#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF22	7570	broad.mit.edu	37	10	45499897	45499898	+	3'UTR	INS	-	-	AAAATT	rs57376331|rs112642104|rs67383081	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	-	-	-	AAAATT	-	AAAATT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr10:45499897_45499898insAAAATT	ENST00000298299.3	+	0	1674_1675				CEP164P1_ENST00000456938.2_RNA	NM_006963.4	NP_008894.2	P17026	ZNF22_HUMAN	zinc finger protein 22						odontogenesis (GO:0042476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(2)|lung(2)	8		Prostate(175;0.0352)|all_neural(218;0.202)				CTGTGGAAGAAAAAAGGGAGAA	0.337														3720	0.742812	0.7761	0.8112	5008	,	,		17508	0.619		0.7624	False		,,,				2504	0.7566				.												.	.	0			.	10						.																																			44819904	SO:0001624	3_prime_UTR_variant	7570	.			BC041139	CCDS7211.1	10q11	2013-01-08	2012-07-12		ENSG00000165512	ENSG00000165512		"""Zinc fingers, C2H2-type"""	13012	protein-coding gene	gene with protein product		194529					Standard	NM_006963		Approved	KOX15, HKR-T1, ZNF422, Zfp422	uc001jbw.3	P17026	OTTHUMG00000018064	ENST00000298299.3:c.*407->AAAATT	10.37:g.45499897_45499898insAAAATT		Germline		Capture	Illumina HiSeq	Phase_I	44819903	.	Q5T741|Q96FM4	Splice_Site	INS	ENST00000298299.3	37	CCDS7211.1																																																																																				0.337	ZNF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047761.1	NM_006963	
ITIH5	80760	broad.mit.edu	37	10	7605141	7605141	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr10:7605141C>T	ENST00000256861.6	-	14	2812	c.2734G>A	c.(2734-2736)Gcc>Acc	p.A912T	ITIH5_ENST00000298441.6_Missense_Mutation_p.A698T|ITIH5_ENST00000446830.2_Missense_Mutation_p.A694T|ITIH5_ENST00000397146.2_Intron	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	912					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A912T(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						ATCAGTTTGGCGGCATTGTTC	0.522																																					p.A912T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2734A	10						.						193.0	155.0	168.0					10																	7605141		2203	4300	6503	7645147	SO:0001583	missense	80760	exon14					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2734G>A	10.37:g.7605141C>T	ENSP00000256861:p.Ala912Thr	Somatic		Capture	Illumina HiSeq	Phase_I	7645147	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		.	.	.	.	.	.	.	.	.	.	C	21.4	4.150437	0.78001	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.01902	4.78;4.57;4.58	5.79	3.89	0.44902	.	0.501998	0.22734	N	0.056287	T	0.07818	0.0196	.	.	.	0.80722	D	1	D;D	0.71674	0.998;0.995	P;P	0.59056	0.801;0.851	T	0.20739	-1.0266	9	0.34782	T	0.22	-13.3339	12.9549	0.58421	0.1296:0.746:0.1244:0.0	.	912;698	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	T	912;698;694	ENSP00000256861:A912T;ENSP00000298441:A698T;ENSP00000387969:A694T	ENSP00000256861:A912T	A	-	1	0	ITIH5	7645147	1.000000	0.71417	0.059000	0.19551	0.800000	0.45204	4.508000	0.60441	0.736000	0.32559	0.650000	0.86243	GCC		0.522	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
CTNNA3	29119	broad.mit.edu	37	10	69299303	69299303	+	Silent	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr10:69299303C>T	ENST00000433211.2	-	4	591	c.417G>A	c.(415-417)gcG>gcA	p.A139A	CTNNA3_ENST00000373744.4_Silent_p.A139A|CTNNA3_ENST00000545309.1_Silent_p.A139A	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.A139A(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						CAATCATGTCCGCAAGGATAA	0.468																																					p.A139A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G417A	10						.						92.0	81.0	84.0					10																	69299303		2203	4300	6503	68969309	SO:0001819	synonymous_variant	29119	exon4			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.417G>A	10.37:g.69299303C>T		Somatic		Capture	Illumina HiSeq	Phase_I	68969309	NM_013266		Silent	SNP	ENST00000433211.2	37	CCDS7269.1																																																																																				0.468	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
WT1	7490	broad.mit.edu	37	11	32421569	32421569	+	Silent	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr11:32421569G>A	ENST00000379079.2	-	6	660	c.387C>T	c.(385-387)agC>agT	p.S129S	WT1_ENST00000332351.3_Silent_p.S341S|WT1_ENST00000448076.3_Silent_p.S341S|WT1_ENST00000530998.1_Silent_p.S112S	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	273					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.S273S(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TGTGGTTATCGCTCTCGTACC	0.542			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.S129S		yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	WT1,peritoneum,NS,Substitution - Missense,-2 	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C387T	11						.						267.0	225.0	239.0					11																	32421569		2202	4299	6501	32378145	SO:0001819	synonymous_variant	7490	exon6	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.387C>T	11.37:g.32421569G>A		Somatic		Capture	Illumina HiSeq	Phase_I	32378145	NM_001198551	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000379079.2	37	CCDS55751.1	.	.	.	.	.	.	.	.	.	.	G	5.875	0.345652	0.11126	.	.	ENSG00000184937	ENST00000527882	.	.	.	5.98	-10.7	0.00240	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5173	0.95170	0.4199:0.0:0.5801:0.0	.	.	.	.	X	32	.	.	R	-	1	2	WT1	32378145	0.027000	0.19231	0.121000	0.21740	0.587000	0.36485	-0.497000	0.06428	-1.949000	0.01031	-0.827000	0.03088	CGA		0.542	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378	
FADS3	3995	broad.mit.edu	37	11	61641303	61641303	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr11:61641303C>T	ENST00000278829.2	-	12	1473	c.1321G>A	c.(1321-1323)Gcc>Acc	p.A441T	FADS3_ENST00000527697.1_Missense_Mutation_p.A326T|FADS3_ENST00000525588.1_Missense_Mutation_p.A413T|FADS3_ENST00000540820.1_3'UTR	NM_021727.3	NP_068373.1	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	441					unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717)	p.A441T(2)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGGAGGTAGGCGTCCAGCCAG	0.632																																					p.A441T												.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.G1321A	11						.						40.0	36.0	38.0					11																	61641303		2202	4297	6499	61397879	SO:0001583	missense	3995	exon12				CCDS8013.1	11q12-q13.1	2013-01-25			ENSG00000221968	ENSG00000221968	1.14.19.3	"""Fatty acid desaturases"""	3576	protein-coding gene	gene with protein product	"""delta-9-desaturase"""	606150		LLCDL3			Standard	NM_021727		Approved	CYB5RP	uc001nsm.3	Q9Y5Q0	OTTHUMG00000167500	ENST00000278829.2:c.1321G>A	11.37:g.61641303C>T	ENSP00000278829:p.Ala441Thr	Somatic		Capture	Illumina HiSeq	Phase_I	61397879	NM_021727	O60426	Missense_Mutation	SNP	ENST00000278829.2	37	CCDS8013.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	24.2|24.2	4.509220|4.509220	0.85282|0.85282	.|.	.|.	ENSG00000221968|ENSG00000221968	ENST00000527697;ENST00000278829;ENST00000525588|ENST00000525094	T;T;T|.	0.60920|.	1.77;0.15;0.19|.	4.78|4.78	3.87|3.87	0.44632|0.44632	.|.	.|.	.|.	.|.	.|.	T|T	0.79862|0.79862	0.4519|0.4519	M|M	0.91090|0.91090	3.175|3.175	0.80722|0.80722	D|D	1|1	B;D|.	0.71674|.	0.186;0.998|.	B;P|.	0.58520|.	0.109;0.84|.	T|T	0.82981|0.82981	-0.0187|-0.0187	9|5	0.59425|.	D|.	0.04|.	0.5283|0.5283	11.9979|11.9979	0.53214|0.53214	0.0:0.9141:0.0:0.0859|0.0:0.9141:0.0:0.0859	.|.	326;441|.	E9PKP8;Q9Y5Q0|.	.;FADS3_HUMAN|.	T|H	326;441;413|111	ENSP00000431533:A326T;ENSP00000278829:A441T;ENSP00000432206:A413T|.	ENSP00000278829:A441T|.	A|R	-|-	1|2	0|0	FADS3|FADS3	61397879|61397879	0.995000|0.995000	0.38212|0.38212	0.998000|0.998000	0.56505|0.56505	0.916000|0.916000	0.54674|0.54674	3.307000|3.307000	0.51888|0.51888	1.015000|1.015000	0.39444|0.39444	-0.264000|-0.264000	0.10439|0.10439	GCC|CGC		0.632	FADS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394836.1		
TMEM135	65084	broad.mit.edu	37	11	87032259	87032259	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr11:87032259C>T	ENST00000305494.5	+	15	1300	c.1261C>T	c.(1261-1263)Cga>Tga	p.R421*	TMEM135_ENST00000340353.7_Nonsense_Mutation_p.R399*|TMEM135_ENST00000532959.1_Nonsense_Mutation_p.R292*|TMEM135_ENST00000535167.1_Nonsense_Mutation_p.R282*	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	421					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)		p.R421*(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TGTCATGAACCGAAAAGTCCT	0.328																																					p.R399X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1195T	11						.						86.0	81.0	83.0					11																	87032259		2201	4299	6500	86709907	SO:0001587	stop_gained	65084	exon14			BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.1261C>T	11.37:g.87032259C>T	ENSP00000306344:p.Arg421*	Somatic		Capture	Illumina HiSeq	Phase_I	86709907	NM_001168724	Q6AW91|Q8ND01|Q9H6M3	Nonsense_Mutation	SNP	ENST00000305494.5	37	CCDS8280.1	.	.	.	.	.	.	.	.	.	.	C	32	5.126971	0.94429	.	.	ENSG00000166575	ENST00000340353;ENST00000544294;ENST00000532959;ENST00000305494;ENST00000535167	.	.	.	5.64	3.61	0.41365	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.7877	12.4229	0.55529	0.657:0.343:0.0:0.0	.	.	.	.	X	399;258;292;421;282	.	.	R	+	1	2	TMEM135	86709907	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.063000	0.49978	0.663000	0.31027	0.655000	0.94253	CGA		0.328	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918	
PRDM10	56980	broad.mit.edu	37	11	129787051	129787051	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr11:129787051G>A	ENST00000360871.3	-	15	2527	c.2296C>T	c.(2296-2298)Cgt>Tgt	p.R766C	PRDM10_ENST00000304538.6_Missense_Mutation_p.R680C|PRDM10_ENST00000528746.1_Missense_Mutation_p.R740C|PRDM10_ENST00000526082.1_Missense_Mutation_p.R684C|PRDM10_ENST00000423662.2_Missense_Mutation_p.R684C|PRDM10_ENST00000358825.5_Missense_Mutation_p.R770C	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	770					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R766C(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		AAGTAATCACGATTGGGTTTT	0.393																																					p.R770C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2308T	11						.						201.0	180.0	187.0					11																	129787051		2201	4297	6498	129292261	SO:0001583	missense	56980	exon16			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.2296C>T	11.37:g.129787051G>A	ENSP00000354118:p.Arg766Cys	Somatic		Capture	Illumina HiSeq	Phase_I	129292261	NM_020228	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.547570	0.65311	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.12039	2.74;2.76;2.74;2.73;2.8;2.72;2.84	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.34832	0.0911	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.85130	0.993;0.997;0.993;0.997;0.996;0.997	T	0.02398	-1.1165	10	0.87932	D	0	-23.192	14.2109	0.65764	0.0:0.0:0.8142:0.1858	.	680;766;770;684;680;684	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	C	770;680;766;684;740;684;483	ENSP00000351686:R770C;ENSP00000302669:R680C;ENSP00000354118:R766C;ENSP00000398431:R684C;ENSP00000431262:R740C;ENSP00000432237:R684C;ENSP00000435940:R483C	ENSP00000302669:R680C	R	-	1	0	PRDM10	129292261	1.000000	0.71417	0.998000	0.56505	0.671000	0.39405	4.337000	0.59310	2.597000	0.87782	0.655000	0.94253	CGT		0.393	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
GUCY2C	2984	broad.mit.edu	37	12	14822656	14822656	+	Splice_Site	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr12:14822656C>T	ENST00000261170.3	-	10	1418	c.1282G>A	c.(1282-1284)Ggc>Agc	p.G428S	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	428					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)	p.G428S(1)		breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	GATATCTTACCCCGGCCTGTA	0.388																																					p.G428S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1282A	12						.						98.0	95.0	96.0					12																	14822656		2203	4300	6503	14713923	SO:0001630	splice_region_variant	2984	exon10				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.1282+1G>A	12.37:g.14822656C>T		Somatic		Capture	Illumina HiSeq	Phase_I	14713923	NM_004963	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947562	0.53186	.	.	ENSG00000070019	ENST00000261170	D	0.81996	-1.56	5.4	5.4	0.78164	.	0.380726	0.31268	N	0.007946	T	0.81688	0.4875	L	0.59436	1.845	0.48901	D	0.999725	B	0.33964	0.434	B	0.37780	0.258	T	0.79082	-0.1949	9	.	.	.	.	15.0342	0.71731	0.0:1.0:0.0:0.0	.	428	P25092	GUC2C_HUMAN	S	428	ENSP00000261170:G428S	.	G	-	1	0	GUCY2C	14713923	0.977000	0.34250	0.960000	0.40013	0.715000	0.41141	2.553000	0.45837	2.692000	0.91855	0.655000	0.94253	GGC		0.388	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		Missense_Mutation
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ANP32D	23519	broad.mit.edu	37	12	48866584	48866584	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr12:48866584T>C	ENST00000266594.1	+	1	137	c.137T>C	c.(136-138)tTa>tCa	p.L46S		NM_012404.2	NP_036536.2	O95626	AN32D_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member D	46			L -> F (in dbSNP:rs7956679).			nuclear matrix (GO:0016363)		p.L46S(1)		central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	9						GAACTGGAATTATTAAATACA	0.413																																					p.L46S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T137C	12						.						126.0	127.0	127.0					12																	48866584		2203	4300	6503	47152851	SO:0001583	missense	23519	exon1			U71084	CCDS31788.1	12q13.12	2008-08-04			ENSG00000139223	ENSG00000139223		"""ANP32 acidic nuclear phosphoproteins"""	16676	protein-coding gene	gene with protein product	"""pp32 related 2"""	606878				10086381, 10400610	Standard	NM_012404		Approved	PP32R2	uc010slt.2	O95626	OTTHUMG00000162681	ENST00000266594.1:c.137T>C	12.37:g.48866584T>C	ENSP00000266594:p.Leu46Ser	Somatic		Capture	Illumina HiSeq	Phase_I	47152851	NM_012404	Q6NTC4	Missense_Mutation	SNP	ENST00000266594.1	37	CCDS31788.1	.	.	.	.	.	.	.	.	.	.	T	8.693	0.907926	0.17833	.	.	ENSG00000139223	ENST00000266594	T	0.00346	8.01	1.57	1.57	0.23409	.	0.000000	0.85682	D	0.000000	T	0.00144	0.0004	N	0.12182	0.205	0.23542	N	0.997454	B	0.09022	0.002	B	0.04013	0.001	T	0.24799	-1.0150	10	0.29301	T	0.29	.	6.9472	0.24526	0.0:0.0:0.0:1.0	.	46	O95626	AN32D_HUMAN	S	46	ENSP00000266594:L46S	ENSP00000266594:L46S	L	+	2	0	ANP32D	47152851	1.000000	0.71417	0.013000	0.15412	0.053000	0.15095	3.620000	0.54203	0.756000	0.33013	0.102000	0.15555	TTA		0.413	ANP32D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370058.1	NM_012404	
RILPL2	196383	broad.mit.edu	37	12	123920952	123920952	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr12:123920952C>T	ENST00000280571.8	-	1	312	c.16G>A	c.(16-18)Gtg>Atg	p.V6M		NM_145058.1	NP_659495.1	Q969X0	RIPL2_HUMAN	Rab interacting lysosomal protein-like 2	6					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|primary cilium (GO:0072372)	identical protein binding (GO:0042802)	p.V6M(1)		endometrium(1)|large_intestine(2)|lung(2)|skin(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000546)|Epithelial(86;0.00179)|all cancers(50;0.0168)		tcttcTCGCACAGGGGGCTCC	0.657																																					p.V6M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G16A	12						.						16.0	13.0	14.0					12																	123920952		2080	4056	6136	122486905	SO:0001583	missense	196383	exon1			AB085763	CCDS9248.1	12q24.31	2007-11-27				ENSG00000150977			28787	protein-coding gene	gene with protein product		614093				14668488	Standard	NM_145058		Approved	MGC7036, FLJ30380, FLJ32372	uc001uey.1	Q969X0		ENST00000280571.8:c.16G>A	12.37:g.123920952C>T	ENSP00000280571:p.Val6Met	Somatic		Capture	Illumina HiSeq	Phase_I	122486905	NM_145058		Missense_Mutation	SNP	ENST00000280571.8	37	CCDS9248.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.809581	0.50421	.	.	ENSG00000150977	ENST00000280571	T	0.48522	0.81	5.17	-5.31	0.02730	.	783.089000	0.00166	N	0.000000	T	0.33876	0.0878	N	0.22421	0.69	0.09310	N	1	B	0.34015	0.435	B	0.31290	0.127	T	0.46679	-0.9174	10	0.87932	D	0	.	11.197	0.48719	0.1457:0.5896:0.2647:0.0	.	6	Q969X0	RIPL2_HUMAN	M	6	ENSP00000280571:V6M	ENSP00000280571:V6M	V	-	1	0	RILPL2	122486905	0.000000	0.05858	0.037000	0.18230	0.906000	0.53458	-0.695000	0.05109	-0.547000	0.06207	-0.321000	0.08615	GTG		0.657	RILPL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145058	
SPERT	220082	broad.mit.edu	37	13	46288409	46288409	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr13:46288409G>A	ENST00000310521.1	+	3	1329	c.1249G>A	c.(1249-1251)Gtg>Atg	p.V417M	SPERT_ENST00000378966.3_Missense_Mutation_p.V381M	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	417						cytoplasmic membrane-bounded vesicle (GO:0016023)		p.V417M(1)		NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		CATTGACACCGTGACCGAGGT	0.612																																					p.V417M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1249A	13						.						26.0	24.0	25.0					13																	46288409		2202	4300	6502	45186410	SO:0001583	missense	220082	exon3			AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.1249G>A	13.37:g.46288409G>A	ENSP00000309189:p.Val417Met	Somatic		Capture	Illumina HiSeq	Phase_I	45186410	NM_152719	A8K8I5|Q8NHV2	Missense_Mutation	SNP	ENST00000310521.1	37	CCDS9399.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626994	0.66901	.	.	ENSG00000174015	ENST00000310521;ENST00000378966	T;T	0.57107	0.43;0.42	5.17	5.17	0.71159	.	0.000000	0.50627	D	0.000119	T	0.54013	0.1832	N	0.08118	0	0.32204	N	0.577393	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.65191	-0.6228	10	0.72032	D	0.01	.	15.512	0.75789	0.0:0.0:1.0:0.0	.	381;417	Q8NA61-2;Q8NA61	.;SPERT_HUMAN	M	417;381	ENSP00000309189:V417M;ENSP00000368249:V381M	ENSP00000309189:V417M	V	+	1	0	SPERT	45186410	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.530000	0.45641	2.680000	0.91292	0.609000	0.83330	GTG		0.612	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044786.2	NM_152719	
