#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CUBN	8029	broad.mit.edu	37	10	16990478	16990478	+	Splice_Site	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr10:16990478C>T	ENST00000377833.4	-	35	5273	c.5208G>A	c.(5206-5208)tcG>tcA	p.S1736S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1736					cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.S1736S(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTTTCTTACCCGACACTGATG	0.512																																					p.S1736S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5208A	10						.						69.0	59.0	62.0					10																	16990478		2203	4300	6503	17030484	SO:0001630	splice_region_variant	8029	exon35			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5209+1G>A	10.37:g.16990478C>T		Somatic		Capture	Illumina HiSeq	Phase_I	17030484	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	CCDS7113.1																																																																																				0.512	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	Silent
XPNPEP1	7511	broad.mit.edu	37	10	111637761	111637761	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr10:111637761C>T	ENST00000502935.1	-	13	1357	c.1238G>A	c.(1237-1239)cGc>cAc	p.R413H	XPNPEP1_ENST00000369680.4_Missense_Mutation_p.R370H|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.R413H|XPNPEP1_ENST00000369683.1_Missense_Mutation_p.R299H					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble									p.R370H(1)		endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TCCTTACCTGCGAAACTCCTC	0.463																																					p.R413H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1238A	10						.						100.0	98.0	99.0					10																	111637761		2203	4300	6503	111627751	SO:0001583	missense	7511	exon13				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1238G>A	10.37:g.111637761C>T	ENSP00000421566:p.Arg413His	Somatic		Capture	Illumina HiSeq	Phase_I	111627751	NM_001167604		Missense_Mutation	SNP	ENST00000502935.1	37	CCDS7560.2	.	.	.	.	.	.	.	.	.	.	C	32	5.190773	0.94923	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	5.77	5.77	0.91146	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.91831	0.7415	H	0.95712	3.71	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.936;0.972	D	0.93727	0.7038	10	0.87932	D	0	.	17.7656	0.88476	0.0:1.0:0.0:0.0	.	413;413;370	B4E2P4;G5E9Y2;Q9NQW7	.;.;XPP1_HUMAN	H	413;299;413;370	ENSP00000421566:R413H;ENSP00000358697:R299H;ENSP00000324011:R413H;ENSP00000358694:R370H	ENSP00000324011:R413H	R	-	2	0	XPNPEP1	111627751	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	6.887000	0.75616	2.729000	0.93468	0.467000	0.42956	CGC		0.463	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2		
OR52L1	338751	broad.mit.edu	37	11	6008110	6008110	+	Silent	SNP	G	G	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr11:6008110G>A	ENST00000332249.4	-	1	105	c.51C>T	c.(49-51)ctC>ctT	p.L17L		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L2L(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AATTGCTAAGGAGCATTATCA	0.463																																					p.L17L	Melanoma(121;653 1666 10547 22796 51255)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C51T	11						.						51.0	50.0	50.0					11																	6008110		1852	4081	5933	5964686	SO:0001819	synonymous_variant	338751	exon1			AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.51C>T	11.37:g.6008110G>A		Somatic		Capture	Illumina HiSeq	Phase_I	5964686	NM_001005173	B2RPA6|Q6IFK9	Silent	SNP	ENST00000332249.4	37	CCDS44529.1																																																																																				0.463	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173	
C12orf40	283461	broad.mit.edu	37	12	40078677	40078677	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr12:40078677T>G	ENST00000324616.5	+	10	1449	c.1295T>G	c.(1294-1296)aTa>aGa	p.I432R	C12orf40_ENST00000405531.3_Missense_Mutation_p.I432R	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	432								p.I432R(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						AGGGGAAATATACCTTCGGAA	0.368																																					p.I432R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1295G	12						.						117.0	112.0	114.0					12																	40078677		1839	4078	5917	38364944	SO:0001583	missense	283461	exon10			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.1295T>G	12.37:g.40078677T>G	ENSP00000317671:p.Ile432Arg	Somatic		Capture	Illumina HiSeq	Phase_I	38364944	NM_001031748	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	ENST00000324616.5	37	CCDS41770.1	.	.	.	.	.	.	.	.	.	.	T	14.67	2.604207	0.46423	.	.	ENSG00000180116	ENST00000405531;ENST00000324616	T;T	0.52754	0.65;0.65	5.15	-0.364	0.12553	.	0.979536	0.08341	N	0.960817	T	0.39784	0.1091	L	0.32530	0.975	0.09310	N	1	D	0.53745	0.962	P	0.49887	0.625	T	0.27297	-1.0078	10	0.66056	D	0.02	.	2.2617	0.04068	0.1475:0.085:0.3057:0.4618	.	432	Q86WS4	CL040_HUMAN	R	432	ENSP00000383897:I432R;ENSP00000317671:I432R	ENSP00000317671:I432R	I	+	2	0	C12orf40	38364944	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-1.069000	0.03444	-0.130000	0.11599	0.533000	0.62120	ATA		0.368	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2	NM_173599	
PDZRN4	29951	broad.mit.edu	37	12	41957403	41957403	+	Silent	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr12:41957403C>T	ENST00000402685.2	+	8	1427	c.1419C>T	c.(1417-1419)aaC>aaT	p.N473N	PDZRN4_ENST00000539469.2_Silent_p.N215N|PDZRN4_ENST00000298919.7_Silent_p.N213N	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	473	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N473N(1)|p.N215N(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TGCTGTCTAACGATGAGTGTA	0.418																																					p.N473N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1419T	12						.						135.0	123.0	127.0					12																	41957403		2203	4300	6503	40243670	SO:0001819	synonymous_variant	29951	exon8			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1419C>T	12.37:g.41957403C>T		Somatic		Capture	Illumina HiSeq	Phase_I	40243670	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Silent	SNP	ENST00000402685.2	37	CCDS53777.1																																																																																				0.418	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
ADAMTS20	80070	broad.mit.edu	37	12	43777690	43777690	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr12:43777690G>A	ENST00000389420.3	-	30	4542	c.4543C>T	c.(4543-4545)Cag>Tag	p.Q1515*		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1515	TSP type-1 12. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Q1515*(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CGGGTGGACTGATCACACATT	0.507																																					p.Q1515X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4543T	12						.						158.0	125.0	136.0					12																	43777690		2203	4300	6503	42063957	SO:0001587	stop_gained	80070	exon30			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4543C>T	12.37:g.43777690G>A	ENSP00000374071:p.Gln1515*	Somatic		Capture	Illumina HiSeq	Phase_I	42063957	NM_025003	A6NNC9|J3QT00	Nonsense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	G	43	9.881666	0.99286	.	.	ENSG00000173157	ENST00000389420	.	.	.	4.25	-0.0478	0.13841	.	1.405700	0.04843	N	0.440846	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	4.073	0.09891	0.073:0.2605:0.3982:0.2683	.	.	.	.	X	1515	.	ENSP00000374071:Q1515X	Q	-	1	0	ADAMTS20	42063957	0.000000	0.05858	0.000000	0.03702	0.950000	0.60333	0.491000	0.22419	-0.003000	0.14444	0.655000	0.94253	CAG		0.507	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
ITGA5	3678	broad.mit.edu	37	12	54803376	54803376	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr12:54803376G>A	ENST00000293379.4	-	3	616	c.355C>T	c.(355-357)Cgg>Tgg	p.R119W	ITGA5_ENST00000547744.1_5'Flank|RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	119					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.R119W(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						TCCAGGAGCCGAGAGCCTTGT	0.587																																					p.R119W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C355T	12						.						38.0	35.0	36.0					12																	54803376		2203	4300	6503	53089643	SO:0001583	missense	3678	exon3				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.355C>T	12.37:g.54803376G>A	ENSP00000293379:p.Arg119Trp	Somatic		Capture	Illumina HiSeq	Phase_I	53089643	NM_002205	Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	37	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.886936	0.91814	.	.	ENSG00000161638	ENST00000293379	D	0.88509	-2.39	4.32	4.32	0.51571	.	0.079486	0.49916	D	0.000136	D	0.93841	0.8030	M	0.81112	2.525	0.45161	D	0.99817	D	0.89917	1.0	D	0.83275	0.996	D	0.94232	0.7477	10	0.87932	D	0	.	12.5091	0.55997	0.0:0.0:1.0:0.0	.	119	P08648	ITA5_HUMAN	W	119	ENSP00000293379:R119W	ENSP00000293379:R119W	R	-	1	2	ITGA5	53089643	1.000000	0.71417	0.981000	0.43875	0.902000	0.53008	1.974000	0.40559	2.417000	0.82017	0.313000	0.20887	CGG		0.587	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		
PLEKHG6	55200	broad.mit.edu	37	12	6426535	6426535	+	Silent	SNP	C	C	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr12:6426535C>A	ENST00000396988.3	+	8	1053	c.823C>A	c.(823-825)Cga>Aga	p.R275R	PLEKHG6_ENST00000449001.2_Silent_p.R243R|PLEKHG6_ENST00000536531.1_Silent_p.R275R|PLEKHG6_ENST00000011684.7_Silent_p.R275R|PLEKHG6_ENST00000304581.8_5'Flank	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	275	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R275R(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						GGCTTACGCCCGAGAACAGCA	0.612																																					p.R243R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C727A	12						.						117.0	98.0	104.0					12																	6426535		2203	4300	6503	6296796	SO:0001819	synonymous_variant	55200	exon7			AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.823C>A	12.37:g.6426535C>A		Somatic		Capture	Illumina HiSeq	Phase_I	6296796	NM_001144857	Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Silent	SNP	ENST00000396988.3	37	CCDS8541.1																																																																																				0.612	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399031.1	NM_018173	
A2M	2	broad.mit.edu	37	12	9246106	9246106	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr12:9246106C>T	ENST00000318602.7	-	18	2502	c.2195G>A	c.(2194-2196)cGa>cAa	p.R732Q		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	732	Inhibitory.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.R732Q(2)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GAAGTACTTTCGTACGGTCTC	0.458																																					p.R732Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2195A	12						.						110.0	103.0	106.0					12																	9246106		1920	4127	6047	9137373	SO:0001583	missense	2	exon18			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.2195G>A	12.37:g.9246106C>T	ENSP00000323929:p.Arg732Gln	Somatic		Capture	Illumina HiSeq	Phase_I	9137373	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688597	0.88639	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.64260	-0.09	5.11	5.11	0.69529	.	0.494944	0.17831	N	0.160522	T	0.82107	0.4965	M	0.89095	3.005	0.40854	D	0.983776	D	0.89917	1.0	D	0.75020	0.985	D	0.85578	0.1238	10	0.87932	D	0	.	15.6236	0.76829	0.0:1.0:0.0:0.0	.	732	P01023	A2MG_HUMAN	Q	732;747	ENSP00000323929:R732Q	ENSP00000323929:R732Q	R	-	2	0	A2M	9137373	0.791000	0.28800	0.047000	0.18901	0.670000	0.39368	7.432000	0.80349	2.538000	0.85594	0.655000	0.94253	CGA		0.458	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
INHBC	3626	broad.mit.edu	37	12	57828738	57828738	+	Silent	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr12:57828738C>T	ENST00000309668.2	+	1	196	c.69C>T	c.(67-69)ggC>ggT	p.G23G	RP11-756H6.1_ENST00000547552.1_lincRNA	NM_005538.2	NP_005529.1	P55103	INHBC_HUMAN	inhibin, beta C	23					growth (GO:0040007)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	transforming growth factor beta receptor binding (GO:0005160)	p.G23G(1)		breast(2)|endometrium(1)|large_intestine(6)|liver(2)|lung(4)|prostate(1)	16						CCAGAGCTGGCGGTCAGTGTC	0.587																																					p.G23G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C69T	12						.						38.0	38.0	38.0					12																	57828738		2203	4300	6503	56115005	SO:0001819	synonymous_variant	3626	exon1				CCDS8938.1	12q13	2008-02-05				ENSG00000175189			6068	protein-coding gene	gene with protein product		601233				7826378	Standard	NM_005538		Approved		uc001snv.1	P55103	OTTHUMG00000169994	ENST00000309668.2:c.69C>T	12.37:g.57828738C>T		Somatic		Capture	Illumina HiSeq	Phase_I	56115005	NM_005538	A1L3Y2	Silent	SNP	ENST00000309668.2	37	CCDS8938.1																																																																																				0.587	INHBC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406770.1	NM_005538	
