#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCC2	1244	broad.mit.edu	37	10	101595881	101595881	+	Missense_Mutation	SNP	C	C	T	rs200009488		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr10:101595881C>T	ENST00000370449.4	+	25	3561	c.3448C>T	c.(3448-3450)Cgt>Tgt	p.R1150C		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1150	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.		R -> H (in DJS; protein is properly localized at the plasma membrane, but transporter activity is impaired). {ECO:0000269|PubMed:11477083}.		cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.R1150C(1)		NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CCAGCTGAGGCGTCTGGACTC	0.517																																					p.R1150C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3448T	10						.						130.0	118.0	122.0					10																	101595881		2203	4300	6503	101585871	SO:0001583	missense	1244	exon25			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3448C>T	10.37:g.101595881C>T	ENSP00000359478:p.Arg1150Cys	Somatic		Capture	Illumina HiSeq	Phase_I	101585871	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817023	0.90790	.	.	ENSG00000023839	ENST00000370449	D	0.90563	-2.69	5.91	5.01	0.66863	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97604	0.9215	H	0.99573	4.635	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99139	1.0855	10	0.87932	D	0	-4.6762	15.2758	0.73739	0.0:0.9327:0.0:0.0673	.	1150	Q92887	MRP2_HUMAN	C	1150	ENSP00000359478:R1150C	ENSP00000359478:R1150C	R	+	1	0	ABCC2	101585871	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.068000	0.71201	1.509000	0.48786	0.462000	0.41574	CGT		0.517	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
ARMC3	219681	broad.mit.edu	37	10	23326254	23326254	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr10:23326254G>C	ENST00000298032.5	+	19	2549	c.2465G>C	c.(2464-2466)aGa>aCa	p.R822T	ARMC3_ENST00000409983.3_Missense_Mutation_p.R815T|ARMC3_ENST00000376528.4_Missense_Mutation_p.R559T	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	822						extracellular vesicular exosome (GO:0070062)		p.R822T(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GAGTACGGTAGAGCGTGGAAT	0.542																																					p.R822T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2465C	10						.						123.0	116.0	119.0					10																	23326254		2203	4300	6503	23366260	SO:0001583	missense	219681	exon19			AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.2465G>C	10.37:g.23326254G>C	ENSP00000298032:p.Arg822Thr	Somatic		Capture	Illumina HiSeq	Phase_I	23366260	NM_173081	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504334	0.64410	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376528	T;T;T	0.41065	1.01;1.01;2.23	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.64091	0.2567	L	0.60845	1.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.988;0.998	T	0.64884	-0.6302	10	0.87932	D	0	-12.7053	19.794	0.96471	0.0:0.0:1.0:0.0	.	815;822	Q5W041-4;Q5W041	.;ARMC3_HUMAN	T	822;815;559	ENSP00000298032:R822T;ENSP00000386943:R815T;ENSP00000365711:R559T	ENSP00000298032:R822T	R	+	2	0	ARMC3	23366260	1.000000	0.71417	0.862000	0.33874	0.004000	0.04260	7.435000	0.80391	2.678000	0.91216	0.655000	0.94253	AGA		0.542	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081	
RET	5979	broad.mit.edu	37	10	43613844	43613844	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr10:43613844C>T	ENST00000355710.3	+	13	2540	c.2308C>T	c.(2308-2310)Cga>Tga	p.R770*	RET_ENST00000340058.5_Nonsense_Mutation_p.R770*	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	770	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R770*(1)	CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GAGTGAGCTGCGAGACCTGCT	0.562		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												p.R770X	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2308T	10						.						52.0	49.0	50.0					10																	43613844		2203	4300	6503	42933850	SO:0001587	stop_gained	5979	exon13	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2308C>T	10.37:g.43613844C>T	ENSP00000347942:p.Arg770*	Somatic		Capture	Illumina HiSeq	Phase_I	42933850	NM_020975	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Nonsense_Mutation	SNP	ENST00000355710.3	37	CCDS7200.1	.	.	.	.	.	.	.	.	.	.	C	41	8.586971	0.98875	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	.	.	.	5.58	3.49	0.39957	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7699	0.78162	0.3268:0.6732:0.0:0.0	.	.	.	.	X	770	.	ENSP00000344798:R770X	R	+	1	2	RET	42933850	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.493000	0.35605	1.324000	0.45282	0.655000	0.94253	CGA		0.562	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975	
SH3PXD2A	9644	broad.mit.edu	37	10	105363438	105363438	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr10:105363438G>A	ENST00000369774.4	-	15	1813	c.1537C>T	c.(1537-1539)Cgc>Tgc	p.R513C	SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.R348C|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.R485C|SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.R380C			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	513					superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)	p.R485C(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		GTGCTTGTGCGGCGGCTCAGG	0.662																																					p.R485C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1453T	10						.						53.0	53.0	53.0					10																	105363438		2203	4300	6503	105353428	SO:0001583	missense	9644	exon14			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.1537C>T	10.37:g.105363438G>A	ENSP00000358789:p.Arg513Cys	Somatic		Capture	Illumina HiSeq	Phase_I	105353428	NM_014631	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	ENST00000369774.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.45|16.45	3.126825|3.126825	0.56721|0.56721	.|.	.|.	ENSG00000107957|ENSG00000107957	ENST00000420222|ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130	.|T;T;T;T	.|0.43294	.|0.95;0.95;0.95;0.95	5.47|5.47	3.44|3.44	0.39384|0.39384	.|Src homology-3 domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.59101|0.59101	0.2169|0.2169	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.973;0.994;0.984;0.999	T|T	0.63247|0.63247	-0.6680|-0.6680	5|10	.|0.72032	.|D	.|0.01	-15.9257|-15.9257	13.3747|13.3747	0.60732|0.60732	0.0:0.0:0.5545:0.4455|0.0:0.0:0.5545:0.4455	.|.	.|513;362;358;485	.|Q5TCZ1;B7Z9L8;B7Z3B0;Q5TCZ1-3	.|SPD2A_HUMAN;.;.;.	L|C	439|513;485;320;428;380;348	.|ENSP00000358789:R513C;ENSP00000348215:R485C;ENSP00000443663:R380C;ENSP00000441514:R348C	.|ENSP00000318135:R320C	P|R	-|-	2|1	0|0	SH3PXD2A|SH3PXD2A	105353428|105353428	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.980000|0.980000	0.70556|0.70556	1.318000|1.318000	0.33643|0.33643	1.248000|1.248000	0.43934|0.43934	0.561000|0.561000	0.74099|0.74099	CCG|CGC		0.662	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631	
DCHS1	8642	broad.mit.edu	37	11	6655164	6655164	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:6655164C>A	ENST00000299441.3	-	4	2485	c.2074G>T	c.(2074-2076)Gcc>Tcc	p.A692S	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	692	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A692S(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTTATACTGGCAGCATACTCC	0.547																																					p.A692S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2074T	11						.						73.0	75.0	74.0					11																	6655164		2201	4296	6497	6611740	SO:0001583	missense	8642	exon4			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.2074G>T	11.37:g.6655164C>A	ENSP00000299441:p.Ala692Ser	Somatic		Capture	Illumina HiSeq	Phase_I	6611740	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	12.45	1.942864	0.34283	.	.	ENSG00000166341	ENST00000299441	T	0.55760	0.5	4.38	2.52	0.30459	Cadherin (3);Cadherin-like (1);	0.172942	0.27563	N	0.018811	T	0.48554	0.1506	M	0.71296	2.17	0.30221	N	0.796852	B	0.23735	0.09	B	0.31442	0.13	T	0.45411	-0.9263	10	0.20046	T	0.44	.	7.5833	0.27978	0.0:0.7456:0.1649:0.0895	.	692	Q96JQ0	PCD16_HUMAN	S	692	ENSP00000299441:A692S	ENSP00000299441:A692S	A	-	1	0	DCHS1	6611740	0.990000	0.36364	1.000000	0.80357	0.478000	0.33099	2.035000	0.41155	0.496000	0.27904	-1.024000	0.02432	GCC		0.547	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
OLFML1	283298	broad.mit.edu	37	11	7530892	7530892	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:7530892C>G	ENST00000329293.3	+	3	1076	c.682C>G	c.(682-684)Cat>Gat	p.H228D	OLFML1_ENST00000528758.1_3'UTR|OLFML1_ENST00000530135.1_Missense_Mutation_p.H228D|CTD-2516F10.2_ENST00000530201.1_RNA	NM_198474.3	NP_940876.2	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1	228	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.					extracellular region (GO:0005576)		p.H228D(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(3)|prostate(2)	24				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		TCTATTTTTTCATAACCAAGC	0.458																																					p.H228D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C682G	11						.						54.0	55.0	55.0					11																	7530892		2201	4296	6497	7487468	SO:0001583	missense	283298	exon3			AY358591	CCDS7779.1	11p15	2008-02-05			ENSG00000183801	ENSG00000183801			24473	protein-coding gene	gene with protein product							Standard	NM_198474		Approved	UNQ564	uc001mfi.3	Q6UWY5	OTTHUMG00000165527	ENST00000329293.3:c.682C>G	11.37:g.7530892C>G	ENSP00000332511:p.His228Asp	Somatic		Capture	Illumina HiSeq	Phase_I	7487468	NM_198474	B4DP03|Q569G4	Missense_Mutation	SNP	ENST00000329293.3	37	CCDS7779.1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.546337	0.27652	.	.	ENSG00000183801	ENST00000530135;ENST00000329293	D;D	0.88741	-2.42;-2.42	5.66	5.66	0.87406	Olfactomedin-like (3);	0.050298	0.85682	D	0.000000	D	0.93132	0.7813	L	0.57536	1.79	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.69824	0.966;0.951	D	0.93330	0.6700	10	0.66056	D	0.02	.	17.2492	0.87037	0.0:1.0:0.0:0.0	.	92;228	B4DN61;Q6UWY5	.;OLFL1_HUMAN	D	228	ENSP00000433455:H228D;ENSP00000332511:H228D	ENSP00000332511:H228D	H	+	1	0	OLFML1	7487468	1.000000	0.71417	1.000000	0.80357	0.416000	0.31233	1.669000	0.37492	2.665000	0.90641	0.563000	0.77884	CAT		0.458	OLFML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384656.1	NM_198474	
DENND5A	23258	broad.mit.edu	37	11	9172291	9172291	+	Missense_Mutation	SNP	G	G	A	rs148317700		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:9172291G>A	ENST00000328194.3	-	14	2862	c.2542C>T	c.(2542-2544)Cgt>Tgt	p.R848C	DENND5A_ENST00000530044.1_Missense_Mutation_p.R848C|DENND5A_ENST00000527700.1_Missense_Mutation_p.R191C	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	848	RUN 1. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R848C(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GACTTCCTACGTTCTGAATCA	0.428																																					p.R848C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2542T	11						.	G	CYS/ARG	0,4402		0,0,2201	134.0	120.0	125.0		2542	5.5	1.0	11	dbSNP_134	125	1,8591		0,1,4295	yes	missense	DENND5A	NM_015213.3	180	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	848/1288	9172291	1,12993	2201	4296	6497	9128867	SO:0001583	missense	23258	exon14			AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.2542C>T	11.37:g.9172291G>A	ENSP00000328524:p.Arg848Cys	Somatic		Capture	Illumina HiSeq	Phase_I	9128867	NM_015213	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	ENST00000328194.3	37	CCDS31423.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.044212|4.044212	0.75732|0.75732	0.0|0.0	1.16E-4|1.16E-4	ENSG00000184014|ENSG00000184014	ENST00000328194;ENST00000530044;ENST00000527700|ENST00000524446	T;T;T|.	0.33438|.	1.41;1.41;1.41|.	5.53|5.53	5.53|5.53	0.82687|0.82687	RUN (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75831|0.75831	0.3903|0.3903	M|M	0.80616|0.80616	2.505|2.505	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.67725|.	0.953;0.939|.	T|T	0.76984|0.76984	-0.2756|-0.2756	10|5	0.87932|.	D|.	0|.	.|.	13.4783|13.4783	0.61322|0.61322	0.0:0.0:0.7382:0.2618|0.0:0.0:0.7382:0.2618	.|.	848;848|.	E9PS91;Q6IQ26|.	.;DEN5A_HUMAN|.	C|M	848;848;191|18	ENSP00000328524:R848C;ENSP00000435866:R848C;ENSP00000432549:R191C|.	ENSP00000328524:R848C|.	R|T	-|-	1|2	0|0	DENND5A|DENND5A	9128867|9128867	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.984000|3.984000	0.56923|0.56923	2.601000|2.601000	0.87937|0.87937	0.655000|0.655000	0.94253|0.94253	CGT|ACG		0.428	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
KIAA1549L	25758	broad.mit.edu	37	11	33564137	33564137	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:33564137G>T	ENST00000321505.4	+	1	317	c.137G>T	c.(136-138)gGg>gTg	p.G46V	KIAA1549L_ENST00000265654.5_Missense_Mutation_p.G46V|KIAA1549L_ENST00000389726.3_Missense_Mutation_p.G46V			Q6ZVL6	K154L_HUMAN	KIAA1549-like	46						integral component of membrane (GO:0016021)		p.G46V(2)									TCCACACCTGGGTTTTTGAGC	0.542																																					p.G46V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G137T	11						.						101.0	101.0	101.0					11																	33564137		1938	4142	6080	33520713	SO:0001583	missense	25758	exon1			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.137G>T	11.37:g.33564137G>T	ENSP00000315295:p.Gly46Val	Somatic		Capture	Illumina HiSeq	Phase_I	33520713	NM_012194	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	37	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	G	0.854	-0.737593	0.03111	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654	.	.	.	4.72	2.44	0.29823	.	.	.	.	.	T	0.17959	0.0431	N	0.14661	0.345	0.09310	N	1	B;B	0.13145	0.002;0.007	B;B	0.15484	0.002;0.013	T	0.18429	-1.0337	8	0.29301	T	0.29	.	2.6874	0.05111	0.3392:0.0:0.2926:0.3682	.	46;46	E9PAT2;Q6ZVL6-2	.;.	V	46	.	ENSP00000265654:G46V	G	+	2	0	C11orf41	33520713	0.004000	0.15560	0.002000	0.10522	0.173000	0.22820	0.170000	0.16663	0.825000	0.34637	0.561000	0.74099	GGG		0.542	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
OR4X1	390113	broad.mit.edu	37	11	48285621	48285621	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:48285621G>T	ENST00000320048.1	+	1	209	c.209G>T	c.(208-210)tGc>tTc	p.C70F		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C70F(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						GTGGAGATCTGCTACTGTTCT	0.488																																					p.C70F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G209T	11						.						135.0	124.0	128.0					11																	48285621		2201	4298	6499	48242197	SO:0001583	missense	390113	exon1			AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.209G>T	11.37:g.48285621G>T	ENSP00000321506:p.Cys70Phe	Somatic		Capture	Illumina HiSeq	Phase_I	48242197	NM_001004726	Q6IF74	Missense_Mutation	SNP	ENST00000320048.1	37	CCDS31487.1	.	.	.	.	.	.	.	.	.	.	G	8.904	0.956956	0.18507	.	.	ENSG00000176567	ENST00000320048	T	0.00421	7.46	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01254	0.0041	M	0.82132	2.575	0.09310	N	1	D	0.76494	0.999	D	0.91635	0.999	T	0.50775	-0.8788	9	0.45353	T	0.12	.	14.6151	0.68541	0.0:0.0:1.0:0.0	.	70	Q8NH49	OR4X1_HUMAN	F	70	ENSP00000321506:C70F	ENSP00000321506:C70F	C	+	2	0	OR4X1	48242197	0.022000	0.18835	0.948000	0.38648	0.159000	0.22180	1.929000	0.40114	2.363000	0.80096	0.563000	0.77884	TGC		0.488	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383373.1	NM_001004726	
OR10AG1	282770	broad.mit.edu	37	11	55735276	55735276	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:55735276C>A	ENST00000312345.2	-	1	714	c.664G>T	c.(664-666)Gcc>Tcc	p.A222S		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A222S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					TTTCCTCTGGCTGATGACAAT	0.408																																					p.A222S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G664T	11						.						67.0	65.0	65.0					11																	55735276		2201	4296	6497	55491852	SO:0001583	missense	282770	exon1			AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.664G>T	11.37:g.55735276C>A	ENSP00000311477:p.Ala222Ser	Somatic		Capture	Illumina HiSeq	Phase_I	55491852	NM_001005491	B2RNH4|Q6IEU3	Missense_Mutation	SNP	ENST00000312345.2	37	CCDS31514.1	.	.	.	.	.	.	.	.	.	.	C	10.17	1.276762	0.23307	.	.	ENSG00000174970	ENST00000312345	T	0.00174	8.62	5.37	1.3	0.21679	GPCR, rhodopsin-like superfamily (1);	0.470122	0.20097	N	0.099304	T	0.00144	0.0004	L	0.49699	1.58	0.09310	N	1	B	0.26577	0.153	B	0.29267	0.1	T	0.29912	-0.9996	10	0.36615	T	0.2	.	3.6144	0.08071	0.1654:0.495:0.0:0.3395	.	222	Q8NH19	O10AG_HUMAN	S	222	ENSP00000311477:A222S	ENSP00000311477:A222S	A	-	1	0	OR10AG1	55491852	0.000000	0.05858	0.567000	0.28434	0.493000	0.33554	-0.911000	0.04050	0.255000	0.21593	0.477000	0.44152	GCC		0.408	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491	
TNKS1BP1	85456	broad.mit.edu	37	11	57076076	57076076	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:57076076A>G	ENST00000532437.1	-	5	4420	c.4109T>C	c.(4108-4110)gTg>gCg	p.V1370A	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.V1370A			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1370	Acidic.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.V1370A(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GCACTGGCTCACCCCGCCCAC	0.662																																					p.V1370A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4109C	11						.						60.0	70.0	66.0					11																	57076076		2201	4296	6497	56832652	SO:0001583	missense	85456	exon6			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.4109T>C	11.37:g.57076076A>G	ENSP00000437271:p.Val1370Ala	Somatic		Capture	Illumina HiSeq	Phase_I	56832652	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711108	0.30322	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.37915	1.17;1.17	4.78	-0.149	0.13420	.	0.433417	0.19291	N	0.117895	T	0.25568	0.0622	L	0.43923	1.385	0.09310	N	1	B	0.15930	0.015	B	0.17722	0.019	T	0.17198	-1.0377	10	0.33141	T	0.24	-10.1915	7.2325	0.26051	0.5977:0.0:0.4023:0.0	.	1370	Q9C0C2	TB182_HUMAN	A	1370	ENSP00000350990:V1370A;ENSP00000437271:V1370A	ENSP00000350990:V1370A	V	-	2	0	TNKS1BP1	56832652	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	1.271000	0.33098	0.005000	0.14708	-0.566000	0.04163	GTG		0.662	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
CLP1	10978	broad.mit.edu	37	11	57427503	57427503	+	Silent	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:57427503G>A	ENST00000533682.1	+	2	1280	c.555G>A	c.(553-555)gtG>gtA	p.V185V	CLP1_ENST00000529430.1_Silent_p.V196V|CLP1_ENST00000302731.4_Intron|CLP1_ENST00000525602.1_Silent_p.V185V			Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)	p.V185V(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						CCCCTCTGGTGTATCATTTTG	0.547																																					p.V185V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G555A	11						.						29.0	28.0	28.0					11																	57427503		2201	4296	6497	57184079	SO:0001819	synonymous_variant	10978	exon2			BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000533682.1:c.555G>A	11.37:g.57427503G>A		Somatic		Capture	Illumina HiSeq	Phase_I	57184079	NM_006831	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000533682.1	37	CCDS7964.1																																																																																				0.547	CLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393462.3	NM_006831	
PGA5	5222	broad.mit.edu	37	11	61015898	61015898	+	Missense_Mutation	SNP	A	A	C	rs200053998		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	A	A	A	C	A	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:61015898A>C	ENST00000312403.5	+	6	849	c.664A>C	c.(664-666)Aag>Cag	p.K222Q	PGA5_ENST00000451616.2_Missense_Mutation_p.K68Q|PGA5_ENST00000541528.1_5'Flank|CTD-2331C18.5_ENST00000537594.1_RNA|PGA4_ENST00000422676.2_Missense_Mutation_p.K222Q	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)	222				K -> Q (in Ref. 1; AAA60061). {ECO:0000305}.	digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|skin(1)	2						CAGCGATGACAAGAGTGGCAG	0.502																																					p.K222Q												.	.	0			c.A664C	11						.						490.0	462.0	472.0					11																	61015898		2202	4299	6501	60772474	SO:0001583	missense	5222	exon6			BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.664A>C	11.37:g.61015898A>C	ENSP00000309542:p.Lys222Gln	Germline		Capture	Illumina HiSeq	Phase_I	60772474	NM_014224	A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	ENST00000312403.5	37	CCDS8001.1	9	0.004120879120879121	2	0.0040650406504065045	3	0.008287292817679558	1	0.0017482517482517483	3	0.00395778364116095	A	9.171	1.021273	0.19433	.	.	ENSG00000229183;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713	ENST00000422676;ENST00000312403;ENST00000537359;ENST00000544083;ENST00000451616	T;T;T	0.58940	0.3;0.3;0.3	2.49	-4.99	0.03010	.	3.414640	0.00875	N	0.002061	T	0.14657	0.0354	N	0.00496	-1.435	0.20307	N	0.999911	B	0.02656	0.0	B	0.04013	0.001	T	0.45848	-0.9233	10	0.02654	T	1	.	9.0217	0.36204	0.0908:0.654:0.1448:0.1104	.	222	B7ZW62	.	Q	222;222;179;81;68	ENSP00000395402:K222Q;ENSP00000309542:K222Q;ENSP00000408739:K68Q	ENSP00000395402:K222Q	K	+	1	0	PGA4;PGA5	60772474	0.000000	0.05858	0.000000	0.03702	0.685000	0.39939	-0.671000	0.05250	-1.812000	0.01227	-0.913000	0.02753	AAG		0.502	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397972.1	NM_014224	
NAALAD2	10003	broad.mit.edu	37	11	89885581	89885581	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:89885581C>A	ENST00000534061.1	+	6	955	c.725C>A	c.(724-726)gCa>gAa	p.A242E	NAALAD2_ENST00000525171.1_Missense_Mutation_p.A242E|NAALAD2_ENST00000321955.4_Missense_Mutation_p.A242E|NAALAD2_ENST00000375944.3_Missense_Mutation_p.A242E	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	242					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)	p.A242E(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CCTGGAACTGCAGCCCAGAGA	0.478																																					p.A242E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C725A	11						.						106.0	93.0	97.0					11																	89885581		2201	4299	6500	89525229	SO:0001583	missense	10003	exon6			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.725C>A	11.37:g.89885581C>A	ENSP00000432481:p.Ala242Glu	Somatic		Capture	Illumina HiSeq	Phase_I	89525229	NM_005467	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	ENST00000534061.1	37	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669241	0.67814	.	.	ENSG00000077616	ENST00000534061;ENST00000321955;ENST00000525171;ENST00000375944	T;T;T;T	0.06768	3.26;3.26;3.26;3.26	5.22	0.603	0.17541	Protease-associated domain, PA (1);	0.475544	0.20419	N	0.092703	T	0.19046	0.0457	M	0.62088	1.915	0.28252	N	0.925237	D;D;P;D;P	0.62365	0.991;0.983;0.947;0.991;0.88	D;D;P;P;P	0.68483	0.956;0.958;0.869;0.882;0.812	T	0.02450	-1.1157	9	.	.	.	-1.3899	7.3164	0.26503	0.0:0.3695:0.3775:0.2529	.	242;242;242;242;242	Q4KKV4;E9PJV2;Q9Y3Q0;E9PKX5;Q8IUX3	.;.;NALD2_HUMAN;.;.	E	242	ENSP00000432481:A242E;ENSP00000320083:A242E;ENSP00000435249:A242E;ENSP00000365111:A242E	.	A	+	2	0	NAALAD2	89525229	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	2.318000	0.43779	0.213000	0.20722	-0.136000	0.14681	GCA		0.478	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467	
C11orf63	79864	broad.mit.edu	37	11	122756744	122756744	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr11:122756744C>T	ENST00000531316.1	+	1	279	c.187C>T	c.(187-189)Cga>Tga	p.R63*	C11orf63_ENST00000227349.2_Nonsense_Mutation_p.R63*|C11orf63_ENST00000307257.6_Nonsense_Mutation_p.R63*			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	63					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.R63*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		GTTTGATGATCGAATCCGGGG	0.483																																					p.R63X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C187T	11						.						98.0	100.0	99.0					11																	122756744		2202	4299	6501	122261954	SO:0001587	stop_gained	79864	exon2			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.187C>T	11.37:g.122756744C>T	ENSP00000431669:p.Arg63*	Somatic		Capture	Illumina HiSeq	Phase_I	122261954	NM_024806	A8K6G0|Q96GB5|Q9H5D6	Nonsense_Mutation	SNP	ENST00000531316.1	37	CCDS8438.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344721	0.61073	.	.	ENSG00000109944	ENST00000307257;ENST00000227349;ENST00000531316	.	.	.	5.14	3.0	0.34707	.	1.681800	0.03669	N	0.243734	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	3.726	9.839	0.40987	0.1539:0.6971:0.1489:0.0	.	.	.	.	X	63	.	ENSP00000227349:R63X	R	+	1	2	C11orf63	122261954	0.000000	0.05858	0.012000	0.15200	0.012000	0.07955	-0.257000	0.08745	2.387000	0.81309	0.543000	0.68304	CGA		0.483	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806	
SDSL	113675	broad.mit.edu	37	12	113875695	113875695	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr12:113875695T>A	ENST00000403593.4	+	8	1063	c.801T>A	c.(799-801)gaT>gaA	p.D267E	SDSL_ENST00000345635.4_Missense_Mutation_p.D267E			Q96GA7	SDSL_HUMAN	serine dehydratase-like	267					cellular amino acid metabolic process (GO:0006520)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|pyridoxal phosphate binding (GO:0030170)	p.D267E(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	15						TGGCAGATGATGAGCGTATGC	0.642																																					p.D267E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T801A	12						.						185.0	194.0	191.0					12																	113875695		2203	4300	6503	112360078	SO:0001583	missense	113675	exon9			AF134473	CCDS9170.1	12q24.21	2014-06-24				ENSG00000139410			30404	protein-coding gene	gene with protein product						16580895	Standard	NM_138432		Approved	SDS-RS1, cSDH	uc001tvi.3	Q96GA7		ENST00000403593.4:c.801T>A	12.37:g.113875695T>A	ENSP00000385790:p.Asp267Glu	Somatic		Capture	Illumina HiSeq	Phase_I	112360078	NM_138432		Missense_Mutation	SNP	ENST00000403593.4	37	CCDS9170.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.37|11.37	1.618486|1.618486	0.28801|0.28801	.|.	.|.	ENSG00000139410|ENSG00000139410	ENST00000403593;ENST00000345635|ENST00000546672	D;D|.	0.96491|.	-4.03;-4.03|.	4.12|4.12	-5.58|-5.58	0.02512|0.02512	Pyridoxal phosphate-dependent enzyme, beta subunit (2);|.	0.124317|.	0.52532|.	D|.	0.000065|.	T|T	0.48978|0.48978	0.1530|0.1530	L|L	0.31845|0.31845	0.965|0.965	0.44798|0.44798	D|D	0.997809|0.997809	B|.	0.31548|.	0.328|.	B|.	0.28011|.	0.085|.	T|T	0.47711|0.47711	-0.9096|-0.9096	10|5	0.49607|.	T|.	0.09|.	-29.2984|-29.2984	14.3471|14.3471	0.66675|0.66675	0.0:0.2335:0.0:0.7665|0.0:0.2335:0.0:0.7665	.|.	267|.	Q96GA7|.	SDSL_HUMAN|.	E|K	267|163	ENSP00000385790:D267E;ENSP00000341117:D267E|.	ENSP00000341117:D267E|.	D|M	+|+	3|2	2|0	SDSL|SDSL	112360078|112360078	0.000000|0.000000	0.05858|0.05858	0.824000|0.824000	0.32777|0.32777	0.625000|0.625000	0.37756|0.37756	-2.793000|-2.793000	0.00766|0.00766	-1.090000|-1.090000	0.03069|0.03069	-0.558000|-0.558000	0.04189|0.04189	GAT|ATG		0.642	SDSL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404782.1	NM_138432	