TMCO3	55002	broad.mit.edu	37	13	114154385	114154385	+	Missense_Mutation	SNP	T	T	G	rs112026532		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr13:114154385T>G	ENST00000434316.2	+	4	1096	c.737T>G	c.(736-738)aTt>aGt	p.I246S	TMCO3_ENST00000375391.1_Missense_Mutation_p.I246S|TMCO3_ENST00000474393.1_3'UTR	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	246						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.I246S(1)		NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			AGCATGCTGATTGACTCCCAG	0.443																																					p.I246S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T737G	13						.						131.0	126.0	128.0					13																	114154385		2203	4300	6503	113202386	SO:0001583	missense	55002	exon4			BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.737T>G	13.37:g.114154385T>G	ENSP00000389399:p.Ile246Ser	Somatic		Capture	Illumina HiSeq	Phase_I	113202386	NM_017905	Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Missense_Mutation	SNP	ENST00000434316.2	37	CCDS9537.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.000983	0.74818	.	.	ENSG00000150403	ENST00000434316;ENST00000375391	T	0.45668	0.89	5.21	4.02	0.46733	.	0.000000	0.85682	D	0.000000	T	0.51075	0.1653	L	0.32530	0.975	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.76575	0.959;0.988	T	0.52381	-0.8583	10	0.87932	D	0	-13.2183	11.3005	0.49302	0.0:0.0724:0.0:0.9276	.	246;246	Q6UWJ1;Q6UWJ1-2	TMCO3_HUMAN;.	S	246	ENSP00000389399:I246S	ENSP00000364540:I246S	I	+	2	0	TMCO3	113202386	1.000000	0.71417	0.298000	0.25002	0.974000	0.67602	7.555000	0.82223	0.919000	0.36945	0.477000	0.44152	ATT		0.443	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045931.3	NM_017905	
SPTB	6710	broad.mit.edu	37	14	65241881	65241881	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr14:65241881C>T	ENST00000389721.5	-	22	4836	c.4804G>A	c.(4804-4806)Gag>Aag	p.E1602K	SPTB_ENST00000556626.1_Missense_Mutation_p.E1602K|SPTB_ENST00000542895.1_Missense_Mutation_p.E1602K|SPTB_ENST00000389722.3_Missense_Mutation_p.E1602K|SPTB_ENST00000389720.3_Missense_Mutation_p.E1602K	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1602					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.E1602K(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		AGCTCCTGCTCGCCAATCCAG	0.642																																					p.E1602K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4804A	14						.						131.0	102.0	112.0					14																	65241881		2203	4300	6503	64311634	SO:0001583	missense	6710	exon22				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.4804G>A	14.37:g.65241881C>T	ENSP00000374371:p.Glu1602Lys	Somatic		Capture	Illumina HiSeq	Phase_I	64311634	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.765818	0.90020	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.73369	0.3578	M	0.92169	3.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.80863	-0.1192	10	0.87932	D	0	.	17.7078	0.88313	0.0:1.0:0.0:0.0	.	386;1602;1606	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	K	1606;1602;386;267;1602;1602;1602;1602	ENSP00000374372:E1602K;ENSP00000451324:E267K;ENSP00000451752:E1602K;ENSP00000374371:E1602K;ENSP00000443882:E1602K;ENSP00000374370:E1602K	ENSP00000334218:E386K	E	-	1	0	SPTB	64311634	1.000000	0.71417	1.000000	0.80357	0.437000	0.31866	7.818000	0.86416	2.532000	0.85374	0.561000	0.74099	GAG		0.642	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
TOX4	9878	broad.mit.edu	37	14	21961232	21961232	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr14:21961232delA	ENST00000405508.1	+	8	1733	c.1457delA	c.(1456-1458)caafs	p.Q487fs	TOX4_ENST00000262709.3_Frame_Shift_Del_p.Q487fs|TOX4_ENST00000448790.2_Frame_Shift_Del_p.Q464fs			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	487	Gln/Pro-rich.					chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)	p.Q486fs*16(1)		large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		AATTTACAGCAACAGCCTCCT	0.532																																					p.Q486fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1457delA	14						.						86.0	78.0	81.0					14																	21961232		2203	4300	6503	21031072	SO:0001589	frameshift_variant	9878	exon7			AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.1457delA	14.37:g.21961232delA	ENSP00000385102:p.Gln487fs	Somatic		Capture	Illumina HiSeq	Phase_I	21031072	NM_014828	B4DPY8|B4DSM0|E7EV69	Frame_Shift_Del	DEL	ENST00000405508.1	37	CCDS32043.1																																																																																				0.532	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317287.2	NM_014828	
KCNK10	54207	broad.mit.edu	37	14	88658593	88658593	+	Silent	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr14:88658593C>T	ENST00000340700.5	-	5	1279	c.828G>A	c.(826-828)acG>acA	p.T276T	KCNK10_ENST00000319231.5_Silent_p.T281T|KCNK10_ENST00000312350.5_Silent_p.T281T	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	276					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.T281T(1)|p.T276T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						CAAAGCCCACCGTGGTCAGAG	0.537																																					p.T281T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G843A	14						.						98.0	108.0	105.0					14																	88658593		2203	4300	6503	87728346	SO:0001819	synonymous_variant	54207	exon5			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.828G>A	14.37:g.88658593C>T		Somatic		Capture	Illumina HiSeq	Phase_I	87728346	NM_138317	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Silent	SNP	ENST00000340700.5	37	CCDS9880.1																																																																																				0.537	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
RYR3	6263	broad.mit.edu	37	15	33952476	33952476	+	Missense_Mutation	SNP	G	G	A	rs202225145		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr15:33952476G>A	ENST00000389232.4	+	34	4544	c.4474G>A	c.(4474-4476)Gtc>Atc	p.V1492I	RYR3_ENST00000415757.3_Missense_Mutation_p.V1492I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1492	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.V1492I(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCGGCTGGACGTCCAAACCAT	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		17435	0.0		0.0	False		,,,				2504	0.001				p.V1492I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4474A	15						.						33.0	37.0	36.0					15																	33952476		2132	4243	6375	31739768	SO:0001583	missense	6263	exon34				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.4474G>A	15.37:g.33952476G>A	ENSP00000373884:p.Val1492Ile	Somatic		Capture	Illumina HiSeq	Phase_I	31739768	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694540	0.88830	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.97850	-4.57;-4.57	4.84	3.93	0.45458	.	0.073893	0.53938	N	0.000047	D	0.97854	0.9295	M	0.67700	2.07	0.53005	D	0.999967	D;D	0.76494	0.999;0.996	P;P	0.59487	0.858;0.791	D	0.97877	1.0289	10	0.59425	D	0.04	.	13.2258	0.59914	0.0764:0.0:0.9236:0.0	.	1492;1492	Q15413-2;Q15413	.;RYR3_HUMAN	I	1492	ENSP00000373884:V1492I;ENSP00000399610:V1492I	ENSP00000354735:V1492I	V	+	1	0	RYR3	31739768	1.000000	0.71417	0.754000	0.31244	0.959000	0.62525	5.485000	0.66850	1.273000	0.44346	0.655000	0.94253	GTC		0.622	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
IGDCC3	9543	broad.mit.edu	37	15	65667641	65667641	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr15:65667641G>A	ENST00000327987.4	-	2	454	c.203C>T	c.(202-204)aCc>aTc	p.T68I		NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	68	Ig-like C2-type 1.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.T68I(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CACTGGAGGGGTCCCCTCCAC	0.587																																					p.T68I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C203T	15						.						63.0	47.0	52.0					15																	65667641		2201	4299	6500	63454694	SO:0001583	missense	9543	exon2			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.203C>T	15.37:g.65667641G>A	ENSP00000332773:p.Thr68Ile	Somatic		Capture	Illumina HiSeq	Phase_I	63454694	NM_004884	O95215	Missense_Mutation	SNP	ENST00000327987.4	37	CCDS10205.1	.	.	.	.	.	.	.	.	.	.	G	7.676	0.688039	0.14973	.	.	ENSG00000174498	ENST00000327987	T	0.68331	-0.32	5.63	3.75	0.43078	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.591117	0.17061	N	0.188550	T	0.43456	0.1248	N	0.11870	0.19	0.30187	N	0.799836	B	0.06786	0.001	B	0.10450	0.005	T	0.33727	-0.9857	10	0.36615	T	0.2	-19.4093	4.5575	0.12143	0.2676:0.1672:0.5652:0.0	.	68	Q8IVU1	IGDC3_HUMAN	I	68	ENSP00000332773:T68I	ENSP00000332773:T68I	T	-	2	0	IGDCC3	63454694	1.000000	0.71417	0.997000	0.53966	0.221000	0.24807	2.985000	0.49362	0.727000	0.32360	0.655000	0.94253	ACC		0.587	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884	
CHRNA5	1138	broad.mit.edu	37	15	78882676	78882676	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr15:78882676G>C	ENST00000299565.5	+	5	1143	c.943G>C	c.(943-945)Gag>Cag	p.E315Q	CHRNA5_ENST00000559554.1_Intron|RP11-650L12.2_ENST00000567141.1_RNA	NM_000745.3	NP_000736.2	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5 (neuronal)	315					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.E315Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|skin(3)	15					Galantamine(DB00674)|Nicotine(DB00184)	TCTAATTGGAGAGTATCTGGT	0.378																																					p.E315Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G943C	15						.						122.0	102.0	109.0					15																	78882676		2196	4293	6489	76669731	SO:0001583	missense	1138	exon5				CCDS10304.1	15q24	2012-02-11	2012-02-07		ENSG00000169684	ENSG00000169684		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1959	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 5 (neuronal)"""	118505	"""cholinergic receptor, nicotinic, alpha polypeptide 5"""			2004777	Standard	NM_000745		Approved		uc002bdy.3	P30532	OTTHUMG00000143858	ENST00000299565.5:c.943G>C	15.37:g.78882676G>C	ENSP00000299565:p.Glu315Gln	Somatic		Capture	Illumina HiSeq	Phase_I	76669731	NM_000745	Q15824|Q99554	Missense_Mutation	SNP	ENST00000299565.5	37	CCDS10304.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.648798	0.87958	.	.	ENSG00000169684	ENST00000299565;ENST00000394802	T	0.70282	-0.47	5.09	5.09	0.68999	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	T	0.77948	0.4207	L	0.31578	0.945	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80176	-0.1491	10	0.62326	D	0.03	.	18.8649	0.92287	0.0:0.0:1.0:0.0	.	315	P30532	ACHA5_HUMAN	Q	315;266	ENSP00000299565:E315Q	ENSP00000299565:E315Q	E	+	1	0	CHRNA5	76669731	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.805000	0.99149	2.527000	0.85204	0.563000	0.77884	GAG		0.378	CHRNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290106.1		
NTRK3	4916	broad.mit.edu	37	15	88472460	88472460	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr15:88472460C>T	ENST00000360948.2	-	16	2256	c.2095G>A	c.(2095-2097)Ggc>Agc	p.G699S	NTRK3_ENST00000558676.1_Missense_Mutation_p.G691S|NTRK3_ENST00000542733.2_Missense_Mutation_p.G601S|NTRK3_ENST00000355254.2_Missense_Mutation_p.G699S|NTRK3_ENST00000394480.2_Missense_Mutation_p.G699S|NTRK3_ENST00000357724.2_Missense_Mutation_p.G691S|NTRK3_ENST00000557856.1_Missense_Mutation_p.G691S	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	699	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G699S(2)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTGGACATGCCGAAGTCCCCA	0.542			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.G699S			Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2095A	15						.						111.0	103.0	106.0					15																	88472460		2201	4299	6500	86273464	SO:0001583	missense	4916	exon16			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.2095G>A	15.37:g.88472460C>T	ENSP00000354207:p.Gly699Ser	Somatic		Capture	Illumina HiSeq	Phase_I	86273464	NM_002530	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	34	5.350804	0.95830	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733	D;D;D;D;D	0.99259	-5.64;-5.64;-5.64;-5.64;-5.64	5.16	5.16	0.70880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99576	0.9847	M	0.93241	3.395	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;0.999	D	0.97994	1.0356	10	0.87932	D	0	.	17.6599	0.88189	0.0:1.0:0.0:0.0	.	601;691;691;699;699	B7Z7U4;E9PG56;B7Z4C5;Q16288-3;Q16288	.;.;.;.;NTRK3_HUMAN	S	699;699;691;699;601	ENSP00000377990:G699S;ENSP00000354207:G699S;ENSP00000350356:G691S;ENSP00000347397:G699S;ENSP00000437773:G601S	ENSP00000347397:G699S	G	-	1	0	NTRK3	86273464	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.636000	0.83301	2.409000	0.81822	0.655000	0.94253	GGC		0.542	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
C16orf45	89927	broad.mit.edu	37	16	15675086	15675086	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr16:15675086C>A	ENST00000300006.4	+	4	676	c.317C>A	c.(316-318)aCc>aAc	p.T106N	C16orf45_ENST00000565913.1_3'UTR|C16orf45_ENST00000452191.2_Missense_Mutation_p.T89N|C16orf45_ENST00000566490.1_Missense_Mutation_p.T106N|C16orf45_ENST00000561692.1_Missense_Mutation_p.T58N	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45	106								p.T106N(3)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						AAAGAAAAAACCAAACTGCAG	0.493																																					p.T89N												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C266A	16						.						69.0	62.0	64.0					16																	15675086		2197	4300	6497	15582587	SO:0001583	missense	89927	exon4			AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.317C>A	16.37:g.15675086C>A	ENSP00000300006:p.Thr106Asn	Somatic		Capture	Illumina HiSeq	Phase_I	15582587	NM_001142469	O00223|O75769|Q8IZ36|Q96H25	Missense_Mutation	SNP	ENST00000300006.4	37	CCDS10561.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.086918	0.55861	.	.	ENSG00000166780	ENST00000300006;ENST00000452191	T;T	0.55760	0.5;0.5	5.33	5.33	0.75918	Domain of unknown function DUF3585 (1);	0.141685	0.64402	D	0.000005	T	0.52041	0.1710	L	0.58428	1.81	0.47905	D	0.999544	B;B	0.29552	0.248;0.01	B;B	0.25884	0.064;0.01	T	0.53774	-0.8391	10	0.54805	T	0.06	-4.0795	18.5994	0.91242	0.0:1.0:0.0:0.0	.	50;106	B4DE25;Q96MC5	.;CP045_HUMAN	N	106;89	ENSP00000300006:T106N;ENSP00000408976:T89N	ENSP00000300006:T106N	T	+	2	0	C16orf45	15582587	0.989000	0.36119	0.998000	0.56505	0.995000	0.86356	2.631000	0.46502	2.499000	0.84300	0.655000	0.94253	ACC		0.493	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252130.2	NM_033201	
ARL6IP1	23204	broad.mit.edu	37	16	18809333	18809333	+	Silent	SNP	G	G	A	rs138748723	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr16:18809333G>A	ENST00000304414.7	-	3	415	c.204C>T	c.(202-204)tcC>tcT	p.S68S	ARL6IP1_ENST00000562819.1_Intron|ARL6IP1_ENST00000546206.2_Silent_p.S39S|RP11-1035H13.3_ENST00000567078.2_Silent_p.S68S	NM_015161.1	NP_055976.1	Q15041	AR6P1_HUMAN	ADP-ribosylation factor-like 6 interacting protein 1	68					cell death (GO:0008219)|cotranslational protein targeting to membrane (GO:0006613)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|Sec61 translocon complex (GO:0005784)		p.S68S(1)		breast(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)	11						AGGAAACGCCGGACAGAACAG	0.343													G|||	20	0.00399361	0.0151	0.0	5008	,	,		19062	0.0		0.0	False		,,,				2504	0.0				p.S68S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C204T	16						.	G		51,4343	51.6+/-87.1	0,51,2146	58.0	58.0	58.0		204	-8.2	0.8	16	dbSNP_134	58	0,8600		0,0,4300	no	coding-synonymous	ARL6IP1	NM_015161.1		0,51,6446	AA,AG,GG		0.0,1.1607,0.3925		68/204	18809333	51,12943	2197	4300	6497	18716834	SO:0001819	synonymous_variant	23204	exon3			BC010281	CCDS10572.1	16p12-p11.2	2014-03-12	2006-09-26	2006-09-26	ENSG00000170540	ENSG00000170540			697	protein-coding gene	gene with protein product		607669	"""ADP-ribosylation factor-like 6 interacting protein"""	ARL6IP		24482476	Standard	NM_015161		Approved	AIP1, ARMER, KIAA0069, SPG61	uc002dfl.1	Q15041	OTTHUMG00000131367	ENST00000304414.7:c.204C>T	16.37:g.18809333G>A		Somatic		Capture	Illumina HiSeq	Phase_I	18716834	NM_015161		Silent	SNP	ENST00000304414.7	37	CCDS10572.1																																																																																				0.343	ARL6IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254156.2	NM_015161	
RBBP6	5930	broad.mit.edu	37	16	24581212	24581212	+	Silent	SNP	G	G	C	rs148354788	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr16:24581212G>C	ENST00000319715.4	+	17	3633	c.3201G>C	c.(3199-3201)ccG>ccC	p.P1067P	RBBP6_ENST00000348022.2_Silent_p.P1033P|RBBP6_ENST00000381039.3_Intron	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1067	Interaction with RB1. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P1067P(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		AGGAGACTCCGAAGACTGACA	0.413																																					p.P1033P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3099C	16						.						49.0	49.0	49.0					16																	24581212		2194	4300	6494	24488713	SO:0001819	synonymous_variant	5930	exon16				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3201G>C	16.37:g.24581212G>C		Somatic		Capture	Illumina HiSeq	Phase_I	24488713	NM_018703	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Silent	SNP	ENST00000319715.4	37	CCDS10621.1																																																																																				0.413	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
