819	synonymous_variant	57679	exon23			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.3645C>T	2.37:g.202587823G>A		Somatic		Capture	Illumina HiSeq	Phase_I	202296068	NM_020919	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	ENST00000264276.6	37	CCDS42800.1																																																																																				0.353	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
GLB1L	79411	broad.mit.edu	37	2	220107583	220107583	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:220107583G>C	ENST00000295759.7	-	4	610	c.297C>G	c.(295-297)agC>agG	p.S99R	GLB1L_ENST00000409640.1_Missense_Mutation_p.S99R|GLB1L_ENST00000497855.1_5'Flank|STK16_ENST00000396738.2_5'Flank|STK16_ENST00000409638.3_5'Flank|GLB1L_ENST00000356283.3_Missense_Mutation_p.S99R|GLB1L_ENST00000392089.2_Missense_Mutation_p.S99R|STK16_ENST00000409516.3_5'Flank			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	99					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)	p.S99R(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGAGGTCCCGGCTGCCATTAA	0.507																																					p.S99R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C297G	2						.						67.0	77.0	74.0					2																	220107583		2203	4300	6503	219815827	SO:0001583	missense	79411	exon4				CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.297C>G	2.37:g.220107583G>C	ENSP00000295759:p.Ser99Arg	Somatic		Capture	Illumina HiSeq	Phase_I	219815827	NM_024506	Q96DR0	Missense_Mutation	SNP	ENST00000295759.7	37	CCDS2437.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.00|15.00	2.704422|2.704422	0.48412|0.48412	.|.	.|.	ENSG00000163521|ENSG00000163521	ENST00000440853|ENST00000295759;ENST00000409640;ENST00000392089;ENST00000356283;ENST00000428427	.|D;D;D;D;D	.|0.97850	.|-4.57;-4.57;-4.57;-4.57;-4.57	6.17|6.17	3.08|3.08	0.35506|0.35506	.|Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.|0.193593	.|0.52532	.|D	.|0.000062	D|D	0.90882|0.90882	0.7135|0.7135	N|N	0.01235|0.01235	-0.94|-0.94	0.21147|0.21147	N|N	0.999776|0.999776	.|P;B	.|0.50443	.|0.935;0.045	.|P;B	.|0.49708	.|0.62;0.102	D|D	0.85621|0.85621	0.1264|0.1264	5|10	.|0.22109	.|T	.|0.4	-19.1889|-19.1889	7.0004|7.0004	0.24807|0.24807	0.2515:0.1339:0.6146:0.0|0.2515:0.1339:0.6146:0.0	.|.	.|99;99	.|Q6UWU2-2;Q6UWU2	.|.;GLB1L_HUMAN	G|R	32|99	.|ENSP00000295759:S99R;ENSP00000386354:S99R;ENSP00000375939:S99R;ENSP00000348628:S99R;ENSP00000400738:S99R	.|ENSP00000295759:S99R	A|S	-|-	2|3	0|2	GLB1L|GLB1L	219815827|219815827	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.434000|1.434000	0.34958|0.34958	1.627000|1.627000	0.50400|0.50400	0.655000|0.655000	0.94253|0.94253	GCC|AGC		0.507	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256822.2	NM_024506	
ID2	3398	broad.mit.edu	37	2	8822451	8822451	+	Silent	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:8822451C>T	ENST00000234091.4	+	3	1016	c.156C>T	c.(154-156)agC>agT	p.S52S	ID2_ENST00000331129.3_Silent_p.S52S|AC011747.7_ENST00000455965.1_RNA|ID2_ENST00000396290.1_Silent_p.S52S			Q02363	ID2_HUMAN	inhibitor of DNA binding 2, dominant negative helix-loop-helix protein	52	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				adipose tissue development (GO:0060612)|bundle of His development (GO:0003166)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|embryonic digestive tract morphogenesis (GO:0048557)|endodermal digestive tract morphogenesis (GO:0061031)|entrainment of circadian clock by photoperiod (GO:0043153)|enucleate erythrocyte differentiation (GO:0043353)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|locomotor rhythm (GO:0045475)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|membranous septum morphogenesis (GO:0003149)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|natural killer cell differentiation (GO:0001779)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of DNA binding (GO:0043392)|negative regulation of gene expression (GO:0010629)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate commitment (GO:0048663)|olfactory bulb development (GO:0021772)|oligodendrocyte development (GO:0014003)|Peyer's patch development (GO:0048541)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of lipid metabolic process (GO:0019216)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|protein complex (GO:0043234)	ion channel binding (GO:0044325)	p.S52S(1)		breast(1)|large_intestine(1)|lung(1)|prostate(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TGGTGCCCAGCATCCCCCAGA	0.562																																					p.S52S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C156T	2						.						77.0	74.0	75.0					2																	8822451		2203	4300	6503	8739902	SO:0001819	synonymous_variant	3398	exon1				CCDS1659.1	2p25	2013-05-21			ENSG00000115738	ENSG00000115738		"""Basic helix-loop-helix proteins"""	5361	protein-coding gene	gene with protein product	"""cell growth-inhibiting gene 8"""	600386				8294468	Standard	NM_002166		Approved	GIG8, bHLHb26	uc002qza.3	Q02363	OTTHUMG00000112454	ENST00000234091.4:c.156C>T	2.37:g.8822451C>T		Somatic		Capture	Illumina HiSeq	Phase_I	8739902	NM_002166		Silent	SNP	ENST00000234091.4	37	CCDS1659.1																																																																																				0.562	ID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000231925.2	NM_002166	
CAD	790	broad.mit.edu	37	2	27456616	27456616	+	Silent	SNP	C	C	T	rs146143846		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:27456616C>T	ENST00000403525.1	+	20	3294	c.3150C>T	c.(3148-3150)agC>agT	p.S1050S	CAD_ENST00000264705.4_Silent_p.S1113S			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.S1113S(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTGAGCAGCGCAGCAGCCG	0.607																																					p.S1113S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3339T	2						.	C		0,4406		0,0,2203	62.0	64.0	63.0		3339	-9.4	0.7	2	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CAD	NM_004341.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1113/2226	27456616	1,13005	2203	4300	6503	27310120	SO:0001819	synonymous_variant	790	exon21			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.3150C>T	2.37:g.27456616C>T		Somatic		Capture	Illumina HiSeq	Phase_I	27310120	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Silent	SNP	ENST00000403525.1	37																																																																																					0.607	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
NRXN1	9378	broad.mit.edu	37	2	51255076	51255076	+	Silent	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:51255076G>A	ENST00000406316.2	-	2	1812	c.336C>T	c.(334-336)ggC>ggT	p.G112G	NRXN1_ENST00000405581.1_Silent_p.G112G|NRXN1_ENST00000401669.2_Silent_p.G112G|NRXN1_ENST00000404971.1_Silent_p.G112G|NRXN1_ENST00000402717.3_Silent_p.G112G|NRXN1_ENST00000406859.3_Silent_p.G112G|NRXN1_ENST00000405472.3_Silent_p.G112G	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	112	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.G112G(2)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGTGCCAGGCGCCGTCGTTAA	0.667																																					p.G112G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C336T	2						.						22.0	27.0	25.0					2																	51255076		2063	4197	6260	51108580	SO:0001819	synonymous_variant	9378	exon2			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.336C>T	2.37:g.51255076G>A		Somatic		Capture	Illumina HiSeq	Phase_I	51108580	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1																																																																																				0.667	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
OTX1	5013	broad.mit.edu	37	2	63283404	63283404	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:63283404T>G	ENST00000282549.2	+	5	1294	c.1018T>G	c.(1018-1020)Tgt>Ggt	p.C340G	OTX1_ENST00000366671.3_Missense_Mutation_p.C340G	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	340					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.C340G(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					CTCCCCCGACTGTCTGGACTA	0.577																																					p.C340G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1018G	2						.						55.0	55.0	55.0					2																	63283404		2203	4300	6503	63136908	SO:0001583	missense	5013	exon5				CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.1018T>G	2.37:g.63283404T>G	ENSP00000282549:p.Cys340Gly	Somatic		Capture	Illumina HiSeq	Phase_I	63136908	NM_001199770	A6NHA2|B3KTJ4|Q53TG6	Missense_Mutation	SNP	ENST00000282549.2	37	CCDS1873.1	.	.	.	.	.	.	.	.	.	.	T	17.39	3.376510	0.61735	.	.	ENSG00000115507	ENST00000366671;ENST00000282549	D;D	0.92752	-3.1;-3.1	3.93	3.93	0.45458	.	0.000000	0.85682	D	0.000000	D	0.93779	0.8011	L	0.52573	1.65	0.80722	D	1	D	0.65815	0.995	D	0.70487	0.969	D	0.93883	0.7173	10	0.62326	D	0.03	.	12.1896	0.54264	0.0:0.0:0.0:1.0	.	340	P32242	OTX1_HUMAN	G	340	ENSP00000355631:C340G;ENSP00000282549:C340G	ENSP00000282549:C340G	C	+	1	0	OTX1	63136908	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.786000	0.85741	1.770000	0.52166	0.459000	0.35465	TGT		0.577	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1		
LYG1	129530	broad.mit.edu	37	2	99900878	99900878	+	Missense_Mutation	SNP	T	T	C	rs550128779		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:99900878T>C	ENST00000409448.1	-	8	879	c.563A>G	c.(562-564)tAc>tGc	p.Y188C	LYG1_ENST00000308528.4_Missense_Mutation_p.Y188C			Q8N1E2	LYG1_HUMAN	lysozyme G-like 1	188					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)	p.Y188C(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						TCTCTTGAGGTACTTGGCTCG	0.502																																					p.Y188C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A563G	2						.						148.0	128.0	135.0					2																	99900878		2203	4300	6503	99267310	SO:0001583	missense	129530	exon7			BC029126	CCDS2043.1	2q11.2	2008-02-05			ENSG00000144214	ENSG00000144214			27014	protein-coding gene	gene with protein product						12574869	Standard	NM_174898		Approved	SALW1939	uc002szy.3	Q8N1E2	OTTHUMG00000130639	ENST00000409448.1:c.563A>G	2.37:g.99900878T>C	ENSP00000386923:p.Tyr188Cys	Somatic		Capture	Illumina HiSeq	Phase_I	99267310	NM_174898	Q53RV9	Missense_Mutation	SNP	ENST00000409448.1	37	CCDS2043.1	.	.	.	.	.	.	.	.	.	.	T	17.25	3.341654	0.61073	.	.	ENSG00000144214	ENST00000308528;ENST00000409448	.	.	.	4.42	4.42	0.53409	Lysozyme-like domain (1);	0.000000	0.44902	D	0.000404	T	0.70727	0.3257	M	0.68593	2.085	0.43907	D	0.996549	D	0.89917	1.0	D	0.91635	0.999	T	0.71286	-0.4638	8	.	.	.	-12.7517	9.9699	0.41747	0.0:0.0:0.0:1.0	.	188	Q8N1E2	LYG1_HUMAN	C	188	.	.	Y	-	2	0	LYG1	99267310	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	1.098000	0.31000	1.871000	0.54225	0.459000	0.35465	TAC		0.502	LYG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330315.1	NM_174898	
OR6B3	150681	broad.mit.edu	37	2	240985276	240985276	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr2:240985276A>G	ENST00000319423.4	-	1	213	c.214T>C	c.(214-216)Tgg>Cgg	p.W72R	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W72R(2)		endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		GACACGTACCAGATCTCTAGG	0.557																																					p.W72R												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.T214C	2						.						109.0	114.0	113.0					2																	240985276		2098	4217	6315	240633949	SO:0001583	missense	150681	exon1				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.214T>C	2.37:g.240985276A>G	ENSP00000322435:p.Trp72Arg	Somatic		Capture	Illumina HiSeq	Phase_I	240633949	NM_173351	Q6IFH3	Missense_Mutation	SNP	ENST00000319423.4	37	CCDS42837.1	.	.	.	.	.	.	.	.	.	.	A	13.43	2.235334	0.39498	.	.	ENSG00000178586	ENST00000319423	T	0.00700	5.82	3.96	3.96	0.45880	GPCR, rhodopsin-like superfamily (1);	0.324871	0.22613	N	0.057805	T	0.03520	0.0101	M	0.81112	2.525	0.25884	N	0.983559	D	0.89917	1.0	D	0.72338	0.977	T	0.11690	-1.0577	10	0.72032	D	0.01	.	7.681	0.28513	0.7848:0.2152:0.0:0.0	.	72	Q8NGW1	OR6B3_HUMAN	R	72	ENSP00000322435:W72R	ENSP00000322435:W72R	W	-	1	0	OR6B3	240633949	0.002000	0.14202	0.999000	0.59377	0.698000	0.40448	1.040000	0.30278	2.000000	0.58554	0.413000	0.27773	TGG		0.557	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1		
