#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CFAP58	159686	broad.mit.edu	37	10	106160480	106160480	+	Missense_Mutation	SNP	C	C	T	rs147314126	byFrequency	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr10:106160480C>T	ENST00000369704.3	+	13	1992	c.1858C>T	c.(1858-1860)Cgc>Tgc	p.R620C	snoU13_ENST00000458914.1_RNA	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		620						extracellular space (GO:0005615)		p.R620C(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		GCTTGTTCGGCGCAATGATGA	0.502													C|||	3	0.000599042	0.0	0.0	5008	,	,		18942	0.002		0.0	False		,,,				2504	0.001				p.R620C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1858T	10						.						164.0	138.0	147.0					10																	106160480		2203	4300	6503	106150470	SO:0001583	missense	159686	exon13																														ENST00000369704.3:c.1858C>T	10.37:g.106160480C>T	ENSP00000358718:p.Arg620Cys	Somatic		Capture	Illumina HiSeq	Phase_I	106150470	NM_001008723	D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	37	CCDS31282.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	22.6	4.315538	0.81469	.	.	ENSG00000120051	ENST00000369704	T	0.55234	0.53	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.76392	0.3981	M	0.84585	2.705	0.80722	D	1	D	0.89917	1.0	D	0.68943	0.961	T	0.79147	-0.1923	10	0.62326	D	0.03	-7.062	19.645	0.95773	0.0:1.0:0.0:0.0	.	620	Q5T655	CC147_HUMAN	C	620	ENSP00000358718:R620C	ENSP00000358718:R620C	R	+	1	0	CCDC147	106150470	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.151000	0.50670	2.647000	0.89833	0.655000	0.94253	CGC		0.502	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1		
NET1	10276	broad.mit.edu	37	10	5494842	5494844	+	In_Frame_Del	DEL	GGT	GGT	-			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	GGT	GGT	GGT	-	GGT	GGT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr10:5494842_5494844delGGT	ENST00000355029.4	+	6	695_697	c.553_555delGGT	c.(553-555)ggtdel	p.G185del	NET1_ENST00000542715.1_In_Frame_Del_p.G4del|NET1_ENST00000380359.3_In_Frame_Del_p.G131del	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	185	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G131delG(1)|p.G185delG(1)		breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						AATGTCCCGAGGTGAACAGGATT	0.31																																					p.131_131del												.	.	2	Deletion - In frame(2)	large_intestine(2)	c.391_393del	10						.																																			5484844	SO:0001651	inframe_deletion	10276	exon4			AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.553_555delGGT	10.37:g.5494842_5494844delGGT	ENSP00000347134:p.Gly185del	Somatic		Capture	Illumina HiSeq	Phase_I	5484842	NM_005863	Q12773|Q96D82|Q99903|Q9UEN6	In_Frame_Del	DEL	ENST00000355029.4	37	CCDS41483.1																																																																																				0.310	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046553.3	NM_005863	
CYP2E1	1571	broad.mit.edu	37	10	135347278	135347278	+	Missense_Mutation	SNP	C	C	T	rs375149895		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr10:135347278C>T	ENST00000463117.2	+	8	1116	c.844C>T	c.(844-846)Cgc>Tgc	p.R282C	SPRN_ENST00000541506.1_Intron|CYP2E1_ENST00000252945.3_Missense_Mutation_p.R282C			P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E, polypeptide 1	282					drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organonitrogen compound (GO:0010243)|response to ozone (GO:0010193)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|triglyceride metabolic process (GO:0006641)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.R282C(1)		NS(1)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(7)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Aldesleukin(DB00041)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminophylline(DB01223)|Amitriptyline(DB00321)|Antipyrine(DB01435)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupropion(DB01156)|Caffeine(DB00201)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Citalopram(DB00215)|Clevidipine(DB04920)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonazepam(DB01068)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Dacarbazine(DB00851)|Dalfampridine(DB06637)|Dapsone(DB00250)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Disulfiram(DB00822)|Econazole(DB01127)|Enflurane(DB00228)|Enfuvirtide(DB00109)|Estrone(DB00655)|Ethanol(DB00898)|Ethanolamine Oleate(DB06689)|Ethosuximide(DB00593)|Etoposide(DB00773)|Etoricoxib(DB01628)|Felbamate(DB00949)|Fingolimod(DB08868)|Flunitrazepam(DB01544)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluvoxamine(DB00176)|Folic Acid(DB00158)|Fomepizole(DB01213)|Glucosamine(DB01296)|Halothane(DB01159)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imipramine(DB00458)|Isoflurane(DB00753)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Itraconazole(DB01167)|Menadione(DB00170)|Meprobamate(DB00371)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Mexiletine(DB00379)|Miconazole(DB01110)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nitrazepam(DB01595)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Orphenadrine(DB01173)|Oxaliplatin(DB00526)|Paramethadione(DB00617)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Pimozide(DB01100)|Proguanil(DB01131)|Propofol(DB00818)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rufinamide(DB06201)|S-Adenosylmethionine(DB00118)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulfadiazine(DB00359)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiopental(DB00599)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Ursodeoxycholic acid(DB01586)|Zafirlukast(DB00549)|Zopiclone(DB01198)	CAGTGCAGAGCGCTTGTACAC	0.562									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.R282C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C844T	10						.	C	CYS/ARG	0,4406		0,0,2203	177.0	157.0	164.0		844	1.1	0.0	10		164	1,8599		0,1,4299	no	missense	CYP2E1	NM_000773.3	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	282/494	135347278	1,13005	2203	4300	6503	135197268	SO:0001583	missense	1571	exon6	Familial Cancer Database	incl.: Familial Head and Neck Cancer	J02843	CCDS7686.1	10q26.3	2013-05-03	2003-01-14	2002-09-13	ENSG00000130649	ENSG00000130649		"""Cytochrome P450s"""	2631	protein-coding gene	gene with protein product		124040	"""cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1"""	CYP2E			Standard	NM_000773		Approved		uc001lnj.1	P05181	OTTHUMG00000019322	ENST00000463117.2:c.844C>T	10.37:g.135347278C>T	ENSP00000440689:p.Arg282Cys	Somatic		Capture	Illumina HiSeq	Phase_I	135197268	NM_000773	Q5VZD5|Q6NWT9|Q9UK47	Missense_Mutation	SNP	ENST00000463117.2	37	CCDS7686.1	.	.	.	.	.	.	.	.	.	.	C	8.901	0.956448	0.18507	0.0	1.16E-4	ENSG00000130649	ENST00000463117;ENST00000252945;ENST00000421586;ENST00000418356	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	3.96	1.09	0.20402	.	0.653399	0.16659	N	0.204852	T	0.47507	0.1449	N	0.21282	0.65	0.09310	N	1	B;B	0.14805	0.011;0.001	B;B	0.04013	0.001;0.001	T	0.41893	-0.9483	10	0.87932	D	0	.	6.3486	0.21363	0.0:0.5819:0.0:0.4181	.	178;282	Q59EW1;P05181	.;CP2E1_HUMAN	C	282;282;195;145	ENSP00000440689:R282C;ENSP00000252945:R282C;ENSP00000412754:R195C;ENSP00000397299:R145C	ENSP00000252945:R282C	R	+	1	0	CYP2E1	135197268	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.040000	0.12104	0.261000	0.21753	0.597000	0.82753	CGC		0.562	CYP2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051161.2	NM_000773	
ABCG4	64137	broad.mit.edu	37	11	119024776	119024776	+	Silent	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr11:119024776C>T	ENST00000449422.2	+	3	467	c.279C>T	c.(277-279)tgC>tgT	p.C93C	ABCG4_ENST00000531739.1_Silent_p.C93C|ABCG4_ENST00000307417.3_Silent_p.C93C	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	93	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.C93C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GTAAATTCTGCCGCCGGGAGC	0.522																																					p.C93C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C279T	11						.						94.0	102.0	100.0					11																	119024776		2200	4295	6495	118529986	SO:0001819	synonymous_variant	64137	exon3			AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.279C>T	11.37:g.119024776C>T		Somatic		Capture	Illumina HiSeq	Phase_I	118529986	NM_001142505	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Silent	SNP	ENST00000449422.2	37	CCDS8415.1																																																																																				0.522	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169	
TECTA	7007	broad.mit.edu	37	11	121000622	121000622	+	Silent	SNP	C	C	T	rs544376595		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr11:121000622C>T	ENST00000392793.1	+	10	2914	c.2643C>T	c.(2641-2643)ttC>ttT	p.F881F	TECTA_ENST00000264037.2_Silent_p.F881F			O75443	TECTA_HUMAN	tectorin alpha	881	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.F881F(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GGACAACTTTCGAGGAGATCT	0.557																																					p.F881F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2643T	11						.						85.0	78.0	81.0					11																	121000622		2203	4299	6502	120505832	SO:0001819	synonymous_variant	7007	exon9			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2643C>T	11.37:g.121000622C>T		Somatic		Capture	Illumina HiSeq	Phase_I	120505832	NM_005422		Silent	SNP	ENST00000392793.1	37	CCDS8434.1																																																																																				0.557	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
KRTAP5-6	440023	broad.mit.edu	37	11	1718646	1718646	+	Silent	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr11:1718646G>A	ENST00000382160.1	+	1	222	c.171G>A	c.(169-171)aaG>aaA	p.K57K		NM_001012416.1	NP_001012416.1	Q6L8G9	KRA56_HUMAN	keratin associated protein 5-6	57	6 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.K57K(1)		endometrium(1)|large_intestine(2)|lung(6)|skin(1)	10		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GGGGCTCCAAGGGGTGCTGTG	0.647																																					p.K57K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G171A	11						.						78.0	100.0	92.0					11																	1718646		2202	4299	6501	1675222	SO:0001819	synonymous_variant	440023	exon1			AB126075	CCDS31332.1	11p15.5	2008-02-05			ENSG00000205864	ENSG00000205864		"""Keratin associated proteins"""	23600	protein-coding gene	gene with protein product						15144888	Standard	NM_001012416		Approved	KRTAP5.6	uc001lua.3	Q6L8G9	OTTHUMG00000043932	ENST00000382160.1:c.171G>A	11.37:g.1718646G>A		Somatic		Capture	Illumina HiSeq	Phase_I	1675222	NM_001012416	A1L452	Silent	SNP	ENST00000382160.1	37	CCDS31332.1																																																																																				0.647	KRTAP5-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102339.2		
ARHGEF17	9828	broad.mit.edu	37	11	73022673	73022673	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr11:73022673C>T	ENST00000263674.3	+	1	3340	c.2990C>T	c.(2989-2991)aCg>aTg	p.T997M	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	997	Pro-rich.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T997M(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GCCCATCCCACGTTGCAGGCA	0.602																																					p.T997M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2990T	11						.						67.0	63.0	65.0					11																	73022673		2200	4293	6493	72700321	SO:0001583	missense	9828	exon1			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.2990C>T	11.37:g.73022673C>T	ENSP00000263674:p.Thr997Met	Somatic		Capture	Illumina HiSeq	Phase_I	72700321	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.37|12.37	1.918542|1.918542	0.33908|0.33908	.|.	.|.	ENSG00000110237|ENSG00000110237	ENST00000544519|ENST00000263674	.|T	.|0.57107	.|0.42	4.49|4.49	-0.691|-0.691	0.11305|0.11305	.|.	.|0.799536	.|0.11183	.|N	.|0.590797	T|T	0.28234|0.28234	0.0697|0.0697	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|B	.|0.20780	.|0.048	.|B	.|0.11329	.|0.006	T|T	0.19582|0.19582	-1.0301|-1.0301	5|10	.|0.72032	.|D	.|0.01	0.5623|0.5623	1.4116|1.4116	0.02292|0.02292	0.1384:0.4059:0.1349:0.3208|0.1384:0.4059:0.1349:0.3208	.|.	.|997	.|Q96PE2	.|ARHGH_HUMAN	C|M	22|997	.|ENSP00000263674:T997M	.|ENSP00000263674:T997M	R|T	+|+	1|2	0|0	ARHGEF17|ARHGEF17	72700321|72700321	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.476000|0.476000	0.33039|0.33039	-0.026000|-0.026000	0.12392|0.12392	-0.211000|-0.211000	0.10124|0.10124	-0.768000|-0.768000	0.03414|0.03414	CGT|ACG		0.602	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
RNF169	254225	broad.mit.edu	37	11	74528707	74528707	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr11:74528707C>T	ENST00000299563.4	+	4	803	c.790C>T	c.(790-792)Cgc>Tgc	p.R264C		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	264					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)	p.R264C(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						ACAGACACATCGCTCGGCATT	0.498																																					p.R264C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C790T	11						.						131.0	129.0	130.0					11																	74528707		1965	4151	6116	74206355	SO:0001583	missense	254225	exon4			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.790C>T	11.37:g.74528707C>T	ENSP00000299563:p.Arg264Cys	Somatic		Capture	Illumina HiSeq	Phase_I	74206355	NM_001098638	Q6N015	Missense_Mutation	SNP	ENST00000299563.4	37	CCDS41691.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637687	0.87760	.	.	ENSG00000166439	ENST00000299563	T	0.51325	0.71	5.89	5.89	0.94794	.	0.428007	0.29335	N	0.012451	T	0.69169	0.3081	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.70594	-0.4829	10	0.66056	D	0.02	-5.5836	15.7563	0.78030	0.0:1.0:0.0:0.0	.	264	Q8NCN4	RN169_HUMAN	C	264	ENSP00000299563:R264C	ENSP00000299563:R264C	R	+	1	0	RNF169	74206355	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.255000	0.58804	2.797000	0.96272	0.563000	0.77884	CGC		0.498	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384741.1	XM_495886	
NCAPD3	23310	broad.mit.edu	37	11	134054582	134054582	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr11:134054582C>T	ENST00000534548.2	-	19	2465	c.2401G>A	c.(2401-2403)Gcc>Acc	p.A801T	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	801					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.A801T(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CTCTGCAAGGCGTCAACAGCT	0.473																																					p.A801T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2401A	11						.						81.0	76.0	78.0					11																	134054582		2201	4297	6498	133559792	SO:0001583	missense	23310	exon19			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2401G>A	11.37:g.134054582C>T	ENSP00000433681:p.Ala801Thr	Somatic		Capture	Illumina HiSeq	Phase_I	133559792	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	0.049	-1.254899	0.01457	.	.	ENSG00000151503	ENST00000534548	T	0.67523	-0.27	5.59	-1.63	0.08345	Armadillo-like helical (1);Armadillo-type fold (1);	0.481174	0.25219	N	0.032244	T	0.29126	0.0724	N	0.02247	-0.625	0.23515	N	0.997515	B	0.09022	0.002	B	0.06405	0.002	T	0.28038	-1.0056	10	0.09084	T	0.74	-7.5009	5.5339	0.17001	0.2728:0.504:0.0:0.2231	.	801	P42695	CNDD3_HUMAN	T	801	ENSP00000433681:A801T	ENSP00000431612:A801T	A	-	1	0	NCAPD3	133559792	0.537000	0.26386	0.041000	0.18516	0.189000	0.23516	0.459000	0.21908	-0.213000	0.10094	-0.150000	0.13652	GCC		0.473	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
MANSC1	54682	broad.mit.edu	37	12	12483417	12483418	+	Frame_Shift_Ins	INS	-	-	AA	rs201432430		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr12:12483417_12483418insAA	ENST00000535902.1	-	4	1402_1403	c.839_840insTT	c.(838-840)acgfs	p.T280fs	MANSC1_ENST00000545735.1_Frame_Shift_Ins_p.T199fs|MANSC1_ENST00000396349.3_Frame_Shift_Ins_p.T246fs			Q9H8J5	MANS1_HUMAN	MANSC domain containing 1	280	Thr-rich.					integral component of membrane (GO:0016021)		p.T281fs*1(1)|p.T280M(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|stomach(4)	23		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		AAATGAGGGTCGTGGGAGGCTG	0.545																																					p.T280fs												.	.	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(2)	c.840_841insTT	12						.			0,4264		0,0,2132						-8.3	0.0			82	4,8250		0,4,4123	no	frameshift	MANSC1	NM_018050.2		0,4,6255	A1A1,A1R,RR		0.0485,0.0,0.032				4,12514				12374685	SO:0001589	frameshift_variant	54682	exon4			AK001160	CCDS8648.1	12p13.2	2006-04-12				ENSG00000111261			25505	protein-coding gene	gene with protein product						12975309	Standard	NM_018050		Approved	FLJ10298, LOH12CR3	uc001rai.1	Q9H8J5		ENST00000535902.1:c.839_840insTT	12.37:g.12483417_12483418insAA	ENSP00000438205:p.Thr280fs	Somatic		Capture	Illumina HiSeq	Phase_I	12374684	NM_018050	Q8NEC1|Q9NW60	Frame_Shift_Ins	INS	ENST00000535902.1	37	CCDS8648.1																																																																																				0.545	MANSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400144.1	NM_018050	
PRR4	11272	broad.mit.edu	37	12	10999790	10999790	+	Nonsense_Mutation	SNP	G	G	A	rs200314617		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr12:10999790G>A	ENST00000228811.4	-	3	314	c.277C>T	c.(277-279)Cga>Tga	p.R93*	PRR4_ENST00000544994.1_Intron|PRR4_ENST00000540107.1_Missense_Mutation_p.T35M|PRR4_ENST00000536668.1_5'UTR	NM_007244.2	NP_009175.2	Q16378	PROL4_HUMAN	proline rich 4 (lacrimal)	93	Pro-rich.				retina homeostasis (GO:0001895)|visual perception (GO:0007601)	extracellular space (GO:0005615)		p.R93*(2)		endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	9						CGGGGTGGTCGTTGCTGATTT	0.542													G|||	0	0.0	0.0	0.0	5008	,	,		17811	0.0		0.0	False		,,,				2504	0.0				p.R93X												.	.	2	Substitution - Nonsense(2)	ovary(1)|large_intestine(1)	c.C277T	12						.						243.0	251.0	249.0					12																	10999790		2038	4179	6217	10891057	SO:0001587	stop_gained	11272	exon3				CCDS41756.1, CCDS55804.1	12p13	2008-02-05		2004-05-28		ENSG00000111215			18020	protein-coding gene	gene with protein product		605359		PROL4		7544782	Standard	NM_007244		Approved	LPRP	uc001qyz.4	Q16378		ENST00000228811.4:c.277C>T	12.37:g.10999790G>A	ENSP00000228811:p.Arg93*	Somatic		Capture	Illumina HiSeq	Phase_I	10891057	NM_007244	A8KA69|F5H0D7|Q8NFB3	Nonsense_Mutation	SNP	ENST00000228811.4	37	CCDS41756.1	1|1	4.578754578754579E-4|4.578754578754579E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	4.837|4.837	0.155590|0.155590	0.09236|0.09236	.|.	.|.	ENSG00000111215|ENSG00000111215	ENST00000228811|ENST00000540107	.|T	.|0.04360	.|3.64	1.63|1.63	-3.26|-3.26	0.05064|0.05064	.|.	3.053280|.	0.05590|.	U|.	0.574564|.	.|T	.|0.05456	.|0.0144	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.28650	.|-1.0037	.|6	0.02654|0.87932	T|D	1|0	.|.	4.026|4.026	0.09687|0.09687	0.0:0.3163:0.1915:0.4922|0.0:0.3163:0.1915:0.4922	.|.	.|.	.|.	.|.	X|M	93|35	.|ENSP00000443939:T35M	ENSP00000228811:R93X|ENSP00000443939:T35M	R|T	-|-	1|2	2|0	PRR4|PRR4	10891057|10891057	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-1.440000|-1.440000	0.02412|0.02412	-1.674000|-1.674000	0.01461|0.01461	-1.928000|-1.928000	0.00512|0.00512	CGA|ACG		0.542	PRR4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400049.1	NM_007244	