ZKSCAN2	342357	broad.mit.edu	37	16	25251373	25251373	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr16:25251373C>T	ENST00000328086.7	-	7	3471	c.2668G>A	c.(2668-2670)Gtg>Atg	p.V890M	CTD-2547G23.2_ENST00000569456.1_RNA	NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	890					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.V890M(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		TCACAGTCCACACATTTGTAG	0.478																																					p.V890M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2668A	16						.						94.0	84.0	87.0					16																	25251373		2197	4300	6497	25158874	SO:0001583	missense	342357	exon7			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.2668G>A	16.37:g.25251373C>T	ENSP00000331626:p.Val890Met	Somatic		Capture	Illumina HiSeq	Phase_I	25158874	NM_001012981	A1L3B4|Q6ZN77	Missense_Mutation	SNP	ENST00000328086.7	37	CCDS32410.1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.267580	0.23136	.	.	ENSG00000155592	ENST00000328086	T	0.17854	2.25	5.52	4.57	0.56435	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.565825	0.17155	N	0.184896	T	0.13030	0.0316	L	0.31752	0.955	0.19575	N	0.999965	B;B	0.27013	0.017;0.166	B;B	0.28232	0.023;0.087	T	0.17137	-1.0379	10	0.46703	T	0.11	-1.8958	8.2881	0.31941	0.0:0.8278:0.0:0.1722	.	686;890	B4DYF0;Q63HK3	.;ZKSC2_HUMAN	M	890	ENSP00000331626:V890M	ENSP00000331626:V890M	V	-	1	0	ZKSCAN2	25158874	0.000000	0.05858	0.978000	0.43139	0.642000	0.38348	-3.043000	0.00631	1.568000	0.49683	0.563000	0.77884	GTG		0.478	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435739.1	NM_001012981	
FAM65A	79567	broad.mit.edu	37	16	67577102	67577102	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr16:67577102C>T	ENST00000379312.3	+	13	2546	c.2425C>T	c.(2425-2427)Cgt>Tgt	p.R809C	FAM65A_ENST00000428437.2_Missense_Mutation_p.R819C|FAM65A_ENST00000422602.2_Missense_Mutation_p.R825C|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.R825C|CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.R805C	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	809						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.R805C(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		GGATGACTACCGTGGCCAGTT	0.662																																					p.R809C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2425T	16						.																																			66134603	SO:0001583	missense	79567	exon13			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.2425C>T	16.37:g.67577102C>T	ENSP00000368614:p.Arg809Cys	Somatic		Capture	Illumina HiSeq	Phase_I	66134603	NM_001193522	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.8|23.8	4.464860|4.464860	0.84425|0.84425	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000428437|ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	.|T;T;T	.|0.51574	.|0.7;0.7;0.7	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.69278|0.69278	0.3093|0.3093	M|M	0.65975|0.65975	2.015|2.015	0.48040|0.48040	D|D	0.999575|0.999575	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.85130	.|0.997;0.997;0.997;0.974	T|T	0.71411|0.71411	-0.4601|-0.4601	5|10	.|0.87932	.|D	.|0	-11.5694|-11.5694	19.4508|19.4508	0.94865|0.94865	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|819;825;809;825	.|B4DIM2;E9PBS3;Q6ZS17;B4DEQ9	.|.;.;FA65A_HUMAN;.	L|C	799|809;805;825;819	.|ENSP00000368614:R809C;ENSP00000042381:R805C;ENSP00000400099:R825C	.|ENSP00000042381:R805C	P|R	+|+	2|1	0|0	FAM65A|FAM65A	66134603|66134603	0.158000|0.158000	0.22850|0.22850	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	0.497000|0.497000	0.22514|0.22514	2.624000|2.624000	0.88883|0.88883	0.555000|0.555000	0.69702|0.69702	CCG|CGT		0.662	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
CLEC18C	283971	broad.mit.edu	37	16	70219843	70219843	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr16:70219843C>T	ENST00000569347.2	+	11	1521	c.1267C>T	c.(1267-1269)Cgc>Tgc	p.R423C	CLEC18C_ENST00000536907.2_Missense_Mutation_p.R432C|CLEC18C_ENST00000314151.8_Missense_Mutation_p.R423C|CLEC18C_ENST00000541793.2_Missense_Mutation_p.R423C	NM_173619.2	NP_775890.2	Q8NCF0	CL18C_HUMAN	C-type lectin domain family 18, member C	423	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.R423C(1)		endometrium(3)|large_intestine(6)|lung(1)	10						GAACAACCAGCGCTGCAAAAC	0.587																																					p.R423C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1267T	16						.						94.0	133.0	120.0					16																	70219843		2074	4297	6371	68777344	SO:0001583	missense	283971	exon11			AL833339	CCDS32473.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157335		"""C-type lectin domain containing"""	28538	protein-coding gene	gene with protein product						12477932	Standard	XM_005255906		Approved	MGC34761		Q8NCF0		ENST00000569347.2:c.1267C>T	16.37:g.70219843C>T	ENSP00000455920:p.Arg423Cys	Somatic		Capture	Illumina HiSeq	Phase_I	68777344	NM_173619	Q8IUW8	Missense_Mutation	SNP	ENST00000569347.2	37	CCDS32473.1	.	.	.	.	.	.	.	.	.	.	c	15.76	2.928767	0.52759	.	.	ENSG00000157335	ENST00000541793;ENST00000314151;ENST00000536907	T;T;T	0.55588	0.51;0.51;0.51	4.34	4.34	0.51931	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.069626	0.64402	D	0.000019	T	0.51958	0.1705	M	0.72479	2.2	0.80722	D	1	B;B	0.15719	0.007;0.014	B;B	0.14578	0.011;0.006	T	0.55328	-0.8158	10	0.52906	T	0.07	.	12.7412	0.57253	0.0:1.0:0.0:0.0	.	423;432	Q8NCF0;F8W692	CL18C_HUMAN;.	C	423;423;432	ENSP00000444875:R423C;ENSP00000326538:R423C;ENSP00000444726:R432C	ENSP00000326538:R423C	R	+	1	0	CLEC18C	68777344	1.000000	0.71417	0.984000	0.44739	0.956000	0.61745	4.861000	0.62969	2.132000	0.65825	0.450000	0.29827	CGC		0.587	CLEC18C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434588.2	NM_173619	
KCNG4	93107	broad.mit.edu	37	16	84270674	84270674	+	Missense_Mutation	SNP	C	C	T	rs146185281	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr16:84270674C>T	ENST00000308251.4	-	2	486	c.418G>A	c.(418-420)Gcg>Acg	p.A140T	KCNG4_ENST00000568181.1_Missense_Mutation_p.A140T	NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	140					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.A140T(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						AAGGACAGCGCGCACATCTCC	0.652													C|||	4	0.000798722	0.0	0.0058	5008	,	,		17210	0.0		0.0	False		,,,				2504	0.0				p.A140T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G418A	16						.	C	THR/ALA	0,4400		0,0,2200	46.0	48.0	47.0		418	5.0	1.0	16	dbSNP_134	47	1,8599	1.2+/-3.3	0,1,4299	yes	missense	KCNG4	NM_172347.2	58	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	140/520	84270674	1,12999	2200	4300	6500	82828175	SO:0001583	missense	93107	exon2			AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.418G>A	16.37:g.84270674C>T	ENSP00000312129:p.Ala140Thr	Somatic		Capture	Illumina HiSeq	Phase_I	82828175	NM_172347	Q96H24	Missense_Mutation	SNP	ENST00000308251.4	37	CCDS10945.1	3	0.0013736263736263737	0	0.0	3	0.008287292817679558	0	0.0	0	0.0	C	33	5.226915	0.95173	0.0	1.16E-4	ENSG00000168418	ENST00000308251	T	0.77358	-1.09	5.02	5.02	0.67125	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.289127	0.36972	N	0.002314	D	0.83617	0.5293	M	0.77820	2.39	0.53005	D	0.999965	D;D	0.71674	0.998;0.997	D;P	0.63597	0.916;0.752	D	0.86857	0.2027	10	0.59425	D	0.04	.	17.3277	0.87253	0.0:1.0:0.0:0.0	.	140;140	Q8TDN1;Q8TDN1-2	KCNG4_HUMAN;.	T	140	ENSP00000312129:A140T	ENSP00000312129:A140T	A	-	1	0	KCNG4	82828175	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.731000	0.84895	2.317000	0.78254	0.549000	0.68633	GCG		0.652	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269079.2	NM_172347	
FXR2	9513	broad.mit.edu	37	17	7517825	7517826	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr17:7517825_7517826insC	ENST00000250113.7	-	1	359_360	c.25_26insG	c.(25-27)gatfs	p.D9fs	SHBG_ENST00000574539.1_Intron|SHBG_ENST00000575314.1_Intron|SHBG_ENST00000570547.1_Intron|SHBG_ENST00000572262.1_Intron|SHBG_ENST00000576728.1_Intron|SHBG_ENST00000572182.1_Intron|SHBG_ENST00000576478.1_Intron	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	9						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.D9fs*27(1)|p.?(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		CGGCTCCACATCCCCCCCAGAG	0.767																																					p.D9fs												.	.	2	Unknown(1)|Insertion - Frameshift(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.26_27insG	17						.			14,2878		1,12,1433						4.4	1.0			4	13,6683		2,9,3337	no	frameshift	FXR2	NM_004860.3		3,21,4770	A1A1,A1R,RR		0.1941,0.4841,0.2816				27,9561				7458551	SO:0001589	frameshift_variant	9513	exon1			U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.26dupG	17.37:g.7517832_7517832dupC	ENSP00000250113:p.Asp9fs	Somatic		Capture	Illumina HiSeq	Phase_I	7458550	NM_004860	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Frame_Shift_Ins	INS	ENST00000250113.7	37	CCDS45604.1																																																																																				0.767	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441084.1		
KRT27	342574	broad.mit.edu	37	17	38936652	38936652	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr17:38936652C>T	ENST00000301656.3	-	3	624	c.584G>A	c.(583-585)cGa>cAa	p.R195Q	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27									p.R195Q(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				CAGGACTCTTCGCAAACCATT	0.478																																					p.R195Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G584A	17						.						86.0	74.0	78.0					17																	38936652		2203	4300	6503	36190178	SO:0001583	missense	342574	exon3			AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.584G>A	17.37:g.38936652C>T	ENSP00000301656:p.Arg195Gln	Somatic		Capture	Illumina HiSeq	Phase_I	36190178	NM_181537		Missense_Mutation	SNP	ENST00000301656.3	37	CCDS11375.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199105	0.79015	.	.	ENSG00000171446	ENST00000301656	D	0.92099	-2.97	5.5	4.53	0.55603	Filament (1);	0.000000	0.64402	D	0.000012	D	0.96153	0.8746	M	0.86573	2.825	0.37185	D	0.903669	D	0.76494	0.999	D	0.75020	0.985	D	0.98541	1.0632	10	0.87932	D	0	.	13.9161	0.63899	0.0:0.9262:0.0:0.0738	.	195	Q7Z3Y8	K1C27_HUMAN	Q	195	ENSP00000301656:R195Q	ENSP00000301656:R195Q	R	-	2	0	KRT27	36190178	0.298000	0.24417	0.981000	0.43875	0.728000	0.41692	0.974000	0.29436	1.456000	0.47831	0.655000	0.94253	CGA		0.478	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537	
CRHR1	1394	broad.mit.edu	37	17	43893903	43893903	+	Missense_Mutation	SNP	C	C	T	rs368605173		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr17:43893903C>T	ENST00000398285.3	+	3	196	c.196C>T	c.(196-198)Cgg>Tgg	p.R66W	CRHR1_ENST00000352855.5_Intron|CRHR1_ENST00000339069.5_5'UTR|RP11-105N13.4_ENST00000587305.1_RNA|CRHR1_ENST00000577353.1_Missense_Mutation_p.R66W|CRHR1_ENST00000293493.7_5'UTR|CRHR1_ENST00000314537.5_Missense_Mutation_p.R66W	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	66					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)	p.R66W(2)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		GCTAGTGGTTCGGCCCTGCCC	0.622																																					p.R66W	Ovarian(110;57 1568 10207 38216 49865)											.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.C196T	17						.	C	TRP/ARG,,TRP/ARG,TRP/ARG	1,3897		0,1,1948	43.0	47.0	45.0		196,,196,196	5.0	1.0	17		45	0,8244		0,0,4122	no	missense,intron,missense,missense	CRHR1	NM_001145146.1,NM_001145147.1,NM_001145148.1,NM_004382.4	101,,101,101	0,1,6070	TT,TC,CC		0.0,0.0257,0.0082	probably-damaging,,probably-damaging,probably-damaging	66/445,,66/402,66/416	43893903	1,12141	1949	4122	6071	41249684	SO:0001583	missense	1394	exon3			L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.196C>T	17.37:g.43893903C>T	ENSP00000381333:p.Arg66Trp	Somatic		Capture	Illumina HiSeq	Phase_I	41249684	NM_001145148	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	ENST00000398285.3	37	CCDS45712.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883574	0.51908	2.57E-4	0.0	ENSG00000120088	ENST00000398285;ENST00000314537;ENST00000347197	T;T;T	0.64803	-0.12;-0.12;-0.12	5.04	5.04	0.67666	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	0.135146	0.49916	D	0.000129	T	0.79423	0.4443	M	0.82517	2.595	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.72625	0.961;0.978;0.944	T	0.81876	-0.0731	10	0.66056	D	0.02	.	13.7707	0.63023	0.0:1.0:0.0:0.0	.	66;66;66	P34998-4;P34998;P34998-2	.;CRFR1_HUMAN;.	W	66	ENSP00000381333:R66W;ENSP00000326060:R66W;ENSP00000239167:R66W	ENSP00000326060:R66W	R	+	1	2	CRHR1	41249684	0.995000	0.38212	1.000000	0.80357	0.971000	0.66376	3.300000	0.51834	2.630000	0.89119	0.655000	0.94253	CGG		0.622	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3		
TP53	7157	broad.mit.edu	37	17	7578382	7578399	+	In_Frame_Del	DEL	GAGCAGCGCTCATGGTGG	GAGCAGCGCTCATGGTGG	-	rs587782596|rs587780070|rs397514495		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	GAGCAGCGCTCATGGTGG	GAGCAGCGCTCATGGTGG	GAGCAGCGCTCATGGTGG	-	GAGCAGCGCTCATGGTGG	GAGCAGCGCTCATGGTGG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr17:7578382_7578399delGAGCAGCGCTCATGGTGG	ENST00000269305.4	-	5	720_737	c.531_548delCCACCATGAGCGCTGCTC	c.(529-549)ccccaccatgagcgctgctca>cca	p.HHERCS178del	TP53_ENST00000359597.4_In_Frame_Del_p.HHERCS178del|TP53_ENST00000420246.2_In_Frame_Del_p.HHERCS178del|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_In_Frame_Del_p.HHERCS178del|TP53_ENST00000455263.2_In_Frame_Del_p.HHERCS178del|TP53_ENST00000445888.2_In_Frame_Del_p.HHERCS178del	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	178	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> HPHP (in a Burkitt lymphoma). {ECO:0000269|PubMed:1303181}.|H -> L (in a sporadic cancer; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H179R(108)|p.H179Y(98)|p.H179L(43)|p.S183*(29)|p.H179Q(23)|p.R181H(21)|p.R181C(19)|p.H179N(16)|p.H178fs*69(14)|p.E180*(14)|p.R181P(14)|p.H179D(13)|p.P177P(10)|p.P177_C182delPHHERC(8)|p.C182S(8)|p.H178Y(8)|p.0?(8)|p.H178D(7)|p.H47Y(6)|p.H178P(6)|p.E180D(6)|p.H86Y(6)|p.E180K(5)|p.H178fs*3(5)|p.H178Q(5)|p.C182*(5)|p.H47L(4)|p.H86L(4)|p.C176_R181delCPHHER(3)|p.H179P(3)|p.H178_S183delHHERCS(3)|p.H178N(3)|p.S183P(3)|p.R175_E180delRCPHHE(3)|p.R181L(3)|p.R174fs*24(3)|p.H179fs*68(2)|p.H179H(2)|p.H47Q(2)|p.H47R(2)|p.R174fs*1(2)|p.H178H(2)|p.S90*(2)|p.P177fs*3(2)|p.S51*(2)|p.C182R(2)|p.C182Y(2)|p.C182C(2)|p.R49C(2)|p.R88C(2)|p.S183L(2)|p.H86R(2)|p.H86Q(2)|p.H85fs*69(2)|p.R181R(2)|p.H46fs*>45(2)|p.V173fs*59(2)|p.?(2)|p.V173fs*69(1)|p.R175_H178>X(1)|p.E180G(1)|p.E180fs*67(1)|p.E180Q(1)|p.E171_H179delEVVRRCPHH(1)|p.H178fs*6(1)|p.P177H(1)|p.H47D(1)|p.R174fs*3(1)|p.H47N(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.H178L(1)|p.E171fs*1(1)|p.H179del(1)|p.H168fs*69(1)|p.E180>DGRCPHQ(1)|p.H178del(1)|p.D184fs*4(1)|p.P177L(1)|p.E48D(1)|p.E180_S183del(1)|p.R49P(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.C176_P177delCP(1)|p.R42fs*24(1)|p.R88P(1)|p.P177fs*69(1)|p.C182fs*4(1)|p.R174_E180>K(1)|p.P177_E180delPHHE(1)|p.C182fs*65(1)|p.E87D(1)|p.H85_S90delHHERCS(1)|p.H86D(1)|p.H86N(1)|p.C176fs*65(1)|p.R181G(1)|p.C176fs*68(1)|p.R174_H178>S(1)|p.H46D(1)|p.R181>XXXXXXX(1)|p.H178_H179>QY(1)|p.H85D(1)|p.R81fs*24(1)|p.H46_S51delHHERCS(1)|p.P177_H179delPHH(1)|p.E180fs*6(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATCGCTATCTGAGCAGCGCTCATGGTGGGGGCAGCGCC	0.638		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.177_183del	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,urinary_tract,bladder,Substitution - Nonsense,0 	.	631	Substitution - Missense(466)|Substitution - Nonsense(52)|Deletion - Frameshift(43)|Deletion - In frame(28)|Substitution - coding silent(18)|Whole gene deletion(8)|Insertion - Frameshift(7)|Complex - deletion inframe(3)|Complex - insertion inframe(2)|Unknown(2)|Insertion - In frame(1)|Complex - compound substitution(1)	lung(106)|large_intestine(76)|upper_aerodigestive_tract(69)|breast(68)|ovary(41)|oesophagus(39)|skin(38)|central_nervous_system(35)|urinary_tract(28)|haematopoietic_and_lymphoid_tissue(28)|liver(25)|stomach(17)|endometrium(11)|pancreas(9)|biliary_tract(8)|bone(8)|prostate(6)|soft_tissue(5)|salivary_gland(3)|vulva(2)|kidney(2)|cervix(2)|genital_tract(2)|thyroid(1)|eye(1)|thymus(1)	c.531_548del	17	GRCh37	CD983489|CM056067|CM067054|CM920671|CM920672|CM941328|CM942120	TP53	D|M	rs68130327	.																																			7519124	SO:0001651	inframe_deletion	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.531_548delCCACCATGAGCGCTGCTC	17.37:g.7578382_7578399delGAGCAGCGCTCATGGTGG	ENSP00000269305:p.His178_Ser183del	Somatic		Capture	Illumina HiSeq	Phase_I	7519107	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																				0.638	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	broad.mit.edu	37	17	7678612	7678612	+	Silent	SNP	C	C	T	rs372171385		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr17:7678612C>T	ENST00000572933.1	+	30	6233	c.4773C>T	c.(4771-4773)ggC>ggT	p.G1591G	DNAH2_ENST00000389173.2_Silent_p.G1591G			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1591	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G1591G(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CGGGCGACGGCGAGTACATTG	0.547																																					p.G1591G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4773T	17						.	C		0,4406		0,0,2203	94.0	79.0	84.0		4773	2.1	1.0	17		84	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DNAH2	NM_020877.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1591/4428	7678612	1,13005	2203	4300	6503	7619337	SO:0001819	synonymous_variant	146754	exon29			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.4773C>T	17.37:g.7678612C>T		Somatic		Capture	Illumina HiSeq	Phase_I	7619337	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																				0.547	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