RNF17	56163	broad.mit.edu	37	13	25416206	25416206	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr13:25416206T>C	ENST00000255324.5	+	19	2562	c.2510T>C	c.(2509-2511)gTt>gCt	p.V837A	RNF17_ENST00000339524.3_5'Flank|RNF17_ENST00000381921.1_Missense_Mutation_p.V837A	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	837					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.V837A(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		GTGCTCTTAGTTGAGCTTTTC	0.333																																					p.V837A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2510C	13						.						154.0	148.0	150.0					13																	25416206		2203	4300	6503	24314206	SO:0001583	missense	56163	exon19			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2510T>C	13.37:g.25416206T>C	ENSP00000255324:p.Val837Ala	Somatic		Capture	Illumina HiSeq	Phase_I	24314206	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	T	17.84	3.487261	0.63962	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120	T;T;T	0.24723	1.84;1.84;1.84	5.29	5.29	0.74685	Staphylococcal nuclease (SNase-like) (1);	0.180678	0.34959	N	0.003553	T	0.39172	0.1068	L	0.34521	1.04	0.80722	D	1	D;D;D	0.71674	0.996;0.996;0.998	P;D;D	0.75484	0.875;0.986;0.917	T	0.20207	-1.0282	10	0.62326	D	0.03	-17.5686	13.0354	0.58867	0.0:0.0:0.0:1.0	.	837;837;837	B7Z7S1;Q9BXT8-5;Q9BXT8	.;.;RNF17_HUMAN	A	837;837;696;161	ENSP00000255324:V837A;ENSP00000371346:V837A;ENSP00000388892:V161A	ENSP00000255324:V837A	V	+	2	0	RNF17	24314206	1.000000	0.71417	0.997000	0.53966	0.670000	0.39368	4.738000	0.62073	2.131000	0.65755	0.477000	0.44152	GTT		0.333	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
FANCM	57697	broad.mit.edu	37	14	45644954	45644954	+	Silent	SNP	G	G	A	rs141430587	byFrequency	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr14:45644954G>A	ENST00000267430.5	+	14	3082	c.2997G>A	c.(2995-2997)ccG>ccA	p.P999P	FANCM_ENST00000542564.2_Silent_p.P973P	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	999					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)	p.P999P(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						ATTCTCCTCCGCCTCTCAGTG	0.368								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.P999P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2997A	14						.	A		2,4404		0,2,2201	54.0	56.0	56.0		2997	-10.0	0.0	14	dbSNP_134	56	0,8592		0,0,4296	no	coding-synonymous	FANCM	NM_020937.2		0,2,6497	AA,AG,GG		0.0,0.0454,0.0154		999/2049	45644954	2,12996	2203	4296	6499	44714704	SO:0001819	synonymous_variant	57697	exon14	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.2997G>A	14.37:g.45644954G>A		Somatic		Capture	Illumina HiSeq	Phase_I	44714704	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	37	CCDS32070.1																																																																																				0.368	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
KLHDC2	23588	broad.mit.edu	37	14	50249122	50249122	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr14:50249122G>A	ENST00000298307.5	+	11	1852	c.991G>A	c.(991-993)Gaa>Aaa	p.E331K	KLHDC2_ENST00000554589.1_Missense_Mutation_p.E331K|KLHDC2_ENST00000557247.1_Silent_p.E306E|NEMF_ENST00000556925.1_5'Flank	NM_014315.2	NP_055130.1	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	331						nucleus (GO:0005634)		p.E331K(1)		endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	all_epithelial(31;0.000959)|Breast(41;0.0117)					CGATGAAGGAGAAGTAATTGT	0.408																																					p.E331K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G991A	14						.						183.0	181.0	182.0					14																	50249122		2203	4300	6503	49318872	SO:0001583	missense	23588	exon11			AK001771	CCDS9693.1	14q21.3	2003-01-15			ENSG00000165516	ENSG00000165516			20231	protein-coding gene	gene with protein product		611280				11384994	Standard	NM_014315		Approved	HCLP-1, LCP	uc001wwx.3	Q9Y2U9	OTTHUMG00000140288	ENST00000298307.5:c.991G>A	14.37:g.50249122G>A	ENSP00000298307:p.Glu331Lys	Somatic		Capture	Illumina HiSeq	Phase_I	49318872	NM_014315	B3KPF9|Q6IAF0|Q86TY9	Missense_Mutation	SNP	ENST00000298307.5	37	CCDS9693.1	.	.	.	.	.	.	.	.	.	.	G	36	5.912992	0.97099	.	.	ENSG00000165516	ENST00000298307;ENST00000554589	T;T	0.62105	0.05;0.05	5.81	5.81	0.92471	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.76709	0.4025	M	0.71036	2.16	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.77557	0.99;0.971	T	0.69847	-0.5034	10	0.09590	T	0.72	-26.0606	19.0621	0.93097	0.0:0.0:1.0:0.0	.	331;331	G3V3U8;Q9Y2U9	.;KLDC2_HUMAN	K	331	ENSP00000298307:E331K;ENSP00000451439:E331K	ENSP00000298307:E331K	E	+	1	0	KLHDC2	49318872	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.038000	0.93771	2.746000	0.94184	0.655000	0.94253	GAA		0.408	KLHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276869.1		
APBA2	321	broad.mit.edu	37	15	29367160	29367160	+	Missense_Mutation	SNP	C	C	T	rs145494651		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr15:29367160C>T	ENST00000558402.1	+	6	1587	c.988C>T	c.(988-990)Cgc>Tgc	p.R330C	APBA2_ENST00000411764.1_Missense_Mutation_p.R330C|APBA2_ENST00000561069.1_Missense_Mutation_p.R330C|APBA2_ENST00000558330.1_Missense_Mutation_p.R330C|APBA2_ENST00000558259.1_Missense_Mutation_p.R330C			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	330					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.R330C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GAAGCAGCAGCGCTCTGATCT	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		19067	0.001		0.0	False		,,,				2504	0.0				p.R330C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C988T	15						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	94.0	86.0	88.0		988,988	5.1	1.0	15	dbSNP_134	88	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	APBA2	NM_001130414.1,NM_005503.3	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	330/738,330/750	29367160	1,13005	2203	4300	6503	27154452	SO:0001583	missense	321	exon4			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.988C>T	15.37:g.29367160C>T	ENSP00000453293:p.Arg330Cys	Somatic		Capture	Illumina HiSeq	Phase_I	27154452	NM_005503	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	37	CCDS10022.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	23.9	4.471689	0.84533	0.0	1.16E-4	ENSG00000034053	ENST00000411764;ENST00000219865;ENST00000382938	T	0.06768	3.26	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.27027	0.0662	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.991;0.99;0.996;0.983	T	0.00601	-1.1650	10	0.66056	D	0.02	.	15.9522	0.79850	0.0:1.0:0.0:0.0	.	330;34;330;330	Q5XKC0;Q6ZVB1;E9PGI4;Q99767	.;.;.;APBA2_HUMAN	C	330;330;34	ENSP00000409312:R330C	ENSP00000219865:R330C	R	+	1	0	APBA2	27154452	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.530000	0.60595	2.350000	0.79820	0.655000	0.94253	CGC		0.428	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
TGM7	116179	broad.mit.edu	37	15	43579774	43579774	+	Missense_Mutation	SNP	C	C	T	rs539233935		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr15:43579774C>T	ENST00000452443.2	-	5	656	c.652G>A	c.(652-654)Gac>Aac	p.D218N		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	218					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.D218N(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	TACACCACGTCGTTCCGCTGG	0.527																																					p.D218N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G652A	15						.						167.0	146.0	153.0					15																	43579774		2201	4299	6500	41367066	SO:0001583	missense	116179	exon5			AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.652G>A	15.37:g.43579774C>T	ENSP00000389466:p.Asp218Asn	Somatic		Capture	Illumina HiSeq	Phase_I	41367066	NM_052955		Missense_Mutation	SNP	ENST00000452443.2	37	CCDS32213.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417007	0.42918	.	.	ENSG00000159495	ENST00000452443	D	0.92149	-2.98	5.91	0.159	0.14968	.	0.196194	0.50627	N	0.000113	T	0.80314	0.4600	N	0.13352	0.335	0.20764	N	0.999857	B	0.24768	0.111	B	0.14578	0.011	T	0.65340	-0.6192	10	0.16896	T	0.51	-14.8034	9.5927	0.39557	0.0:0.5297:0.0:0.4703	.	218	Q96PF1	TGM7_HUMAN	N	218	ENSP00000389466:D218N	ENSP00000389466:D218N	D	-	1	0	TGM7	41367066	0.002000	0.14202	0.967000	0.41034	0.870000	0.49936	0.063000	0.14410	0.122000	0.18314	-0.136000	0.14681	GAC		0.527	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955	
CGNL1	84952	broad.mit.edu	37	15	57816920	57816920	+	Nonsense_Mutation	SNP	C	C	T	rs142707768		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr15:57816920C>T	ENST00000281282.5	+	12	3088	c.3010C>T	c.(3010-3012)Cga>Tga	p.R1004*	CTD-2515H24.4_ENST00000566990.1_lincRNA	NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	1004						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.R1004*(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		AGAAAAGTCCCGACTGACAGC	0.468																																					p.R1004X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3010T	15						.	C	stop/ARG	0,4384		0,0,2192	69.0	70.0	70.0		3010	4.4	0.6	15	dbSNP_134	70	1,8583	1.2+/-3.3	0,1,4291	no	stop-gained	CGNL1	NM_032866.3		0,1,6483	TT,TC,CC		0.0116,0.0,0.0077		1004/1303	57816920	1,12967	2192	4292	6484	55604212	SO:0001587	stop_gained	84952	exon12			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.3010C>T	15.37:g.57816920C>T	ENSP00000281282:p.Arg1004*	Somatic		Capture	Illumina HiSeq	Phase_I	55604212	NM_032866	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Nonsense_Mutation	SNP	ENST00000281282.5	37	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	C	40	8.123648	0.98665	0.0	1.16E-4	ENSG00000128849	ENST00000281282	.	.	.	5.34	4.39	0.52855	.	0.332802	0.21788	N	0.069101	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.1418	8.4778	0.33023	0.1596:0.7634:0.0:0.0771	.	.	.	.	X	1004	.	ENSP00000281282:R1004X	R	+	1	2	CGNL1	55604212	0.167000	0.22975	0.636000	0.29352	0.687000	0.40016	2.416000	0.44644	1.183000	0.42943	0.655000	0.94253	CGA		0.468	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
MEFV	4210	broad.mit.edu	37	16	3304261	3304261	+	Silent	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr16:3304261C>T	ENST00000219596.1	-	2	846	c.807G>A	c.(805-807)gcG>gcA	p.A269A	MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron|MEFV_ENST00000536379.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	269	Interaction with RELA.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A269A(1)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						AGTCCAGATTCGCAGCTGTCT	0.557																																					p.A269A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G807A	16						.						113.0	129.0	124.0					16																	3304261		2197	4300	6497	3244262	SO:0001819	synonymous_variant	4210	exon2			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.807G>A	16.37:g.3304261C>T		Somatic		Capture	Illumina HiSeq	Phase_I	3244262	NM_000243	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																				0.557	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
KRTAP4-12	83755	broad.mit.edu	37	17	39280162	39280162	+	Silent	SNP	A	A	G	rs28515113	byFrequency	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr17:39280162A>G	ENST00000394014.1	-	1	257	c.213T>C	c.(211-213)tgT>tgC	p.C71C		NM_031854.2	NP_114060.1	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	71	31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament (GO:0045095)		p.C71C(3)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGGTGGTCCTACAGCAGGTGG	0.677													A|||	863	0.172324	0.4357	0.1138	5008	,	,		14227	0.1389		0.0477	False		,,,				2504	0.0204				p.C71C												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.T213C	17						.	A		192,3702		9,174,1764	31.0	55.0	47.0		213	-2.0	0.0	17	dbSNP_125	47	5,8543		0,5,4269	no	coding-synonymous	KRTAP4-12	NM_031854.2		9,179,6033	GG,GA,AA		0.0585,4.9307,1.5833		71/202	39280162	197,12245	1947	4274	6221	36533688	SO:0001819	synonymous_variant	83755	exon1			AJ406943	CCDS32649.1	17q21.2	2013-06-25			ENSG00000213416	ENSG00000213416		"""Keratin associated proteins"""	16776	protein-coding gene	gene with protein product						11279113	Standard	NM_031854		Approved	KAP4.12	uc002hwa.3	Q9BQ66	OTTHUMG00000133632	ENST00000394014.1:c.213T>C	17.37:g.39280162A>G		Somatic		Capture	Illumina HiSeq	Phase_I	36533688	NM_031854	A3KMC5|Q495I0	Silent	SNP	ENST00000394014.1	37	CCDS32649.1																																																																																				0.677	KRTAP4-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257777.1		
XYLT2	64132	broad.mit.edu	37	17	48435636	48435636	+	Silent	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr17:48435636C>T	ENST00000017003.2	+	10	2059	c.2010C>T	c.(2008-2010)gaC>gaT	p.D670D	XYLT2_ENST00000507602.1_Intron	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	670					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.D670D(1)		endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					GGCCGCTGGACGAGCCTGTGG	0.612																																					p.D670D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2010T	17						.						25.0	28.0	27.0					17																	48435636		2202	4299	6501	45790635	SO:0001819	synonymous_variant	64132	exon10			AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.2010C>T	17.37:g.48435636C>T		Somatic		Capture	Illumina HiSeq	Phase_I	45790635	NM_022167	Q6UY41|Q86V00	Silent	SNP	ENST00000017003.2	37	CCDS11563.1																																																																																				0.612	XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367046.1	NM_022167	