IRAK2	3656	broad.mit.edu	37	3	10280577	10280577	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr3:10280577C>T	ENST00000256458.4	+	12	1709	c.1619C>T	c.(1618-1620)tCc>tTc	p.S540F		NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	540					activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)	p.S540F(2)		breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						CTTGATGCCTCCTCCTCCATG	0.597																																					p.S540F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1619T	3						.						77.0	72.0	74.0					3																	10280577		2203	4300	6503	10255577	SO:0001583	missense	3656	exon12			AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.1619C>T	3.37:g.10280577C>T	ENSP00000256458:p.Ser540Phe	Somatic		Capture	Illumina HiSeq	Phase_I	10255577	NM_001570	B4DQZ6|Q08AG6|Q5K546	Missense_Mutation	SNP	ENST00000256458.4	37	CCDS33697.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221718	0.58560	.	.	ENSG00000134070	ENST00000256458	T	0.56275	0.47	5.15	4.26	0.50523	.	0.595797	0.15107	N	0.280194	T	0.52693	0.1750	L	0.50333	1.59	0.09310	N	1	P	0.50710	0.938	P	0.47470	0.548	T	0.43972	-0.9358	10	0.51188	T	0.08	-4.0385	10.8703	0.46879	0.1883:0.8117:0.0:0.0	.	540	O43187	IRAK2_HUMAN	F	540	ENSP00000256458:S540F	ENSP00000256458:S540F	S	+	2	0	IRAK2	10255577	0.005000	0.15991	0.001000	0.08648	0.369000	0.29798	2.089000	0.41672	1.127000	0.42034	0.563000	0.77884	TCC		0.597	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339623.1		
ATP2B2	491	broad.mit.edu	37	3	10382255	10382255	+	Silent	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr3:10382255G>A	ENST00000352432.4	-	19	3120	c.3051C>T	c.(3049-3051)caC>caT	p.H1017H	ATP2B2_ENST00000343816.4_Silent_p.H1003H|ATP2B2_ENST00000360273.2_Silent_p.H1017H|ATP2B2_ENST00000397077.1_Silent_p.H972H|ATP2B2_ENST00000383800.4_Silent_p.H972H			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	1017					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.H972H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						TGCGCTCGCCGTGGATCTTGC	0.567																																					p.H972H	Ovarian(125;1619 1709 15675 19819 38835)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2916T	3						.						230.0	188.0	202.0					3																	10382255		2203	4300	6503	10357255	SO:0001819	synonymous_variant	491	exon17			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.3051C>T	3.37:g.10382255G>A		Somatic		Capture	Illumina HiSeq	Phase_I	10357255	NM_001683	O00766|Q12994|Q16818	Silent	SNP	ENST00000352432.4	37	CCDS33701.1																																																																																				0.567	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
SETD5	55209	broad.mit.edu	37	3	9512351	9512351	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr3:9512351G>A	ENST00000406341.1	+	18	3123	c.2933G>A	c.(2932-2934)cGg>cAg	p.R978Q	SETD5_ENST00000407969.1_Missense_Mutation_p.R997Q|SETD5_ENST00000302463.6_Missense_Mutation_p.R880Q|SETD5_ENST00000402198.1_Missense_Mutation_p.R978Q|SETD5_ENST00000402466.1_Missense_Mutation_p.R880Q			Q9C0A6	SETD5_HUMAN	SET domain containing 5	978								p.R880Q(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CAGGCATTTCGGACAGAGTTC	0.527																																					p.R978Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2933A	3						.						166.0	156.0	159.0					3																	9512351		1938	4148	6086	9487351	SO:0001583	missense	55209	exon19			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.2933G>A	3.37:g.9512351G>A	ENSP00000383939:p.Arg978Gln	Somatic		Capture	Illumina HiSeq	Phase_I	9487351	NM_001080517	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	ENST00000406341.1	37	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962406	0.92791	.	.	ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463	D;D;D;D;D	0.95001	-3.23;-3.58;-3.23;-3.19;-3.58	5.51	5.51	0.81932	.	0.055504	0.64402	D	0.000001	D	0.95739	0.8614	L	0.32530	0.975	0.51482	D	0.999921	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.99;0.982	D	0.96431	0.9319	10	0.87932	D	0	-10.6248	19.3917	0.94585	0.0:0.0:1.0:0.0	.	647;880;978	B3KXG4;Q9C0A6-3;Q9C0A6	.;.;SETD5_HUMAN	Q	978;880;978;997;880	ENSP00000385852:R978Q;ENSP00000384429:R880Q;ENSP00000383939:R978Q;ENSP00000384114:R997Q;ENSP00000302028:R880Q	ENSP00000302028:R880Q	R	+	2	0	SETD5	9487351	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.934000	0.87649	2.585000	0.87301	0.591000	0.81541	CGG		0.527	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
KCNH8	131096	broad.mit.edu	37	3	19295238	19295238	+	Nonsense_Mutation	SNP	C	C	T	rs564126399		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr3:19295238C>T	ENST00000328405.2	+	2	435	c.169C>T	c.(169-171)Cga>Tga	p.R57*		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	57	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.R57*(1)|p.R57R(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TGGATTTGCCCGAACTGAAGT	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		19403	0.0		0.0	False		,,,				2504	0.001				p.R57X	NSCLC(124;1625 1765 8018 24930 42026)											.	.	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C169T	3						.						176.0	182.0	180.0					3																	19295238		2203	4300	6503	19270242	SO:0001587	stop_gained	131096	exon2			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.169C>T	3.37:g.19295238C>T	ENSP00000328813:p.Arg57*	Somatic		Capture	Illumina HiSeq	Phase_I	19270242	NM_144633	B7Z2I7|Q59GQ6	Nonsense_Mutation	SNP	ENST00000328405.2	37	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	C	40	8.095817	0.98651	.	.	ENSG00000183960	ENST00000328405	.	.	.	5.48	5.48	0.80851	.	0.000000	0.27027	U	0.021300	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3515	0.94389	0.0:1.0:0.0:0.0	.	.	.	.	X	57	.	.	R	+	1	2	KCNH8	19270242	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.806000	0.62569	2.554000	0.86153	0.655000	0.94253	CGA		0.458	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
TOP2B	7155	broad.mit.edu	37	3	25668118	25668118	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr3:25668118G>T	ENST00000264331.4	-	18	2156	c.2157C>A	c.(2155-2157)ttC>ttA	p.F719L	TOP2B_ENST00000435706.2_Missense_Mutation_p.F714L	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	719					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)	p.F714L(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	CCTTGTTGATGAAATCATTAT	0.279																																					p.F714L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2142A	3						.						39.0	39.0	39.0					3																	25668118		1970	4191	6161	25643122	SO:0001583	missense	7155	exon18			X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.2157C>A	3.37:g.25668118G>T	ENSP00000264331:p.Phe719Leu	Somatic		Capture	Illumina HiSeq	Phase_I	25643122	NM_001068	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	ENST00000264331.4	37		.	.	.	.	.	.	.	.	.	.	G	21.6	4.176550	0.78564	.	.	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.55760	0.5;0.5	5.5	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.78805	0.4341	H	0.96748	3.875	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81733	-0.0798	10	0.87932	D	0	-5.9691	10.4829	0.44704	0.337:0.0:0.663:0.0	.	714	Q02880-2	.	L	714;719;714	ENSP00000396704:F714L;ENSP00000264331:F719L	ENSP00000264331:F719L	F	-	3	2	TOP2B	25643122	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.452000	0.52971	0.383000	0.24910	0.557000	0.71058	TTC		0.279	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
CCDC39	339829	broad.mit.edu	37	3	180381706	180381706	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr3:180381706A>C	ENST00000442201.2	-	2	278	c.159T>G	c.(157-159)aaT>aaG	p.N53K	CCDC39_ENST00000273654.4_Missense_Mutation_p.N137K	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	53					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.N137K(1)|p.N53K(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AAGTCATAGAATTAATTCGCT	0.333																																					p.N53K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T159G	3						.						160.0	151.0	154.0					3																	180381706		1843	4103	5946	181864400	SO:0001583	missense	339829	exon2			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.159T>G	3.37:g.180381706A>C	ENSP00000405708:p.Asn53Lys	Somatic		Capture	Illumina HiSeq	Phase_I	181864400	NM_181426	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	A	15.80	2.940327	0.52972	.	.	ENSG00000145075	ENST00000273654;ENST00000442201;ENST00000471307	T	0.76968	-1.06	6.07	-0.72	0.11195	.	0.604430	0.19825	N	0.105217	T	0.53899	0.1825	L	0.32530	0.975	0.30327	N	0.787002	B	0.27316	0.175	B	0.27887	0.084	T	0.40942	-0.9536	10	0.06891	T	0.86	-17.3294	0.5524	0.00664	0.43:0.1244:0.2043:0.2413	.	53	Q9UFE4	CCD39_HUMAN	K	137;53;35	ENSP00000418702:N35K	ENSP00000273654:N137K	N	-	3	2	CCDC39	181864400	0.479000	0.25925	0.990000	0.47175	0.458000	0.32498	0.527000	0.22987	-0.068000	0.12953	-0.446000	0.05623	AAT		0.333	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
SLC10A7	84068	broad.mit.edu	37	4	147178067	147178068	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr4:147178067_147178068insC	ENST00000507030.1	-	12	1013_1014	c.1014_1015insG	c.(1012-1017)gggccafs	p.P339fs	SLC10A7_ENST00000432059.2_Intron|SLC10A7_ENST00000264986.3_Intron|SLC10A7_ENST00000335472.7_Intron|SLC10A7_ENST00000394062.3_Frame_Shift_Ins_p.P339fs			Q0GE19	NTCP7_HUMAN	solute carrier family 10, member 7	339					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|skin(1)	16	all_hematologic(180;0.151)					TTAGCCAGTGGCCCCCTGGTTT	0.381																																					.												.	.	0			.	4						.																																			147397518	SO:0001589	frameshift_variant	84068	.			AY346324	CCDS3768.1, CCDS34073.1, CCDS75198.1	4q31.2	2013-07-18	2013-07-18	2006-12-19	ENSG00000120519	ENSG00000120519		"""Solute carriers"""	23088	protein-coding gene	gene with protein product		611459	"""chromosome 4 open reading frame 13"""	C4orf13		15932064	Standard	NM_032128		Approved	MGC25043, DKFZp566M114, DKFZp313H0531, DKFZp779O2438	uc003ikr.2	Q0GE19	OTTHUMG00000161437	ENST00000507030.1:c.1015dupG	4.37:g.147178072_147178072dupC	ENSP00000421275:p.Pro339fs	None		Capture	Illumina HiSeq	Phase_I	147397517	.	A7E2E6|A7MAX9|Q0VAP9|Q45NG1|Q45NG2|Q5H9S6|Q6P4E6|Q8IZ62|Q8NBP8|Q9H0M9	Frame_Shift_Ins	INS	ENST00000507030.1	37	CCDS34073.1																																																																																				0.381	SLC10A7-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366932.1	NM_032128	
POU4F2	5458	broad.mit.edu	37	4	147561776	147561776	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr4:147561776G>A	ENST00000281321.3	+	2	1294	c.1046G>A	c.(1045-1047)cGc>cAc	p.R349H	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	349					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R349H(1)		NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					AAGCGCAAGCGCACGTCCATC	0.612																																					p.R349H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1046A	4						.						84.0	88.0	87.0					4																	147561776		2203	4300	6503	147781226	SO:0001583	missense	5458	exon2			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.1046G>A	4.37:g.147561776G>A	ENSP00000281321:p.Arg349His	Somatic		Capture	Illumina HiSeq	Phase_I	147781226	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	ENST00000281321.3	37	CCDS34074.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528257	0.85706	.	.	ENSG00000151615	ENST00000281321	D	0.99167	-5.51	5.49	5.49	0.81192	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99674	0.9878	H	0.99130	4.44	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97261	0.9904	10	0.87932	D	0	.	19.37	0.94480	0.0:0.0:1.0:0.0	.	349	Q12837	PO4F2_HUMAN	H	349	ENSP00000281321:R349H	ENSP00000281321:R349H	R	+	2	0	POU4F2	147781226	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.841000	0.99482	2.595000	0.87683	0.561000	0.74099	CGC		0.612	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