ABCA5	23461	broad.mit.edu	37	17	67246664	67246664	+	Missense_Mutation	SNP	C	C	T	rs370515109		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr17:67246664C>T	ENST00000392676.3	-	36	4698	c.4634G>A	c.(4633-4635)cGc>cAc	p.R1545H	ABCA5_ENST00000588877.1_Missense_Mutation_p.R1545H|ABCA5_ENST00000392677.2_Missense_Mutation_p.R1546H			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	1545					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.R1545H(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	TCTTTGAAGGCGGTCTACTTC	0.328																																					p.R1545H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4634A	17						.						66.0	67.0	67.0					17																	67246664		2202	4295	6497	64758259	SO:0001583	missense	23461	exon36			U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.4634G>A	17.37:g.67246664C>T	ENSP00000376443:p.Arg1545His	Somatic		Capture	Illumina HiSeq	Phase_I	64758259	NM_172232	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	37	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.584632	0.28268	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.83837	-1.77;-1.77	6.07	3.9	0.45041	.	0.290286	0.29822	N	0.011120	T	0.61553	0.2356	N	0.08118	0	0.32379	N	0.554844	B	0.09022	0.002	B	0.04013	0.001	T	0.58370	-0.7648	10	0.33940	T	0.23	.	3.3186	0.07041	0.1781:0.5321:0.1739:0.116	.	1545	Q8WWZ7	ABCA5_HUMAN	H	1546;1545	ENSP00000376444:R1546H;ENSP00000376443:R1545H	ENSP00000376443:R1545H	R	-	2	0	ABCA5	64758259	0.337000	0.24766	0.983000	0.44433	0.995000	0.86356	0.694000	0.25512	1.549000	0.49425	0.655000	0.94253	CGC		0.328	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
BAHCC1	57597	broad.mit.edu	37	17	79427705	79427705	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr17:79427705delA	ENST00000307745.7	+	29	6175	c.6175delA	c.(6175-6177)aaafs	p.K2060fs	RP11-1055B8.8_ENST00000572590.1_RNA														p.K2060fs*14(1)									GACACCTGGGAAAAAATCCAT	0.597																																					p.K2004fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.6010delA	17						.						14.0	16.0	15.0					17																	79427705		1865	4086	5951	77042300	SO:0001589	frameshift_variant	57597	exon24																														ENST00000307745.7:c.6175delA	17.37:g.79427705delA	ENSP00000303486:p.Lys2060fs	Somatic		Capture	Illumina HiSeq	Phase_I	77042300	NM_001080519		Frame_Shift_Del	DEL	ENST00000307745.7	37																																																																																					0.597	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
CDH2	1000	broad.mit.edu	37	18	25593817	25593817	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr18:25593817C>T	ENST00000269141.3	-	3	652	c.229G>A	c.(229-231)Gca>Aca	p.A77T	CDH2_ENST00000399380.3_Missense_Mutation_p.A46T	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	77					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.A77T(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTAAAATCTGCAGGCTCACTG	0.383																																					p.A77T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G229A	18						.						168.0	144.0	152.0					18																	25593817		2203	4300	6503	23847815	SO:0001583	missense	1000	exon3			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.229G>A	18.37:g.25593817C>T	ENSP00000269141:p.Ala77Thr	Somatic		Capture	Illumina HiSeq	Phase_I	23847815	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.372477	0.24857	.	.	ENSG00000170558	ENST00000269141;ENST00000399380;ENST00000418492	T;T;T	0.60920	0.15;0.15;0.15	5.55	5.55	0.83447	Cadherin prodomain-like (1);Cadherin-like (1);	0.224024	0.45361	D	0.000364	T	0.28599	0.0708	N	0.02539	-0.55	0.33698	D	0.614248	B;B	0.11235	0.001;0.004	B;B	0.18871	0.023;0.012	T	0.30621	-0.9972	10	0.05959	T	0.93	.	12.7917	0.57537	0.0:0.9251:0.0:0.0749	.	46;77	A8MWK3;P19022	.;CADH2_HUMAN	T	77;46;26	ENSP00000269141:A77T;ENSP00000382312:A46T;ENSP00000411360:A26T	ENSP00000269141:A77T	A	-	1	0	CDH2	23847815	0.997000	0.39634	0.992000	0.48379	0.975000	0.68041	3.500000	0.53318	2.616000	0.88540	0.585000	0.79938	GCA		0.383	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
FHOD3	80206	broad.mit.edu	37	18	34340639	34340639	+	Silent	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr18:34340639C>T	ENST00000359247.4	+	22	3918	c.3918C>T	c.(3916-3918)gaC>gaT	p.D1306D	FHOD3_ENST00000257209.4_Silent_p.D1323D|FHOD3_ENST00000590592.1_Silent_p.D1506D|FHOD3_ENST00000445677.1_Silent_p.D1285D|FHOD3_ENST00000591635.1_Silent_p.D519D|FHOD3_ENST00000592128.1_Silent_p.D302D	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1306					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.D1323D(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ATGCGGAGGACGCGGCTGAGC	0.652																																					p.D1323D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3969T	18						.						46.0	47.0	47.0					18																	34340639		2202	4296	6498	32594637	SO:0001819	synonymous_variant	80206	exon23			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3918C>T	18.37:g.34340639C>T		Somatic		Capture	Illumina HiSeq	Phase_I	32594637	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	37																																																																																					0.652	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
APC2	10297	broad.mit.edu	37	19	1457967	1457967	+	Missense_Mutation	SNP	C	C	T	rs141413463		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:1457967C>T	ENST00000535453.1	+	9	2924	c.1211C>T	c.(1210-1212)cCg>cTg	p.P404L	CTB-25B13.12_ENST00000588225.1_RNA|APC2_ENST00000238483.4_Intron|APC2_ENST00000233607.2_Missense_Mutation_p.P404L			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)	p.P404L(1)		breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCACAGCCCCGATCCCCATC	0.622																																					p.P404L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1211T	19						.	C	LEU/PRO	1,4371		0,1,2185	64.0	39.0	47.0		1211	4.1	0.9	19	dbSNP_134	47	0,8540		0,0,4270	no	missense	APC2	NM_005883.2	98	0,1,6455	TT,TC,CC		0.0,0.0229,0.0077	probably-damaging	404/2304	1457967	1,12911	2186	4270	6456	1408967	SO:0001583	missense	10297	exon10				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.1211C>T	19.37:g.1457967C>T	ENSP00000442954:p.Pro404Leu	Somatic		Capture	Illumina HiSeq	Phase_I	1408967	NM_005883	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	ENST00000535453.1	37	CCDS12068.1	.	.	.	.	.	.	.	.	.	.	c	16.90	3.250726	0.59212	2.29E-4	0.0	ENSG00000115266	ENST00000233607;ENST00000535453	D;D	0.93247	-3.19;-3.19	4.06	4.06	0.47325	Armadillo-type fold (1);	0.138076	0.48767	D	0.000167	D	0.95595	0.8568	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	D	0.95929	0.8937	10	0.87932	D	0	-26.9675	13.7611	0.62966	0.0:1.0:0.0:0.0	.	403;404	O95996-3;O95996	.;APC2_HUMAN	L	404	ENSP00000233607:P404L;ENSP00000442954:P404L	ENSP00000233607:P404L	P	+	2	0	APC2	1408967	1.000000	0.71417	0.868000	0.34077	0.021000	0.10359	5.721000	0.68477	2.099000	0.63709	0.556000	0.70494	CCG		0.622	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883	
DNM2	1785	broad.mit.edu	37	19	10897347	10897347	+	Silent	SNP	C	C	T	rs141911457	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:10897347C>T	ENST00000355667.6	+	7	1037	c.957C>T	c.(955-957)ccC>ccT	p.P319P	DNM2_ENST00000359692.6_Silent_p.P319P|DNM2_ENST00000314646.5_Silent_p.P319P|DNM2_ENST00000585892.1_Silent_p.P319P|DNM2_ENST00000408974.4_Silent_p.P319P|DNM2_ENST00000389253.4_Silent_p.P319P	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	319					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)	p.P319P(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			ACTTTCGGCCCGACGACCCCA	0.637			"""F, N, Splice, Mis, O"""		ETP ALL								C|||	5	0.000998403	0.0	0.0072	5008	,	,		16866	0.0		0.0	False		,,,				2504	0.0				p.P319P			Rec	yes		19	19p13.2	1785	dynamin 2		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C957T	19						.	C	,,,,	0,4406		0,0,2203	110.0	94.0	100.0		957,957,957,957,957	-2.8	0.9	19	dbSNP_134	100	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DNM2	NM_001005360.2,NM_001005361.2,NM_001005362.2,NM_001190716.1,NM_004945.3	,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,	319/871,319/871,319/867,319/870,319/867	10897347	1,13005	2203	4300	6503	10758347	SO:0001819	synonymous_variant	1785	exon7				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.957C>T	19.37:g.10897347C>T		Somatic		Capture	Illumina HiSeq	Phase_I	10758347	NM_001190716	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Silent	SNP	ENST00000355667.6	37	CCDS45968.1																																																																																				0.637	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945	
NCAN	1463	broad.mit.edu	37	19	19338514	19338514	+	Silent	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:19338514C>T	ENST00000252575.6	+	8	2184	c.2085C>T	c.(2083-2085)ccC>ccT	p.P695P	NCAN_ENST00000538881.1_Silent_p.P146P	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	695					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.P695L(1)|p.P695P(1)|p.P709P(1)		breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	AGGCCATGCCCACAACACCTG	0.617																																					p.P695P												.	.	3	Substitution - coding silent(2)|Substitution - Missense(1)	large_intestine(2)|skin(1)	c.C2085T	19						.						84.0	84.0	84.0					19																	19338514		2203	4300	6503	19199514	SO:0001819	synonymous_variant	1463	exon8			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.2085C>T	19.37:g.19338514C>T		Somatic		Capture	Illumina HiSeq	Phase_I	19199514	NM_004386	Q9UPK6	Silent	SNP	ENST00000252575.6	37	CCDS12397.1																																																																																				0.617	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386	
SIPA1L3	23094	broad.mit.edu	37	19	38682861	38682861	+	Missense_Mutation	SNP	C	C	T	rs139358619	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:38682861C>T	ENST00000222345.6	+	17	5016	c.4507C>T	c.(4507-4509)Cgg>Tgg	p.R1503W		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1503					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)	p.R1503W(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCGGTCACCACGGAAGAACTA	0.557													C|||	7	0.00139776	0.0	0.0	5008	,	,		21002	0.0069		0.0	False		,,,				2504	0.0				p.R1503W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4507T	19						.	C	TRP/ARG	0,4406		0,0,2203	104.0	86.0	92.0		4507	3.0	0.7	19	dbSNP_134	92	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SIPA1L3	NM_015073.1	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1503/1782	38682861	1,13005	2203	4300	6503	43374701	SO:0001583	missense	23094	exon17			AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.4507C>T	19.37:g.38682861C>T	ENSP00000222345:p.Arg1503Trp	Somatic		Capture	Illumina HiSeq	Phase_I	43374701	NM_015073	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	37	CCDS33007.1	7	0.003205128205128205	0	0.0	0	0.0	7	0.012237762237762238	0	0.0	C	18.62	3.664111	0.67700	0.0	1.16E-4	ENSG00000105738	ENST00000222345	T	0.34859	1.34	5.2	3.02	0.34903	.	0.070735	0.56097	D	0.000027	T	0.39708	0.1088	L	0.42245	1.32	0.48511	D	0.999669	D	0.89917	1.0	D	0.83275	0.996	T	0.32613	-0.9900	10	0.72032	D	0.01	-19.5508	8.9029	0.35505	0.1489:0.7714:0.0:0.0797	.	1503	O60292	SI1L3_HUMAN	W	1503	ENSP00000222345:R1503W	ENSP00000222345:R1503W	R	+	1	2	SIPA1L3	43374701	0.985000	0.35326	0.676000	0.29932	0.709000	0.40893	3.080000	0.50112	0.547000	0.28938	0.455000	0.32223	CGG		0.557	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	
PLA2G4C	8605	broad.mit.edu	37	19	48558278	48558278	+	Missense_Mutation	SNP	C	C	T	rs145766964		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:48558278C>T	ENST00000599921.1	-	15	1643	c.1286G>A	c.(1285-1287)cGc>cAc	p.R429H	PLA2G4C_ENST00000599111.1_Missense_Mutation_p.R439H|PLA2G4C_ENST00000354276.3_Missense_Mutation_p.R429H|PLA2G4C_ENST00000413144.2_Missense_Mutation_p.R429H|PLA2G4C_ENST00000596510.1_5'UTR			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	429	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)	p.R429H(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		CTTGTGGCGGCGGCAGTAGTC	0.572																																					p.R429H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1286A	19						.	C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	75.0	77.0	77.0		1316,1286,1286	0.7	0.0	19	dbSNP_134	77	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	PLA2G4C	NM_001159322.1,NM_001159323.1,NM_003706.2	29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	439/552,429/528,429/542	48558278	1,13005	2203	4300	6503	53250090	SO:0001583	missense	8605	exon15			AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1286G>A	19.37:g.48558278C>T	ENSP00000469473:p.Arg429His	Somatic		Capture	Illumina HiSeq	Phase_I	53250090	NM_001159323	B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	37	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	C	7.390	0.630663	0.14322	0.0	1.16E-4	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.16073	2.37;2.37	3.19	0.694	0.18062	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.973553	0.08400	N	0.951573	T	0.14743	0.0356	M	0.64404	1.975	0.09310	N	1	B;B	0.22683	0.073;0.013	B;B	0.17722	0.019;0.003	T	0.40403	-0.9565	10	0.20046	T	0.44	-0.0138	2.2339	0.04003	0.2335:0.181:0.0:0.5856	.	439;429	B4DI40;Q9UP65	.;PA24C_HUMAN	H	429	ENSP00000346228:R429H;ENSP00000400036:R429H	ENSP00000346228:R429H	R	-	2	0	PLA2G4C	53250090	0.000000	0.05858	0.001000	0.08648	0.064000	0.16182	-0.056000	0.11787	-0.221000	0.09973	0.411000	0.27672	CGC		0.572	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1		
SPACA4	171169	broad.mit.edu	37	19	49110285	49110285	+	Missense_Mutation	SNP	C	C	T	rs143767613		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:49110285C>T	ENST00000321762.1	+	1	286	c.50C>T	c.(49-51)aCg>aTg	p.T17M	FAM83E_ENST00000263266.3_Intron	NM_133498.2	NP_598005.1	Q8TDM5	SACA4_HUMAN	sperm acrosome associated 4	17					cell adhesion (GO:0007155)	anchored component of membrane (GO:0031225)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)		p.T17M(1)		central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	5		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		CCCCCAGGCACGACGGGCGTC	0.647																																					p.T17M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C50T	19						.	C	,MET/THR	1,4405	2.1+/-5.4	0,1,2202	67.0	60.0	62.0		,50	2.0	0.0	19	dbSNP_134	62	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	FAM83E,SPACA4	NM_017708.3,NM_133498.2	,81	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,probably-damaging	,17/125	49110285	2,13004	2203	4300	6503	53802097	SO:0001583	missense	171169	exon1				CCDS12725.1	19q13.33	2013-10-24			ENSG00000177202	ENSG00000177202			16441	protein-coding gene	gene with protein product		609932					Standard	NM_133498		Approved	SAMP14	uc002pjo.3	Q8TDM5	OTTHUMG00000183316	ENST00000321762.1:c.50C>T	19.37:g.49110285C>T	ENSP00000312774:p.Thr17Met	Somatic		Capture	Illumina HiSeq	Phase_I	53802097	NM_133498		Missense_Mutation	SNP	ENST00000321762.1	37	CCDS12725.1	.	.	.	.	.	.	.	.	.	.	C	2.663	-0.279275	0.05642	2.27E-4	1.16E-4	ENSG00000177202	ENST00000321762	.	.	.	5.28	1.98	0.26296	.	1.058810	0.07492	N	0.905754	T	0.28433	0.0703	L	0.27053	0.805	0.09310	N	1	P	0.49783	0.928	P	0.44477	0.451	T	0.17592	-1.0364	9	0.72032	D	0.01	-8.3457	5.6142	0.17422	0.0:0.6603:0.1622:0.1775	.	17	Q8TDM5	SACA4_HUMAN	M	17	.	ENSP00000312774:T17M	T	+	2	0	SPACA4	53802097	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.772000	0.26647	0.327000	0.23409	-0.136000	0.14681	ACG		0.647	SPACA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466149.1	NM_133498	
SLC6A16	28968	broad.mit.edu	37	19	49796610	49796610	+	Missense_Mutation	SNP	C	C	T	rs374589467		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:49796610C>T	ENST00000335875.4	-	10	1889	c.1648G>A	c.(1648-1650)Ggc>Agc	p.G550S	SLC6A16_ENST00000454748.3_Missense_Mutation_p.G550S	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	550					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)	p.G550S(1)		NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		AAGAAGAGGCCGCACACGAAC	0.488																																					p.G550S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1648A	19						.	C	SER/GLY	0,4060		0,0,2030	75.0	84.0	81.0		1648	-0.6	0.1	19		81	1,8379		0,1,4189	no	missense	SLC6A16	NM_014037.2	56	0,1,6219	TT,TC,CC		0.0119,0.0,0.0080	benign	550/737	49796610	1,12439	2030	4190	6220	54488422	SO:0001583	missense	28968	exon10			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.1648G>A	19.37:g.49796610C>T	ENSP00000338627:p.Gly550Ser	Somatic		Capture	Illumina HiSeq	Phase_I	54488422	NM_014037	Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	ENST00000335875.4	37	CCDS42590.1	.	.	.	.	.	.	.	.	.	.	C	6.243	0.413015	0.11812	0.0	1.19E-4	ENSG00000063127	ENST00000335875;ENST00000454748	T;T	0.76968	-1.06;-1.06	4.3	-0.606	0.11619	.	0.284104	0.38326	N	0.001739	T	0.54711	0.1875	L	0.28014	0.82	0.34466	D	0.702315	P;P	0.44521	0.631;0.837	B;B	0.32465	0.146;0.146	T	0.59021	-0.7532	10	0.37606	T	0.19	.	7.9701	0.30122	0.0:0.4808:0.0:0.5192	.	550;550	Q8IYV4;Q9GZN6	.;S6A16_HUMAN	S	550	ENSP00000338627:G550S;ENSP00000404022:G550S	ENSP00000338627:G550S	G	-	1	0	SLC6A16	54488422	0.913000	0.31002	0.064000	0.19789	0.002000	0.02628	1.863000	0.39459	-0.028000	0.13850	-0.409000	0.06214	GGC		0.488	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465503.2	NM_014037	