KCNA1	3736	broad.mit.edu	37	12	5020811	5020811	+	Silent	SNP	C	C	T	rs371963908		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr12:5020811C>T	ENST00000382545.3	+	2	1374	c.267C>T	c.(265-267)ttC>ttT	p.F89F	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	89					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.F89F(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	GGCCCAGCTTCGACGCCATCC	0.607																																					p.F89F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C267T	12						.	C		0,4406		0,0,2203	56.0	59.0	58.0		267	3.4	1.0	12		58	1,8599		0,1,4299	no	coding-synonymous	KCNA1	NM_000217.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		89/496	5020811	1,13005	2203	4300	6503	4891072	SO:0001819	synonymous_variant	3736	exon2			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.267C>T	12.37:g.5020811C>T		Somatic		Capture	Illumina HiSeq	Phase_I	4891072	NM_000217	A6NM83|Q3MIQ9	Silent	SNP	ENST00000382545.3	37	CCDS8535.1																																																																																				0.607	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
DNM1L	10059	broad.mit.edu	37	12	32860334	32860334	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr12:32860334A>G	ENST00000549701.1	+	3	358	c.284A>G	c.(283-285)cAc>cGc	p.H95R	DNM1L_ENST00000553257.1_Missense_Mutation_p.H108R|DNM1L_ENST00000381000.4_Missense_Mutation_p.H108R|DNM1L_ENST00000358214.5_Missense_Mutation_p.H108R|DNM1L_ENST00000414834.2_Missense_Mutation_p.T40A|DNM1L_ENST00000452533.2_Missense_Mutation_p.H95R|DNM1L_ENST00000547312.1_Missense_Mutation_p.H95R|Y_RNA_ENST00000364693.1_RNA|DNM1L_ENST00000266481.6_Missense_Mutation_p.H95R|DNM1L_ENST00000548671.1_3'UTR			O00429	DNM1L_HUMAN	dynamin 1-like	95	Dynamin-type G.|GTPase domain.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dynamin polymerization involved in mitochondrial fission (GO:0003374)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|membrane fission involved in mitochondrial fission (GO:0090149)|membrane fusion (GO:0061025)|mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion morphogenesis (GO:0070584)|necroptotic process (GO:0070266)|peroxisome fission (GO:0016559)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homotetramerization (GO:0051289)|protein localization to mitochondrion (GO:0070585)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|regulation of protein oligomerization (GO:0032459)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|protein complex (GO:0043234)|synapse (GO:0045202)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)	p.H95R(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	23	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					AAATTTCTTCACACCAAAAAT	0.279																																					p.H95R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A284G	12						.						93.0	95.0	95.0					12																	32860334		2203	4287	6490	32751601	SO:0001583	missense	10059	exon3			AF000430	CCDS8728.1, CCDS8729.1, CCDS8730.1, CCDS61095.1, CCDS61096.1, CCDS61098.1, CCDS61099.1	12p11.21	2012-10-02			ENSG00000087470	ENSG00000087470			2973	protein-coding gene	gene with protein product		603850				9348079, 9731200	Standard	NM_012062		Approved	DRP1, DVLP, HDYNIV, DYMPLE, VPS1	uc001rld.2	O00429	OTTHUMG00000169451	ENST00000549701.1:c.284A>G	12.37:g.32860334A>G	ENSP00000450399:p.His95Arg	Somatic		Capture	Illumina HiSeq	Phase_I	32751601	NM_012062	A8K4X9|B4DGC9|B4DSU8|J3KPI2|O14541|O60709|Q59GN9|Q7L6B3|Q8TBT7|Q9BWM1|Q9Y5J2	Missense_Mutation	SNP	ENST00000549701.1	37	CCDS8729.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.8|21.8	4.206784|4.206784	0.79127|0.79127	.|.	.|.	ENSG00000087470|ENSG00000087470	ENST00000452533;ENST00000411996;ENST00000266479;ENST00000553257;ENST00000549701;ENST00000358214;ENST00000266481;ENST00000551476;ENST00000550154;ENST00000547312;ENST00000381000;ENST00000548750|ENST00000414834	D;D;D;D;D;D;D;D;D;D|D	0.96365|0.95205	-3.77;-3.77;-3.77;-3.77;-3.77;-3.77;-3.99;-3.77;-3.77;-3.27|-3.64	4.81|4.81	4.81|4.81	0.61882|0.61882	Dynamin, GTPase domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.94568|0.94568	0.8250|0.8250	M|M	0.82193|0.82193	2.58|2.58	0.33186|0.33186	D|D	0.550263|0.550263	D;D;D;D;D|B	0.89917|0.22541	1.0;1.0;1.0;1.0;1.0|0.071	D;D;D;D;D|B	0.97110|0.25759	1.0;1.0;1.0;0.999;1.0|0.063	D|D	0.96332|0.96332	0.9244|0.9244	10|9	0.87932|0.87932	D|D	0|0	.|.	14.3948|14.3948	0.67003|0.67003	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	148;148;161;148;95|40	D3DUW6;D3DUW5;F8W8D1;D3DUW7;O00429|B4DGC9	.;.;.;.;DNM1L_HUMAN|.	R|A	95;161;95;108;95;108;95;78;95;95;108;95|40	ENSP00000415131:H95R;ENSP00000449089:H108R;ENSP00000450399:H95R;ENSP00000350948:H108R;ENSP00000266481:H95R;ENSP00000447845:H78R;ENSP00000447013:H95R;ENSP00000448610:H95R;ENSP00000370388:H108R;ENSP00000447788:H95R|ENSP00000404160:T40A	ENSP00000266479:H95R|ENSP00000404160:T40A	H|T	+|+	2|1	0|0	DNM1L|DNM1L	32751601|32751601	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.065000|9.065000	0.93941|0.93941	1.803000|1.803000	0.52742|0.52742	0.528000|0.528000	0.53228|0.53228	CAC|ACA		0.279	DNM1L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404124.1	NM_012062	
ASB8	140461	broad.mit.edu	37	12	48547200	48547200	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr12:48547200G>A	ENST00000317697.3	-	2	249	c.80C>T	c.(79-81)gCt>gTt	p.A27V	ASB8_ENST00000536549.1_Missense_Mutation_p.A27V|ASB8_ENST00000539528.1_Missense_Mutation_p.A27V|ASB8_ENST00000536953.1_Missense_Mutation_p.A27V|ASB8_ENST00000536071.1_Missense_Mutation_p.A27V|ASB8_ENST00000535055.1_Missense_Mutation_p.A27V|ASB8_ENST00000537754.1_Intron|ASB8_ENST00000540782.1_Missense_Mutation_p.A27V|ASB8_ENST00000535988.1_Missense_Mutation_p.A27V	NM_024095.3	NP_077000.1	Q9H765	ASB8_HUMAN	ankyrin repeat and SOCS box containing 8	27					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.A27V(1)		breast(1)|kidney(2)|large_intestine(2)|lung(5)|soft_tissue(1)	11						ACGGATGGCAGCAATTGTTCG	0.468																																					p.A27V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C80T	12						.						202.0	191.0	195.0					12																	48547200		2203	4300	6503	46833467	SO:0001583	missense	140461	exon2			AK024908	CCDS8761.1	12q13.12	2013-01-10	2011-01-25			ENSG00000177981		"""Ankyrin repeat domain containing"""	17183	protein-coding gene	gene with protein product		615053	"""ankyrin repeat and SOCS box-containing 8"""			12076535	Standard	NM_024095		Approved	MGC5540, FLJ21255	uc001rrh.3	Q9H765		ENST00000317697.3:c.80C>T	12.37:g.48547200G>A	ENSP00000320893:p.Ala27Val	Somatic		Capture	Illumina HiSeq	Phase_I	46833467	NM_024095	A8K1P2|Q547Q2	Missense_Mutation	SNP	ENST00000317697.3	37	CCDS8761.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256365	0.80246	.	.	ENSG00000177981	ENST00000317697;ENST00000536549;ENST00000446549;ENST00000536953;ENST00000539528;ENST00000535055;ENST00000536071;ENST00000539503;ENST00000545791;ENST00000540212;ENST00000540782;ENST00000535988;ENST00000548228	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;0.4;0.39	5.07	5.07	0.68467	Ankyrin repeat-containing domain (1);	0.055368	0.64402	D	0.000001	T	0.66157	0.2761	N	0.25094	0.71	0.80722	D	1	P	0.49253	0.921	P	0.51945	0.685	T	0.70296	-0.4911	10	0.59425	D	0.04	-6.7066	18.4424	0.90671	0.0:0.0:1.0:0.0	.	27	Q9H765	ASB8_HUMAN	V	27	ENSP00000320893:A27V;ENSP00000445622:A27V;ENSP00000444093:A27V;ENSP00000437769:A27V;ENSP00000442639:A27V	ENSP00000320893:A27V	A	-	2	0	ASB8	46833467	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	8.995000	0.93534	2.521000	0.84997	0.650000	0.86243	GCT		0.468	ASB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396497.1		
KRT3	3850	broad.mit.edu	37	12	53189265	53189265	+	Missense_Mutation	SNP	C	C	T	rs530962648		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr12:53189265C>T	ENST00000417996.2	-	1	636	c.562G>A	c.(562-564)Gac>Aac	p.D188N	KRT3_ENST00000309505.3_Missense_Mutation_p.D188N	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	188	Head.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.D188N(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						ATCTGGGGGTCGATCTCCACA	0.537													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15967	0.0		0.0	False		,,,				2504	0.0				p.D188N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G562A	12						.						74.0	94.0	87.0					12																	53189265		2203	4300	6503	51475532	SO:0001583	missense	3850	exon1				CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.562G>A	12.37:g.53189265C>T	ENSP00000413479:p.Asp188Asn	Somatic		Capture	Illumina HiSeq	Phase_I	51475532	NM_057088	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	37	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	c	29.3	4.991851	0.93106	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	D;D	0.87809	-2.3;-2.3	4.68	4.68	0.58851	.	0.000000	0.44285	D	0.000471	D	0.94732	0.8300	M	0.90483	3.12	0.53005	D	0.999968	D	0.89917	1.0	D	0.85130	0.997	D	0.95865	0.8886	10	0.87932	D	0	.	17.987	0.89158	0.0:1.0:0.0:0.0	.	188	P12035	K2C3_HUMAN	N	188	ENSP00000413479:D188N;ENSP00000312206:D188N	ENSP00000312206:D188N	D	-	1	0	KRT3	51475532	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	7.812000	0.86109	2.308000	0.77769	0.650000	0.86243	GAC		0.537	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
GNS	2799	broad.mit.edu	37	12	65130819	65130819	+	Nonsense_Mutation	SNP	G	G	A	rs119461974		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr12:65130819G>A	ENST00000258145.3	-	9	1233	c.1063C>T	c.(1063-1065)Cga>Tga	p.R355*	GNS_ENST00000542058.1_Nonsense_Mutation_p.R335*|GNS_ENST00000418919.2_Nonsense_Mutation_p.R299*|GNS_ENST00000543646.1_Nonsense_Mutation_p.R387*	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	355					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)	p.R355*(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		CCAGGTCCTCGAACCAACAGT	0.448																																					p.R355X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1063T	12	GRCh37	CM030467	GNS	M	rs119461974	.						141.0	132.0	135.0					12																	65130819		2203	4300	6503	63417086	SO:0001587	stop_gained	2799	exon9				CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.1063C>T	12.37:g.65130819G>A	ENSP00000258145:p.Arg355*	Somatic		Capture	Illumina HiSeq	Phase_I	63417086	NM_002076	B4DYH8|Q53F05	Nonsense_Mutation	SNP	ENST00000258145.3	37	CCDS8970.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.721542|6.721542	0.97788|0.97788	.|.	.|.	ENSG00000135677|ENSG00000135677	ENST00000418919;ENST00000258145;ENST00000543646;ENST00000542058;ENST00000539825;ENST00000545471|ENST00000540196	.|.	.|.	.|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.79730	.|0.4496	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77691	.|-0.2493	.|3	.|.	.|.	.|.	-11.3062|-11.3062	19.7699|19.7699	0.96359|0.96359	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	299;355;387;335;272;292|174	.|.	.|.	R|S	-|-	1|2	2|0	GNS|GNS	63417086|63417086	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	3.668000|3.668000	0.54554|0.54554	2.759000|2.759000	0.94783|0.94783	0.555000|0.555000	0.69702|0.69702	CGA|TCG		0.448	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401195.2		
GRIP1	23426	broad.mit.edu	37	12	66849267	66849267	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr12:66849267G>A	ENST00000398016.3	-	10	1188	c.1120C>T	c.(1120-1122)Cct>Tct	p.P374S	GRIP1_ENST00000359742.4_Missense_Mutation_p.P426S|GRIP1_ENST00000286445.7_Missense_Mutation_p.P426S	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)	p.P374S(1)		NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		AGGCTTCGAGGTAGAGTCCCC	0.493																																					p.P374S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1120T	12						.						149.0	150.0	150.0					12																	66849267		2008	4176	6184	65135534	SO:0001583	missense	23426	exon10			AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.1120C>T	12.37:g.66849267G>A	ENSP00000381098:p.Pro374Ser	Somatic		Capture	Illumina HiSeq	Phase_I	65135534	NM_001178074	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000398016.3	37	CCDS41807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.63|15.63	2.890516|2.890516	0.52014|0.52014	.|.	.|.	ENSG00000155974|ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433|ENST00000543172	T;T;T;T;T|.	0.20069|.	2.13;2.1;2.1;2.13;2.21|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	0.105729|.	0.64402|.	D|.	0.000003|.	T|T	0.76140|0.76140	0.3946|0.3946	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	D;P;D|.	0.65815|.	0.986;0.498;0.995|.	P;B;D|.	0.64687|.	0.885;0.335;0.928|.	T|T	0.74878|0.74878	-0.3514|-0.3514	9|5	.|.	.|.	.|.	-13.6579|-13.6579	19.32|19.32	0.94234|0.94234	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	374;374;426|.	F5H4N6;Q9Y3R0-3;Q9Y3R0-2|.	.;.;.|.	S|I	374;426;426;374;318|193	ENSP00000381098:P374S;ENSP00000352780:P426S;ENSP00000286445:P426S;ENSP00000446047:P374S;ENSP00000446024:P318S|.	.|.	P|T	-|-	1|2	0|0	GRIP1|GRIP1	65135534|65135534	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.659000|0.659000	0.38960|0.38960	6.640000|6.640000	0.74319|0.74319	2.650000|2.650000	0.89964|0.89964	0.561000|0.561000	0.74099|0.74099	CCT|ACC		0.493	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2		
ZFC3H1	196441	broad.mit.edu	37	12	72057241	72057241	+	Missense_Mutation	SNP	T	T	A	rs372412639		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr12:72057241T>A	ENST00000378743.3	-	1	508	c.150A>T	c.(148-150)ttA>ttT	p.L50F	ZFC3H1_ENST00000552037.1_Missense_Mutation_p.L50F|THAP2_ENST00000547843.1_5'Flank|THAP2_ENST00000308086.2_5'UTR|ZFC3H1_ENST00000549407.1_5'Flank|ZFC3H1_ENST00000548100.1_Missense_Mutation_p.L50F	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	50	Ser-rich.				RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.L50F(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCGGATAGGGTAACAGCCCGC	0.622											OREG0021993	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L50F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A150T	12						.	T	PHE/LEU	0,4112		0,0,2056	44.0	55.0	51.0		150	-1.8	0.9	12		51	1,8403		0,1,4201	no	missense	ZFC3H1	NM_144982.4	22	0,1,6257	AA,AT,TT		0.0119,0.0,0.0080	probably-damaging	50/1990	72057241	1,12515	2056	4202	6258	70343508	SO:0001583	missense	196441	exon1			AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.150A>T	12.37:g.72057241T>A	ENSP00000368017:p.Leu50Phe	Somatic	1134	Capture	Illumina HiSeq	Phase_I	70343508	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	T	13.87	2.364741	0.41902	0.0	1.19E-4	ENSG00000133858	ENST00000378743;ENST00000548100;ENST00000552037	T	0.34275	1.37	4.85	-1.81	0.07882	.	0.270751	0.25500	N	0.030242	T	0.35393	0.0930	N	0.14661	0.345	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.995	D;D;D	0.80764	0.994;0.994;0.969	T	0.11108	-1.0601	10	0.48119	T	0.1	.	10.2973	0.43631	0.0:0.4485:0.0:0.5515	.	50;50;50	G3V1X1;O60293-4;O60293	.;.;ZC3H1_HUMAN	F	50	ENSP00000368017:L50F	ENSP00000368017:L50F	L	-	3	2	ZFC3H1	70343508	0.997000	0.39634	0.895000	0.35142	0.737000	0.42083	0.043000	0.13971	-0.190000	0.10465	0.374000	0.22700	TTA		0.622	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
NOS1	4842	broad.mit.edu	37	12	117698325	117698325	+	Missense_Mutation	SNP	G	G	A	rs150227193		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr12:117698325G>A	ENST00000338101.4	-	13	2316	c.2312C>T	c.(2311-2313)tCg>tTg	p.S771L	NOS1_ENST00000317775.6_Missense_Mutation_p.S771L|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.S771L(3)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		ATAAGCTTGCGATTTGCCTGT	0.542																																					p.S771L	Esophageal Squamous(162;1748 2599 51982 52956)											.	.	3	Substitution - Missense(3)	skin(2)|large_intestine(1)	c.C2312T	12						.						106.0	106.0	106.0					12																	117698325		2011	4174	6185	116182708	SO:0001583	missense	4842	exon14				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.2312C>T	12.37:g.117698325G>A	ENSP00000337459:p.Ser771Leu	Somatic		Capture	Illumina HiSeq	Phase_I	116182708	NM_000620		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.893065	0.91889	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.62498	0.02;0.02	5.2	5.2	0.72013	Flavodoxin/nitric oxide synthase (2);	0.000000	0.85682	D	0.000000	D	0.85647	0.5745	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.89697	0.3902	10	0.87932	D	0	-7.2635	18.9373	0.92590	0.0:0.0:1.0:0.0	.	771	P29475	NOS1_HUMAN	L	666;771;771;771	ENSP00000320758:S771L;ENSP00000337459:S771L	ENSP00000320758:S771L	S	-	2	0	NOS1	116182708	1.000000	0.71417	0.938000	0.37757	0.607000	0.37147	9.623000	0.98386	2.722000	0.93159	0.655000	0.94253	TCG		0.542	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
UGGT2	55757	broad.mit.edu	37	13	96529969	96529969	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr13:96529969T>C	ENST00000376747.3	-	28	3440	c.3370A>G	c.(3370-3372)Ata>Gta	p.I1124V		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1124					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.I1124V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						GCCATCACTATTGTATCAACC	0.358																																					p.I1124V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3370G	13						.						99.0	94.0	96.0					13																	96529969		2203	4300	6503	95327970	SO:0001583	missense	55757	exon28			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.3370A>G	13.37:g.96529969T>C	ENSP00000365938:p.Ile1124Val	Somatic		Capture	Illumina HiSeq	Phase_I	95327970	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	T	14.36	2.513003	0.44660	.	.	ENSG00000102595	ENST00000376747	T	0.35789	1.29	4.9	3.73	0.42828	.	0.054940	0.64402	D	0.000001	T	0.48714	0.1515	M	0.81682	2.555	0.80722	D	1	B;P	0.41450	0.27;0.75	B;P	0.47827	0.198;0.558	T	0.51647	-0.8679	10	0.87932	D	0	-16.4712	10.2147	0.43162	0.0:0.0784:0.0:0.9216	.	1124;1124	Q9NV86;Q9NYU1	.;UGGG2_HUMAN	V	1124	ENSP00000365938:I1124V	ENSP00000365938:I1124V	I	-	1	0	UGGT2	95327970	1.000000	0.71417	0.997000	0.53966	0.731000	0.41821	3.631000	0.54280	0.736000	0.32559	0.383000	0.25322	ATA		0.358	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
NPAS3	64067	broad.mit.edu	37	14	33684428	33684428	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr14:33684428C>T	ENST00000356141.4	+	3	181	c.181C>T	c.(181-183)Cgc>Tgc	p.R61C	NPAS3_ENST00000547068.1_5'UTR|NPAS3_ENST00000341321.4_Missense_Mutation_p.R61C|NPAS3_ENST00000551492.1_Missense_Mutation_p.R68C|NPAS3_ENST00000346562.2_Missense_Mutation_p.R31C|NPAS3_ENST00000548645.1_Missense_Mutation_p.R31C|NPAS3_ENST00000357798.5_Missense_Mutation_p.R31C|NPAS3_ENST00000551008.1_5'UTR			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	61	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.R31C(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		AGATGCTGCTCGCTCCCGCCG	0.448																																					p.R31C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C91T	14						.						59.0	65.0	63.0					14																	33684428		2203	4300	6503	32754179	SO:0001583	missense	64067	exon2			AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.181C>T	14.37:g.33684428C>T	ENSP00000348460:p.Arg61Cys	Somatic		Capture	Illumina HiSeq	Phase_I	32754179	NM_022123	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	37	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154952	0.78114	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000341321;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;D;T;T;T	0.99089	2.79;1.85;2.69;-5.41;2.69;1.85;2.58	5.96	5.96	0.96718	Helix-loop-helix DNA-binding (4);	0.000000	0.64402	D	0.000004	D	0.99272	0.9746	M	0.73598	2.24	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.99838	1.1059	10	0.87932	D	0	.	20.4008	0.98991	0.0:1.0:0.0:0.0	.	31;61;31;31	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	C	38;68;31;61;31;61;31	ENSP00000448373:R38C;ENSP00000450392:R68C;ENSP00000319610:R31C;ENSP00000344158:R61C;ENSP00000448916:R31C;ENSP00000348460:R61C;ENSP00000350446:R31C	ENSP00000344158:R61C	R	+	1	0	NPAS3	32754179	1.000000	0.71417	0.996000	0.52242	0.831000	0.47069	4.787000	0.62432	2.826000	0.97356	0.655000	0.94253	CGC		0.448	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
ATG14	22863	broad.mit.edu	37	14	55864124	55864124	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr14:55864124G>A	ENST00000247178.5	-	2	285	c.250C>T	c.(250-252)Cga>Tga	p.R84*		NM_014924.4	NP_055739.2	Q6ZNE5	BAKOR_HUMAN	autophagy related 14	84					autophagic vacuole assembly (GO:0000045)|endosome to lysosome transport (GO:0008333)|positive regulation of autophagy (GO:0010508)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|pre-autophagosomal structure membrane (GO:0034045)		p.R84*(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(2)	13						CTCTTAAGTCGGCTTAACCTT	0.333																																					p.R84X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C250T	14						.						138.0	115.0	123.0					14																	55864124		2202	4298	6500	54933877	SO:0001587	stop_gained	22863	exon2			AB020638	CCDS32087.1	14q22.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000126775	ENSG00000126775			19962	protein-coding gene	gene with protein product	"""Barkor"", ""beclin 1-associated autophagy-related key regulator"""	613515	"""KIAA0831"", ""ATG14 autophagy related 14 homolog (S. cerevisiae)"""	KIAA0831		18843052	Standard	NM_014924		Approved	ATG14L	uc001xbx.2	Q6ZNE5	OTTHUMG00000172129	ENST00000247178.5:c.250C>T	14.37:g.55864124G>A	ENSP00000247178:p.Arg84*	Somatic		Capture	Illumina HiSeq	Phase_I	54933877	NM_014924	A6NJE4|A8K9U5|B7ZWP5|O94920|Q32MK7|Q32MK8	Nonsense_Mutation	SNP	ENST00000247178.5	37	CCDS32087.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848751	0.91277	.	.	ENSG00000126775	ENST00000247178	.	.	.	5.61	4.72	0.59763	.	0.516189	0.20741	N	0.086539	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.1718	14.6477	0.68772	0.0:0.1451:0.8549:0.0	.	.	.	.	X	84	.	ENSP00000247178:R84X	R	-	1	2	ATG14	54933877	0.714000	0.27936	0.032000	0.17829	0.967000	0.64934	5.576000	0.67437	1.369000	0.46134	0.655000	0.94253	CGA		0.333	ATG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416992.1	NM_014924	
SIX1	6495	broad.mit.edu	37	14	61113253	61113253	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr14:61113253G>T	ENST00000247182.6	-	2	875	c.603C>A	c.(601-603)aaC>aaA	p.N201K	SIX1_ENST00000554986.1_Missense_Mutation_p.N28K	NM_005982.3	NP_005973.1	Q15475	SIX1_HUMAN	SIX homeobox 1	201					aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|branching involved in ureteric bud morphogenesis (GO:0001658)|cochlea morphogenesis (GO:0090103)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial cell differentiation (GO:0030855)|facial nerve morphogenesis (GO:0021610)|generation of neurons (GO:0048699)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesonephric tubule formation (GO:0072172)|metanephric mesenchyme development (GO:0072075)|middle ear morphogenesis (GO:0042474)|myoblast migration (GO:0051451)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|organ induction (GO:0001759)|otic vesicle development (GO:0071599)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|protein localization to nucleus (GO:0034504)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of neuron differentiation (GO:0045664)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.N201K(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0201)		GAGAGAGTTGGTTCTGCTTGT	0.453																																					p.N201K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C603A	14						.						89.0	77.0	81.0					14																	61113253		2203	4300	6503	60183006	SO:0001583	missense	6495	exon2			X91868	CCDS9748.1	14q23.1	2011-06-20	2007-07-13		ENSG00000126778	ENSG00000126778		"""Homeoboxes / SINE class"""	10887	protein-coding gene	gene with protein product		601205	"""sine oculis homeobox (Drosophila) homolog 1"", ""sine oculis homeobox homolog 1 (Drosophila)"", ""deafness, autosomal dominant 23"""	DFNA23		8617500, 15141091	Standard	NM_005982		Approved		uc001xfb.4	Q15475	OTTHUMG00000140334	ENST00000247182.6:c.603C>A	14.37:g.61113253G>T	ENSP00000247182:p.Asn201Lys	Somatic		Capture	Illumina HiSeq	Phase_I	60183006	NM_005982	Q53Y16|Q96H64	Missense_Mutation	SNP	ENST00000247182.6	37	CCDS9748.1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.888126	0.72524	.	.	ENSG00000126778	ENST00000247182;ENST00000555955;ENST00000553535	D;D;D	0.87491	-2.26;-2.14;-2.14	5.19	4.06	0.47325	.	0.000000	0.85682	D	0.000000	T	0.75228	0.3821	L	0.29908	0.895	0.51012	D	0.999902	B	0.16396	0.017	B	0.16289	0.015	T	0.63097	-0.6713	10	0.09590	T	0.72	-1.6656	6.7911	0.23699	0.7642:0.0:0.2358:0.0	.	201	Q15475	SIX1_HUMAN	K	201;17;17	ENSP00000247182:N201K;ENSP00000450952:N17K;ENSP00000450739:N17K	ENSP00000247182:N201K	N	-	3	2	SIX1	60183006	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.222000	0.58580	1.004000	0.39156	-0.302000	0.09304	AAC		0.453	SIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276951.3		
NGB	58157	broad.mit.edu	37	14	77732899	77732899	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr14:77732899G>A	ENST00000298352.4	-	4	810	c.436C>T	c.(436-438)Cga>Tga	p.R146*	MIR1260A_ENST00000408827.1_RNA	NM_021257.3	NP_067080.1	Q9NPG2	NGB_HUMAN	neuroglobin	146	Globin.				apoptotic process (GO:0006915)|oxygen transport (GO:0015671)	mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)	p.R146*(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		TCCCAGCCTCGACTCATGGCC	0.632																																					p.R146X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C436T	14						.						54.0	51.0	52.0					14																	77732899		2203	4300	6503	76802652	SO:0001587	stop_gained	58157	exon4			AJ245946	CCDS9856.1	14q24.3	2014-06-13			ENSG00000165553	ENSG00000165553			14077	protein-coding gene	gene with protein product		605304				11029004, 17210637	Standard	NM_021257		Approved		uc001xtg.1	Q9NPG2	OTTHUMG00000171558	ENST00000298352.4:c.436C>T	14.37:g.77732899G>A	ENSP00000298352:p.Arg146*	Somatic		Capture	Illumina HiSeq	Phase_I	76802652	NM_021257		Nonsense_Mutation	SNP	ENST00000298352.4	37	CCDS9856.1	.	.	.	.	.	.	.	.	.	.	G	39	7.557090	0.98358	.	.	ENSG00000165553	ENST00000298352	.	.	.	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9414	0.47275	0.0918:0.0:0.9082:0.0	.	.	.	.	X	146	.	ENSP00000298352:R146X	R	-	1	2	NGB	76802652	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.299000	0.43611	2.186000	0.69663	0.561000	0.74099	CGA		0.632	NGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414194.1	NM_021257	