FBXO8	26269	broad.mit.edu	37	4	175184040	175184040	+	Silent	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr4:175184040G>A	ENST00000393674.2	-	2	1066	c.204C>T	c.(202-204)ttC>ttT	p.F68F	FBXO8_ENST00000503293.1_Intron	NM_012180.2	NP_036312.2	Q9NRD0	FBX8_HUMAN	F-box protein 8	68	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell junction (GO:0030054)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.F68F(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|urinary_tract(1)	14		Prostate(90;0.00201)|Melanoma(52;0.012)|Renal(120;0.0183)|all_neural(102;0.0887)|all_hematologic(60;0.107)		all cancers(43;7.29e-18)|Epithelial(43;1.85e-15)|OV - Ovarian serous cystadenocarcinoma(60;5.62e-09)|GBM - Glioblastoma multiforme(59;0.00115)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.1)		CCAAATTAATGAATCCTTCCT	0.418																																					p.F68F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C204T	4						.						213.0	190.0	198.0					4																	175184040		2203	4300	6503	175420615	SO:0001819	synonymous_variant	26269	exon2			AF174596	CCDS3820.1	4q34.1	2008-02-05	2004-06-15			ENSG00000164117		"""F-boxes /  ""other"""""	13587	protein-coding gene	gene with protein product		605649	"""F-box only protein 8"""			10531035, 10531037	Standard	NM_012180		Approved	FBX8, FBS	uc003itp.3	Q9NRD0		ENST00000393674.2:c.204C>T	4.37:g.175184040G>A		Somatic		Capture	Illumina HiSeq	Phase_I	175420615	NM_012180	B2RB40|D3DP41|G5E9Z0|Q6UWN4|Q8IWE1|Q9NRP5|Q9UKC4	Silent	SNP	ENST00000393674.2	37	CCDS3820.1																																																																																				0.418	FBXO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362085.2	NM_012180	
PCDHA7	56141	broad.mit.edu	37	5	140214396	140214396	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr5:140214396C>T	ENST00000525929.1	+	1	428	c.428C>T	c.(427-429)gCg>gTg	p.A143V	PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.A143V|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	143	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A143V(2)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTTCATCGCGGAATCCAGG	0.567																																					p.A143V	NSCLC(160;258 2013 5070 22440 28951)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C428T	5						.						72.0	68.0	69.0					5																	140214396		2203	4292	6495	140194580	SO:0001583	missense	56141	exon1			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.428C>T	5.37:g.140214396C>T	ENSP00000436426:p.Ala143Val	Somatic		Capture	Illumina HiSeq	Phase_I	140194580	NM_018910	O75282	Missense_Mutation	SNP	ENST00000525929.1	37	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	C	6.361	0.434793	0.12045	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.52983	0.64;0.64	4.17	1.88	0.25563	Cadherin (3);Cadherin-like (1);	0.708972	0.10662	U	0.648542	T	0.57286	0.2043	M	0.62209	1.925	0.09310	N	1	P;P	0.48016	0.904;0.869	B;P	0.58820	0.361;0.846	T	0.43163	-0.9408	10	0.27785	T	0.31	.	7.9008	0.29734	0.2103:0.6976:0.0:0.0921	.	143;143	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	V	143	ENSP00000436426:A143V;ENSP00000367365:A143V	ENSP00000367365:A143V	A	+	2	0	PCDHA7	140194580	0.000000	0.05858	0.001000	0.08648	0.062000	0.15995	-0.060000	0.11712	0.830000	0.34757	0.455000	0.32223	GCG		0.567	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCDHA9	9752	broad.mit.edu	37	5	140230290	140230290	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr5:140230290C>T	ENST00000532602.1	+	1	3243	c.2210C>T	c.(2209-2211)cCg>cTg	p.P737L	PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.P737L|PCDHA5_ENST00000529619.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	737	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P737L(2)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGCAAGCCGACGCTGGTG	0.642																																					p.P737L	Melanoma(55;1800 1972 14909)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2210T	5						.						75.0	68.0	71.0					5																	140230290		2197	4273	6470	140210474	SO:0001583	missense	9752	exon1			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2210C>T	5.37:g.140230290C>T	ENSP00000436042:p.Pro737Leu	Somatic		Capture	Illumina HiSeq	Phase_I	140210474	NM_014005	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497231	0.44352	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.15487	2.42;2.42	4.51	4.51	0.55191	.	0.000000	0.31734	U	0.007147	T	0.50684	0.1630	M	0.93550	3.43	0.35984	D	0.836184	D;D	0.89917	0.984;1.0	P;D	0.91635	0.533;0.999	T	0.70189	-0.4940	10	0.87932	D	0	.	12.4922	0.55907	0.1663:0.8337:0.0:0.0	.	737;737	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	L	737	ENSP00000436042:P737L;ENSP00000367362:P737L	ENSP00000367362:P737L	P	+	2	0	PCDHA9	140210474	0.007000	0.16637	0.717000	0.30585	0.003000	0.03518	0.241000	0.18065	2.183000	0.69458	0.491000	0.48974	CCG		0.642	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
PCDHB12	56124	broad.mit.edu	37	5	140590797	140590797	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr5:140590797A>G	ENST00000239450.2	+	1	2507	c.2318A>G	c.(2317-2319)aAc>aGc	p.N773S	PCDHB12_ENST00000541609.1_Missense_Mutation_p.N436S|PCDHB13_ENST00000341948.4_5'Flank	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	773					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N773S(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATTATCCCCAACTTCCTACCC	0.433																																					p.N773S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2318G	5						.						73.0	74.0	74.0					5																	140590797		2203	4300	6503	140570981	SO:0001583	missense	56124	exon1			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.2318A>G	5.37:g.140590797A>G	ENSP00000239450:p.Asn773Ser	Somatic		Capture	Illumina HiSeq	Phase_I	140570981	NM_018932	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	A	6.391	0.440195	0.12104	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.18338	2.22;2.22	3.13	-1.64	0.08318	.	.	.	.	.	T	0.11281	0.0275	L	0.42008	1.315	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.36016	-0.9765	9	0.28530	T	0.3	.	2.6541	0.05007	0.2613:0.0:0.3353:0.4034	.	773	Q9Y5F1	PCDBC_HUMAN	S	436;773;393	ENSP00000440199:N436S;ENSP00000239450:N773S	ENSP00000239450:N773S	N	+	2	0	PCDHB12	140570981	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.959000	0.03853	-0.146000	0.11274	0.254000	0.18369	AAC		0.433	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
SKP2	6502	broad.mit.edu	37	5	36166712	36166712	+	Missense_Mutation	SNP	G	G	T	rs146156245		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr5:36166712G>T	ENST00000274255.6	+	4	680	c.484G>T	c.(484-486)Gcc>Tcc	p.A162S	SKP2_ENST00000546211.1_5'UTR|SKP2_ENST00000508514.1_Intron|SKP2_ENST00000274254.5_Missense_Mutation_p.A162S	NM_005983.3	NP_005974.2	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2, E3 ubiquitin protein ligase	162					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|cellular response to cell-matrix adhesion (GO:0071460)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	identical protein binding (GO:0042802)|ubiquitin-protein transferase activity (GO:0004842)	p.A162S(1)		breast(1)|central_nervous_system(2)|ovary(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGGGGTGATTGCCTTCCGCTG	0.448																																					p.A162S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G484T	5						.						107.0	98.0	101.0					5																	36166712		2203	4300	6503	36202469	SO:0001583	missense	6502	exon4			U33761	CCDS3915.1, CCDS3916.1, CCDS58944.1	5p13	2012-02-23	2012-02-23		ENSG00000145604	ENSG00000145604		"""F-boxes / Leucine-rich repeats"""	10901	protein-coding gene	gene with protein product		601436	"""S-phase kinase-associated protein 2 (p45)"""			8646875	Standard	NM_005983		Approved	FBXL1, FBL1, p45	uc003jkc.2	Q13309	OTTHUMG00000131106	ENST00000274255.6:c.484G>T	5.37:g.36166712G>T	ENSP00000274255:p.Ala162Ser	Somatic		Capture	Illumina HiSeq	Phase_I	36202469	NM_032637	A8K5E0|B4DJT4|Q8TDZ0|Q8TDZ1|Q9BV69	Missense_Mutation	SNP	ENST00000274255.6	37	CCDS3916.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709318	0.68615	.	.	ENSG00000145604	ENST00000274254;ENST00000274255;ENST00000308927;ENST00000513151	T;T;T	0.30981	2.4;2.4;1.51	5.91	5.91	0.95273	.	0.176421	0.48286	D	0.000199	T	0.38295	0.1035	M	0.70595	2.14	0.80722	D	1	P;B	0.44946	0.846;0.046	P;B	0.46026	0.501;0.044	T	0.20042	-1.0287	10	0.06891	T	0.86	-24.417	17.2151	0.86941	0.0:0.0:1.0:0.0	.	162;162	Q13309-2;Q13309	.;SKP2_HUMAN	S	162;162;128;162	ENSP00000274254:A162S;ENSP00000274255:A162S;ENSP00000423188:A162S	ENSP00000274254:A162S	A	+	1	0	SKP2	36202469	1.000000	0.71417	0.966000	0.40874	0.966000	0.64601	4.917000	0.63369	2.802000	0.96397	0.655000	0.94253	GCC		0.448	SKP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253769.2	NM_005983	
LIFR	3977	broad.mit.edu	37	5	38493714	38493714	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr5:38493714C>A	ENST00000263409.4	-	14	2221	c.2059G>T	c.(2059-2061)Gaa>Taa	p.E687*	LIFR_ENST00000453190.2_Nonsense_Mutation_p.E687*|LIFR_ENST00000503088.1_5'UTR	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	687	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.E687*(1)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					TTACCAGATTCTATTACAGTT	0.403			T	PLAG1	salivary adenoma																																p.E687X	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2059T	5						.						120.0	114.0	116.0					5																	38493714		2203	4300	6503	38529471	SO:0001587	stop_gained	3977	exon14			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2059G>T	5.37:g.38493714C>A	ENSP00000263409:p.Glu687*	Somatic		Capture	Illumina HiSeq	Phase_I	38529471	NM_001127671	Q6LCD9	Nonsense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	C	36	5.681486	0.96774	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	.	.	.	5.68	4.81	0.61882	.	0.528141	0.23258	N	0.050176	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-23.9418	8.5429	0.33404	0.0:0.8176:0.0:0.1824	.	.	.	.	X	687	.	ENSP00000263409:E687X	E	-	1	0	LIFR	38529471	0.862000	0.29867	0.752000	0.31206	0.086000	0.17979	1.578000	0.36525	1.527000	0.49086	0.591000	0.81541	GAA		0.403	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
PRKAA1	5562	broad.mit.edu	37	5	40798229	40798229	+	Silent	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr5:40798229C>T	ENST00000397128.2	-	1	71	c.63G>A	c.(61-63)cgG>cgA	p.R21R	PRKAA1_ENST00000296800.4_Silent_p.R12R|PRKAA1_ENST00000354209.3_Silent_p.R21R	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	21					activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)	p.R21R(1)		breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	CGATCTTCACCCGCCCGTCGT	0.667																																					p.R21R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G63A	5						.						57.0	75.0	69.0					5																	40798229		2201	4300	6501	40833986	SO:0001819	synonymous_variant	5562	exon1				CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.63G>A	5.37:g.40798229C>T		Somatic		Capture	Illumina HiSeq	Phase_I	40833986	NM_006251	A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Silent	SNP	ENST00000397128.2	37	CCDS3932.2																																																																																				0.667	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253833.2	NM_006251	