LILRA1	11024	broad.mit.edu	37	19	55106755	55106755	+	Silent	SNP	T	T	C			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:55106755T>C	ENST00000251372.3	+	5	731	c.549T>C	c.(547-549)tcT>tcC	p.S183S	LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000453777.1_Silent_p.S183S|LILRB1_ENST00000396321.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	183	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.S183S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CCATCTTCTCTGTGGGCCCCG	0.567																																					p.S183S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T549C	19						.						155.0	158.0	157.0					19																	55106755		2203	4300	6503	59798567	SO:0001819	synonymous_variant	11024	exon5			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.549T>C	19.37:g.55106755T>C		Somatic		Capture	Illumina HiSeq	Phase_I	59798567	NM_006863	O75018|Q3MJA6	Silent	SNP	ENST00000251372.3	37	CCDS12901.1																																																																																				0.567	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
SYT5	6861	broad.mit.edu	37	19	55689643	55689643	+	Missense_Mutation	SNP	C	C	T	rs141150330	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:55689643C>T	ENST00000354308.3	-	3	542	c.173G>A	c.(172-174)cGg>cAg	p.R58Q	SYT5_ENST00000537500.1_Missense_Mutation_p.R58Q|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000590851.1_Intron	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	58					calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.R58Q(1)		kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CTTGCCTGTCCGCCTCCGACA	0.627													C|||	17	0.00339457	0.0121	0.0014	5008	,	,		17905	0.0		0.0	False		,,,				2504	0.0				p.R58Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G173A	19						.	C	GLN/ARG	37,4369	41.6+/-74.8	0,37,2166	28.0	25.0	26.0		173	3.0	0.9	19	dbSNP_134	26	0,8598		0,0,4299	yes	missense	SYT5	NM_003180.2	43	0,37,6465	TT,TC,CC		0.0,0.8398,0.2845	benign	58/387	55689643	37,12967	2203	4299	6502	60381455	SO:0001583	missense	6861	exon3			X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.173G>A	19.37:g.55689643C>T	ENSP00000346265:p.Arg58Gln	Somatic		Capture	Illumina HiSeq	Phase_I	60381455	NM_003180	B3KWJ8|B7Z300|Q86X72	Missense_Mutation	SNP	ENST00000354308.3	37	CCDS12919.1	7	0.003205128205128205	6	0.012195121951219513	1	0.0027624309392265192	0	0.0	0	0.0	C	16.29	3.081343	0.55753	0.008398	0.0	ENSG00000129990	ENST00000537500;ENST00000354308	T;T	0.56275	0.47;0.47	4.06	3.03	0.35002	.	0.060138	0.64402	D	0.000005	T	0.26448	0.0646	L	0.59436	1.845	0.50171	D	0.999856	P;B	0.49253	0.921;0.084	B;B	0.29077	0.098;0.007	T	0.18808	-1.0325	10	0.36615	T	0.2	.	4.5027	0.11872	0.0:0.692:0.0:0.308	.	58;58	Q4FD32;O00445	.;SYT5_HUMAN	Q	58	ENSP00000442896:R58Q;ENSP00000346265:R58Q	ENSP00000346265:R58Q	R	-	2	0	SYT5	60381455	1.000000	0.71417	0.930000	0.37139	0.872000	0.50106	3.262000	0.51538	2.214000	0.71695	0.561000	0.74099	CGG		0.627	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	NM_003180	
MAST3	23031	broad.mit.edu	37	19	18254593	18254595	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	CTG	CTG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:18254593_18254595delCTG	ENST00000262811.6	+	21	2273_2275	c.2273_2275delCTG	c.(2272-2277)tctgga>tga	p.758_759SG>*	AC007192.6_ENST00000600364.2_RNA	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	758							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.S780_G781>*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						TGGACATCCTCTGGATCCTCCTG	0.596																																					p.758_759del												.	.	1	Complex - deletion inframe(1)	large_intestine(1)	c.2273_2275del	19						.																																			18115595	SO:0001651	inframe_deletion	23031	exon21			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.2273_2275delCTG	19.37:g.18254593_18254595delCTG	ENSP00000262811:p.Ser758_Gly759delins*	Somatic		Capture	Illumina HiSeq	Phase_I	18115593	NM_015016	Q7LDZ8|Q9UPI0	In_Frame_Del	DEL	ENST00000262811.6	37	CCDS46014.1																																																																																				0.596	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150	
FIZ1	84922	broad.mit.edu	37	19	56108964	56108964	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr19:56108964C>T	ENST00000221665.3	-	2	357	c.268G>A	c.(268-270)Gac>Aac	p.D90N	ZNF524_ENST00000301073.3_5'Flank|FIZ1_ENST00000592585.1_Intron	NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	90					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)	p.D90N(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CCGGTGGAGTCGCGGAACCCC	0.682																																					p.D90N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G268A	19						.						26.0	26.0	26.0					19																	56108964		2203	4298	6501	60800776	SO:0001583	missense	84922	exon2			AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.268G>A	19.37:g.56108964C>T	ENSP00000221665:p.Asp90Asn	Somatic		Capture	Illumina HiSeq	Phase_I	60800776	NM_032836	A2RU72|Q6ZMJ7	Missense_Mutation	SNP	ENST00000221665.3	37	CCDS12928.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.857105	0.32791	.	.	ENSG00000179943	ENST00000221665	T	0.60424	0.19	3.57	2.49	0.30216	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36331	0.0963	N	0.16016	0.355	0.19300	N	0.99997	D	0.57571	0.98	B	0.38562	0.276	T	0.10776	-1.0615	9	0.46703	T	0.11	-40.2705	10.3109	0.43708	0.0:0.7982:0.2018:0.0	.	90	Q96SL8	FIZ1_HUMAN	N	90	ENSP00000221665:D90N	ENSP00000221665:D90N	D	-	1	0	FIZ1	60800776	0.004000	0.15560	0.986000	0.45419	0.979000	0.70002	0.069000	0.14552	0.815000	0.34398	0.462000	0.41574	GAC		0.682	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453350.1	NM_032836	
VPS13D	55187	broad.mit.edu	37	1	12336516	12336516	+	Silent	SNP	G	G	A	rs183276517		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr1:12336516G>A	ENST00000358136.3	+	19	3001	c.2871G>A	c.(2869-2871)gcG>gcA	p.A957A	VPS13D_ENST00000356315.4_Silent_p.A957A	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)									p.A957A(1)		NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TCCTCCTGGCGGAATTTAAAG	0.498											OREG0013110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0008	0.0	5008	,	,		18884	0.0		0.0	False		,,,				2504	0.0				p.A957A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2871A	1						.						74.0	74.0	74.0					1																	12336516		2203	4300	6503	12259103	SO:0001819	synonymous_variant	55187	exon19			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.2871G>A	1.37:g.12336516G>A		Somatic	679	Capture	Illumina HiSeq	Phase_I	12259103	NM_018156		Silent	SNP	ENST00000358136.3	37	CCDS30588.1																																																																																				0.498	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
CHRNB2	1141	broad.mit.edu	37	1	154544245	154544245	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr1:154544245G>A	ENST00000368476.3	+	5	1210	c.946G>A	c.(946-948)Gtg>Atg	p.V316M		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	316					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)	p.V316M(2)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	CGTCACCAGCGTGTGCGTGCT	0.622																																					p.V316M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G946A	1						.						122.0	90.0	101.0					1																	154544245		2203	4300	6503	152810869	SO:0001583	missense	1141	exon5			U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.946G>A	1.37:g.154544245G>A	ENSP00000357461:p.Val316Met	Somatic		Capture	Illumina HiSeq	Phase_I	152810869	NM_000748	Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	37	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372552	0.82573	.	.	ENSG00000160716	ENST00000368476	D	0.87887	-2.31	3.97	3.97	0.46021	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95645	0.8584	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97447	1.0025	10	0.87932	D	0	.	15.8078	0.78527	0.0:0.0:1.0:0.0	.	316	P17787	ACHB2_HUMAN	M	316	ENSP00000357461:V316M	ENSP00000357461:V316M	V	+	1	0	CHRNB2	152810869	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.592000	0.98245	2.024000	0.59613	0.313000	0.20887	GTG		0.622	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748	
INSRR	3645	broad.mit.edu	37	1	156812203	156812203	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr1:156812203C>T	ENST00000368195.3	-	18	3620	c.3224G>A	c.(3223-3225)cGg>cAg	p.R1075Q	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1075	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R1075Q(2)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGCCTCAGGCCGCAAAGATCG	0.597																																					p.R1075Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3224A	1						.						99.0	99.0	99.0					1																	156812203		2203	4300	6503	155078827	SO:0001583	missense	3645	exon18			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3224G>A	1.37:g.156812203C>T	ENSP00000357178:p.Arg1075Gln	Somatic		Capture	Illumina HiSeq	Phase_I	155078827	NM_014215	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.377026	0.82682	.	.	ENSG00000027644	ENST00000368195	D	0.89485	-2.52	4.58	3.65	0.41850	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42548	D	0.000694	T	0.79569	0.4468	.	.	.	0.50039	D	0.999844	D	0.63046	0.992	B	0.39379	0.298	T	0.81867	-0.0735	9	0.87932	D	0	.	12.5999	0.56491	0.1673:0.8327:0.0:0.0	.	1075	P14616	INSRR_HUMAN	Q	1075	ENSP00000357178:R1075Q	ENSP00000357178:R1075Q	R	-	2	0	INSRR	155078827	0.967000	0.33354	0.806000	0.32338	0.991000	0.79684	7.651000	0.83577	1.121000	0.41925	0.561000	0.74099	CGG		0.597	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
CD1A	909	broad.mit.edu	37	1	158226761	158226761	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr1:158226761G>A	ENST00000289429.5	+	4	1323	c.790G>A	c.(790-792)Gca>Aca	p.A264T		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	264	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)		p.A264T(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	GTATCTCCGCGCAACCCTGGA	0.627																																					p.A264T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G790A	1						.						91.0	84.0	87.0					1																	158226761		2203	4300	6503	156493385	SO:0001583	missense	909	exon4			M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.790G>A	1.37:g.158226761G>A	ENSP00000289429:p.Ala264Thr	Somatic		Capture	Illumina HiSeq	Phase_I	156493385	NM_001763	D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Missense_Mutation	SNP	ENST00000289429.5	37	CCDS1174.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.349793	0.41599	.	.	ENSG00000158477	ENST00000289429	T	0.02863	4.13	3.84	0.883	0.19177	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	1.471120	0.04702	N	0.416033	T	0.03348	0.0097	M	0.65498	2.005	0.09310	N	1	D	0.54964	0.969	P	0.54238	0.746	T	0.35847	-0.9772	10	0.59425	D	0.04	-0.5712	6.7352	0.23405	0.2614:0.0:0.7386:0.0	.	264	P06126	CD1A_HUMAN	T	264	ENSP00000289429:A264T	ENSP00000289429:A264T	A	+	1	0	CD1A	156493385	0.000000	0.05858	0.000000	0.03702	0.265000	0.26407	-0.065000	0.11617	0.080000	0.16959	0.491000	0.48974	GCA		0.627	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763	
OR10J1	26476	broad.mit.edu	37	1	159409721	159409721	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr1:159409721C>A	ENST00000423932.3	+	1	210	c.173C>A	c.(172-174)aCc>aAc	p.T58N	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	58					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T214N(1)|p.T58N(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					ATCATTGTGACCATCATCCGA	0.438																																					p.T58N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C173A	1						.						204.0	184.0	191.0					1																	159409721		2203	4300	6503	157676345	SO:0001583	missense	26476	exon1			X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.173C>A	1.37:g.159409721C>A	ENSP00000399078:p.Thr58Asn	Somatic		Capture	Illumina HiSeq	Phase_I	157676345	NM_012351	Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	ENST00000423932.3	37	CCDS1185.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548714	0.27652	.	.	ENSG00000196184	ENST00000423932	T	0.01092	5.35	4.48	1.54	0.23209	GPCR, rhodopsin-like superfamily (1);	0.340673	0.21140	N	0.079485	T	0.01254	0.0041	M	0.78916	2.43	0.18873	N	0.999981	P	0.50528	0.936	P	0.55260	0.772	T	0.47674	-0.9099	10	0.48119	T	0.1	.	3.5682	0.07908	0.0:0.517:0.1966:0.2863	.	58	P30954	O10J1_HUMAN	N	58	ENSP00000399078:T58N	ENSP00000399078:T58N	T	+	2	0	OR10J1	157676345	0.001000	0.12720	0.897000	0.35233	0.036000	0.12997	0.336000	0.19823	0.589000	0.29677	-0.176000	0.13171	ACC		0.438	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059020.1	NM_012351	
TPR	7175	broad.mit.edu	37	1	186332051	186332051	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr1:186332051G>A	ENST00000367478.4	-	6	910	c.614C>T	c.(613-615)aCt>aTt	p.T205I	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	205					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.T206I(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AAGTTCATCAGTTTTGGTTTT	0.333			T	NTRK1	papillary thyroid																																p.T205I			Dom	yes		1	1q25	7175	translocated promoter region		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C614T	1						.						85.0	77.0	80.0					1																	186332051		1817	4071	5888	184598674	SO:0001583	missense	7175	exon6			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.614C>T	1.37:g.186332051G>A	ENSP00000356448:p.Thr205Ile	Somatic		Capture	Illumina HiSeq	Phase_I	184598674	NM_003292	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049829	0.75846	.	.	ENSG00000047410	ENST00000367478	T	0.25912	1.77	5.53	5.53	0.82687	.	0.110711	0.64402	D	0.000017	T	0.52773	0.1755	M	0.70275	2.135	0.44201	D	0.99702	D;D	0.76494	0.999;0.998	D;P	0.70016	0.967;0.878	T	0.52801	-0.8527	10	0.72032	D	0.01	.	19.8241	0.96610	0.0:0.0:1.0:0.0	.	205;205	Q15624;P12270	.;TPR_HUMAN	I	205	ENSP00000356448:T205I	ENSP00000356448:T205I	T	-	2	0	TPR	184598674	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.552000	0.60747	2.758000	0.94735	0.655000	0.94253	ACT		0.333	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
BAI2	576	broad.mit.edu	37	1	32196507	32196507	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr1:32196507G>A	ENST00000373658.3	-	29	4615	c.4274C>T	c.(4273-4275)cCg>cTg	p.P1425L	BAI2_ENST00000398556.3_Missense_Mutation_p.P1340L|BAI2_ENST00000257070.4_Missense_Mutation_p.P1392L|BAI2_ENST00000398547.1_Missense_Mutation_p.P1358L|BAI2_ENST00000398538.1_Missense_Mutation_p.P1413L|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000527361.1_Missense_Mutation_p.P1392L|BAI2_ENST00000373655.2_Missense_Mutation_p.P1425L|BAI2_ENST00000440175.2_Missense_Mutation_p.P1034L|BAI2_ENST00000398542.1_Missense_Mutation_p.P1325L	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1425	Poly-Pro.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P1425L(2)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CGGCGGTGGCGGTTGGAAGGT	0.667																																					p.P1425L												BAI2,central_nervous_system,brain,Substitution - Missense,0 	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.C4274T	1						.						35.0	49.0	44.0					1																	32196507		2203	4300	6503	31969094	SO:0001583	missense	576	exon29			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.4274C>T	1.37:g.32196507G>A	ENSP00000362762:p.Pro1425Leu	Somatic		Capture	Illumina HiSeq	Phase_I	31969094	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738139	0.49045	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.50548	1.43;1.63;0.81;0.8;1.8;0.74;0.74;1.44;0.83	5.47	5.47	0.80525	.	0.000000	0.38058	N	0.001822	T	0.40522	0.1120	L	0.43923	1.385	0.49582	D	0.999801	B;P;B;B;P;B;B	0.46327	0.05;0.548;0.006;0.047;0.876;0.413;0.005	B;B;B;B;B;B;B	0.39904	0.03;0.093;0.001;0.007;0.313;0.043;0.003	T	0.40156	-0.9578	10	0.62326	D	0.03	.	12.6291	0.56646	0.0:0.0:0.7302:0.2698	.	1392;1413;1034;1340;1425;1425;1413	O60241-4;O60241-3;B4DKC3;A2A3C6;O60241-2;O60241;A2A3C2	.;.;.;.;.;BAI2_HUMAN;.	L	1340;1358;1425;1425;1325;1392;1392;1034;1413	ENSP00000381564:P1340L;ENSP00000381555:P1358L;ENSP00000362762:P1425L;ENSP00000362759:P1425L;ENSP00000381550:P1325L;ENSP00000257070:P1392L;ENSP00000435397:P1392L;ENSP00000391071:P1034L;ENSP00000381548:P1413L	ENSP00000257070:P1392L	P	-	2	0	BAI2	31969094	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	3.598000	0.54038	2.735000	0.93741	0.655000	0.94253	CCG		0.667	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