ZNF516	9658	broad.mit.edu	37	18	74154505	74154506	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr18:74154505_74154506insC	ENST00000443185.2	-	3	822_823	c.505_506insG	c.(505-507)gagfs	p.E169fs	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E169fs*48(1)|p.E169fs*18(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		TGCCTTGGCCTCCCCCGGGGCG	0.683																																					p.E169fs												.	.	2	Deletion - Frameshift(1)|Insertion - Frameshift(1)	large_intestine(2)	c.506_507insG	18						.																																			72283494	SO:0001589	frameshift_variant	9658	exon3			D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.506dupG	18.37:g.74154510_74154510dupC	ENSP00000394757:p.Glu169fs	Somatic		Capture	Illumina HiSeq	Phase_I	72283493	NM_014643		Frame_Shift_Ins	INS	ENST00000443185.2	37																																																																																					0.683	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
EPG5	57724	broad.mit.edu	37	18	43535197	43535197	+	Silent	SNP	T	T	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr18:43535197T>A	ENST00000282041.5	-	2	205	c.171A>T	c.(169-171)ggA>ggT	p.G57G		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	57					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.G57G(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TCAGATGGTCTCCTTTGAATT	0.453																																					p.G57G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A171T	18						.						97.0	90.0	92.0					18																	43535197		1891	4116	6007	41789195	SO:0001819	synonymous_variant	57724	exon2			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.171A>T	18.37:g.43535197T>A		Somatic		Capture	Illumina HiSeq	Phase_I	41789195	NM_020964	A2BDF3|Q9H8C8	Silent	SNP	ENST00000282041.5	37	CCDS11926.2																																																																																				0.453	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
ZBTB7C	201501	broad.mit.edu	37	18	45556212	45556212	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr18:45556212C>T	ENST00000588982.1	-	4	1780	c.1279G>A	c.(1279-1281)Gcc>Acc	p.A427T	ZBTB7C_ENST00000586438.1_Missense_Mutation_p.A427T|ZBTB7C_ENST00000332053.2_Missense_Mutation_p.A427T|ZBTB7C_ENST00000535628.2_Missense_Mutation_p.A427T|ZBTB7C_ENST00000590800.1_Missense_Mutation_p.A427T			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	427							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.A427T(1)		endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						ACGAACTTGGCGTTGCAGTGG	0.597																																					p.A427T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1279A	18						.						147.0	109.0	122.0					18																	45556212		2203	4300	6503	43810210	SO:0001583	missense	201501	exon3			Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.1279G>A	18.37:g.45556212C>T	ENSP00000468782:p.Ala427Thr	Somatic		Capture	Illumina HiSeq	Phase_I	43810210	NM_001039360	O73453	Missense_Mutation	SNP	ENST00000588982.1	37	CCDS32830.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962196	0.74016	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	T;T	0.07567	3.18;3.18	4.51	3.64	0.41730	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.063897	0.64402	D	0.000006	T	0.07683	0.0193	L	0.35288	1.05	0.37800	D	0.927681	B;B	0.13594	0.008;0.008	B;B	0.10450	0.005;0.005	T	0.18555	-1.0333	10	0.35671	T	0.21	.	12.5514	0.56229	0.0:0.9173:0.0:0.0827	.	427;427	B2RG49;A1YPR0	.;ZBT7C_HUMAN	T	427	ENSP00000439781:A427T;ENSP00000328732:A427T	ENSP00000328732:A427T	A	-	1	0	ZBTB7C	43810210	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.403000	0.52615	0.886000	0.36113	0.555000	0.69702	GCC		0.597	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
PTPRS	5802	broad.mit.edu	37	19	5212221	5212221	+	Missense_Mutation	SNP	C	C	T	rs377564137		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr19:5212221C>T	ENST00000587303.1	-	31	4909	c.4810G>A	c.(4810-4812)Gcc>Acc	p.A1604T	PTPRS_ENST00000592099.1_Missense_Mutation_p.A1157T|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Missense_Mutation_p.A1584T|PTPRS_ENST00000353284.2_Missense_Mutation_p.A1157T|PTPRS_ENST00000357368.4_Missense_Mutation_p.A1604T|PTPRS_ENST00000348075.2_Missense_Mutation_p.A1566T|PTPRS_ENST00000588012.1_Missense_Mutation_p.A1566T|PTPRS_ENST00000372412.4_Missense_Mutation_p.A1605T			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1604	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A1604T(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	TCAAGCATGGCGTCGATGACG	0.637																																					p.A1604T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4810A	19						.	C	THR/ALA,THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	66.0	68.0	67.0		4810,3469,4696,3481	2.5	1.0	19		67	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	PTPRS	NM_002850.3,NM_130853.2,NM_130854.2,NM_130855.2	58,58,58,58	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging	1604/1949,1157/1502,1566/1911,1161/1506	5212221	2,13004	2203	4300	6503	5163221	SO:0001583	missense	5802	exon32			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.4810G>A	19.37:g.5212221C>T	ENSP00000467537:p.Ala1604Thr	Somatic		Capture	Illumina HiSeq	Phase_I	5163221	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768668	0.69878	2.27E-4	1.16E-4	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6	2.47	2.47	0.30058	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	U	0.000004	T	0.40473	0.1118	L	0.27975	0.815	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.972;1.0;0.995;1.0;1.0	D;P;D;P;D;D	0.97110	0.999;0.467;0.999;0.62;1.0;0.999	T	0.43491	-0.9388	10	0.87932	D	0	.	13.3072	0.60359	0.0:1.0:0.0:0.0	.	1186;1157;1161;1566;1604;1199	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	T	1199;1605;1604;1604;1595;1584;1566;1186;1161;1157	ENSP00000361489:A1605T;ENSP00000349932:A1604T;ENSP00000262963:A1584T;ENSP00000269907:A1566T;ENSP00000327313:A1157T	ENSP00000262963:A1584T	A	-	1	0	PTPRS	5163221	1.000000	0.71417	0.987000	0.45799	0.917000	0.54804	7.484000	0.81180	1.399000	0.46721	0.478000	0.44815	GCC		0.637	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
CEACAM20	125931	broad.mit.edu	37	19	45028102	45028102	+	RNA	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr19:45028102C>T	ENST00000454753.1	-	0	667							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				TGAGTCCTCCCGCTGGACAAT	0.527																																					p.R130Q												.	.	0			c.G389A	19						.						68.0	68.0	68.0					19																	45028102		2079	4228	6307	49719942			125931	exon3			AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45028102C>T		Somatic		Capture	Illumina HiSeq	Phase_I	49719942	NM_001102597		Missense_Mutation	SNP	ENST00000454753.1	37																																																																																					0.527	CEACAM20-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000323032.1	NM_198444	
NLRP4	147945	broad.mit.edu	37	19	56370010	56370010	+	Silent	SNP	C	C	T	rs376218682		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr19:56370010C>T	ENST00000301295.6	+	3	1673	c.1251C>T	c.(1249-1251)gaC>gaT	p.D417D	NLRP4_ENST00000587891.1_Silent_p.D342D|NLRP4_ENST00000346986.5_Silent_p.D417D	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	417	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.D417D(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TTTGTGAAGACGACCTCCGGA	0.587																																					p.D417D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1251T	19						.	C		0,4406		0,0,2203	104.0	103.0	104.0		1251	-2.5	0.0	19		104	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	NLRP4	NM_134444.4		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		417/995	56370010	2,13004	2203	4300	6503	61061822	SO:0001819	synonymous_variant	147945	exon3			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1251C>T	19.37:g.56370010C>T		Somatic		Capture	Illumina HiSeq	Phase_I	61061822	NM_134444	Q86W87|Q96AY6	Silent	SNP	ENST00000301295.6	37	CCDS12936.1																																																																																				0.587	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
RASAL2	9462	broad.mit.edu	37	1	178412306	178412306	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr1:178412306A>G	ENST00000462775.1	+	6	1105	c.980A>G	c.(979-981)aAt>aGt	p.N327S	RASAL2_ENST00000448150.3_Missense_Mutation_p.N457S|RASAL2_ENST00000367649.3_Missense_Mutation_p.N475S	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	327	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)	p.N475S(1)|p.N457S(1)		biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						AGTGTGAGAAATAAAGAGGAG	0.448																																					p.N475S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1424G	1						.						103.0	104.0	104.0					1																	178412306		2203	4300	6503	176678929	SO:0001583	missense	9462	exon8			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.980A>G	1.37:g.178412306A>G	ENSP00000420558:p.Asn327Ser	Somatic		Capture	Illumina HiSeq	Phase_I	176678929	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	37	CCDS1322.1	.	.	.	.	.	.	.	.	.	.	A	6.970	0.548938	0.13312	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	T;T;T	0.80994	-1.44;2.36;-1.44	5.88	4.69	0.59074	Rho GTPase activation protein (1);Ras GTPase-activating protein (2);	0.052473	0.64402	D	0.000001	T	0.62024	0.2394	N	0.12422	0.21	0.54753	D	0.999986	B;B	0.15930	0.004;0.015	B;B	0.20767	0.01;0.031	T	0.57015	-0.7883	10	0.07482	T	0.82	.	11.9921	0.53182	0.8704:0.0:0.0:0.1296	.	327;475	Q9UJF2;F8W755	NGAP_HUMAN;.	S	457;475;327	ENSP00000407768:N457S;ENSP00000356621:N475S;ENSP00000420558:N327S	ENSP00000356621:N475S	N	+	2	0	RASAL2	176678929	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.149000	0.71795	2.243000	0.73865	0.533000	0.62120	AAT		0.448	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	
PAX7	5081	broad.mit.edu	37	1	19018282	19018282	+	Silent	SNP	G	G	A	rs140086399		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr1:19018282G>A	ENST00000375375.3	+	5	1219	c.621G>A	c.(619-621)tcG>tcA	p.S207S	PAX7_ENST00000420770.2_Silent_p.S207S|PAX7_ENST00000400661.3_Silent_p.S205S	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	207	Sufficient to mediate interaction with PAXBP1. {ECO:0000250}.				anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S207S(1)	PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		ATGTGGAGTCGGAACCTGACC	0.642			T	FOXO1A	alveolar rhabdomyosarcoma																																p.S205S			Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G615A	1						.	G	,,	2,4392		0,2,2195	31.0	25.0	27.0		621,621,615	-6.5	1.0	1	dbSNP_134	27	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	PAX7	NM_001135254.1,NM_002584.2,NM_013945.2	,,	0,2,6494	AA,AG,GG		0.0,0.0455,0.0154	,,	207/506,207/521,205/519	19018282	2,12990	2197	4299	6496	18890869	SO:0001819	synonymous_variant	5081	exon5			X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.621G>A	1.37:g.19018282G>A		Somatic		Capture	Illumina HiSeq	Phase_I	18890869	NM_013945	E9PFV9|Q0VA99|Q2PJS5	Silent	SNP	ENST00000375375.3	37	CCDS186.1																																																																																				0.642	PAX7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006928.1	NM_002584	
CACNA1E	777	broad.mit.edu	37	1	181727989	181727989	+	Silent	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr1:181727989C>T	ENST00000367573.2	+	32	4590	c.4590C>T	c.(4588-4590)atC>atT	p.I1530I	CACNA1E_ENST00000367570.1_Silent_p.I1530I|CACNA1E_ENST00000526775.1_Silent_p.I1511I|CACNA1E_ENST00000357570.5_Silent_p.I1481I|CACNA1E_ENST00000367567.4_Silent_p.I1137I|CACNA1E_ENST00000360108.3_Silent_p.I1511I|CACNA1E_ENST00000358338.5_Silent_p.I1462I	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1530					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.I1530I(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TGAAGGTCATCGCTTTTGGCT	0.498																																					p.I1530I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4590T	1						.						234.0	212.0	219.0					1																	181727989		1974	4165	6139	179994612	SO:0001819	synonymous_variant	777	exon32			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4590C>T	1.37:g.181727989C>T		Somatic		Capture	Illumina HiSeq	Phase_I	179994612	NM_000721	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1																																																																																				0.498	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
KCNQ4	9132	broad.mit.edu	37	1	41303411	41303411	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr1:41303411C>T	ENST00000347132.5	+	13	1902	c.1820C>T	c.(1819-1821)gCg>gTg	p.A607V	KCNQ4_ENST00000506017.1_3'UTR|KCNQ4_ENST00000509682.2_Missense_Mutation_p.A553V	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	607	A-domain (Tetramerization).				inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.A607V(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	CCCTCCGACGCGGAGGTGGTG	0.627																																					p.A607V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1820T	1						.						55.0	49.0	51.0					1																	41303411		2202	4300	6502	41075998	SO:0001583	missense	9132	exon13			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1820C>T	1.37:g.41303411C>T	ENSP00000262916:p.Ala607Val	Somatic		Capture	Illumina HiSeq	Phase_I	41075998	NM_004700	O96025	Missense_Mutation	SNP	ENST00000347132.5	37	CCDS456.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.381716	0.24944	.	.	ENSG00000117013	ENST00000347132;ENST00000509682	D;D	0.99619	-6.28;-6.28	4.85	1.95	0.26073	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.852454	0.10672	N	0.647448	D	0.97826	0.9286	L	0.36672	1.1	0.09310	N	0.999999	B;B	0.20550	0.012;0.046	B;B	0.15052	0.009;0.012	D	0.96273	0.9200	10	0.28530	T	0.3	-0.5687	6.8325	0.23917	0.0:0.6161:0.0:0.3839	.	553;607	P56696-2;P56696	.;KCNQ4_HUMAN	V	607;553	ENSP00000262916:A607V;ENSP00000423756:A553V	ENSP00000262916:A607V	A	+	2	0	KCNQ4	41075998	0.000000	0.05858	0.090000	0.20809	0.815000	0.46073	0.306000	0.19279	0.131000	0.18576	0.407000	0.27541	GCG		0.627	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	