CAPZA3	93661	broad.mit.edu	37	12	18891571	18891571	+	Silent	SNP	C	C	T	rs200625390		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr12:18891571C>T	ENST00000317658.3	+	1	527	c.369C>T	c.(367-369)tgC>tgT	p.C123C	PLCZ1_ENST00000266505.7_5'Flank|PLCZ1_ENST00000447925.2_5'Flank|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000435379.1_5'Flank|PLCZ1_ENST00000539875.1_5'Flank	NM_033328.2	NP_201585.1	Q96KX2	CAZA3_HUMAN	capping protein (actin filament) muscle Z-line, alpha 3	123					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cortical cytoskeleton (GO:0030863)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|nucleus (GO:0005634)|WASH complex (GO:0071203)		p.C123C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)	19	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				TTCTTCTGTGCGCCTTAAAAC	0.378													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21421	0.0		0.0	False		,,,				2504	0.0				p.C123C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C369T	12						.	C		0,4406		0,0,2203	88.0	80.0	83.0		369	-2.5	1.0	12		83	3,8595	3.0+/-9.4	0,3,4296	no	coding-synonymous	CAPZA3	NM_033328.2		0,3,6499	TT,TC,CC		0.0349,0.0,0.0231		123/300	18891571	3,13001	2203	4299	6502	18782838	SO:0001819	synonymous_variant	93661	exon1			AB053259	CCDS8681.1	12p12.3	2008-02-05			ENSG00000177938	ENSG00000177938			24205	protein-coding gene	gene with protein product		608722				12029070	Standard	NM_033328		Approved	Gsg3, CAPPA3	uc001rdy.3	Q96KX2	OTTHUMG00000169001	ENST00000317658.3:c.369C>T	12.37:g.18891571C>T		Somatic		Capture	Illumina HiSeq	Phase_I	18782838	NM_033328	Q969J0	Silent	SNP	ENST00000317658.3	37	CCDS8681.1																																																																																				0.378	CAPZA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401902.1	NM_033328	
CNTN1	1272	broad.mit.edu	37	12	41353034	41353034	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr12:41353034G>T	ENST00000551295.2	+	15	1919	c.1802G>T	c.(1801-1803)aGa>aTa	p.R601I	CNTN1_ENST00000547849.1_Missense_Mutation_p.R601I|CNTN1_ENST00000348761.2_Missense_Mutation_p.R590I|CNTN1_ENST00000547702.1_Missense_Mutation_p.R601I|CNTN1_ENST00000347616.1_Missense_Mutation_p.R601I|CNTN1_ENST00000360099.3_Missense_Mutation_p.R601I	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	601	Ig-like C2-type 6.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.R601I(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CTTGTAGTGAGAGGTAAGAGT	0.368																																					p.R590I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1769T	12						.						89.0	83.0	85.0					12																	41353034		2203	4300	6503	39639301	SO:0001583	missense	1272	exon14			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1802G>T	12.37:g.41353034G>T	ENSP00000447006:p.Arg601Ile	Somatic		Capture	Illumina HiSeq	Phase_I	39639301	NM_175038	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743862	0.89663	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72;1.72	5.3	5.3	0.74995	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.53867	0.1823	M	0.73598	2.24	0.80722	D	1	D;D;D	0.71674	0.982;0.998;0.997	P;D;D	0.74348	0.891;0.983;0.963	T	0.54977	-0.8212	10	0.72032	D	0.01	.	19.8519	0.96744	0.0:0.0:1.0:0.0	.	601;590;601	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	I	601;601;601;601;601;590	ENSP00000448004:R601I;ENSP00000447006:R601I;ENSP00000448653:R601I;ENSP00000325660:R601I;ENSP00000353213:R601I;ENSP00000261160:R590I	ENSP00000325660:R601I	R	+	2	0	CNTN1	39639301	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.886000	0.92447	2.861000	0.98227	0.655000	0.94253	AGA		0.368	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
CLEC4C	170482	broad.mit.edu	37	12	7894077	7894077	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr12:7894077G>A	ENST00000542353.1	-	4	665	c.175C>T	c.(175-177)Cga>Tga	p.R59*	CLEC4C_ENST00000540085.1_Nonsense_Mutation_p.R28*|CLEC4C_ENST00000354629.5_Nonsense_Mutation_p.R28*|CLEC4C_ENST00000360345.3_Nonsense_Mutation_p.R59*	NM_130441.2	NP_569708.1	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C	59					innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R59*(2)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				Kidney(36;0.0915)		TGATACTCTCGTAACTTGGAC	0.423																																					p.R28X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|lung(1)	c.C82T	12						.						192.0	161.0	171.0					12																	7894077		2203	4300	6503	7785344	SO:0001587	stop_gained	170482	exon3			AF325460	CCDS8583.1, CCDS8584.1	12p13.2-p12.3	2008-02-05	2004-02-13	2005-02-11	ENSG00000198178	ENSG00000198178		"""C-type lectin domain containing"", ""CD molecules"""	13258	protein-coding gene	gene with protein product		606677	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 7"""	CLECSF11, CLECSF7		11031109, 11536172	Standard	NM_130441		Approved	HECL, DLEC, BDCA2, CD303	uc001qth.1	Q8WTT0	OTTHUMG00000168441	ENST00000542353.1:c.175C>T	12.37:g.7894077G>A	ENSP00000440428:p.Arg59*	Somatic		Capture	Illumina HiSeq	Phase_I	7785344	NM_203503	D3DUU3|Q3T1C3|Q6UXS8|Q8WXX8	Nonsense_Mutation	SNP	ENST00000542353.1	37	CCDS8583.1	.	.	.	.	.	.	.	.	.	.	G	37	6.499228	0.97616	.	.	ENSG00000198178	ENST00000542353;ENST00000354629;ENST00000540085;ENST00000360345	.	.	.	1.79	0.884	0.19182	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	4.1172	0.10088	0.2174:0.0:0.7826:0.0	.	.	.	.	X	59;28;28;59	.	ENSP00000346648:R28X	R	-	1	2	CLEC4C	7785344	0.019000	0.18553	0.017000	0.16124	0.415000	0.31203	1.490000	0.35573	0.312000	0.23038	0.514000	0.50259	CGA		0.423	CLEC4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399750.1	NM_203503	
ITGB7	3695	broad.mit.edu	37	12	53586154	53586154	+	Silent	SNP	G	G	A	rs371035663		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr12:53586154G>A	ENST00000267082.5	-	14	2346	c.2115C>T	c.(2113-2115)gaC>gaT	p.D705D	ITGB7_ENST00000550743.2_Silent_p.D557D|ITGB7_ENST00000338737.4_Silent_p.D557D|ITGB7_ENST00000422257.3_Silent_p.D705D	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	705					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.D705D(1)		NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGCCTCTGGCGTCATCCTCCA	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		22159	0.0		0.0	False		,,,				2504	0.001				p.D705D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2115T	12						.	G		1,4405	2.1+/-5.4	0,1,2202	125.0	113.0	117.0		2115	-4.0	0.0	12		117	0,8600		0,0,4300	no	coding-synonymous	ITGB7	NM_000889.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		705/799	53586154	1,13005	2203	4300	6503	51872421	SO:0001819	synonymous_variant	3695	exon14				CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.2115C>T	12.37:g.53586154G>A		Somatic		Capture	Illumina HiSeq	Phase_I	51872421	NM_000889	Q9UCP7|Q9UCS7	Silent	SNP	ENST00000267082.5	37	CCDS8849.1																																																																																				0.562	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2		
PIBF1	10464	broad.mit.edu	37	13	73482683	73482683	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr13:73482683A>C	ENST00000326291.6	+	12	1841	c.1503A>C	c.(1501-1503)gaA>gaC	p.E501D		NM_006346.2	NP_006337.2	Q8WXW3	PIBF1_HUMAN	progesterone immunomodulatory binding factor 1	501						centrosome (GO:0005813)		p.E501D(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		TAACCAAAGAATTTTATAGTC	0.363																																					p.E501D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1503C	13						.						47.0	49.0	48.0					13																	73482683		2203	4299	6502	72380684	SO:0001583	missense	10464	exon12			AF330046	CCDS31991.1	13q21.33	2014-02-20	2007-10-17	2007-10-17	ENSG00000083535	ENSG00000083535			23352	protein-coding gene	gene with protein product	"""progesterone-induced blocking factor 1"""	607532	"""chromosome 13 open reading frame 24"""	C13orf24		11935316	Standard	NM_006346		Approved	CEP90	uc001vjc.3	Q8WXW3	OTTHUMG00000017071	ENST00000326291.6:c.1503A>C	13.37:g.73482683A>C	ENSP00000317144:p.Glu501Asp	Somatic		Capture	Illumina HiSeq	Phase_I	72380684	NM_006346	O95664|Q6U9V2|Q6UG50|Q86V07|Q96SF4	Missense_Mutation	SNP	ENST00000326291.6	37	CCDS31991.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.403241	0.83230	.	.	ENSG00000083535	ENST00000326291	T	0.75260	-0.92	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.83599	0.5289	M	0.69823	2.125	0.54753	D	0.999988	D;D	0.71674	0.998;0.998	D;D	0.77557	0.99;0.99	D	0.84483	0.0606	10	0.54805	T	0.06	-21.9663	10.3739	0.44071	0.9272:0.0:0.0728:0.0	.	501;501	Q8WXW3;Q4G0R1	PIBF1_HUMAN;.	D	501	ENSP00000317144:E501D	ENSP00000317144:E501D	E	+	3	2	PIBF1	72380684	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.332000	0.52083	2.179000	0.69175	0.528000	0.53228	GAA		0.363	PIBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045255.1	NM_006346	
SLITRK5	26050	broad.mit.edu	37	13	88330253	88330253	+	Silent	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr13:88330253C>T	ENST00000325089.6	+	2	2829	c.2610C>T	c.(2608-2610)gcC>gcT	p.A870A	SLITRK5_ENST00000400028.3_Silent_p.A629A	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	870					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.A870A(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CCACCCCCGCCGGCAATAGCC	0.602																																					p.A870A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2610T	13						.						37.0	39.0	38.0					13																	88330253		2203	4300	6503	87128254	SO:0001819	synonymous_variant	26050	exon2			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2610C>T	13.37:g.88330253C>T		Somatic		Capture	Illumina HiSeq	Phase_I	87128254	NM_015567	B3KNB8|B4DSH5|Q5VT81	Silent	SNP	ENST00000325089.6	37	CCDS9465.1																																																																																				0.602	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
ACOT4	122970	broad.mit.edu	37	14	74060511	74060512	+	Frame_Shift_Ins	INS	-	-	TCAA	rs79684878|rs373880503	byFrequency	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr14:74060511_74060512insTCAA	ENST00000326303.4	+	2	817_818	c.563_564insTCAA	c.(562-567)ctagctfs	p.A189fs		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	189				ALAY -> DLQS (in Ref. 1; BAC04313). {ECO:0000305}.	acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		ACGTTGGCTCTAGCTTATTATA	0.495														6	0.00119808	0.0	0.0	5008	,	,		16663	0.0		0.006	False		,,,				2504	0.0				p.L188fs												.	.	0			c.563_564insTCAA	14						.																																			73130265	SO:0001589	frameshift_variant	122970	exon2			BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	Exception_encountered	14.37:g.74060511_74060512insTCAA	ENSP00000323071:p.Ala189fs	None		Capture	Illumina HiSeq	Phase_I	73130264	NM_152331	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Frame_Shift_Ins	INS	ENST00000326303.4	37	CCDS9817.1																																																																																				0.495	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404298.2	NM_152331	
RIN3	79890	broad.mit.edu	37	14	93118318	93118319	+	Missense_Mutation	DNP	CT	CT	AC			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	CT	CT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr14:93118318_93118319CT>AC	ENST00000216487.7	+	6	1083_1084	c.924_925CT>AC	c.(922-927)gcCTgt>gcACgt	p.C309R	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	309	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.A308>?(1)		endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				ccgcccctgcctgtcctttgcc	0.733																																					.												.	.	1	Complex(1)	large_intestine(1)	c.924_925AC	14						.																																			92188072	SO:0001583	missense	79890	exon6			BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		Exception_encountered	14.37:g.93118318_93118319delinsAC	ENSP00000216487:p.Cys309Arg	Somatic		Capture	Illumina HiSeq	Phase_I	92188071	NM_024832	Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Missense_Mutation	DNP	ENST00000216487.7	37	CCDS32144.1																																																																																				0.733	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412269.1		
ACOT4	122970	broad.mit.edu	37	14	74060514	74060517	+	Frame_Shift_Del	DEL	CTTA	CTTA	-	rs74553611|rs562751690|rs77261428|rs77814755|rs375801976|rs77408762	byFrequency	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	CTTA	CTTA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr14:74060514_74060517delCTTA	ENST00000326303.4	+	2	820_823	c.566_569delCTTA	c.(565-570)gcttatfs	p.AY189fs		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	189				ALAY -> DLQS (in Ref. 1; BAC04313). {ECO:0000305}.	acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)	p.A189fs*32(2)		endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		TTGGCTCTAGCTTATTATAACTTT	0.495																																					p.189_190del												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.566_569del	14						.			103,4159		3,97,2031						4.3	1.0			126	861,7311		130,601,3355	no	frameshift	ACOT4	NM_152331.3		133,698,5386	A1A1,A1R,RR		10.536,2.4167,7.7529				964,11470				73130270	SO:0001589	frameshift_variant	122970	exon2			BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.566_569delCTTA	14.37:g.74060514_74060517delCTTA	ENSP00000323071:p.Ala189fs	Somatic		Capture	Illumina HiSeq	Phase_I	73130267	NM_152331	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Frame_Shift_Del	DEL	ENST00000326303.4	37	CCDS9817.1																																																																																				0.495	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404298.2	NM_152331	
RIN3	79890	broad.mit.edu	37	14	93118321	93118321	+	Silent	SNP	T	T	C			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr14:93118321T>C	ENST00000216487.7	+	6	1086	c.927T>C	c.(925-927)tgT>tgC	p.C309C	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	309	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.C309C(1)		endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				cccctgcctgtcctttgccca	0.726																																					p.C309C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T927C	14						.						5.0	6.0	6.0					14																	93118321		1999	3901	5900	92188074	SO:0001819	synonymous_variant	79890	exon6			BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.927T>C	14.37:g.93118321T>C		Somatic		Capture	Illumina HiSeq	Phase_I	92188074	NM_024832	Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Silent	SNP	ENST00000216487.7	37	CCDS32144.1																																																																																				0.726	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412269.1		
CSK	1445	broad.mit.edu	37	15	75092823	75092824	+	Frame_Shift_Ins	INS	-	-	G	rs144101323	byFrequency	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr15:75092823_75092824insG	ENST00000220003.9	+	6	1262_1263	c.533_534insG	c.(532-537)gcggccfs	p.A179fs	CSK_ENST00000567571.1_Frame_Shift_Ins_p.A179fs|CSK_ENST00000309470.9_Frame_Shift_Ins_p.A179fs|CSK_ENST00000439220.2_Frame_Shift_Ins_p.A179fs	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	179					adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|lung(2)	3						GGCACAGTGGCGGCCCAGGATG	0.624											OREG0023291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A178fs												.	.	0			c.533_534insG	15						.																																			72879877	SO:0001589	frameshift_variant	1445	exon6				CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.535dupG	15.37:g.75092825_75092825dupG	ENSP00000220003:p.Ala179fs	None	1157	Capture	Illumina HiSeq	Phase_I	72879876	NM_004383	Q2M3N2|Q6FGZ6	Frame_Shift_Ins	INS	ENST00000220003.9	37	CCDS10269.1																																																																																				0.624	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2	NM_004383	
BUB1B	701	broad.mit.edu	37	15	40457259	40457259	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr15:40457259C>T	ENST00000287598.6	+	2	236	c.41C>T	c.(40-42)gCc>gTc	p.A14V	BUB1B_ENST00000560120.1_Intron|BUB1B_ENST00000412359.3_Missense_Mutation_p.A14V	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	14					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A14V(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		CACAGTGAAGCCATGTCCCTG	0.418			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																												p.A14V		yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C41T	15						.						103.0	98.0	100.0					15																	40457259		2203	4300	6503	38244551	SO:0001583	missense	701	exon2	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.41C>T	15.37:g.40457259C>T	ENSP00000287598:p.Ala14Val	Somatic		Capture	Illumina HiSeq	Phase_I	38244551	NM_001211	B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	ENST00000287598.6	37	CCDS10053.1	.	.	.	.	.	.	.	.	.	.	C	16.24	3.066640	0.55539	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.16324	2.36;2.35	5.77	4.84	0.62591	.	0.424528	0.27155	N	0.020679	T	0.15392	0.0371	L	0.40543	1.245	0.30387	N	0.781406	B	0.10296	0.003	B	0.09377	0.004	T	0.05146	-1.0903	10	0.36615	T	0.2	-0.3455	12.5179	0.56042	0.0:0.9161:0.0:0.0839	.	14	O60566	BUB1B_HUMAN	V	14	ENSP00000287598:A14V;ENSP00000398470:A14V	ENSP00000287598:A14V	A	+	2	0	BUB1B	38244551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.932000	0.40143	1.395000	0.46643	0.650000	0.86243	GCC		0.418	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252122.4		
DMXL2	23312	broad.mit.edu	37	15	51792233	51792233	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr15:51792233C>T	ENST00000251076.5	-	18	3475	c.3188G>A	c.(3187-3189)aGt>aAt	p.S1063N	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000449909.3_Intron|DMXL2_ENST00000543779.2_Missense_Mutation_p.S1063N	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1063						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.S1063N(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		GCTCACTGTACTGCTATTATC	0.413																																					p.S1063N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3188A	15						.						133.0	117.0	122.0					15																	51792233		2195	4293	6488	49579525	SO:0001583	missense	23312	exon18			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.3188G>A	15.37:g.51792233C>T	ENSP00000251076:p.Ser1063Asn	Somatic		Capture	Illumina HiSeq	Phase_I	49579525	NM_015263	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490138	0.64074	.	.	ENSG00000104093	ENST00000251076;ENST00000543779	T;T	0.39592	1.07;1.07	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.68155	0.2970	M	0.79011	2.435	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.87578	0.998;0.968	T	0.71368	-0.4614	10	0.87932	D	0	.	19.5332	0.95237	0.0:1.0:0.0:0.0	.	1063;1063	F5GWF1;Q8TDJ6	.;DMXL2_HUMAN	N	1063	ENSP00000251076:S1063N;ENSP00000441858:S1063N	ENSP00000251076:S1063N	S	-	2	0	DMXL2	49579525	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.741000	0.68638	2.608000	0.88229	0.591000	0.81541	AGT		0.413	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