MTF1	4520	broad.mit.edu	37	1	38304297	38304297	+	Splice_Site	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr1:38304297C>T	ENST00000373036.4	-	4	919	c.779G>A	c.(778-780)cGg>cAg	p.R260Q		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	260					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.R260Q(1)		endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TAAGACCTACCGAAATGGCTT	0.403																																					p.R260Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G779A	1						.						135.0	116.0	122.0					1																	38304297		2203	4300	6503	38076884	SO:0001630	splice_region_variant	4520	exon4			BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.779+1G>A	1.37:g.38304297C>T		Somatic		Capture	Illumina HiSeq	Phase_I	38076884	NM_005955	B2RAK6|Q96CB1	Missense_Mutation	SNP	ENST00000373036.4	37	CCDS30676.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039451	0.93630	.	.	ENSG00000188786	ENST00000373036;ENST00000543396	T	0.14391	2.51	5.07	5.07	0.68467	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.19725	0.0474	N	0.11201	0.11	0.53688	D	0.999975	D	0.76494	0.999	D	0.68192	0.956	T	0.27262	-1.0079	9	.	.	.	.	18.8206	0.92096	0.0:1.0:0.0:0.0	.	260	Q14872	MTF1_HUMAN	Q	260;128	ENSP00000362127:R260Q	.	R	-	2	0	MTF1	38076884	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.922000	0.70036	2.509000	0.84616	0.563000	0.77884	CGG		0.403	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955	Missense_Mutation
ODF2L	57489	broad.mit.edu	37	1	86822191	86822191	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr1:86822191C>A	ENST00000359242.3	-	14	1735	c.1454G>T	c.(1453-1455)aGt>aTt	p.S485I	ODF2L_ENST00000317336.7_Missense_Mutation_p.S485I|ODF2L_ENST00000370567.1_Missense_Mutation_p.S456I|ODF2L_ENST00000294678.2_Missense_Mutation_p.S456I|ODF2L_ENST00000394731.1_Missense_Mutation_p.S325I|ODF2L_ENST00000370566.3_Intron|ODF2L_ENST00000524695.1_5'UTR	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	485						centrosome (GO:0005813)		p.S456I(1)		endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		GCACTGCAGACTCTCCTGACA	0.562																																					p.S456I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1367T	1						.						91.0	84.0	86.0					1																	86822191		2203	4300	6503	86594779	SO:0001583	missense	57489	exon13				CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.1454G>T	1.37:g.86822191C>A	ENSP00000359600:p.Ser485Ile	Somatic		Capture	Illumina HiSeq	Phase_I	86594779	NM_020729	A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Missense_Mutation	SNP	ENST00000359242.3	37	CCDS41354.2	.	.	.	.	.	.	.	.	.	.	C	13.19	2.162065	0.38217	.	.	ENSG00000122417	ENST00000359242;ENST00000460698;ENST00000317336;ENST00000370567;ENST00000394731;ENST00000294678	T;T;T;T;T;T	0.79033	1.87;-1.23;1.87;1.88;1.88;-1.17	6.16	-0.428	0.12306	.	0.860826	0.10704	N	0.643635	T	0.49508	0.1561	L	0.36672	1.1	0.09310	N	0.999998	P;P;P	0.49090	0.919;0.919;0.919	B;B;B	0.43052	0.406;0.406;0.406	T	0.41893	-0.9483	10	0.62326	D	0.03	0.2688	5.5294	0.16976	0.0:0.3259:0.1505:0.5237	.	456;456;485	Q9ULJ1-4;Q9ULJ1-3;Q9ULJ1	.;.;ODF2L_HUMAN	I	485;332;485;456;325;456	ENSP00000359600:S485I;ENSP00000433092:S332I;ENSP00000320165:S485I;ENSP00000359598:S456I;ENSP00000378219:S325I;ENSP00000294678:S456I	ENSP00000294678:S456I	S	-	2	0	ODF2L	86594779	0.002000	0.14202	0.326000	0.25389	0.667000	0.39255	-0.257000	0.08745	-0.096000	0.12329	-0.355000	0.07637	AGT		0.562	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2		
ASPM	259266	broad.mit.edu	37	1	197070068	197070068	+	Silent	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr1:197070068G>A	ENST00000367409.4	-	18	8569	c.8313C>T	c.(8311-8313)aaC>aaT	p.N2771N	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2771					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.N2771N(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GTGCAGATTGGTTAACAATGG	0.378																																					p.N2771N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C8313T	1						.						110.0	110.0	110.0					1																	197070068		2203	4299	6502	195336691	SO:0001819	synonymous_variant	259266	exon18			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.8313C>T	1.37:g.197070068G>A		Somatic		Capture	Illumina HiSeq	Phase_I	195336691	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	37	CCDS1389.1																																																																																				0.378	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
CDK5RAP1	51654	broad.mit.edu	37	20	31958376	31958376	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr20:31958376C>T	ENST00000357886.4	-	12	1516	c.1363G>A	c.(1363-1365)Gtc>Atc	p.V455I	CDK5RAP1_ENST00000473997.1_Missense_Mutation_p.V351I|CDK5RAP1_ENST00000544843.1_Intron|CDK5RAP1_ENST00000339269.5_Missense_Mutation_p.V364I|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.V441I			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	455					brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)	p.V441I(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						ACTGTCTGGACGTGATCTTCC	0.537																																					p.V351I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1051A	20						.						269.0	221.0	237.0					20																	31958376		2203	4300	6503	31422037	SO:0001583	missense	51654	exon11			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.1363G>A	20.37:g.31958376C>T	ENSP00000350558:p.Val455Ile	Somatic		Capture	Illumina HiSeq	Phase_I	31422037	NM_016082	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	ENST00000357886.4	37		.	.	.	.	.	.	.	.	.	.	C	14.73	2.623211	0.46840	.	.	ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000339269;ENST00000452723;ENST00000375351	T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37	5.71	2.73	0.32206	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.332441	0.33075	N	0.005306	T	0.60261	0.2255	N	0.11201	0.11	0.80722	D	1	B;B;B;B;B;B;B	0.20780	0.048;0.045;0.045;0.004;0.045;0.036;0.01	B;B;B;B;B;B;B	0.13407	0.009;0.007;0.007;0.001;0.004;0.002;0.002	T	0.52177	-0.8610	10	0.59425	D	0.04	-2.7141	6.0813	0.19942	0.0751:0.1406:0.6492:0.1352	.	364;455;441;181;441;441;351	Q96SZ6-4;Q96SZ6;Q675N5;E9PF14;Q53H36;Q96SZ6-3;Q96SZ6-2	.;CK5P1_HUMAN;.;.;.;.;.	I	441;455;364;351;181	ENSP00000217372:V441I;ENSP00000350558:V455I;ENSP00000341840:V364I;ENSP00000408133:V351I	ENSP00000341840:V364I	V	-	1	0	CDK5RAP1	31422037	1.000000	0.71417	0.993000	0.49108	0.784000	0.44337	4.341000	0.59335	0.358000	0.24211	-1.195000	0.01675	GTC		0.537	CDK5RAP1-011	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078697.1	NM_016408	
ATP9A	10079	broad.mit.edu	37	20	50273605	50273605	+	Missense_Mutation	SNP	C	C	T	rs199887924		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr20:50273605C>T	ENST00000338821.5	-	14	1642	c.1378G>A	c.(1378-1380)Gtg>Atg	p.V460M	ATP9A_ENST00000402822.1_Missense_Mutation_p.V339M|ATP9A_ENST00000311637.5_Missense_Mutation_p.V324M	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	460					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.V460M(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ATGGCCTTCACGGCTTCGTGC	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		17433	0.0		0.001	False		,,,				2504	0.0				p.V460M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1378A	20						.						99.0	76.0	84.0					20																	50273605		2203	4300	6503	49707012	SO:0001583	missense	10079	exon14			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1378G>A	20.37:g.50273605C>T	ENSP00000342481:p.Val460Met	Somatic		Capture	Illumina HiSeq	Phase_I	49707012	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	21.9	4.214169	0.79352	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	T;T;T	0.64618	-0.11;-0.11;-0.11	5.02	5.02	0.67125	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.057240	0.64402	D	0.000001	T	0.71307	0.3324	L	0.33624	1.015	0.80722	D	1	D;D	0.76494	0.997;0.999	P;D	0.69824	0.743;0.966	T	0.75317	-0.3360	10	0.87932	D	0	-19.5827	18.3424	0.90309	0.0:1.0:0.0:0.0	.	339;460	O75110-2;O75110	.;ATP9A_HUMAN	M	324;460;339	ENSP00000309086:V324M;ENSP00000342481:V460M;ENSP00000385875:V339M	ENSP00000309086:V324M	V	-	1	0	ATP9A	49707012	1.000000	0.71417	0.909000	0.35828	0.515000	0.34225	7.760000	0.85248	2.319000	0.78375	0.655000	0.94253	GTG		0.612	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
KCNJ15	3772	broad.mit.edu	37	21	39672159	39672159	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr21:39672159G>T	ENST00000328656.4	+	4	1279	c.976G>T	c.(976-978)Gat>Tat	p.D326Y	KCNJ15_ENST00000398934.1_Missense_Mutation_p.D326Y|KCNJ15_ENST00000398932.1_Missense_Mutation_p.D326Y|KCNJ15_ENST00000398930.1_Missense_Mutation_p.D326Y|KCNJ15_ENST00000398938.2_Missense_Mutation_p.D326Y	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	326					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.D326Y(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	ATATGTGGCTGATTTCAGTCA	0.443																																					p.D326Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G976T	21						.						67.0	65.0	66.0					21																	39672159		2203	4300	6503	38594029	SO:0001583	missense	3772	exon3			Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.976G>T	21.37:g.39672159G>T	ENSP00000331698:p.Asp326Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	38594029	NM_170736	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	ENST00000328656.4	37	CCDS13656.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374008	0.82573	.	.	ENSG00000157551	ENST00000328656;ENST00000398938;ENST00000398932;ENST00000398930;ENST00000398934	D;D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5;-3.5	5.83	5.83	0.93111	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.98163	0.9393	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98616	1.0665	9	.	.	.	.	20.1338	0.98010	0.0:0.0:1.0:0.0	.	326	Q99712	IRK15_HUMAN	Y	326	ENSP00000331698:D326Y;ENSP00000381911:D326Y;ENSP00000381905:D326Y;ENSP00000381904:D326Y;ENSP00000381907:D326Y	.	D	+	1	0	KCNJ15	38594029	1.000000	0.71417	0.940000	0.37924	0.982000	0.71751	9.869000	0.99810	2.770000	0.95276	0.655000	0.94253	GAT		0.443	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243	
TPO	7173	broad.mit.edu	37	2	1544469	1544469	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:1544469C>T	ENST00000345913.4	+	16	2813	c.2722C>T	c.(2722-2724)Cgg>Tgg	p.R908W	TPO_ENST00000382198.1_Missense_Mutation_p.R735W|TPO_ENST00000349624.3_Missense_Mutation_p.R735W|TPO_ENST00000329066.4_Missense_Mutation_p.R908W|TPO_ENST00000382201.3_Missense_Mutation_p.R851W|TPO_ENST00000497517.2_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.R864W|TPO_ENST00000337415.3_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	908					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.R908W(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CTCACCGCAGCGGGCCGCAGC	0.642																																					p.R864W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2590T	2						.						64.0	57.0	59.0					2																	1544469		2203	4300	6503	1523476	SO:0001583	missense	7173	exon14				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2722C>T	2.37:g.1544469C>T	ENSP00000318820:p.Arg908Trp	Somatic		Capture	Illumina HiSeq	Phase_I	1523476	NM_175721	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	C	8.829	0.939425	0.18281	.	.	ENSG00000115705	ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607;ENST00000425083	T;T;T;T;T;T;T;T;T	0.70869	-0.29;-0.28;-0.04;-0.29;-0.23;-0.04;-0.34;0.49;-0.52	1.3	-2.61	0.06171	.	907.158000	0.00166	U	0.000008	T	0.55210	0.1906	N	0.08118	0	0.09310	N	1	D;P;D;D	0.61080	0.989;0.858;0.978;0.978	P;B;B;B	0.47573	0.55;0.057;0.237;0.18	T	0.51903	-0.8646	10	0.72032	D	0.01	0.0494	5.715	0.17954	0.4159:0.5841:0.0:0.0	.	864;735;851;908	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	W	908;864;735;908;851;735;793;338;129	ENSP00000318820:R908W;ENSP00000263886:R864W;ENSP00000332044:R735W;ENSP00000329869:R908W;ENSP00000371636:R851W;ENSP00000371633:R735W;ENSP00000405788:R793W;ENSP00000419461:R338W;ENSP00000389659:R129W	ENSP00000329869:R908W	R	+	1	2	TPO	1523476	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.967000	0.01508	-0.583000	0.05921	0.134000	0.15878	CGG		0.642	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
ARHGAP15	55843	broad.mit.edu	37	2	144314000	144314000	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:144314000C>T	ENST00000295095.6	+	11	1116	c.949C>T	c.(949-951)Cga>Tga	p.R317*	RP11-570L15.2_ENST00000546678.1_RNA|RP11-570L15.1_ENST00000553076.1_RNA	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	317	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)	p.R317*(1)		endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		TGGAATATATCGAGTTAGTGG	0.323																																					p.R317X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C949T	2						.						192.0	200.0	197.0					2																	144314000		2203	4298	6501	144030470	SO:0001587	stop_gained	55843	exon11			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.949C>T	2.37:g.144314000C>T	ENSP00000295095:p.Arg317*	Somatic		Capture	Illumina HiSeq	Phase_I	144030470	NM_018460	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Nonsense_Mutation	SNP	ENST00000295095.6	37	CCDS2184.1	.	.	.	.	.	.	.	.	.	.	C	37	6.118596	0.97300	.	.	ENSG00000075884	ENST00000295095	.	.	.	4.99	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.9049	0.52705	0.4872:0.5128:0.0:0.0	.	.	.	.	X	317	.	ENSP00000295095:R317X	R	+	1	2	ARHGAP15	144030470	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.303000	0.43646	1.040000	0.40099	0.561000	0.74099	CGA		0.323	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
KCNH7	90134	broad.mit.edu	37	2	163374435	163374435	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:163374435C>T	ENST00000332142.5	-	4	796	c.697G>A	c.(697-699)Gga>Aga	p.G233R	KCNH7_ENST00000328032.4_Missense_Mutation_p.G233R|KCNH7_ENST00000477019.1_5'UTR	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	233					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.G233R(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TCAAGAGGTCCGGATATATTC	0.483																																					p.G233R	GBM(196;1492 2208 17507 24132 45496)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G697A	2						.						148.0	143.0	145.0					2																	163374435		2202	4300	6502	163082681	SO:0001583	missense	90134	exon4			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.697G>A	2.37:g.163374435C>T	ENSP00000331727:p.Gly233Arg	Somatic		Capture	Illumina HiSeq	Phase_I	163082681	NM_173162	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.157874	0.78114	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.98512	-4.97;-4.97	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.95655	0.8587	N	0.14661	0.345	0.80722	D	1	P;D	0.69078	0.802;0.997	B;P	0.47044	0.182;0.535	D	0.94087	0.7349	10	0.12766	T	0.61	.	20.2556	0.98417	0.0:1.0:0.0:0.0	.	233;233	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	R	233	ENSP00000331727:G233R;ENSP00000333781:G233R	ENSP00000333781:G233R	G	-	1	0	KCNH7	163082681	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.273000	0.78527	2.791000	0.96007	0.655000	0.94253	GGA		0.483	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
GORASP2	26003	broad.mit.edu	37	2	171819383	171819383	+	Silent	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:171819383C>T	ENST00000234160.4	+	9	1760	c.945C>T	c.(943-945)ctC>ctT	p.L315L	GORASP2_ENST00000452526.2_Silent_p.L327L|GORASP2_ENST00000493692.1_3'UTR	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	315	Pro-rich.				mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.L315L(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						TGCCCAACCTCCCCAACCTCA	0.498																																					p.L315L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C945T	2						.						110.0	95.0	100.0					2																	171819383		2203	4300	6503	171527629	SO:0001819	synonymous_variant	26003	exon9				CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.945C>T	2.37:g.171819383C>T		Somatic		Capture	Illumina HiSeq	Phase_I	171527629	NM_015530	B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Silent	SNP	ENST00000234160.4	37	CCDS33325.1																																																																																				0.498	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333719.2		
HOXD10	3236	broad.mit.edu	37	2	176981935	176981935	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:176981935C>T	ENST00000249501.4	+	1	629	c.374C>T	c.(373-375)tCg>tTg	p.S125L	HOXD10_ENST00000490088.2_Intron	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	125					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S125L(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		AAACTCATTTCGGCCGAGGTC	0.502																																					p.S125L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C374T	2						.						149.0	161.0	157.0					2																	176981935		2203	4300	6503	176690181	SO:0001583	missense	3236	exon1				CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.374C>T	2.37:g.176981935C>T	ENSP00000249501:p.Ser125Leu	Somatic		Capture	Illumina HiSeq	Phase_I	176690181	NM_002148	Q6NT10	Missense_Mutation	SNP	ENST00000249501.4	37	CCDS2266.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.091884	0.55968	.	.	ENSG00000128710	ENST00000249501	T	0.25414	1.8	5.99	5.99	0.97316	.	0.096986	0.64402	D	0.000001	T	0.39306	0.1073	M	0.83384	2.64	0.80722	D	1	B	0.26635	0.155	B	0.23574	0.047	T	0.27773	-1.0064	10	0.59425	D	0.04	.	20.4756	0.99175	0.0:1.0:0.0:0.0	.	125	P28358	HXD10_HUMAN	L	125	ENSP00000249501:S125L	ENSP00000249501:S125L	S	+	2	0	HOXD10	176690181	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.346000	0.79347	2.847000	0.97988	0.655000	0.94253	TCG		0.502	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255692.2		