LAD1	3898	broad.mit.edu	37	1	201358417	201358418	+	Missense_Mutation	DNP	CT	CT	TG			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	CT	CT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr1:201358417_201358418CT>TG	ENST00000391967.2	-	2	353_354	c.52_53AG>CA	c.(52-54)AGg>CAg	p.R18Q	LAD1_ENST00000367313.3_Missense_Mutation_p.R32Q	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	18						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)	p.R18>?(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						CTCCAGAGTCCTCTGCCGGGCA	0.673																																					.												.	.	1	Complex(1)	large_intestine(1)	c.52_53CA	1						.																																			199625041	SO:0001583	missense	3898	exon2			U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.52_53delinsTG	1.37:g.201358417_201358418delinsTG	ENSP00000375829:p.Arg18Gln	Somatic		Capture	Illumina HiSeq	Phase_I	199625040	NM_005558	O95614|Q96GD8	Missense_Mutation	DNP	ENST00000391967.2	37	CCDS1410.1																																																																																				0.673	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086946.1	NM_005558	
ELF3	1999	broad.mit.edu	37	1	201983066	201983066	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr1:201983066delC	ENST00000359651.3	+	7	4107	c.915delC	c.(913-915)ttcfs	p.F305fs	ELF3_ENST00000367284.5_Frame_Shift_Del_p.F305fs|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367283.3_Frame_Shift_Del_p.F305fs					E74-like factor 3 (ets domain transcription factor, epithelial-specific )									p.L306fs*19(2)		breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						TCTTCAAGTTCCTGCGCTCCG	0.592																																					p.F305fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.915delC	1						.						91.0	74.0	80.0					1																	201983066		2203	4300	6503	200249689	SO:0001589	frameshift_variant	1999	exon8			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.915delC	1.37:g.201983066delC	ENSP00000352673:p.Phe305fs	Somatic		Capture	Illumina HiSeq	Phase_I	200249689	NM_001114309		Frame_Shift_Del	DEL	ENST00000359651.3	37	CCDS1419.1																																																																																				0.592	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
LBP	3929	broad.mit.edu	37	20	36993398	36993398	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr20:36993398G>A	ENST00000217407.2	+	8	1074	c.913G>A	c.(913-915)Gat>Aat	p.D305N		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	305					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)	p.D305N(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				CTCCATCACAGATGACATGGT	0.448																																					p.D305N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G913A	20						.						149.0	132.0	138.0					20																	36993398		2203	4300	6503	36426812	SO:0001583	missense	3929	exon8				CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.913G>A	20.37:g.36993398G>A	ENSP00000217407:p.Asp305Asn	Somatic		Capture	Illumina HiSeq	Phase_I	36426812	NM_004139	B2R938|O43438|Q92672|Q9H403|Q9UD66	Missense_Mutation	SNP	ENST00000217407.2	37	CCDS13304.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.324855	0.24080	.	.	ENSG00000129988	ENST00000217407;ENST00000538599	T	0.11063	2.81	5.55	2.47	0.30058	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.284220	0.34484	N	0.003930	T	0.11537	0.0281	L	0.60957	1.885	0.41886	D	0.990349	B	0.20988	0.05	B	0.31812	0.136	T	0.10520	-1.0626	10	0.23302	T	0.38	-5.9802	6.0884	0.19980	0.1702:0.0:0.6812:0.1486	.	305	P18428	LBP_HUMAN	N	305	ENSP00000217407:D305N	ENSP00000217407:D305N	D	+	1	0	LBP	36426812	0.997000	0.39634	0.922000	0.36590	0.248000	0.25809	2.393000	0.44442	0.408000	0.25621	-1.251000	0.01509	GAT		0.448	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139	
LIME1	54923	broad.mit.edu	37	20	62369984	62369984	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr20:62369984delA	ENST00000309546.3	+	6	706	c.619delA	c.(619-621)aaafs	p.K207fs	RP4-583P15.14_ENST00000467211.1_Intron|LIME1_ENST00000490824.1_3'UTR|RP4-583P15.15_ENST00000490623.2_3'UTR|SLC2A4RG_ENST00000266077.2_5'Flank|RP4-583P15.14_ENST00000476221.1_3'UTR	NM_017806.2	NP_060276.2	Q9H400	LIME1_HUMAN	Lck interacting transmembrane adaptor 1	207					B cell receptor signaling pathway (GO:0050853)|T cell receptor signaling pathway (GO:0050852)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R208fs*76(1)		kidney(1)|large_intestine(1)|liver(1)	3	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					CTGCAAGCCTAAAAGGAGGGA	0.662																																					p.K207fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.619delA	20						.						25.0	31.0	29.0					20																	62369984		2201	4297	6498	61840428	SO:0001589	frameshift_variant	54923	exon6			AK000413	CCDS13536.1	20q13.33	2010-05-11			ENSG00000203896	ENSG00000203896			26016	protein-coding gene	gene with protein product		609809				12477932	Standard	NM_017806		Approved	FLJ20406, dJ583P15.4, LIME	uc002ygp.4	Q9H400	OTTHUMG00000032999	ENST00000309546.3:c.619delA	20.37:g.62369984delA	ENSP00000309521:p.Lys207fs	Somatic		Capture	Illumina HiSeq	Phase_I	61840428	NM_017806	E1P5K5|E1P5K6|Q5JWJ2|Q6XYB3|Q9NX69	Frame_Shift_Del	DEL	ENST00000309546.3	37	CCDS13536.1																																																																																				0.662	LIME1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080225.1	NM_017806	
TTC31	64427	broad.mit.edu	37	2	74719355	74719355	+	Splice_Site	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr2:74719355C>T	ENST00000233623.5	+	10	1025	c.1018C>T	c.(1018-1020)Cgg>Tgg	p.R340W	TTC31_ENST00000410003.1_Missense_Mutation_p.R340W|TTC31_ENST00000442235.2_Intron	NM_022492.4	NP_071937.4	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	340								p.R340W(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						CCAGGACCACCGGTAGGTGGG	0.542																																					p.R340W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1018T	2						.						69.0	66.0	67.0					2																	74719355		1868	4100	5968	74572863	SO:0001630	splice_region_variant	64427	exon10			AK026819	CCDS42701.1	2p13.1	2013-01-11			ENSG00000115282	ENSG00000115282		"""Tetratricopeptide (TTC) repeat domain containing"""	25759	protein-coding gene	gene with protein product						12477932	Standard	NM_022492		Approved	FLJ12788	uc002slt.2	Q49AM3	OTTHUMG00000152887	ENST00000233623.5:c.1019+1C>T	2.37:g.74719355C>T		Somatic		Capture	Illumina HiSeq	Phase_I	74572863	NM_022492	Q4KN40|Q53FD4|Q9H9F7	Missense_Mutation	SNP	ENST00000233623.5	37	CCDS42701.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.813795	0.70912	.	.	ENSG00000115282	ENST00000410003;ENST00000233623	T;T	0.59772	0.28;0.24	4.2	-2.95	0.05564	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.134101	0.46758	D	0.000275	T	0.62780	0.2456	M	0.73962	2.25	0.80722	D	1	P;P	0.48589	0.912;0.912	P;P	0.58820	0.846;0.846	T	0.62186	-0.6907	10	0.87932	D	0	.	4.1372	0.10176	0.5412:0.2474:0.0:0.2114	.	308;340	Q86XF2;Q49AM3	.;TTC31_HUMAN	W	340	ENSP00000387213:R340W;ENSP00000233623:R340W	ENSP00000233623:R340W	R	+	1	2	TTC31	74572863	0.929000	0.31497	0.977000	0.42913	0.965000	0.64279	0.273000	0.18662	-0.259000	0.09432	0.561000	0.74099	CGG		0.542	TTC31-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328422.1	NM_022492	Missense_Mutation
TSGA10	80705	broad.mit.edu	37	2	99635008	99635008	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr2:99635008C>T	ENST00000393483.3	-	19	2757	c.1913G>A	c.(1912-1914)cGc>cAc	p.R638H	TSGA10_ENST00000410001.1_Missense_Mutation_p.R638H|TSGA10_ENST00000355053.4_Missense_Mutation_p.R638H|TSGA10_ENST00000539964.1_Missense_Mutation_p.R638H	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	638	Interaction with HIF1A. {ECO:0000250}.				cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.R638H(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						CCTTTCAAAGCGCTCTGTTCC	0.393																																					p.R638H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1913A	2						.						135.0	113.0	120.0					2																	99635008		2203	4300	6503	99001440	SO:0001583	missense	80705	exon19			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1913G>A	2.37:g.99635008C>T	ENSP00000377123:p.Arg638His	Somatic		Capture	Illumina HiSeq	Phase_I	99001440	NM_025244	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	ENST00000393483.3	37	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482146	0.84747	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	T;T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45;2.45	4.66	4.66	0.58398	.	0.000000	0.64402	D	0.000006	T	0.40372	0.1114	M	0.64170	1.965	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.23833	-1.0177	10	0.87932	D	0	-3.889	16.6144	0.84903	0.0:1.0:0.0:0.0	.	638	Q9BZW7	TSG10_HUMAN	H	638;638;638;638;568;638	ENSP00000377123:R638H;ENSP00000386956:R638H;ENSP00000347161:R638H;ENSP00000444419:R638H;ENSP00000386508:R568H;ENSP00000377122:R638H	ENSP00000347161:R638H	R	-	2	0	TSGA10	99001440	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.890000	0.56220	2.576000	0.86940	0.650000	0.86243	CGC		0.393	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
SCN7A	6332	broad.mit.edu	37	2	167301375	167301375	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr2:167301375T>G	ENST00000409855.1	-	12	1649	c.1523A>C	c.(1522-1524)gAt>gCt	p.D508A		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	508					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.D508A(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	AAGGAAAAGATCAGTAAATGG	0.328																																					p.D508A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1523C	2						.						65.0	64.0	64.0					2																	167301375		1824	4088	5912	167009621	SO:0001583	missense	6332	exon12			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1523A>C	2.37:g.167301375T>G	ENSP00000386796:p.Asp508Ala	Somatic		Capture	Illumina HiSeq	Phase_I	167009621	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.264145	0.59431	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.97731	-4.51;-4.51	5.43	5.43	0.79202	.	0.000000	0.53938	D	0.000060	D	0.98823	0.9603	M	0.90082	3.085	0.50039	D	0.999848	D	0.89917	1.0	D	0.83275	0.996	D	0.99690	1.1001	10	0.87932	D	0	.	13.4827	0.61345	0.0:0.0:0.0:1.0	.	508	Q01118	SCN7A_HUMAN	A	508	ENSP00000386796:D508A;ENSP00000413699:D508A	ENSP00000259060:D508A	D	-	2	0	SCN7A	167009621	1.000000	0.71417	1.000000	0.80357	0.198000	0.23893	7.868000	0.87116	2.277000	0.76020	0.528000	0.53228	GAT		0.328	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
STAB1	23166	broad.mit.edu	37	3	52546373	52546374	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr3:52546373_52546374insG	ENST00000321725.6	+	27	2976_2977	c.2900_2901insG	c.(2899-2904)gtggggfs	p.VG967fs		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	967	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)	p.G970fs*14(1)		breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TGCCGGGCAGTGGGGGGAGGTC	0.639																																					p.V967fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2900_2901insG	3						.																																			52521414	SO:0001589	frameshift_variant	23166	exon27			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.2906dupG	3.37:g.52546379_52546379dupG	ENSP00000312946:p.Val967fs	Somatic		Capture	Illumina HiSeq	Phase_I	52521413	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Frame_Shift_Ins	INS	ENST00000321725.6	37	CCDS33768.1																																																																																				0.639	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
LAMB2	3913	broad.mit.edu	37	3	49158670	49158670	+	Missense_Mutation	SNP	T	T	G	rs200838685	byFrequency	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr3:49158670T>G	ENST00000418109.1	-	33	5550	c.5386A>C	c.(5386-5388)Acc>Ccc	p.T1796P	USP19_ENST00000488993.1_5'Flank|USP19_ENST00000453664.1_5'Flank|USP19_ENST00000398892.3_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.T1796P|USP19_ENST00000417901.1_5'Flank|USP19_ENST00000434032.2_5'Flank|USP19_ENST00000398898.2_5'Flank|USP19_ENST00000398888.2_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1796	Domain I.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CACTGGCAGGTGTTGTAGATC	0.617																																					p.T1796P												.	.	0			c.A5386C	3						.						74.0	65.0	68.0					3																	49158670		2203	4300	6503	49133674	SO:0001583	missense	3913	exon32				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.5386A>C	3.37:g.49158670T>G	ENSP00000388325:p.Thr1796Pro	None		Capture	Illumina HiSeq	Phase_I	49133674	NM_002292	Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.650167	0.87958	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.37235	1.21;1.21	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.62756	0.2454	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.68447	-0.5406	10	0.72032	D	0.01	.	15.1868	0.73009	0.0:0.0:0.0:1.0	.	1796	P55268	LAMB2_HUMAN	P	1796	ENSP00000388325:T1796P;ENSP00000307156:T1796P	ENSP00000307156:T1796P	T	-	1	0	LAMB2	49133674	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.930000	0.70104	1.982000	0.57802	0.459000	0.35465	ACC		0.617	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