FAM214A	56204	broad.mit.edu	37	15	52900950	52900950	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr15:52900950T>G	ENST00000261844.7	-	6	2313	c.2161A>C	c.(2161-2163)Aat>Cat	p.N721H	FAM214A_ENST00000546305.2_Missense_Mutation_p.N728H	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	721								p.N721H(1)									TCTATGCTATTAAGTTGAGTA	0.299																																					p.N721H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2161C	15						.						135.0	120.0	125.0					15																	52900950		1811	4063	5874	50688242	SO:0001583	missense	56204	exon6			AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.2161A>C	15.37:g.52900950T>G	ENSP00000261844:p.Asn721His	Somatic		Capture	Illumina HiSeq	Phase_I	50688242	NM_019600	A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Missense_Mutation	SNP	ENST00000261844.7	37	CCDS45263.1	.	.	.	.	.	.	.	.	.	.	T	14.90	2.673262	0.47781	.	.	ENSG00000047346	ENST00000261844;ENST00000399202;ENST00000534964;ENST00000546305	T;T	0.31247	1.5;1.5	6.07	0.782	0.18567	.	0.965251	0.08730	N	0.902152	T	0.33411	0.0862	L	0.44542	1.39	0.19775	N	0.99996	D;P	0.61080	0.989;0.947	P;P	0.56700	0.804;0.453	T	0.16276	-1.0408	10	0.38643	T	0.18	.	1.4456	0.02364	0.1234:0.2162:0.3132:0.3472	.	728;721	F5H8G0;Q32MH5	.;K1370_HUMAN	H	721;721;720;728	ENSP00000261844:N721H;ENSP00000443598:N728H	ENSP00000261844:N721H	N	-	1	0	KIAA1370	50688242	0.159000	0.22864	0.873000	0.34254	0.966000	0.64601	-0.292000	0.08332	0.124000	0.18369	0.477000	0.44152	AAT		0.299	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419914.1	NM_019600	
UNC45A	55898	broad.mit.edu	37	15	91485758	91485758	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr15:91485758T>C	ENST00000418476.2	+	7	819	c.779T>C	c.(778-780)cTg>cCg	p.L260P	UNC45A_ENST00000394275.2_Missense_Mutation_p.L245P|UNC45A_ENST00000553671.2_Intron	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	260					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.L260P(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GCCTGCCACCTGCTGCAGGTT	0.577																																					p.L245P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T734C	15						.						110.0	97.0	102.0					15																	91485758		2198	4298	6496	89286762	SO:0001583	missense	55898	exon10				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.779T>C	15.37:g.91485758T>C	ENSP00000407487:p.Leu260Pro	Somatic		Capture	Illumina HiSeq	Phase_I	89286762	NM_001039675	A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	ENST00000418476.2	37	CCDS10367.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.617687	0.87359	.	.	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.54479	0.57;0.57	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.164651	0.41500	D	0.000872	T	0.70272	0.3205	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.998	D;D;D;D	0.85130	0.972;0.98;0.997;0.995	T	0.72421	-0.4299	10	0.56958	D	0.05	-17.2768	14.5219	0.67856	0.0:0.0:0.0:1.0	.	260;252;260;245	B4DZL0;B4DLE6;Q9H3U1;A8K6F7	.;.;UN45A_HUMAN;.	P	245;260	ENSP00000377816:L245P;ENSP00000407487:L260P	ENSP00000377816:L245P	L	+	2	0	UNC45A	89286762	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.429000	0.80309	2.223000	0.72356	0.456000	0.33151	CTG		0.577	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671	
TMC7	79905	broad.mit.edu	37	16	19058478	19058478	+	Silent	SNP	C	C	T	rs142134127	byFrequency	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr16:19058478C>T	ENST00000304381.5	+	12	1777	c.1647C>T	c.(1645-1647)taC>taT	p.Y549Y	TMC7_ENST00000421369.3_Silent_p.Y439Y|TMC7_ENST00000569532.1_Silent_p.Y549Y	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	549					ion transport (GO:0006811)	integral component of membrane (GO:0016021)		p.Y549Y(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						GGATAGTTTACGGGCAAACCA	0.493													c|||	2	0.000399361	0.0	0.0	5008	,	,		16127	0.0		0.0	False		,,,				2504	0.002				p.Y439Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1317T	16						.	C	,	0,4394		0,0,2197	296.0	299.0	298.0		1317,1647	-4.1	0.8	16	dbSNP_134	298	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous,coding-synonymous	TMC7	NM_001160364.1,NM_024847.3	,	0,5,6492	TT,TC,CC		0.0581,0.0,0.0385	,	439/614,549/724	19058478	5,12989	2197	4300	6497	18965979	SO:0001819	synonymous_variant	79905	exon12			AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1647C>T	16.37:g.19058478C>T		Somatic		Capture	Illumina HiSeq	Phase_I	18965979	NM_001160364	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Silent	SNP	ENST00000304381.5	37	CCDS10573.1																																																																																				0.493	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	
CENPN	55839	broad.mit.edu	37	16	81053859	81053859	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr16:81053859G>A	ENST00000305850.5	+	6	1299	c.509G>A	c.(508-510)cGc>cAc	p.R170H	CENPN_ENST00000428963.2_Missense_Mutation_p.R170H|CMC2_ENST00000565914.1_5'UTR|CENPN_ENST00000299572.5_Missense_Mutation_p.R170H|RP11-303E16.3_ENST00000562315.1_RNA|CENPN_ENST00000393335.3_Missense_Mutation_p.R170H|CENPN_ENST00000439957.3_Missense_Mutation_p.R150H	NM_001100624.2|NM_001270474.1	NP_001094094.2|NP_001257403.1	Q96H22	CENPN_HUMAN	centromere protein N	170					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R150H(1)|p.R170H(1)		breast(1)|large_intestine(5)|lung(4)	10						ATGCTGAGGCGCAATACACCG	0.418																																					p.R170H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G509A	16						.						94.0	70.0	78.0					16																	81053859		2202	4300	6502	79611360	SO:0001583	missense	55839	exon6			AK026313	CCDS10931.1, CCDS42199.1, CCDS42200.1, CCDS58482.1, CCDS58483.1	16q23.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000166451	ENSG00000166451			30873	protein-coding gene	gene with protein product		611509	"""chromosome 16 open reading frame 60"""	C16orf60		16622419	Standard	NM_001100625		Approved	FLJ13607, FLJ22660, BM039	uc002ffy.4	Q96H22	OTTHUMG00000137628	ENST00000305850.5:c.509G>A	16.37:g.81053859G>A	ENSP00000305608:p.Arg170His	Somatic		Capture	Illumina HiSeq	Phase_I	79611360	NM_018455	A8MZE6|B3KN53|B4DJD1|B4DPY7|C9JJM5|D3DUK8|E7ES30|E7ETS3|Q9NZ83	Missense_Mutation	SNP	ENST00000305850.5	37	CCDS42200.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.637657	0.47049	.	.	ENSG00000166451	ENST00000305850;ENST00000299572;ENST00000439957;ENST00000393335;ENST00000428963	T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99	5.95	1.72	0.24424	.	0.620450	0.20518	N	0.090754	T	0.17916	0.0430	N	0.19112	0.55	0.09310	N	1	D;D;D;D;D	0.61080	0.965;0.965;0.989;0.965;0.977	B;B;P;B;B	0.52109	0.377;0.399;0.69;0.399;0.439	T	0.06570	-1.0819	10	0.51188	T	0.08	-0.6124	7.1827	0.25782	0.1879:0.223:0.5891:0.0	.	150;170;170;170;170	E7ETS3;E7ES30;A8MZE6;Q96H22;Q96H22-2	.;.;.;CENPN_HUMAN;.	H	170;170;150;170;170	ENSP00000305608:R170H;ENSP00000299572:R170H;ENSP00000395235:R150H;ENSP00000377007:R170H;ENSP00000393991:R170H	ENSP00000299572:R170H	R	+	2	0	CENPN	79611360	0.970000	0.33590	0.000000	0.03702	0.002000	0.02628	1.634000	0.37123	0.406000	0.25560	0.655000	0.94253	CGC		0.418	CENPN-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269051.1	NM_018455	
ERBB2	2064	broad.mit.edu	37	17	37880220	37880220	+	Missense_Mutation	SNP	T	T	C	rs121913470|rs121913469		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr17:37880220T>C	ENST00000269571.5	+	19	2423	c.2264T>C	c.(2263-2265)tTg>tCg	p.L755S	ERBB2_ENST00000445658.2_Missense_Mutation_p.L479S|ERBB2_ENST00000584601.1_Missense_Mutation_p.L725S|ERBB2_ENST00000406381.2_Missense_Mutation_p.L725S|ERBB2_ENST00000540147.1_Missense_Mutation_p.L725S|ERBB2_ENST00000541774.1_Missense_Mutation_p.L740S|ERBB2_ENST00000584450.1_Missense_Mutation_p.L755S|MIR4728_ENST00000580969.1_RNA			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	755	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> P (in a lung adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:15457249}.		axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.L755S(10)|p.L755P(2)|p.L755_S760>A(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	ATCAAAGTGTTGAGGGAAAAC	0.532	L755S(LN229_CENTRAL_NERVOUS_SYSTEM)	1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.L725S			Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	ERBB2,lung,NS,Substitution - Missense,+1 	.	13	Substitution - Missense(12)|Complex - insertion inframe(1)	breast(7)|lung(3)|stomach(2)|large_intestine(1)	c.T2174C	17						.						112.0	97.0	102.0					17																	37880220		2203	4300	6503	35133746	SO:0001583	missense	2064	exon22			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2264T>C	17.37:g.37880220T>C	ENSP00000269571:p.Leu755Ser	Somatic		Capture	Illumina HiSeq	Phase_I	35133746	NM_001005862	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	T	32	5.190536	0.94923	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.18	5.18	0.71444	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.83644	0.5299	M	0.86740	2.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86913	0.2062	9	0.87932	D	0	.	14.7238	0.69329	0.0:0.0:0.0:1.0	.	479;740;755	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	S	725;740;479;755;725	ENSP00000385185:L725S;ENSP00000446466:L740S;ENSP00000404047:L479S;ENSP00000269571:L755S;ENSP00000443562:L725S	ENSP00000269571:L755S	L	+	2	0	ERBB2	35133746	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	1.955000	0.56771	0.379000	0.24179	TTG		0.532	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
KRTAP4-12	83755	broad.mit.edu	37	17	39280162	39280162	+	Silent	SNP	A	A	G	rs28515113	byFrequency	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr17:39280162A>G	ENST00000394014.1	-	1	257	c.213T>C	c.(211-213)tgT>tgC	p.C71C		NM_031854.2	NP_114060.1	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	71	31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament (GO:0045095)		p.C71C(3)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGGTGGTCCTACAGCAGGTGG	0.677													A|||	863	0.172324	0.4357	0.1138	5008	,	,		14227	0.1389		0.0477	False		,,,				2504	0.0204				p.C71C												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.T213C	17						.	A		192,3702		9,174,1764	31.0	55.0	47.0		213	-2.0	0.0	17	dbSNP_125	47	5,8543		0,5,4269	no	coding-synonymous	KRTAP4-12	NM_031854.2		9,179,6033	GG,GA,AA		0.0585,4.9307,1.5833		71/202	39280162	197,12245	1947	4274	6221	36533688	SO:0001819	synonymous_variant	83755	exon1			AJ406943	CCDS32649.1	17q21.2	2013-06-25			ENSG00000213416	ENSG00000213416		"""Keratin associated proteins"""	16776	protein-coding gene	gene with protein product						11279113	Standard	NM_031854		Approved	KAP4.12	uc002hwa.3	Q9BQ66	OTTHUMG00000133632	ENST00000394014.1:c.213T>C	17.37:g.39280162A>G		Somatic		Capture	Illumina HiSeq	Phase_I	36533688	NM_031854	A3KMC5|Q495I0	Silent	SNP	ENST00000394014.1	37	CCDS32649.1																																																																																				0.677	KRTAP4-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257777.1		
CUEDC1	404093	broad.mit.edu	37	17	55950172	55950172	+	Silent	SNP	T	T	G			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr17:55950172T>G	ENST00000577830.1	-	5	1049	c.636A>C	c.(634-636)ccA>ccC	p.P212P	CUEDC1_ENST00000360238.2_Silent_p.P212P|CUEDC1_ENST00000407144.2_Silent_p.P212P|CUEDC1_ENST00000578357.1_5'Flank|CUEDC1_ENST00000577840.1_Silent_p.P75P	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1	212								p.P212P(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						CCATGGCAGGTGGACATCCCT	0.602																																					p.P212P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A636C	17						.						68.0	64.0	65.0					17																	55950172		2203	4300	6503	53305171	SO:0001819	synonymous_variant	404093	exon5			AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.636A>C	17.37:g.55950172T>G		Somatic		Capture	Illumina HiSeq	Phase_I	53305171	NM_017949	D3DTZ2|Q9NWD0	Silent	SNP	ENST00000577830.1	37	CCDS11599.1																																																																																				0.602	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443305.1	NM_017949	
TP53	7157	broad.mit.edu	37	17	7574018	7574018	+	Missense_Mutation	SNP	G	G	A	rs587782529		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr17:7574018G>A	ENST00000269305.4	-	10	1198	c.1009C>T	c.(1009-1011)Cgc>Tgc	p.R337C	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.R337C|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	337	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9452042}.|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11481490}.|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R337C(18)|p.0?(8)|p.R337fs*8(2)|p.R337G(1)|p.?(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATCTCGAAGCGCTCACGCCCA	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R337C	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,oesophagus,upper_third,Substitution - Missense,0 	.	31	Substitution - Missense(19)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(1)	central_nervous_system(6)|large_intestine(5)|ovary(4)|bone(4)|breast(3)|haematopoietic_and_lymphoid_tissue(2)|oesophagus(2)|stomach(1)|liver(1)|peritoneum(1)|lung(1)|kidney(1)	c.C1009T	17	GRCh37	CM981929	TP53	M		.						56.0	44.0	48.0					17																	7574018		2203	4300	6503	7514743	SO:0001583	missense	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1009C>T	17.37:g.7574018G>A	ENSP00000269305:p.Arg337Cys	Somatic		Capture	Illumina HiSeq	Phase_I	7514743	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	9.719	1.159246	0.21454	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.95205	-3.64;-3.64	5.43	3.38	0.38709	p53, tetramerisation domain (3);	0.000000	0.85682	D	0.000000	D	0.94321	0.8175	M	0.82323	2.585	0.48341	D	0.999635	P	0.39940	0.696	B	0.40940	0.344	D	0.93083	0.6493	10	0.87932	D	0	-7.3279	12.447	0.55657	0.0:0.0:0.6947:0.3053	.	337	P04637	P53_HUMAN	C	337;337;326	ENSP00000269305:R337C;ENSP00000391478:R337C	ENSP00000269305:R337C	R	-	1	0	TP53	7514743	0.558000	0.26554	0.006000	0.13384	0.274000	0.26718	1.012000	0.29924	0.615000	0.30124	0.561000	0.74099	CGC		0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SCN4A	6329	broad.mit.edu	37	17	62018679	62018679	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr17:62018679T>A	ENST00000435607.1	-	24	5039	c.4963A>T	c.(4963-4965)Aag>Tag	p.K1655*	SCN4A_ENST00000578147.1_Nonsense_Mutation_p.K1655*	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1655					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.K1655*(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTGTTGGGCTTGGCAATCCTC	0.582																																					p.K1655X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A4963T	17						.						77.0	79.0	78.0					17																	62018679		2104	4231	6335	59372411	SO:0001587	stop_gained	6329	exon24			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.4963A>T	17.37:g.62018679T>A	ENSP00000396320:p.Lys1655*	Somatic		Capture	Illumina HiSeq	Phase_I	59372411	NM_000334	Q15478|Q16447|Q7Z6B1	Nonsense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	T	43	10.140113	0.99345	.	.	ENSG00000007314	ENST00000435607	.	.	.	3.66	3.66	0.41972	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.9578	0.52991	0.0:0.0:0.0:1.0	.	.	.	.	X	1655	.	ENSP00000396320:K1655X	K	-	1	0	SCN4A	59372411	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.825000	0.86693	1.678000	0.50952	0.459000	0.35465	AAG		0.582	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
NOL4	8715	broad.mit.edu	37	18	31432873	31432873	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr18:31432873C>T	ENST00000261592.5	-	11	2147	c.1850G>A	c.(1849-1851)cGa>cAa	p.R617Q	NOL4_ENST00000535384.1_Missense_Mutation_p.R332Q|NOL4_ENST00000538587.1_Missense_Mutation_p.R543Q|NOL4_ENST00000589544.1_Missense_Mutation_p.R515Q|NOL4_ENST00000535475.1_Missense_Mutation_p.R398Q|NOL4_ENST00000269185.4_Missense_Mutation_p.R401Q	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	617						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.R617Q(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						AGCTGATTCTCGATATCCTGC	0.458																																					p.R553Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1658A	18						.						135.0	120.0	125.0					18																	31432873		2203	4300	6503	29686871	SO:0001583	missense	8715	exon10			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1850G>A	18.37:g.31432873C>T	ENSP00000261592:p.Arg617Gln	Somatic		Capture	Illumina HiSeq	Phase_I	29686871	NM_001198546	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353228	0.82132	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000535384;ENST00000535475;ENST00000538587	.	.	.	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000020	T	0.80314	0.4600	M	0.70595	2.14	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.984;0.998	D;D;D;D;P;D	0.83275	0.996;0.99;0.994;0.996;0.89;0.968	T	0.80587	-0.1316	9	0.87932	D	0	-7.5924	20.4082	0.99013	0.0:1.0:0.0:0.0	.	332;543;617;332;515;398	B7Z3Z7;B4DSQ0;O94818;F5H1E3;O94818-2;B3KRF4	.;.;NOL4_HUMAN;.;.;.	Q	617;401;332;398;543	.	ENSP00000261592:R617Q	R	-	2	0	NOL4	29686871	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.370000	0.79589	2.814000	0.96858	0.655000	0.94253	CGA		0.458	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
MAST1	22983	broad.mit.edu	37	19	12979571	12979571	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr19:12979571G>A	ENST00000251472.4	+	21	2720	c.2681G>A	c.(2680-2682)gGg>gAg	p.G894E		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1									p.G894E(2)		NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						CAGATGTCAGGGGATGTGGCA	0.577																																					p.G894E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2681A	19						.						102.0	102.0	102.0					19																	12979571		2203	4300	6503	12840571	SO:0001583	missense	22983	exon21			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.2681G>A	19.37:g.12979571G>A	ENSP00000251472:p.Gly894Glu	Somatic		Capture	Illumina HiSeq	Phase_I	12840571	NM_014975		Missense_Mutation	SNP	ENST00000251472.4	37	CCDS32921.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021554	0.54576	.	.	ENSG00000105613	ENST00000251472	T	0.66638	-0.22	4.83	4.83	0.62350	.	0.178072	0.37437	N	0.002098	T	0.77877	0.4196	M	0.68593	2.085	0.50813	D	0.999897	D	0.58620	0.983	P	0.61592	0.891	T	0.79376	-0.1829	10	0.51188	T	0.08	-31.6306	15.4002	0.74834	0.0:0.0:1.0:0.0	.	894	Q9Y2H9	MAST1_HUMAN	E	894	ENSP00000251472:G894E	ENSP00000251472:G894E	G	+	2	0	MAST1	12840571	1.000000	0.71417	0.970000	0.41538	0.144000	0.21451	4.141000	0.58038	2.242000	0.73789	0.561000	0.74099	GGG		0.577	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975	
RYR1	6261	broad.mit.edu	37	19	38976647	38976647	+	Silent	SNP	C	C	T	rs373382967		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr19:38976647C>T	ENST00000359596.3	+	34	5352	c.5352C>T	c.(5350-5352)gcC>gcT	p.A1784A	RYR1_ENST00000360985.3_Silent_p.A1784A|RYR1_ENST00000355481.4_Silent_p.A1784A			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1784	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.A1784A(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GTTTCGTGGCCGCTCTGCCAG	0.692																																					p.A1784A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5352T	19						.						27.0	27.0	27.0					19																	38976647		2203	4300	6503	43668487	SO:0001819	synonymous_variant	6261	exon34			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5352C>T	19.37:g.38976647C>T		Somatic		Capture	Illumina HiSeq	Phase_I	43668487	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																				0.692	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