FLRT2	23768	broad.mit.edu	37	14	86088177	86088177	+	Missense_Mutation	SNP	C	C	T	rs117507441	byFrequency	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr14:86088177C>T	ENST00000330753.4	+	2	1086	c.319C>T	c.(319-321)Ctt>Ttt	p.L107F	FLRT2_ENST00000554746.1_Missense_Mutation_p.L107F	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	107					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.L107F(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CCCCATGAACCTTCCCAAGAA	0.473																																					p.L107F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C319T	14						.						109.0	105.0	106.0					14																	86088177		2203	4300	6503	85157930	SO:0001583	missense	23768	exon2			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.319C>T	14.37:g.86088177C>T	ENSP00000332879:p.Leu107Phe	Somatic		Capture	Illumina HiSeq	Phase_I	85157930	NM_013231	A0AV84|B7ZLP3	Missense_Mutation	SNP	ENST00000330753.4	37	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.514700	0.64634	.	.	ENSG00000185070	ENST00000330753;ENST00000554746	T;T	0.02863	4.13;4.13	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.11281	0.0275	M	0.73430	2.235	0.80722	D	1	D	0.64830	0.994	P	0.56960	0.81	T	0.37753	-0.9692	10	0.09843	T	0.71	-16.3713	19.9036	0.96999	0.0:1.0:0.0:0.0	.	107	O43155	FLRT2_HUMAN	F	107	ENSP00000332879:L107F;ENSP00000451050:L107F	ENSP00000332879:L107F	L	+	1	0	FLRT2	85157930	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.285000	0.51716	2.706000	0.92434	0.655000	0.94253	CTT		0.473	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
UBE3A	7337	broad.mit.edu	37	15	25616717	25616717	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr15:25616717C>T	ENST00000397954.2	-	4	612	c.613G>A	c.(613-615)Gaa>Aaa	p.E205K	UBE3A_ENST00000438097.1_Missense_Mutation_p.E182K|SNHG14_ENST00000554726.1_RNA|UBE3A_ENST00000566215.1_Missense_Mutation_p.E182K|UBE3A_ENST00000232165.3_Missense_Mutation_p.E202K|UBE3A_ENST00000428984.2_Missense_Mutation_p.E182K			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	205					androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)	p.E205K(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		TCTGAGTCTTCTTCCATAGCA	0.413																																					p.E202K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G604A	15						.						213.0	204.0	208.0					15																	25616717		2203	4300	6503	23167810	SO:0001583	missense	7337	exon6			AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.613G>A	15.37:g.25616717C>T	ENSP00000381045:p.Glu205Lys	Somatic		Capture	Illumina HiSeq	Phase_I	23167810	NM_130839	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	ENST00000397954.2	37	CCDS45192.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.938944	0.34189	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.17054	2.3;2.3;2.3;2.3	5.84	5.84	0.93424	.	0.044374	0.85682	D	0.000000	T	0.10508	0.0257	N	0.14661	0.345	0.54753	D	0.999982	B;B	0.31730	0.065;0.337	B;B	0.26770	0.038;0.073	T	0.09907	-1.0653	10	0.06365	T	0.9	.	20.1466	0.98079	0.0:1.0:0.0:0.0	.	202;205	Q05086-3;Q05086	.;UBE3A_HUMAN	K	202;202;205;182;182	ENSP00000232165:E202K;ENSP00000381045:E205K;ENSP00000411258:E182K;ENSP00000401265:E182K	ENSP00000232165:E202K	E	-	1	0	UBE3A	23167810	1.000000	0.71417	0.999000	0.59377	0.886000	0.51366	6.346000	0.72999	2.779000	0.95612	0.591000	0.81541	GAA		0.413	UBE3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000434203.1	NM_000462	
RYR3	6263	broad.mit.edu	37	15	33893677	33893677	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr15:33893677C>A	ENST00000389232.4	+	17	1916	c.1846C>A	c.(1846-1848)Cag>Aag	p.Q616K	RYR3_ENST00000415757.3_Missense_Mutation_p.Q616K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	616	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.Q616K(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAGAGCCAACCAGAATCTGAT	0.537																																					p.Q616K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1846A	15						.						114.0	108.0	110.0					15																	33893677		2063	4216	6279	31680969	SO:0001583	missense	6263	exon17				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1846C>A	15.37:g.33893677C>A	ENSP00000373884:p.Gln616Lys	Somatic		Capture	Illumina HiSeq	Phase_I	31680969	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898997	0.91962	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.97089	-4.24;-4.24	4.57	4.57	0.56435	Intracellular calcium-release channel (1);B30.2/SPRY domain (1);	0.000000	0.85682	D	0.000000	D	0.98560	0.9519	M	0.87758	2.905	0.80722	D	1	P;D	0.69078	0.917;0.997	D;D	0.76071	0.915;0.987	D	0.99585	1.0974	10	0.87932	D	0	.	17.9744	0.89122	0.0:1.0:0.0:0.0	.	616;616	Q15413-2;Q15413	.;RYR3_HUMAN	K	616	ENSP00000373884:Q616K;ENSP00000399610:Q616K	ENSP00000354735:Q616K	Q	+	1	0	RYR3	31680969	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.562000	0.82300	2.553000	0.86117	0.650000	0.86243	CAG		0.537	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
MAPKBP1	23005	broad.mit.edu	37	15	42105966	42105966	+	Missense_Mutation	SNP	G	G	A	rs374717785		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr15:42105966G>A	ENST00000456763.2	+	10	1181	c.985G>A	c.(985-987)Gtc>Atc	p.V329I	MAPKBP1_ENST00000457542.2_Missense_Mutation_p.V323I|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.V211I|MAPKBP1_ENST00000221214.6_Intron|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.V323I	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	329								p.V323I(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CATTGCTAGCGTCACCGAGGC	0.592																																					p.V323I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G967A	15						.	A	ILE/VAL,ILE/VAL	3,4403	6.2+/-15.9	0,3,2200	115.0	106.0	109.0		985,967	-6.3	0.1	15		109	0,8600		0,0,4300	no	missense,missense	MAPKBP1	NM_001128608.1,NM_014994.2	29,29	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign,benign	329/1515,323/1509	42105966	3,13003	2203	4300	6503	39893258	SO:0001583	missense	23005	exon9			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.985G>A	15.37:g.42105966G>A	ENSP00000393099:p.Val329Ile	Somatic		Capture	Illumina HiSeq	Phase_I	39893258	NM_014994	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	g	0.324	-0.960053	0.02267	6.81E-4	0.0	ENSG00000137802	ENST00000457542;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T	0.42131	1.08;0.98;1.15;1.24	5.64	-6.33	0.01988	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.593302	0.19314	N	0.117308	T	0.28962	0.0719	L	0.38531	1.155	0.09310	N	0.999993	B;B;B;B	0.12013	0.001;0.005;0.001;0.001	B;B;B;B	0.13407	0.001;0.009;0.001;0.002	T	0.05053	-1.0909	10	0.21014	T	0.42	-1.6987	18.1757	0.89760	0.2499:0.0:0.7501:0.0	.	211;323;329;323	F8WC21;O60336-2;O60336;O60336-6	.;.;MABP1_HUMAN;.	I	323;211;329;323	ENSP00000397570:V323I;ENSP00000260357:V211I;ENSP00000393099:V329I;ENSP00000426154:V323I	ENSP00000260357:V211I	V	+	1	0	MAPKBP1	39893258	0.000000	0.05858	0.055000	0.19348	0.822000	0.46500	-0.443000	0.06862	-1.516000	0.01782	-1.913000	0.00520	GTC		0.592	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
MAPKBP1	23005	broad.mit.edu	37	15	42107484	42107484	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr15:42107484C>T	ENST00000456763.2	+	12	1412	c.1216C>T	c.(1216-1218)Cag>Tag	p.Q406*	MAPKBP1_ENST00000457542.2_Nonsense_Mutation_p.Q400*|MAPKBP1_ENST00000260357.7_Intron|MAPKBP1_ENST00000221214.6_Nonsense_Mutation_p.Q283*|MAPKBP1_ENST00000514566.1_Nonsense_Mutation_p.Q400*	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	406								p.Q400*(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		GGATAGTAACCAGGCCTGCCT	0.587																																					p.Q400X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1198T	15						.						89.0	80.0	83.0					15																	42107484		2203	4300	6503	39894776	SO:0001587	stop_gained	23005	exon11			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1216C>T	15.37:g.42107484C>T	ENSP00000393099:p.Gln406*	Somatic		Capture	Illumina HiSeq	Phase_I	39894776	NM_014994	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Nonsense_Mutation	SNP	ENST00000456763.2	37	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	c	39	7.901301	0.98551	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000456763;ENST00000514566	.	.	.	5.72	4.8	0.61643	.	0.108147	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-16.6162	14.665	0.68901	0.0:0.9302:0.0:0.0698	.	.	.	.	X	400;283;406;400	.	ENSP00000221214:Q283X	Q	+	1	0	MAPKBP1	39894776	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.223000	0.58587	1.422000	0.47177	0.556000	0.70494	CAG		0.587	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
FBN1	2200	broad.mit.edu	37	15	48704804	48704804	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr15:48704804G>A	ENST00000316623.5	-	65	8643	c.8188C>T	c.(8188-8190)Cgg>Tgg	p.R2730W	FBN1_ENST00000561429.1_5'UTR	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2730					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R2730W(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GTGCTTCTCCGTTTCCTGCCC	0.507																																					p.R2730W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8188T	15						.						244.0	192.0	209.0					15																	48704804		2198	4296	6494	46492096	SO:0001583	missense	2200	exon65			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8188C>T	15.37:g.48704804G>A	ENSP00000325527:p.Arg2730Trp	Somatic		Capture	Illumina HiSeq	Phase_I	46492096	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425814	0.62733	.	.	ENSG00000166147	ENST00000316623	D	0.82893	-1.66	5.38	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.89608	0.6764	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.90638	0.4572	10	0.87932	D	0	.	13.1212	0.59327	0.0:0.0:0.709:0.2909	.	2730	P35555	FBN1_HUMAN	W	2730	ENSP00000325527:R2730W	ENSP00000325527:R2730W	R	-	1	2	FBN1	46492096	1.000000	0.71417	0.997000	0.53966	0.665000	0.39181	5.225000	0.65294	1.488000	0.48433	-0.169000	0.13324	CGG		0.507	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FBN1	2200	broad.mit.edu	37	15	48704921	48704921	+	Missense_Mutation	SNP	C	C	G	rs145105768		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr15:48704921C>G	ENST00000316623.5	-	65	8526	c.8071G>C	c.(8071-8073)Ggc>Cgc	p.G2691R	FBN1_ENST00000561429.1_5'UTR	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2691					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.G2691R(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CGGCCCATGCCCATTCCAGAA	0.502																																					p.G2691R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8071C	15						.						155.0	150.0	152.0					15																	48704921		2198	4296	6494	46492213	SO:0001583	missense	2200	exon65			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8071G>C	15.37:g.48704921C>G	ENSP00000325527:p.Gly2691Arg	Somatic		Capture	Illumina HiSeq	Phase_I	46492213	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196795	0.79015	.	.	ENSG00000166147	ENST00000316623	D	0.81996	-1.56	5.38	5.38	0.77491	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.85128	0.5626	M	0.73598	2.24	0.80722	D	1	B	0.29378	0.243	B	0.34536	0.185	D	0.83537	0.0094	10	0.49607	T	0.09	.	18.926	0.92544	0.0:1.0:0.0:0.0	.	2691	P35555	FBN1_HUMAN	R	2691	ENSP00000325527:G2691R	ENSP00000325527:G2691R	G	-	1	0	FBN1	46492213	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.841000	0.69409	2.793000	0.96121	0.655000	0.94253	GGC		0.502	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
UNC13C	440279	broad.mit.edu	37	15	54838963	54838963	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr15:54838963C>T	ENST00000260323.11	+	26	5740	c.5740C>T	c.(5740-5742)Cga>Tga	p.R1914*	UNC13C_ENST00000537900.1_Nonsense_Mutation_p.R1912*|UNC13C_ENST00000545554.1_Nonsense_Mutation_p.R1914*	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1914	MHD2. {ECO:0000255|PROSITE- ProRule:PRU00588}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.R1914*(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AGTCCTAAAGCGAGTTTTAAA	0.279																																					p.R1914X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C5740T	15						.						39.0	34.0	36.0					15																	54838963		1757	4026	5783	52626255	SO:0001587	stop_gained	440279	exon25			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5740C>T	15.37:g.54838963C>T	ENSP00000260323:p.Arg1914*	Somatic		Capture	Illumina HiSeq	Phase_I	52626255	NM_001080534	Q0P613|Q8ND48|Q96NP3	Nonsense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	9.674	1.147519	0.21288	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	.	.	.	5.59	2.54	0.30619	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2199	0.65820	0.4092:0.5908:0.0:0.0	.	.	.	.	X	1914;1914;1912	.	ENSP00000260323:R1914X	R	+	1	2	UNC13C	52626255	1.000000	0.71417	0.979000	0.43373	0.126000	0.20510	1.709000	0.37909	0.704000	0.31869	-0.219000	0.12488	CGA		0.279	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
CRAMP1L	57585	broad.mit.edu	37	16	1710038	1710038	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr16:1710038C>T	ENST00000397412.3	+	11	2486	c.2387C>T	c.(2386-2388)cCg>cTg	p.P796L	CRAMP1L_ENST00000436138.3_Missense_Mutation_p.P793L|CRAMP1L_ENST00000293925.5_Missense_Mutation_p.P796L|LA16c-431H6.6_ENST00000454337.1_3'UTR|CRAMP1L_ENST00000262317.4_Missense_Mutation_p.P174L			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	796						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.P796L(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						AAGACCTTCCCGCCCAGCTCT	0.687																																					p.P796L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2387T	16						.						22.0	28.0	26.0					16																	1710038		2133	4227	6360	1650039	SO:0001583	missense	57585	exon10			AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.2387C>T	16.37:g.1710038C>T	ENSP00000380559:p.Pro796Leu	Somatic		Capture	Illumina HiSeq	Phase_I	1650039	NM_020825	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Missense_Mutation	SNP	ENST00000397412.3	37	CCDS10440.2	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071692	0.55646	.	.	ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138;ENST00000262317	.	.	.	4.93	4.93	0.64822	.	0.340006	0.32204	N	0.006430	T	0.38719	0.1051	L	0.29908	0.895	0.40035	D	0.975577	P	0.44946	0.846	B	0.30401	0.115	T	0.51764	-0.8664	9	0.66056	D	0.02	-3.6045	18.3395	0.90300	0.0:1.0:0.0:0.0	.	796	Q96RY5	CRML_HUMAN	L	796;796;793;174	.	ENSP00000262317:P174L	P	+	2	0	CRAMP1L	1650039	0.999000	0.42202	0.848000	0.33437	0.885000	0.51271	4.718000	0.61930	2.563000	0.86464	0.655000	0.94253	CCG		0.687	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4		
SRRM2	23524	broad.mit.edu	37	16	2812280	2812280	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr16:2812280C>T	ENST00000301740.8	+	11	2300	c.1751C>T	c.(1750-1752)tCc>tTc	p.S584F		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	584	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.S584F(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CGGGGCAGGTCCCGCTCTAGA	0.627																																					p.S584F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1751T	16						.						38.0	43.0	42.0					16																	2812280		2198	4300	6498	2752281	SO:0001583	missense	23524	exon11			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1751C>T	16.37:g.2812280C>T	ENSP00000301740:p.Ser584Phe	Somatic		Capture	Illumina HiSeq	Phase_I	2752281	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.762061	0.49468	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.27720	1.65	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000011	T	0.45034	0.1322	L	0.27053	0.805	0.48236	D	0.999615	D	0.71674	0.998	D	0.80764	0.994	T	0.37709	-0.9694	10	0.72032	D	0.01	-9.7929	17.7728	0.88497	0.0:1.0:0.0:0.0	.	584	Q9UQ35	SRRM2_HUMAN	F	584;584;549	ENSP00000301740:S584F	ENSP00000301740:S584F	S	+	2	0	SRRM2	2752281	0.976000	0.34144	0.985000	0.45067	0.897000	0.52465	2.429000	0.44758	2.801000	0.96364	0.655000	0.94253	TCC		0.627	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
CD2BP2	10421	broad.mit.edu	37	16	30365995	30365995	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr16:30365995T>G	ENST00000305596.3	-	2	183	c.8A>C	c.(7-9)aAg>aCg	p.K3T	RP11-347C12.10_ENST00000563252.1_lincRNA|CD2BP2_ENST00000569466.1_Missense_Mutation_p.K3T	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	3					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)	p.K3T(1)		breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						CACTTTCCTCTTTGGCATGAC	0.562																																					p.K3T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A8C	16						.						227.0	218.0	221.0					16																	30365995		2197	4300	6497	30273496	SO:0001583	missense	10421	exon2			AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.8A>C	16.37:g.30365995T>G	ENSP00000304903:p.Lys3Thr	Somatic		Capture	Illumina HiSeq	Phase_I	30273496	NM_006110	B2RDX2|Q9ULP2	Missense_Mutation	SNP	ENST00000305596.3	37	CCDS10675.1	.	.	.	.	.	.	.	.	.	.	T	32	5.161839	0.94727	.	.	ENSG00000169217	ENST00000305596	T	0.37752	1.18	5.24	5.24	0.73138	.	0.093317	0.64402	D	0.000001	T	0.58366	0.2117	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62699	-0.6799	10	0.87932	D	0	6.3474	12.6585	0.56801	0.0:0.0:0.0:1.0	.	3	O95400	CD2B2_HUMAN	T	3	ENSP00000304903:K3T	ENSP00000304903:K3T	K	-	2	0	CD2BP2	30273496	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	5.409000	0.66374	1.987000	0.57996	0.482000	0.46254	AAG		0.562	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255528.1	NM_006110	
CNTNAP4	85445	broad.mit.edu	37	16	76523611	76523611	+	Silent	SNP	C	C	T	rs148411005		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr16:76523611C>T	ENST00000476707.1	+	12	2059	c.1920C>T	c.(1918-1920)aaC>aaT	p.N640N	CNTNAP4_ENST00000377504.4_Silent_p.N588N|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Silent_p.N564N|CNTNAP4_ENST00000307431.8_Silent_p.N636N			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	637	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.N564N(1)|p.N636N(1)|p.N612N(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TACAGCACAACGGCTCTGACT	0.423																																					p.T637M												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C1910T	16						.	C	,	1,4395	2.1+/-5.4	0,1,2197	44.0	38.0	40.0		1910,1692	-1.7	1.0	16	dbSNP_134	40	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CNTNAP4	NM_033401.3,NM_138994.3	,	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	,	637/1309,564/1236	76523611	1,12995	2198	4300	6498	75081112	SO:0001819	synonymous_variant	85445	exon13			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1920C>T	16.37:g.76523611C>T		Somatic		Capture	Illumina HiSeq	Phase_I	75081112	NM_033401	E9PFZ6|Q86YZ7	Silent	SNP	ENST00000476707.1	37																																																																																					0.423	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
MON1B	22879	broad.mit.edu	37	16	77225392	77225392	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr16:77225392G>A	ENST00000248248.3	+	2	360	c.10G>A	c.(10-12)Gga>Aga	p.G4R	MON1B_ENST00000320859.6_Missense_Mutation_p.G4R|MON1B_ENST00000439557.2_Missense_Mutation_p.G4R|MON1B_ENST00000545553.1_Intron	NM_014940.2	NP_055755.1	Q7L1V2	MON1B_HUMAN	MON1 secretory trafficking family member B	4								p.G4R(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	17						GATGGAGGTCGGAGGAGACAC	0.617																																					p.G4R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10A	16						.						20.0	21.0	21.0					16																	77225392		2198	4299	6497	75782893	SO:0001583	missense	22879	exon2			BC024277	CCDS10925.1, CCDS67082.1, CCDS67083.1	16q23.1	2013-08-21	2013-08-21		ENSG00000103111	ENSG00000103111			25020	protein-coding gene	gene with protein product		608954	"""MON1 homolog B (yeast)"""			10048485	Standard	NM_014940		Approved	SAND2, HSRG1, KIAA0872	uc002fez.3	Q7L1V2	OTTHUMG00000137618	ENST00000248248.3:c.10G>A	16.37:g.77225392G>A	ENSP00000248248:p.Gly4Arg	Somatic		Capture	Illumina HiSeq	Phase_I	75782893	NM_014940	B4DDZ0|O94949	Missense_Mutation	SNP	ENST00000248248.3	37	CCDS10925.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.130012	0.77549	.	.	ENSG00000103111	ENST00000248248;ENST00000320859;ENST00000439557	.	.	.	4.23	3.27	0.37495	.	0.497718	0.15344	N	0.267362	T	0.30324	0.0761	N	0.08118	0	0.29271	N	0.870671	D;P	0.76494	0.999;0.66	P;B	0.59546	0.859;0.042	T	0.04930	-1.0917	9	0.45353	T	0.12	-3.8871	7.3064	0.26451	0.1176:0.0:0.8824:0.0	.	4;4	E7EW32;Q7L1V2	.;MON1B_HUMAN	R	4	.	ENSP00000248248:G4R	G	+	1	0	MON1B	75782893	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.206000	0.32321	2.341000	0.79615	0.448000	0.29417	GGA		0.617	MON1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269036.2	NM_014940	
MBTPS1	8720	broad.mit.edu	37	16	84097006	84097006	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr16:84097006G>A	ENST00000343411.3	-	19	2971	c.2476C>T	c.(2476-2478)Ccc>Tcc	p.P826S		NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	826					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.P826S(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CCCAAAATGGGGACGTTTTCA	0.463											OREG0023981	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P826S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2476T	16						.						85.0	81.0	82.0					16																	84097006		2200	4300	6500	82654507	SO:0001583	missense	8720	exon19			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.2476C>T	16.37:g.84097006G>A	ENSP00000344223:p.Pro826Ser	Somatic	1226	Capture	Illumina HiSeq	Phase_I	82654507	NM_003791	A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	ENST00000343411.3	37	CCDS10941.1	.	.	.	.	.	.	.	.	.	.	G	33	5.237279	0.95240	.	.	ENSG00000140943	ENST00000343411;ENST00000347334	T	0.18960	2.18	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.41190	0.1148	L	0.54323	1.7	0.80722	D	1	D	0.64830	0.994	P	0.60415	0.874	T	0.09818	-1.0657	10	0.59425	D	0.04	-24.4099	19.6238	0.95670	0.0:0.0:1.0:0.0	.	826	Q14703	MBTP1_HUMAN	S	826;271	ENSP00000344223:P826S	ENSP00000344223:P826S	P	-	1	0	MBTPS1	82654507	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.800000	0.99124	2.721000	0.93114	0.491000	0.48974	CCC		0.463	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
MYOCD	93649	broad.mit.edu	37	17	12666521	12666521	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr17:12666521C>T	ENST00000343344.4	+	13	2377	c.2377C>T	c.(2377-2379)Cag>Tag	p.Q793*	MYOCD_ENST00000425538.1_Nonsense_Mutation_p.Q841*|RP11-1090M7.1_ENST00000584772.1_RNA			Q8IZQ8	MYCD_HUMAN	myocardin	793					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.Q793*(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TTCAGGCAGCCAGATCCCCTT	0.493																																					p.Q841X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2521T	17						.						101.0	98.0	99.0					17																	12666521		2203	4300	6503	12607246	SO:0001587	stop_gained	93649	exon14			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2377C>T	17.37:g.12666521C>T	ENSP00000341835:p.Gln793*	Somatic		Capture	Illumina HiSeq	Phase_I	12607246	NM_001146312	Q5UBU5|Q8N7Q1	Nonsense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	C	33	5.266230	0.95399	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000443061	.	.	.	6.08	6.08	0.98989	.	0.233115	0.37761	N	0.001958	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-24.1157	19.4349	0.94788	0.0:1.0:0.0:0.0	.	.	.	.	X	517;841;793;503	.	ENSP00000341835:Q793X	Q	+	1	0	MYOCD	12607246	1.000000	0.71417	0.227000	0.23927	0.138000	0.21146	6.864000	0.75494	2.894000	0.99253	0.655000	0.94253	CAG		0.493	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
MAPT	4137	broad.mit.edu	37	17	44039727	44039727	+	Silent	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr17:44039727C>T	ENST00000571987.1	+	1	24	c.24C>T	c.(22-24)ttC>ttT	p.F8F	MAPT_ENST00000446361.3_Silent_p.F8F|MAPT_ENST00000340799.5_Silent_p.F8F|MAPT_ENST00000415613.2_Silent_p.F8F|MAPT_ENST00000535772.1_Silent_p.F8F|MAPT_ENST00000262410.5_Silent_p.F8F|MAPT_ENST00000347967.5_5'UTR|MAPT_ENST00000431008.3_Silent_p.F8F|MAPT_ENST00000344290.5_Silent_p.F8F|MAPT_ENST00000334239.8_Silent_p.F8F|MAPT_ENST00000570299.1_3'UTR|MAPT_ENST00000574436.1_Silent_p.F8F|MAPT_ENST00000420682.2_Silent_p.F8F|MAPT_ENST00000351559.5_Silent_p.F8F			P10636	TAU_HUMAN	microtubule-associated protein tau	8					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)	p.F8F(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	GCCAGGAGTTCGAAGTGATGG	0.582																																					p.F8F												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C24T	17						.						45.0	40.0	42.0					17																	44039727		2203	4300	6503	41395563	SO:0001819	synonymous_variant	4137	exon2			J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.24C>T	17.37:g.44039727C>T		Somatic		Capture	Illumina HiSeq	Phase_I	41395563	NM_016834	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Silent	SNP	ENST00000571987.1	37	CCDS11501.1																																																																																				0.582	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	NM_016835	