FAM208A	23272	broad.mit.edu	37	3	56667420	56667420	+	Silent	SNP	G	G	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr3:56667420G>A	ENST00000493960.2	-	18	3409	c.3399C>T	c.(3397-3399)ctC>ctT	p.L1133L	FAM208A_ENST00000355628.5_Silent_p.L1072L|FAM208A_ENST00000431842.2_Silent_p.L696L	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1133							poly(A) RNA binding (GO:0044822)	p.L696L(2)|p.L1072L(2)		NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						GTGGCTCAAGGAGATGTTTAT	0.438																																					p.L1133L												.	.	4	Substitution - coding silent(4)	large_intestine(2)|lung(2)	c.C3399T	3						.						143.0	137.0	139.0					3																	56667420		2203	4300	6503	56642460	SO:0001819	synonymous_variant	23272	exon18			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3399C>T	3.37:g.56667420G>A		Somatic		Capture	Illumina HiSeq	Phase_I	56642460	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Silent	SNP	ENST00000493960.2	37	CCDS46853.1																																																																																				0.438	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
ROBO1	6091	broad.mit.edu	37	3	78667089	78667089	+	Silent	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr3:78667089C>T	ENST00000464233.1	-	27	4091	c.3978G>A	c.(3976-3978)gcG>gcA	p.A1326A	ROBO1_ENST00000436010.2_Silent_p.A1287A|ROBO1_ENST00000467549.1_Silent_p.A1226A|ROBO1_ENST00000495273.1_Silent_p.A1281A	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1326					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.A1281A(1)|p.A1303A(1)|p.A1326A(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CCTCTTCTGGCGCATCCGTAT	0.557																																					p.A1326A												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G3978A	3						.						60.0	68.0	65.0					3																	78667089		2008	4167	6175	78749779	SO:0001819	synonymous_variant	6091	exon27			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3978G>A	3.37:g.78667089C>T		Somatic		Capture	Illumina HiSeq	Phase_I	78749779	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	37	CCDS54611.1																																																																																				0.557	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
PRR27	401137	broad.mit.edu	37	4	71024512	71024512	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr4:71024512G>T	ENST00000344526.5	+	3	732	c.543G>T	c.(541-543)gaG>gaT	p.E181D	C4orf40_ENST00000502294.1_Missense_Mutation_p.E181D	NM_214711.3	NP_999876.2	Q6MZM9	PRR27_HUMAN		181	Ala/Pro-rich.					extracellular vesicular exosome (GO:0070062)		p.E181D(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CTGCTGCAGAGGCACCTGTTG	0.632																																					p.E181D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G543T	4						.						47.0	44.0	45.0					4																	71024512		2203	4298	6501	71059101	SO:0001583	missense	401137	exon3																														ENST00000344526.5:c.543G>T	4.37:g.71024512G>T	ENSP00000343172:p.Glu181Asp	Somatic		Capture	Illumina HiSeq	Phase_I	71059101	NM_214711	A8MXP0|Q6MZR6	Missense_Mutation	SNP	ENST00000344526.5	37	CCDS3535.1	.	.	.	.	.	.	.	.	.	.	G	7.037	0.561812	0.13498	.	.	ENSG00000187533	ENST00000502294;ENST00000344526	T;T	0.31769	1.48;1.48	3.02	-4.99	0.03010	.	.	.	.	.	T	0.12646	0.0307	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.34403	-0.9830	9	0.13470	T	0.59	0.1899	1.0115	0.01498	0.149:0.2211:0.1568:0.4731	.	181	Q6MZM9	CD040_HUMAN	D	181	ENSP00000426249:E181D;ENSP00000343172:E181D	ENSP00000343172:E181D	E	+	3	2	C4orf40	71059101	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.741000	0.04855	-0.560000	0.06102	-0.723000	0.03601	GAG		0.632	C4orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251558.1		
RCHY1	25898	broad.mit.edu	37	4	76407852	76407852	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr4:76407852G>A	ENST00000324439.5	-	9	1080	c.682C>T	c.(682-684)Cga>Tga	p.R228*	RCHY1_ENST00000512706.1_Nonsense_Mutation_p.R206*|RCHY1_ENST00000380840.2_Nonsense_Mutation_p.R188*|RCHY1_ENST00000513257.1_Nonsense_Mutation_p.R219*|RCHY1_ENST00000451788.1_3'UTR	NM_001278536.1|NM_001278538.1|NM_001278539.1	NP_001265465.1|NP_001265467.1|NP_001265468.1	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase	228					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R228*(1)		large_intestine(2)|pancreas(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ACAGTGGATCGTCCATTACAG	0.338																																					p.R228X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C682T	4						.						89.0	86.0	87.0					4																	76407852		2203	4300	6503	76626876	SO:0001587	stop_gained	25898	exon9			AF255666	CCDS3567.1, CCDS34012.1, CCDS63990.1, CCDS63991.1, CCDS63992.1	4q21.1-q21.3	2014-02-17	2012-02-23	2004-03-30	ENSG00000163743	ENSG00000163743		"""RING-type (C3HC4) zinc fingers"""	17479	protein-coding gene	gene with protein product	"""androgen-receptor N-terminal-interacting protein"", ""p53-induced protein with a RING-H2 domain"", ""zinc finger, CHY-type"""	607680	"""zinc finger protein 363"", ""ring finger and CHY zinc finger domain containing 1"""	ZNF363		12654245	Standard	NM_015436		Approved	CHIMP, DKFZp586C1620, PRO1996, RNF199, ARNIP, PIRH2, ZCHY	uc003hik.3	Q96PM5	OTTHUMG00000130105	ENST00000324439.5:c.682C>T	4.37:g.76407852G>A	ENSP00000321239:p.Arg228*	Somatic		Capture	Illumina HiSeq	Phase_I	76626876	NM_015436	B3KRG3|C7E541|C7E542|C7E543|D3YRV2|E7EMC8|E7ETW5|J3KPI0|Q2KN33|Q59GN7|Q86X26|Q96PR5	Nonsense_Mutation	SNP	ENST00000324439.5	37	CCDS3567.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680204	0.88542	.	.	ENSG00000163743	ENST00000324439;ENST00000380840;ENST00000512706;ENST00000513257;ENST00000507014	.	.	.	5.87	3.04	0.35103	.	0.054275	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-19.7569	4.8148	0.13362	0.1777:0.0:0.4283:0.394	.	.	.	.	X	228;188;206;219;179	.	ENSP00000321239:R228X	R	-	1	2	RCHY1	76626876	1.000000	0.71417	0.987000	0.45799	0.988000	0.76386	3.867000	0.56047	0.300000	0.22699	0.650000	0.86243	CGA		0.338	RCHY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252411.2	NM_015436	
PCDHB12	56124	broad.mit.edu	37	5	140590168	140590168	+	Silent	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr5:140590168C>T	ENST00000239450.2	+	1	1878	c.1689C>T	c.(1687-1689)taC>taT	p.Y563Y	PCDHB12_ENST00000541609.1_Silent_p.Y226Y	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	563					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.Y563Y(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCGTGCTGTACCCGCTGCAGA	0.716																																					p.Y563Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1689T	5						.						17.0	22.0	21.0					5																	140590168		2193	4269	6462	140570352	SO:0001819	synonymous_variant	56124	exon1			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1689C>T	5.37:g.140590168C>T		Somatic		Capture	Illumina HiSeq	Phase_I	140570352	NM_018932	B4DDU1	Silent	SNP	ENST00000239450.2	37	CCDS4254.1																																																																																				0.716	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
PLEKHG4B	153478	broad.mit.edu	37	5	161984	161984	+	Silent	SNP	C	C	T	rs373547646	byFrequency	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr5:161984C>T	ENST00000283426.6	+	10	1556	c.1506C>T	c.(1504-1506)agC>agT	p.S502S		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	502							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S502S(1)		endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		GGGGCCTGAGCGCCGTGGTCA	0.612													C|||	2	0.000399361	0.0	0.0	5008	,	,		16549	0.0		0.0	False		,,,				2504	0.002				p.S502S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1506T	5						.	C		0,4406		0,0,2203	86.0	78.0	81.0		1506	-2.3	0.0	5		81	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PLEKHG4B	NM_052909.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		502/1272	161984	1,13005	2203	4300	6503	214984	SO:0001819	synonymous_variant	153478	exon10			BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.1506C>T	5.37:g.161984C>T		Somatic		Capture	Illumina HiSeq	Phase_I	214984	NM_052909		Silent	SNP	ENST00000283426.6	37	CCDS34124.1																																																																																				0.612	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909	
RXFP3	51289	broad.mit.edu	37	5	33936992	33936992	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr5:33936992G>C	ENST00000330120.3	+	1	502	c.147G>C	c.(145-147)tgG>tgC	p.W49C		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	49					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)	p.W49C(1)		endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						CGGACTTGTGGTGGGAGCTGG	0.692																																					p.W49C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G147C	5						.						63.0	77.0	72.0					5																	33936992		2203	4300	6503	33972749	SO:0001583	missense	51289	exon1			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.147G>C	5.37:g.33936992G>C	ENSP00000328708:p.Trp49Cys	Somatic		Capture	Illumina HiSeq	Phase_I	33972749	NM_016568	Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	G	9.033	0.987724	0.18966	.	.	ENSG00000182631	ENST00000330120	T	0.69561	-0.41	5.43	3.6	0.41247	.	0.814401	0.10741	N	0.639427	T	0.45955	0.1368	N	0.14661	0.345	0.42341	D	0.992333	P	0.52463	0.953	B	0.39971	0.315	T	0.33879	-0.9851	10	0.40728	T	0.16	-4.182	6.707	0.23257	0.0678:0.235:0.5764:0.1209	.	49	Q9NSD7	RL3R1_HUMAN	C	49	ENSP00000328708:W49C	ENSP00000328708:W49C	W	+	3	0	RXFP3	33972749	0.836000	0.29430	0.849000	0.33467	0.332000	0.28634	-0.229000	0.09098	1.408000	0.46895	0.655000	0.94253	TGG		0.692	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
APC	324	broad.mit.edu	37	5	112175605	112175605	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr5:112175605delA	ENST00000457016.1	+	16	4694	c.4314delA	c.(4312-4314)acafs	p.T1438fs	APC_ENST00000508376.2_Frame_Shift_Del_p.T1438fs|APC_ENST00000257430.4_Frame_Shift_Del_p.T1438fs|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1438	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.P1439fs*15(2)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.P1439fs*34(1)|p.S1436fs*33(1)|p.S1436fs*22(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAAGTAAAACACCTCCACCAC	0.473		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.T1420fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	8	Deletion - Frameshift(7)|Unknown(1)	large_intestine(5)|prostate(1)|soft_tissue(1)|skin(1)	c.4260delA	5						.						117.0	103.0	108.0					5																	112175605		2202	4300	6502	112203504	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4314delA	5.37:g.112175605delA	ENSP00000413133:p.Thr1438fs	Somatic		Capture	Illumina HiSeq	Phase_I	112203504	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.473	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
GFPT2	9945	broad.mit.edu	37	5	179729555	179729555	+	Silent	SNP	G	G	A	rs371527867		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr5:179729555G>A	ENST00000253778.8	-	18	2041	c.1872C>T	c.(1870-1872)gaC>gaT	p.D624D		NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	624	SIS 2. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)	p.D624D(1)		breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	TTTCAGTATCGTCCTTGGAGC	0.488																																					p.D624D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1872T	5						.	G		2,4136		0,2,2067	125.0	126.0	126.0		1872	-10.3	0.3	5		126	0,8426		0,0,4213	no	coding-synonymous	GFPT2	NM_005110.2		0,2,6280	AA,AG,GG		0.0,0.0483,0.0159		624/683	179729555	2,12562	2069	4213	6282	179662161	SO:0001819	synonymous_variant	9945	exon18			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.1872C>T	5.37:g.179729555G>A		Somatic		Capture	Illumina HiSeq	Phase_I	179662161	NM_005110	Q53XM2|Q9BWS4	Silent	SNP	ENST00000253778.8	37	CCDS43411.1																																																																																				0.488	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373444.4	NM_005110	
TRIM41	90933	broad.mit.edu	37	5	180659868	180659868	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr5:180659868delG	ENST00000315073.5	+	3	1829	c.1119delG	c.(1117-1119)cagfs	p.Q373fs	CTC-338M12.7_ENST00000499096.2_RNA|TRIM41_ENST00000351937.5_Frame_Shift_Del_p.Q373fs	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	373					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.G375fs*39(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGAGCCAGCAGGGGGGTCTCC	0.677																																					p.Q373fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1119delG	5						.						5.0	6.0	6.0					5																	180659868		2087	4039	6126	180592474	SO:0001589	frameshift_variant	90933	exon3			AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.1119delG	5.37:g.180659868delG	ENSP00000320869:p.Gln373fs	Somatic		Capture	Illumina HiSeq	Phase_I	180592474	NM_033549	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Frame_Shift_Del	DEL	ENST00000315073.5	37	CCDS4466.1																																																																																				0.677	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253574.3	NM_201627	