GSK3A	2931	broad.mit.edu	37	19	42737327	42737327	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr19:42737327G>A	ENST00000222330.3	-	8	1160	c.1033C>T	c.(1033-1035)Cga>Tga	p.R345*	GSK3A_ENST00000398249.4_Nonsense_Mutation_p.R263*	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	345	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.R345*(1)		endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				TTCATCTCTCGGATTTGTTCC	0.607																																					p.R345X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1033T	19						.						105.0	104.0	105.0					19																	42737327		2203	4300	6503	47429167	SO:0001587	stop_gained	2931	exon8				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.1033C>T	19.37:g.42737327G>A	ENSP00000222330:p.Arg345*	Somatic		Capture	Illumina HiSeq	Phase_I	47429167	NM_019884	O14959	Nonsense_Mutation	SNP	ENST00000222330.3	37	CCDS12599.1	.	.	.	.	.	.	.	.	.	.	G	38	7.127931	0.98081	.	.	ENSG00000105723	ENST00000222330;ENST00000398249;ENST00000544315	.	.	.	4.75	4.75	0.60458	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.2328	12.1668	0.54135	0.0:0.0:0.8287:0.1713	.	.	.	.	X	345;263;290	.	ENSP00000222330:R345X	R	-	1	2	GSK3A	47429167	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.631000	0.61304	2.634000	0.89283	0.491000	0.48974	CGA		0.607	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1		
SAE1	10055	broad.mit.edu	37	19	47653606	47653606	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr19:47653606G>A	ENST00000270225.7	+	3	426	c.358G>A	c.(358-360)Gag>Aag	p.E120K	SAE1_ENST00000413379.3_Missense_Mutation_p.E120K|SAE1_ENST00000598840.1_Missense_Mutation_p.E120K|SAE1_ENST00000540850.1_5'UTR|SAE1_ENST00000392776.3_Missense_Mutation_p.E120K	NM_005500.2	NP_005491.1	Q9UBE0	SAE1_HUMAN	SUMO1 activating enzyme subunit 1	120					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitotic cell cycle (GO:0007346)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP-dependent protein binding (GO:0043008)|enzyme activator activity (GO:0008047)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|ubiquitin activating enzyme activity (GO:0004839)	p.E120K(1)		endometrium(3)|large_intestine(5)|lung(4)|ovary(1)	13		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)		GAAGAAACCAGAGTCATTTTT	0.403																																					p.E120K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G358A	19						.						141.0	146.0	144.0					19																	47653606		2203	4300	6503	52345446	SO:0001583	missense	10055	exon3			BC018271	CCDS12696.1, CCDS54284.1, CCDS54285.1	19q13.32	2013-09-26				ENSG00000142230		"""Ubiquitin-like modifier activating enzymes"""	30660	protein-coding gene	gene with protein product	"""activator Of sumo 1"""	613294				10187858, 9920803, 10217437	Standard	NM_005500		Approved	AOS1, FLJ3091, Sua1	uc002pgc.3	Q9UBE0		ENST00000270225.7:c.358G>A	19.37:g.47653606G>A	ENSP00000270225:p.Glu120Lys	Somatic		Capture	Illumina HiSeq	Phase_I	52345446	NM_005500	B2RDP5|B3KMQ2|F5GXX7|G3XAK6|O95717|Q9P020	Missense_Mutation	SNP	ENST00000270225.7	37	CCDS12696.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248248	0.80024	.	.	ENSG00000142230	ENST00000413379;ENST00000270225;ENST00000392776;ENST00000414294	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.24	5.24	0.73138	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.049428	0.85682	D	0.000000	T	0.49490	0.1560	L	0.31578	0.945	0.80722	D	1	B;B;B	0.28880	0.226;0.123;0.113	B;B;B	0.26310	0.064;0.068;0.068	T	0.44483	-0.9325	10	0.11485	T	0.65	.	17.947	0.89042	0.0:0.0:1.0:0.0	.	120;120;120	G3XAK6;F5GXX7;Q9UBE0	.;.;SAE1_HUMAN	K	120	ENSP00000416557:E120K;ENSP00000270225:E120K;ENSP00000440818:E120K;ENSP00000398818:E120K	ENSP00000270225:E120K	E	+	1	0	SAE1	52345446	1.000000	0.71417	0.732000	0.30844	0.983000	0.72400	7.289000	0.78701	2.609000	0.88269	0.655000	0.94253	GAG		0.403	SAE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466775.1	NM_005500	
EPS8L1	54869	broad.mit.edu	37	19	55592141	55592141	+	Splice_Site	SNP	C	C	G	rs201364329		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr19:55592141C>G	ENST00000201647.6	+	7	487	c.431C>G	c.(430-432)gCg>gGg	p.A144G	EPS8L1_ENST00000245618.5_Splice_Site_p.A17G|EPS8L1_ENST00000540810.1_Splice_Site_p.A80G|EPS8L1_ENST00000586329.1_Splice_Site_p.A126G|EPS8L1_ENST00000588359.1_Intron|EPS8L1_ENST00000592824.1_3'UTR	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	144					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)	p.A144G(1)|p.A126G(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GATTGGCAGGCGGAGCTGATC	0.682																																					p.A144G	Ovarian(149;255 1863 3636 27051 29647)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C431G	19						.						17.0	24.0	22.0					19																	55592141		2196	4293	6489	60283953	SO:0001630	splice_region_variant	54869	exon7			AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.430-1C>G	19.37:g.55592141C>G		Somatic		Capture	Illumina HiSeq	Phase_I	60283953	NM_133180	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Missense_Mutation	SNP	ENST00000201647.6	37	CCDS12914.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627070	0.87560	.	.	ENSG00000131037	ENST00000310075;ENST00000201647;ENST00000540810;ENST00000245618	T;T;T	0.61040	0.14;0.14;2.65	3.65	2.59	0.31030	Tensin phosphotyrosine-binding domain (1);	0.138034	0.46758	D	0.000274	T	0.68952	0.3057	M	0.79926	2.475	0.80722	D	1	D;P;D;D	0.60575	0.988;0.954;0.986;0.963	P;P;P;P	0.59056	0.838;0.634;0.851;0.665	T	0.70371	-0.4890	10	0.87932	D	0	-21.468	7.6885	0.28554	0.0:0.8735:0.0:0.1265	.	80;126;17;144	B4DKV7;Q8TE68-3;Q8TE68-2;Q8TE68	.;.;.;ES8L1_HUMAN	G	126;144;80;17	ENSP00000201647:A144G;ENSP00000437541:A80G;ENSP00000245618:A17G	ENSP00000201647:A144G	A	+	2	0	EPS8L1	60283953	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.908000	0.48750	0.814000	0.34374	0.591000	0.81541	GCG		0.682	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729	Missense_Mutation
ZNF329	79673	broad.mit.edu	37	19	58640849	58640849	+	Missense_Mutation	SNP	G	G	A	rs188135790	byFrequency	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr19:58640849G>A	ENST00000598312.1	-	4	255	c.22C>T	c.(22-24)Cgg>Tgg	p.R8W	ZNF329_ENST00000358067.4_Missense_Mutation_p.R8W	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	8					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R8W(1)		NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		GGAAAATTCCGAGTCGTCATT	0.398													G|||	3	0.000599042	0.0	0.0029	5008	,	,		19002	0.0		0.001	False		,,,				2504	0.0				p.R8W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C22T	19						.																																			63332661	SO:0001583	missense	79673	exon4			AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.22C>T	19.37:g.58640849G>A	ENSP00000470008:p.Arg8Trp	Somatic		Capture	Illumina HiSeq	Phase_I	63332661	NM_024620	B3KR32|Q9H9R7	Missense_Mutation	SNP	ENST00000598312.1	37	CCDS12972.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	3.376	-0.127486	0.06753	.	.	ENSG00000181894	ENST00000358067;ENST00000500161	T;T	0.09163	3.01;3.01	4.48	0.0181	0.14115	.	0.709738	0.12219	N	0.488533	T	0.04092	0.0114	N	0.03608	-0.345	0.22354	N	0.999171	B	0.02656	0.0	B	0.01281	0.0	T	0.37641	-0.9697	10	0.52906	T	0.07	-8.5037	4.3979	0.11372	0.2737:0.1641:0.5622:0.0	.	8	Q86UD4	ZN329_HUMAN	W	8	ENSP00000350773:R8W;ENSP00000439527:R8W	ENSP00000350773:R8W	R	-	1	2	ZNF329	63332661	0.357000	0.24938	0.467000	0.27180	0.024000	0.10985	0.266000	0.18534	0.124000	0.18369	-0.751000	0.03497	CGG		0.398	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466724.1	NM_024620	
OBSCN	84033	broad.mit.edu	37	1	228437723	228437724	+	Frame_Shift_Ins	INS	-	-	G	rs572422398		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr1:228437723_228437724insG	ENST00000422127.1	+	14	4135_4136	c.4091_4092insG	c.(4090-4095)gcggggfs	p.AG1364fs	OBSCN_ENST00000570156.2_Frame_Shift_Ins_p.AG1456fs|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Frame_Shift_Ins_p.AG1364fs|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1364	Ig-like 14.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGGCCGAGGCGGGGGCCATTG	0.624																																					p.A1364fs												.	.	0			c.4091_4092insG	1						.																																			226504347	SO:0001589	frameshift_variant	84033	exon14			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4096dupG	1.37:g.228437728_228437728dupG	ENSP00000409493:p.Ala1364fs	None		Capture	Illumina HiSeq	Phase_I	226504346	NM_001098623	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Ins	INS	ENST00000422127.1	37	CCDS58065.1																																																																																				0.624	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ARNT	405	broad.mit.edu	37	1	150808899	150808899	+	Missense_Mutation	SNP	A	A	C	rs200439860		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr1:150808899A>C	ENST00000358595.5	-	7	757	c.557T>G	c.(556-558)gTg>gGg	p.V186G	ARNT_ENST00000354396.2_Missense_Mutation_p.V186G|ARNT_ENST00000505755.1_Missense_Mutation_p.V171G|ARNT_ENST00000515192.1_Missense_Mutation_p.V177G|ARNT_ENST00000468970.1_5'UTR	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	186	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.V186G(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CACATACACCACCCTGCCTGT	0.453			T	ETV6	AML																																p.V171G			Dom	yes		1	1q21	405	aryl hydrocarbon receptor nuclear translocator		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T512G	1						.						98.0	83.0	88.0					1																	150808899		2203	4300	6503	149075523	SO:0001583	missense	405	exon6			AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.557T>G	1.37:g.150808899A>C	ENSP00000351407:p.Val186Gly	Somatic		Capture	Illumina HiSeq	Phase_I	149075523	NM_001197325	B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Missense_Mutation	SNP	ENST00000358595.5	37	CCDS970.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.855831	0.91355	.	.	ENSG00000143437	ENST00000358595;ENST00000368975;ENST00000354396;ENST00000515192;ENST00000394700;ENST00000505755	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	5.52	5.52	0.82312	PAS (2);PAS fold (1);	0.161095	0.56097	D	0.000032	T	0.49525	0.1562	M	0.92833	3.35	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.998;0.989;0.998;0.998;0.998;0.999;0.998	D;D;D;D;D;D;D	0.75484	0.977;0.928;0.977;0.981;0.981;0.986;0.977	T	0.63786	-0.6558	10	0.87932	D	0	.	15.938	0.79729	1.0:0.0:0.0:0.0	.	170;186;171;186;177;171;186	B4E3L5;A6NGV6;A8K6P0;F8WAP6;P27540-3;P27540-2;P27540	.;.;.;.;.;.;ARNT_HUMAN	G	186;186;186;177;170;171	ENSP00000351407:V186G;ENSP00000346372:V186G;ENSP00000423851:V177G;ENSP00000427571:V171G	ENSP00000346372:V186G	V	-	2	0	ARNT	149075523	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	7.105000	0.77031	2.222000	0.72286	0.533000	0.62120	GTG		0.453	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084741.2		
LCE1B	353132	broad.mit.edu	37	1	152785254	152785254	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr1:152785254G>A	ENST00000360090.3	+	1	808	c.332G>A	c.(331-333)gGc>gAc	p.G111D		NM_178349.1	NP_848126.1	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	111	Gly-rich.				keratinization (GO:0031424)			p.G111D(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|skin(2)	18	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGAGGGAGTGGCCAGCACTCT	0.617																																					p.G111D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G332A	1						.						36.0	44.0	41.0					1																	152785254		2201	4300	6501	151051878	SO:0001583	missense	353132	exon1			BI670515	CCDS1027.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000196734	ENSG00000196734		"""Late cornified envelopes"""	16611	protein-coding gene	gene with protein product		612604	"""small proline rich-like (epidermal differentiation complex) 2A"""	SPRL2A		11698679	Standard	NM_178349		Approved	LEP2	uc001faq.3	Q5T7P3	OTTHUMG00000014402	ENST00000360090.3:c.332G>A	1.37:g.152785254G>A	ENSP00000353203:p.Gly111Asp	Somatic		Capture	Illumina HiSeq	Phase_I	151051878	NM_178349	A4IF40	Missense_Mutation	SNP	ENST00000360090.3	37	CCDS1027.1	.	.	.	.	.	.	.	.	.	.	G	0.952	-0.706004	0.03255	.	.	ENSG00000196734	ENST00000360090;ENST00000439693	T	0.05139	3.49	4.68	1.61	0.23674	.	1.393460	0.05169	N	0.499190	T	0.02119	0.0066	L	0.47716	1.5	0.09310	N	1	B	0.18968	0.032	B	0.18561	0.022	T	0.46925	-0.9156	10	0.87932	D	0	.	2.996	0.05998	0.099:0.2319:0.5002:0.1689	.	111	Q5T7P3	LCE1B_HUMAN	D	111;103	ENSP00000353203:G111D	ENSP00000353203:G111D	G	+	2	0	LCE1B	151051878	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.838000	0.27572	0.223000	0.20920	-0.158000	0.13435	GGC		0.617	LCE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040060.1	NM_178349	
SLC2A5	6518	broad.mit.edu	37	1	9097840	9097840	+	Silent	SNP	G	G	A	rs371723590		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr1:9097840G>A	ENST00000377424.4	-	12	1490	c.1311C>T	c.(1309-1311)ctC>ctT	p.L437L	SLC2A5_ENST00000536305.1_Silent_p.L378L|SLC2A5_ENST00000535586.1_Silent_p.L322L	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	437					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)	p.L437L(1)		endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		TGTACGGGCCGAGGCCCTCCT	0.602													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19000	0.0		0.0	False		,,,				2504	0.0				p.L437L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1311T	1						.	G		0,4406		0,0,2203	64.0	68.0	67.0		1311	-10.7	0.0	1		67	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC2A5	NM_003039.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		437/502	9097840	1,13005	2203	4300	6503	9020427	SO:0001819	synonymous_variant	6518	exon12			BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1311C>T	1.37:g.9097840G>A		Somatic		Capture	Illumina HiSeq	Phase_I	9020427	NM_003039	Q14770|Q5T977|Q8IVB3	Silent	SNP	ENST00000377424.4	37	CCDS99.1																																																																																				0.602	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039	
SRSF4	6429	broad.mit.edu	37	1	29475704	29475704	+	Silent	SNP	G	G	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr1:29475704G>T	ENST00000373795.4	-	6	937	c.703C>A	c.(703-705)Cgg>Agg	p.R235R	SRSF4_ENST00000466448.1_5'UTR|RP11-242O24.3_ENST00000413004.1_lincRNA|SRSF4_ENST00000546138.1_Missense_Mutation_p.P133Q	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	235	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R235R(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						ctctggctccggctccggctc	0.582																																					p.R235R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C703A	1						.						32.0	40.0	37.0					1																	29475704		2195	4266	6461	29348291	SO:0001819	synonymous_variant	6429	exon6			BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.703C>A	1.37:g.29475704G>T		Somatic		Capture	Illumina HiSeq	Phase_I	29348291	NM_005626	Q5VXP1|Q9BUA4|Q9UEB5	Silent	SNP	ENST00000373795.4	37	CCDS333.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.019028	0.35606	.	.	ENSG00000116350	ENST00000546138	T	0.17370	2.28	5.09	4.16	0.48862	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.25505	N	0.987515	B	0.06786	0.001	B	0.08055	0.003	T	0.15407	-1.0438	8	0.87932	D	0	.	11.932	0.52851	0.0:0.0:0.6846:0.3154	.	133	F6T1J1	.	Q	133	ENSP00000444600:P133Q	ENSP00000444600:P133Q	P	-	2	0	SRSF4	29348291	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.836000	0.55813	1.329000	0.45376	0.655000	0.94253	CCG		0.582	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626	
SRSF4	6429	broad.mit.edu	37	1	29475711	29475711	+	Silent	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr1:29475711G>A	ENST00000373795.4	-	6	930	c.696C>T	c.(694-696)agC>agT	p.S232S	SRSF4_ENST00000466448.1_5'UTR|RP11-242O24.3_ENST00000413004.1_lincRNA|SRSF4_ENST00000546138.1_Missense_Mutation_p.P131S	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	232	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S232S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						tccggctccggctcTTGCTCC	0.582																																					p.S232S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C696T	1						.																																			29348298	SO:0001819	synonymous_variant	6429	exon6			BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.696C>T	1.37:g.29475711G>A		Somatic		Capture	Illumina HiSeq	Phase_I	29348298	NM_005626	Q5VXP1|Q9BUA4|Q9UEB5	Silent	SNP	ENST00000373795.4	37	CCDS333.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717726	0.48622	.	.	ENSG00000116350	ENST00000546138	T	0.17213	2.29	5.62	4.71	0.59529	.	.	.	.	.	T	0.12390	0.0301	.	.	.	0.29644	N	0.844465	B	0.25312	0.123	B	0.21151	0.033	T	0.11324	-1.0592	7	.	.	.	.	13.3594	0.60646	0.0755:0.0:0.9245:0.0	.	131	F6T1J1	.	S	131	ENSP00000444600:P131S	.	P	-	1	0	SRSF4	29348298	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.076000	0.30729	1.374000	0.46228	0.655000	0.94253	CCG		0.582	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626	
SRSF4	6429	broad.mit.edu	37	1	29475714	29475714	+	Silent	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr1:29475714C>T	ENST00000373795.4	-	6	927	c.693G>A	c.(691-693)aaG>aaA	p.K231K	SRSF4_ENST00000466448.1_5'UTR|RP11-242O24.3_ENST00000413004.1_lincRNA|SRSF4_ENST00000546138.1_Missense_Mutation_p.E130K	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	231	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K231K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						ggctccggctcTTGCTCCGGG	0.567																																					p.K231K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G693A	1						.						26.0	33.0	31.0					1																	29475714		2187	4242	6429	29348301	SO:0001819	synonymous_variant	6429	exon6			BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.693G>A	1.37:g.29475714C>T		Somatic		Capture	Illumina HiSeq	Phase_I	29348301	NM_005626	Q5VXP1|Q9BUA4|Q9UEB5	Silent	SNP	ENST00000373795.4	37	CCDS333.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.575621	0.45902	.	.	ENSG00000116350	ENST00000546138	T	0.17370	2.28	5.77	3.89	0.44902	.	.	.	.	.	T	0.10252	0.0251	.	.	.	0.24823	N	0.992575	B	0.02656	0.0	B	0.08055	0.003	T	0.28713	-1.0035	7	.	.	.	.	7.6065	0.28105	0.0:0.7201:0.1337:0.1462	.	130	F6T1J1	.	K	130	ENSP00000444600:E130K	.	E	-	1	0	SRSF4	29348301	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.158000	0.42329	1.440000	0.47531	0.655000	0.94253	GAG		0.567	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626	
COL16A1	1307	broad.mit.edu	37	1	32165417	32165417	+	Missense_Mutation	SNP	G	G	A	rs41263975		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr1:32165417G>A	ENST00000373672.3	-	4	779	c.263C>T	c.(262-264)aCg>aTg	p.T88M	COL16A1_ENST00000373668.3_Missense_Mutation_p.T88M|COL16A1_ENST00000271069.6_Missense_Mutation_p.T88M	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	88	Laminin G-like.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.T88M(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CATTTACCGCGTGGGCTGGGT	0.607																																					p.T88M	Colon(143;498 1786 21362 25193 36625)											.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C263T	1						.	G	MET/THR	1,3923		0,1,1961	53.0	55.0	54.0		263	0.3	0.0	1	dbSNP_127	54	1,8295		0,1,4147	no	missense	COL16A1	NM_001856.3	81	0,2,6108	AA,AG,GG		0.0121,0.0255,0.0164	benign	88/1605	32165417	2,12218	1962	4148	6110	31938004	SO:0001583	missense	1307	exon4			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.263C>T	1.37:g.32165417G>A	ENSP00000362776:p.Thr88Met	Somatic		Capture	Illumina HiSeq	Phase_I	31938004	NM_001856	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849287	0.32699	2.55E-4	1.21E-4	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668	T;T;T	0.27557	1.66;1.66;1.66	4.64	0.301	0.15781	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.548538	0.16742	N	0.201387	T	0.33990	0.0882	M	0.80508	2.5	0.09310	N	0.999995	D;B	0.55605	0.972;0.015	B;B	0.43052	0.406;0.006	T	0.26224	-1.0109	10	0.54805	T	0.06	.	8.6228	0.33870	0.3598:0.0:0.6402:0.0	rs41263975	88;88	A6NCT7;Q07092	.;COGA1_HUMAN	M	88	ENSP00000362776:T88M;ENSP00000271069:T88M;ENSP00000362772:T88M	ENSP00000271069:T88M	T	-	2	0	COL16A1	31938004	0.909000	0.30893	0.005000	0.12908	0.011000	0.07611	1.265000	0.33027	-0.134000	0.11516	0.561000	0.74099	ACG		0.607	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