TP53	7157	broad.mit.edu	37	17	7578542	7578542	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr17:7578542G>A	ENST00000269305.4	-	5	577	c.388C>T	c.(388-390)Ctc>Ttc	p.L130F	TP53_ENST00000413465.2_Missense_Mutation_p.L130F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.L130F|TP53_ENST00000420246.2_Missense_Mutation_p.L130F|TP53_ENST00000445888.2_Missense_Mutation_p.L130F|TP53_ENST00000359597.4_Missense_Mutation_p.L130F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	130	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in a sporadic cancer; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L130F(16)|p.L130V(11)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.L37F(3)|p.Y126_N131delYSPALN(3)|p.L130fs*19(2)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.A129_L130insXX(1)|p.A129_N131delALN(1)|p.V73fs*9(1)|p.Y126fs*18(1)|p.L130fs*39(1)|p.L130fs*16(1)|p.A129_K132delALNK(1)|p.L130_M133delLNKM(1)|p.N131fs*27(1)|p.P13fs*18(1)|p.S127fs*36(1)|p.L130del(1)|p.L130fs*40(1)|p.L130fs*41(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATCTTGTTGAGGGCAGGGGAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.L130F	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0 	.	65	Substitution - Missense(30)|Deletion - In frame(14)|Deletion - Frameshift(9)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)	large_intestine(11)|breast(9)|ovary(6)|upper_aerodigestive_tract(5)|lung(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|prostate(4)|bone(4)|urinary_tract(3)|oesophagus(3)|adrenal_gland(2)|stomach(2)|biliary_tract(1)|skin(1)|liver(1)	c.C388T	17						.						45.0	46.0	45.0					17																	7578542		2203	4300	6503	7519267	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.388C>T	17.37:g.7578542G>A	ENSP00000269305:p.Leu130Phe	Somatic		Capture	Illumina HiSeq	Phase_I	7519267	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900016	0.72754	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99873	-7.38;-7.38;-7.38;-7.38;-7.38;-7.38;-7.38;-7.38	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	M	0.91300	3.195	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.988;1.0;0.999;0.96;1.0;1.0;0.999	D	0.96542	0.9401	10	0.87932	D	0	-29.0594	17.2272	0.86973	0.0:0.0:1.0:0.0	.	91;130;130;37;130;130;130	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	130;130;130;130;130;130;119;37;37;130	ENSP00000410739:L130F;ENSP00000352610:L130F;ENSP00000269305:L130F;ENSP00000398846:L130F;ENSP00000391127:L130F;ENSP00000391478:L130F;ENSP00000423862:L37F;ENSP00000424104:L130F	ENSP00000269305:L130F	L	-	1	0	TP53	7519267	1.000000	0.71417	0.930000	0.37139	0.764000	0.43329	5.638000	0.67861	2.733000	0.93635	0.655000	0.94253	CTC		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SDK2	54549	broad.mit.edu	37	17	71418495	71418495	+	Missense_Mutation	SNP	C	C	T	rs367622362		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr17:71418495C>T	ENST00000392650.3	-	15	1976	c.1976G>A	c.(1975-1977)cGc>cAc	p.R659H	SDK2_ENST00000388726.3_Missense_Mutation_p.R659H	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	659	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.R659H(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CTGGTAGGAGCGTGCAGGAAC	0.612																																					p.R659H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1976A	17						.	C	HIS/ARG	0,4406		0,0,2203	167.0	135.0	146.0		1976	5.1	0.5	17		146	1,8599	1.2+/-3.3	0,1,4299	no	missense	SDK2	NM_001144952.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	659/2173	71418495	1,13005	2203	4300	6503	68930090	SO:0001583	missense	54549	exon15			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1976G>A	17.37:g.71418495C>T	ENSP00000376421:p.Arg659His	Somatic		Capture	Illumina HiSeq	Phase_I	68930090	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.941592	0.92526	0.0	1.16E-4	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.58797	0.31;0.31	5.12	5.12	0.69794	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.72771	0.3502	L	0.58669	1.825	0.80722	D	1	D;D	0.67145	0.995;0.996	D;D	0.68621	0.931;0.959	T	0.74645	-0.3596	10	0.56958	D	0.05	.	18.1572	0.89696	0.0:1.0:0.0:0.0	.	659;659	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	H	283;659;659;659	ENSP00000376421:R659H;ENSP00000373378:R659H	ENSP00000324967:R659H	R	-	2	0	SDK2	68930090	1.000000	0.71417	0.532000	0.27989	0.923000	0.55619	7.421000	0.80204	2.373000	0.80994	0.462000	0.41574	CGC		0.612	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
TGIF1	7050	broad.mit.edu	37	18	3452223	3452223	+	Frame_Shift_Del	DEL	T	T	-	rs11571510|rs557543525|rs202189171	byFrequency	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr18:3452223delT	ENST00000330513.5	+	1	549	c.246delT	c.(244-246)cctfs	p.P85fs	TGIF1_ENST00000405385.3_Intron|TGIF1_ENST00000345133.5_Intron|TGIF1_ENST00000548489.2_Intron|TGIF1_ENST00000401449.1_Intron|TGIF1_ENST00000551402.1_Intron|TGIF1_ENST00000343820.5_Intron|TGIF1_ENST00000407501.2_Intron|TGIF1_ENST00000400167.2_5'Flank|TGIF1_ENST00000577543.1_Intron|TGIF1_ENST00000551541.1_Intron	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	85					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P83fs*51(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				GCGCCCCCCCTCCTCCACCGG	0.766													T|T|-|deletion	1280	0.255591	0.3419	0.2349	5008	,	,		10884	0.0109		0.4304	False		,,,				2504	0.226				p.P82fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.246delT	18						.						10.0	11.0	10.0					18																	3452223		2031	3818	5849	3442223	SO:0001589	frameshift_variant	7050	exon1			X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.246delT	18.37:g.3452223delT	ENSP00000327959:p.Pro85fs	Somatic		Capture	Illumina HiSeq	Phase_I	3442223	NM_170695	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Frame_Shift_Del	DEL	ENST00000330513.5	37	CCDS11834.1																																																																																				0.766	TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695	
U2AF2	11338	broad.mit.edu	37	19	56173905	56173906	+	Frame_Shift_Ins	INS	-	-	G	rs149491308		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr19:56173905_56173906insG	ENST00000308924.4	+	6	564_565	c.524_525insG	c.(523-528)ctggggfs	p.LG175fs	CTD-2537I9.12_ENST00000585940.1_RNA|CTD-2537I9.12_ENST00000589456.1_RNA|U2AF2_ENST00000450554.2_Frame_Shift_Ins_p.LG175fs|U2AF2_ENST00000590551.1_Frame_Shift_Ins_p.LG11fs			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	175	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CAGATGCGCCTGGGGGGGCTGA	0.604																																					p.L175fs												.	.	0			c.524_525insG	19						.		,	9,4255		0,9,2123					,	4.1	1.0			43	6,8248		0,6,4121	no	frameshift,frameshift	U2AF2	NM_007279.2,NM_001012478.1	,	0,15,6244	A1A1,A1R,RR		0.0727,0.2111,0.1198	,	,		15,12503				60865718	SO:0001589	frameshift_variant	11338	exon6			BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.531dupG	19.37:g.56173912_56173912dupG	ENSP00000307863:p.Leu175fs	None		Capture	Illumina HiSeq	Phase_I	60865717	NM_007279	Q96HC5	Frame_Shift_Ins	INS	ENST00000308924.4	37	CCDS12933.1																																																																																				0.604	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279	
OR10H5	284433	broad.mit.edu	37	19	15905323	15905323	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr19:15905323G>A	ENST00000308940.8	+	1	563	c.465G>A	c.(463-465)atG>atA	p.M155I		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M155I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						GCTTGGTCATGGGGATGGTGG	0.617																																					p.M155I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G465A	19						.						92.0	76.0	82.0					19																	15905323		2203	4300	6503	15766323	SO:0001583	missense	284433	exon1			AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.465G>A	19.37:g.15905323G>A	ENSP00000310704:p.Met155Ile	Somatic		Capture	Illumina HiSeq	Phase_I	15766323	NM_001004466	Q6IFJ0|Q96R60	Missense_Mutation	SNP	ENST00000308940.8	37	CCDS32940.1	.	.	.	.	.	.	.	.	.	.	.	0.018	-1.479365	0.01035	.	.	ENSG00000172519	ENST00000308940	T	0.34667	1.35	3.36	1.04	0.20106	GPCR, rhodopsin-like superfamily (1);	0.212564	0.32785	N	0.005660	T	0.12689	0.0308	N	0.05050	-0.12	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.23726	-1.0180	10	0.10902	T	0.67	.	3.9576	0.09396	0.1303:0.0:0.6376:0.2321	.	155	Q8NGA6	O10H5_HUMAN	I	155	ENSP00000310704:M155I	ENSP00000310704:M155I	M	+	3	0	OR10H5	15766323	0.994000	0.37717	0.715000	0.30552	0.065000	0.16274	1.176000	0.31957	0.206000	0.20587	-0.224000	0.12420	ATG		0.617	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1		
NFKBIB	4793	broad.mit.edu	37	19	39396103	39396103	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr19:39396103T>G	ENST00000313582.5	+	3	581	c.547T>G	c.(547-549)Tcc>Gcc	p.S183A	NFKBIB_ENST00000572515.1_Missense_Mutation_p.S183A|NFKBIB_ENST00000392079.3_Missense_Mutation_p.S151A	NM_002503.4	NP_002494.2	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta	183					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|signal transduction (GO:0007165)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.S183A(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	8	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GTACCCCGATTCCGACTTGGA	0.632																																					p.S183A	Pancreas(165;1492 2005 6979 7739 34483)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T547G	19						.						65.0	67.0	67.0					19																	39396103		2203	4300	6503	44087943	SO:0001583	missense	4793	exon3			L40407	CCDS12524.1, CCDS74362.1	19q13.1	2013-01-10				ENSG00000104825		"""Ankyrin repeat domain containing"""	7798	protein-coding gene	gene with protein product		604495				9763672	Standard	NM_002503		Approved	IKBB, TRIP9	uc002ojw.3	Q15653		ENST00000313582.5:c.547T>G	19.37:g.39396103T>G	ENSP00000312988:p.Ser183Ala	Somatic		Capture	Illumina HiSeq	Phase_I	44087943	NM_002503	A8K3F4|Q96BJ7	Missense_Mutation	SNP	ENST00000313582.5	37	CCDS12524.1	.	.	.	.	.	.	.	.	.	.	T	2.535	-0.307556	0.05458	.	.	ENSG00000104825	ENST00000509705;ENST00000313582;ENST00000392079	T;T	0.52754	0.65;0.91	4.12	-2.06	0.07298	Ankyrin repeat-containing domain (2);	0.595704	0.15115	N	0.279734	T	0.15349	0.0370	N	0.08118	0	0.09310	N	1	B;B;B	0.10296	0.0;0.003;0.0	B;B;B	0.09377	0.001;0.004;0.0	T	0.21861	-1.0233	10	0.02654	T	1	-3.647	0.7278	0.00951	0.1675:0.3662:0.1638:0.3025	.	206;151;183	Q59EM7;G5E9C2;Q15653	.;.;IKBB_HUMAN	A	206;183;151	ENSP00000312988:S183A;ENSP00000375929:S151A	ENSP00000312988:S183A	S	+	1	0	NFKBIB	44087943	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.125000	0.10579	-0.227000	0.09884	-0.899000	0.02877	TCC		0.632	NFKBIB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438155.1	NM_002503	
RPS16	6217	broad.mit.edu	37	19	39924368	39924368	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr19:39924368G>A	ENST00000251453.3	-	3	236	c.184C>T	c.(184-186)Cga>Tga	p.R62*	RPS16_ENST00000601655.1_Nonsense_Mutation_p.R45*|RPS16_ENST00000339471.4_Nonsense_Mutation_p.R62*|RPS16_ENST00000599539.1_Nonsense_Mutation_p.R62*	NM_001020.4	NP_001011.1	P62249	RS16_HUMAN	ribosomal protein S16	62					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.R62*(1)		central_nervous_system(1)|large_intestine(2)|lung(2)|skin(2)	7	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;4.14e-26)|all cancers(26;2.68e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCAGCAAATCGCTCCTTGCCG	0.547																																					p.R62X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C184T	19						.						73.0	58.0	63.0					19																	39924368		2203	4300	6503	44616208	SO:0001587	stop_gained	6217	exon3			M60854	CCDS12535.1	19q13.1	2011-04-05				ENSG00000105193		"""S ribosomal proteins"""	10396	protein-coding gene	gene with protein product	"""40S ribosomal protein S16"""	603675				2016298, 9582194	Standard	XM_005259137		Approved	S16	uc002olk.3	P62249		ENST00000251453.3:c.184C>T	19.37:g.39924368G>A	ENSP00000251453:p.Arg62*	Somatic		Capture	Illumina HiSeq	Phase_I	44616208	NM_001020	B2RDD5|P17008	Nonsense_Mutation	SNP	ENST00000251453.3	37	CCDS12535.1	.	.	.	.	.	.	.	.	.	.	G	35	5.559492	0.96514	.	.	ENSG00000105193	ENST00000251453;ENST00000339471	.	.	.	5.14	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.7383	12.9404	0.58340	0.0:0.0:0.8372:0.1628	.	.	.	.	X	62	.	.	R	-	1	2	RPS16	44616208	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.129000	0.64739	1.119000	0.41883	0.643000	0.83706	CGA		0.547	RPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464511.1	NM_001020	
GRIK5	2901	broad.mit.edu	37	19	42546716	42546716	+	Silent	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr19:42546716C>T	ENST00000262895.3	-	11	1460	c.1461G>A	c.(1459-1461)gaG>gaA	p.E487E	GRIK5_ENST00000593562.1_Silent_p.E487E|GRIK5_ENST00000301218.4_Silent_p.E487E	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	487					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.E487E(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				GGTTGATGAGCTCGCCAACCA	0.687																																					p.E487E												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1461A	19						.						44.0	48.0	46.0					19																	42546716		2202	4298	6500	47238556	SO:0001819	synonymous_variant	2901	exon11				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.1461G>A	19.37:g.42546716C>T		Somatic		Capture	Illumina HiSeq	Phase_I	47238556	NM_002088	Q8WWG8	Silent	SNP	ENST00000262895.3	37	CCDS12595.1																																																																																				0.687	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1		
ZNF808	388558	broad.mit.edu	37	19	53058577	53058577	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr19:53058577A>T	ENST00000359798.4	+	5	2588	c.2408A>T	c.(2407-2409)aAt>aTt	p.N803I		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	803					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		TTCGTGCGTAATTCATACCTG	0.398																																					p.N803I												.	.	0			c.A2408T	19						.						159.0	164.0	162.0					19																	53058577		2203	4300	6503	57750389	SO:0001583	missense	388558	exon5			CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.2408A>T	19.37:g.53058577A>T	ENSP00000352846:p.Asn803Ile	Somatic		Capture	Illumina HiSeq	Phase_I	57750389	NM_001039886	Q68CN7	Missense_Mutation	SNP	ENST00000359798.4	37	CCDS46167.1	.	.	.	.	.	.	.	.	.	.	.	4.123	0.020974	0.08006	.	.	ENSG00000198482	ENST00000359798	T	0.07688	3.17	1.58	-3.16	0.05217	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04497	0.0123	L	0.41079	1.255	0.09310	N	1	P	0.34815	0.47	B	0.24541	0.054	T	0.38457	-0.9660	9	0.21540	T	0.41	.	3.3603	0.07184	0.5342:0.0:0.2816:0.1842	.	803	Q8N4W9	ZN808_HUMAN	I	803	ENSP00000352846:N803I	ENSP00000352846:N803I	N	+	2	0	ZNF808	57750389	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-3.308000	0.00518	-0.969000	0.03573	0.260000	0.18958	AAT		0.398	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
ZNF628	89887	broad.mit.edu	37	19	55995322	55995322	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr19:55995322A>T	ENST00000598519.1	+	3	3315	c.2762A>T	c.(2761-2763)gAt>gTt	p.D921V	NAT14_ENST00000587400.1_5'Flank|NAT14_ENST00000205194.4_5'Flank|NAT14_ENST00000591590.1_5'Flank|ZNF628_ENST00000391718.2_Missense_Mutation_p.D917V			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	921					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D917V(1)		endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		GTGGTCCAGGATGTCCTCTTT	0.652																																					p.D917V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2750T	19						.						43.0	32.0	36.0					19																	55995322		2201	4299	6500	60687134	SO:0001583	missense	89887	exon3			AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.2762A>T	19.37:g.55995322A>T	ENSP00000469591:p.Asp921Val	Somatic		Capture	Illumina HiSeq	Phase_I	60687134	NM_033113	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	.	.	.	.	.	.	.	.	.	.	.	13.78	2.339452	0.41398	.	.	ENSG00000197483	ENST00000391718	T	0.13196	2.61	3.81	3.81	0.43845	.	0.000000	0.48286	U	0.000191	T	0.13670	0.0331	N	0.19112	0.55	0.38756	D	0.954228	D	0.61080	0.989	P	0.50825	0.651	T	0.06844	-1.0804	10	0.87932	D	0	.	10.8296	0.46652	1.0:0.0:0.0:0.0	.	917	Q5EBL2	ZN628_HUMAN	V	917	ENSP00000375598:D917V	ENSP00000375598:D917V	D	+	2	0	ZNF628	60687134	0.610000	0.26983	0.977000	0.42913	0.836000	0.47400	1.102000	0.31050	1.507000	0.48752	0.240000	0.17902	GAT		0.652	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
TNFSF14	8740	broad.mit.edu	37	19	6664993	6664993	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr19:6664993G>A	ENST00000599359.1	-	5	1048	c.667C>T	c.(667-669)Cgc>Tgc	p.R223C	TNFSF14_ENST00000326176.9_Missense_Mutation_p.R187C|TNFSF14_ENST00000245912.3_Missense_Mutation_p.R187C			O43557	TNF14_HUMAN	tumor necrosis factor (ligand) superfamily, member 14	223					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of T cell chemotaxis (GO:0010820)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|receptor binding (GO:0005102)	p.R223C(1)		breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18						CGAACCAGGCGTTCATCCAGC	0.612																																					p.R223C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C667T	19						.						185.0	152.0	163.0					19																	6664993		2203	4300	6503	6615993	SO:0001583	missense	8740	exon5			AF036581	CCDS12171.1, CCDS45939.1	19p13.3	2008-02-05				ENSG00000125735		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11930	protein-coding gene	gene with protein product		604520				9462508	Standard	NM_172014		Approved	LIGHT, LTg, HVEM-L, CD258	uc002mfk.2	O43557		ENST00000599359.1:c.667C>T	19.37:g.6664993G>A	ENSP00000469049:p.Arg223Cys	Somatic		Capture	Illumina HiSeq	Phase_I	6615993	NM_003807	A8K7M2|C9J5H4|O75476|Q6FHA1|Q8WVF8|Q96LD2	Missense_Mutation	SNP	ENST00000599359.1	37	CCDS12171.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.763719	0.31228	.	.	ENSG00000125735	ENST00000245912;ENST00000326176	T	0.31510	1.49	4.46	-0.824	0.10812	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	1.337180	0.05076	N	0.482571	T	0.40743	0.1129	M	0.64997	1.995	0.09310	N	0.999991	D;D	0.71674	0.998;0.998	P;P	0.54965	0.765;0.653	T	0.29701	-1.0003	10	0.66056	D	0.02	-15.216	3.0044	0.06024	0.089:0.2223:0.392:0.2967	.	223;187	O43557;O43557-2	TNF14_HUMAN;.	C	223;187	ENSP00000326940:R187C	ENSP00000245912:R223C	R	-	1	0	TNFSF14	6615993	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	0.442000	0.21628	0.021000	0.15133	0.561000	0.74099	CGC		0.612	TNFSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457863.1		
NLRP9	338321	broad.mit.edu	37	19	56243634	56243634	+	Silent	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr19:56243634C>T	ENST00000332836.2	-	2	1590	c.1563G>A	c.(1561-1563)caG>caA	p.Q521Q		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	521						cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.Q521Q(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		GGGTTATTTCCTGCTTTAGGT	0.413																																					p.Q521Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1563A	19						.						72.0	73.0	72.0					19																	56243634		2203	4300	6503	60935446	SO:0001819	synonymous_variant	338321	exon2			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1563G>A	19.37:g.56243634C>T		Somatic		Capture	Illumina HiSeq	Phase_I	60935446	NM_176820	B2RN12|Q86W27	Silent	SNP	ENST00000332836.2	37	CCDS12934.1																																																																																				0.413	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
RAB25	57111	broad.mit.edu	37	1	156035728	156035728	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr1:156035728G>A	ENST00000361084.5	+	2	311	c.70G>A	c.(70-72)Ggg>Agg	p.G24R	RAB25_ENST00000487325.1_Intron	NM_020387.2	NP_065120.2	P57735	RAB25_HUMAN	RAB25, member RAS oncogene family	24					positive regulation of cell proliferation (GO:0008284)|protein transport (GO:0015031)|pseudopodium organization (GO:0031268)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)	p.G28R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	Hepatocellular(266;0.158)|all_neural(408;0.195)					ATCAGGTGTGGGGAAGACCAA	0.587																																					p.G24R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G70A	1						.						78.0	80.0	79.0					1																	156035728		2136	4254	6390	154302352	SO:0001583	missense	57111	exon2			AF083124	CCDS41413.1	1q22	2008-07-03			ENSG00000132698	ENSG00000132698		"""RAB, member RAS oncogene"""	18238	protein-coding gene	gene with protein product		612942				11697911	Standard	NM_020387		Approved	CATX-8	uc001fnc.3	P57735	OTTHUMG00000017457	ENST00000361084.5:c.70G>A	1.37:g.156035728G>A	ENSP00000354376:p.Gly24Arg	Somatic		Capture	Illumina HiSeq	Phase_I	154302352	NM_020387	Q5VYA2|Q8NG24|Q96GB1|Q9BT12	Missense_Mutation	SNP	ENST00000361084.5	37	CCDS41413.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.921376	0.92249	.	.	ENSG00000132698	ENST00000361084	D	0.99418	-5.87	5.3	4.38	0.52667	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.99829	0.9923	H	0.99939	4.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96408	0.9302	10	0.87932	D	0	.	14.2491	0.66007	0.0:0.0:0.85:0.15	.	24	P57735	RAB25_HUMAN	R	24	ENSP00000354376:G24R	ENSP00000354376:G24R	G	+	1	0	RAB25	154302352	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.525000	0.98039	1.462000	0.47948	0.655000	0.94253	GGG		0.587	RAB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046185.1		
FCRL3	115352	broad.mit.edu	37	1	157667156	157667156	+	Silent	SNP	G	G	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr1:157667156G>T	ENST00000368184.3	-	6	909	c.618C>A	c.(616-618)ccC>ccA	p.P206P	FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Silent_p.P206P|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	206	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P206P(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					TCAGGGTCATGGGACTCCCCT	0.547																																					p.P206P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C618A	1						.						68.0	72.0	71.0					1																	157667156		2203	4300	6503	155933780	SO:0001819	synonymous_variant	115352	exon6			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.618C>A	1.37:g.157667156G>T		Somatic		Capture	Illumina HiSeq	Phase_I	155933780	NM_052939	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	ENST00000368184.3	37	CCDS1167.1																																																																																				0.547	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939	
FCRL3	115352	broad.mit.edu	37	1	157667561	157667561	+	Silent	SNP	G	G	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr1:157667561G>T	ENST00000368184.3	-	5	738	c.447C>A	c.(445-447)atC>atA	p.I149I	FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Silent_p.I149I|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	149	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I149I(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					AATTCACTGTGATCTTCTCTA	0.338																																					p.I149I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C447A	1						.						181.0	183.0	182.0					1																	157667561		2203	4300	6503	155934185	SO:0001819	synonymous_variant	115352	exon5			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.447C>A	1.37:g.157667561G>T		Somatic		Capture	Illumina HiSeq	Phase_I	155934185	NM_052939	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	ENST00000368184.3	37	CCDS1167.1																																																																																				0.338	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939	
CENPF	1063	broad.mit.edu	37	1	214816319	214816319	+	Silent	SNP	G	G	A	rs564882822		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr1:214816319G>A	ENST00000366955.3	+	12	4806	c.4638G>A	c.(4636-4638)gcG>gcA	p.A1546A		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1642	2 X 96 AA approximate tandem repeats.		Missing. {ECO:0000269|PubMed:7651420}.		cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.A1546A(2)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CGGCCCCAGCGAAGGGTGTTG	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20317	0.0		0.0	False		,,,				2504	0.0				p.A1546A	Colon(80;575 1284 11000 14801 43496)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G4638A	1						.						43.0	46.0	45.0					1																	214816319		2203	4300	6503	212882942	SO:0001819	synonymous_variant	1063	exon12			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.4638G>A	1.37:g.214816319G>A		Somatic		Capture	Illumina HiSeq	Phase_I	212882942	NM_016343	Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	CCDS31023.1																																																																																				0.493	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
TAF1A	9015	broad.mit.edu	37	1	222734727	222734727	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr1:222734727C>T	ENST00000352967.4	-	10	1407	c.1219G>A	c.(1219-1221)Gct>Act	p.A407T	TAF1A_ENST00000391882.1_Missense_Mutation_p.A293T|TAF1A_ENST00000350027.4_Missense_Mutation_p.A407T|TAF1A_ENST00000366890.1_Missense_Mutation_p.A293T	NM_005681.3	NP_005672.1	Q15573	TAF1A_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa	407					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA binding (GO:0003677)	p.A407T(1)		kidney(3)|large_intestine(3)|lung(11)|urinary_tract(1)	18				GBM - Glioblastoma multiforme(131;0.0186)		AGTAAACCAGCCACAAAAGCT	0.398																																					p.A407T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1219A	1						.						92.0	99.0	97.0					1																	222734727		2203	4300	6503	220801350	SO:0001583	missense	9015	exon10			L39060	CCDS1531.1, CCDS1532.1	1q42	2008-02-05	2002-08-29		ENSG00000143498	ENSG00000143498			11532	protein-coding gene	gene with protein product		604903	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kD"""			7801123	Standard	NM_005681		Approved	TAFI48, SL1	uc009xdz.2	Q15573	OTTHUMG00000037544	ENST00000352967.4:c.1219G>A	1.37:g.222734727C>T	ENSP00000327072:p.Ala407Thr	Somatic		Capture	Illumina HiSeq	Phase_I	220801350	NM_005681	B2RDZ8|D3DTB7|Q9NWA1	Missense_Mutation	SNP	ENST00000352967.4	37	CCDS1531.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.576025	0.45902	.	.	ENSG00000143498	ENST00000366890;ENST00000350027;ENST00000352967;ENST00000391882	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.97	4.99	0.66335	.	0.285570	0.38436	N	0.001684	T	0.65491	0.2696	M	0.77103	2.36	0.80722	D	1	P	0.51351	0.944	P	0.50825	0.651	T	0.70769	-0.4782	10	0.72032	D	0.01	0.485	16.9448	0.86228	0.1362:0.8638:0.0:0.0	.	407	Q15573	TAF1A_HUMAN	T	293;407;407;293	ENSP00000355856:A293T;ENSP00000339976:A407T;ENSP00000327072:A407T;ENSP00000375754:A293T	ENSP00000339976:A407T	A	-	1	0	TAF1A	220801350	1.000000	0.71417	1.000000	0.80357	0.020000	0.10135	3.803000	0.55560	2.836000	0.97738	0.655000	0.94253	GCT		0.398	TAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091493.2	NM_005681	
CSMD2	114784	broad.mit.edu	37	1	34068024	34068024	+	Missense_Mutation	SNP	G	G	A	rs144426100		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr1:34068024G>A	ENST00000373380.1	-	22	3494	c.3274C>T	c.(3274-3276)Cgc>Tgc	p.R1092C	CSMD2_ENST00000373388.2_Missense_Mutation_p.R318C|CSMD2_ENST00000489419.1_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.R2219C|CSMD2_ENST00000373377.1_Missense_Mutation_p.R318C			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2221	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R2221C(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AGGTTGAGGCGGACGCCATGG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18135	0.0		0.001	False		,,,				2504	0.0				p.R2221C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6661T	1						.						71.0	71.0	71.0					1																	34068024		2203	4300	6503	33840611	SO:0001583	missense	114784	exon44			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.3274C>T	1.37:g.34068024G>A	ENSP00000362478:p.Arg1092Cys	Somatic		Capture	Illumina HiSeq	Phase_I	33840611	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	20.1	3.939725	0.73557	.	.	ENSG00000121904	ENST00000373381;ENST00000373380;ENST00000373377;ENST00000373388	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.29	4.38	0.52667	CUB (5);	0.777035	0.12272	N	0.483686	T	0.38983	0.1061	M	0.81614	2.55	0.39572	D	0.969293	D;D;P	0.55605	0.972;0.96;0.921	P;P;P	0.51453	0.655;0.67;0.67	T	0.30327	-0.9982	10	0.42905	T	0.14	.	12.7293	0.57189	0.0791:0.0:0.9209:0.0	.	1092;2221;2219	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	C	2219;1092;318;318	ENSP00000362479:R2219C;ENSP00000362478:R1092C;ENSP00000362475:R318C;ENSP00000362486:R318C	ENSP00000241312:R2221C	R	-	1	0	CSMD2	33840611	1.000000	0.71417	0.686000	0.30086	0.850000	0.48378	4.682000	0.61671	1.231000	0.43661	0.655000	0.94253	CGC		0.577	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