BDP1	55814	broad.mit.edu	37	5	70757680	70757680	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr5:70757680C>T	ENST00000358731.4	+	3	789	c.526C>T	c.(526-528)Cag>Tag	p.Q176*	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	176	Interaction with ZBTB43.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.Q176*(1)		NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AAATGAAAGTCAGAGGCCACC	0.289																																					p.Q176X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C526T	5						.						79.0	83.0	82.0					5																	70757680		1885	4119	6004	70793436	SO:0001587	stop_gained	55814	exon3			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.526C>T	5.37:g.70757680C>T	ENSP00000351575:p.Gln176*	Somatic		Capture	Illumina HiSeq	Phase_I	70793436	NM_018429	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Nonsense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	C	40	7.985195	0.98596	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000444711	.	.	.	5.34	5.34	0.76211	.	0.384181	0.27941	N	0.017236	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	9.5949	0.39567	0.1573:0.6905:0.1522:0.0	.	.	.	.	X	176	.	ENSP00000351575:Q176X	Q	+	1	0	BDP1	70793436	0.061000	0.20836	1.000000	0.80357	0.994000	0.84299	0.745000	0.26259	2.651000	0.90000	0.557000	0.71058	CAG		0.289	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
APC	324	broad.mit.edu	37	5	112175351	112175351	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr5:112175351delT	ENST00000457016.1	+	16	4440	c.4060delT	c.(4060-4062)tttfs	p.F1354fs	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.F1354fs|APC_ENST00000257430.4_Frame_Shift_Del_p.F1354fs			P25054	APC_HUMAN	adenomatous polyposis coli	1354	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1355fs*18(3)|p.S1355fs*60(2)|p.E1353fs*19(1)|p.?(1)|p.K1192fs*3(1)|p.S1355fs*19(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGCTGTTGAATTTTCTTCAGG	0.483		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.F1336fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Missense,-2 	.	9	Deletion - Frameshift(8)|Unknown(1)	large_intestine(7)|soft_tissue(1)|skin(1)	c.4006delT	5						.						63.0	66.0	65.0					5																	112175351		2202	4300	6502	112203250	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4060delT	5.37:g.112175351delT	ENSP00000413133:p.Phe1354fs	Somatic		Capture	Illumina HiSeq	Phase_I	112203250	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.483	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SLC34A1	6569	broad.mit.edu	37	5	176825152	176825152	+	Silent	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr5:176825152C>T	ENST00000324417.5	+	13	1876	c.1785C>T	c.(1783-1785)cgC>cgT	p.R595R	SLC34A1_ENST00000513614.1_3'UTR	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	595					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.R595R(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCATCACCCGCGCCACCCTAT	0.677																																					p.R595R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1785T	5						.						44.0	47.0	46.0					5																	176825152		2203	4300	6503	176757758	SO:0001819	synonymous_variant	6569	exon13			L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.1785C>T	5.37:g.176825152C>T		Somatic		Capture	Illumina HiSeq	Phase_I	176757758	NM_003052	B4DPE3	Silent	SNP	ENST00000324417.5	37	CCDS4418.1																																																																																				0.677	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052	
GJA1	2697	broad.mit.edu	37	6	121769078	121769078	+	Missense_Mutation	SNP	G	G	A	rs2227885		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr6:121769078G>A	ENST00000282561.3	+	2	1242	c.1085G>A	c.(1084-1086)cGa>cAa	p.R362Q		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	362			R -> Q (in HLHS1 and AVSD3; associated with Gln-376 in one individual with atrioventricular septal defect; abolishes phosphorylation by PKA and PKC; dbSNP:rs2227885). {ECO:0000269|PubMed:11470490}.		adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)	p.R362Q(1)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	GTGGACCAGCGACCTTCAAGC	0.488													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17974	0.0		0.0	False		,,,				2504	0.0				p.R362Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1085A	6	GRCh37	CM014191	GJA1	M	rs2227885	.						65.0	70.0	68.0					6																	121769078		2201	4295	6496	121810777	SO:0001583	missense	2697	exon2			BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.1085G>A	6.37:g.121769078G>A	ENSP00000282561:p.Arg362Gln	Somatic		Capture	Illumina HiSeq	Phase_I	121810777	NM_000165	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999333	0.74818	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.84800	-1.9	4.75	3.88	0.44766	.	0.072279	0.49916	D	0.000127	T	0.79329	0.4427	L	0.27053	0.805	0.49051	A	0.999741	D	0.60575	0.988	P	0.57057	0.812	T	0.82319	-0.0516	9	0.54805	T	0.06	.	13.2872	0.60249	0.0768:0.0:0.9232:0.0	.	362	P17302	CXA1_HUMAN	Q	346;362	ENSP00000282561:R362Q	ENSP00000282561:R362Q	R	+	2	0	GJA1	121810777	1.000000	0.71417	0.976000	0.42696	0.959000	0.62525	7.258000	0.78371	1.365000	0.46057	0.484000	0.47621	CGA		0.488	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
TAAR5	9038	broad.mit.edu	37	6	132910100	132910100	+	Silent	SNP	C	C	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr6:132910100C>A	ENST00000258034.2	-	1	777	c.726G>T	c.(724-726)ggG>ggT	p.G242G		NM_003967.2	NP_003958.2	O14804	TAAR5_HUMAN	trace amine associated receptor 5	242					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|trimethylamine receptor activity (GO:1990081)	p.G242G(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	32	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		GCTTGGCAGCCCCAGCCAGGC	0.517																																					p.G242G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G726T	6						.						46.0	47.0	46.0					6																	132910100		2203	4300	6503	132951793	SO:0001819	synonymous_variant	9038	exon1			AF021818	CCDS5156.1	6q23.2	2012-08-08			ENSG00000135569	ENSG00000135569		"""GPCR / Class A : Trace amine associated receptors"""	30236	protein-coding gene	gene with protein product		607405				9464258, 15718104	Standard	NM_003967		Approved	PNR	uc003qdk.2	O14804	OTTHUMG00000015581	ENST00000258034.2:c.726G>T	6.37:g.132910100C>A		Somatic		Capture	Illumina HiSeq	Phase_I	132951793	NM_003967	D8KZS1|Q2M1V1|Q4VBL1|Q5VUQ3|Q6NTA8	Silent	SNP	ENST00000258034.2	37	CCDS5156.1																																																																																				0.517	TAAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042257.1	NM_003967	
TIAM2	26230	broad.mit.edu	37	6	155451237	155451237	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr6:155451237T>C	ENST00000461783.3	+	6	2153	c.880T>C	c.(880-882)Tct>Cct	p.S294P	TIAM2_ENST00000318981.5_Missense_Mutation_p.S294P|TIAM2_ENST00000529824.2_Missense_Mutation_p.S294P|TIAM2_ENST00000456144.1_Missense_Mutation_p.S294P|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000360366.4_Missense_Mutation_p.S294P			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	294					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S294P(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CAACCAAAGCTCTTCCCTCTC	0.602																																					p.S294P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T880C	6						.						61.0	57.0	58.0					6																	155451237		2203	4300	6503	155492929	SO:0001583	missense	26230	exon3				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.880T>C	6.37:g.155451237T>C	ENSP00000437188:p.Ser294Pro	Somatic		Capture	Illumina HiSeq	Phase_I	155492929	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	T	14.60	2.583507	0.46006	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.05855	3.51;3.38;3.46;3.51;3.51;3.46	5.23	0.0582	0.14326	.	0.477030	0.23314	N	0.049538	T	0.03564	0.0102	M	0.63428	1.95	0.80722	D	1	P	0.44478	0.836	B	0.37989	0.262	T	0.38779	-0.9645	10	0.66056	D	0.02	.	14.5235	0.67870	0.0:0.0:0.6063:0.3937	.	294	Q8IVF5	TIAM2_HUMAN	P	294;540;294;294;294;294;294	ENSP00000437188:S294P;ENSP00000434901:S294P;ENSP00000407746:S294P;ENSP00000327315:S294P;ENSP00000353528:S294P;ENSP00000433348:S294P	ENSP00000327315:S294P	S	+	1	0	TIAM2	155492929	0.993000	0.37304	0.544000	0.28141	0.610000	0.37248	0.645000	0.24782	-0.151000	0.11176	-0.316000	0.08728	TCT		0.602	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
DSP	1832	broad.mit.edu	37	6	7583049	7583049	+	Missense_Mutation	SNP	C	C	T	rs550818559	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr6:7583049C>T	ENST00000379802.3	+	24	5895	c.5554C>T	c.(5554-5556)Cgc>Tgc	p.R1852C	DSP_ENST00000418664.2_Missense_Mutation_p.R1253C	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1852	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.R1852C(2)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GGTGAAACAGCGCCTGGAGTG	0.478													C|||	3	0.000599042	0.0	0.0	5008	,	,		18641	0.0		0.0	False		,,,				2504	0.0031				p.R1253C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C3757T	6						.						97.0	99.0	98.0					6																	7583049		2203	4300	6503	7528048	SO:0001583	missense	1832	exon24			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.5554C>T	6.37:g.7583049C>T	ENSP00000369129:p.Arg1852Cys	Somatic		Capture	Illumina HiSeq	Phase_I	7528048	NM_001008844	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172043	0.78452	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.64803	-0.12;-0.12	5.2	5.2	0.72013	.	0.000000	0.56097	D	0.000027	T	0.67627	0.2913	L	0.43152	1.355	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.68621	0.924;0.959	T	0.68864	-0.5296	10	0.51188	T	0.08	.	18.7596	0.91845	0.0:1.0:0.0:0.0	.	1300;1852	Q4LE79;P15924	.;DESP_HUMAN	C	1852;1253	ENSP00000369129:R1852C;ENSP00000396591:R1253C	ENSP00000369129:R1852C	R	+	1	0	DSP	7528048	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.818000	0.86416	2.410000	0.81850	0.650000	0.86243	CGC		0.478	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
PRRC2A	7916	broad.mit.edu	37	6	31599689	31599689	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr6:31599689G>A	ENST00000376033.2	+	16	3473	c.3239G>A	c.(3238-3240)cGa>cAa	p.R1080Q	PRRC2A_ENST00000376007.4_Missense_Mutation_p.R1080Q	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1080	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R1080Q(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CCTGCTCCCCGAGGCCGCACT	0.652																																					p.R1080Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3239A	6						.						25.0	25.0	25.0					6																	31599689		1508	2707	4215	31707668	SO:0001583	missense	7916	exon16			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3239G>A	6.37:g.31599689G>A	ENSP00000365201:p.Arg1080Gln	Somatic		Capture	Illumina HiSeq	Phase_I	31707668	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.06|12.06	1.824610|1.824610	0.32237|0.32237	.|.	.|.	ENSG00000204469|ENSG00000204469	ENST00000424184;ENST00000435052|ENST00000376007;ENST00000376033;ENST00000376010	.|T;T	.|0.02032	.|4.49;4.49	5.04|5.04	5.04|5.04	0.67666|0.67666	.|.	.|0.000000	.|0.43260	.|D	.|0.000588	T|T	0.03739|0.03739	0.0106|0.0106	L|L	0.57536|0.57536	1.79|1.79	0.38202|0.38202	D|D	0.940219|0.940219	.|D	.|0.69078	.|0.997	.|P	.|0.56474	.|0.799	T|T	0.24835|0.24835	-1.0149|-1.0149	6|10	0.87932|0.87932	D|D	0|0	-7.2979|-7.2979	11.3974|11.3974	0.49849|0.49849	0.0865:0.0:0.9135:0.0|0.0865:0.0:0.9135:0.0	.|.	.|1080	.|P48634	.|PRC2A_HUMAN	K|Q	1079;1068|1080;1080;305	.|ENSP00000365175:R1080Q;ENSP00000365201:R1080Q	ENSP00000407986:E1079K|ENSP00000365175:R1080Q	E|R	+|+	1|2	0|0	PRRC2A|PRRC2A	31707668|31707668	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.640000|6.640000	0.74319|0.74319	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.652	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