TNN	63923	broad.mit.edu	37	1	175063177	175063177	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr1:175063177C>A	ENST00000239462.4	+	7	1489	c.1376C>A	c.(1375-1377)gCa>gAa	p.A459E		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	459	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.A459E(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GAAGACACAGCAACTGTCTCC	0.453																																					p.A459E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1376A	1						.						99.0	85.0	89.0					1																	175063177		2203	4300	6503	173329800	SO:0001583	missense	63923	exon7			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1376C>A	1.37:g.175063177C>A	ENSP00000239462:p.Ala459Glu	Somatic		Capture	Illumina HiSeq	Phase_I	173329800	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.080683	0.36758	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.56275	0.47	5.4	3.54	0.40534	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.344248	0.27294	N	0.020039	T	0.74450	0.3718	M	0.93062	3.375	0.30275	N	0.791849	P;D	0.54601	0.931;0.967	P;D	0.63877	0.832;0.919	T	0.75411	-0.3327	10	0.66056	D	0.02	.	10.0172	0.42022	0.0:0.8418:0.0:0.1582	.	459;459	B3KXB6;Q9UQP3	.;TENN_HUMAN	E	459	ENSP00000239462:A459E	ENSP00000239462:A459E	A	+	2	0	TNN	173329800	0.992000	0.36948	0.075000	0.20258	0.039000	0.13416	3.064000	0.49986	0.658000	0.30925	0.563000	0.77884	GCA		0.453	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
PTPRT	11122	broad.mit.edu	37	20	40979285	40979285	+	Silent	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr20:40979285G>A	ENST00000373187.1	-	11	1847	c.1848C>T	c.(1846-1848)tcC>tcT	p.S616S	PTPRT_ENST00000373198.4_Silent_p.S616S|PTPRT_ENST00000356100.2_Silent_p.S616S|PTPRT_ENST00000373201.1_Silent_p.S616S|PTPRT_ENST00000373184.1_Silent_p.S616S|PTPRT_ENST00000373193.3_Silent_p.S616S|PTPRT_ENST00000373190.1_Silent_p.S616S			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	616	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.S616S(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GAGCTCCCCGGGACTGAGCGG	0.527																																					p.S616S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1848T	20						.						159.0	167.0	164.0					20																	40979285		2040	4187	6227	40412699	SO:0001819	synonymous_variant	11122	exon11			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1848C>T	20.37:g.40979285G>A		Somatic		Capture	Illumina HiSeq	Phase_I	40412699	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	CCDS42874.1																																																																																				0.527	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
SLC2A10	81031	broad.mit.edu	37	20	45362440	45362440	+	Silent	SNP	G	G	A	rs148424607		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr20:45362440G>A	ENST00000359271.2	+	5	1843	c.1593G>A	c.(1591-1593)ccG>ccA	p.P531P		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	531					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)	p.P531P(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				CTGGCATCCCGTACAGCCGCA	0.597																																					p.P531P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1593A	20						.	G		2,4404	4.2+/-10.8	0,2,2201	106.0	87.0	94.0		1593	1.3	0.8	20	dbSNP_134	94	0,8600		0,0,4300	no	coding-synonymous	SLC2A10	NM_030777.3		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		531/542	45362440	2,13004	2203	4300	6503	44795847	SO:0001819	synonymous_variant	81031	exon5			AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.1593G>A	20.37:g.45362440G>A		Somatic		Capture	Illumina HiSeq	Phase_I	44795847	NM_030777	A8K4J6|Q3MIX5|Q9H4I6	Silent	SNP	ENST00000359271.2	37	CCDS13402.1																																																																																				0.597	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2		
PTPN1	5770	broad.mit.edu	37	20	49197976	49197976	+	Silent	SNP	C	C	T	rs566921306		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr20:49197976C>T	ENST00000371621.3	+	9	1437	c.1263C>T	c.(1261-1263)gcC>gcT	p.A421A	PTPN1_ENST00000541713.1_Silent_p.A348A	NM_001278618.1|NM_002827.2	NP_001265547.1|NP_002818.1	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type 1	421					actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine dephosphorylation involved in inactivation of protein kinase activity (GO:1990264)|platelet activation (GO:0030168)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|regulation of endocytosis (GO:0030100)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of signal transduction (GO:0009966)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|sorting endosome (GO:0097443)	enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|zinc ion binding (GO:0008270)	p.A421A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(2)	16		Lung NSC(126;0.163)			Tiludronate(DB01133)	TCCTCACGGCCGGCGCTTACC	0.602																																					p.A421A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1263T	20						.																																			48631383	SO:0001819	synonymous_variant	5770	exon9				CCDS13430.1, CCDS63309.1	20q13.1-q13.2	2011-06-09			ENSG00000196396	ENSG00000196396		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9642	protein-coding gene	gene with protein product		176885		PTP1B		2164224	Standard	NM_002827		Approved		uc002xvl.3	P18031	OTTHUMG00000032729	ENST00000371621.3:c.1263C>T	20.37:g.49197976C>T		Somatic		Capture	Illumina HiSeq	Phase_I	48631383	NM_002827	Q5TGD8|Q9BQV9|Q9NQQ4	Silent	SNP	ENST00000371621.3	37	CCDS13430.1																																																																																				0.602	PTPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079694.2		
GNAS	2778	broad.mit.edu	37	20	57485873	57485873	+	Missense_Mutation	SNP	G	G	A	rs397514456		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr20:57485873G>A	ENST00000371085.3	+	13	1598	c.1174G>A	c.(1174-1176)Gag>Aag	p.E392K	GNAS_ENST00000371095.3_Missense_Mutation_p.E378K|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.E377K|GNAS_ENST00000371102.4_Missense_Mutation_p.E1021K|GNAS_ENST00000371100.4_Missense_Mutation_p.E1035K|GNAS_ENST00000354359.7_Missense_Mutation_p.E393K|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000306090.10_Missense_Mutation_p.E378K	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	392			E -> K (in PHP1C; significantly reduces receptor-mediated activation; displays normal receptor-independent activation). {ECO:0000269|PubMed:21488135}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.E1035K(1)|p.E392K(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TCGTCAGTACGAGCTGCTCTA	0.458			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.E378K	Colon(117;935 1597 6045 8307 46442)		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1132A	20	GRCh37	CM030882	GNAS	M		.						108.0	82.0	91.0					20																	57485873		2203	4300	6503	56919268	SO:0001583	missense	2778	exon12			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.1174G>A	20.37:g.57485873G>A	ENSP00000360126:p.Glu392Lys	Somatic		Capture	Illumina HiSeq	Phase_I	56919268	NM_080426	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	37	CCDS13472.1	.	.	.	.	.	.	.	.	.	.	G	34	5.331282	0.95733	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090;ENST00000371082	D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.91222	0.7234	M	0.78049	2.395	0.80722	D	1	P;P;P;D	0.89917	0.786;0.786;0.746;1.0	B;B;B;D	0.72075	0.245;0.308;0.205;0.976	D	0.91786	0.5439	10	0.62326	D	0.03	.	19.0096	0.92868	0.0:0.0:1.0:0.0	.	392;393;377;1035	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	K	1035;1021;378;392;393;377;378;158	ENSP00000360141:E1035K;ENSP00000360143:E1021K;ENSP00000360136:E378K;ENSP00000360126:E392K;ENSP00000346328:E393K;ENSP00000265620:E377K;ENSP00000304472:E378K	ENSP00000265620:E377K	E	+	1	0	GNAS	56919268	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	9.338000	0.96553	2.567000	0.86603	0.467000	0.42956	GAG		0.458	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	NM_000516	
SYCP2	10388	broad.mit.edu	37	20	58455468	58455468	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr20:58455468C>T	ENST00000357552.3	-	31	3056	c.2831G>A	c.(2830-2832)tGt>tAt	p.C944Y	SYCP2_ENST00000371001.2_Missense_Mutation_p.C944Y			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	944					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)	p.C944Y(1)		NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			GCTGTCATCACATCTGTACTC	0.299																																					p.C944Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2831A	20						.						105.0	95.0	99.0					20																	58455468		2197	4294	6491	57888863	SO:0001583	missense	10388	exon30			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.2831G>A	20.37:g.58455468C>T	ENSP00000350162:p.Cys944Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	57888863	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	37	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.610809	0.28712	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.18338	2.49;2.49;2.22	6.01	3.03	0.35002	.	0.473531	0.23316	N	0.049509	T	0.16171	0.0389	L	0.56769	1.78	0.26824	N	0.968722	B	0.20261	0.043	B	0.17433	0.018	T	0.17107	-1.0380	10	0.49607	T	0.09	1.0146	6.5403	0.22377	0.146:0.7027:0.0:0.1513	.	944	Q9BX26	SYCP2_HUMAN	Y	944	ENSP00000360040:C944Y;ENSP00000350162:C944Y;ENSP00000402456:C944Y	ENSP00000350162:C944Y	C	-	2	0	SYCP2	57888863	0.092000	0.21681	0.526000	0.27913	0.757000	0.42996	0.312000	0.19397	0.419000	0.25927	0.655000	0.94253	TGT		0.299	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
USP25	29761	broad.mit.edu	37	21	17150333	17150333	+	Missense_Mutation	SNP	C	C	A	rs79081278		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr21:17150333C>A	ENST00000285679.6	+	4	748	c.379C>A	c.(379-381)Caa>Aaa	p.Q127K	USP25_ENST00000285681.2_Missense_Mutation_p.Q127K|USP25_ENST00000351097.5_Missense_Mutation_p.Q127K|USP25_ENST00000547201.1_3'UTR|USP25_ENST00000400183.2_Missense_Mutation_p.Q127K	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	127					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TGATGAGGAACAAGCCATTAG	0.333																																					p.Q127K												.	.	0			c.C379A	21						.						57.0	57.0	57.0					21																	17150333		2203	4300	6503	16072204	SO:0001583	missense	29761	exon4			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.379C>A	21.37:g.17150333C>A	ENSP00000285679:p.Gln127Lys	None		Capture	Illumina HiSeq	Phase_I	16072204	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	37	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728068	0.69074	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000351097;ENST00000400183	T;T;T;T	0.31510	1.9;1.89;1.49;1.91	4.9	4.9	0.64082	Ubiquitin interacting motif (1);	0.000000	0.85682	D	0.000000	T	0.40297	0.1111	L	0.29908	0.895	0.80722	D	1	P;D;B;D	0.59357	0.728;0.963;0.34;0.985	B;D;B;D	0.73708	0.39;0.959;0.108;0.981	T	0.06391	-1.0829	10	0.06236	T	0.91	.	18.4483	0.90693	0.0:1.0:0.0:0.0	.	127;127;127;127	Q9UHP3-3;Q96B65;Q9UHP3-1;Q9UHP3	.;.;.;UBP25_HUMAN	K	127	ENSP00000285681:Q127K;ENSP00000285679:Q127K;ENSP00000299574:Q127K;ENSP00000383044:Q127K	ENSP00000285679:Q127K	Q	+	1	0	USP25	16072204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.414000	0.80117	2.424000	0.82194	0.585000	0.79938	CAA		0.333	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
KCNE1	3753	broad.mit.edu	37	21	35821816	35821816	+	Silent	SNP	G	G	A	rs368465967		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr21:35821816G>A	ENST00000337385.3	-	3	492	c.117C>T	c.(115-117)gaC>gaT	p.D39D	KCNE1_ENST00000399289.3_Silent_p.D39D|KCNE1_ENST00000416357.2_Silent_p.D39D|KCNE1_ENST00000432085.1_Silent_p.D39D|KCNE1_ENST00000399284.1_Silent_p.D39D|KCNE1_ENST00000399286.2_Silent_p.D39D	NM_001270402.1|NM_001270403.1	NP_001257331.1|NP_001257332.1	P15382	KCNE1_HUMAN	potassium voltage-gated channel, Isk-related family, member 1	39					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular response to cAMP (GO:0071320)|membrane repolarization (GO:0086009)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|protein N-linked glycosylation (GO:0006487)|protein O-linked glycosylation (GO:0006493)|regulation of delayed rectifier potassium channel activity (GO:1902259)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	potassium channel regulator activity (GO:0015459)|telethonin binding (GO:0031433)|voltage-gated potassium channel activity (GO:0005249)	p.D39D(1)		large_intestine(4)|lung(1)|ovary(2)	7					Indapamide(DB00808)	CCAGCTTGCCGTCACTGCTGC	0.622																																					p.D39D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C117T	21						.	A	,,,	0,4406		0,0,2203	82.0	67.0	72.0		117,117,117,117	0.8	0.0	21		72	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KCNE1	NM_000219.3,NM_001127668.1,NM_001127669.1,NM_001127670.1	,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,	39/130,39/130,39/130,39/130	35821816	1,13005	2203	4300	6503	34743686	SO:0001819	synonymous_variant	3753	exon3			L28168	CCDS13636.1	21q22.1-q22.2	2014-09-17			ENSG00000180509	ENSG00000180509		"""Potassium channels"""	6240	protein-coding gene	gene with protein product		176261				8432548	Standard	NM_001127670		Approved	minK, ISK, JLNS2, LQT5	uc010gmp.4	P15382	OTTHUMG00000086236	ENST00000337385.3:c.117C>T	21.37:g.35821816G>A		Somatic		Capture	Illumina HiSeq	Phase_I	34743686	NM_001127668	A5H1P2|Q8N709|Q91Z94	Silent	SNP	ENST00000337385.3	37	CCDS13636.1																																																																																				0.622	KCNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194155.1		
KRTAP10-6	386674	broad.mit.edu	37	21	46011720	46011720	+	Missense_Mutation	SNP	G	G	A	rs9977124	byFrequency	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr21:46011720G>A	ENST00000400368.1	-	1	666	c.646C>T	c.(646-648)Cca>Tca	p.P216S	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	216	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.P216S(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						CAGCAAGTTGGCTGGCAGCTA	0.672													.|||	290	0.0579073	0.1543	0.0476	5008	,	,		21953	0.0446		0.003	False		,,,				2504	0.0051				p.P216S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C646T	21						.	G	,SER/PRO	227,4163		25,177,1993	92.0	120.0	111.0		,646	0.2	0.0	21	dbSNP_119	111	0,8600		0,0,4300	no	intron,missense	TSPEAR,KRTAP10-6	NM_144991.2,NM_198688.2	,74	25,177,6293	AA,AG,GG		0.0,5.1708,1.7475	,benign	,216/366	46011720	227,12763	2195	4300	6495	44836148	SO:0001583	missense	386674	exon1			AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.646C>T	21.37:g.46011720G>A	ENSP00000383219:p.Pro216Ser	Somatic		Capture	Illumina HiSeq	Phase_I	44836148	NM_198688		Missense_Mutation	SNP	ENST00000400368.1	37	CCDS42959.1	69	0.03159340659340659	43	0.08739837398373984	12	0.03314917127071823	14	0.024475524475524476	0	0.0	-	10.25	1.298149	0.23650	0.051708	0.0	ENSG00000188155	ENST00000400368	T	0.01887	4.58	3.12	0.189	0.15119	.	.	.	.	.	T	0.00144	0.0004	L	0.49640	1.575	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.43458	-0.9390	9	0.49607	T	0.09	.	6.7771	0.23626	0.3716:0.0:0.6284:0.0	rs9977124	216	P60371	KR106_HUMAN	S	216	ENSP00000383219:P216S	ENSP00000383219:P216S	P	-	1	0	KRTAP10-6	44836148	0.000000	0.05858	0.006000	0.13384	0.237000	0.25408	-0.250000	0.08830	0.184000	0.20083	0.508000	0.49915	CCA		0.672	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
KRTAP12-4	386684	broad.mit.edu	37	21	46074522	46074522	+	Missense_Mutation	SNP	T	T	G	rs76605324		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr21:46074522T>G	ENST00000391618.1	-	1	54	c.10A>C	c.(10-12)Acc>Ccc	p.T4P	TSPEAR_ENST00000323084.4_Intron	NM_198698.1	NP_941971.1	P60329	KR124_HUMAN	keratin associated protein 12-4	4						keratin filament (GO:0045095)				lung(4)|ovary(1)|prostate(1)	6						GAGTGGCTGGTGTGGCACATG	0.652																																					p.T4P												.	.	0			c.A10C	21						.						10.0	14.0	13.0					21																	46074522		2033	4170	6203	44898950	SO:0001583	missense	386684	exon1			AB076360	CCDS42963.1	21q22.3	2006-03-13			ENSG00000212933	ENSG00000212933		"""Keratin associated proteins"""	20532	protein-coding gene	gene with protein product							Standard	NM_198698		Approved	KRTAP12.4	uc002zfs.1	P60329	OTTHUMG00000057633	ENST00000391618.1:c.10A>C	21.37:g.46074522T>G	ENSP00000375476:p.Thr4Pro	None		Capture	Illumina HiSeq	Phase_I	44898950	NM_198698	Q08AF5	Missense_Mutation	SNP	ENST00000391618.1	37	CCDS42963.1	.	.	.	.	.	.	.	.	.	.	t	12.57	1.978775	0.34942	.	.	ENSG00000212933	ENST00000391618	T	0.02216	4.39	4.93	1.08	0.20341	.	.	.	.	.	T	0.04048	0.0113	L	0.55213	1.73	0.29008	N	0.887068	P	0.36587	0.559	P	0.44647	0.456	T	0.30707	-0.9969	9	0.72032	D	0.01	.	4.452	0.11624	0.0:0.1817:0.1673:0.651	.	4	P60329	KR124_HUMAN	P	4	ENSP00000375476:T4P	ENSP00000375476:T4P	T	-	1	0	KRTAP12-4	44898950	0.027000	0.19231	0.970000	0.41538	0.028000	0.11728	0.154000	0.16343	0.005000	0.14708	0.383000	0.25322	ACC		0.652	KRTAP12-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128036.1		
TRIOBP	11078	broad.mit.edu	37	22	38120343	38120343	+	Missense_Mutation	SNP	A	A	G	rs71317067		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr22:38120343A>G	ENST00000406386.3	+	7	2035	c.1780A>G	c.(1780-1782)Aca>Gca	p.T594A		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	594					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.T594A(5)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CAATAGAGCTACACGAGACAA	0.572																																					p.T594A												.	.	5	Substitution - Missense(5)	skin(2)|large_intestine(1)|NS(1)|prostate(1)	c.A1780G	22						.						112.0	164.0	147.0					22																	38120343		1955	4165	6120	36450289	SO:0001583	missense	11078	exon7			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1780A>G	22.37:g.38120343A>G	ENSP00000384312:p.Thr594Ala	Somatic		Capture	Illumina HiSeq	Phase_I	36450289	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	-	7.079	0.569772	0.13560	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.20738	2.05	2.6	0.164	0.14990	.	.	.	.	.	T	0.11879	0.0289	L	0.28115	0.83	0.09310	N	0.999998	B	0.21381	0.055	B	0.12837	0.008	T	0.32745	-0.9895	9	0.26408	T	0.33	.	5.3198	0.15876	0.5376:0.0:0.0:0.4624	.	594	Q9H2D6	TARA_HUMAN	A	594	ENSP00000384312:T594A	ENSP00000384312:T594A	T	+	1	0	TRIOBP	36450289	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.521000	0.06245	-0.162000	0.10964	-1.765000	0.00666	ACA		0.572	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