ZMYM4	9202	broad.mit.edu	37	1	35859278	35859278	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr1:35859278C>T	ENST00000314607.6	+	18	2929	c.2849C>T	c.(2848-2850)cCc>cTc	p.P950L	ZMYM4_ENST00000373297.2_Missense_Mutation_p.P861L	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	950					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.P950L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTATGCAAACCCATCACACAG	0.383																																					p.P950L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2849T	1						.						112.0	101.0	105.0					1																	35859278		2203	4300	6503	35631865	SO:0001583	missense	9202	exon18			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2849C>T	1.37:g.35859278C>T	ENSP00000322915:p.Pro950Leu	Somatic		Capture	Illumina HiSeq	Phase_I	35631865	NM_005095	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	.	.	.	.	.	.	.	.	.	.	C	29.4	4.999139	0.93227	.	.	ENSG00000146463	ENST00000314607;ENST00000373297	T;T	0.48522	0.93;0.81	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.71443	0.3340	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.74813	-0.3537	10	0.87932	D	0	-7.1048	19.2728	0.94018	0.0:1.0:0.0:0.0	.	950	Q5VZL5	ZMYM4_HUMAN	L	950;861	ENSP00000322915:P950L;ENSP00000362394:P861L	ENSP00000322915:P950L	P	+	2	0	ZMYM4	35631865	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.681000	0.74523	2.651000	0.90000	0.585000	0.79938	CCC		0.383	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
KANK4	163782	broad.mit.edu	37	1	62739027	62739027	+	Silent	SNP	C	C	T	rs192453281	byFrequency	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr1:62739027C>T	ENST00000371153.4	-	3	2127	c.1749G>A	c.(1747-1749)ccG>ccA	p.P583P	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	583						cytoplasm (GO:0005737)		p.P583P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						TGGCCAGCTCCGGGTACCCAT	0.627													C|||	10	0.00199681	0.0	0.0	5008	,	,		16366	0.003		0.0	False		,,,				2504	0.0072				p.P583P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1749A	1						.						35.0	35.0	35.0					1																	62739027		2203	4300	6503	62511615	SO:0001819	synonymous_variant	163782	exon3			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.1749G>A	1.37:g.62739027C>T		Somatic		Capture	Illumina HiSeq	Phase_I	62511615	NM_181712	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Silent	SNP	ENST00000371153.4	37	CCDS620.1																																																																																				0.627	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
PTBP2	58155	broad.mit.edu	37	1	97189121	97189121	+	Splice_Site	SNP	A	A	G			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr1:97189121A>G	ENST00000426398.2	+	2	53	c.10A>G	c.(10-12)Atc>Gtc	p.I4V	PTBP2_ENST00000370198.1_Splice_Site_p.I4V|PTBP2_ENST00000609116.1_Splice_Site_p.I4V|PTBP2_ENST00000394184.3_5'UTR|PTBP2_ENST00000541987.1_5'UTR|PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000370197.1_Splice_Site_p.I4V	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	4					mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.I4V(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		TCTTTGCAGAATCGTCACTGA	0.338																																					p.I4V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A10G	1						.						181.0	191.0	188.0					1																	97189121		2203	4300	6503	96961709	SO:0001630	splice_region_variant	58155	exon2			AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.9-1A>G	1.37:g.97189121A>G		Somatic		Capture	Illumina HiSeq	Phase_I	96961709	NM_021190	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	ENST00000426398.2	37	CCDS754.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.429122	0.43122	.	.	ENSG00000117569	ENST00000236228;ENST00000370198;ENST00000370197;ENST00000426398	T;T;T;T	0.44083	0.93;0.96;0.96;0.93	5.35	5.35	0.76521	.	0.270736	0.33670	N	0.004668	T	0.23451	0.0567	L	0.45228	1.405	0.80722	D	1	B;B;B;B;B;B	0.19706	0.009;0.038;0.002;0.004;0.004;0.007	B;B;B;B;B;B	0.26310	0.02;0.068;0.02;0.03;0.044;0.024	T	0.08597	-1.0714	10	0.42905	T	0.14	.	12.855	0.57880	1.0:0.0:0.0:0.0	.	12;4;4;4;4;26	B4DSU5;Q9UKA9-4;Q9UKA9;Q9UKA9-2;Q9UKA9-3;Q59G43	.;.;PTBP2_HUMAN;.;.;.	V	4	ENSP00000236228:I4V;ENSP00000359217:I4V;ENSP00000359216:I4V;ENSP00000412788:I4V	ENSP00000236228:I4V	I	+	1	0	PTBP2	96961709	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	4.709000	0.61867	2.016000	0.59253	0.528000	0.53228	ATC		0.338	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029453.1		Missense_Mutation
NVL	4931	broad.mit.edu	37	1	224424254	224424254	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr1:224424254C>T	ENST00000281701.6	-	20	2579	c.2320G>A	c.(2320-2322)Gta>Ata	p.V774I	NVL_ENST00000482491.1_Missense_Mutation_p.V498I|NVL_ENST00000469075.1_Missense_Mutation_p.V683I|NVL_ENST00000361463.3_3'UTR|NVL_ENST00000340871.4_Missense_Mutation_p.V585I|NVL_ENST00000391875.2_Missense_Mutation_p.V668I	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	774						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.V774I(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		TCCAAATTTACATCTGCATCC	0.408																																					p.V774I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2320A	1						.						153.0	144.0	147.0					1																	224424254		2203	4300	6503	222490877	SO:0001583	missense	4931	exon20			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.2320G>A	1.37:g.224424254C>T	ENSP00000281701:p.Val774Ile	Somatic		Capture	Illumina HiSeq	Phase_I	222490877	NM_002533	B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	ENST00000281701.6	37	CCDS1541.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.04|18.04	3.535617|3.535617	0.64972|0.64972	.|.	.|.	ENSG00000143748|ENSG00000143748	ENST00000469968|ENST00000281701;ENST00000391875;ENST00000469075;ENST00000482491;ENST00000340871	.|D;D;D;D;D	.|0.94931	.|-3.56;-3.56;-3.56;-3.56;-3.56	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93409|0.93409	0.7898|0.7898	L|L	0.49640|0.49640	1.575|1.575	0.80722|0.80722	D|D	1|1	.|B;P;P	.|0.48694	.|0.426;0.683;0.914	.|B;B;P	.|0.46076	.|0.372;0.284;0.503	D|D	0.93215|0.93215	0.6603|0.6603	5|10	.|0.51188	.|T	.|0.08	-18.756|-18.756	15.5999|15.5999	0.76616|0.76616	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|585;683;774	.|B4DMC4;B4DP98;O15381	.|.;.;NVL_HUMAN	Y|I	656|774;668;683;498;585	.|ENSP00000281701:V774I;ENSP00000375747:V668I;ENSP00000417826:V683I;ENSP00000417213:V498I;ENSP00000341362:V585I	.|ENSP00000281701:V774I	C|V	-|-	2|1	0|0	NVL|NVL	222490877|222490877	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.993000|0.993000	0.82548|0.82548	2.896000|2.896000	0.48656|0.48656	2.831000|2.831000	0.97527|0.97527	0.655000|0.655000	0.94253|0.94253	TGT|GTA		0.408	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533	
SON	6651	broad.mit.edu	37	21	34924413	34924413	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr21:34924413C>T	ENST00000356577.4	+	3	3351	c.2876C>T	c.(2875-2877)aCt>aTt	p.T959I	SON_ENST00000300278.4_Missense_Mutation_p.T959I|SON_ENST00000290239.6_Missense_Mutation_p.T959I|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.T959I	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	959	11 X 7 AA tandem repeats of [DR]-P-Y-R- [LI][AG][QHP].				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.T959I(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TACAGACTAACTCCTGATCCC	0.483																																					p.T959I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2876T	21						.						128.0	112.0	118.0					21																	34924413		2203	4300	6503	33846283	SO:0001583	missense	6651	exon3			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.2876C>T	21.37:g.34924413C>T	ENSP00000348984:p.Thr959Ile	Somatic		Capture	Illumina HiSeq	Phase_I	33846283	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400051	0.62177	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.12147	2.9;2.9;2.89;2.71	6.01	6.01	0.97437	.	0.112774	0.40385	N	0.001118	T	0.28134	0.0694	L	0.44542	1.39	0.36803	D	0.885454	D;D;P	0.57571	0.965;0.98;0.939	P;P;P	0.58721	0.703;0.844;0.617	T	0.01202	-1.1420	10	0.72032	D	0.01	.	18.0754	0.89425	0.0:1.0:0.0:0.0	.	959;959;959	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	I	959	ENSP00000348984:T959I;ENSP00000290239:T959I;ENSP00000300278:T959I;ENSP00000371095:T959I	ENSP00000290239:T959I	T	+	2	0	SON	33846283	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.303000	0.51858	2.873000	0.98535	0.644000	0.83932	ACT		0.483	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
CECR2	27443	broad.mit.edu	37	22	18021605	18021605	+	Silent	SNP	G	G	A	rs540911813		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr22:18021605G>A	ENST00000400585.2	+	15	1911	c.1473G>A	c.(1471-1473)ccG>ccA	p.P491P	CECR2_ENST00000262608.8_Silent_p.P633P|CECR2_ENST00000400573.5_Silent_p.P632P			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	674	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)		p.P632P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		CTGGAGTCCCGGAGCCACACC	0.602																																					p.R633Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1898A	22						.						32.0	35.0	34.0					22																	18021605		1934	4152	6086	16401605	SO:0001819	synonymous_variant	27443	exon14			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.1473G>A	22.37:g.18021605G>A		Somatic		Capture	Illumina HiSeq	Phase_I	16401605	NM_031413	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	ENST00000400585.2	37																																																																																					0.602	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	NM_031413	
CELSR1	9620	broad.mit.edu	37	22	46807530	46807530	+	Missense_Mutation	SNP	C	C	T	rs375003533		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr22:46807530C>T	ENST00000262738.3	-	6	4737	c.4738G>A	c.(4738-4740)Gct>Act	p.A1580T		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1580	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)	p.A1580T(1)		breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CCCTGGGCAGCGCAGCTGTAG	0.622																																					p.A1580T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4738A	22						.	C	THR/ALA	0,4406		0,0,2203	81.0	69.0	73.0		4738	4.4	0.5	22		73	1,8599	1.2+/-3.3	0,1,4299	no	missense	CELSR1	NM_014246.1	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1580/3015	46807530	1,13005	2203	4300	6503	45186194	SO:0001583	missense	9620	exon6			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4738G>A	22.37:g.46807530C>T	ENSP00000262738:p.Ala1580Thr	Somatic		Capture	Illumina HiSeq	Phase_I	45186194	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449205	0.84101	0.0	1.16E-4	ENSG00000075275	ENST00000262738	T	0.70399	-0.48	4.43	4.43	0.53597	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.64402	U	0.000003	D	0.84320	0.5446	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.86000	0.1494	10	0.49607	T	0.09	.	17.0436	0.86496	0.0:1.0:0.0:0.0	.	1580	Q9NYQ6	CELR1_HUMAN	T	1580	ENSP00000262738:A1580T	ENSP00000262738:A1580T	A	-	1	0	CELSR1	45186194	0.998000	0.40836	0.455000	0.27031	0.914000	0.54420	2.728000	0.47319	2.178000	0.69098	0.655000	0.94253	GCT		0.622	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
EPB41L5	57669	broad.mit.edu	37	2	120925527	120925527	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr2:120925527A>T	ENST00000263713.5	+	24	2293	c.2079A>T	c.(2077-2079)aaA>aaT	p.K693N	EPB41L5_ENST00000488691.1_3'UTR|EPB41L5_ENST00000443902.2_Intron|EPB41L5_ENST00000452780.1_Missense_Mutation_p.K692N	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	693					actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)		p.K693N(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						ATGGTAATAAAGATGGAATCT	0.453																																					p.K693N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2079T	2						.						143.0	125.0	131.0					2																	120925527		2203	4300	6503	120641997	SO:0001583	missense	57669	exon24			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.2079A>T	2.37:g.120925527A>T	ENSP00000263713:p.Lys693Asn	Somatic		Capture	Illumina HiSeq	Phase_I	120641997	NM_020909	Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	ENST00000263713.5	37	CCDS2130.1	.	.	.	.	.	.	.	.	.	.	A	8.396	0.840805	0.16891	.	.	ENSG00000115109	ENST00000263713;ENST00000452780	D;D	0.81499	-1.5;-1.5	4.98	-4.17	0.03857	.	1.085870	0.07263	N	0.867762	T	0.61085	0.2319	N	0.19112	0.55	0.09310	N	1	B;B	0.23990	0.095;0.023	B;B	0.18871	0.023;0.007	T	0.43048	-0.9415	10	0.26408	T	0.33	.	5.3016	0.15781	0.3474:0.2996:0.353:0.0	.	692;693	Q9HCM4-3;Q9HCM4	.;E41L5_HUMAN	N	693;692	ENSP00000263713:K693N;ENSP00000390439:K692N	ENSP00000263713:K693N	K	+	3	2	EPB41L5	120641997	0.003000	0.15002	0.000000	0.03702	0.021000	0.10359	-0.160000	0.10041	-0.661000	0.05345	-2.075000	0.00382	AAA		0.453	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909	
TUBA3D	113457	broad.mit.edu	37	2	132237994	132237994	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr2:132237994G>A	ENST00000321253.6	+	4	835	c.728G>A	c.(727-729)cGa>cAa	p.R243Q		NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	243					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R243Q(2)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		GCCTCCCTGCGATTTGATGGG	0.567																																					p.R243Q	Ovarian(137;2059 2432 35543 39401)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G728A	2						.						87.0	119.0	109.0					2																	132237994		1982	4281	6263	131954464	SO:0001583	missense	113457	exon4			K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.728G>A	2.37:g.132237994G>A	ENSP00000326042:p.Arg243Gln	Somatic		Capture	Illumina HiSeq	Phase_I	131954464	NM_080386	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000321253.6	37	CCDS33290.1	.	.	.	.	.	.	.	.	.	.	g	7.395	0.631548	0.14322	.	.	ENSG00000075886	ENST00000321253;ENST00000341158	T	0.74209	-0.82	2.24	-1.18	0.09617	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.44688	U	0.000440	D	0.83792	0.5331	M	0.91249	3.19	0.31925	N	0.612915	D	0.89917	1.0	D	0.70016	0.967	T	0.79952	-0.1586	10	0.72032	D	0.01	.	4.0589	0.09829	0.2665:0.1951:0.5383:0.0	.	243	Q13748	TBA3C_HUMAN	Q	243	ENSP00000326042:R243Q	ENSP00000326042:R243Q	R	+	2	0	TUBA3D	131954464	0.879000	0.30193	0.614000	0.29051	0.020000	0.10135	3.620000	0.54203	-0.518000	0.06452	-1.031000	0.02408	CGA		0.567	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331800.2	NM_080386	
THSD7B	80731	broad.mit.edu	37	2	137814212	137814212	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr2:137814212G>A	ENST00000409968.1	+	3	540	c.362G>A	c.(361-363)cGc>cAc	p.R121H	THSD7B_ENST00000272643.3_Missense_Mutation_p.R121H|THSD7B_ENST00000543459.1_5'Flank|THSD7B_ENST00000413152.2_Missense_Mutation_p.R90H			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	121	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.R121H(2)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCTTACGCTCGCGGTGAAGTC	0.542																																					p.R90H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G269A	2						.						75.0	82.0	79.0					2																	137814212		2061	4206	6267	137530682	SO:0001583	missense	80731	exon2					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.362G>A	2.37:g.137814212G>A	ENSP00000387145:p.Arg121His	Somatic		Capture	Illumina HiSeq	Phase_I	137530682	NM_001080427		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	g	5.876	0.345696	0.11126	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.23754	2.43;2.29;1.89	6.07	1.07	0.20283	.	0.972227	0.08512	N	0.934707	T	0.07818	0.0196	N	0.01705	-0.755	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.36286	-0.9754	9	.	.	.	.	1.4505	0.02374	0.5177:0.1143:0.2233:0.1447	.	90	C9JKN6	.	H	121;121;90	ENSP00000387145:R121H;ENSP00000272643:R121H;ENSP00000413841:R90H	.	R	+	2	0	THSD7B	137530682	0.000000	0.05858	0.002000	0.10522	0.135000	0.20990	0.037000	0.13840	-0.046000	0.13446	-0.385000	0.06624	CGC		0.542	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
ZEB2	9839	broad.mit.edu	37	2	145156878	145156878	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr2:145156878C>T	ENST00000558170.2	-	8	3060	c.1876G>A	c.(1876-1878)Gga>Aga	p.G626R	ZEB2_ENST00000409487.3_Missense_Mutation_p.G626R|ZEB2_ENST00000539609.3_Missense_Mutation_p.G602R|ZEB2_ENST00000303660.4_Missense_Mutation_p.G626R	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	626					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.G626R(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		ACAAAAACTCCGGCTTTGTTG	0.453																																					p.G602R	Melanoma(33;1235 1264 5755 16332)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1804A	2						.						70.0	71.0	71.0					2																	145156878		2203	4300	6503	144873348	SO:0001583	missense	9839	exon7			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.1876G>A	2.37:g.145156878C>T	ENSP00000454157:p.Gly626Arg	Somatic		Capture	Illumina HiSeq	Phase_I	144873348	NM_001171653	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076660	0.36662	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902	T;T;T;T	0.20881	2.04;2.04;2.04;2.28	5.75	5.75	0.90469	.	0.303746	0.36778	N	0.002402	T	0.32912	0.0845	L	0.29908	0.895	0.42123	D	0.991434	D;P;P;P	0.57571	0.98;0.63;0.813;0.895	P;B;B;B	0.57057	0.812;0.059;0.081;0.336	T	0.02975	-1.1087	10	0.72032	D	0.01	-7.0638	19.9507	0.97198	0.0:1.0:0.0:0.0	.	602;491;625;626	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	R	602;626;626;626	ENSP00000443792:G602R;ENSP00000302501:G626R;ENSP00000386854:G626R;ENSP00000395496:G626R	ENSP00000302501:G626R	G	-	1	0	ZEB2	144873348	0.997000	0.39634	0.997000	0.53966	0.999000	0.98932	3.695000	0.54749	2.705000	0.92388	0.655000	0.94253	GGA		0.453	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
SCN2A	6326	broad.mit.edu	37	2	166165900	166165900	+	Missense_Mutation	SNP	C	C	T	rs149024364		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr2:166165900C>T	ENST00000375437.2	+	6	934	c.644C>T	c.(643-645)gCg>gTg	p.A215V	SCN2A_ENST00000357398.3_Intron|SCN2A_ENST00000375427.2_Intron|SCN2A_ENST00000283256.6_Missense_Mutation_p.A215V	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	215					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.A215V(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AATGTCTCAGCGTTGAGAACA	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		18784	0.001		0.0	False		,,,				2504	0.0				p.A215V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C644T	2						.						99.0	91.0	94.0					2																	166165900		2203	4299	6502	165874146	SO:0001583	missense	6326	exon6			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.644C>T	2.37:g.166165900C>T	ENSP00000364586:p.Ala215Val	Somatic		Capture	Illumina HiSeq	Phase_I	165874146	NM_021007	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	18.47	3.630478	0.67015	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000283256	D;D;D	0.98280	-4.84;-4.84;-4.84	5.48	5.48	0.80851	Ion transport (1);	.	.	.	.	D	0.98018	0.9347	L	0.41124	1.26	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97646	1.0151	9	0.51188	T	0.08	.	12.9924	0.58627	0.0:0.9257:0.0:0.0743	.	215	Q99250	SCN2A_HUMAN	V	215	ENSP00000406454:A215V;ENSP00000364586:A215V;ENSP00000283256:A215V	ENSP00000283256:A215V	A	+	2	0	SCN2A	165874146	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.971000	0.63749	2.733000	0.93635	0.655000	0.94253	GCG		0.438	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
MAP2	4133	broad.mit.edu	37	2	210560569	210560569	+	Silent	SNP	C	C	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr2:210560569C>A	ENST00000360351.4	+	7	4181	c.3675C>A	c.(3673-3675)atC>atA	p.I1225I	MAP2_ENST00000447185.1_Silent_p.I1221I|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1225					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.I1225I(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	ATGAAACGATCGTATCTGAAC	0.453																																					p.I1225I	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3675A	2						.						63.0	67.0	66.0					2																	210560569		2203	4300	6503	210268814	SO:0001819	synonymous_variant	4133	exon7				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.3675C>A	2.37:g.210560569C>A		Somatic		Capture	Illumina HiSeq	Phase_I	210268814	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	37	CCDS2384.1																																																																																				0.453	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
MYL1	4632	broad.mit.edu	37	2	211179701	211179701	+	Silent	SNP	C	C	T	rs370260390	byFrequency	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr2:211179701C>T	ENST00000352451.3	-	1	213	c.66G>A	c.(64-66)ccG>ccA	p.P22P		NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	22					cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)	p.P22P(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		gtgcaggtgccggtgccgggg	0.498													C|||	2	0.000399361	0.0	0.0	5008	,	,		10166	0.0		0.0	False		,,,				2504	0.002				p.P22P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G66A	2						.	C		1,4405		0,1,2202	74.0	102.0	93.0		66	-10.9	0.5	2		93	0,8600		0,0,4300	no	coding-synonymous	MYL1	NM_079420.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		22/195	211179701	1,13005	2203	4300	6503	210887946	SO:0001819	synonymous_variant	4632	exon1				CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.66G>A	2.37:g.211179701C>T		Somatic		Capture	Illumina HiSeq	Phase_I	210887946	NM_079420	B2R4N6|B2R4T6|P06741|Q6IBD5	Silent	SNP	ENST00000352451.3	37	CCDS2390.1																																																																																				0.498	MYL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256566.2	NM_079420	
SLC8A1	6546	broad.mit.edu	37	2	40656129	40656129	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr2:40656129C>T	ENST00000403092.1	-	2	1325	c.1292G>A	c.(1291-1293)cGc>cAc	p.R431H	SLC8A1_ENST00000542024.1_Missense_Mutation_p.R431H|SLC8A1_ENST00000402441.1_Missense_Mutation_p.R431H|SLC8A1_ENST00000405269.1_Missense_Mutation_p.R431H|SLC8A1_ENST00000406785.2_Missense_Mutation_p.R431H|SLC8A1_ENST00000405901.3_Missense_Mutation_p.R431H|SLC8A1_ENST00000408028.2_Missense_Mutation_p.R431H|SLC8A1_ENST00000332839.4_Missense_Mutation_p.R431H|SLC8A1_ENST00000406391.2_Missense_Mutation_p.R431H|SLC8A1_ENST00000542756.1_Missense_Mutation_p.R431H			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	431	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.R431H(2)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	ACCACCTCTGCGGATAATGGT	0.433																																					p.R431H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1292A	2						.						97.0	84.0	88.0					2																	40656129		2203	4300	6503	40509633	SO:0001583	missense	6546	exon1				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1292G>A	2.37:g.40656129C>T	ENSP00000384763:p.Arg431His	Somatic		Capture	Illumina HiSeq	Phase_I	40509633	NM_001112800	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.152140	0.78001	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48	6.17	6.17	0.99709	Na-Ca exchanger/integrin-beta4 (2);	0.043864	0.85682	D	0.000000	D	0.84701	0.5530	H	0.99058	4.415	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999	D	0.89881	0.4030	10	0.72032	D	0.01	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	431;431;431;431;431	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	H	431	ENSP00000383886:R431H;ENSP00000440727:R431H;ENSP00000384763:R431H;ENSP00000385678:R431H;ENSP00000385188:R431H;ENSP00000385535:R431H;ENSP00000332931:R431H;ENSP00000384908:R431H;ENSP00000385811:R431H;ENSP00000443515:R431H	ENSP00000332931:R431H	R	-	2	0	SLC8A1	40509633	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.663000	0.83820	2.941000	0.99782	0.655000	0.94253	CGC		0.433	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
NRXN1	9378	broad.mit.edu	37	2	50149201	50149201	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr2:50149201G>A	ENST00000406316.2	-	22	5791	c.4315C>T	c.(4315-4317)Cga>Tga	p.R1439*	NRXN1_ENST00000342183.5_Nonsense_Mutation_p.R404*|NRXN1_ENST00000406859.3_Nonsense_Mutation_p.R1439*|NRXN1_ENST00000401710.1_Nonsense_Mutation_p.R457*|NRXN1_ENST00000402717.3_Nonsense_Mutation_p.R1461*|NRXN1_ENST00000401669.2_Nonsense_Mutation_p.R1469*|NRXN1_ENST00000404971.1_Nonsense_Mutation_p.R1509*|NRXN1_ENST00000405472.3_Nonsense_Mutation_p.R1461*	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1439					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.R1510*(1)|p.R1439*(1)|p.R404*(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATGTAGTTTCGACTCTCGTCC	0.478																																					p.R404X												.	.	3	Substitution - Nonsense(3)	large_intestine(3)	c.C1210T	2						.						225.0	182.0	197.0					2																	50149201		2203	4300	6503	50002705	SO:0001587	stop_gained	9378	exon6			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4315C>T	2.37:g.50149201G>A	ENSP00000384311:p.Arg1439*	Somatic		Capture	Illumina HiSeq	Phase_I	50002705	NM_138735	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Nonsense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	50|50	16.154296|16.154296	0.99855|0.99855	.|.	.|.	ENSG00000179915|ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859|ENST00000378262	.|T	.|0.67523	.|-0.27	5.44|5.44	4.51|4.51	0.55191|0.55191	.|.	0.000000|.	0.49305|.	U|.	0.000143|.	.|T	.|0.78071	.|0.4226	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.81280	.|-0.1004	.|6	0.02654|0.87932	T|D	1|0	.|.	14.7519|14.7519	0.69533|0.69533	0.0:0.0:0.8253:0.1747|0.0:0.0:0.8253:0.1747	.|.	.|.	.|.	.|.	X|L	404;358;457;1509;1439;1461;1469;1510;1461;1439|105	.|ENSP00000367510:S105L	ENSP00000341184:R404X|ENSP00000367510:S105L	R|S	-|-	1|2	2|0	NRXN1|NRXN1	50002705|50002705	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.508000|6.508000	0.73721|0.73721	1.352000|1.352000	0.45808|0.45808	0.655000|0.655000	0.94253|0.94253	CGA|TCG		0.478	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