TCTE1	202500	broad.mit.edu	37	6	44253953	44253953	+	Silent	SNP	C	C	T	rs201345272		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr6:44253953C>T	ENST00000371505.4	-	3	716	c.594G>A	c.(592-594)ccG>ccA	p.P198P	TCTE1_ENST00000371503.3_Silent_p.P45P|TCTE1_ENST00000371504.1_Silent_p.P45P|RP11-444E17.6_ENST00000505802.1_Intron|TMEM151B_ENST00000438774.2_Intron	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	198								p.P198P(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GCTGCACCGGCGGAAGGAACT	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		17855	0.001		0.0	False		,,,				2504	0.0				p.P198P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G594A	6						.						41.0	42.0	42.0					6																	44253953		2203	4300	6503	44361931	SO:0001819	synonymous_variant	202500	exon3			BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.594G>A	6.37:g.44253953C>T		Somatic		Capture	Illumina HiSeq	Phase_I	44361931	NM_182539	B4DX59|Q8IYS6	Silent	SNP	ENST00000371505.4	37	CCDS4910.1																																																																																				0.662	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040736.1	NM_182539	
ANKRD6	22881	broad.mit.edu	37	6	90340477	90340477	+	Silent	SNP	A	A	C			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr6:90340477A>C	ENST00000522441.1	+	16	2579	c.1938A>C	c.(1936-1938)ccA>ccC	p.P646P	ANKRD6_ENST00000339746.4_Silent_p.P646P|LYRM2_ENST00000520441.1_Intron|ANKRD6_ENST00000369408.5_Silent_p.P611P|ANKRD6_ENST00000520793.1_Silent_p.P582P|ANKRD6_ENST00000447838.2_Silent_p.P641P	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	646					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P646P(1)		NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		GGCAGCCGCCACCAGCCACAG	0.587																																					p.P641P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1923C	6						.						26.0	30.0	29.0					6																	90340477		2068	4210	6278	90397198	SO:0001819	synonymous_variant	22881	exon16			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.1938A>C	6.37:g.90340477A>C		Somatic		Capture	Illumina HiSeq	Phase_I	90397198	NM_014942	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Silent	SNP	ENST00000522441.1	37	CCDS56441.1																																																																																				0.587	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376594.1		
MDN1	23195	broad.mit.edu	37	6	90357839	90357839	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr6:90357839T>G	ENST00000369393.3	-	99	16422	c.16307A>C	c.(16306-16308)cAc>cCc	p.H5436P	MDN1_ENST00000428876.1_Missense_Mutation_p.H5436P			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5436	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.H5436P(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ATGAAATGGGTGTAACAGCTT	0.403																																					p.H5436P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A16307C	6						.						111.0	108.0	109.0					6																	90357839		2203	4300	6503	90414560	SO:0001583	missense	23195	exon99			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.16307A>C	6.37:g.90357839T>G	ENSP00000358400:p.His5436Pro	Somatic		Capture	Illumina HiSeq	Phase_I	90414560	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	15.50	2.851062	0.51270	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.21932	1.98;1.98	6.17	6.17	0.99709	von Willebrand factor, type A (2);	0.000000	0.85682	D	0.000000	T	0.50701	0.1631	M	0.92923	3.36	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.62950	-0.6745	10	0.62326	D	0.03	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	5436	Q9NU22	MDN1_HUMAN	P	5436	ENSP00000358400:H5436P;ENSP00000413970:H5436P	ENSP00000358400:H5436P	H	-	2	0	MDN1	90414560	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.671000	0.83941	2.371000	0.80710	0.533000	0.62120	CAC		0.403	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
SLC22A1	6580	broad.mit.edu	37	6	160564677	160564677	+	Missense_Mutation	SNP	G	G	A	rs34295611	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr6:160564677G>A	ENST00000366963.4	+	8	1528	c.1381G>A	c.(1381-1383)Gtc>Atc	p.V461I	SLC22A1_ENST00000457470.2_Missense_Mutation_p.V461I|SLC22A1_ENST00000324965.4_Missense_Mutation_p.V461I	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	461			V -> I (no changes in the MPP uptake; when associated with V-408; dbSNP:rs34295611). {ECO:0000269|PubMed:12719534}.		dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)	p.V461I(1)	SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	CCCCACATTCGTCAGGTGAGT	0.498													G|||	15	0.00299521	0.0113	0.0	5008	,	,		21738	0.0		0.0	False		,,,				2504	0.0				p.V461I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1381A	6						.	G	ILE/VAL,ILE/VAL	40,4366	43.8+/-77.6	2,36,2165	147.0	112.0	124.0		1381,1381	-8.6	0.9	6	dbSNP_126	124	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	SLC22A1	NM_003057.2,NM_153187.1	29,29	2,38,6463	AA,AG,GG		0.0233,0.9079,0.3229	benign,benign	461/555,461/507	160564677	42,12964	2203	4300	6503	160484667	SO:0001583	missense	6580	exon8			U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.1381G>A	6.37:g.160564677G>A	ENSP00000355930:p.Val461Ile	Somatic		Capture	Illumina HiSeq	Phase_I	160484667	NM_003057	A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	Missense_Mutation	SNP	ENST00000366963.4	37	CCDS5274.1	9	0.004120879120879121	9	0.018292682926829267	0	0.0	0	0.0	0	0.0	G	0.011	-1.695410	0.00731	0.009079	2.33E-4	ENSG00000175003	ENST00000366963;ENST00000324965;ENST00000457470	T;T;T	0.76578	-1.03;0.32;0.32	5.54	-8.63	0.00878	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.681013	0.14416	N	0.320992	T	0.22085	0.0532	N	0.04162	-0.26	0.28579	N	0.910242	B;B	0.15141	0.003;0.012	B;B	0.15052	0.007;0.012	T	0.42396	-0.9454	10	0.06891	T	0.86	.	11.2824	0.49203	0.3104:0.1838:0.5059:0.0	rs34295611;rs45573733;rs56731613	461;461	O15245-2;O15245	.;S22A1_HUMAN	I	461	ENSP00000355930:V461I;ENSP00000318103:V461I;ENSP00000409557:V461I	ENSP00000318103:V461I	V	+	1	0	SLC22A1	160484667	0.000000	0.05858	0.906000	0.35671	0.082000	0.17680	-0.865000	0.04250	-1.296000	0.02353	-0.300000	0.09419	GTC		0.498	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042938.2		
GIGYF1	64599	broad.mit.edu	37	7	100285610	100285610	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr7:100285610C>A	ENST00000275732.5	-	2	1368	c.159G>T	c.(157-159)gaG>gaT	p.E53D	GIGYF1_ENST00000471340.2_5'UTR	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	53					insulin-like growth factor receptor signaling pathway (GO:0048009)			p.E53D(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CCACCTTGTTCTCCTTGACGT	0.637																																					p.E53D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G159T	7						.						118.0	110.0	112.0					7																	100285610		2203	4300	6503	100123546	SO:0001583	missense	64599	exon2			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.159G>T	7.37:g.100285610C>A	ENSP00000275732:p.Glu53Asp	Somatic		Capture	Illumina HiSeq	Phase_I	100123546	NM_022574	Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	ENST00000275732.5	37	CCDS34708.1	.	.	.	.	.	.	.	.	.	.	.	11.97	1.797477	0.31777	.	.	ENSG00000146830	ENST00000275732	D	0.81908	-1.55	5.01	4.13	0.48395	.	0.060819	0.64402	D	0.000004	T	0.52058	0.1711	N	0.00788	-1.185	0.41120	D	0.9858	B	0.18166	0.026	B	0.12837	0.008	T	0.57266	-0.7841	10	0.02654	T	1	-24.9264	11.2588	0.49069	0.0:0.9116:0.0:0.0884	.	53	O75420	PERQ1_HUMAN	D	53	ENSP00000275732:E53D	ENSP00000275732:E53D	E	-	3	2	GIGYF1	100123546	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	0.815000	0.27253	1.342000	0.45619	0.563000	0.77884	GAG		0.637	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347205.2	NM_022574	
PUS7	54517	broad.mit.edu	37	7	105135650	105135650	+	Missense_Mutation	SNP	C	C	T	rs143361545		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr7:105135650C>T	ENST00000356362.2	-	6	995	c.781G>A	c.(781-783)Gta>Ata	p.V261I	PUS7_ENST00000469408.1_Missense_Mutation_p.V261I	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	261					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.V261I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						TTATATAGTACGAAGTGGCAG	0.318																																					p.V261I	Colon(138;2387 3051 17860)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G781A	7						.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	220.0	225.0	223.0		781	4.3	0.7	7	dbSNP_134	223	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PUS7	NM_019042.3	29	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	261/662	105135650	3,13003	2203	4300	6503	104922886	SO:0001583	missense	54517	exon6			AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.781G>A	7.37:g.105135650C>T	ENSP00000348722:p.Val261Ile	Somatic		Capture	Illumina HiSeq	Phase_I	104922886	NM_019042	Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	CCDS34725.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.155135|4.155135	0.78114|0.78114	2.27E-4|2.27E-4	2.33E-4|2.33E-4	ENSG00000091127|ENSG00000091127	ENST00000482157|ENST00000356362;ENST00000544995;ENST00000469408	.|T;T	.|0.41758	.|0.99;0.99	5.21|5.21	4.32|4.32	0.51571|0.51571	.|Pseudouridine synthase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.61652|0.61652	0.2364|0.2364	M|M	0.68593|0.68593	2.085|2.085	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.75484	.|0.979;0.986	T|T	0.62544|0.62544	-0.6832|-0.6832	5|10	.|0.42905	.|T	.|0.14	-21.5856|-21.5856	14.9969|14.9969	0.71439|0.71439	0.0:0.857:0.143:0.0|0.0:0.857:0.143:0.0	.|.	.|261;261	.|B3KY42;Q96PZ0	.|.;PUS7_HUMAN	H|I	101|261	.|ENSP00000348722:V261I;ENSP00000417402:V261I	.|ENSP00000348722:V261I	R|V	-|-	2|1	0|0	PUS7|PUS7	104922886|104922886	1.000000|1.000000	0.71417|0.71417	0.668000|0.668000	0.29813|0.29813	0.753000|0.753000	0.42808|0.42808	3.633000|3.633000	0.54295|0.54295	1.175000|1.175000	0.42826|0.42826	0.650000|0.650000	0.86243|0.86243	CGT|GTA		0.318	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042	
ZC3HAV1	56829	broad.mit.edu	37	7	138732457	138732457	+	Missense_Mutation	SNP	G	G	C	rs3735008	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr7:138732457G>C	ENST00000242351.5	-	13	2908	c.2592C>G	c.(2590-2592)ttC>ttG	p.F864L	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.F986L	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	864	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.F864L(1)		cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						CACAGCTGTCGAACTGTGGAG	0.428																																					p.F864L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2592G	7						.						153.0	149.0	150.0					7																	138732457		2203	4300	6503	138382997	SO:0001583	missense	56829	exon13			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.2592C>G	7.37:g.138732457G>C	ENSP00000242351:p.Phe864Leu	Somatic		Capture	Illumina HiSeq	Phase_I	138382997	NM_020119	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	37	CCDS5851.1	.	.	.	.	.	.	.	.	.	.	G	7.242	0.601467	0.13939	.	.	ENSG00000105939	ENST00000242351;ENST00000464606	T;T	0.13538	2.58;2.58	5.23	0.151	0.14888	Poly(ADP-ribose) polymerase, catalytic domain (2);	1.084410	0.07173	N	0.852778	T	0.16557	0.0398	M	0.64170	1.965	0.58432	P	1.0000000000287557E-6	B	0.06786	0.001	B	0.08055	0.003	T	0.29610	-1.0006	9	0.66056	D	0.02	.	9.0152	0.36166	0.4883:0.0:0.5117:0.0	.	864	Q7Z2W4	ZCCHV_HUMAN	L	864;986	ENSP00000242351:F864L;ENSP00000418385:F986L	ENSP00000242351:F864L	F	-	3	2	ZC3HAV1	138382997	0.832000	0.29368	0.034000	0.17996	0.003000	0.03518	0.014000	0.13333	-0.118000	0.11851	0.555000	0.69702	TTC		0.428	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