EP300	2033	broad.mit.edu	37	22	41574534	41574534	+	Silent	SNP	T	T	G			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr22:41574534T>G	ENST00000263253.7	+	31	8038	c.6819T>G	c.(6817-6819)gtT>gtG	p.V2273V	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	2273					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.V2273V(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GGTCCCCTGTTCAGCCCAACC	0.587			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.V2273V			Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T6819G	22						.						122.0	121.0	122.0					22																	41574534		2203	4300	6503	39904480	SO:0001819	synonymous_variant	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.6819T>G	22.37:g.41574534T>G		Somatic		Capture	Illumina HiSeq	Phase_I	39904480	NM_001429	B1AKC2	Silent	SNP	ENST00000263253.7	37	CCDS14010.1																																																																																				0.587	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
SHANK3	85358	broad.mit.edu	37	22	51153450	51153450	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr22:51153450G>A	ENST00000414786.2	+	19	2425	c.2198G>A	c.(2197-2199)cGg>cAg	p.R733Q	SHANK3_ENST00000445220.2_Missense_Mutation_p.R749Q|SHANK3_ENST00000262795.3_Missense_Mutation_p.R763Q			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	747					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.R763Q(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CCCACCAGTCGGAGGATCACA	0.682																																					p.R763Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2288A	22						.						11.0	14.0	13.0					22																	51153450		2153	4232	6385	49500316	SO:0001583	missense	85358	exon20			AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.2198G>A	22.37:g.51153450G>A	ENSP00000464552:p.Arg733Gln	Somatic		Capture	Illumina HiSeq	Phase_I	49500316	NM_001080420	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	37		.	.	.	.	.	.	.	.	.	.	G	34	5.328536	0.95733	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.40756	1.02;1.03	4.21	4.21	0.49690	.	.	.	.	.	T	0.59293	0.2183	M	0.64997	1.995	0.30219	N	0.797013	D;D	0.76494	0.999;0.999	D;P	0.63957	0.92;0.886	T	0.60084	-0.7332	9	0.72032	D	0.01	.	14.0983	0.65037	0.0:0.0:1.0:0.0	.	748;763	Q9BYB0;F2Z3L0	SHAN3_HUMAN;.	Q	763;749	ENSP00000442518:R763Q;ENSP00000446078:R749Q	ENSP00000442518:R763Q	R	+	2	0	SHANK3	49500316	1.000000	0.71417	0.999000	0.59377	0.743000	0.42351	8.929000	0.92859	2.187000	0.69744	0.511000	0.50034	CGG		0.682	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
CCDC93	54520	broad.mit.edu	37	2	118706947	118706947	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr2:118706947C>T	ENST00000376300.2	-	14	1230	c.1093G>A	c.(1093-1095)Gac>Aac	p.D365N	CCDC93_ENST00000460781.1_5'Flank|CCDC93_ENST00000319432.5_Missense_Mutation_p.D364N	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	365								p.D365N(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						TGCTCTTTGTCCAGTTTCTCA	0.443																																					p.D365N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1093A	2						.						211.0	179.0	190.0					2																	118706947		2203	4300	6503	118423417	SO:0001583	missense	54520	exon14			BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.1093G>A	2.37:g.118706947C>T	ENSP00000365477:p.Asp365Asn	Somatic		Capture	Illumina HiSeq	Phase_I	118423417	NM_019044	A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Missense_Mutation	SNP	ENST00000376300.2	37	CCDS2121.2	.	.	.	.	.	.	.	.	.	.	C	18.90	3.722438	0.68959	.	.	ENSG00000125633	ENST00000376300;ENST00000319432	T;T	0.18174	2.23;2.23	5.43	5.43	0.79202	.	0.159561	0.56097	D	0.000035	T	0.21590	0.0520	M	0.67953	2.075	0.43622	D	0.996	B	0.27229	0.172	B	0.22601	0.04	T	0.02282	-1.1183	10	0.24483	T	0.36	-25.1433	17.5969	0.88014	0.0:1.0:0.0:0.0	.	365	Q567U6	CCD93_HUMAN	N	365;364	ENSP00000365477:D365N;ENSP00000324135:D364N	ENSP00000324135:D364N	D	-	1	0	CCDC93	118423417	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.249000	0.51437	2.824000	0.97209	0.655000	0.94253	GAC		0.443	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000129615.1	NM_019044	
NCKAP5	344148	broad.mit.edu	37	2	133540347	133540347	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr2:133540347G>A	ENST00000409261.1	-	14	4410	c.4037C>T	c.(4036-4038)tCc>tTc	p.S1346F	NCKAP5_ENST00000317721.6_Missense_Mutation_p.S1346F|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1346								p.S1346F(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTTCCCGGAGGAGGGGTGCCC	0.617																																					p.S1346F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4037T	2						.						30.0	29.0	29.0					2																	133540347		1861	4102	5963	133256817	SO:0001583	missense	344148	exon14			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4037C>T	2.37:g.133540347G>A	ENSP00000387128:p.Ser1346Phe	Somatic		Capture	Illumina HiSeq	Phase_I	133256817	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.602951	0.00849	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.10192	2.9;2.9	5.5	3.52	0.40303	.	0.432276	0.17012	N	0.190475	T	0.04092	0.0114	N	0.11560	0.145	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.42699	-0.9436	10	0.09338	T	0.73	.	2.5038	0.04640	0.1038:0.1396:0.4136:0.343	.	1346	O14513	NCKP5_HUMAN	F	1346	ENSP00000387128:S1346F;ENSP00000380603:S1346F	ENSP00000380603:S1346F	S	-	2	0	NCKAP5	133256817	0.204000	0.23447	0.014000	0.15608	0.487000	0.33371	2.032000	0.41127	1.421000	0.47157	0.655000	0.94253	TCC		0.617	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
NT5C1B	93034	broad.mit.edu	37	2	18765444	18765444	+	Silent	SNP	G	G	A	rs376326986		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr2:18765444G>A	ENST00000359846.2	-	6	1058	c.981C>T	c.(979-981)taC>taT	p.Y327Y	NT5C1B_ENST00000460052.1_5'Flank|RNU6-1215P_ENST00000384441.1_RNA|NT5C1B_ENST00000600945.1_Silent_p.Y327Y|NT5C1B-RDH14_ENST00000532967.1_Silent_p.Y327Y|NT5C1B_ENST00000304081.4_Silent_p.Y267Y	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	327					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.Y327Y(1)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				CCTCTTGCTCGTAGATTTTCC	0.557																																					p.Y267Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C801T	2						.	G	,,,,,,	1,4405	2.1+/-5.4	0,1,2202	166.0	159.0	161.0		981,930,1032,987,807,981,801	-2.9	0.7	2		161	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NT5C1B,NT5C1B-RDH14	NM_001002006.2,NM_001199086.1,NM_001199087.1,NM_001199088.1,NM_001199103.1,NM_001199104.1,NM_033253.3	,,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,	327/611,310/594,344/628,329/613,269/651,327/603,267/551	18765444	1,13005	2203	4300	6503	18628925	SO:0001819	synonymous_variant	93034	exon5			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.981C>T	2.37:g.18765444G>A		Somatic		Capture	Illumina HiSeq	Phase_I	18628925	NM_033253	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Silent	SNP	ENST00000359846.2	37	CCDS33150.1																																																																																				0.557	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
TTN	7273	broad.mit.edu	37	2	179474894	179474894	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr2:179474894C>T	ENST00000591111.1	-	221	46660	c.46436G>A	c.(46435-46437)cGt>cAt	p.R15479H	TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R8055H|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R8180H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R8247H|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R17120H|TTN_ENST00000342992.6_Missense_Mutation_p.R14552H|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15479	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R8247H(1)|p.R14552H(1)|p.R8055H(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCTTTAACACGGAAGAAGTA	0.418																																					p.R8055H												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G24164A	2						.						129.0	125.0	127.0					2																	179474894		1924	4134	6058	179183139	SO:0001583	missense	7273	exon99			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.46436G>A	2.37:g.179474894C>T	ENSP00000465570:p.Arg15479His	Somatic		Capture	Illumina HiSeq	Phase_I	179183139	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	16.49	3.137037	0.56936	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.48	5.48	0.80851	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.81683	0.4874	M	0.90542	3.125	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.85308	0.1077	9	0.87932	D	0	.	19.3587	0.94425	0.0:1.0:0.0:0.0	.	8055;8180;8247;15479	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	14552;8055;8247;8180;8055	ENSP00000343764:R14552H;ENSP00000434586:R8055H;ENSP00000340554:R8247H;ENSP00000352154:R8180H	ENSP00000340554:R8247H	R	-	2	0	TTN	179183139	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.770000	0.85390	2.573000	0.86826	0.655000	0.94253	CGT		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PTPRG	5793	broad.mit.edu	37	3	61975388	61975388	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr3:61975388C>T	ENST00000474889.1	+	3	657	c.280C>T	c.(280-282)Cgt>Tgt	p.R94C	PTPRG_ENST00000295874.10_Missense_Mutation_p.R94C	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	94	Alpha-carbonic anhydrase.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R94C(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CCAGTATGCGCGTGTTGGGGA	0.488																																					p.R94C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C280T	3						.						117.0	107.0	110.0					3																	61975388		2203	4300	6503	61950428	SO:0001583	missense	5793	exon3			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.280C>T	3.37:g.61975388C>T	ENSP00000418112:p.Arg94Cys	Somatic		Capture	Illumina HiSeq	Phase_I	61950428	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914487	0.72983	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.69175	-0.38;-0.38	5.92	5.04	0.67666	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.537042	0.20086	N	0.099558	T	0.65852	0.2731	L	0.41906	1.305	0.42524	D	0.993019	D;D	0.67145	0.995;0.996	P;P	0.47376	0.528;0.545	T	0.70941	-0.4735	10	0.87932	D	0	.	16.5237	0.84324	0.1319:0.8681:0.0:0.0	.	94;94	P23470-2;P23470	.;PTPRG_HUMAN	C	94	ENSP00000418112:R94C;ENSP00000295874:R94C	ENSP00000295874:R94C	R	+	1	0	PTPRG	61950428	0.014000	0.17966	0.035000	0.18076	0.958000	0.62258	1.115000	0.31209	1.487000	0.48415	0.655000	0.94253	CGT		0.488	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
EPHA3	2042	broad.mit.edu	37	3	89391168	89391168	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr3:89391168G>A	ENST00000336596.2	+	5	1459	c.1234G>A	c.(1234-1236)Gtt>Att	p.V412I	EPHA3_ENST00000494014.1_Missense_Mutation_p.V412I|EPHA3_ENST00000452448.2_Missense_Mutation_p.V412I	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	412	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.V412I(2)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GATTGATGCCGTTAATGGGGT	0.498										TSP Lung(6;0.00050)																											p.V412I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1234A	3						.						85.0	69.0	74.0					3																	89391168		2203	4300	6503	89473858	SO:0001583	missense	2042	exon5			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1234G>A	3.37:g.89391168G>A	ENSP00000337451:p.Val412Ile	Somatic		Capture	Illumina HiSeq	Phase_I	89473858	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.485963	0.26686	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.61627	0.09;0.09;0.09	5.66	-10.3	0.00346	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.762565	0.13437	N	0.388004	T	0.41743	0.1172	L	0.45285	1.41	0.09310	N	1	B;B	0.14012	0.004;0.009	B;B	0.13407	0.003;0.009	T	0.17961	-1.0352	9	.	.	.	.	17.0649	0.86556	0.1451:0.1722:0.6827:0.0	.	412;412	P29320;P29320-2	EPHA3_HUMAN;.	I	412	ENSP00000337451:V412I;ENSP00000399926:V412I;ENSP00000419190:V412I	.	V	+	1	0	EPHA3	89473858	0.000000	0.05858	0.016000	0.15963	0.851000	0.48451	-0.316000	0.08071	-1.437000	0.01967	-0.238000	0.12139	GTT		0.498	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
PPM1L	151742	broad.mit.edu	37	3	160783243	160783243	+	Silent	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr3:160783243C>T	ENST00000498165.1	+	3	728	c.627C>T	c.(625-627)aaC>aaT	p.N209N	PPM1L_ENST00000295839.9_Silent_p.N82N|PPM1L_ENST00000480117.1_3'UTR|PPM1L_ENST00000464260.1_Silent_p.N30N	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	209	PP2C-like.				MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.N209N(1)|p.N30N(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CTGTGGCCAACGTGGGTGACT	0.483																																					p.N209N	Pancreas(86;250 1994 13715 43211)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C627T	3						.						108.0	110.0	109.0					3																	160783243		2203	4300	6503	162265937	SO:0001819	synonymous_variant	151742	exon3			AK055115	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	"""protein phosphatase 1 (formerly 2C)-like"""			12556533	Standard	XM_006713507		Approved	PP2CE	uc003fdr.3	Q5SGD2	OTTHUMG00000159048	ENST00000498165.1:c.627C>T	3.37:g.160783243C>T		Somatic		Capture	Illumina HiSeq	Phase_I	162265937	NM_139245	Q2M3J2|Q96NM7	Silent	SNP	ENST00000498165.1	37	CCDS33886.1																																																																																				0.483	PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353019.1	NM_139245	
LPHN3	23284	broad.mit.edu	37	4	62845291	62845291	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr4:62845291C>T	ENST00000514591.1	+	17	2941	c.2612C>T	c.(2611-2613)gCg>gTg	p.A871V	LPHN3_ENST00000506746.1_Missense_Mutation_p.A939V|LPHN3_ENST00000514157.1_Missense_Mutation_p.A871V|LPHN3_ENST00000507164.1_Missense_Mutation_p.A939V|LPHN3_ENST00000545650.1_Missense_Mutation_p.A871V|LPHN3_ENST00000508693.1_Missense_Mutation_p.A939V|LPHN3_ENST00000514996.1_Missense_Mutation_p.A871V|LPHN3_ENST00000506700.1_Missense_Mutation_p.A871V|LPHN3_ENST00000508946.1_Missense_Mutation_p.A871V|LPHN3_ENST00000507625.1_Missense_Mutation_p.A939V|LPHN3_ENST00000506720.1_Missense_Mutation_p.A939V|LPHN3_ENST00000504896.1_Missense_Mutation_p.A871V|LPHN3_ENST00000511324.1_Missense_Mutation_p.A939V|LPHN3_ENST00000512091.2_Missense_Mutation_p.A871V|LPHN3_ENST00000509896.1_Missense_Mutation_p.A939V			Q9HAR2	LPHN3_HUMAN	latrophilin 3	858					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.A871V(2)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CACAGTGATGCGGTCCATGAC	0.438																																					p.A871V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2612T	4						.						266.0	255.0	258.0					4																	62845291		1955	4163	6118	62527886	SO:0001583	missense	23284	exon15			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2612C>T	4.37:g.62845291C>T	ENSP00000422533:p.Ala871Val	Somatic		Capture	Illumina HiSeq	Phase_I	62527886	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.214087	0.39102	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21	5.5	5.5	0.81552	.	0.262239	0.38005	N	0.001849	T	0.25531	0.0621	N	0.20881	0.62	0.40755	D	0.982955	P;P;P	0.48640	0.913;0.913;0.907	B;B;B	0.39738	0.158;0.158;0.308	T	0.03852	-1.0998	10	0.32370	T	0.25	.	14.6038	0.68463	0.0:0.8542:0.1458:0.0	.	871;858;871	E9PE04;Q9HAR2;Q9HAR2-2	.;LPHN3_HUMAN;.	V	871;871;939;939;871;871;858;871;939;939;939;871;871;871;939;939;871	ENSP00000423388:A871V;ENSP00000422533:A871V;ENSP00000423787:A939V;ENSP00000425033:A939V;ENSP00000424120:A871V;ENSP00000439831:A871V;ENSP00000421476:A939V;ENSP00000424030:A939V;ENSP00000421372:A939V;ENSP00000425201:A871V;ENSP00000423434:A871V;ENSP00000421627:A871V;ENSP00000420931:A939V;ENSP00000425884:A939V;ENSP00000424258:A871V	ENSP00000280009:A871V	A	+	2	0	LPHN3	62527886	0.988000	0.35896	0.937000	0.37676	0.849000	0.48306	2.927000	0.48900	2.580000	0.87095	0.467000	0.42956	GCG		0.438	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
MUC7	4589	broad.mit.edu	37	4	71347060	71347060	+	Missense_Mutation	SNP	A	A	C	rs74904873	byFrequency	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	A	A	A	C	A	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr4:71347060A>C	ENST00000304887.5	+	3	789	c.599A>C	c.(598-600)cAa>cCa	p.Q200P	MUC7_ENST00000413702.1_Missense_Mutation_p.Q200P|MUC7_ENST00000456088.1_Missense_Mutation_p.Q200P	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	200	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.Q200P(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			GCAACTACACAAGCTCCACCA	0.597													A|||	6	0.00119808	0.0015	0.0	5008	,	,		20514	0.002		0.001	False		,,,				2504	0.001				p.Q200P												.	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.A599C	4						.						489.0	395.0	427.0					4																	71347060		2203	4300	6503	71381649	SO:0001583	missense	4589	exon3			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.599A>C	4.37:g.71347060A>C	ENSP00000302021:p.Gln200Pro	Germline		Capture	Illumina HiSeq	Phase_I	71381649	NM_152291	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.465514	0.01053	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.48522	0.81;0.81;0.81	2.05	1.2	0.21068	.	.	.	.	.	T	0.20129	0.0484	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25433	-1.0132	8	.	.	.	3.0933	9.4049	0.38455	0.2401:0.7599:0.0:0.0	.	200	Q8TAX7	MUC7_HUMAN	P	200	ENSP00000407422:Q200P;ENSP00000400585:Q200P;ENSP00000302021:Q200P	.	Q	+	2	0	MUC7	71381649	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.162000	0.03141	0.022000	0.15160	-0.710000	0.03640	CAA		0.597	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
AFF1	4299	broad.mit.edu	37	4	87968297	87968297	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr4:87968297G>A	ENST00000307808.6	+	3	1009	c.589G>A	c.(589-591)Gag>Aag	p.E197K	AFF1_ENST00000395146.4_Missense_Mutation_p.E204K|AFF1_ENST00000544085.1_Intron	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	197					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E204K(1)		breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		TCCAGAGAGGGAGCTTTCTCC	0.542																																					p.E204K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G610A	4						.						140.0	136.0	137.0					4																	87968297		2203	4300	6503	88187321	SO:0001583	missense	4299	exon4			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.589G>A	4.37:g.87968297G>A	ENSP00000305689:p.Glu197Lys	Somatic		Capture	Illumina HiSeq	Phase_I	88187321	NM_001166693	B4DTU1|E9PBM3	Missense_Mutation	SNP	ENST00000307808.6	37	CCDS3616.1	.	.	.	.	.	.	.	.	.	.	G	0.233	-1.019328	0.02078	.	.	ENSG00000172493	ENST00000395146;ENST00000395142;ENST00000507468;ENST00000503477;ENST00000307808	T;T;T;T	0.62788	0.0;0.0;0.0;0.0	5.79	3.12	0.35913	.	1.276350	0.05045	N	0.477057	T	0.47097	0.1427	N	0.17082	0.46	0.23653	N	0.99719	P;B;B;P;P;P	0.39094	0.536;0.014;0.025;0.659;0.659;0.536	B;B;B;B;B;B	0.41988	0.223;0.016;0.026;0.372;0.372;0.223	T	0.29243	-1.0018	10	0.06757	T	0.87	-13.2418	7.8212	0.29288	0.1383:0.2499:0.6118:0.0	.	204;204;138;197;197;204	E9PBM3;B4DXZ8;B4DJM6;Q14C88;P51825;B4DTU1	.;.;.;.;AFF1_HUMAN;.	K	204;204;204;204;197	ENSP00000378578:E204K;ENSP00000427593:E204K;ENSP00000424483:E204K;ENSP00000305689:E197K	ENSP00000305689:E197K	E	+	1	0	AFF1	88187321	0.021000	0.18746	0.269000	0.24586	0.017000	0.09413	1.985000	0.40668	0.365000	0.24400	-0.156000	0.13503	GAG		0.542	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935	