ERBB4	2066	broad.mit.edu	37	2	212578301	212578301	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr2:212578301C>T	ENST00000342788.4	-	8	1266	c.956G>A	c.(955-957)gGg>gAg	p.G319E	ERBB4_ENST00000436443.1_Missense_Mutation_p.G319E|ERBB4_ENST00000402597.1_Missense_Mutation_p.G319E	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	319	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G319E(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CATTTTAATCCCATTTTCTTC	0.353										TSP Lung(8;0.080)																											p.G319E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G956A	2						.						133.0	129.0	130.0					2																	212578301		2203	4300	6503	212286546	SO:0001583	missense	2066	exon8			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.956G>A	2.37:g.212578301C>T	ENSP00000342235:p.Gly319Glu	Somatic		Capture	Illumina HiSeq	Phase_I	212286546	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.85|16.85	3.236909|3.236909	0.58886|0.58886	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597|ENST00000260943	D;D;D|D	0.83250|0.83837	-1.7;-1.7;-1.7|-1.77	5.57|5.57	5.57|5.57	0.84162|0.84162	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);|.	0.149763|0.149763	0.64402|0.64402	D|D	0.000010|0.000010	D|D	0.89818|0.89818	0.6825|0.6825	M|M	0.73372|0.73372	2.23|2.23	0.51233|0.51233	D|D	0.999913|0.999913	P;P;D;P;P|.	0.61080|.	0.768;0.892;0.989;0.768;0.805|.	B;B;P;B;B|.	0.58780|.	0.181;0.346;0.845;0.181;0.295|.	D|D	0.89636|0.89636	0.3859|0.3859	10|8	0.59425|0.54805	D|T	0.04|0.06	.|.	19.6104|19.6104	0.95604|0.95604	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	319;319;178;319;319|.	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303|.	.;.;.;.;ERBB4_HUMAN|.	E|R	319|319	ENSP00000342235:G319E;ENSP00000403204:G319E;ENSP00000385565:G319E|ENSP00000260943:G319R	ENSP00000342235:G319E|ENSP00000260943:G319R	G|G	-|-	2|1	0|0	ERBB4|ERBB4	212286546|212286546	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.990000|0.990000	0.78478|0.78478	4.927000|4.927000	0.63440|0.63440	2.634000|2.634000	0.89283|0.89283	0.650000|0.650000	0.86243|0.86243	GGG|GGA		0.353	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
STAG1	10274	broad.mit.edu	37	3	136240207	136240207	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr3:136240207C>A	ENST00000383202.2	-	7	780	c.524G>T	c.(523-525)cGt>cTt	p.R175L	STAG1_ENST00000434713.2_5'UTR|STAG1_ENST00000236698.5_Missense_Mutation_p.R175L|STAG1_ENST00000480733.1_Missense_Mutation_p.R175L	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	175					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.R175L(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						AAAGTTTGAACGAAATTTTTT	0.353																																					p.R175L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G524T	3						.						84.0	85.0	85.0					3																	136240207		2203	4300	6503	137722897	SO:0001583	missense	10274	exon7			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.524G>T	3.37:g.136240207C>A	ENSP00000372689:p.Arg175Leu	Somatic		Capture	Illumina HiSeq	Phase_I	137722897	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635340	0.87760	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000480733	T;T;T	0.52983	0.64;0.64;0.64	5.78	5.78	0.91487	STAG (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72317	0.3445	M	0.83312	2.635	0.80722	D	1	D;P;P;D	0.58620	0.983;0.909;0.942;0.983	D;P;P;D	0.66847	0.947;0.826;0.849;0.947	T	0.73421	-0.3988	10	0.52906	T	0.07	.	20.0024	0.97423	0.0:1.0:0.0:0.0	.	192;175;175;175	Q4LE48;C9JJQ0;Q6P275;Q8WVM7	.;.;.;STAG1_HUMAN	L	175	ENSP00000372689:R175L;ENSP00000236698:R175L;ENSP00000420789:R175L	ENSP00000236698:R175L	R	-	2	0	STAG1	137722897	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.089000	0.71384	2.722000	0.93159	0.467000	0.42956	CGT		0.353	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
FHIT	2272	broad.mit.edu	37	3	59908131	59908131	+	Missense_Mutation	SNP	C	C	T	rs139666727	byFrequency	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr3:59908131C>T	ENST00000468189.1	-	8	659	c.289G>A	c.(289-291)Gtc>Atc	p.V97I	FHIT_ENST00000476844.1_Missense_Mutation_p.V97I|FHIT_ENST00000466788.1_5'UTR|FHIT_ENST00000341848.4_Missense_Mutation_p.V97I|FHIT_ENST00000492590.1_Missense_Mutation_p.V97I			P49789	FHIT_HUMAN	fragile histidine triad	97	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				DNA replication (GO:0006260)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide metabolic process (GO:0009117)|purine nucleotide metabolic process (GO:0006163)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|catalytic activity (GO:0003824)|hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|ubiquitin protein ligase binding (GO:0031625)	p.V97I(2)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)	12		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		AGAACATGGACGTGAACGTGC	0.428			T	HMGA2	pleomorphic salivary gland adenoma				Renal Cell Cancer associated with constitutional translocation of chromosome 3				C|||	2	0.000399361	0.0015	0.0	5008	,	,		20100	0.0		0.0	False		,,,				2504	0.0				p.V97I			Dom	yes		3	3p14.2	2272	fragile histidine triad gene		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G289A	3						.						133.0	117.0	122.0					3																	59908131		2203	4300	6503	59883171	SO:0001583	missense	2272	exon8	Familial Cancer Database		BC032336	CCDS2894.1	3p14.2	2012-02-27	2012-02-27		ENSG00000189283	ENSG00000189283			3701	protein-coding gene	gene with protein product		601153	"""fragile histidine triad gene"""			8598045, 9671749	Standard	NM_002012		Approved	FRA3B, AP3Aase	uc003dky.3	P49789	OTTHUMG00000158591	ENST00000468189.1:c.289G>A	3.37:g.59908131C>T	ENSP00000417480:p.Val97Ile	Somatic		Capture	Illumina HiSeq	Phase_I	59883171	NM_002012	A2IAS9|A2IAT0|A2IAT6|A8K1A9|Q45QG9|Q6IU12	Missense_Mutation	SNP	ENST00000468189.1	37	CCDS2894.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	0.576	-0.839164	0.02692	.	.	ENSG00000189283	ENST00000492590;ENST00000476844;ENST00000468189;ENST00000341848	D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72	5.38	-1.75	0.08031	Histidine triad, conserved site (1);Histidine triad motif (1);Histidine triad-like motif (1);	0.479200	0.22074	N	0.064989	T	0.79695	0.4490	N	0.17248	0.465	0.42982	D	0.994465	B	0.02656	0.0	B	0.15870	0.014	T	0.59511	-0.7441	9	.	.	.	-0.3828	12.5294	0.56106	0.0:0.7024:0.0:0.2976	.	97	P49789	FHIT_HUMAN	I	97	ENSP00000418582:V97I;ENSP00000417557:V97I;ENSP00000417480:V97I;ENSP00000342087:V97I	.	V	-	1	0	FHIT	59883171	0.998000	0.40836	0.688000	0.30117	0.721000	0.41392	0.678000	0.25277	-0.786000	0.04516	-0.749000	0.03505	GTC		0.428	FHIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351648.1	NM_002012	
NAALADL2	254827	broad.mit.edu	37	3	175184863	175184863	+	Missense_Mutation	SNP	G	G	A	rs372908344		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr3:175184863G>A	ENST00000454872.1	+	8	1552	c.1424G>A	c.(1423-1425)cGt>cAt	p.R475H	NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	475						integral component of membrane (GO:0016021)		p.R475P(1)|p.R475H(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		GCGTTTATCCGTGCCTTGATG	0.438																																					p.R475H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1424A	3						.	G	HIS/ARG	0,3938		0,0,1969	186.0	180.0	182.0		1424	-2.9	0.2	3		182	1,8305		0,1,4152	no	missense	NAALADL2	NM_207015.2	29	0,1,6121	AA,AG,GG		0.012,0.0,0.0082	probably-damaging	475/796	175184863	1,12243	1969	4153	6122	176667557	SO:0001583	missense	254827	exon8				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1424G>A	3.37:g.175184863G>A	ENSP00000404705:p.Arg475His	Somatic		Capture	Illumina HiSeq	Phase_I	176667557	NM_207015	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	ENST00000454872.1	37	CCDS46960.1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.809931	0.31961	0.0	1.2E-4	ENSG00000177694	ENST00000454872	T	0.55052	0.54	5.58	-2.92	0.05615	Peptidase M28 (1);	0.866607	0.10260	N	0.696052	T	0.51890	0.1701	M	0.65320	2	0.18873	N	0.999984	P	0.48694	0.914	B	0.43251	0.413	T	0.56378	-0.7989	10	0.66056	D	0.02	0.1799	15.5622	0.76258	0.8883:0.0:0.1117:0.0	.	475	Q58DX5	NADL2_HUMAN	H	475	ENSP00000404705:R475H	ENSP00000404705:R475H	R	+	2	0	NAALADL2	176667557	0.933000	0.31639	0.217000	0.23759	0.036000	0.12997	0.531000	0.23052	-0.815000	0.04346	-0.237000	0.12165	CGT		0.438	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015	
CYTL1	54360	broad.mit.edu	37	4	5018596	5018596	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr4:5018596C>A	ENST00000307746.4	-	3	320	c.294G>T	c.(292-294)aaG>aaT	p.K98N		NM_018659.2	NP_061129.1	Q9NRR1	CYTL1_HUMAN	cytokine-like 1	98					cartilage homeostasis (GO:1990079)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|inner ear development (GO:0048839)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)	p.K98N(1)		breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		TGGTGTACAGCTTCCGTGCTT	0.488																																					p.K98N	Colon(15;457 478 29696 43408 47165)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G294T	4						.						137.0	136.0	136.0					4																	5018596		2203	4300	6503	5069497	SO:0001583	missense	54360	exon3			AF193766	CCDS3379.1	4p16-p15	2007-08-01			ENSG00000170891	ENSG00000170891			24435	protein-coding gene	gene with protein product		607930				10857752	Standard	NM_018659		Approved	C17, C4orf4	uc003gig.3	Q9NRR1	OTTHUMG00000125479	ENST00000307746.4:c.294G>T	4.37:g.5018596C>A	ENSP00000303550:p.Lys98Asn	Somatic		Capture	Illumina HiSeq	Phase_I	5069497	NM_018659		Missense_Mutation	SNP	ENST00000307746.4	37	CCDS3379.1	.	.	.	.	.	.	.	.	.	.	C	9.742	1.165054	0.21538	.	.	ENSG00000170891	ENST00000307746	T	0.30448	1.53	4.94	-1.48	0.08745	.	0.178845	0.48286	D	0.000190	T	0.16685	0.0401	L	0.41710	1.295	0.32744	N	0.507336	B	0.33637	0.42	B	0.29077	0.098	T	0.24154	-1.0168	10	0.20046	T	0.44	-12.213	6.3263	0.21244	0.1593:0.6323:0.0:0.2084	.	98	Q9NRR1	CYTL1_HUMAN	N	98	ENSP00000303550:K98N	ENSP00000303550:K98N	K	-	3	2	CYTL1	5069497	0.756000	0.28383	0.998000	0.56505	0.737000	0.42083	-0.725000	0.04942	0.011000	0.14865	0.561000	0.74099	AAG		0.488	CYTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246802.1	NM_018659	
CORIN	10699	broad.mit.edu	37	4	47605478	47605478	+	Silent	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr4:47605478C>T	ENST00000273857.4	-	20	2747	c.2748G>A	c.(2746-2748)ccG>ccA	p.P916P	CORIN_ENST00000505909.1_Silent_p.P879P|CORIN_ENST00000508498.1_Silent_p.P777P|CORIN_ENST00000502252.1_Silent_p.P849P	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	916	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.P916P(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						GCCACTGCTCCGGGTTGGGCA	0.527																																					p.P916P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2748A	4						.						97.0	83.0	88.0					4																	47605478		2203	4300	6503	47300235	SO:0001819	synonymous_variant	10699	exon20			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.2748G>A	4.37:g.47605478C>T		Somatic		Capture	Illumina HiSeq	Phase_I	47300235	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Silent	SNP	ENST00000273857.4	37	CCDS3477.1																																																																																				0.527	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
STOX2	56977	broad.mit.edu	37	4	184932087	184932087	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr4:184932087G>T	ENST00000308497.4	+	3	3531	c.2096G>T	c.(2095-2097)aGc>aTc	p.S699I	STOX2_ENST00000438269.1_Missense_Mutation_p.S699I	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	699					embryo development (GO:0009790)|maternal placenta development (GO:0001893)			p.S699I(1)		breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		GAGATATTTAGCAAAGACACA	0.542																																					p.S699I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2096T	4						.						34.0	39.0	37.0					4																	184932087		2017	4174	6191	185169081	SO:0001583	missense	56977	exon3			AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.2096G>T	4.37:g.184932087G>T	ENSP00000311257:p.Ser699Ile	Somatic		Capture	Illumina HiSeq	Phase_I	185169081	NM_020225	A6H8U4|Q9NPS8	Missense_Mutation	SNP	ENST00000308497.4	37	CCDS47167.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938048	0.73557	.	.	ENSG00000173320	ENST00000308497;ENST00000438269	T;D	0.83755	-0.77;-1.76	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.87386	0.6164	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.80764	0.994;0.986	D	0.88557	0.3120	10	0.87932	D	0	-25.2765	18.987	0.92775	0.0:0.0:1.0:0.0	.	699;699	Q9P2F5-2;Q9P2F5	.;STOX2_HUMAN	I	699	ENSP00000311257:S699I;ENSP00000390127:S699I	ENSP00000311257:S699I	S	+	2	0	STOX2	185169081	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.936000	0.92931	2.725000	0.93324	0.655000	0.94253	AGC		0.542	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361433.3	NM_020225	
DNAH5	1767	broad.mit.edu	37	5	13759065	13759065	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr5:13759065G>T	ENST00000265104.4	-	61	10413	c.10309C>A	c.(10309-10311)Cat>Aat	p.H3437N		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3437	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.H3437N(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCCAGGAGATGGCGATTCTCT	0.547									Kartagener syndrome																												p.H3437N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C10309A	5						.						180.0	161.0	168.0					5																	13759065		2203	4300	6503	13812065	SO:0001583	missense	1767	exon61	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.10309C>A	5.37:g.13759065G>T	ENSP00000265104:p.His3437Asn	Somatic		Capture	Illumina HiSeq	Phase_I	13812065	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.865500	0.51588	.	.	ENSG00000039139	ENST00000265104	T	0.73363	-0.74	5.78	0.55	0.17219	Dynein heavy chain, coiled coil stalk (1);	0.374396	0.29876	N	0.010977	T	0.61949	0.2388	N	0.22421	0.69	0.30495	N	0.770964	B	0.12013	0.005	B	0.30495	0.116	T	0.61217	-0.7107	10	0.72032	D	0.01	.	11.3507	0.49585	0.3002:0.0:0.6998:0.0	.	3437	Q8TE73	DYH5_HUMAN	N	3437	ENSP00000265104:H3437N	ENSP00000265104:H3437N	H	-	1	0	DNAH5	13812065	0.997000	0.39634	0.266000	0.24541	0.824000	0.46624	2.451000	0.44952	0.029000	0.15352	0.650000	0.86243	CAT		0.547	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
PCDHA2	56146	broad.mit.edu	37	5	140174749	140174749	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr5:140174749C>T	ENST00000526136.1	+	1	200	c.200C>T	c.(199-201)gCg>gTg	p.A67V	PCDHA2_ENST00000520672.2_Missense_Mutation_p.A67V|PCDHA2_ENST00000378132.1_Missense_Mutation_p.A67V|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	67	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A67V(4)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCGGGTGGCGTCCAAAAGA	0.642																																					p.A67V												.	.	4	Substitution - Missense(4)	large_intestine(2)|endometrium(2)	c.C200T	5						.						54.0	66.0	62.0					5																	140174749		2201	4293	6494	140154933	SO:0001583	missense	56146	exon1			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.200C>T	5.37:g.140174749C>T	ENSP00000431748:p.Ala67Val	Somatic		Capture	Illumina HiSeq	Phase_I	140154933	NM_018905	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	c	1.867	-0.461162	0.04508	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.23348	1.91;1.91;1.91	3.66	1.81	0.25067	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.215380	0.23000	U	0.053089	T	0.04227	0.0117	N	0.00459	-1.475	0.20638	N	0.999879	B;B;B	0.17667	0.023;0.016;0.023	B;B;B	0.16289	0.01;0.003;0.015	T	0.39742	-0.9599	10	0.02654	T	1	.	2.4547	0.04526	0.4752:0.3046:0.0:0.2202	.	67;67;67	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	V	67	ENSP00000430584:A67V;ENSP00000367372:A67V;ENSP00000431748:A67V	ENSP00000367372:A67V	A	+	2	0	PCDHA2	140154933	0.319000	0.24607	0.998000	0.56505	0.885000	0.51271	1.375000	0.34295	0.863000	0.35553	0.644000	0.83932	GCG		0.642	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
FBXL7	23194	broad.mit.edu	37	5	15936735	15936735	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr5:15936735C>T	ENST00000504595.1	+	4	1397	c.916C>T	c.(916-918)Cgc>Tgc	p.R306C	FBXL7_ENST00000329673.7_Missense_Mutation_p.R294C|FBXL7_ENST00000510662.1_Missense_Mutation_p.R259C|MIR887_ENST00000401258.1_RNA	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	306					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.R306C(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CCTCTACCTGCGCCGCTGCGT	0.647																																					p.R306C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C916T	5						.						41.0	44.0	43.0					5																	15936735		2184	4286	6470	15989735	SO:0001583	missense	23194	exon4			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.916C>T	5.37:g.15936735C>T	ENSP00000423630:p.Arg306Cys	Somatic		Capture	Illumina HiSeq	Phase_I	15989735	NM_012304	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.347724	0.82022	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.02369	4.32;4.32;4.32	5.16	4.28	0.50868	.	0.048457	0.85682	D	0.000000	T	0.12603	0.0306	L	0.58583	1.82	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00643	-1.1630	10	0.72032	D	0.01	.	15.5304	0.75956	0.0:0.8611:0.1389:0.0	.	306	Q9UJT9	FBXL7_HUMAN	C	306;259;294	ENSP00000423630:R306C;ENSP00000425184:R259C;ENSP00000329632:R294C	ENSP00000329632:R294C	R	+	1	0	FBXL7	15989735	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	1.146000	0.42352	0.655000	0.94253	CGC		0.647	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
LIFR	3977	broad.mit.edu	37	5	38530734	38530734	+	Missense_Mutation	SNP	C	C	T	rs373771721		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr5:38530734C>T	ENST00000263409.4	-	2	178	c.16G>A	c.(16-18)Gta>Ata	p.V6I	LIFR_ENST00000453190.2_Missense_Mutation_p.V6I|LIFR_ENST00000503088.1_5'UTR	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	6					cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.V6I(2)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					TTCAAACATACGTAAATATCC	0.398			T	PLAG1	salivary adenoma																																p.V6I	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G16A	5						.	C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	132.0	124.0	126.0		16,16	-0.3	0.0	5		126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LIFR	NM_002310.5,NM_001127671.1	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	6/1098,6/1098	38530734	1,13005	2203	4300	6503	38566491	SO:0001583	missense	3977	exon2			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.16G>A	5.37:g.38530734C>T	ENSP00000263409:p.Val6Ile	Somatic		Capture	Illumina HiSeq	Phase_I	38566491	NM_001127671	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	C	6.474	0.455645	0.12283	0.0	1.16E-4	ENSG00000113594	ENST00000263409;ENST00000453190;ENST00000506990;ENST00000511561	T;T;T	0.55234	0.53;0.53;0.94	4.84	-0.336	0.12658	.	2.836110	0.00984	N	0.003438	T	0.28001	0.0690	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.06954	-1.0798	10	0.17832	T	0.49	0.4938	0.9093	0.01291	0.5001:0.1683:0.1772:0.1544	.	6	P42702	LIFR_HUMAN	I	6	ENSP00000263409:V6I;ENSP00000398368:V6I;ENSP00000426685:V6I	ENSP00000263409:V6I	V	-	1	0	LIFR	38566491	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.670000	0.25157	-0.116000	0.11893	-2.556000	0.00176	GTA		0.398	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
SH3TC2	79628	broad.mit.edu	37	5	148427546	148427546	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr5:148427546G>A	ENST00000515425.1	-	3	259	c.158C>T	c.(157-159)aCa>aTa	p.T53I	SH3TC2_ENST00000512049.1_Missense_Mutation_p.T53I|SH3TC2_ENST00000394358.2_5'UTR	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	53					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)		p.T53I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGGAGAGTGTCAGGTCTTA	0.488																																					p.T53I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C158T	5						.						97.0	103.0	101.0					5																	148427546		2203	4300	6503	148407739	SO:0001583	missense	79628	exon3			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.158C>T	5.37:g.148427546G>A	ENSP00000423660:p.Thr53Ile	Somatic		Capture	Illumina HiSeq	Phase_I	148407739	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	37	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408190	0.42715	.	.	ENSG00000169247	ENST00000515425;ENST00000512049	T;T	0.76060	-0.99;-0.99	5.53	3.35	0.38373	.	0.679913	0.14784	N	0.298601	T	0.58235	0.2108	L	0.29908	0.895	0.20975	N	0.999814	B;B;B	0.32829	0.039;0.386;0.039	B;B;B	0.24541	0.015;0.054;0.015	T	0.49283	-0.8956	10	0.52906	T	0.07	.	8.174	0.31270	0.2252:0.0:0.7748:0.0	.	53;53;53	Q14CC0;D6RFX2;Q8TF17	.;.;S3TC2_HUMAN	I	53	ENSP00000423660:T53I;ENSP00000421860:T53I	ENSP00000313025:T53I	T	-	2	0	SH3TC2	148407739	0.961000	0.32948	0.409000	0.26459	0.413000	0.31143	2.670000	0.46833	0.566000	0.29273	-0.150000	0.13652	ACA		0.488	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
ROS1	6098	broad.mit.edu	37	6	117647468	117647468	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr6:117647468A>G	ENST00000368508.3	-	33	5674	c.5476T>C	c.(5476-5478)Ttt>Ctt	p.F1826L	ROS1_ENST00000368507.3_Missense_Mutation_p.F1820L|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1826	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.F1826L(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CTGAACTGAAATATTCCTTTC	0.353			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.F1826L			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T5476C	6						.						133.0	132.0	132.0					6																	117647468		2202	4300	6502	117754161	SO:0001583	missense	6098	exon33			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.5476T>C	6.37:g.117647468A>G	ENSP00000357494:p.Phe1826Leu	Somatic		Capture	Illumina HiSeq	Phase_I	117754161	NM_002944	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.508633	0.85282	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.54479	0.57;0.57	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000009	T	0.54695	0.1874	L	0.41356	1.27	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.60786	-0.7194	10	0.66056	D	0.02	.	14.2136	0.65779	1.0:0.0:0.0:0.0	.	1826	P08922	ROS1_HUMAN	L	1826;1820	ENSP00000357494:F1826L;ENSP00000357493:F1820L	ENSP00000357493:F1820L	F	-	1	0	ROS1	117754161	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.779000	0.62375	2.009000	0.58944	0.477000	0.44152	TTT		0.353	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
LAMA2	3908	broad.mit.edu	37	6	129785589	129785589	+	Nonsense_Mutation	SNP	C	C	T	rs121913576		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr6:129785589C>T	ENST00000421865.2	+	50	7196	c.7147C>T	c.(7147-7149)Cga>Tga	p.R2383*		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2383	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.R2383*(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TCTTGCCACACGAGACCTGGT	0.408																																					p.R2383X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C7147T	6	GRCh37	CM004723	LAMA2	M	rs121913576	.						236.0	198.0	211.0					6																	129785589		2203	4300	6503	129827282	SO:0001587	stop_gained	3908	exon50			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.7147C>T	6.37:g.129785589C>T	ENSP00000400365:p.Arg2383*	Somatic		Capture	Illumina HiSeq	Phase_I	129827282	NM_001079823	Q14736|Q5VUM2|Q93022	Nonsense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	C	48	14.415863	0.99794	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	.	.	.	5.6	2.67	0.31697	.	0.331335	0.32002	N	0.006740	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5022	0.44813	0.4532:0.4227:0.1242:0.0	.	.	.	.	X	2383;2382;2383;401	.	.	R	+	1	2	LAMA2	129827282	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.045000	0.30341	0.664000	0.31047	0.655000	0.94253	CGA		0.408	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
SYNE1	23345	broad.mit.edu	37	6	152644655	152644655	+	Missense_Mutation	SNP	G	G	A	rs200626370		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr6:152644655G>A	ENST00000367255.5	-	82	16476	c.15875C>T	c.(15874-15876)cCg>cTg	p.P5292L	SYNE1_ENST00000341594.5_Missense_Mutation_p.P4985L|SYNE1_ENST00000265368.4_Missense_Mutation_p.P5292L|SYNE1_ENST00000448038.1_Missense_Mutation_p.P5221L|SYNE1_ENST00000423061.1_Missense_Mutation_p.P5221L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5292					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.P5292L(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGCATGAGCGGAGGCTCTTC	0.557										HNSCC(10;0.0054)																											p.P5221L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C15662T	6						.						71.0	71.0	71.0					6																	152644655		2203	4300	6503	152686348	SO:0001583	missense	23345	exon81			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.15875C>T	6.37:g.152644655G>A	ENSP00000356224:p.Pro5292Leu	Somatic		Capture	Illumina HiSeq	Phase_I	152686348	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	9.558	1.117627	0.20877	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.60040	0.31;0.33;0.22;0.33;1.41	5.35	4.48	0.54585	.	0.228590	0.30879	N	0.008700	T	0.62648	0.2445	M	0.81942	2.565	0.80722	D	1	D;D;D;D	0.57899	0.969;0.967;0.967;0.981	P;B;B;P	0.53146	0.51;0.283;0.283;0.719	T	0.70215	-0.4933	10	0.59425	D	0.04	.	15.5432	0.76074	0.0:0.0:0.8609:0.139	.	5292;5292;5292;5221	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	L	5292;5221;5292;5221;4985	ENSP00000356224:P5292L;ENSP00000396024:P5221L;ENSP00000265368:P5292L;ENSP00000390975:P5221L;ENSP00000341887:P4985L	ENSP00000265368:P5292L	P	-	2	0	SYNE1	152686348	1.000000	0.71417	0.002000	0.10522	0.007000	0.05969	4.565000	0.60836	1.252000	0.44001	-0.230000	0.12252	CCG		0.557	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	broad.mit.edu	37	6	152757182	152757182	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr6:152757182C>T	ENST00000367255.5	-	33	4805	c.4204G>A	c.(4204-4206)Gaa>Aaa	p.E1402K	SYNE1_ENST00000367248.3_Missense_Mutation_p.E1392K|SYNE1_ENST00000413186.2_Missense_Mutation_p.E1402K|SYNE1_ENST00000341594.5_Missense_Mutation_p.E1468K|SYNE1_ENST00000265368.4_Missense_Mutation_p.E1402K|SYNE1_ENST00000367253.4_Missense_Mutation_p.E1402K|SYNE1_ENST00000448038.1_Missense_Mutation_p.E1409K|SYNE1_ENST00000423061.1_Missense_Mutation_p.E1409K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1402					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E1402K(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTGAAGCTTCCTTTACAAGG	0.388										HNSCC(10;0.0054)																											p.E1409K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4225A	6						.						132.0	120.0	124.0					6																	152757182		2203	4300	6503	152798875	SO:0001583	missense	23345	exon33			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.4204G>A	6.37:g.152757182C>T	ENSP00000356224:p.Glu1402Lys	Somatic		Capture	Illumina HiSeq	Phase_I	152798875	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	14.38	2.517906	0.44763	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;D;D;D	0.87491	0.69;0.7;0.6;0.66;0.87;-2.25;-2.24;-2.26	5.91	5.91	0.95273	.	0.204001	0.34178	N	0.004191	T	0.63768	0.2539	L	0.27053	0.805	0.80722	D	1	B;B;B;B;B;B	0.20780	0.013;0.001;0.002;0.048;0.001;0.002	B;B;B;B;B;B	0.18871	0.005;0.003;0.01;0.023;0.003;0.01	T	0.59402	-0.7461	10	0.12430	T	0.62	.	7.7575	0.28933	0.0:0.8104:0.0:0.1896	.	1385;1402;1392;1402;1402;1409	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	K	1402;1409;1402;1409;1468;1402;1392;1402	ENSP00000356224:E1402K;ENSP00000396024:E1409K;ENSP00000265368:E1402K;ENSP00000390975:E1409K;ENSP00000341887:E1468K;ENSP00000356222:E1402K;ENSP00000356217:E1392K;ENSP00000414510:E1402K	ENSP00000265368:E1402K	E	-	1	0	SYNE1	152798875	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.369000	0.52365	2.805000	0.96524	0.460000	0.39030	GAA		0.388	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	broad.mit.edu	37	6	152831401	152831401	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr6:152831401G>A	ENST00000367255.5	-	8	1109	c.508C>T	c.(508-510)Cgg>Tgg	p.R170W	SYNE1_ENST00000367248.3_Missense_Mutation_p.R177W|SYNE1_ENST00000413186.2_Missense_Mutation_p.R170W|SYNE1_ENST00000341594.5_Missense_Mutation_p.R170W|SYNE1_ENST00000466159.2_Missense_Mutation_p.R170W|SYNE1_ENST00000265368.4_Missense_Mutation_p.R170W|SYNE1_ENST00000367253.4_Missense_Mutation_p.R170W|SYNE1_ENST00000448038.1_Missense_Mutation_p.R177W|SYNE1_ENST00000423061.1_Missense_Mutation_p.R177W	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	170	Actin-binding.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.R170W(7)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTCACCTTCCGTTTACTTGGT	0.483										HNSCC(10;0.0054)																											p.R177W												.	.	7	Substitution - Missense(7)	large_intestine(4)|prostate(3)	c.C529T	6						.						195.0	175.0	182.0					6																	152831401		2203	4300	6503	152873094	SO:0001583	missense	23345	exon8			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.508C>T	6.37:g.152831401G>A	ENSP00000356224:p.Arg170Trp	Somatic		Capture	Illumina HiSeq	Phase_I	152873094	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271820	0.59649	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	T;T;T;T;T;D;D;D;D;D	0.92348	0.32;0.31;0.22;0.31;0.47;-2.46;-2.58;-2.59;-2.83;-3.02	5.66	1.3	0.21679	Calponin homology domain (1);	0.118151	0.37219	N	0.002183	D	0.94889	0.8348	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.998;0.999;1.0	D	0.95353	0.8448	10	0.72032	D	0.01	.	14.8467	0.70264	0.0:0.0:0.52:0.4799	.	170;170;170;170;177	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	W	170;177;170;177;170;170;177;170;170;170	ENSP00000356224:R170W;ENSP00000396024:R177W;ENSP00000265368:R170W;ENSP00000390975:R177W;ENSP00000341887:R170W;ENSP00000356222:R170W;ENSP00000356217:R177W;ENSP00000414510:R170W;ENSP00000446021:R170W;ENSP00000441264:R170W	ENSP00000265368:R170W	R	-	1	2	SYNE1	152873094	0.978000	0.34361	0.672000	0.29872	0.750000	0.42670	1.413000	0.34725	0.686000	0.31488	-0.202000	0.12741	CGG		0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