TTN	7273	broad.mit.edu	37	2	179595288	179595288	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:179595288C>A	ENST00000591111.1	-	59	17245	c.17021G>T	c.(17020-17022)tGt>tTt	p.C5674F	TTN_ENST00000342992.6_Missense_Mutation_p.C4747F|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.C5991F			Q8WZ42	TITIN_HUMAN	titin	12483	Ig-like 37.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.C4747F(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTGGCAGAACAAGTGTATGT	0.398																																					p.C4747F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G14240T	2						.						120.0	117.0	118.0					2																	179595288		1946	4131	6077	179303533	SO:0001583	missense	7273	exon58			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17021G>T	2.37:g.179595288C>A	ENSP00000465570:p.Cys5674Phe	Somatic		Capture	Illumina HiSeq	Phase_I	179303533	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	14.44	2.537353	0.45176	.	.	ENSG00000155657	ENST00000342992	T	0.63744	-0.06	5.99	5.99	0.97316	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89532	0.6742	H	0.99600	4.65	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93351	0.6718	9	0.87932	D	0	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	5674	Q8WZ42	TITIN_HUMAN	F	4747	ENSP00000343764:C4747F	ENSP00000343764:C4747F	C	-	2	0	TTN	179303533	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.840000	0.97914	0.655000	0.94253	TGT		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
WDR35	57539	broad.mit.edu	37	2	20130225	20130225	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:20130225G>A	ENST00000345530.3	-	26	3201	c.3086C>T	c.(3085-3087)gCt>gTt	p.A1029V	WDR35_ENST00000281405.4_Missense_Mutation_p.A1018V|WDR35_ENST00000416055.2_Missense_Mutation_p.A502V	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	1029					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)		p.A1029V(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGTGGTAAGCCTCTGCCCC	0.478																																					p.A1029V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3086T	2						.						173.0	169.0	171.0					2																	20130225		2203	4300	6503	19993706	SO:0001583	missense	57539	exon26			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.3086C>T	2.37:g.20130225G>A	ENSP00000314444:p.Ala1029Val	Somatic		Capture	Illumina HiSeq	Phase_I	19993706	NM_001006657	B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	ENST00000345530.3	37	CCDS33152.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.432882	0.83776	.	.	ENSG00000118965	ENST00000345530;ENST00000281405;ENST00000416055	T;T;D	0.87029	-0.95;-0.96;-2.2	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.95050	0.8397	M	0.91300	3.195	0.46927	D	0.999259	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.997	D	0.95609	0.8670	10	0.66056	D	0.02	-17.5597	18.4109	0.90550	0.0:0.0:1.0:0.0	.	1018;1029;502	Q9P2L0-2;Q9P2L0;B3KR94	.;WDR35_HUMAN;.	V	1029;1018;502	ENSP00000314444:A1029V;ENSP00000281405:A1018V;ENSP00000399159:A502V	ENSP00000281405:A1018V	A	-	2	0	WDR35	19993706	1.000000	0.71417	0.974000	0.42286	0.972000	0.66771	9.784000	0.99039	2.596000	0.87737	0.563000	0.77884	GCT		0.478	WDR35-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207472.2	NM_020779	
CCDC141	285025	broad.mit.edu	37	2	179732815	179732815	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:179732815C>A	ENST00000420890.2	-	16	2629	c.2512G>T	c.(2512-2514)Gac>Tac	p.D838Y	CCDC141_ENST00000295723.5_Missense_Mutation_p.D263Y	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	838								p.D838Y(1)|p.D263Y(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TGGAGATGGTCTACACGGGCT	0.498																																					p.D838Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2512T	2						.						139.0	119.0	126.0					2																	179732815		2203	4300	6503	179441060	SO:0001583	missense	285025	exon16			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2512G>T	2.37:g.179732815C>A	ENSP00000395995:p.Asp838Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	179441060	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37		.	.	.	.	.	.	.	.	.	.	C	19.15	3.771217	0.69992	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758	T;T;T;T	0.47177	0.85;1.45;1.45;1.44	5.5	3.68	0.42216	.	0.650519	0.14900	N	0.291867	T	0.47116	0.1428	L	0.29908	0.895	0.09310	N	1	D	0.54207	0.965	P	0.56474	0.799	T	0.27262	-1.0079	10	0.72032	D	0.01	-7.8297	6.8016	0.23754	0.0:0.7422:0.0:0.2578	.	263	Q6ZP82	CC141_HUMAN	Y	838;282;263;838	ENSP00000395995:D838Y;ENSP00000344627:D282Y;ENSP00000295723:D263Y;ENSP00000390190:D838Y	ENSP00000295723:D263Y	D	-	1	0	CCDC141	179441060	0.015000	0.18098	0.332000	0.25469	0.394000	0.30568	0.333000	0.19768	1.464000	0.47987	0.650000	0.86243	GAC		0.498	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
FAM117B	150864	broad.mit.edu	37	2	203622019	203622019	+	Silent	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:203622019G>A	ENST00000392238.2	+	6	1188	c.1188G>A	c.(1186-1188)acG>acA	p.T396T	FAM117B_ENST00000303116.6_Silent_p.T152T			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	396								p.T152T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						ACACACAGACGCCTGGTGGGG	0.547																																					p.T396T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1188A	2						.						91.0	84.0	86.0					2																	203622019		2203	4300	6503	203330264	SO:0001819	synonymous_variant	150864	exon6			AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.1188G>A	2.37:g.203622019G>A		Somatic		Capture	Illumina HiSeq	Phase_I	203330264	NM_173511	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Silent	SNP	ENST00000392238.2	37	CCDS33362.2																																																																																				0.547	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335888.3	NM_173511	
ADAM23	8745	broad.mit.edu	37	2	207414826	207414826	+	Missense_Mutation	SNP	G	G	A	rs201146986		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:207414826G>A	ENST00000264377.3	+	9	1203	c.875G>A	c.(874-876)cGt>cAt	p.R292H	ADAM23_ENST00000374416.1_Missense_Mutation_p.R292H|ADAM23_ENST00000374415.3_Missense_Mutation_p.R292H	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	292					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R292H(1)		NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		TAGCCATCACGTGGTATATTT	0.313																																					p.R292H	Melanoma(194;1127 2130 19620 24042 27855)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G875A	2						.						82.0	82.0	82.0					2																	207414826		2202	4295	6497	207123071	SO:0001583	missense	8745	exon9			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.875G>A	2.37:g.207414826G>A	ENSP00000264377:p.Arg292His	Somatic		Capture	Illumina HiSeq	Phase_I	207123071	NM_003812	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200109	0.79015	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.02682	4.21;4.2;4.21	5.86	5.86	0.93980	.	0.000000	0.56097	D	0.000037	T	0.04452	0.0122	L	0.34521	1.04	0.80722	D	1	P	0.44946	0.846	B	0.39971	0.315	T	0.44375	-0.9332	10	0.66056	D	0.02	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	292	O75077	ADA23_HUMAN	H	292;292;186;292	ENSP00000264377:R292H;ENSP00000363537:R292H;ENSP00000363536:R292H	ENSP00000264377:R292H	R	+	2	0	ADAM23	207123071	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.689000	0.91265	2.937000	0.99478	0.650000	0.86243	CGT		0.313	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	
ASAP2	8853	broad.mit.edu	37	2	9484733	9484733	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:9484733C>T	ENST00000281419.3	+	10	1262	c.922C>T	c.(922-924)Cgg>Tgg	p.R308W	ASAP2_ENST00000315273.4_Missense_Mutation_p.R308W	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	308	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)	p.R308W(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						TGGGACCGAGCGGAACGGCAG	0.458																																					p.R308W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C922T	2						.						97.0	90.0	92.0					2																	9484733		2203	4300	6503	9402184	SO:0001583	missense	8853	exon10			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.922C>T	2.37:g.9484733C>T	ENSP00000281419:p.Arg308Trp	Somatic		Capture	Illumina HiSeq	Phase_I	9402184	NM_001135191	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475120	0.63737	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.76968	-1.06;-1.06	5.64	3.61	0.41365	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.87140	0.6103	M	0.77103	2.36	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.989;0.997	D	0.88848	0.3317	10	0.87932	D	0	.	13.7117	0.62672	0.4415:0.5585:0.0:0.0	.	308;308	O43150-2;O43150	.;ASAP2_HUMAN	W	308	ENSP00000281419:R308W;ENSP00000316404:R308W	ENSP00000281419:R308W	R	+	1	2	ASAP2	9402184	1.000000	0.71417	0.902000	0.35471	0.475000	0.33008	2.430000	0.44766	1.309000	0.44985	0.650000	0.86243	CGG		0.458	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
PSME4	23198	broad.mit.edu	37	2	54135459	54135459	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:54135459G>A	ENST00000404125.1	-	24	2837	c.2782C>T	c.(2782-2784)Cgg>Tgg	p.R928W	PSME4_ENST00000421748.2_Missense_Mutation_p.R72W	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	928					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)	p.R814W(1)		breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			ATACTGACCCGATTTTCCATT	0.338																																					p.R928W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2782T	2						.						52.0	52.0	52.0					2																	54135459		2202	4298	6500	53988963	SO:0001583	missense	23198	exon24			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2782C>T	2.37:g.54135459G>A	ENSP00000384211:p.Arg928Trp	Somatic		Capture	Illumina HiSeq	Phase_I	53988963	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269681	0.80469	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.12255	2.7;2.7	5.36	2.26	0.28386	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.31734	0.0806	M	0.70275	2.135	0.58432	D	0.999997	D;D;D	0.76494	0.999;0.999;0.999	D;D;P	0.64776	0.929;0.928;0.852	T	0.04029	-1.0983	10	0.36615	T	0.2	.	14.0124	0.64505	0.0:0.0:0.4359:0.5641	.	303;72;928	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	W	72;928	ENSP00000410830:R72W;ENSP00000384211:R928W	ENSP00000384211:R928W	R	-	1	2	PSME4	53988963	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.090000	0.50191	0.547000	0.28938	0.655000	0.94253	CGG		0.338	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
PCBP1	5093	broad.mit.edu	37	2	70315174	70315174	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:70315174T>C	ENST00000303577.5	+	1	590	c.299T>C	c.(298-300)cTg>cCg	p.L100P	PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	100	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.L100P(1)|p.L100Q(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						CCGGTCACCCTGAGGCTGGTG	0.602																																					p.L100P	Colon(85;1146 1307 3484 18706 25380)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T299C	2						.						59.0	73.0	68.0					2																	70315174		2201	4300	6501	70168678	SO:0001583	missense	5093	exon1				CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.299T>C	2.37:g.70315174T>C	ENSP00000305556:p.Leu100Pro	Somatic		Capture	Illumina HiSeq	Phase_I	70168678	NM_006196	Q13157|Q14975	Missense_Mutation	SNP	ENST00000303577.5	37	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	T	17.52	3.411219	0.62399	.	.	ENSG00000169564	ENST00000303577	T	0.32753	1.44	4.16	4.16	0.48862	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.168590	0.40469	U	0.001094	T	0.63977	0.2557	H	0.94582	3.555	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.74070	-0.3783	10	0.87932	D	0	.	11.8577	0.52449	0.0:0.0:0.0:1.0	.	100	Q15365	PCBP1_HUMAN	P	100	ENSP00000305556:L100P	ENSP00000305556:L100P	L	+	2	0	PCBP1	70168678	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	5.884000	0.69729	2.120000	0.65058	0.477000	0.44152	CTG		0.602	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
LRRTM1	347730	broad.mit.edu	37	2	80530053	80530053	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:80530053G>A	ENST00000295057.3	-	2	1548	c.892C>T	c.(892-894)Cgg>Tgg	p.R298W	CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000466387.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.R298W|CTNNA2_ENST00000402739.4_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	298					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.R298W(2)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						TTGAGGATCCGGGGCTCGATG	0.617										HNSCC(69;0.2)																											p.R298W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C892T	2						.						55.0	55.0	55.0					2																	80530053		2203	4300	6503	80383564	SO:0001583	missense	347730	exon2			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.892C>T	2.37:g.80530053G>A	ENSP00000295057:p.Arg298Trp	Somatic		Capture	Illumina HiSeq	Phase_I	80383564	NM_178839	A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160416	0.57368	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.58506	0.33;0.33	5.26	3.3	0.37823	.	0.071997	0.53938	U	0.000060	T	0.70176	0.3194	M	0.62088	1.915	0.58432	D	0.999996	D	0.89917	1.0	D	0.72338	0.977	T	0.70281	-0.4915	9	.	.	.	.	12.6783	0.56908	0.0:0.0:0.5733:0.4267	.	298	Q86UE6	LRRT1_HUMAN	W	298	ENSP00000295057:R298W;ENSP00000386646:R298W	.	R	-	1	2	LRRTM1	80383564	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.827000	0.48112	1.144000	0.42321	0.655000	0.94253	CGG		0.617	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839	
CRYGA	1418	broad.mit.edu	37	2	209028060	209028060	+	Silent	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr2:209028060G>A	ENST00000304502.4	-	2	139	c.120C>T	c.(118-120)agC>agT	p.S40S		NM_014617.3	NP_055432.2	P11844	CRGA_HUMAN	crystallin, gamma A	40	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.S40S(1)|p.S40R(1)		endometrium(1)|kidney(3)|large_intestine(1)|lung(7)	12				Epithelial(149;0.067)|LUSC - Lung squamous cell carcinoma(261;0.0708)|Lung(261;0.135)		TCCAGCAGCCGCTGTCTACTC	0.592																																					p.S40S												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C120T	2						.						45.0	51.0	49.0					2																	209028060		2203	4300	6503	208736305	SO:0001819	synonymous_variant	1418	exon2				CCDS33367.1	2q34	2013-02-14			ENSG00000168582	ENSG00000168582			2408	protein-coding gene	gene with protein product	"""gamma crystallin 5"""	123660		CRYG1			Standard	NM_014617		Approved	CRYG5, CRY-g-A		P11844	OTTHUMG00000154796	ENST00000304502.4:c.120C>T	2.37:g.209028060G>A		Somatic		Capture	Illumina HiSeq	Phase_I	208736305	NM_014617	Q53ST5	Silent	SNP	ENST00000304502.4	37	CCDS33367.1																																																																																				0.592	CRYGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337096.1	NM_014617	
FGD5	152273	broad.mit.edu	37	3	14905695	14905695	+	Silent	SNP	T	T	G			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr3:14905695T>G	ENST00000285046.5	+	2	2696	c.2586T>G	c.(2584-2586)ctT>ctG	p.L862L	FGD5_ENST00000543601.1_Silent_p.L621L	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	862					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.L621L(1)|p.L862L(1)		NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						AAGAGGACCTTACGTCGGATG	0.572																																					p.L862L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T2586G	3						.						84.0	87.0	86.0					3																	14905695		1968	4149	6117	14880699	SO:0001819	synonymous_variant	152273	exon2			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.2586T>G	3.37:g.14905695T>G		Somatic		Capture	Illumina HiSeq	Phase_I	14880699	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Silent	SNP	ENST00000285046.5	37	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	T	7.487	0.649922	0.14516	.	.	ENSG00000154783	ENST00000457774	.	.	.	4.37	1.54	0.23209	.	.	.	.	.	T	0.51193	0.1660	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34875	-0.9811	4	.	.	.	-18.2662	4.8536	0.13549	0.0:0.5779:0.1561:0.266	.	.	.	.	D	76	.	.	Y	+	1	0	FGD5	14880699	0.987000	0.35691	0.675000	0.29917	0.688000	0.40055	0.329000	0.19698	0.080000	0.16959	-0.375000	0.07067	TAC		0.572	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
ZBTB47	92999	broad.mit.edu	37	3	42701101	42701101	+	Silent	SNP	G	G	C			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr3:42701101G>C	ENST00000232974.6	+	2	1535	c.1254G>C	c.(1252-1254)ccG>ccC	p.P418P	ZBTB47_ENST00000457842.3_Silent_p.P42P|ZBTB47_ENST00000505904.1_Intron			Q9UFB7	ZBT47_HUMAN	zinc finger and BTB domain containing 47	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P418P(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.216)		CCCGAGGGCCGCCAGCCACTG	0.667																																					p.P418P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1254C	3						.						15.0	19.0	18.0					3																	42701101		1910	4109	6019	42676105	SO:0001819	synonymous_variant	92999	exon2			AB033016	CCDS46805.1, CCDS46805.2	3p22.1	2013-01-08	2006-09-19	2006-09-19	ENSG00000114853	ENSG00000114853		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26955	protein-coding gene	gene with protein product			"""zinc finger protein 651"""	ZNF651		10574461	Standard	NM_145166		Approved	KIAA1190, DKFZp434N0615	uc003clu.2	Q9UFB7	OTTHUMG00000156207	ENST00000232974.6:c.1254G>C	3.37:g.42701101G>C		Somatic		Capture	Illumina HiSeq	Phase_I	42676105	NM_145166	H7BXD3|Q6ZSY6|Q8WTY8|Q9ULN0	Silent	SNP	ENST00000232974.6	37	CCDS46805.2																																																																																				0.667	ZBTB47-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343485.3	NM_145166	