FAM126A	84668	broad.mit.edu	37	7	22985641	22985641	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr7:22985641C>T	ENST00000432176.2	-	11	1365	c.1133G>A	c.(1132-1134)gGa>gAa	p.G378E	FAM126A_ENST00000498833.1_5'UTR|FAM126A_ENST00000409923.1_3'UTR	NM_032581.3	NP_115970.2	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	378					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)	p.G378E(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|urinary_tract(2)	23						GTGGTTCTTTCCTATACTTGG	0.433																																					p.G378E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1133A	7						.						129.0	137.0	134.0					7																	22985641		2203	4300	6503	22952166	SO:0001583	missense	84668	exon11			BC018710	CCDS5377.1	7p15.3	2008-10-02			ENSG00000122591	ENSG00000122591			24587	protein-coding gene	gene with protein product	"""down regulated by Ctnnb1, a"""	610531				10910037, 16951682	Standard	NM_032581		Approved	DRCTNNB1A, HCC, HYCC1, hyccin	uc003svm.4	Q9BYI3	OTTHUMG00000128435	ENST00000432176.2:c.1133G>A	7.37:g.22985641C>T	ENSP00000403396:p.Gly378Glu	Somatic		Capture	Illumina HiSeq	Phase_I	22952166	NM_032581	A4D145|Q6N010|Q75MR4|Q7LDZ4|Q96MX1|Q96NQ6	Missense_Mutation	SNP	ENST00000432176.2	37	CCDS5377.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982759	0.74474	.	.	ENSG00000122591	ENST00000432176	T	0.78246	-1.16	6.17	6.17	0.99709	.	0.093830	0.85682	D	0.000000	D	0.85915	0.5808	L	0.53249	1.67	0.80722	D	1	D	0.76494	0.999	D	0.63597	0.916	D	0.84743	0.0752	10	0.56958	D	0.05	-5.789	20.8794	0.99867	0.0:1.0:0.0:0.0	.	378	Q9BYI3	HYCCI_HUMAN	E	378	ENSP00000403396:G378E	ENSP00000403396:G378E	G	-	2	0	FAM126A	22952166	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.180000	0.58296	2.941000	0.99782	0.655000	0.94253	GGA		0.433	FAM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250230.1	NM_032581	
HOXA11	3207	broad.mit.edu	37	7	27222618	27222618	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr7:27222618G>A	ENST00000006015.3	-	2	810	c.739C>T	c.(739-741)Ccc>Tcc	p.P247S	RP1-170O19.20_ENST00000470747.4_5'Flank|HOXA11-AS_ENST00000522863.1_RNA|HOXA10_ENST00000396344.4_5'Flank|HOXA11-AS_ENST00000520395.1_RNA|HOXA11-AS_ENST00000520360.1_RNA|HOXA11-AS_ENST00000522674.1_RNA	NM_005523.5	NP_005514.1	P31270	HXA11_HUMAN	homeobox A11	247					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal joint morphogenesis (GO:0060272)|male gonad development (GO:0008584)|mesodermal cell fate specification (GO:0007501)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)	nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)	p.P247S(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	16						TTGGTATAGGGGCAGCGCTTT	0.572			T	NUP98	CML																																p.P247S			Dom	yes		7	7p15-p14.2	3207	homeo box A11		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C739T	7						.						82.0	80.0	80.0					7																	27222618		2203	4300	6503	27189143	SO:0001583	missense	3207	exon2				CCDS5411.1	7p15.2	2014-09-17	2005-12-22		ENSG00000005073	ENSG00000005073		"""Homeoboxes / ANTP class : HOXL subclass"""	5101	protein-coding gene	gene with protein product		142958	"""homeo box A11"""	HOX1I, HOX1		1973146, 1358459	Standard	NM_005523		Approved		uc003syx.3	P31270	OTTHUMG00000023437	ENST00000006015.3:c.739C>T	7.37:g.27222618G>A	ENSP00000006015:p.Pro247Ser	Somatic		Capture	Illumina HiSeq	Phase_I	27189143	NM_005523	A4D190	Missense_Mutation	SNP	ENST00000006015.3	37	CCDS5411.1	.	.	.	.	.	.	.	.	.	.	G	31	5.092519	0.94149	.	.	ENSG00000005073	ENST00000006015	D	0.95853	-3.83	5.91	5.91	0.95273	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.061993	0.64402	D	0.000003	D	0.97108	0.9055	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97321	0.9944	10	0.87932	D	0	.	20.3052	0.98627	0.0:0.0:1.0:0.0	.	247	P31270	HXA11_HUMAN	S	247	ENSP00000006015:P247S	ENSP00000006015:P247S	P	-	1	0	HOXA11	27189143	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.808000	0.96608	0.655000	0.94253	CCC		0.572	HOXA11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358754.1		
NT5C3A	51251	broad.mit.edu	37	7	33060942	33060942	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr7:33060942C>T	ENST00000242210.7	-	5	473	c.397G>A	c.(397-399)Gct>Act	p.A133T	NT5C3A_ENST00000381626.2_Missense_Mutation_p.A82T|NT5C3A_ENST00000409467.1_Missense_Mutation_p.A82T|NT5C3A_ENST00000405342.1_Missense_Mutation_p.A94T|NT5C3A_ENST00000396152.2_Missense_Mutation_p.A94T|NT5C3A_ENST00000409787.1_Missense_Mutation_p.A94T|NT5C3A_ENST00000610140.1_Missense_Mutation_p.A128T|AVL9_ENST00000404479.1_Intron	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	133					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.A133T(1)									ACTTCAATAGCGTAATATTTT	0.294																																					p.A94T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G280A	7						.						97.0	98.0	98.0					7																	33060942		2202	4295	6497	33027467	SO:0001583	missense	51251	exon6			AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.397G>A	7.37:g.33060942C>T	ENSP00000242210:p.Ala133Thr	Somatic		Capture	Illumina HiSeq	Phase_I	33027467	NM_016489	A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Missense_Mutation	SNP	ENST00000242210.7	37	CCDS34616.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.256138	0.59321	.	.	ENSG00000122643	ENST00000381626;ENST00000396152;ENST00000242210;ENST00000405342;ENST00000409467;ENST00000409787	D;D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5;-1.5	5.68	3.87	0.44632	HAD-like domain (1);	0.156736	0.56097	D	0.000021	T	0.76018	0.3929	L	0.50919	1.6	0.53688	D	0.999976	D;P	0.54772	0.968;0.593	B;B	0.42555	0.391;0.09	T	0.77197	-0.2676	10	0.87932	D	0	.	12.6006	0.56494	0.1316:0.742:0.1264:0.0	.	133;94	Q9H0P0;Q9H0P0-1	5NT3_HUMAN;.	T	82;94;133;94;82;94	ENSP00000371039:A82T;ENSP00000379456:A94T;ENSP00000242210:A133T;ENSP00000385261:A94T;ENSP00000387166:A82T;ENSP00000387205:A94T	ENSP00000242210:A133T	A	-	1	0	NT5C3	33027467	0.996000	0.38824	0.975000	0.42487	0.820000	0.46376	2.845000	0.48254	0.746000	0.32786	0.655000	0.94253	GCT		0.294	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328880.1	NM_016489	
CDK14	5218	broad.mit.edu	37	7	90613545	90613545	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr7:90613545C>T	ENST00000380050.3	+	10	1161	c.1030C>T	c.(1030-1032)Cga>Tga	p.R344*	CDK14_ENST00000265741.3_Nonsense_Mutation_p.R326*|CDK14_ENST00000406263.1_Nonsense_Mutation_p.R298*|CDK14_ENST00000436577.2_Nonsense_Mutation_p.R215*			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	344	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.R326*(1)		breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						TCAACTTGAACGAATATTTCT	0.358																																					p.R326X	GBM(83;1228 1256 8311 16577 31299)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C976T	7						.						137.0	133.0	134.0					7																	90613545		2203	4300	6503	90451481	SO:0001587	stop_gained	5218	exon9				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.1030C>T	7.37:g.90613545C>T	ENSP00000369390:p.Arg344*	Somatic		Capture	Illumina HiSeq	Phase_I	90451481	NM_012395	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Nonsense_Mutation	SNP	ENST00000380050.3	37		.	.	.	.	.	.	.	.	.	.	C	38	7.002760	0.97994	.	.	ENSG00000058091	ENST00000380050;ENST00000265741;ENST00000406263;ENST00000436577	.	.	.	5.33	3.42	0.39159	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	-8.4791	13.6149	0.62101	0.4656:0.5344:0.0:0.0	.	.	.	.	X	344;326;298;215	.	ENSP00000265741:R326X	R	+	1	2	CDK14	90451481	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.558000	0.36309	0.662000	0.31006	0.655000	0.94253	CGA		0.358	CDK14-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000059970.5	NM_012395	
TRRAP	8295	broad.mit.edu	37	7	98552777	98552777	+	Silent	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr7:98552777G>A	ENST00000359863.4	+	40	5975	c.5766G>A	c.(5764-5766)caG>caA	p.Q1922Q	TRRAP_ENST00000355540.3_Silent_p.Q1904Q|TRRAP_ENST00000446306.3_Silent_p.Q1903Q	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1922					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.Q1922Q(1)|p.Q1904Q(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TCGTCAGACAGGCGATGGCCA	0.572																																					p.Q1904Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G5712A	7						.						57.0	51.0	53.0					7																	98552777		2203	4300	6503	98390713	SO:0001819	synonymous_variant	8295	exon39			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.5766G>A	7.37:g.98552777G>A		Somatic		Capture	Illumina HiSeq	Phase_I	98390713	NM_003496	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	G	9.798	1.179667	0.21787	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.56	-8.12	0.01078	.	.	.	.	.	T	0.65333	0.2681	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71318	-0.4629	4	.	.	.	.	18.3689	0.90400	0.7949:0.0:0.2051:0.0	.	.	.	.	K	1644	.	.	R	+	2	0	TRRAP	98390713	0.318000	0.24598	0.452000	0.26994	0.976000	0.68499	-0.218000	0.09240	-1.601000	0.01601	-0.302000	0.09304	AGG		0.572	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
TRPV6	55503	broad.mit.edu	37	7	142573619	142573619	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr7:142573619C>A	ENST00000359396.3	-	7	1046	c.801G>T	c.(799-801)caG>caT	p.Q267H	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	267					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)	p.Q267H(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					CATACGTCCACTGGGTGTGCT	0.522																																					p.Q267H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G801T	7						.						209.0	158.0	175.0					7																	142573619		2203	4300	6503	142283741	SO:0001583	missense	55503	exon7			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.801G>T	7.37:g.142573619C>A	ENSP00000352358:p.Gln267His	Somatic		Capture	Illumina HiSeq	Phase_I	142283741	NM_018646	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	C	9.631	1.136344	0.21123	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	T	0.45668	0.89	4.96	2.16	0.27623	.	0.069097	0.64402	D	0.000010	T	0.37625	0.1010	M	0.81682	2.555	0.38423	D	0.946225	B	0.27316	0.175	B	0.24269	0.052	T	0.16188	-1.0411	10	0.16420	T	0.52	-25.1862	6.3478	0.21359	0.0:0.6159:0.1423:0.2418	.	267	Q9H1D0	TRPV6_HUMAN	H	267;99	ENSP00000352358:Q267H	ENSP00000310825:Q99H	Q	-	3	2	TRPV6	142283741	1.000000	0.71417	1.000000	0.80357	0.448000	0.32197	1.051000	0.30417	0.531000	0.28639	-0.136000	0.14681	CAG		0.522	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274	
RSPO2	340419	broad.mit.edu	37	8	109094785	109094785	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr8:109094785G>A	ENST00000276659.5	-	2	702	c.82C>T	c.(82-84)Cgc>Tgc	p.R28C	RSPO2_ENST00000517781.1_Missense_Mutation_p.R28C|RSPO2_ENST00000517939.1_5'Flank|RSPO2_ENST00000378439.2_Missense_Mutation_p.R28C	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	28					bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.R28C(3)	EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			CGCTTACTGCGTCTCCATCGG	0.627																																					p.R28C												.	.	3	Substitution - Missense(3)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(1)	c.C82T	8						.						111.0	95.0	100.0					8																	109094785		2203	4300	6503	109163961	SO:0001583	missense	340419	exon2			AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.82C>T	8.37:g.109094785G>A	ENSP00000276659:p.Arg28Cys	Somatic		Capture	Illumina HiSeq	Phase_I	109163961	NM_178565	B3KVP0|Q4G0U4|Q8N6X6	Missense_Mutation	SNP	ENST00000276659.5	37	CCDS6307.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468646	0.63625	.	.	ENSG00000147655	ENST00000517781;ENST00000378439;ENST00000276659;ENST00000521956;ENST00000522333	T;T;T;T;T	0.79247	1.55;1.55;-1.25;-1.25;-1.25	5.57	5.57	0.84162	Growth factor, receptor (1);	0.333064	0.26586	N	0.023556	D	0.86752	0.6008	L	0.60455	1.87	0.53005	D	0.999962	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.87128	0.2195	10	0.66056	D	0.02	-9.5123	19.1489	0.93479	0.0:0.0:1.0:0.0	.	28;28	Q6UXX9;Q6UXX9-3	RSPO2_HUMAN;.	C	28	ENSP00000427937:R28C;ENSP00000367698:R28C;ENSP00000276659:R28C;ENSP00000430010:R28C;ENSP00000430973:R28C	ENSP00000276659:R28C	R	-	1	0	RSPO2	109163961	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.099000	0.71466	2.622000	0.88805	0.591000	0.81541	CGC		0.627	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565	