MARCH1	55016	broad.mit.edu	37	4	165118829	165118829	+	Intron	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr4:165118829C>T	ENST00000503008.1	-	2	864				MARCH1_ENST00000508725.1_Intron|MARCH1_ENST00000514618.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R12Q(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CGCCCTGTTCCGCAGCTCTGA	0.522																																					p.R12Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G35A	4						.						114.0	117.0	116.0					4																	165118829		2203	4300	6503	165338279	SO:0001627	intron_variant	23520	exon1			AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-86015G>A	4.37:g.165118829C>T		Somatic		Capture	Illumina HiSeq	Phase_I	165338279	NM_012403	D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	CCDS54814.1																																																																																				0.522	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923	
NMUR2	56923	broad.mit.edu	37	5	151784251	151784251	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr5:151784251C>T	ENST00000255262.3	-	1	589	c.424G>A	c.(424-426)Gtg>Atg	p.V142M	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	142					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)	p.V142M(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			TAGCGCTCCACGCTGACGGTG	0.637																																					p.V142M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G424A	5						.						57.0	62.0	60.0					5																	151784251		2203	4300	6503	151764444	SO:0001583	missense	56923	exon1			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.424G>A	5.37:g.151784251C>T	ENSP00000255262:p.Val142Met	Somatic		Capture	Illumina HiSeq	Phase_I	151764444	NM_020167	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	37	CCDS4321.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.914429	0.52546	.	.	ENSG00000132911	ENST00000255262	T	0.44083	0.93	5.45	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	0.292967	0.28431	N	0.015374	T	0.41558	0.1164	M	0.74881	2.28	0.36034	D	0.839586	P	0.48350	0.909	B	0.42851	0.4	T	0.52888	-0.8515	10	0.56958	D	0.05	-11.7019	7.1649	0.25685	0.0:0.6583:0.13:0.2117	.	142	Q9GZQ4	NMUR2_HUMAN	M	142	ENSP00000255262:V142M	ENSP00000255262:V142M	V	-	1	0	NMUR2	151764444	0.988000	0.35896	0.998000	0.56505	0.674000	0.39518	0.437000	0.21543	0.600000	0.29862	0.655000	0.94253	GTG		0.637	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167	
MAT2B	27430	broad.mit.edu	37	5	162930412	162930412	+	5'Flank	SNP	G	G	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr5:162930412G>T	ENST00000321757.6	+	0	0				MAT2B_ENST00000280969.5_Missense_Mutation_p.M4I|MAT2B_ENST00000518095.1_5'Flank	NM_013283.3	NP_037415.1	Q9NZL9	MAT2B_HUMAN	methionine adenosyltransferase II, beta						cellular nitrogen compound metabolic process (GO:0034641)|extracellular polysaccharide biosynthetic process (GO:0045226)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|regulation of catalytic activity (GO:0050790)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|methionine adenosyltransferase complex (GO:0048269)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dTDP-4-dehydrorhamnose reductase activity (GO:0008831)|enzyme binding (GO:0019899)|methionine adenosyltransferase regulator activity (GO:0048270)	p.M4I(1)		endometrium(3)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	14	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	L-Methionine(DB00134)	TGCCTGAAATGCCAGAGGACA	0.463																																					p.M4I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G12T	5						.						143.0	137.0	139.0					5																	162930412		2203	4300	6503	162862990	SO:0001631	upstream_gene_variant	27430	exon1			AF182814	CCDS4364.1, CCDS4365.1	5q34-q35	2011-09-14			ENSG00000038274	ENSG00000038274		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	6905	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 23E, member 1"""	605527				9055605, 10644686, 19027726	Standard	NM_182796		Approved	MATIIbeta, SDR23E1	uc003lzk.4	Q9NZL9	OTTHUMG00000130379		5.37:g.162930412G>T	Exception_encountered	Somatic		Capture	Illumina HiSeq	Phase_I	162862990	NM_182796	B2R5Y6|Q1WAI7|Q27J92|Q3LIE8|Q567T7|Q6NYC7|Q9BS89|Q9H3E1|Q9UJ54	Missense_Mutation	SNP	ENST00000321757.6	37	CCDS4365.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066440	0.36470	.	.	ENSG00000038274	ENST00000280969;ENST00000518731	T	0.39056	1.1	5.86	4.99	0.66335	.	.	.	.	.	T	0.24236	0.0587	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.05582	-1.0876	9	0.44086	T	0.13	.	11.3767	0.49733	0.0835:0.0:0.9165:0.0	.	4	Q9NZL9-2	.	I	4	ENSP00000280969:M4I	ENSP00000280969:M4I	M	+	3	0	MAT2B	162862990	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.768000	0.47645	2.773000	0.95371	0.655000	0.94253	ATG		0.463	MAT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252749.2	NM_013283	
SH3PXD2B	285590	broad.mit.edu	37	5	171766173	171766173	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr5:171766173G>T	ENST00000311601.5	-	13	2106	c.1936C>A	c.(1936-1938)Cca>Aca	p.P646T	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	646					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)	p.P646T(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GAAGGAGCTGGTTTTGGCCTA	0.562																																					p.P646T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1936A	5						.						96.0	94.0	95.0					5																	171766173		2203	4300	6503	171698778	SO:0001583	missense	285590	exon13			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.1936C>A	5.37:g.171766173G>T	ENSP00000309714:p.Pro646Thr	Somatic		Capture	Illumina HiSeq	Phase_I	171698778	NM_001017995	B6F0V2|Q9P2Q1	Missense_Mutation	SNP	ENST00000311601.5	37	CCDS34291.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610639	0.66558	.	.	ENSG00000174705	ENST00000311601	T	0.80994	-1.44	5.46	5.46	0.80206	.	0.134561	0.50627	D	0.000105	D	0.84982	0.5593	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.83503	0.0076	9	.	.	.	-11.1378	16.8011	0.85614	0.0:0.0:1.0:0.0	.	646	A1X283	SPD2B_HUMAN	T	646	ENSP00000309714:P646T	.	P	-	1	0	SH3PXD2B	171698778	1.000000	0.71417	0.999000	0.59377	0.668000	0.39293	9.434000	0.97515	2.558000	0.86282	0.555000	0.69702	CCA		0.562	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963	
HLA-DQA2	3118	broad.mit.edu	37	6	32714078	32714078	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr6:32714078G>T	ENST00000374940.3	+	4	777	c.675G>T	c.(673-675)ttG>ttT	p.L225F		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	225					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)	p.L225F(1)		endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	CCCTGGGGTTGTCTGTGGGCC	0.542																																					p.L225F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G675T	6						.						163.0	161.0	162.0					6																	32714078		1511	2709	4220	32822056	SO:0001583	missense	3118	exon4				CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.675G>T	6.37:g.32714078G>T	ENSP00000364076:p.Leu225Phe	Somatic		Capture	Illumina HiSeq	Phase_I	32822056	NM_020056	A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	SNP	ENST00000374940.3	37	CCDS4753.1	.	.	.	.	.	.	.	.	.	.	.	8.475	0.858533	0.17178	.	.	ENSG00000237541	ENST00000374940	T	0.02498	4.27	3.06	1.1	0.20463	.	0.327282	0.24942	N	0.034369	T	0.04724	0.0128	M	0.79475	2.455	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.22243	-1.0222	10	0.87932	D	0	.	4.1815	0.10378	0.1447:0.2414:0.6139:0.0	.	225	P01906	DQA2_HUMAN	F	225	ENSP00000364076:L225F	ENSP00000364076:L225F	L	+	3	2	HLA-DQA2	32822056	0.659000	0.27411	0.008000	0.14137	0.085000	0.17905	1.285000	0.33261	0.108000	0.17862	0.174000	0.16983	TTG		0.542	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076179.2	NM_020056	
RAB23	51715	broad.mit.edu	37	6	57058662	57058662	+	Silent	SNP	C	C	T	rs201731610		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr6:57058662C>T	ENST00000317483.3	-	6	1171	c.552G>A	c.(550-552)acG>acA	p.T184T	RAB23_ENST00000468148.1_Silent_p.T184T	NM_016277.3	NP_057361.3	Q9ULC3	RAB23_HUMAN	RAB23, member RAS oncogene family	184					autophagic vacuole assembly (GO:0000045)|cellular defense response (GO:0006968)|cilium assembly (GO:0042384)|craniofacial suture morphogenesis (GO:0097094)|embryonic digit morphogenesis (GO:0042733)|GTP catabolic process (GO:0006184)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription factor import into nucleus (GO:0042992)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|small GTPase mediated signal transduction (GO:0007264)|spinal cord dorsal/ventral patterning (GO:0021513)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.T184T(1)		kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	8	Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TACTTGAATGCGTTAGTTCTG	0.318													c|||	1	0.000199681	0.0008	0.0	5008	,	,		16766	0.0		0.0	False		,,,				2504	0.0				p.T184T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G552A	6						.	T	,	1,4403	2.1+/-5.4	0,1,2201	162.0	149.0	153.0		552,552	3.1	0.3	6		153	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	RAB23	NM_016277.3,NM_183227.1	,	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	,	184/238,184/238	57058662	1,13001	2202	4299	6501	57166621	SO:0001819	synonymous_variant	51715	exon6			AB034244	CCDS4962.1	6p12.1	2008-05-15			ENSG00000112210	ENSG00000112210		"""RAB, member RAS oncogene"""	14263	protein-coding gene	gene with protein product		606144					Standard	NM_016277		Approved		uc003pdt.3	Q9ULC3	OTTHUMG00000014918	ENST00000317483.3:c.552G>A	6.37:g.57058662C>T		Somatic		Capture	Illumina HiSeq	Phase_I	57166621	NM_016277	B2R9I5|Q68DJ6|Q8NI06|Q9P023	Silent	SNP	ENST00000317483.3	37	CCDS4962.1																																																																																				0.318	RAB23-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041042.1		
ELOVL4	6785	broad.mit.edu	37	6	80626510	80626510	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr6:80626510A>T	ENST00000369816.4	-	6	1060	c.760T>A	c.(760-762)Tat>Aat	p.Y254N		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	254					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)	p.Y254N(1)		central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	CTGATTGCATAGGCAATTAGA	0.423																																					p.Y254N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T760A	6						.						106.0	99.0	102.0					6																	80626510		2203	4300	6503	80683229	SO:0001583	missense	6785	exon6			AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.760T>A	6.37:g.80626510A>T	ENSP00000358831:p.Tyr254Asn	Somatic		Capture	Illumina HiSeq	Phase_I	80683229	NM_022726	B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Missense_Mutation	SNP	ENST00000369816.4	37	CCDS4992.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.904099	0.52333	.	.	ENSG00000118402	ENST00000369816	T	0.25912	1.77	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.37348	0.1000	L	0.58354	1.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.06499	-1.0823	10	0.33940	T	0.23	-16.5188	15.5895	0.76517	1.0:0.0:0.0:0.0	.	254	Q9GZR5	ELOV4_HUMAN	N	254	ENSP00000358831:Y254N	ENSP00000358831:Y254N	Y	-	1	0	ELOVL4	80683229	1.000000	0.71417	0.879000	0.34478	0.241000	0.25554	9.336000	0.96533	2.280000	0.76307	0.528000	0.53228	TAT		0.423	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041315.1		
FAM162B	221303	broad.mit.edu	37	6	117083222	117083222	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr6:117083222T>C	ENST00000368557.4	-	3	454	c.308A>G	c.(307-309)aAc>aGc	p.N103S		NM_001085480.2	NP_001078949.1	Q5T6X4	F162B_HUMAN	family with sequence similarity 162, member B	103						integral component of membrane (GO:0016021)		p.N103S(1)		large_intestine(2)|lung(4)	6						TCGAGCTTTGTTTCTTGCGGT	0.363																																					p.N103S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A308G	6						.						200.0	188.0	192.0					6																	117083222		1876	4113	5989	117189915	SO:0001583	missense	221303	exon3			BC038997	CCDS43497.1	6q22.31	2014-01-28	2008-06-05	2008-06-05	ENSG00000183807	ENSG00000183807			21549	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 189"""	C6orf189			Standard	NM_001085480		Approved	bA86F4.2	uc003pxi.2	Q5T6X4	OTTHUMG00000015446	ENST00000368557.4:c.308A>G	6.37:g.117083222T>C	ENSP00000357545:p.Asn103Ser	Somatic		Capture	Illumina HiSeq	Phase_I	117189915	NM_001085480	Q8IXW8	Missense_Mutation	SNP	ENST00000368557.4	37	CCDS43497.1	.	.	.	.	.	.	.	.	.	.	T	16.32	3.088731	0.55968	.	.	ENSG00000183807	ENST00000368557	T	0.59083	0.29	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.62295	0.2416	L	0.49571	1.57	0.50467	D	0.999876	D	0.76494	0.999	D	0.85130	0.997	T	0.65623	-0.6123	10	0.54805	T	0.06	-16.9981	13.1585	0.59531	0.0:0.0:0.0:1.0	.	103	Q5T6X4	F162B_HUMAN	S	103	ENSP00000357545:N103S	ENSP00000357545:N103S	N	-	2	0	FAM162B	117189915	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	3.771000	0.55318	2.011000	0.59026	0.528000	0.53228	AAC		0.363	FAM162B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041965.1	XM_927381	
MGAM	8972	broad.mit.edu	37	7	141754687	141754687	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr7:141754687G>A	ENST00000549489.2	+	27	3388	c.3293G>A	c.(3292-3294)cGg>cAg	p.R1098Q	MGAM_ENST00000475668.2_Missense_Mutation_p.R1098Q	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1098	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.R1098Q(1)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GAAATTCGCCGGAAGAGTACA	0.502																																					p.R1098Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3293A	7						.						69.0	66.0	67.0					7																	141754687		1870	4094	5964	141401156	SO:0001583	missense	8972	exon27			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3293G>A	7.37:g.141754687G>A	ENSP00000447378:p.Arg1098Gln	Somatic		Capture	Illumina HiSeq	Phase_I	141401156	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997028	0.54147	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	T	0.33438	1.41	4.24	4.24	0.50183	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.34338	N	0.004050	T	0.70298	0.3208	H	0.97852	4.09	0.09310	N	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.71912	-0.4449	10	0.87932	D	0	.	15.3761	0.74607	0.0:0.0:1.0:0.0	.	1098	O43451	MGA_HUMAN	Q	1098;1098;975	ENSP00000447378:R1098Q	ENSP00000316431:R975Q	R	+	2	0	MGAM	141401156	0.998000	0.40836	0.021000	0.16686	0.014000	0.08584	8.923000	0.92808	1.890000	0.54733	0.460000	0.39030	CGG		0.502	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
ATG9B	285973	broad.mit.edu	37	7	150720191	150720191	+	Silent	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr7:150720191C>T	ENST00000377974.2	-	4	837	c.762G>A	c.(760-762)ccG>ccA	p.P254P	ATG9B_ENST00000605952.1_Silent_p.P254P|ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000444312.1_5'UTR|ATG9B_ENST00000605938.1_Silent_p.P254P			Q674R7	ATG9B_HUMAN	autophagy related 9B	254					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)		p.P254P(2)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCTGTGGAACGGCCCAGGTC	0.517																																					p.P254P												.	.	2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	c.G762A	7						.						237.0	241.0	240.0					7																	150720191		2008	4185	6193	150351124	SO:0001819	synonymous_variant	285973	exon4			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.762G>A	7.37:g.150720191C>T		Somatic		Capture	Illumina HiSeq	Phase_I	150351124	NM_173681	A1A5D3|Q6JRW5|Q8N8I8	Silent	SNP	ENST00000377974.2	37																																																																																					0.517	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173681	
EEPD1	80820	broad.mit.edu	37	7	36194167	36194168	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	GG	GG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr7:36194167_36194168GG>AA	ENST00000242108.4	+	2	952_953	c.234_235GG>AA	c.(232-237)gaGGac>gaAAac	p.D79N	EEPD1_ENST00000534978.1_Missense_Mutation_p.D79N	NM_030636.2	NP_085139.2	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family domain containing 1	79					DNA repair (GO:0006281)		DNA binding (GO:0003677)	p.E78>?(1)		endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|skin(1)	18						AGAAGGTGGAGGACCTGGCATT	0.609																																					.												.	.	1	Complex(1)	large_intestine(1)	c.234_235AA	7						.																																			36160693	SO:0001583	missense	80820	exon2			AK027386	CCDS34619.1	7p14.2	2007-12-07	2007-12-07		ENSG00000122547	ENSG00000122547			22223	protein-coding gene	gene with protein product							Standard	NM_030636		Approved	KIAA1706	uc003tfa.3	Q7L9B9	OTTHUMG00000154904	Exception_encountered	7.37:g.36194167_36194168delinsAA	ENSP00000242108:p.Asp79Asn	Somatic		Capture	Illumina HiSeq	Phase_I	36160692	NM_030636	Q96K64|Q9C0F7	Missense_Mutation	DNP	ENST00000242108.4	37	CCDS34619.1																																																																																				0.609	EEPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337602.1	NM_030636	
GATS	352954	broad.mit.edu	37	7	99821248	99821248	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr7:99821248C>T	ENST00000436886.2	-	4	733	c.485G>A	c.(484-486)aGa>aAa	p.R162K	GATS_ENST00000543273.1_RNA	NM_178831.6	NP_849153.3	Q8NAP1	GATS_HUMAN	GATS, stromal antigen 3 opposite strand	162								p.R162K(1)		endometrium(2)|large_intestine(2)|lung(4)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTGCTACAGTCTAGCCACTGA	0.587																																					p.R162K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G485A	7						.						147.0	159.0	155.0					7																	99821248		2097	4224	6321	99659184	SO:0001583	missense	352954	exon4			AK095056	CCDS43621.1	7q22.1	2014-08-13	2009-04-08	2009-04-08	ENSG00000160844	ENSG00000239521			29954	protein-coding gene	gene with protein product	"""stromal antigen 3 opposite strand"""					12477932	Standard	NM_178831		Approved	DKFZp686B07267, STAG3OS	uc003uua.4	Q8NAP1	OTTHUMG00000155289	ENST00000436886.2:c.485G>A	7.37:g.99821248C>T	ENSP00000389760:p.Arg162Lys	Somatic		Capture	Illumina HiSeq	Phase_I	99659184	NM_178831	D6W5V0|Q68D93|Q6P198|Q6PII7|Q7Z720|Q86UK9	Missense_Mutation	SNP	ENST00000436886.2	37	CCDS43621.1	.	.	.	.	.	.	.	.	.	.	c	2.518	-0.311480	0.05422	.	.	ENSG00000160844	ENST00000436886	.	.	.	1.56	1.56	0.23342	.	0.068772	0.64402	D	0.000014	T	0.15869	0.0382	N	0.08118	0	0.21256	N	0.999743	B	0.02656	0.0	B	0.04013	0.001	T	0.14811	-1.0459	9	0.87932	D	0	.	4.5106	0.11910	0.0:0.7698:0.0:0.2302	.	162	Q8NAP1	GATS_HUMAN	K	162	.	ENSP00000389760:R162K	R	-	2	0	GATS	99659184	1.000000	0.71417	0.379000	0.26080	0.010000	0.07245	1.783000	0.38664	0.787000	0.33731	0.173000	0.16961	AGA		0.587	GATS-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178831	