PNLDC1	154197	broad.mit.edu	37	6	160234665	160234665	+	Silent	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr6:160234665G>A	ENST00000610273.1	+	12	1110	c.939G>A	c.(937-939)tcG>tcA	p.S313S	PNLDC1_ENST00000392167.3_Silent_p.S324S	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	313						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.S313S(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CGAATCTTTCGGAAGTCTATG	0.507																																					p.S313S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G939A	6						.						164.0	160.0	161.0					6																	160234665		2203	4300	6503	160154655	SO:0001819	synonymous_variant	154197	exon12			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.939G>A	6.37:g.160234665G>A		Somatic		Capture	Illumina HiSeq	Phase_I	160154655	NM_173516	Q5TAP7|Q8N7X5	Silent	SNP	ENST00000610273.1	37	CCDS5271.1																																																																																				0.507	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516	
DST	667	broad.mit.edu	37	6	56399962	56399962	+	Silent	SNP	C	C	G	rs369986184		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr6:56399962C>G	ENST00000361203.3	-	59	16273	c.16266G>C	c.(16264-16266)tcG>tcC	p.S5422S	DST_ENST00000446842.2_Silent_p.S5098S|DST_ENST00000340834.4_5'UTR|DST_ENST00000244364.6_Silent_p.S3010S|DST_ENST00000370769.4_Silent_p.S5424S|DST_ENST00000312431.6_3'UTR|DST_ENST00000370754.5_Silent_p.S5602S|DST_ENST00000421834.2_Silent_p.S3336S|DST_ENST00000370788.2_Silent_p.S3336S			Q03001	DYST_HUMAN	dystonin	5422					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.S3010S(2)|p.S5424S(2)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGAACTCAGCCGACGGGGGCT	0.478																																					p.S3010S												.	.	4	Substitution - coding silent(4)	large_intestine(2)|lung(2)	c.G9030C	6						.						147.0	152.0	150.0					6																	56399962		1885	4126	6011	56507921	SO:0001819	synonymous_variant	667	exon44			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.16266G>C	6.37:g.56399962C>G		Somatic		Capture	Illumina HiSeq	Phase_I	56507921	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37																																																																																					0.478	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
EPHA7	2045	broad.mit.edu	37	6	93953252	93953252	+	Silent	SNP	C	C	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr6:93953252C>A	ENST00000369303.4	-	17	3073	c.2889G>T	c.(2887-2889)gtG>gtT	p.V963V		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	963	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.V963V(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CTAAACTCATCACATCCCTGA	0.353																																					p.V963V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2889T	6						.						216.0	181.0	193.0					6																	93953252		2203	4300	6503	94009973	SO:0001819	synonymous_variant	2045	exon17			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2889G>T	6.37:g.93953252C>A		Somatic		Capture	Illumina HiSeq	Phase_I	94009973	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Silent	SNP	ENST00000369303.4	37	CCDS5031.1																																																																																				0.353	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
PDE10A	10846	broad.mit.edu	37	6	165801833	165801833	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr6:165801833G>A	ENST00000366882.1	-	18	1890	c.1736C>T	c.(1735-1737)tCc>tTc	p.S579F	PDE10A_ENST00000539869.2_Missense_Mutation_p.S589F|PDE10A_ENST00000354448.4_Missense_Mutation_p.S579F			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	579					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.S579F(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	CTCCATGGTGGAAGTGGAGTA	0.572																																					p.S579F	Esophageal Squamous(22;308 615 5753 12038 40624)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1736T	6						.						146.0	119.0	128.0					6																	165801833		2203	4300	6503	165721823	SO:0001583	missense	10846	exon18			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1736C>T	6.37:g.165801833G>A	ENSP00000355847:p.Ser579Phe	Somatic		Capture	Illumina HiSeq	Phase_I	165721823	NM_006661	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37		.	.	.	.	.	.	.	.	.	.	G	29.4	5.002930	0.93287	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	D;D	0.89681	-2.55;-2.55	5.89	5.89	0.94794	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.96156	0.8747	M	0.93150	3.385	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.97110	1.0;0.981	D	0.96326	0.9240	10	0.87932	D	0	.	20.2561	0.98419	0.0:0.0:1.0:0.0	.	589;579	Q9ULW9;Q9Y233	.;PDE10_HUMAN	F	579;607;589;579;578	ENSP00000355847:S579F;ENSP00000346435:S579F	ENSP00000341187:S589F	S	-	2	0	PDE10A	165721823	1.000000	0.71417	0.782000	0.31804	0.850000	0.48378	9.113000	0.94321	2.797000	0.96272	0.563000	0.77884	TCC		0.572	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
TMEM176A	55365	broad.mit.edu	37	7	150498449	150498450	+	Intron	INS	-	-	G	rs5888418|rs79002088|rs34855806	byFrequency	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr7:150498449_150498450insG	ENST00000484928.1	+	2	566				TMEM176B_ENST00000492607.1_5'Flank|TMEM176A_ENST00000004103.3_Intron|TMEM176B_ENST00000450753.2_5'Flank|TMEM176B_ENST00000434545.1_5'Flank|TMEM176B_ENST00000326442.5_5'Flank|TMEM176A_ENST00000461345.1_5'Flank|TMEM176B_ENST00000447204.2_5'Flank			Q96HP8	T176A_HUMAN	transmembrane protein 176A						negative regulation of dendritic cell differentiation (GO:2001199)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|lung(7)|ovary(2)|stomach(1)	12			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CATGGTCAGCACCCCCTCTGCT	0.644													G|-|G|deletion	3337	0.666334	0.7413	0.5634	5008	,	,		15858	0.6825		0.5746	False		,,,				2504	0.7157				.												.	.	0			.	7						.																																			150129383	SO:0001627	intron_variant	28959	.			AF258340	CCDS5909.1	7q36.1	2006-09-04			ENSG00000002933	ENSG00000002933			24930	protein-coding gene	gene with protein product		610334				12097419, 8889548	Standard	NM_018487		Approved	HCA112	uc003whx.1	Q96HP8	OTTHUMG00000158114	ENST00000484928.1:c.-15-174->G	7.37:g.150498449_150498450insG		Somatic		Capture	Illumina HiSeq	Phase_I	150129382	.	D3DX00|Q9NYC7	Splice_Site	INS	ENST00000484928.1	37	CCDS5909.1																																																																																				0.644	TMEM176A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350222.1	NM_018487	
LAMB1	3912	broad.mit.edu	37	7	107626718	107626718	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr7:107626718C>T	ENST00000222399.6	-	6	744	c.514G>A	c.(514-516)Gcc>Acc	p.A172T	LAMB1_ENST00000393560.1_Missense_Mutation_p.A172T|LAMB1_ENST00000393561.1_Missense_Mutation_p.A196T	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	172	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.A172T(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GGAAACGAGGCCTCACAGTCA	0.463																																					p.A172T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G514A	7						.						107.0	104.0	105.0					7																	107626718		2203	4300	6503	107413954	SO:0001583	missense	3912	exon6			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.514G>A	7.37:g.107626718C>T	ENSP00000222399:p.Ala172Thr	Somatic		Capture	Illumina HiSeq	Phase_I	107413954	NM_002291	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813822	0.32053	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.75367	-0.93;-0.93;-0.93	5.86	4.72	0.59763	Laminin, N-terminal (3);	.	.	.	.	T	0.52677	0.1749	N	0.04245	-0.25	0.25527	N	0.987313	B;B;B	0.10296	0.002;0.001;0.003	B;B;B	0.12837	0.007;0.008;0.002	T	0.39375	-0.9617	9	0.25106	T	0.35	.	11.2059	0.48769	0.0:0.0729:0.0:0.9271	.	172;172;196	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	T	196;172;172	ENSP00000377191:A196T;ENSP00000222399:A172T;ENSP00000377190:A172T	ENSP00000222399:A172T	A	-	1	0	LAMB1	107413954	0.363000	0.24989	1.000000	0.80357	0.476000	0.33039	-0.014000	0.12656	1.051000	0.40369	-0.302000	0.09304	GCC		0.463	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
TBX20	57057	broad.mit.edu	37	7	35288347	35288347	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr7:35288347C>T	ENST00000408931.3	-	3	1013	c.487G>A	c.(487-489)Gcc>Acc	p.A163T		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	163					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A163T(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						CGGTGGTAGGCGTAGCGGTAC	0.577																																					p.A163T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G487A	7						.						89.0	83.0	85.0					7																	35288347		2203	4300	6503	35254872	SO:0001583	missense	57057	exon3			AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.487G>A	7.37:g.35288347C>T	ENSP00000386170:p.Ala163Thr	Somatic		Capture	Illumina HiSeq	Phase_I	35254872	NM_001077653	A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	ENST00000408931.3	37	CCDS43568.1	.	.	.	.	.	.	.	.	.	.	C	36	5.887636	0.97068	.	.	ENSG00000164532	ENST00000408931	D	0.89552	-2.53	5.87	5.87	0.94306	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94807	0.8323	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.94351	0.7579	10	0.72032	D	0.01	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	163	Q9UMR3	TBX20_HUMAN	T	163	ENSP00000386170:A163T	ENSP00000386170:A163T	A	-	1	0	TBX20	35254872	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	GCC		0.577	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417	
COL1A2	1278	broad.mit.edu	37	7	94049720	94049720	+	Silent	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr7:94049720C>T	ENST00000297268.6	+	36	2622	c.2151C>T	c.(2149-2151)gtC>gtT	p.V717V		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	717			Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.V717V(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GTGGTGAGGTCGGTCCTGCTG	0.443										HNSCC(75;0.22)																											p.V717V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2151T	7						.						91.0	88.0	89.0					7																	94049720		2203	4300	6503	93887656	SO:0001819	synonymous_variant	1278	exon36			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2151C>T	7.37:g.94049720C>T		Somatic		Capture	Illumina HiSeq	Phase_I	93887656	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	ENST00000297268.6	37	CCDS34682.1																																																																																				0.443	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
ARPC1A	10552	broad.mit.edu	37	7	98946507	98946507	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr7:98946507G>A	ENST00000262942.5	+	5	549	c.425G>A	c.(424-426)cGc>cAc	p.R142H	ARPC1A_ENST00000432884.2_Missense_Mutation_p.R95H	NM_001190996.1|NM_006409.3	NP_001177925.1|NP_006400.2	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex, subunit 1A, 41kDa	142					actin cytoskeleton organization (GO:0030036)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of actin filament polymerization (GO:0030833)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	actin binding (GO:0003779)	p.R142H(1)		endometrium(3)|large_intestine(5)|liver(2)|lung(7)|ovary(1)|prostate(1)	19	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			AAGCCGATTCGCTCCACAGTC	0.463																																					p.R128H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G383A	7						.						148.0	124.0	132.0					7																	98946507		2203	4300	6503	98784443	SO:0001583	missense	10552	exon5			Y08999	CCDS5660.1	7q22.1	2013-03-14	2002-08-29		ENSG00000241685	ENSG00000241685		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	703	protein-coding gene	gene with protein product	"""actin binding protein (Schizosaccharomyces pombe sop2-like)"", ""SOP2-like protein"""	604220	"""actin related protein 2/3 complex, subunit 1A (41 kD)"""			8978670, 9230079	Standard	NM_006409		Approved	SOP2Hs, SOP2L, Arc40	uc003upx.2	Q92747	OTTHUMG00000154553	ENST00000262942.5:c.425G>A	7.37:g.98946507G>A	ENSP00000262942:p.Arg142His	Somatic		Capture	Illumina HiSeq	Phase_I	98784443	NM_001190996	A4D276|B4DLQ7|D6W5S1|Q7Z5U8|Q86WU5|Q8IXQ0	Missense_Mutation	SNP	ENST00000262942.5	37	CCDS5660.1	.	.	.	.	.	.	.	.	.	.	G	36	5.651862	0.96714	.	.	ENSG00000241685	ENST00000432884;ENST00000262942	T;T	0.60548	0.18;0.18	5.29	5.29	0.74685	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80859	0.4704	M	0.89968	3.075	0.80722	D	1	D;D	0.76494	0.977;0.999	P;D	0.69654	0.717;0.965	D	0.84248	0.0476	10	0.62326	D	0.03	.	19.2883	0.94087	0.0:0.0:1.0:0.0	.	137;142	Q53GB6;Q92747	.;ARC1A_HUMAN	H	95;142	ENSP00000408578:R95H;ENSP00000262942:R142H	ENSP00000262942:R142H	R	+	2	0	ARPC1A	98784443	1.000000	0.71417	0.957000	0.39632	0.991000	0.79684	9.835000	0.99442	2.646000	0.89796	0.591000	0.81541	CGC		0.463	ARPC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335908.1	NM_006409	
RBM28	55131	broad.mit.edu	37	7	127975664	127975664	+	Silent	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr7:127975664G>A	ENST00000223073.2	-	8	993	c.879C>T	c.(877-879)agC>agT	p.S293S	RBM28_ENST00000415472.2_Silent_p.S152S	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	293					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S293S(1)		breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						CAATACTATCGCTTTCCTCTA	0.453																																					p.S152S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C456T	7						.						116.0	103.0	108.0					7																	127975664		2203	4300	6503	127762900	SO:0001819	synonymous_variant	55131	exon4			AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.879C>T	7.37:g.127975664G>A		Somatic		Capture	Illumina HiSeq	Phase_I	127762900	NM_001166135	A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Silent	SNP	ENST00000223073.2	37	CCDS5801.1																																																																																				0.453	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349442.2	NM_018077	
ZNF703	80139	broad.mit.edu	37	8	37556086	37556087	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr8:37556086_37556087insG	ENST00000331569.4	+	2	1896_1897	c.1667_1668insG	c.(1666-1671)gcggggfs	p.AG556fs		NM_025069.1	NP_079345.1	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	556					adherens junction assembly (GO:0034333)|cellular response to estradiol stimulus (GO:0071392)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.L559fs*>33(1)	FGFR1/ZNF703(2)	breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)	7			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			TTATCCACAGCGGGGGGCCTGG	0.663																																					p.A556fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1667_1668insG	8						.																																			37675245	SO:0001589	frameshift_variant	80139	exon2			AK024361	CCDS6094.1	8p12	2008-05-02				ENSG00000183779			25883	protein-coding gene	gene with protein product						15897872	Standard	NM_025069		Approved	FLJ14299, ZNF503L	uc003xjy.1	Q9H7S9		ENST00000331569.4:c.1673dupG	8.37:g.37556092_37556092dupG	ENSP00000332325:p.Ala556fs	Somatic		Capture	Illumina HiSeq	Phase_I	37675244	NM_025069	Q5XG76	Frame_Shift_Ins	INS	ENST00000331569.4	37	CCDS6094.1																																																																																				0.663	ZNF703-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376683.2	NM_025069	
PRSS55	203074	broad.mit.edu	37	8	10390437	10390437	+	Missense_Mutation	SNP	C	C	T	rs202134590		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr8:10390437C>T	ENST00000328655.3	+	4	660	c.620C>T	c.(619-621)aCg>aTg	p.T207M	PRSS51_ENST00000523024.1_RNA|PRSS55_ENST00000522210.1_Missense_Mutation_p.T207M	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	207	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.T207M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						TCTGTGAAAACGGATCTGATG	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		20003	0.001		0.0	False		,,,				2504	0.0				p.T207M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C620T	8						.						100.0	95.0	97.0					8																	10390437		2203	4300	6503	10427847	SO:0001583	missense	203074	exon4			AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.620C>T	8.37:g.10390437C>T	ENSP00000333003:p.Thr207Met	Somatic		Capture	Illumina HiSeq	Phase_I	10427847	NM_001197020	E5RJX5	Missense_Mutation	SNP	ENST00000328655.3	37	CCDS5976.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	11.24	1.581646	0.28180	.	.	ENSG00000184647	ENST00000328655;ENST00000522210	D;D	0.88896	-2.44;-2.44	5.27	-1.68	0.08212	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.965092	0.08437	N	0.945993	T	0.73992	0.3658	N	0.25245	0.725	0.09310	N	1	P	0.40578	0.722	B	0.32864	0.154	T	0.65784	-0.6084	10	0.46703	T	0.11	.	1.1344	0.01752	0.1428:0.3236:0.2793:0.2543	.	207	Q6UWB4	PRS55_HUMAN	M	207	ENSP00000333003:T207M;ENSP00000430459:T207M	ENSP00000333003:T207M	T	+	2	0	PRSS55	10427847	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.354000	0.02614	-0.205000	0.10219	-0.218000	0.12543	ACG		0.488	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	NM_198464	
OXR1	55074	broad.mit.edu	37	8	107695513	107695513	+	Silent	SNP	C	C	G			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr8:107695513C>G	ENST00000442977.2	+	4	492	c.393C>G	c.(391-393)tcC>tcG	p.S131S	OXR1_ENST00000445937.1_Silent_p.S130S|OXR1_ENST00000497705.1_Silent_p.S63S|OXR1_ENST00000312046.6_Silent_p.S123S|OXR1_ENST00000517566.2_Silent_p.S130S|OXR1_ENST00000452423.2_5'UTR|OXR1_ENST00000531443.1_Silent_p.S130S	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	131					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)	p.S42S(1)|p.S131S(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			AGTTATTCTCCCGAGCAGTTG	0.323																																					p.S123S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C369G	8						.						77.0	77.0	77.0					8																	107695513		2203	4294	6497	107764689	SO:0001819	synonymous_variant	55074	exon3			AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.393C>G	8.37:g.107695513C>G		Somatic		Capture	Illumina HiSeq	Phase_I	107764689	NM_181354	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Silent	SNP	ENST00000442977.2	37	CCDS56548.1	.	.	.	.	.	.	.	.	.	.	C	9.605	1.129646	0.21041	.	.	ENSG00000164830	ENST00000517455	.	.	.	5.25	3.43	0.39272	.	.	.	.	.	T	0.62792	0.2457	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59542	-0.7435	4	.	.	.	-22.5788	12.2022	0.54333	0.0:0.8588:0.0:0.1412	.	.	.	.	R	47	.	.	P	+	2	0	OXR1	107764689	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.968000	0.40500	0.696000	0.31696	0.557000	0.71058	CCC		0.323	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
BMP1	649	broad.mit.edu	37	8	22052282	22052282	+	Missense_Mutation	SNP	G	G	A	rs146182213		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr8:22052282G>A	ENST00000306385.5	+	12	2159	c.1489G>A	c.(1489-1491)Gac>Aac	p.D497N	BMP1_ENST00000397814.3_Missense_Mutation_p.D497N|BMP1_ENST00000354870.5_3'UTR|BMP1_ENST00000306349.8_Missense_Mutation_p.D497N|BMP1_ENST00000397816.3_Missense_Mutation_p.D497N	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	497	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)	p.D497N(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		GGAGGTGCGCGACGGGCACAG	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		18364	0.001		0.0	False		,,,				2504	0.0				p.D497N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1489A	8						.	G	ASN/ASP,ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	53.0	53.0	53.0		1489,1489	5.2	0.6	8	dbSNP_134	53	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	BMP1	NM_001199.3,NM_006129.4	23,23	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging,probably-damaging	497/731,497/987	22052282	3,13003	2203	4300	6503	22108227	SO:0001583	missense	649	exon12				CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.1489G>A	8.37:g.22052282G>A	ENSP00000305714:p.Asp497Asn	Somatic		Capture	Illumina HiSeq	Phase_I	22108227	NM_006129	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	ENST00000306385.5	37	CCDS6026.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	32	5.117133	0.94385	2.27E-4	2.33E-4	ENSG00000168487	ENST00000306385;ENST00000397816;ENST00000306349;ENST00000397814	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.25	5.25	0.73442	CUB (5);	0.000000	0.40064	U	0.001184	T	0.66489	0.2794	M	0.77313	2.365	0.80722	D	1	D;D;D;D	0.89917	0.988;1.0;1.0;0.999	P;D;D;D	0.97110	0.887;1.0;0.998;0.938	T	0.67841	-0.5566	10	0.46703	T	0.11	.	17.6068	0.88040	0.0:0.0:1.0:0.0	.	497;570;497;497	P13497;Q59F71;P13497-2;P13497-6	BMP1_HUMAN;.;.;.	N	497	ENSP00000305714:D497N;ENSP00000380917:D497N;ENSP00000306121:D497N;ENSP00000380915:D497N	ENSP00000306121:D497N	D	+	1	0	BMP1	22108227	1.000000	0.71417	0.629000	0.29254	0.802000	0.45316	9.869000	0.99810	2.438000	0.82558	0.462000	0.41574	GAC		0.612	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	NM_006132	
TRIM55	84675	broad.mit.edu	37	8	67066397	67066397	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr8:67066397G>A	ENST00000315962.4	+	9	1725	c.1352G>A	c.(1351-1353)cGg>cAg	p.R451Q	TRIM55_ENST00000353317.5_Intron|TRIM55_ENST00000350034.4_Intron|TRIM55_ENST00000276573.7_Missense_Mutation_p.R451Q	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	451					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.R451Q(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			GGCCAAACCCGGAAAGCCACC	0.552																																					p.R451Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1352A	8						.						71.0	66.0	67.0					8																	67066397		2203	4300	6503	67228951	SO:0001583	missense	84675	exon9			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.1352G>A	8.37:g.67066397G>A	ENSP00000323913:p.Arg451Gln	Somatic		Capture	Illumina HiSeq	Phase_I	67228951	NM_184085	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	ENST00000315962.4	37	CCDS6184.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199687	0.58126	.	.	ENSG00000147573	ENST00000315962;ENST00000276573	T;T	0.36699	1.24;1.24	6.04	5.14	0.70334	.	0.104424	0.43260	D	0.000586	T	0.19765	0.0475	N	0.16656	0.425	0.80722	D	1	B;B	0.31752	0.338;0.116	B;B	0.16722	0.016;0.014	T	0.04103	-1.0977	10	0.42905	T	0.14	.	10.1609	0.42851	0.0677:0.0:0.7953:0.1369	.	451;451	Q9BYV6;Q9BYV6-3	TRI55_HUMAN;.	Q	451	ENSP00000323913:R451Q;ENSP00000276573:R451Q	ENSP00000276573:R451Q	R	+	2	0	TRIM55	67228951	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.146000	0.50631	2.881000	0.98747	0.650000	0.86243	CGG		0.552	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085	
ZFHX4	79776	broad.mit.edu	37	8	77690522	77690522	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr8:77690522G>T	ENST00000521891.2	+	4	3620	c.3172G>T	c.(3172-3174)Gtc>Ttc	p.V1058F	ZFHX4_ENST00000455469.2_Missense_Mutation_p.V1032F|ZFHX4_ENST00000050961.6_Missense_Mutation_p.V1032F|ZFHX4_ENST00000517683.1_3'UTR|ZFHX4_ENST00000518282.1_Missense_Mutation_p.V1032F	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1032					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.V1058F(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CACCACCAAGGTCAAGTTGAA	0.532										HNSCC(33;0.089)																											p.V1058F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3172T	8						.						155.0	159.0	158.0					8																	77690522		2050	4191	6241	77853077	SO:0001583	missense	79776	exon4				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3172G>T	8.37:g.77690522G>T	ENSP00000430497:p.Val1058Phe	Somatic		Capture	Illumina HiSeq	Phase_I	77853077	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	7.600	0.672579	0.14776	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.22	4.34	0.51931	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);	0.176135	0.26609	U	0.023422	T	0.25195	0.0612	N	0.22421	0.69	0.36998	D	0.895132	B;B;B	0.30146	0.177;0.27;0.27	B;B;B	0.29716	0.049;0.106;0.106	T	0.12941	-1.0528	10	0.10377	T	0.69	.	9.6884	0.40114	0.1594:0.0:0.8406:0.0	.	1032;1032;1058	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	F	1058;1058;1032;1032;1032	ENSP00000430497:V1058F;ENSP00000399605:V1032F;ENSP00000050961:V1032F;ENSP00000430848:V1032F	ENSP00000050961:V1032F	V	+	1	0	ZFHX4	77853077	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.374000	0.66167	1.543000	0.49345	0.650000	0.86243	GTC		0.532	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