ZHX1	11244	broad.mit.edu	37	8	124265703	124265703	+	Silent	SNP	A	A	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr8:124265703A>G	ENST00000522655.1	-	3	3024	c.2484T>C	c.(2482-2484)ggT>ggC	p.G828G	ZHX1_ENST00000395571.3_Silent_p.G828G|ZHX1_ENST00000297857.2_Silent_p.G828G|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000522595.1_5'Flank			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	828					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.G828G(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			ATAATTCTATACCTAATTCTG	0.393																																					p.G828G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2484C	8						.						193.0	190.0	191.0					8																	124265703		2203	4300	6503	124334884	SO:0001819	synonymous_variant	11244	exon3			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.2484T>C	8.37:g.124265703A>G		Somatic		Capture	Illumina HiSeq	Phase_I	124334884	NM_001017926	Q8IWD8	Silent	SNP	ENST00000522655.1	37	CCDS6342.1	.	.	.	.	.	.	.	.	.	.	A	5.712	0.315917	0.10789	.	.	ENSG00000165156	ENST00000520474	.	.	.	5.8	-8.85	0.00799	.	.	.	.	.	T	0.34745	0.0908	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46034	-0.9220	4	.	.	.	-15.8436	2.6278	0.04934	0.3437:0.2226:0.0607:0.3731	.	.	.	.	A	513	.	.	V	-	2	0	ZHX1	124334884	0.000000	0.05858	0.695000	0.30226	0.966000	0.64601	-3.802000	0.00362	-0.925000	0.03775	-0.466000	0.05196	GTA		0.393	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381759.1		
TNKS	8658	broad.mit.edu	37	8	9413684	9413684	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr8:9413684C>T	ENST00000310430.6	+	1	261	c.235C>T	c.(235-237)Cga>Tga	p.R79*	RP11-375N15.2_ENST00000607598.1_RNA|TNKS_ENST00000520408.1_Nonsense_Mutation_p.R79*|TNKS_ENST00000522110.1_Nonsense_Mutation_p.R79*	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	79					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)	p.R79*(2)		NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		CGACAGGCCCCGATCCCCGGA	0.701																																					p.R79X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C235T	8						.						23.0	26.0	25.0					8																	9413684		2202	4299	6501	9451094	SO:0001587	stop_gained	8658	exon1			AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.235C>T	8.37:g.9413684C>T	ENSP00000311579:p.Arg79*	Somatic		Capture	Illumina HiSeq	Phase_I	9451094	NM_003747	O95272|Q4G0F2	Nonsense_Mutation	SNP	ENST00000310430.6	37	CCDS5974.1	.	.	.	.	.	.	.	.	.	.	C	34	5.351853	0.95830	.	.	ENSG00000173273	ENST00000520408;ENST00000310430;ENST00000522110	.	.	.	4.84	2.01	0.26516	.	0.123149	0.33457	N	0.004900	.	.	.	.	.	.	0.26366	N	0.976961	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.6253	0.17478	0.3245:0.5507:0.0:0.1248	.	.	.	.	X	79	.	ENSP00000311579:R79X	R	+	1	2	TNKS	9451094	0.020000	0.18652	0.999000	0.59377	0.985000	0.73830	0.272000	0.18644	0.719000	0.32188	-0.169000	0.13324	CGA		0.701	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
TNFRSF10C	8794	broad.mit.edu	37	8	22974405	22974405	+	Missense_Mutation	SNP	C	C	A	rs61736406	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr8:22974405C>A	ENST00000356864.3	+	5	1173	c.641C>A	c.(640-642)aCc>aAc	p.T214N	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.T112N	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	214					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.T214N(7)		endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGACCACCAGCCCG	0.612																																					p.T214N												.	.	7	Substitution - Missense(7)	prostate(4)|large_intestine(3)	c.C641A	8						.						63.0	71.0	68.0					8																	22974405		2203	4298	6501	23030350	SO:0001583	missense	8794	exon5			AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.641C>A	8.37:g.22974405C>A	ENSP00000349324:p.Thr214Asn	Somatic		Capture	Illumina HiSeq	Phase_I	23030350	NM_003841	O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	c	0.310	-0.968378	0.02232	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.61510	0.1;0.39	.	.	.	.	7739.210000	0.00166	N	0.000000	T	0.32164	0.0820	N	0.08118	0	0.09310	N	1	B	0.22909	0.077	B	0.06405	0.002	T	0.16719	-1.0393	9	0.37606	T	0.19	.	5.2848	0.15696	0.3272:0.6728:0.0:0.0	rs61736406	214	O14798	TR10C_HUMAN	N	214;112;214	ENSP00000349324:T214N;ENSP00000437612:T112N	ENSP00000349324:T214N	T	+	2	0	TNFRSF10C	23030350	0.033000	0.19621	0.001000	0.08648	0.141000	0.21300	0.550000	0.23345	-2.089000	0.00860	-2.399000	0.00225	ACC		0.612	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
TACC1	6867	broad.mit.edu	37	8	38678143	38678143	+	Missense_Mutation	SNP	C	C	T	rs368667882		TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr8:38678143C>T	ENST00000317827.4	+	3	1760	c.1381C>T	c.(1381-1383)Cgt>Tgt	p.R461C	TACC1_ENST00000379931.3_Missense_Mutation_p.R461C|TACC1_ENST00000443286.2_Missense_Mutation_p.R477C|TACC1_ENST00000520611.1_5'UTR|TACC1_ENST00000522752.1_Intron|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000520340.1_Missense_Mutation_p.R425C|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000519416.1_Missense_Mutation_p.R266C|TACC1_ENST00000518415.1_Missense_Mutation_p.R416C|TACC1_ENST00000348567.4_Intron|TACC1_ENST00000520973.1_Missense_Mutation_p.R266C|TACC1_ENST00000520615.1_Missense_Mutation_p.R266C	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	461	SPAZ 2.				cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.R461C(2)		breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			GGCAAAGTCGCGTTTAATAAC	0.448																																					p.R461C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1381T	8						.	C	CYS/ARG,CYS/ARG,	0,4406		0,0,2203	105.0	113.0	110.0		796,1381,	5.7	1.0	8		110	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,intron	TACC1	NM_001146216.2,NM_006283.2,NM_001122824.1	180,180,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,	266/611,461/806,	38678143	1,13005	2203	4300	6503	38797300	SO:0001583	missense	6867	exon3			AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.1381C>T	8.37:g.38678143C>T	ENSP00000321703:p.Arg461Cys	Somatic		Capture	Illumina HiSeq	Phase_I	38797300	NM_006283	B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Missense_Mutation	SNP	ENST00000317827.4	37	CCDS6109.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412037	0.83340	0.0	1.16E-4	ENSG00000147526	ENST00000519416;ENST00000520615;ENST00000443388;ENST00000443286;ENST00000518415;ENST00000522904;ENST00000317827;ENST00000379931;ENST00000520973	T;T;T;T;T;T;T;T	0.13901	2.58;2.66;2.78;2.76;2.55;2.81;2.91;2.63	5.69	5.69	0.88448	.	0.060827	0.64402	D	0.000009	T	0.40196	0.1107	M	0.76002	2.32	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.87578	0.998;0.951;0.951;0.925;0.984;0.971;0.981;0.987	T	0.09443	-1.0674	10	0.56958	D	0.05	-7.9593	17.9839	0.89150	0.0:1.0:0.0:0.0	.	266;266;266;477;461;461;266;416	B7Z3G3;E7EVI4;B4DH49;B4E302;O75410-2;O75410;E7ET87;O75410-7	.;.;.;.;.;TACC1_HUMAN;.;.	C	266;266;266;477;416;433;461;461;266	ENSP00000428687:R266C;ENSP00000428450:R266C;ENSP00000393647:R477C;ENSP00000428706:R416C;ENSP00000430355:R433C;ENSP00000321703:R461C;ENSP00000369263:R461C;ENSP00000430959:R266C	ENSP00000321703:R461C	R	+	1	0	TACC1	38797300	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.762000	0.55250	2.669000	0.90835	0.655000	0.94253	CGT		0.448	TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376768.1	NM_006283	
RP1	6101	broad.mit.edu	37	8	55534729	55534729	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr8:55534729G>T	ENST00000220676.1	+	3	816	c.668G>T	c.(667-669)gGa>gTa	p.G223V		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	223	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.G223V(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GTGGCGGCAGGAAGGGAGCCA	0.478																																					p.G223V	Colon(91;1014 1389 7634 14542 40420)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G668T	8						.						66.0	66.0	66.0					8																	55534729		2203	4300	6503	55697282	SO:0001583	missense	6101	exon3			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.668G>T	8.37:g.55534729G>T	ENSP00000220676:p.Gly223Val	Somatic		Capture	Illumina HiSeq	Phase_I	55697282	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239417	0.79800	.	.	ENSG00000104237	ENST00000427058;ENST00000220676	D	0.94537	-3.45	5.55	5.55	0.83447	Doublecortin domain (5);	0.000000	0.56097	D	0.000023	D	0.97791	0.9275	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98356	1.0546	10	0.87932	D	0	.	19.5182	0.95174	0.0:0.0:1.0:0.0	.	33;223	E7EVW9;P56715	.;RP1_HUMAN	V	33;223	ENSP00000220676:G223V	ENSP00000220676:G223V	G	+	2	0	RP1	55697282	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.518000	0.81795	2.603000	0.88011	0.655000	0.94253	GGA		0.478	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
ZFHX4	79776	broad.mit.edu	37	8	77775741	77775741	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr8:77775741C>T	ENST00000521891.2	+	11	10239	c.9791C>T	c.(9790-9792)cCa>cTa	p.P3264L	ZFHX4_ENST00000455469.2_Missense_Mutation_p.P3219L|ZFHX4_ENST00000518282.1_Missense_Mutation_p.P3238L|ZFHX4_ENST00000050961.6_Missense_Mutation_p.P3215L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.P3248L(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAGTTCTTGCCATACTTTATC	0.478										HNSCC(33;0.089)																											p.P3264L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C9791T	8						.						156.0	148.0	151.0					8																	77775741		1904	4128	6032	77938296	SO:0001583	missense	79776	exon11				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9791C>T	8.37:g.77775741C>T	ENSP00000430497:p.Pro3264Leu	Somatic		Capture	Illumina HiSeq	Phase_I	77938296	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747187	0.49257	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.81163	-1.46;-1.34;-1.3;-1.38	4.69	4.69	0.59074	.	0.000000	0.42172	U	0.000751	D	0.89842	0.6832	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91112	0.4923	10	0.87932	D	0	.	18.171	0.89745	0.0:1.0:0.0:0.0	.	3219	Q86UP3-4	.	L	3264;3248;3219;3215;3238	ENSP00000430497:P3264L;ENSP00000399605:P3219L;ENSP00000050961:P3215L;ENSP00000430848:P3238L	ENSP00000050961:P3215L	P	+	2	0	ZFHX4	77938296	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	7.563000	0.82314	2.594000	0.87642	0.655000	0.94253	CCA		0.478	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
INTS8	55656	broad.mit.edu	37	8	95892366	95892366	+	Silent	SNP	A	A	G			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr8:95892366A>G	ENST00000523731.1	+	27	3025	c.2892A>G	c.(2890-2892)acA>acG	p.T964T	CCNE2_ENST00000520509.1_3'UTR|INTS8_ENST00000447247.1_Silent_p.T947T	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	964					snRNA processing (GO:0016180)	integrator complex (GO:0032039)		p.T964T(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					TCGGCCAGACAGAGTTGAATG	0.378																																					p.T964T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2892G	8						.						99.0	98.0	99.0					8																	95892366		2203	4300	6503	95961542	SO:0001819	synonymous_variant	55656	exon27			AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.2892A>G	8.37:g.95892366A>G		Somatic		Capture	Illumina HiSeq	Phase_I	95961542	NM_017864	B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Silent	SNP	ENST00000523731.1	37	CCDS34925.1	.	.	.	.	.	.	.	.	.	.	A	5.640	0.302683	0.10678	.	.	ENSG00000164941	ENST00000520526	.	.	.	6.02	0.602	0.17535	.	.	.	.	.	T	0.42471	0.1204	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27502	-1.0072	4	.	.	.	-12.8136	1.9756	0.03415	0.5611:0.1098:0.1259:0.2032	.	.	.	.	R	769	.	.	Q	+	2	0	INTS8	95961542	0.835000	0.29415	1.000000	0.80357	0.889000	0.51656	0.023000	0.13533	0.508000	0.28173	0.533000	0.62120	CAG		0.378	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1	NM_017864	