KMT2C	58508	broad.mit.edu	37	7	151845435	151845435	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr7:151845435T>C	ENST00000262189.6	-	52	13795	c.13577A>G	c.(13576-13578)tAt>tGt	p.Y4526C	KMT2C_ENST00000355193.2_Missense_Mutation_p.Y4583C	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4526					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.Y4583C(1)|p.Y4526C(1)									ACGCTGAACATAGACCCTCCT	0.463																																					p.Y4526C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A13577G	7						.						127.0	106.0	113.0					7																	151845435		2203	4300	6503	151476368	SO:0001583	missense	58508	exon52			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.13577A>G	7.37:g.151845435T>C	ENSP00000262189:p.Tyr4526Cys	Somatic		Capture	Illumina HiSeq	Phase_I	151476368	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.983671	0.53827	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877	D;D;D	0.90900	-2.25;-2.2;-2.75	5.19	5.19	0.71726	.	0.000000	0.38164	U	0.001783	D	0.94009	0.8081	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.99;0.999;0.999	D	0.94513	0.7720	10	0.66056	D	0.02	.	15.0423	0.71799	0.0:0.0:0.0:1.0	.	4526;3644;4583	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	C	4526;4583;1143	ENSP00000262189:Y4526C;ENSP00000347325:Y4583C;ENSP00000410411:Y1143C	ENSP00000262189:Y4526C	Y	-	2	0	MLL3	151476368	1.000000	0.71417	0.939000	0.37840	0.971000	0.66376	8.040000	0.89188	1.959000	0.56917	0.377000	0.23210	TAT		0.463	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
SLC30A8	169026	broad.mit.edu	37	8	118184901	118184901	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr8:118184901G>T	ENST00000456015.2	+	8	1091	c.1091G>T	c.(1090-1092)tGt>tTt	p.C364F	SLC30A8_ENST00000427715.2_Missense_Mutation_p.C315F|SLC30A8_ENST00000519688.1_Missense_Mutation_p.C315F|SLC30A8_ENST00000521243.1_Missense_Mutation_p.C315F	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	364					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.C364F(1)		breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TGCCTTTTCTGTGAAGACCCC	0.468																																					p.C364F	Ovarian(162;1202 1922 6011 16223 52092)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1091T	8						.						139.0	126.0	130.0					8																	118184901		2203	4300	6503	118254082	SO:0001583	missense	169026	exon8				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.1091G>T	8.37:g.118184901G>T	ENSP00000415011:p.Cys364Phe	Somatic		Capture	Illumina HiSeq	Phase_I	118254082	NM_173851	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	ENST00000456015.2	37	CCDS6322.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274561	0.59649	.	.	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.73575	-0.6;-0.6;-0.6;-0.76	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.85336	0.5673	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86928	0.2071	10	0.87932	D	0	-9.4665	16.2727	0.82629	0.0:0.0:1.0:0.0	.	364	Q8IWU4	ZNT8_HUMAN	F	315;315;315;364	ENSP00000428545:C315F;ENSP00000407505:C315F;ENSP00000431069:C315F;ENSP00000415011:C364F	ENSP00000407505:C315F	C	+	2	0	SLC30A8	118254082	1.000000	0.71417	1.000000	0.80357	0.313000	0.28021	5.238000	0.65366	2.518000	0.84900	0.650000	0.86243	TGT		0.468	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381205.1	NM_173851	
MROH5	389690	broad.mit.edu	37	8	142446115	142446115	+	RNA	SNP	C	C	T	rs375142667		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr8:142446115C>T	ENST00000606664.1	+	0	1471				MROH5_ENST00000430863.1_RNA																							CTGCCATGGCCGCCACCAGGT	0.682																																					p.A1151A												.	.	0			c.G3453A	8						.			0,4250		0,0,2125	30.0	38.0	36.0		3453	-8.3	0.0	8		36	1,8425		0,1,4212	no	coding-synonymous	FLJ43860	NM_207414.2		0,1,6337	TT,TC,CC		0.0119,0.0,0.0079		1151/1319	142446115	1,12675	2125	4213	6338	142515297			389690	exon26																															8.37:g.142446115C>T		Somatic		Capture	Illumina HiSeq	Phase_I	142515297	NM_207414		Silent	SNP	ENST00000606664.1	37																																																																																					0.682	CTD-3064M3.7-001	KNOWN	non_canonical_TEC|basic	antisense	antisense	OTTHUMT00000470872.1		
BAI1	575	broad.mit.edu	37	8	143570762	143570762	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr8:143570762G>A	ENST00000517894.1	+	16	3488	c.2594G>A	c.(2593-2595)cGc>cAc	p.R865H	BAI1_ENST00000323289.5_Missense_Mutation_p.R865H			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	865					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R865H(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CGCTCCCTGCGCACACCCTTG	0.587																																					p.R865H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2594A	8						.						98.0	108.0	105.0					8																	143570762		2062	4198	6260	143567764	SO:0001583	missense	575	exon15			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2594G>A	8.37:g.143570762G>A	ENSP00000430945:p.Arg865His	Somatic		Capture	Illumina HiSeq	Phase_I	143567764	NM_001702		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	G	16.98	3.272671	0.59649	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.09723	2.95;2.95	4.76	1.98	0.26296	.	0.672540	0.13670	U	0.370939	T	0.04363	0.0120	N	0.08118	0	0.22926	N	0.99855	P	0.48694	0.914	B	0.40199	0.322	T	0.27938	-1.0059	10	0.46703	T	0.11	.	1.8566	0.03180	0.1582:0.103:0.1752:0.5636	.	865	E9PBK0	.	H	865	ENSP00000430945:R865H;ENSP00000313046:R865H	ENSP00000313046:R865H	R	+	2	0	BAI1	143567764	0.865000	0.29922	1.000000	0.80357	0.988000	0.76386	0.911000	0.28584	0.661000	0.30985	0.462000	0.41574	CGC		0.587	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
TNKS	8658	broad.mit.edu	37	8	9609236	9609236	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr8:9609236T>C	ENST00000310430.6	+	19	2976	c.2950T>C	c.(2950-2952)Tcc>Ccc	p.S984P	TNKS_ENST00000518281.1_Missense_Mutation_p.S747P	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	984					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		ATCCACCCCCTCCTGCCTCTC	0.582																																					p.S984P												.	.	0			c.T2950C	8						.						125.0	130.0	128.0					8																	9609236		2203	4300	6503	9646646	SO:0001583	missense	8658	exon19			AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.2950T>C	8.37:g.9609236T>C	ENSP00000311579:p.Ser984Pro	None		Capture	Illumina HiSeq	Phase_I	9646646	NM_003747	O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	37	CCDS5974.1	.	.	.	.	.	.	.	.	.	.	T	15.30	2.791809	0.50102	.	.	ENSG00000173273	ENST00000310430;ENST00000518281	T;T	0.63744	-0.06;0.01	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.44767	0.1309	N	0.11560	0.145	0.80722	D	1	B	0.11235	0.004	B	0.12837	0.008	T	0.32955	-0.9887	10	0.27082	T	0.32	.	16.0239	0.80528	0.0:0.0:0.0:1.0	.	984	O95271	TNKS1_HUMAN	P	984;747	ENSP00000311579:S984P;ENSP00000429890:S747P	ENSP00000311579:S984P	S	+	1	0	TNKS	9646646	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.186000	0.72026	2.179000	0.69175	0.533000	0.62120	TCC		0.582	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
TNFRSF10C	8794	broad.mit.edu	37	8	22974405	22974405	+	Missense_Mutation	SNP	C	C	A	rs61736406	byFrequency	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr8:22974405C>A	ENST00000356864.3	+	5	1173	c.641C>A	c.(640-642)aCc>aAc	p.T214N	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.T112N	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	214					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.T214N(7)		endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGACCACCAGCCCG	0.612																																					p.T214N												.	.	7	Substitution - Missense(7)	prostate(4)|large_intestine(3)	c.C641A	8						.						63.0	71.0	68.0					8																	22974405		2203	4298	6501	23030350	SO:0001583	missense	8794	exon5			AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.641C>A	8.37:g.22974405C>A	ENSP00000349324:p.Thr214Asn	Somatic		Capture	Illumina HiSeq	Phase_I	23030350	NM_003841	O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	c	0.310	-0.968378	0.02232	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.61510	0.1;0.39	.	.	.	.	7739.210000	0.00166	N	0.000000	T	0.32164	0.0820	N	0.08118	0	0.09310	N	1	B	0.22909	0.077	B	0.06405	0.002	T	0.16719	-1.0393	9	0.37606	T	0.19	.	5.2848	0.15696	0.3272:0.6728:0.0:0.0	rs61736406	214	O14798	TR10C_HUMAN	N	214;112;214	ENSP00000349324:T214N;ENSP00000437612:T112N	ENSP00000349324:T214N	T	+	2	0	TNFRSF10C	23030350	0.033000	0.19621	0.001000	0.08648	0.141000	0.21300	0.550000	0.23345	-2.089000	0.00860	-2.399000	0.00225	ACC		0.612	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
CYP7B1	9420	broad.mit.edu	37	8	65517364	65517364	+	Missense_Mutation	SNP	G	G	A	rs114067006		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr8:65517364G>A	ENST00000310193.3	-	5	1281	c.1108C>T	c.(1108-1110)Cgt>Tgt	p.R370C	CYP7B1_ENST00000523954.1_5'UTR	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	370					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)	p.R370C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TCAACAAAACGAATGGTGGTT	0.443																																					p.R370C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1108T	8						.						100.0	92.0	95.0					8																	65517364		2203	4300	6503	65679918	SO:0001583	missense	9420	exon5			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.1108C>T	8.37:g.65517364G>A	ENSP00000310721:p.Arg370Cys	Somatic		Capture	Illumina HiSeq	Phase_I	65679918	NM_004820	B2RN07|Q9UNF5	Missense_Mutation	SNP	ENST00000310193.3	37	CCDS6180.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774858	0.90108	.	.	ENSG00000172817	ENST00000310193	T	0.81078	-1.45	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.94185	0.8134	H	0.97240	3.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95088	0.8219	10	0.87932	D	0	-17.9304	20.8794	0.99867	0.0:0.0:1.0:0.0	.	370	O75881	CP7B1_HUMAN	C	370	ENSP00000310721:R370C	ENSP00000310721:R370C	R	-	1	0	CYP7B1	65679918	1.000000	0.71417	0.347000	0.25668	0.242000	0.25591	7.502000	0.81614	2.941000	0.99782	0.655000	0.94253	CGT		0.443	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1		
CYP11B2	1585	broad.mit.edu	37	8	143994819	143994819	+	Missense_Mutation	SNP	C	C	T	rs377560888		TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr8:143994819C>T	ENST00000323110.2	-	6	1005	c.1003G>A	c.(1003-1005)Gac>Aac	p.D335N		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	335					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.D335N(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TGCTGCACGTCGGGGTTCCGA	0.637									Familial Hyperaldosteronism type I				.|||	1	0.000199681	0.0	0.0	5008	,	,		16749	0.0		0.001	False		,,,				2504	0.0				p.D335N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1003A	8	GRCh37	CM087151	CYP11B2	M		.	C	ASN/ASP	0,4406		0,0,2203	72.0	72.0	72.0		1003	-2.5	0.0	8		72	1,8599		0,1,4299	no	missense	CYP11B2	NM_000498.3	23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	335/504	143994819	1,13005	2203	4300	6503	143991821	SO:0001583	missense	1585	exon6	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1003G>A	8.37:g.143994819C>T	ENSP00000325822:p.Asp335Asn	Somatic		Capture	Illumina HiSeq	Phase_I	143991821	NM_000498	B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	37	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	3.417	-0.118935	0.06838	0.0	1.16E-4	ENSG00000179142	ENST00000323110	T	0.70986	-0.53	3.88	-2.5	0.06384	.	1.387850	0.04770	N	0.427825	T	0.60586	0.2280	L	0.55743	1.74	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.33675	-0.9859	10	0.42905	T	0.14	.	1.7073	0.02884	0.143:0.2581:0.1405:0.4585	.	335	P19099	C11B2_HUMAN	N	335	ENSP00000325822:D335N	ENSP00000325822:D335N	D	-	1	0	CYP11B2	143991821	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.058000	0.03482	-0.978000	0.03533	-1.031000	0.02408	GAC		0.637	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
RORB	6096	broad.mit.edu	37	9	77282723	77282723	+	Silent	SNP	G	G	C			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr9:77282723G>C	ENST00000396204.2	+	8	1050	c.1050G>C	c.(1048-1050)gtG>gtC	p.V350V	RORB_ENST00000376896.3_Silent_p.V339V			Q92753	RORB_HUMAN	RAR-related orphan receptor B	350	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.V339V(1)		breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	ATGACCTAGTGAATGAAGCAT	0.383																																					p.V339V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1017C	9						.						171.0	152.0	158.0					9																	77282723		2203	4300	6503	76472543	SO:0001819	synonymous_variant	6096	exon8			Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.1050G>C	9.37:g.77282723G>C		Somatic		Capture	Illumina HiSeq	Phase_I	76472543	NM_006914	Q8WX73	Silent	SNP	ENST00000396204.2	37																																																																																					0.383	RORB-201	KNOWN	basic	protein_coding	protein_coding			
SPATA31E1	286234	broad.mit.edu	37	9	90501041	90501041	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chr9:90501041G>T	ENST00000325643.5	+	4	1705	c.1639G>T	c.(1639-1641)Gca>Tca	p.A547S		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	547					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.A547S(1)									GGGCTGTGGGGCATCTTACCC	0.587																																					p.A547S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1639T	9						.						83.0	88.0	86.0					9																	90501041		2203	4300	6503	89690861	SO:0001583	missense	286234	exon4			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.1639G>T	9.37:g.90501041G>T	ENSP00000322640:p.Ala547Ser	Somatic		Capture	Illumina HiSeq	Phase_I	89690861	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	g	7.576	0.667760	0.14710	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.07114	3.22	2.1	-2.23	0.06930	.	2.809840	0.01355	N	0.012038	T	0.07413	0.0187	L	0.36672	1.1	0.09310	N	1	B;B	0.17667	0.023;0.003	B;B	0.15870	0.014;0.003	T	0.34601	-0.9822	10	0.20519	T	0.43	.	6.2667	0.20930	0.559:0.0:0.441:0.0	.	547;199	Q6ZUB1;Q8NA33	CI079_HUMAN;.	S	547;199	ENSP00000322640:A547S	ENSP00000322640:A547S	A	+	1	0	C9orf79	89690861	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.045000	0.12003	-0.645000	0.05458	-0.507000	0.04495	GCA		0.587	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
MAP3K15	389840	broad.mit.edu	37	X	19389553	19389553	+	Silent	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chrX:19389553C>T	ENST00000338883.4	-	23	3203	c.3204G>A	c.(3202-3204)gcG>gcA	p.A1068A	MAP3K15_ENST00000359173.3_Silent_p.A503A|MAP3K15_ENST00000469203.2_Silent_p.A900A|MAP3K15_ENST00000518578.1_5'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	1068							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.A1115A(1)|p.A543A(1)		NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					ATATTGTGGTCGCCATCACCC	0.517																																					p.A1068A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G3204A	X						.						142.0	112.0	122.0					X																	19389553		2203	4300	6503	19299474	SO:0001819	synonymous_variant	389840	exon23			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.3204G>A	X.37:g.19389553C>T		Somatic		Capture	Illumina HiSeq	Phase_I	19299474	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Silent	SNP	ENST00000338883.4	37																																																																																					0.517	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
ITIH6	347365	broad.mit.edu	37	X	54784198	54784198	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chrX:54784198G>A	ENST00000218436.6	-	8	2338	c.2309C>T	c.(2308-2310)tCg>tTg	p.S770L		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	770	Pro-rich.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S770L(1)									AGCTTTGGGCGAGGCTGGGAT	0.532																																					p.S770L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2309T	X						.						110.0	101.0	104.0					X																	54784198		2203	4300	6503	54800923	SO:0001583	missense	347365	exon8			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.2309C>T	X.37:g.54784198G>A	ENSP00000218436:p.Ser770Leu	Somatic		Capture	Illumina HiSeq	Phase_I	54800923	NM_198510	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	1.426	-0.571662	0.03882	.	.	ENSG00000102313	ENST00000218436	T	0.02158	4.42	3.9	-3.91	0.04168	.	.	.	.	.	T	0.01254	0.0041	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47459	-0.9116	9	0.31617	T	0.26	.	7.8568	0.29487	0.1367:0.0:0.5515:0.3118	.	770	Q6UXX5	ITH5L_HUMAN	L	770	ENSP00000218436:S770L	ENSP00000218436:S770L	S	-	2	0	ITIH5L	54800923	0.980000	0.34600	0.002000	0.10522	0.001000	0.01503	0.629000	0.24538	-0.474000	0.06862	-2.752000	0.00124	TCG		0.532	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
AMER1	139285	broad.mit.edu	37	X	63411366	63411366	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chrX:63411366G>A	ENST00000330258.3	-	2	2073	c.1801C>T	c.(1801-1803)Cga>Tga	p.R601*	AMER1_ENST00000403336.1_Nonsense_Mutation_p.R601*|AMER1_ENST00000374869.3_Nonsense_Mutation_p.R601*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	601					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.R601*(2)									TAAGCCTCTCGAGTATAGGCC	0.642																																					p.R601X												.	.	69	Whole gene deletion(67)|Substitution - Nonsense(2)	kidney(65)|large_intestine(3)|ovary(1)	c.C1801T	X						.						37.0	33.0	34.0					X																	63411366		2203	4296	6499	63328091	SO:0001587	stop_gained	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1801C>T	X.37:g.63411366G>A	ENSP00000329117:p.Arg601*	Somatic		Capture	Illumina HiSeq	Phase_I	63328091	NM_152424	A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429397	0.83776	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	3.52	-0.532	0.11890	.	1.141380	0.06874	N	0.801297	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0202	4.8079	0.13329	0.1945:0.0:0.2151:0.5904	.	.	.	.	X	601	.	ENSP00000329117:R601X	R	-	1	2	FAM123B	63328091	0.000000	0.05858	0.000000	0.03702	0.258000	0.26162	0.264000	0.18497	-0.228000	0.09869	-0.353000	0.07706	CGA		0.642	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
GPRASP1	9737	broad.mit.edu	37	X	101908990	101908990	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3869-01A-01W-0995-10	TCGA-AA-3869-10A-01W-0995-10	g.chrX:101908990C>T	ENST00000361600.5	+	5	950	c.149C>T	c.(148-150)gCa>gTa	p.A50V	GPRASP1_ENST00000415986.1_Missense_Mutation_p.A50V|GPRASP1_ENST00000537097.1_Missense_Mutation_p.A50V|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000444152.1_Missense_Mutation_p.A50V	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	50					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)		p.A50V(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						ATGCCTGGGGCAAGGCCCAAG	0.547																																					p.A50V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C149T	X						.						128.0	124.0	126.0					X																	101908990		2203	4300	6503	101795646	SO:0001583	missense	9737	exon3			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.149C>T	X.37:g.101908990C>T	ENSP00000355146:p.Ala50Val	Somatic		Capture	Illumina HiSeq	Phase_I	101795646	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.056311	0.36277	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	2.28	0.396	0.16309	.	.	.	.	.	T	0.30417	0.0764	L	0.36672	1.1	0.23568	N	0.997399	D	0.58620	0.983	P	0.54965	0.765	T	0.15122	-1.0448	9	0.72032	D	0.01	-0.9381	2.0667	0.03604	0.2594:0.4141:0.0:0.3265	.	50	Q5JY77	GASP1_HUMAN	V	50	ENSP00000393691:A50V;ENSP00000409420:A50V;ENSP00000355146:A50V;ENSP00000445683:A50V	ENSP00000355146:A50V	A	+	2	0	GPRASP1	101795646	0.029000	0.19370	0.052000	0.19188	0.152000	0.21847	-0.173000	0.09854	-0.007000	0.14345	0.292000	0.19580	GCA		0.547	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