TBC1D31	93594	broad.mit.edu	37	8	124121762	124121762	+	Silent	SNP	G	G	T	rs142070556		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr8:124121762G>T	ENST00000287380.1	+	10	1428	c.1338G>T	c.(1336-1338)gcG>gcT	p.A446A	TBC1D31_ENST00000518805.1_Silent_p.A79A|TBC1D31_ENST00000521676.1_Intron|TBC1D31_ENST00000378080.2_Silent_p.A341A|TBC1D31_ENST00000327098.5_Silent_p.A446A|TBC1D31_ENST00000522420.1_Silent_p.A341A|TBC1D31_ENST00000309336.3_Silent_p.A446A	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	446	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)	p.A446A(1)									ATCATACTGCGTTTAGTACCC	0.373																																					p.A446A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1338T	8						.						132.0	133.0	133.0					8																	124121762		2203	4300	6503	124190943	SO:0001819	synonymous_variant	93594	exon10			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.1338G>T	8.37:g.124121762G>T		Somatic		Capture	Illumina HiSeq	Phase_I	124190943	NM_145647	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Silent	SNP	ENST00000287380.1	37	CCDS6338.1																																																																																				0.373	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381721.1	NM_145647	
PTPN3	5774	broad.mit.edu	37	9	112225661	112225661	+	Silent	SNP	C	C	A	rs145689613	byFrequency	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr9:112225661C>A	ENST00000374541.2	-	2	158	c.54G>T	c.(52-54)tcG>tcT	p.S18S	PTPN3_ENST00000262539.3_5'UTR	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	18					negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)	p.S18S(2)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TGGGTAACTCCGAGGTGCGTA	0.398																																					p.S18S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G54T	9						.						128.0	130.0	130.0					9																	112225661		2203	4300	6503	111265482	SO:0001819	synonymous_variant	5774	exon2				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.54G>T	9.37:g.112225661C>A		Somatic		Capture	Illumina HiSeq	Phase_I	111265482	NM_002829	A0AUW9|E7EN99|E9PGU7	Silent	SNP	ENST00000374541.2	37	CCDS6776.1																																																																																				0.398	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
TNFSF8	944	broad.mit.edu	37	9	117668143	117668143	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr9:117668143C>T	ENST00000223795.2	-	3	388	c.275G>A	c.(274-276)aGg>aAg	p.R92K	TNFSF8_ENST00000474301.1_5'Flank	NM_001244.3	NP_001235.1	P32971	TNFL8_HUMAN	tumor necrosis factor (ligand) superfamily, member 8	92					apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)	p.R92K(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(3)|urinary_tract(1)	12						GAATGGAGCCCTTTTCAGGAT	0.418																																					p.R92K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G275A	9						.						169.0	171.0	171.0					9																	117668143		2203	4300	6503	116707964	SO:0001583	missense	944	exon3			L09753	CCDS6810.1, CCDS75884.1	9q33	2008-02-05			ENSG00000106952	ENSG00000106952		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11938	protein-coding gene	gene with protein product		603875		CD30LG		8391931, 9349718	Standard	NM_001244		Approved	CD153	uc004bji.2	P32971	OTTHUMG00000021025	ENST00000223795.2:c.275G>A	9.37:g.117668143C>T	ENSP00000223795:p.Arg92Lys	Somatic		Capture	Illumina HiSeq	Phase_I	116707964	NM_001244	O43404	Missense_Mutation	SNP	ENST00000223795.2	37	CCDS6810.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.441247	0.25900	.	.	ENSG00000106952	ENST00000223795	.	.	.	5.78	-2.65	0.06095	Tumour necrosis factor-like (1);	1.128880	0.06342	N	0.708151	T	0.24736	0.0600	N	0.24115	0.695	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.18903	-1.0322	9	0.22109	T	0.4	-0.3808	5.8464	0.18669	0.1309:0.3511:0.0:0.518	.	92	P32971	TNFL8_HUMAN	K	92	.	ENSP00000223795:R92K	R	-	2	0	TNFSF8	116707964	0.000000	0.05858	0.074000	0.20217	0.957000	0.61999	-0.885000	0.04161	-0.767000	0.04633	-0.140000	0.14226	AGG		0.418	TNFSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055464.1		
PRDM12	59335	broad.mit.edu	37	9	133543602	133543602	+	Missense_Mutation	SNP	C	C	T	rs371786311		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr9:133543602C>T	ENST00000253008.2	+	3	532	c.472C>T	c.(472-474)Cgg>Tgg	p.R158W		NM_021619.2	NP_067632.2	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	158	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				neurogenesis (GO:0022008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R158W(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		GGAGGACCACCGGAGCTGGAT	0.562																																					p.R158W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C472T	9						.	C	TRP/ARG	0,4406		0,0,2203	196.0	145.0	162.0		472	5.2	1.0	9		162	1,8599	1.2+/-3.3	0,1,4299	no	missense	PRDM12	NM_021619.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	158/368	133543602	1,13005	2203	4300	6503	132533423	SO:0001583	missense	59335	exon3			AY004252	CCDS6934.1	9q33-q34	2013-01-08			ENSG00000130711	ENSG00000130711		"""Zinc fingers, C2H2-type"""	13997	protein-coding gene	gene with protein product	"""PR-domain containing protein 12"", ""PR-domain zinc finger protein 12"""					14523459	Standard	NM_021619		Approved		uc004bzt.1	Q9H4Q4	OTTHUMG00000020808	ENST00000253008.2:c.472C>T	9.37:g.133543602C>T	ENSP00000253008:p.Arg158Trp	Somatic		Capture	Illumina HiSeq	Phase_I	132533423	NM_021619	A3KFK9	Missense_Mutation	SNP	ENST00000253008.2	37	CCDS6934.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.945451	0.92593	0.0	1.16E-4	ENSG00000130711	ENST00000253008	T	0.41758	0.99	5.21	5.21	0.72293	SET domain (2);	0.000000	0.85682	D	0.000000	T	0.53351	0.1791	N	0.25647	0.755	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.58047	-0.7705	10	0.72032	D	0.01	-17.9569	17.7439	0.88414	0.0:1.0:0.0:0.0	.	158	Q9H4Q4	PRD12_HUMAN	W	158	ENSP00000253008:R158W	ENSP00000253008:R158W	R	+	1	2	PRDM12	132533423	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	2.842000	0.48230	2.423000	0.82170	0.655000	0.94253	CGG		0.562	PRDM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054664.1	NM_021619	
FRMD3	257019	broad.mit.edu	37	9	85905622	85905622	+	Missense_Mutation	SNP	C	C	T	rs372201657		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr9:85905622C>T	ENST00000304195.3	-	13	1297	c.1091G>A	c.(1090-1092)cGc>cAc	p.R364H	FRMD3_ENST00000376438.1_Missense_Mutation_p.R364H|FRMD3_ENST00000376434.1_Missense_Mutation_p.R170H	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	364						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)		p.R364H(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						GTGGGAACTGCGGCTCTGAGT	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		17791	0.0		0.0	False		,,,				2504	0.001				p.R364H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1091A	9						.	C	HIS/ARG	0,3960		0,0,1980	109.0	115.0	113.0		1091	4.8	1.0	9		113	1,8317		0,1,4158	no	missense	FRMD3	NM_174938.4	29	0,1,6138	TT,TC,CC		0.012,0.0,0.0081	probably-damaging	364/598	85905622	1,12277	1980	4159	6139	85095442	SO:0001583	missense	257019	exon13			AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.1091G>A	9.37:g.85905622C>T	ENSP00000303508:p.Arg364His	Somatic		Capture	Illumina HiSeq	Phase_I	85095442	NM_174938	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Missense_Mutation	SNP	ENST00000304195.3	37	CCDS43840.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482143	0.84747	0.0	1.2E-4	ENSG00000172159	ENST00000376438;ENST00000376434;ENST00000304195	D;D;D	0.86230	-2.09;-2.09;-2.09	5.9	4.83	0.62350	FERM adjacent (FA) (1);	0.056192	0.64402	D	0.000002	D	0.90113	0.6911	L	0.47716	1.5	0.54753	D	0.999981	D;D	0.67145	0.996;0.996	D;P	0.64144	0.922;0.832	D	0.90518	0.4486	10	0.72032	D	0.01	.	14.8755	0.70491	0.0:0.9177:0.0:0.0823	.	364;364	A2A2Y4;A2A2Y4-2	FRMD3_HUMAN;.	H	364;170;364	ENSP00000365621:R364H;ENSP00000365617:R170H;ENSP00000303508:R364H	ENSP00000303508:R364H	R	-	2	0	FRMD3	85095442	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.507000	0.45442	2.806000	0.96561	0.655000	0.94253	CGC		0.532	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157355.1	NM_174938	
SEMA4D	10507	broad.mit.edu	37	9	92007391	92007391	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr9:92007391C>T	ENST00000450295.1	-	8	1345	c.569G>A	c.(568-570)cGa>cAa	p.R190Q	SEMA4D_ENST00000420987.1_Missense_Mutation_p.R190Q|SEMA4D_ENST00000422704.2_Missense_Mutation_p.R190Q|SEMA4D_ENST00000455551.2_Missense_Mutation_p.R190Q|SEMA4D_ENST00000438547.2_Missense_Mutation_p.R190Q|SEMA4D_ENST00000356444.2_Missense_Mutation_p.R190Q|SEMA4D_ENST00000339861.4_Missense_Mutation_p.R190Q|SEMA4D_ENST00000343780.4_Missense_Mutation_p.R190Q			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	190	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.R190Q(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GGAAGAATTTCGGGAGATGAT	0.498																																					p.R190Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G569A	9						.						116.0	108.0	111.0					9																	92007391		2203	4300	6503	91197211	SO:0001583	missense	10507	exon10			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.569G>A	9.37:g.92007391C>T	ENSP00000416523:p.Arg190Gln	Somatic		Capture	Illumina HiSeq	Phase_I	91197211	NM_001142287	B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	ENST00000450295.1	37	CCDS6685.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.012052	0.75046	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000455551;ENST00000343780;ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	T;T;T;T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28	5.92	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	D	0.82430	0.5035	M	0.93507	3.425	0.51482	D	0.999923	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87685	0.2550	10	0.72032	D	0.01	.	16.9992	0.86377	0.0:0.8726:0.1274:0.0	.	190;190	Q92854-2;Q92854	.;SEM4D_HUMAN	Q	190	ENSP00000344923:R190Q;ENSP00000391733:R190Q;ENSP00000411981:R190Q;ENSP00000343418:R190Q;ENSP00000416523:R190Q;ENSP00000405102:R190Q;ENSP00000348822:R190Q;ENSP00000388768:R190Q	ENSP00000344923:R190Q	R	-	2	0	SEMA4D	91197211	1.000000	0.71417	0.205000	0.23548	0.182000	0.23217	7.149000	0.77396	1.469000	0.48083	0.655000	0.94253	CGA		0.498	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1	NM_006378	
ASPN	54829	broad.mit.edu	37	9	95236930	95236930	+	Silent	SNP	G	G	T	rs148382623		TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr9:95236930G>T	ENST00000375544.3	-	2	493	c.250C>A	c.(250-252)Cga>Aga	p.R84R	ASPN_ENST00000375543.1_Silent_p.R84R|ASPN_ENST00000395538.3_Silent_p.R84R|CENPP_ENST00000375587.3_Intron|ASPN_ENST00000450139.2_Silent_p.R56R	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	84	Cys-rich.|LRRNT.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.R84R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						TGTACAACTCGTGAATAGCAC	0.348																																					p.R84R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C250A	9						.						116.0	106.0	109.0					9																	95236930		2203	4300	6503	94276751	SO:0001819	synonymous_variant	54829	exon2			AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.250C>A	9.37:g.95236930G>T		Somatic		Capture	Illumina HiSeq	Phase_I	94276751	NM_001193335	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Silent	SNP	ENST00000375544.3	37																																																																																					0.348	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1	NM_017680	
SARDH	1757	broad.mit.edu	37	9	136595248	136595248	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chr9:136595248C>T	ENST00000371872.4	-	5	1009	c.752G>A	c.(751-753)cGg>cAg	p.R251Q	SARDH_ENST00000422262.2_Missense_Mutation_p.R83Q|SARDH_ENST00000298628.5_Missense_Mutation_p.R251Q|SARDH_ENST00000439388.1_Missense_Mutation_p.R251Q|SARDH_ENST00000371867.1_Missense_Mutation_p.R162Q	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	251					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)	p.R251Q(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		ACCCGCGACCCGCCGCACCCC	0.572																																					p.R251Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G752A	9						.						100.0	91.0	94.0					9																	136595248		2203	4300	6503	135585069	SO:0001583	missense	1757	exon5				CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.752G>A	9.37:g.136595248C>T	ENSP00000360938:p.Arg251Gln	Somatic		Capture	Illumina HiSeq	Phase_I	135585069	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	37	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	C	17.44	3.390291	0.62066	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000422262;ENST00000427237;ENST00000539227;ENST00000535281;ENST00000371867;ENST00000393050;ENST00000298628	D;D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13;-2.13	5.29	5.29	0.74685	FAD dependent oxidoreductase (1);	0.056033	0.64402	D	0.000002	D	0.84674	0.5524	L	0.50847	1.595	0.51482	D	0.99992	P	0.39831	0.69	B	0.36845	0.234	D	0.84987	0.0892	10	0.42905	T	0.14	-38.0602	18.929	0.92556	0.0:1.0:0.0:0.0	.	251	Q9UL12	SARDH_HUMAN	Q	251;251;83;251;251;251;162;229;251	ENSP00000360938:R251Q;ENSP00000403084:R251Q;ENSP00000415537:R83Q;ENSP00000360933:R162Q;ENSP00000298628:R251Q	ENSP00000298628:R251Q	R	-	2	0	SARDH	135585069	1.000000	0.71417	0.997000	0.53966	0.642000	0.38348	3.569000	0.53827	2.463000	0.83235	0.591000	0.81541	CGG		0.572	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
TAF7L	54457	broad.mit.edu	37	X	100547928	100547928	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chrX:100547928C>T	ENST00000372907.3	-	1	117	c.106G>A	c.(106-108)Gac>Aac	p.D36N	TAF7L_ENST00000356784.1_5'Flank|TAF7L_ENST00000372905.2_5'UTR	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	36					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)		p.D36N(1)		NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						GACCCACGGTCGACAAGAATT	0.527																																					p.D36N	Ovarian(104;431 1530 3210 15406 18594)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G106A	X						.						203.0	200.0	201.0					X																	100547928		2203	4300	6503	100434584	SO:0001583	missense	54457	exon1			AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.106G>A	X.37:g.100547928C>T	ENSP00000361998:p.Asp36Asn	Somatic		Capture	Illumina HiSeq	Phase_I	100434584	NM_024885	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	ENST00000372907.3	37	CCDS35347.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.618155	0.46736	.	.	ENSG00000102387	ENST00000372907	T	0.18338	2.22	3.67	-0.703	0.11261	.	0.899431	0.09165	N	0.839639	T	0.08802	0.0218	L	0.27053	0.805	0.09310	N	0.999998	B	0.30033	0.266	B	0.14023	0.01	T	0.30031	-0.9992	10	0.39692	T	0.17	0.1001	3.0495	0.06165	0.1946:0.41:0.0:0.3955	.	36	Q5H9L4	TAF7L_HUMAN	N	36	ENSP00000361998:D36N	ENSP00000361998:D36N	D	-	1	0	TAF7L	100434584	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.619000	0.05572	-0.300000	0.08895	0.600000	0.82982	GAC		0.527	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057526.2		
TENM1	10178	broad.mit.edu	37	X	124097531	124097531	+	Silent	SNP	G	G	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chrX:124097531G>T	ENST00000371130.3	-	1	135	c.72C>A	c.(70-72)acC>acA	p.T24T	TENM1_ENST00000422452.2_Silent_p.T24T	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	24	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.T24T(1)									CAGAAGAACTGGTGTAAGCTA	0.443																																					p.T24T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C72A	X						.						285.0	254.0	264.0					X																	124097531		2203	4300	6503	123925212	SO:0001819	synonymous_variant	10178	exon1			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.72C>A	X.37:g.124097531G>T		Somatic		Capture	Illumina HiSeq	Phase_I	123925212	NM_014253	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																				0.443	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
HTATSF1	27336	broad.mit.edu	37	X	135593892	135593892	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chrX:135593892C>T	ENST00000218364.4	+	9	2162	c.1988C>T	c.(1987-1989)gCg>gTg	p.A663V	HTATSF1_ENST00000535601.1_Missense_Mutation_p.A663V	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	663	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A663V(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					GATAAAAAGGCGGAAGAAGGT	0.403																																					p.A663V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1988T	X						.						160.0	144.0	149.0					X																	135593892		2203	4300	6503	135421558	SO:0001583	missense	27336	exon9			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1988C>T	X.37:g.135593892C>T	ENSP00000218364:p.Ala663Val	Somatic		Capture	Illumina HiSeq	Phase_I	135421558	NM_014500	D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	C	6.461	0.453189	0.12283	.	.	ENSG00000102241	ENST00000535601;ENST00000218364	T;T	0.04317	3.65;3.65	3.61	1.22	0.21188	.	0.349077	0.20704	N	0.087220	T	0.02342	0.0072	N	0.08118	0	0.09310	N	0.999999	B	0.12013	0.005	B	0.01281	0.0	T	0.41858	-0.9485	10	0.72032	D	0.01	-6.383	4.3195	0.11009	0.6854:0.2013:0.1133:0.0	.	663	O43719	HTSF1_HUMAN	V	663	ENSP00000442699:A663V;ENSP00000218364:A663V	ENSP00000218364:A663V	A	+	2	0	HTATSF1	135421558	0.004000	0.15560	0.016000	0.15963	0.009000	0.06853	0.493000	0.22451	0.142000	0.18901	-0.436000	0.05848	GCG		0.403	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
ARSF	416	broad.mit.edu	37	X	3030423	3030423	+	Silent	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chrX:3030423G>A	ENST00000381127.1	+	11	1820	c.1599G>A	c.(1597-1599)aaG>aaA	p.K533K	ARSF_ENST00000359361.2_Silent_p.K533K|ARSF_ENST00000537104.1_Silent_p.K533K	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	533					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.K533K(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGATTAAAAAGGTGGCCAACG	0.562																																					p.K533K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1599A	X						.						100.0	83.0	89.0					X																	3030423		2203	4300	6503	3040423	SO:0001819	synonymous_variant	416	exon11			X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.1599G>A	X.37:g.3030423G>A		Somatic		Capture	Illumina HiSeq	Phase_I	3040423	NM_004042	Q8TCC5	Silent	SNP	ENST00000381127.1	37	CCDS14123.1																																																																																				0.562	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1		
TBL1X	6907	broad.mit.edu	37	X	9660260	9660260	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chrX:9660260C>T	ENST00000217964.7	+	9	1497	c.857C>T	c.(856-858)cCg>cTg	p.P286L	TBL1X_ENST00000380961.1_Missense_Mutation_p.P235L|TBL1X_ENST00000536365.1_Missense_Mutation_p.P235L|TBL1X_ENST00000424279.1_Missense_Mutation_p.P235L|TBL1X_ENST00000407597.2_Missense_Mutation_p.P286L	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	286					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P286L(2)		breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				CATGACGTCCCGAGTAACAAA	0.547																																					p.P235L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C704T	X						.						104.0	90.0	95.0					X																	9660260		2203	4300	6503	9620260	SO:0001583	missense	6907	exon9			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.857C>T	X.37:g.9660260C>T	ENSP00000217964:p.Pro286Leu	Somatic		Capture	Illumina HiSeq	Phase_I	9620260	NM_001139468	A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371795	0.42003	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.59502	0.26;3.53;3.53;3.53;0.26	4.35	4.35	0.52113	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.53867	0.1823	L	0.45352	1.415	0.80722	D	1	D;P	0.53885	0.963;0.926	B;B	0.43728	0.429;0.429	T	0.62081	-0.6929	10	0.62326	D	0.03	.	16.5092	0.84280	0.0:1.0:0.0:0.0	.	249;286	Q59F53;O60907	.;TBL1X_HUMAN	L	286;235;235;235;286	ENSP00000385988:P286L;ENSP00000394097:P235L;ENSP00000445317:P235L;ENSP00000370348:P235L;ENSP00000217964:P286L	ENSP00000217964:P286L	P	+	2	0	TBL1X	9620260	1.000000	0.71417	0.161000	0.22692	0.097000	0.18754	7.195000	0.77798	1.895000	0.54865	0.600000	0.82982	CCG		0.547	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
NHS	4810	broad.mit.edu	37	X	17742544	17742544	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chrX:17742544G>T	ENST00000380060.3	+	5	1509	c.1171G>T	c.(1171-1173)Gaa>Taa	p.E391*	NHS_ENST00000398097.3_Nonsense_Mutation_p.E235*	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	412					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.E235*(1)|p.E391*(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					AGTTCAACAAGAAATAGGTGT	0.388																																					p.E235X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G703T	X						.						85.0	78.0	80.0					X																	17742544		2203	4300	6503	17652465	SO:0001587	stop_gained	4810	exon6				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.1171G>T	X.37:g.17742544G>T	ENSP00000369400:p.Glu391*	Somatic		Capture	Illumina HiSeq	Phase_I	17652465	NM_001136024	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Nonsense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	G	41	8.568417	0.98866	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	.	.	.	5.44	5.44	0.79542	.	0.090805	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-21.0499	18.5982	0.91236	0.0:0.0:1.0:0.0	.	.	.	.	X	391;235;233	.	ENSP00000369397:E233X	E	+	1	0	NHS	17652465	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.721000	0.98766	2.422000	0.82143	0.544000	0.68410	GAA		0.388	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270	
TBC1D25	4943	broad.mit.edu	37	X	48418377	48418377	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chrX:48418377C>T	ENST00000376771.4	+	6	1422	c.1081C>T	c.(1081-1083)Cgc>Tgc	p.R361C	TBC1D25_ENST00000537536.1_Missense_Mutation_p.R107C|snoU13_ENST00000459609.1_RNA	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	361	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)	p.R361C(1)		large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CATCATGAAACGCCTGGCCGC	0.562																																					p.R361C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1081T	X						.						48.0	31.0	37.0					X																	48418377		2203	4298	6501	48303321	SO:0001583	missense	4943	exon6			L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.1081C>T	X.37:g.48418377C>T	ENSP00000365962:p.Arg361Cys	Somatic		Capture	Illumina HiSeq	Phase_I	48303321	NM_002536	Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	ENST00000376771.4	37	CCDS35242.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.556171	0.27827	.	.	ENSG00000068354	ENST00000376771;ENST00000537536	T;T	0.05139	3.49;3.49	5.65	4.79	0.61399	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.33000	0.0848	H	0.96333	3.805	0.58432	D	0.999999	D;D;P	0.71674	0.998;0.998;0.818	P;P;P	0.61003	0.882;0.882;0.502	T	0.50816	-0.8783	10	0.87932	D	0	-4.2707	12.91	0.58175	0.1635:0.8365:0.0:0.0	.	365;303;361	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	C	361;107	ENSP00000365962:R361C;ENSP00000444091:R107C	ENSP00000365962:R361C	R	+	1	0	TBC1D25	48303321	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	4.353000	0.59411	1.174000	0.42811	-0.413000	0.06143	CGC		0.562	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060764.2	NM_002536	
WNK3	65267	broad.mit.edu	37	X	54276548	54276548	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chrX:54276548C>G	ENST00000375159.2	-	15	2591	c.2592G>C	c.(2590-2592)caG>caC	p.Q864H	WNK3_ENST00000354646.2_Missense_Mutation_p.Q864H|WNK3_ENST00000375169.3_Missense_Mutation_p.Q864H			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	864					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q864H(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CTGGGGATGACTGAGGAGCAG	0.398																																					p.Q864H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2592C	X						.						37.0	32.0	34.0					X																	54276548		2203	4300	6503	54293273	SO:0001583	missense	65267	exon16			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.2592G>C	X.37:g.54276548C>G	ENSP00000364301:p.Gln864His	Somatic		Capture	Illumina HiSeq	Phase_I	54293273	NM_001002838	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	37	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827147	0.32329	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.29917	1.55;1.55;1.55	5.5	5.5	0.81552	.	0.000000	0.53938	D	0.000059	T	0.24275	0.0588	L	0.32530	0.975	0.33482	D	0.58759	B;B	0.23185	0.081;0.048	B;B	0.21151	0.033;0.015	T	0.28038	-1.0056	10	0.51188	T	0.08	-6.3671	11.2859	0.49222	0.0:0.9099:0.0:0.0901	.	864;864	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	H	864	ENSP00000364312:Q864H;ENSP00000346667:Q864H;ENSP00000364301:Q864H	ENSP00000346667:Q864H	Q	-	3	2	WNK3	54293273	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.100000	0.41777	2.302000	0.77476	0.506000	0.49869	CAG		0.398	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
MAGEC1	9947	broad.mit.edu	37	X	140995938	140995938	+	Silent	SNP	G	G	A			TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3875-01A-01W-0900-09	TCGA-AA-3875-10A-01W-0902-09	g.chrX:140995938G>A	ENST00000285879.4	+	4	3034	c.2748G>A	c.(2746-2748)gcG>gcA	p.A916A	MAGEC1_ENST00000406005.2_5'UTR	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	916	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.A916A(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					ACGAGTTGGCGCGGTTTCTTC	0.483										HNSCC(15;0.026)			G|||	1	0.000264901	0.0	0.0	3775	,	,		13260	0.001		0.0	False		,,,				2504	0.0				p.A916A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2748A	X						.						166.0	162.0	163.0					X																	140995938		2203	4300	6503	140823604	SO:0001819	synonymous_variant	9947	exon4			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2748G>A	X.37:g.140995938G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140823604	NM_005462	A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	CCDS35417.1																																																																																				0.483	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