KCNQ3	3786	broad.mit.edu	37	8	133141628	133141628	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr8:133141628C>T	ENST00000388996.4	-	15	2920	c.2500G>A	c.(2500-2502)Gcc>Acc	p.A834T	KCNQ3_ENST00000521134.1_Missense_Mutation_p.A714T|KCNQ3_ENST00000519445.1_Missense_Mutation_p.A822T	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	834					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.A834T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TCACCCTCGGCGAGGTACCGC	0.602																																					p.A834T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2500A	8						.						77.0	66.0	70.0					8																	133141628		2203	4300	6503	133210810	SO:0001583	missense	3786	exon15			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.2500G>A	8.37:g.133141628C>T	ENSP00000373648:p.Ala834Thr	Somatic		Capture	Illumina HiSeq	Phase_I	133210810	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	C	32	5.186297	0.94885	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	T;T;T	0.59772	0.24;0.24;0.24	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.72179	0.3428	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.65067	-0.6258	10	0.18276	T	0.48	-22.7798	18.678	0.91535	0.0:1.0:0.0:0.0	.	822;834	E7ET42;O43525	.;KCNQ3_HUMAN	T	834;714;822;811;713	ENSP00000373648:A834T;ENSP00000429799:A714T;ENSP00000428790:A822T	ENSP00000373648:A834T	A	-	1	0	KCNQ3	133210810	1.000000	0.71417	0.976000	0.42696	0.990000	0.78478	7.294000	0.78760	2.669000	0.90835	0.655000	0.94253	GCC		0.602	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
ABCA1	19	broad.mit.edu	37	9	107594980	107594980	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr9:107594980C>T	ENST00000374736.3	-	12	1778	c.1384G>A	c.(1384-1386)Gac>Aac	p.D462N	ABCA1_ENST00000494467.1_5'Flank	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	462					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.D462N(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GCCACGATGTCTTGGGCTGTC	0.493																																					p.D462N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1384A	9						.						204.0	163.0	177.0					9																	107594980		2203	4300	6503	106634801	SO:0001583	missense	19	exon12			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.1384G>A	9.37:g.107594980C>T	ENSP00000363868:p.Asp462Asn	Somatic		Capture	Illumina HiSeq	Phase_I	106634801	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.818324	0.50633	.	.	ENSG00000165029	ENST00000374736	D	0.85013	-1.93	5.82	5.82	0.92795	.	0.046341	0.85682	D	0.000000	T	0.78729	0.4329	L	0.44542	1.39	0.80722	D	1	B	0.09022	0.002	B	0.11329	0.006	T	0.71024	-0.4712	10	0.11794	T	0.64	.	13.308	0.60363	0.0:0.9278:0.0:0.0722	.	462	O95477	ABCA1_HUMAN	N	462	ENSP00000363868:D462N	ENSP00000363868:D462N	D	-	1	0	ABCA1	106634801	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	5.761000	0.68801	2.743000	0.94032	0.563000	0.77884	GAC		0.493	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
OR1J4	26219	broad.mit.edu	37	9	125281980	125281980	+	Silent	SNP	C	C	A			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr9:125281980C>A	ENST00000340750.1	+	1	561	c.561C>A	c.(559-561)ctC>ctA	p.L187L		NM_001004452.1	NP_001004452.1	Q8NGS1	OR1J4_HUMAN	olfactory receptor, family 1, subfamily J, member 4	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L187L(1)		large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	20						TACTCAAGCTCTCATGCTCAG	0.493																																					p.L187L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C561A	9						.						147.0	127.0	134.0					9																	125281980		2203	4300	6503	124321801	SO:0001819	synonymous_variant	26219	exon1			X64979	CCDS35122.1	9q33.2	2013-09-20			ENSG00000239590	ENSG00000239590		"""GPCR / Class A : Olfactory receptors"""	8211	protein-coding gene	gene with protein product						1370859	Standard	NM_001004452		Approved	HTPCRX01, HSHTPCRX01	uc011lyw.2	Q8NGS1	OTTHUMG00000020606	ENST00000340750.1:c.561C>A	9.37:g.125281980C>A		Somatic		Capture	Illumina HiSeq	Phase_I	124321801	NM_001004452	A3KFM0|Q6IEZ3|Q96R89	Silent	SNP	ENST00000340750.1	37	CCDS35122.1																																																																																				0.493	OR1J4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053936.1		
OR1L8	138881	broad.mit.edu	37	9	125330268	125330268	+	Silent	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr9:125330268C>T	ENST00000304865.2	-	1	570	c.489G>A	c.(487-489)ctG>ctA	p.L163L		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L163L(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						GACGATTCAGCAGAAGTGTGT	0.507																																					p.L163L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G489A	9						.						149.0	111.0	124.0					9																	125330268		2203	4300	6503	124370089	SO:0001819	synonymous_variant	138881	exon1				CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.489G>A	9.37:g.125330268C>T		Somatic		Capture	Illumina HiSeq	Phase_I	124370089	NM_001004454	A3KFM3|B9EIR6|Q6IF15|Q96R79	Silent	SNP	ENST00000304865.2	37	CCDS35124.1																																																																																				0.507	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053939.1		
DAPK1	1612	broad.mit.edu	37	9	90219963	90219963	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr9:90219963C>T	ENST00000408954.3	+	3	492	c.157C>T	c.(157-159)Cgg>Tgg	p.R53W	DAPK1_ENST00000358077.5_Missense_Mutation_p.R53W|DAPK1_ENST00000472284.1_Missense_Mutation_p.R53W|DAPK1_ENST00000469640.2_Missense_Mutation_p.R53W|DAPK1_ENST00000491893.1_Missense_Mutation_p.R53W	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	53	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R53W(2)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TAAGTCCAGCCGGCGGGGTGT	0.547									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.R53W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C157T	9						.						48.0	51.0	50.0					9																	90219963		2175	4288	6463	89409783	SO:0001583	missense	1612	exon3	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.157C>T	9.37:g.90219963C>T	ENSP00000386135:p.Arg53Trp	Somatic		Capture	Illumina HiSeq	Phase_I	89409783	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	ENST00000408954.3	37	CCDS43842.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825448	0.90955	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.04	4.14	0.48551	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43579	D	0.000554	T	0.74344	0.3704	L	0.56340	1.77	0.80722	D	1	D;D;D	0.89917	0.997;0.977;1.0	P;P;D	0.83275	0.856;0.627;0.996	T	0.77349	-0.2621	10	0.87932	D	0	.	14.0693	0.64851	0.1517:0.8483:0.0:0.0	.	53;53;53	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	W	53	ENSP00000350785:R53W;ENSP00000417076:R53W;ENSP00000418885:R53W;ENSP00000386135:R53W;ENSP00000419026:R53W	ENSP00000350785:R53W	R	+	1	2	DAPK1	89409783	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.007000	0.49536	1.334000	0.45468	0.511000	0.50034	CGG		0.547	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
FAM163B	642968	broad.mit.edu	37	9	136445260	136445260	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chr9:136445260C>T	ENST00000496132.1	-	2	330	c.86G>A	c.(85-87)cGg>cAg	p.R29Q	FAM163B_ENST00000356873.3_Missense_Mutation_p.R29Q			P0C2L3	F163B_HUMAN	family with sequence similarity 163, member B	29						integral component of membrane (GO:0016021)		p.R29Q(1)		large_intestine(1)	1						TACCTGGAGCCGGCAGTAGCA	0.662																																					p.R29Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G86A	9						.																																			135435081	SO:0001583	missense	642968	exon1			BX629352	CCDS35171.1	9q34.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000196990	ENSG00000196990			33277	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 166"""	C9orf166			Standard	NM_001080515		Approved		uc011mdm.2	P0C2L3	OTTHUMG00000159557	ENST00000496132.1:c.86G>A	9.37:g.136445260C>T	ENSP00000419867:p.Arg29Gln	Somatic		Capture	Illumina HiSeq	Phase_I	135435081	NM_001080515	B2RUZ5	Missense_Mutation	SNP	ENST00000496132.1	37	CCDS35171.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.937362	0.92458	.	.	ENSG00000196990	ENST00000496132;ENST00000356873	.	.	.	3.45	3.45	0.39498	.	0.067781	0.53938	D	0.000048	T	0.64659	0.2618	L	0.41492	1.28	0.58432	D	0.999997	D	0.89917	1.0	P	0.62649	0.905	T	0.69672	-0.5082	9	0.87932	D	0	-33.7409	14.0083	0.64478	0.0:1.0:0.0:0.0	.	29	P0C2L3	F163B_HUMAN	Q	29	.	ENSP00000349336:R29Q	R	-	2	0	FAM163B	135435081	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.153000	0.77428	1.936000	0.56123	0.561000	0.74099	CGG		0.662	FAM163B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356190.1	NM_001080515	
ZMYM3	9203	broad.mit.edu	37	X	70470014	70470014	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chrX:70470014delA	ENST00000353904.2	-	6	1300	c.1113delT	c.(1111-1113)actfs	p.T371fs	ZMYM3_ENST00000314425.5_Frame_Shift_Del_p.T371fs|ZMYM3_ENST00000373981.1_Frame_Shift_Del_p.T371fs|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373982.1_Frame_Shift_Del_p.T373fs|ZMYM3_ENST00000373978.1_Frame_Shift_Del_p.L275fs|ZMYM3_ENST00000373998.1_Frame_Shift_Del_p.T371fs|ZMYM3_ENST00000373984.3_Frame_Shift_Del_p.T373fs|ZMYM3_ENST00000373988.1_Frame_Shift_Del_p.T373fs	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	371					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G372fs*75(1)		breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					CTCCAGAACCAGTCTGCGCCA	0.577																																					p.T371fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1113delT	X						.						92.0	72.0	79.0					X																	70470014		2203	4300	6503	70386739	SO:0001589	frameshift_variant	9203	exon6			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.1113delT	X.37:g.70470014delA	ENSP00000343909:p.Thr371fs	Somatic		Capture	Illumina HiSeq	Phase_I	70386739	NM_001171162	D3DVV3|O15089|Q96E26	Frame_Shift_Del	DEL	ENST00000353904.2	37	CCDS14409.1																																																																																				0.577	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599	
ZCCHC5	203430	broad.mit.edu	37	X	77913570	77913570	+	Silent	SNP	C	C	T	rs139493021	byFrequency	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3855-01A-01W-0995-10	TCGA-AA-3855-10A-01W-0995-10	g.chrX:77913570C>T	ENST00000321110.1	-	2	643	c.348G>A	c.(346-348)gcG>gcA	p.A116A		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	116	Pro-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.A116A(2)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TTGCTGGAGGCGCCAGGGACT	0.632													C|||	1	0.000264901	0.0	0.0	3775	,	,		10029	0.0		0.001	False		,,,				2504	0.0				p.A116A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|breast(1)	c.G348A	X						.	C		1,3834		0,1,0,1631,571	25.0	27.0	27.0		348	-0.9	0.0	X	dbSNP_134	27	9,6715		0,6,3,2422,1865	no	coding-synonymous	ZCCHC5	NM_152694.2		0,7,3,4053,2436	TT,TC,T,CC,C		0.1338,0.0261,0.0947		116/476	77913570	10,10549	2203	4296	6499	77800226	SO:0001819	synonymous_variant	203430	exon2			AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.348G>A	X.37:g.77913570C>T		Somatic		Capture	Illumina HiSeq	Phase_I	77800226	NM_152694	B2RMZ0|Q5JQE9	Silent	SNP	ENST00000321110.1	37	CCDS14440.1																																																																																				0.632	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694	