GPR126	57211	broad.mit.edu	37	6	142759476	142759476	+	Silent	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr6:142759476C>T	ENST00000230173.6	+	24	4025	c.3549C>T	c.(3547-3549)acC>acT	p.T1183T	GPR126_ENST00000367609.3_Silent_p.T1183T|GPR126_ENST00000367608.2_Silent_p.T1155T|GPR126_ENST00000296932.8_Silent_p.T1155T	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	1183	Ser-rich.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T1154T(1)|p.T1183T(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		GCTCTACCACCTATTTCAAAA	0.358																																					p.T1155T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3465T	6						.						100.0	89.0	93.0					6																	142759476		1825	4092	5917	142801169	SO:0001819	synonymous_variant	57211	exon23			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.3549C>T	6.37:g.142759476C>T		Somatic		Capture	Illumina HiSeq	Phase_I	142801169	NM_001032394	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Silent	SNP	ENST00000230173.6	37	CCDS47490.1																																																																																				0.358	GPR126-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042487.2		
CLPSL1	340204	broad.mit.edu	37	6	35754775	35754775	+	Splice_Site	SNP	G	G	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr6:35754775G>T	ENST00000373861.5	+	2	194	c.100G>T	c.(100-102)Gag>Tag	p.E34*	CLPSL1_ENST00000542261.1_Splice_Site_p.E33*			A2RUU4	COLL1_HUMAN	colipase-like 1	34					digestion (GO:0007586)|lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	enzyme activator activity (GO:0008047)										CTCCCTGCAGGAGCTCAAGGA	0.682																																					p.E34X												.	.	0			c.G100T	6						.						23.0	29.0	27.0					6																	35754775		2119	4233	6352	35862753	SO:0001630	splice_region_variant	340204	exon2				CCDS43456.1	6p21.31	2014-01-28	2012-02-06	2012-02-06	ENSG00000204140	ENSG00000204140			21251	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 127"""	C6orf127			Standard	NM_001010886		Approved	dJ510O8.6	uc003old.4	A2RUU4	OTTHUMG00000014582	ENST00000373861.5:c.100-1G>T	6.37:g.35754775G>T		None		Capture	Illumina HiSeq	Phase_I	35862753	NM_001010886	A7E2T6|B2RPE2|B5G4V2|B6ZDM9|Q5T9G1	Nonsense_Mutation	SNP	ENST00000373861.5	37	CCDS43456.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.610826	0.46527	.	.	ENSG00000204140	ENST00000373861;ENST00000373860;ENST00000542261	.	.	.	2.05	-0.819	0.10829	.	2.342790	0.04144	U	0.320084	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.9693	0.14108	0.5205:0.0:0.4795:0.0	.	.	.	.	X	34;34;33	.	.	E	+	1	0	C6orf127	35862753	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-0.132000	0.10467	-0.244000	0.09639	0.467000	0.42956	GAG		0.682	CLPSL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040317.2	NM_001010886	Nonsense_Mutation
BAI3	577	broad.mit.edu	37	6	69348827	69348827	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr6:69348827C>A	ENST00000370598.1	+	3	1081	c.260C>A	c.(259-261)gCt>gAt	p.A87D		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	87	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A87D(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TCACTCCTGGCTTATCAGTTT	0.348																																					p.A87D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C260A	6						.						59.0	65.0	63.0					6																	69348827		2202	4300	6502	69405548	SO:0001583	missense	577	exon3			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.260C>A	6.37:g.69348827C>A	ENSP00000359630:p.Ala87Asp	Somatic		Capture	Illumina HiSeq	Phase_I	69405548	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597399	0.66332	.	.	ENSG00000135298	ENST00000370598	T	0.21031	2.03	5.32	5.32	0.75619	CUB (1);	0.141721	0.46145	D	0.000303	T	0.30885	0.0779	L	0.36672	1.1	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.05370	-1.0889	10	0.66056	D	0.02	.	19.3677	0.94471	0.0:1.0:0.0:0.0	.	87	O60242	BAI3_HUMAN	D	87	ENSP00000359630:A87D	ENSP00000359630:A87D	A	+	2	0	BAI3	69405548	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.684000	0.68197	2.634000	0.89283	0.655000	0.94253	GCT		0.348	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
GRM1	2911	broad.mit.edu	37	6	146720139	146720139	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr6:146720139C>A	ENST00000282753.1	+	7	2199	c.1964C>A	c.(1963-1965)aCc>aAc	p.T655N	GRM1_ENST00000361719.2_Missense_Mutation_p.T655N|GRM1_ENST00000492807.2_Missense_Mutation_p.T655N|GRM1_ENST00000355289.4_Missense_Mutation_p.T655N|GRM1_ENST00000507907.1_Missense_Mutation_p.T655N|GRM1_ENST00000392299.2_Missense_Mutation_p.T655N			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	655					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.T655N(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CCTACTACCACCTCCTGCTAC	0.527																																					p.T655N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1964A	6						.						363.0	317.0	333.0					6																	146720139		2203	4300	6503	146761832	SO:0001583	missense	2911	exon8			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1964C>A	6.37:g.146720139C>A	ENSP00000282753:p.Thr655Asn	Somatic		Capture	Illumina HiSeq	Phase_I	146761832	NM_001114329	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880664	0.33255	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43;-2.43	5.51	4.64	0.57946	GPCR, family 3, C-terminal (2);	0.140083	0.64402	D	0.000004	D	0.83403	0.5247	L	0.52011	1.625	0.39046	D	0.960229	B;P;B	0.37122	0.244;0.583;0.244	B;P;B	0.44673	0.212;0.457;0.212	T	0.82715	-0.0320	10	0.36615	T	0.2	.	12.1478	0.54034	0.0:0.8572:0.0:0.1428	.	655;655;655	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	N	655	ENSP00000354896:T655N;ENSP00000376119:T655N;ENSP00000424095:T655N;ENSP00000282753:T655N;ENSP00000347437:T655N;ENSP00000425599:T655N	ENSP00000282753:T655N	T	+	2	0	GRM1	146761832	0.862000	0.29867	0.882000	0.34594	0.810000	0.45777	1.724000	0.38064	1.337000	0.45525	0.585000	0.79938	ACC		0.527	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
NAPEPLD	222236	broad.mit.edu	37	7	102760508	102760508	+	Missense_Mutation	SNP	G	G	A	rs201645773	byFrequency	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr7:102760508G>A	ENST00000417955.1	-	3	611	c.457C>T	c.(457-459)Cgt>Tgt	p.R153C	NAPEPLD_ENST00000427257.1_Missense_Mutation_p.R153C|NAPEPLD_ENST00000455523.2_Missense_Mutation_p.R226C|NAPEPLD_ENST00000465647.1_Missense_Mutation_p.R153C|NAPEPLD_ENST00000341533.4_Missense_Mutation_p.R153C			Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	153					phospholipid catabolic process (GO:0009395)	extracellular vesicular exosome (GO:0070062)|photoreceptor outer segment membrane (GO:0042622)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|zinc ion binding (GO:0008270)	p.R153C(1)		endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GGTGAAGCACGAGAGCTAAAG	0.498													G|||	2	0.000399361	0.0	0.0	5008	,	,		13299	0.0		0.002	False		,,,				2504	0.0				p.R153C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C457T	7						.	G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	171.0	134.0	146.0		457,457	5.1	0.1	7		146	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	NAPEPLD	NM_001122838.1,NM_198990.4	180,180	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	153/394,153/394	102760508	2,13004	2203	4300	6503	102547744	SO:0001583	missense	222236	exon3			BC037350, AY357337	CCDS5729.1	7q22.1	2014-03-14			ENSG00000161048	ENSG00000161048	3.1.4.54		21683	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 18, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D"""	612334				14634025, 15820312, 18067139	Standard	NM_198990		Approved	FMP30, C7orf18, NAPE-PLD	uc003vbd.2	Q6IQ20	OTTHUMG00000157204	ENST00000417955.1:c.457C>T	7.37:g.102760508G>A	ENSP00000407112:p.Arg153Cys	Somatic		Capture	Illumina HiSeq	Phase_I	102547744	NM_198990	Q5CZ87|Q769K1	Missense_Mutation	SNP	ENST00000417955.1	37	CCDS5729.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	23.3	4.393740	0.83011	0.0	2.33E-4	ENSG00000161048	ENST00000341533;ENST00000417955;ENST00000465647;ENST00000427257;ENST00000455523	D;D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.38;-3.38	5.93	5.05	0.67936	.	0.046170	0.85682	D	0.000000	D	0.97250	0.9101	M	0.93283	3.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.97598	1.0121	10	0.66056	D	0.02	-15.5455	11.5171	0.50529	0.0657:0.0:0.8093:0.125	.	226;153	B4E3B0;Q6IQ20	.;NAPEP_HUMAN	C	153;153;153;153;226	ENSP00000340093:R153C;ENSP00000407112:R153C;ENSP00000419188:R153C;ENSP00000392775:R153C;ENSP00000414364:R226C	ENSP00000340093:R153C	R	-	1	0	NAPEPLD	102547744	1.000000	0.71417	0.064000	0.19789	0.996000	0.88848	3.317000	0.51968	1.521000	0.48983	0.591000	0.81541	CGT		0.498	NAPEPLD-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347904.1	NM_198990	
THSD7A	221981	broad.mit.edu	37	7	11676273	11676273	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr7:11676273G>T	ENST00000423059.4	-	2	757	c.506C>A	c.(505-507)gCg>gAg	p.A169E	THSD7A_ENST00000480061.1_5'UTR	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	169					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A169E(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GATATCCTCCGCAGGAATGTC	0.478										HNSCC(18;0.044)																											p.A169E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C506A	7						.						97.0	95.0	95.0					7																	11676273		2011	4203	6214	11642798	SO:0001583	missense	221981	exon2				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.506C>A	7.37:g.11676273G>T	ENSP00000406482:p.Ala169Glu	Somatic		Capture	Illumina HiSeq	Phase_I	11642798	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618096	0.66787	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.59772	0.24	5.57	5.57	0.84162	.	0.044879	0.85682	D	0.000000	T	0.57961	0.2089	N	0.10707	0.03	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	T	0.57165	-0.7858	10	0.18710	T	0.47	.	19.9278	0.97110	0.0:0.0:1.0:0.0	.	169	Q9UPZ6	THS7A_HUMAN	E	169	ENSP00000406482:A169E	ENSP00000262042:A169E	A	-	2	0	THSD7A	11642798	1.000000	0.71417	0.179000	0.23059	0.634000	0.38068	8.009000	0.88606	2.770000	0.95276	0.650000	0.86243	GCG		0.478	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
LRRN3	54674	broad.mit.edu	37	7	110764548	110764548	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr7:110764548G>C	ENST00000422987.3	+	2	2551	c.1720G>C	c.(1720-1722)Gat>Cat	p.D574H	IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.D574H|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000405709.2_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.D574H|IMMP2L_ENST00000450877.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	574	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D574H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		AATACCATCTGATGTCAAGGT	0.343																																					p.D574H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1720C	7						.						57.0	53.0	54.0					7																	110764548		2203	4300	6503	110551784	SO:0001583	missense	54674	exon2			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1720G>C	7.37:g.110764548G>C	ENSP00000412417:p.Asp574His	Somatic		Capture	Illumina HiSeq	Phase_I	110551784	NM_018334	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	G	9.912	1.209923	0.22289	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	T;T;T	0.57907	0.37;0.37;0.37	6.13	4.34	0.51931	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.182425	0.38272	N	0.001752	T	0.49133	0.1539	L	0.61218	1.895	0.48901	D	0.999721	B	0.16396	0.017	B	0.21917	0.037	T	0.45614	-0.9249	10	0.49607	T	0.09	.	9.4874	0.38937	0.1284:0.1184:0.7532:0.0	.	574	Q9H3W5	LRRN3_HUMAN	H	574	ENSP00000312001:D574H;ENSP00000397312:D574H;ENSP00000412417:D574H	ENSP00000312001:D574H	D	+	1	0	LRRN3	110551784	1.000000	0.71417	0.982000	0.44146	0.994000	0.84299	5.338000	0.65947	0.940000	0.37473	0.650000	0.86243	GAT		0.343	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
WIPF3	644150	broad.mit.edu	37	7	29928929	29928929	+	Silent	SNP	C	C	T	rs367957588		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr7:29928929C>T	ENST00000409290.1	+	6	1257	c.1257C>T	c.(1255-1257)ttC>ttT	p.F419F	WIPF3_ENST00000409123.1_Silent_p.F419F|WIPF3_ENST00000242140.5_Silent_p.F419F	NM_001080529.2	NP_001073998.2	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3	419					cell differentiation (GO:0030154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)		p.F419F(1)		breast(2)|large_intestine(3)|lung(6)|ovary(1)	12						CAGATGACTTCGAGTCTAAAT	0.438																																					p.F419F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1257T	7						.	T		0,3866		0,0,1933	133.0	123.0	126.0		1257	0.7	1.0	7		126	2,8284		0,2,4141	no	coding-synonymous	WIPF3	NM_001080529.2		0,2,6074	TT,TC,CC		0.0241,0.0,0.0165		419/484	29928929	2,12150	1933	4143	6076	29895454	SO:0001819	synonymous_variant	644150	exon6			AK094250	CCDS56472.1	7p15.1	2006-10-12			ENSG00000122574	ENSG00000122574			22004	protein-coding gene	gene with protein product		612432					Standard	NM_001080529		Approved	CR16, FLJ36931	uc022aaz.1	A6NGB9	OTTHUMG00000152761	ENST00000409290.1:c.1257C>T	7.37:g.29928929C>T		Somatic		Capture	Illumina HiSeq	Phase_I	29895454	NM_001080529	B8ZZV2	Silent	SNP	ENST00000409290.1	37	CCDS56472.1																																																																																				0.438	WIPF3-002	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327705.1		
HECW1	23072	broad.mit.edu	37	7	43485075	43485075	+	Silent	SNP	G	G	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr7:43485075G>A	ENST00000395891.2	+	11	2909	c.2304G>A	c.(2302-2304)ccG>ccA	p.P768P	HECW1_ENST00000453890.1_Silent_p.P768P	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	768					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.P747P(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GCGCTGGGCCGTGGCAAGACG	0.647																																					p.P768P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2304A	7						.						20.0	24.0	22.0					7																	43485075		1967	4133	6100	43451600	SO:0001819	synonymous_variant	23072	exon11			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.2304G>A	7.37:g.43485075G>A		Somatic		Capture	Illumina HiSeq	Phase_I	43451600	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	37	CCDS5469.2																																																																																				0.647	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
IKZF1	10320	broad.mit.edu	37	7	50467818	50467818	+	Missense_Mutation	SNP	C	C	A	rs200107829		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr7:50467818C>A	ENST00000331340.3	+	8	1208	c.1053C>A	c.(1051-1053)caC>caA	p.H351Q	IKZF1_ENST00000346667.4_Missense_Mutation_p.H121Q|IKZF1_ENST00000343574.5_Missense_Mutation_p.H264Q|IKZF1_ENST00000359197.5_Missense_Mutation_p.H309Q|IKZF1_ENST00000357364.4_Missense_Mutation_p.H264Q|IKZF1_ENST00000440768.2_3'UTR|IKZF1_ENST00000439701.1_Missense_Mutation_p.H309Q|IKZF1_ENST00000438033.1_Missense_Mutation_p.H264Q|IKZF1_ENST00000349824.4_Missense_Mutation_p.H208Q	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	351					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(28)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				ACCAGCTGCACAAGCCGCTCG	0.701			"""D,T"""	BCL6	"""ALL, DLBCL"""																																p.H351Q			"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	.	.	28	Unknown(28)	haematopoietic_and_lymphoid_tissue(28)	c.C1053A	7						.						7.0	11.0	10.0					7																	50467818		1943	4078	6021	50435312	SO:0001583	missense	10320	exon8			U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.1053C>A	7.37:g.50467818C>A	ENSP00000331614:p.His351Gln	None		Capture	Illumina HiSeq	Phase_I	50435312	NM_006060	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	ENST00000331340.3	37		.	.	.	.	.	.	.	.	.	.	C	12.44	1.939520	0.34189	.	.	ENSG00000185811	ENST00000346667;ENST00000343574;ENST00000359197;ENST00000349824;ENST00000357364;ENST00000331340;ENST00000438033;ENST00000439701	T;T;T;T;T;T;T;T	0.06528	4.72;3.29;3.36;4.44;3.45;3.37;3.29;3.36	5.41	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.19927	0.0479	.	.	.	0.80722	D	1	B;D;B;B;B	0.76494	0.015;0.999;0.036;0.016;0.011	B;D;B;B;B	0.66351	0.044;0.943;0.031;0.02;0.019	T	0.00369	-1.1784	9	0.51188	T	0.08	-16.9673	10.3363	0.43852	0.0:0.8496:0.0:0.1504	.	264;121;264;309;351	Q13422-2;Q13422-6;Q13422-3;Q13422-7;Q13422	.;.;.;.;IKZF1_HUMAN	Q	121;264;309;208;264;351;264;309	ENSP00000340080:H121Q;ENSP00000342750:H264Q;ENSP00000352123:H309Q;ENSP00000342485:H208Q;ENSP00000349928:H264Q;ENSP00000331614:H351Q;ENSP00000396554:H264Q;ENSP00000413025:H309Q	ENSP00000331614:H351Q	H	+	3	2	IKZF1	50435312	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	3.993000	0.56987	1.288000	0.44600	0.585000	0.79938	CAC		0.701	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060	
ANKIB1	54467	broad.mit.edu	37	7	92019302	92019302	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr7:92019302G>T	ENST00000265742.3	+	15	2300	c.1924G>T	c.(1924-1926)Gat>Tat	p.D642Y		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	642							zinc ion binding (GO:0008270)	p.D642Y(1)		cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGGCTGTCCAGATACCACTTT	0.338																																					p.D642Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1924T	7						.						136.0	132.0	133.0					7																	92019302		1849	4097	5946	91857238	SO:0001583	missense	54467	exon15			AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.1924G>T	7.37:g.92019302G>T	ENSP00000265742:p.Asp642Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	91857238	NM_019004	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	ENST00000265742.3	37	CCDS47639.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602624	0.87157	.	.	ENSG00000001629	ENST00000265742	T	0.12672	2.66	5.48	5.48	0.80851	Zinc finger, RING-type (1);	0.000000	0.85682	D	0.000000	T	0.37019	0.0988	M	0.73962	2.25	0.80722	D	1	D	0.69078	0.997	P	0.59703	0.862	T	0.09509	-1.0671	10	0.87932	D	0	.	19.7981	0.96494	0.0:0.0:1.0:0.0	.	642	Q9P2G1	AKIB1_HUMAN	Y	642	ENSP00000265742:D642Y	ENSP00000265742:D642Y	D	+	1	0	ANKIB1	91857238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.416000	0.97383	2.761000	0.94854	0.644000	0.83932	GAT		0.338	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
MBLAC1	255374	broad.mit.edu	37	7	99725332	99725332	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr7:99725332G>C	ENST00000398075.2	+	2	713	c.314G>C	c.(313-315)gGa>gCa	p.G105A	RP11-506M12.1_ENST00000494221.1_RNA	NM_203397.1	NP_981942.1	A4D2B0	MBLC1_HUMAN	metallo-beta-lactamase domain containing 1	105							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.G105A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	7						GTGGCCCCGGGAGACGTGACG	0.736																																					p.G105A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G314C	7						.						5.0	7.0	6.0					7																	99725332		1837	3998	5835	99563268	SO:0001583	missense	255374	exon2			BC031288	CCDS43620.1	7q22	2014-02-12	2009-04-08		ENSG00000214309	ENSG00000214309			22180	protein-coding gene	gene with protein product							Standard	XM_005250250		Approved	MGC49416	uc003utp.3	A4D2B0	OTTHUMG00000154846	ENST00000398075.2:c.314G>C	7.37:g.99725332G>C	ENSP00000381150:p.Gly105Ala	Somatic		Capture	Illumina HiSeq	Phase_I	99563268	NM_203397	Q8N5X8	Missense_Mutation	SNP	ENST00000398075.2	37	CCDS43620.1	.	.	.	.	.	.	.	.	.	.	G	0.450	-0.894399	0.02491	.	.	ENSG00000214309	ENST00000398075;ENST00000421390	T;T	0.43294	1.61;0.95	4.66	0.52	0.17040	Beta-lactamase-like (2);	0.753644	0.10852	U	0.627074	T	0.14313	0.0346	N	0.02011	-0.69	0.09310	N	1	B	0.10296	0.003	B	0.12156	0.007	T	0.32025	-0.9922	10	0.12766	T	0.61	.	5.5227	0.16941	0.2601:0.2974:0.4424:0.0	.	105	A4D2B0	MBLC1_HUMAN	A	105	ENSP00000381150:G105A;ENSP00000406055:G105A	ENSP00000381150:G105A	G	+	2	0	MBLAC1	99563268	0.000000	0.05858	0.457000	0.27056	0.146000	0.21551	-0.413000	0.07123	0.117000	0.18138	-0.291000	0.09656	GGA		0.736	MBLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337353.1	NM_203397	
DGKI	9162	broad.mit.edu	37	7	137154346	137154346	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr7:137154346G>A	ENST00000288490.5	-	25	2447	c.2447C>T	c.(2446-2448)cCc>cTc	p.P816L	DGKI_ENST00000453654.2_Missense_Mutation_p.P516L|DGKI_ENST00000446122.1_Missense_Mutation_p.P798L|DGKI_ENST00000424189.2_Missense_Mutation_p.P819L	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	816					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.P816L(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GAGAGCCCTGGGGAAGGAGGT	0.527																																					p.P816L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2447T	7						.						130.0	116.0	121.0					7																	137154346		2203	4300	6503	136804886	SO:0001583	missense	9162	exon25			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2447C>T	7.37:g.137154346G>A	ENSP00000288490:p.Pro816Leu	Somatic		Capture	Illumina HiSeq	Phase_I	136804886	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.443454	0.63067	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.31769	1.98;1.48;1.74	5.65	5.65	0.86999	.	0.105627	0.64402	D	0.000003	T	0.30572	0.0769	L	0.56769	1.78	0.80722	D	1	P;P	0.46859	0.655;0.885	B;B	0.40901	0.101;0.343	T	0.21484	-1.0244	10	0.02654	T	1	.	19.7329	0.96190	0.0:0.0:1.0:0.0	.	516;816	E9PFX6;O75912	.;DGKI_HUMAN	L	516;764;819;816;798	ENSP00000392161:P516L;ENSP00000288490:P816L;ENSP00000399131:P798L	ENSP00000288490:P816L	P	-	2	0	DGKI	136804886	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.934000	0.75880	2.663000	0.90544	0.655000	0.94253	CCC		0.527	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
TNFRSF10C	8794	broad.mit.edu	37	8	22974360	22974360	+	Missense_Mutation	SNP	C	C	A	rs12550828		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr8:22974360C>A	ENST00000356864.3	+	5	1128	c.596C>A	c.(595-597)aCc>aAc	p.T199N	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.T97N	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	199			T -> N (in dbSNP:rs12550828).		apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.T199N(3)		endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGACCACCAGCCCG	0.627																																					p.T199N												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C596A	8						.						63.0	81.0	75.0					8																	22974360		2203	4298	6501	23030305	SO:0001583	missense	8794	exon5			AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.596C>A	8.37:g.22974360C>A	ENSP00000349324:p.Thr199Asn	Somatic		Capture	Illumina HiSeq	Phase_I	23030305	NM_003841	O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.942372	0.00479	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.61510	0.1;0.69	.	.	.	.	60.732300	0.00622	N	0.000444	T	0.35364	0.0929	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.42959	0.403	T	0.37842	-0.9688	9	0.13470	T	0.59	.	4.6548	0.12611	0.3618:0.6381:0.0:1.0E-4	rs12550828	199	O14798	TR10C_HUMAN	N	199;97;199	ENSP00000349324:T199N;ENSP00000437612:T97N	ENSP00000349324:T199N	T	+	2	0	TNFRSF10C	23030305	0.000000	0.05858	0.011000	0.14972	0.077000	0.17291	-1.773000	0.01786	-1.934000	0.01051	-1.966000	0.00469	ACC		0.627	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
EYA1	2138	broad.mit.edu	37	8	72184042	72184042	+	Missense_Mutation	SNP	C	C	T	rs373250373		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr8:72184042C>T	ENST00000340726.3	-	10	1556	c.917G>A	c.(916-918)cGg>cAg	p.R306Q	EYA1_ENST00000388740.3_Missense_Mutation_p.R273Q|EYA1_ENST00000388743.2_Missense_Mutation_p.R305Q|EYA1_ENST00000388742.4_Missense_Mutation_p.R306Q|EYA1_ENST00000388741.2_Missense_Mutation_p.R272Q|EYA1_ENST00000303824.7_Missense_Mutation_p.R300Q|EYA1_ENST00000419131.1_Missense_Mutation_p.R301Q	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	306					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)	p.R306Q(1)|p.R306L(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			TCTTCGGCCCCGTCCACGTGA	0.463																																					p.R273Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G818A	8						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	229.0	210.0	216.0		917,917,902,818	5.7	1.0	8		216	0,8600		0,0,4300	no	missense,missense,missense,missense	EYA1	NM_000503.4,NM_172058.2,NM_172059.2,NM_172060.2	43,43,43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	306/593,306/593,301/558,273/560	72184042	1,13005	2203	4300	6503	72346596	SO:0001583	missense	2138	exon8			AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.917G>A	8.37:g.72184042C>T	ENSP00000342626:p.Arg306Gln	Somatic		Capture	Illumina HiSeq	Phase_I	72346596	NM_172060	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	37	CCDS34906.1	.	.	.	.	.	.	.	.	.	.	C	36	5.894357	0.97074	2.27E-4	0.0	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.7	5.7	0.88788	.	0.114015	0.64402	D	0.000009	D	0.87928	0.6301	M	0.76838	2.35	0.80722	D	1	D;D;D;D;D	0.64830	0.993;0.967;0.967;0.993;0.994	P;P;P;P;P	0.50109	0.592;0.631;0.631;0.615;0.631	D	0.87768	0.2603	10	0.45353	T	0.12	-15.6706	19.8344	0.96650	0.0:1.0:0.0:0.0	.	300;233;273;306;301	A6NCB9;Q0P517;Q99502-2;Q99502;G5E9R4	.;.;.;EYA1_HUMAN;.	Q	306;306;274;273;300;272;305;301	ENSP00000373394:R306Q;ENSP00000342626:R306Q;ENSP00000373392:R273Q;ENSP00000303221:R300Q;ENSP00000373393:R272Q;ENSP00000373395:R305Q;ENSP00000410176:R301Q	ENSP00000303221:R300Q	R	-	2	0	EYA1	72346596	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.440000	0.80464	2.696000	0.92011	0.561000	0.74099	CGG		0.463	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060	
FAM189A2	9413	broad.mit.edu	37	9	72003251	72003251	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr9:72003251C>T	ENST00000257515.8	+	10	1454	c.1034C>T	c.(1033-1035)tCc>tTc	p.S345F	FAM189A2_ENST00000455972.1_Missense_Mutation_p.S345F|FAM189A2_ENST00000469179.1_3'UTR|FAM189A2_ENST00000303068.7_Missense_Mutation_p.S180F|FAM189A2_ENST00000377216.3_Missense_Mutation_p.S132F	NM_004816.3	NP_004807.3	Q15884	F1892_HUMAN	family with sequence similarity 189, member A2	345						integral component of membrane (GO:0016021)		p.S345F(1)|p.S132F(1)		endometrium(3)|large_intestine(5)|liver(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12						CTGGAGCAGTCCTCTTGTACC	0.483																																					p.S345F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1034T	9						.						76.0	71.0	73.0					9																	72003251		2203	4300	6503	71193071	SO:0001583	missense	9413	exon10			L27479	CCDS6629.1	9q21.11	2009-07-09	2009-07-09	2009-07-09	ENSG00000135063	ENSG00000135063			24820	protein-coding gene	gene with protein product		607710	"""chromosome 9 open reading frame 61"""	C9orf61		7951235	Standard	NM_004816		Approved	X123	uc010mon.1	Q15884	OTTHUMG00000019979	ENST00000257515.8:c.1034C>T	9.37:g.72003251C>T	ENSP00000257515:p.Ser345Phe	Somatic		Capture	Illumina HiSeq	Phase_I	71193071	NM_004816	Q14CN5|Q5T6C8|Q5T6C9|Q6ZTX4|Q96N10	Missense_Mutation	SNP	ENST00000257515.8	37	CCDS6629.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617392	0.87359	.	.	ENSG00000135063	ENST00000455972;ENST00000257515;ENST00000303068;ENST00000377225;ENST00000377216	T;T;T	0.39787	2.18;2.18;1.06	5.54	5.54	0.83059	.	0.125544	0.56097	D	0.000031	T	0.58750	0.2144	M	0.72118	2.19	0.54753	D	0.999985	D	0.61080	0.989	P	0.53450	0.726	T	0.63296	-0.6669	10	0.87932	D	0	-23.546	19.0802	0.93178	0.0:1.0:0.0:0.0	.	345	Q15884	F1892_HUMAN	F	345;345;180;344;132	ENSP00000395675:S345F;ENSP00000257515:S345F;ENSP00000304435:S180F	ENSP00000257515:S345F	S	+	2	0	FAM189A2	71193071	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	5.842000	0.69417	2.603000	0.88011	0.655000	0.94253	TCC		0.483	FAM189A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052576.2	NM_004816	
PRUNE2	158471	broad.mit.edu	37	9	79322234	79322234	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr9:79322234A>C	ENST00000376718.3	-	8	5079	c.4956T>G	c.(4954-4956)caT>caG	p.H1652Q	PRUNE2_ENST00000428286.1_Missense_Mutation_p.H1293Q	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1652					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.H1652Q(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TGCTTTCCTGATGTGTCCCTG	0.418																																					p.H1652Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4956G	9						.						62.0	52.0	55.0					9																	79322234		1568	3582	5150	78512054	SO:0001583	missense	158471	exon8			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.4956T>G	9.37:g.79322234A>C	ENSP00000365908:p.His1652Gln	Somatic		Capture	Illumina HiSeq	Phase_I	78512054	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.609|0.609	-0.825890|-0.825890	0.02734|0.02734	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.41065|.	1.01;1.02|.	5.83|5.83	-0.527|-0.527	0.11909|0.11909	.|.	1.000500|.	0.08067|.	N|.	0.999246|.	T|T	0.34337|0.34337	0.0894|0.0894	N|N	0.14661|0.14661	0.345|0.345	0.34886|0.34886	D|D	0.745064|0.745064	B|.	0.10296|.	0.003|.	B|.	0.11329|.	0.006|.	T|T	0.34825|0.34825	-0.9813|-0.9813	10|5	0.15066|.	T|.	0.55|.	-0.0349|-0.0349	9.6532|9.6532	0.39910|0.39910	0.6801:0.0:0.3199:0.0|0.6801:0.0:0.3199:0.0	.|.	1652|.	Q8WUY3|.	PRUN2_HUMAN|.	Q|A	1652;1293;1651|974	ENSP00000365908:H1652Q;ENSP00000397425:H1293Q|.	ENSP00000365908:H1652Q|.	H|S	-|-	3|1	2|0	PRUNE2|PRUNE2	78512054|78512054	0.618000|0.618000	0.27051|0.27051	0.015000|0.015000	0.15790|0.15790	0.007000|0.007000	0.05969|0.05969	1.166000|1.166000	0.31834|0.31834	-0.328000|-0.328000	0.08539|0.08539	-1.151000|-1.151000	0.01829|0.01829	CAT|TCA		0.418	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
NUTM2F	54754	broad.mit.edu	37	9	97082793	97082793	+	Missense_Mutation	SNP	C	C	G	rs577940402		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr9:97082793C>G	ENST00000253262.4	-	5	1085	c.1065G>C	c.(1063-1065)aaG>aaC	p.K355N	NUTM2F_ENST00000335456.7_Missense_Mutation_p.K355N|NUTM2F_ENST00000341207.4_Missense_Mutation_p.K355N	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	355	Pro-rich.							p.K236N(5)									GCAGGTGGGCCTTGGTCTCCG	0.706													.|||	1	0.000199681	0.0	0.0	5008	,	,		14002	0.0		0.0	False		,,,				2504	0.001				p.K355N												.	.	5	Substitution - Missense(5)	large_intestine(5)	c.G1065C	9						.						17.0	24.0	21.0					9																	97082793		1985	4123	6108	96122614	SO:0001583	missense	54754	exon5				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1065G>C	9.37:g.97082793C>G	ENSP00000253262:p.Lys355Asn	Somatic		Capture	Illumina HiSeq	Phase_I	96122614	NM_017561	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	ENST00000253262.4	37	CCDS47994.1	.	.	.	.	.	.	.	.	.	.	.	10.88	1.475748	0.26511	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207	T;T;T	0.24151	1.87;2.67;2.67	0.1	0.1	0.14510	.	.	.	.	.	T	0.30070	0.0753	N	0.24115	0.695	0.09310	N	1	D	0.57899	0.981	D	0.69824	0.966	T	0.14062	-1.0486	9	0.62326	D	0.03	.	5.97	0.19346	0.0:0.9994:0.0:6.0E-4	.	355	A1L443	FA22F_HUMAN	N	355	ENSP00000335067:K355N;ENSP00000253262:K355N;ENSP00000343865:K355N	ENSP00000253262:K355N	K	-	3	2	FAM22F	96122614	0.001000	0.12720	0.113000	0.21522	0.093000	0.18481	0.349000	0.20055	0.170000	0.19704	0.173000	0.16961	AAG		0.706	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053173.2	NM_017561	
NTNG2	84628	broad.mit.edu	37	9	135073568	135073568	+	Silent	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chr9:135073568C>T	ENST00000393229.3	+	3	1205	c.429C>T	c.(427-429)taC>taT	p.Y143Y	NTNG2_ENST00000372179.3_Silent_p.Y143Y|NTNG2_ENST00000393228.4_Silent_p.Y143Y|NTNG2_ENST00000360670.3_Silent_p.Y143Y	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	143	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)		p.Y143Y(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		CCTTCGAGTACGGCCGGCCCA	0.632																																					p.Y143Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C429T	9						.						81.0	60.0	67.0					9																	135073568		2203	4300	6503	134063389	SO:0001819	synonymous_variant	84628	exon3			AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.429C>T	9.37:g.135073568C>T		Somatic		Capture	Illumina HiSeq	Phase_I	134063389	NM_032536	Q5JUJ2|Q6UXY0|Q96JH0	Silent	SNP	ENST00000393229.3	37	CCDS6946.1																																																																																				0.632	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	NM_032536	
ARMCX1	51309	broad.mit.edu	37	X	100808175	100808175	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chrX:100808175C>T	ENST00000372829.3	+	4	633	c.262C>T	c.(262-264)Ccg>Tcg	p.P88S		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	88						integral component of membrane (GO:0016021)		p.P88S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						CGAGGATTGTCCGGGTGTAAA	0.557																																					p.P88S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C262T	X						.						65.0	59.0	61.0					X																	100808175		2203	4300	6503	100694831	SO:0001583	missense	51309	exon4			AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.262C>T	X.37:g.100808175C>T	ENSP00000361917:p.Pro88Ser	Somatic		Capture	Illumina HiSeq	Phase_I	100694831	NM_016608	Q53HK2|Q9H2Q0	Missense_Mutation	SNP	ENST00000372829.3	37	CCDS14487.1	.	.	.	.	.	.	.	.	.	.	c	7.549	0.662228	0.14645	.	.	ENSG00000126947	ENST00000372829	T	0.25250	1.81	3.4	-3.13	0.05266	.	.	.	.	.	T	0.09113	0.0225	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36163	-0.9759	9	0.05721	T	0.95	0.248	4.3433	0.11120	0.0:0.2971:0.3131:0.3897	.	88	Q9P291	ARMX1_HUMAN	S	88	ENSP00000361917:P88S	ENSP00000361917:P88S	P	+	1	0	ARMCX1	100694831	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.829000	0.04415	-0.967000	0.03582	-0.440000	0.05779	CCG		0.557	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608	
SPANXC	64663	broad.mit.edu	37	X	140335818	140335818	+	Missense_Mutation	SNP	C	C	T	rs59800971	byFrequency	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chrX:140335818C>T	ENST00000358993.2	-	2	164	c.126G>A	c.(124-126)atG>atA	p.M42I		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	42						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.M42I(1)		large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					CAGATGTTTTCATTTTTTTAG	0.498																																					p.M42I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G126A	X						.						12.0	11.0	11.0					X																	140335818		1247	2748	3995	140163484	SO:0001583	missense	64663	exon2			AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.126G>A	X.37:g.140335818C>T	ENSP00000351884:p.Met42Ile	Somatic		Capture	Illumina HiSeq	Phase_I	140163484	NM_022661	Q32WL9|Q5JX88	Missense_Mutation	SNP	ENST00000358993.2	37	CCDS14673.1	.	.	.	.	.	.	.	.	.	.	c	0.353	-0.943983	0.02322	.	.	ENSG00000198573	ENST00000358993	T	0.06449	3.3	.	.	.	.	.	.	.	.	T	0.04318	0.0119	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.41161	-0.9524	7	0.39692	T	0.17	.	.	.	.	rs59800971	42	Q9NY87	SPNXC_HUMAN	I	42	ENSP00000351884:M42I	ENSP00000351884:M42I	M	-	3	0	SPANXC	140163484	0.014000	0.17966	0.002000	0.10522	0.003000	0.03518	0.064000	0.14437	-0.548000	0.06199	0.330000	0.21533	ATG		0.498	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058590.1	NM_022661	
FAM155B	27112	broad.mit.edu	37	X	68749416	68749416	+	Missense_Mutation	SNP	T	T	G	rs199520828		TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chrX:68749416T>G	ENST00000252338.4	+	3	1078	c.1036T>G	c.(1036-1038)Ttg>Gtg	p.L346V		NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	346						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						ATTGGCAGGGTTGCTGGATAC	0.552																																					p.L346V												.	.	0			c.T1036G	X						.						51.0	43.0	45.0					X																	68749416		2203	4300	6503	68666141	SO:0001583	missense	27112	exon3			AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.1036T>G	X.37:g.68749416T>G	ENSP00000252338:p.Leu346Val	None		Capture	Illumina HiSeq	Phase_I	68666141	NM_015686	B1ALV6|B9EGK1|D3DVU1	Missense_Mutation	SNP	ENST00000252338.4	37	CCDS35317.1	.	.	.	.	.	.	.	.	.	.	T	8.860	0.946744	0.18356	.	.	ENSG00000130054	ENST00000252338	T	0.13089	2.62	3.66	2.47	0.30058	.	0.233665	0.29159	N	0.012971	T	0.08358	0.0208	L	0.29908	0.895	0.33551	D	0.596077	B	0.17038	0.02	B	0.15484	0.013	T	0.07520	-1.0768	10	0.51188	T	0.08	-3.4314	3.3268	0.07070	0.2142:0.0:0.2588:0.527	.	346	O75949-2	.	V	346	ENSP00000252338:L346V	ENSP00000252338:L346V	L	+	1	2	FAM155B	68666141	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.329000	0.33770	1.360000	0.45960	0.425000	0.28330	TTG		0.552	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057037.1	NM_015686	
ZNF711	7552	broad.mit.edu	37	X	84510342	84510342	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chrX:84510342G>A	ENST00000373165.3	+	4	463	c.157G>A	c.(157-159)Gat>Aat	p.D53N	ZNF711_ENST00000276123.3_Missense_Mutation_p.D53N|ZNF711_ENST00000360700.4_Missense_Mutation_p.D53N|ZNF711_ENST00000395402.1_Missense_Mutation_p.D31N|ZNF711_ENST00000542798.1_5'Flank	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	53					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.D33N(2)|p.D53N(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						TTTAGTTTCTGATGTTGTCAC	0.413																																					p.D53N												.	.	3	Substitution - Missense(3)	kidney(2)|large_intestine(1)	c.G157A	X						.						232.0	179.0	197.0					X																	84510342		2203	4300	6503	84396998	SO:0001583	missense	7552	exon4			BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.157G>A	X.37:g.84510342G>A	ENSP00000362260:p.Asp53Asn	Somatic		Capture	Illumina HiSeq	Phase_I	84396998	NM_021998	B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.565369	0.86439	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700	T;T;T;T	0.15017	2.73;2.46;2.46;2.7	4.94	4.94	0.65067	.	0.000000	0.45126	D	0.000394	T	0.34048	0.0884	L	0.44542	1.39	0.80722	D	1	D;P	0.67145	0.996;0.941	D;P	0.68039	0.955;0.515	T	0.04678	-1.0934	10	0.51188	T	0.08	-10.665	17.3849	0.87413	0.0:0.0:1.0:0.0	.	53;53	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	N	31;53;53;53	ENSP00000378798:D31N;ENSP00000362260:D53N;ENSP00000276123:D53N;ENSP00000353922:D53N	ENSP00000276123:D53N	D	+	1	0	ZNF711	84396998	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.230000	0.95299	2.029000	0.59856	0.550000	0.68814	GAT		0.413	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998	
SPANXC	64663	broad.mit.edu	37	X	140335820	140335820	+	Missense_Mutation	SNP	T	T	G	rs57835830	byFrequency	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3872-01A-01W-0995-10	TCGA-AA-3872-10A-01W-0995-10	g.chrX:140335820T>G	ENST00000358993.2	-	2	162	c.124A>C	c.(124-126)Atg>Ctg	p.M42L		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	42						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.M42L(1)		large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					GATGTTTTCATTTTTTTAGGA	0.498																																					p.M42L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A124C	X						.																																			140163486	SO:0001583	missense	64663	exon2			AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.124A>C	X.37:g.140335820T>G	ENSP00000351884:p.Met42Leu	Somatic		Capture	Illumina HiSeq	Phase_I	140163486	NM_022661	Q32WL9|Q5JX88	Missense_Mutation	SNP	ENST00000358993.2	37	CCDS14673.1	.	.	.	.	.	.	.	.	.	.	t	0.003	-2.562291	0.00136	.	.	ENSG00000198573	ENST00000358993	T	0.05717	3.4	.	.	.	.	.	.	.	.	T	0.02418	0.0074	N	0.02802	-0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48468	-0.9033	7	0.19147	T	0.46	.	.	.	.	rs57835830	42	Q9NY87	SPNXC_HUMAN	L	42	ENSP00000351884:M42L	ENSP00000351884:M42L	M	-	1	0	SPANXC	140163486	0.012000	0.17670	0.003000	0.11579	0.004000	0.04260	0.065000	0.14466	0.424000	0.26061	0.270000	0.19313	ATG		0.498	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058590.1	NM_022661	