CCR3	1232	broad.mit.edu	37	3	46307082	46307082	+	Missense_Mutation	SNP	C	C	T	rs567984457	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr3:46307082C>T	ENST00000357422.2	+	4	976	c.433C>T	c.(433-435)Cgg>Tgg	p.R145W	CCR3_ENST00000541018.1_Missense_Mutation_p.R145W|CCR3_ENST00000395942.2_Missense_Mutation_p.R145W|CCR3_ENST00000545097.1_Missense_Mutation_p.R166W|CCR3_ENST00000395940.2_Missense_Mutation_p.R145W			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	145					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.R145W(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		CCTTCGAGCCCGGACTGTCAC	0.488													C|||	2	0.000399361	0.0008	0.0	5008	,	,		19669	0.0		0.0	False		,,,				2504	0.001				p.R166W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C496T	3						.						86.0	83.0	84.0					3																	46307082		2203	4300	6503	46282086	SO:0001583	missense	1232	exon3			AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.433C>T	3.37:g.46307082C>T	ENSP00000350003:p.Arg145Trp	Somatic		Capture	Illumina HiSeq	Phase_I	46282086	NM_178328	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784434	0.49997	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06	5.86	1.56	0.23342	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000028	T	0.67664	0.2917	M	0.91090	3.175	0.48696	D	0.999691	D;D	0.57257	0.974;0.979	P;P	0.59171	0.853;0.852	T	0.78858	-0.2038	10	0.87932	D	0	.	17.6677	0.88208	0.5213:0.4787:0.0:0.0	.	166;145	F5GWL6;P51677	.;CCR3_HUMAN	W	145;166;145;145;145	ENSP00000350003:R145W;ENSP00000441600:R166W;ENSP00000440097:R145W;ENSP00000379271:R145W;ENSP00000379273:R145W	ENSP00000350003:R145W	R	+	1	2	CCR3	46282086	0.000000	0.05858	0.937000	0.37676	0.536000	0.34869	-0.136000	0.10405	0.090000	0.17273	-2.547000	0.00178	CGG		0.488	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
PRICKLE2	166336	broad.mit.edu	37	3	64133022	64133022	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr3:64133022A>T	ENST00000295902.6	-	7	1729	c.1144T>A	c.(1144-1146)Tcc>Acc	p.S382T	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.S438T	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	382					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S382T(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GTCTGGCTGGACAGGCTGAGC	0.607																																					p.S382T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1144A	3						.						79.0	87.0	84.0					3																	64133022		2203	4300	6503	64108062	SO:0001583	missense	166336	exon7			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.1144T>A	3.37:g.64133022A>T	ENSP00000295902:p.Ser382Thr	Somatic		Capture	Illumina HiSeq	Phase_I	64108062	NM_198859	Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	37	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	A	6.587	0.476629	0.12521	.	.	ENSG00000163637	ENST00000295902	T	0.61980	0.06	5.94	3.52	0.40303	.	0.080572	0.52532	D	0.000062	T	0.49406	0.1555	L	0.38175	1.15	0.44432	D	0.997357	B	0.16603	0.018	B	0.12156	0.007	T	0.39522	-0.9610	10	0.51188	T	0.08	-37.2493	8.937	0.35706	0.6286:0.259:0.0:0.1124	.	382	Q7Z3G6	PRIC2_HUMAN	T	382	ENSP00000295902:S382T	ENSP00000295902:S382T	S	-	1	0	PRICKLE2	64108062	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	4.037000	0.57311	0.472000	0.27344	-0.444000	0.05651	TCC		0.607	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
ADAMTS9	56999	broad.mit.edu	37	3	64607933	64607933	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr3:64607933G>T	ENST00000498707.1	-	18	2969	c.2627C>A	c.(2626-2628)cCt>cAt	p.P876H	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.P848H	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	876	Spacer.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P876H(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		AAACTGCTGAGGTTTATCTTC	0.423																																					p.P876H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2627A	3						.						79.0	80.0	79.0					3																	64607933		2203	4300	6503	64582973	SO:0001583	missense	56999	exon18			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.2627C>A	3.37:g.64607933G>T	ENSP00000418735:p.Pro876His	Somatic		Capture	Illumina HiSeq	Phase_I	64582973	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338024	0.81911	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.60672	0.17;0.19	5.63	5.63	0.86233	.	0.062472	0.64402	D	0.000004	T	0.79924	0.4530	M	0.88704	2.975	0.80722	D	1	P;P;D;P	0.69078	0.74;0.831;0.997;0.626	P;P;D;B	0.66602	0.592;0.605;0.945;0.401	T	0.81132	-0.1072	10	0.45353	T	0.12	.	19.673	0.95918	0.0:0.0:1.0:0.0	.	848;876;876;876	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	H	848;876	ENSP00000295903:P848H;ENSP00000418735:P876H	ENSP00000295903:P848H	P	-	2	0	ADAMTS9	64582973	1.000000	0.71417	0.994000	0.49952	0.878000	0.50629	5.218000	0.65257	2.668000	0.90789	0.563000	0.77884	CCT		0.423	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
IGSF10	285313	broad.mit.edu	37	3	151166190	151166190	+	Missense_Mutation	SNP	G	G	A	rs372867906		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr3:151166190G>A	ENST00000282466.3	-	4	1578	c.1579C>T	c.(1579-1581)Cgg>Tgg	p.R527W		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	527	Ig-like C2-type 1.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.R527W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATTAGGATCCGTCCATCCTCA	0.478																																					p.R527W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1579T	3						.	G	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	154.0	154.0	154.0		1579	1.4	0.6	3		154	0,8600		0,0,4300	no	missense	IGSF10	NM_178822.4	101	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	527/2624	151166190	2,13004	2203	4300	6503	152648880	SO:0001583	missense	285313	exon4			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.1579C>T	3.37:g.151166190G>A	ENSP00000282466:p.Arg527Trp	Somatic		Capture	Illumina HiSeq	Phase_I	152648880	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777328	0.49786	4.54E-4	0.0	ENSG00000152580	ENST00000282466	T	0.40756	1.02	4.76	1.41	0.22369	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.42548	D	0.000689	T	0.70448	0.3225	M	0.94101	3.495	0.43678	D	0.996119	D	0.89917	1.0	D	0.97110	1.0	T	0.77770	-0.2463	10	0.59425	D	0.04	.	13.7934	0.63155	0.0:0.0:0.3846:0.6154	.	527	Q6WRI0	IGS10_HUMAN	W	527	ENSP00000282466:R527W	ENSP00000282466:R527W	R	-	1	2	IGSF10	152648880	0.999000	0.42202	0.557000	0.28306	0.715000	0.41141	3.083000	0.50136	0.379000	0.24794	-0.410000	0.06199	CGG		0.478	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
PLK4	10733	broad.mit.edu	37	4	128806981	128806981	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr4:128806981T>G	ENST00000270861.5	+	5	730	c.456T>G	c.(454-456)atT>atG	p.I152M	PLK4_ENST00000514379.1_Missense_Mutation_p.I111M|PLK4_ENST00000507249.1_Missense_Mutation_p.I152M|PLK4_ENST00000515069.1_Missense_Mutation_p.I152M|PLK4_ENST00000513090.1_Missense_Mutation_p.I120M	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	152	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.I152M(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						ACATCAAGATTGCTGATTTTG	0.408																																					p.I111M	Colon(135;508 1718 19061 31832 42879)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T333G	4						.						174.0	163.0	167.0					4																	128806981		2203	4300	6503	129026431	SO:0001583	missense	10733	exon5			Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.456T>G	4.37:g.128806981T>G	ENSP00000270861:p.Ile152Met	Somatic		Capture	Illumina HiSeq	Phase_I	129026431	NM_001190801	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	37	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518203	0.64634	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	5.92	-2.78	0.05859	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.54615	0.1869	M	0.89658	3.05	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.54200	-0.8329	10	0.72032	D	0.01	-10.3486	2.4742	0.04572	0.1072:0.2461:0.1113:0.5354	.	120;152	O00444-2;O00444	.;PLK4_HUMAN	M	152;152;120;152;111	ENSP00000270861:I152M;ENSP00000421774:I152M;ENSP00000427554:I120M;ENSP00000423412:I152M;ENSP00000423582:I111M	ENSP00000270861:I152M	I	+	3	3	PLK4	129026431	0.931000	0.31567	0.972000	0.41901	0.995000	0.86356	-0.067000	0.11579	-0.408000	0.07565	-0.336000	0.08194	ATT		0.408	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
DCHS2	54798	broad.mit.edu	37	4	155256132	155256132	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr4:155256132G>T	ENST00000357232.4	-	8	1103	c.1104C>A	c.(1102-1104)ttC>ttA	p.F368L	DCHS2_ENST00000339452.1_Missense_Mutation_p.F867L|DCHS2_ENST00000507542.1_5'UTR	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	368	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F368L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GAGTTGTCTGGAAAATGTGTA	0.443																																					p.F867L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2601A	4						.						105.0	103.0	104.0					4																	155256132		2203	4300	6503	155475582	SO:0001583	missense	54798	exon4			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1104C>A	4.37:g.155256132G>T	ENSP00000349768:p.Phe368Leu	Somatic		Capture	Illumina HiSeq	Phase_I	155475582	NM_001142552	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	0.066	-1.211851	0.01555	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.53206	0.89;0.63	6.17	-2.96	0.05547	Cadherin (1);	0.572103	0.16303	N	0.220359	T	0.09598	0.0236	N	0.00226	-1.805	0.58432	D	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46428	-0.9192	10	0.02654	T	1	.	9.9574	0.41675	0.2302:0.2844:0.4853:0.0	.	867;368	E9PC11;Q6V1P9	.;PCD23_HUMAN	L	368;867;867	ENSP00000349768:F368L;ENSP00000345062:F867L	ENSP00000345062:F867L	F	-	3	2	DCHS2	155475582	0.817000	0.29147	0.086000	0.20670	0.154000	0.21943	-0.006000	0.12833	-0.420000	0.07427	0.655000	0.94253	TTC		0.443	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
GLRA3	8001	broad.mit.edu	37	4	175636693	175636693	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr4:175636693C>G	ENST00000274093.3	-	5	1022	c.520G>C	c.(520-522)Gat>Cat	p.D174H	GLRA3_ENST00000340217.5_Missense_Mutation_p.D174H	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	174					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.D174H(1)		endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	TTCTTGAGATCCATTGGACAG	0.274																																					p.D174H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G520C	4						.						79.0	82.0	81.0					4																	175636693		2203	4295	6498	175873268	SO:0001583	missense	8001	exon5			AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.520G>C	4.37:g.175636693C>G	ENSP00000274093:p.Asp174His	Somatic		Capture	Illumina HiSeq	Phase_I	175873268	NM_001042543	D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	ENST00000274093.3	37	CCDS3822.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577017	0.65878	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	T;T	0.81415	-1.49;-1.49	5.68	5.68	0.88126	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.80560	0.4646	L	0.39085	1.19	0.80722	D	1	P;P	0.50066	0.507;0.931	B;P	0.49047	0.251;0.599	T	0.81942	-0.0702	10	0.59425	D	0.04	.	18.5632	0.91108	0.0:1.0:0.0:0.0	.	174;174	O75311-2;O75311	.;GLRA3_HUMAN	H	174	ENSP00000274093:D174H;ENSP00000345284:D174H	ENSP00000274093:D174H	D	-	1	0	GLRA3	175873268	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.468000	0.80943	2.685000	0.91497	0.650000	0.86243	GAT		0.274	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313427.1		
PCDH7	5099	broad.mit.edu	37	4	30921914	30921914	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr4:30921914C>T	ENST00000543491.1	+	2	3314	c.3314C>T	c.(3313-3315)gCg>gTg	p.A1105V	PCDH7_ENST00000509925.1_3'UTR			O60245	PCDH7_HUMAN	protocadherin 7	0					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A1058V(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						AGACTGGGTGCGCTTCCACTC	0.547																																					p.A1105V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3314T	4						.						103.0	111.0	108.0					4																	30921914		2182	4292	6474	30531012	SO:0001583	missense	5099	exon2			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000543491.1:c.3314C>T	4.37:g.30921914C>T	ENSP00000441802:p.Ala1105Val	Somatic		Capture	Illumina HiSeq	Phase_I	30531012	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000543491.1	37	CCDS54753.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732621	0.89482	.	.	ENSG00000169851	ENST00000543491;ENST00000333135	T	0.52295	0.67	5.9	5.9	0.94986	.	.	.	.	.	T	0.47637	0.1456	N	0.14661	0.345	0.58432	D	0.999997	D;D	0.64830	0.994;0.988	P;P	0.55391	0.775;0.619	T	0.35475	-0.9787	9	0.25106	T	0.35	.	20.2789	0.98501	0.0:1.0:0.0:0.0	.	1105;1058	F5GWJ1;O60245-3	.;.	V	1105;1058	ENSP00000441802:A1105V	ENSP00000330302:A1058V	A	+	2	0	PCDH7	30531012	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.788000	0.95919	0.650000	0.86243	GCG		0.547	PCDH7-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032457, NM_002589	
ARAP2	116984	broad.mit.edu	37	4	36214876	36214876	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr4:36214876C>G	ENST00000303965.4	-	4	1519	c.1030G>C	c.(1030-1032)Gaa>Caa	p.E344Q		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	344					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)	p.E344Q(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TTGGAATTTTCTAGTCTCTGG	0.343																																					p.E344Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1030C	4						.						67.0	71.0	70.0					4																	36214876		2203	4297	6500	35891271	SO:0001583	missense	116984	exon4			AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.1030G>C	4.37:g.36214876C>G	ENSP00000302895:p.Glu344Gln	Somatic		Capture	Illumina HiSeq	Phase_I	35891271	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	37	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234610	0.58886	.	.	ENSG00000047365	ENST00000303965	T	0.10573	2.86	5.42	5.42	0.78866	.	0.284575	0.30320	N	0.009887	T	0.13243	0.0321	M	0.62723	1.935	0.37178	D	0.903362	P;P	0.43094	0.799;0.799	B;B	0.35931	0.214;0.214	T	0.06917	-1.0800	10	0.49607	T	0.09	.	15.0697	0.72026	0.0:1.0:0.0:0.0	.	274;344	A7E2A5;Q8WZ64	.;ARAP2_HUMAN	Q	344	ENSP00000302895:E344Q	ENSP00000302895:E344Q	E	-	1	0	ARAP2	35891271	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.715000	0.54897	2.709000	0.92574	0.591000	0.81541	GAA		0.343	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
MUC7	4589	broad.mit.edu	37	4	71347060	71347060	+	Missense_Mutation	SNP	A	A	C	rs74904873	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	A	A	A	C	A	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr4:71347060A>C	ENST00000304887.5	+	3	789	c.599A>C	c.(598-600)cAa>cCa	p.Q200P	MUC7_ENST00000413702.1_Missense_Mutation_p.Q200P|MUC7_ENST00000456088.1_Missense_Mutation_p.Q200P	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	200	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.Q200P(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			GCAACTACACAAGCTCCACCA	0.597													A|||	6	0.00119808	0.0015	0.0	5008	,	,		20514	0.002		0.001	False		,,,				2504	0.001				p.Q200P												.	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.A599C	4						.						489.0	395.0	427.0					4																	71347060		2203	4300	6503	71381649	SO:0001583	missense	4589	exon3			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.599A>C	4.37:g.71347060A>C	ENSP00000302021:p.Gln200Pro	Germline		Capture	Illumina HiSeq	Phase_I	71381649	NM_152291	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.465514	0.01053	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.48522	0.81;0.81;0.81	2.05	1.2	0.21068	.	.	.	.	.	T	0.20129	0.0484	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25433	-1.0132	8	.	.	.	3.0933	9.4049	0.38455	0.2401:0.7599:0.0:0.0	.	200	Q8TAX7	MUC7_HUMAN	P	200	ENSP00000407422:Q200P;ENSP00000400585:Q200P;ENSP00000302021:Q200P	.	Q	+	2	0	MUC7	71381649	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.162000	0.03141	0.022000	0.15160	-0.710000	0.03640	CAA		0.597	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
ADAM29	11086	broad.mit.edu	37	4	175896825	175896825	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr4:175896825G>T	ENST00000359240.3	+	5	819	c.149G>T	c.(148-150)gGc>gTc	p.G50V	ADAM29_ENST00000404450.4_Missense_Mutation_p.G50V|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000514159.1_Missense_Mutation_p.G50V|ADAM29_ENST00000445694.1_Missense_Mutation_p.G50V	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	50					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G50V(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		ACACCTCCAGGCTGGCTCTCC	0.512																																					p.G50V	Ovarian(140;1727 1835 21805 25838 41440)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G149T	4						.						57.0	54.0	55.0					4																	175896825		2203	4300	6503	176133400	SO:0001583	missense	11086	exon3			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.149G>T	4.37:g.175896825G>T	ENSP00000352177:p.Gly50Val	Somatic		Capture	Illumina HiSeq	Phase_I	176133400	NM_001130705	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	G	9.669	1.146166	0.21288	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000502940;ENST00000404450;ENST00000514159	T;T;T;T;T	0.06371	3.31;3.31;3.31;3.31;3.31	3.77	2.02	0.26589	Peptidase M12B, propeptide (1);	0.425230	0.16506	U	0.211440	T	0.27278	0.0669	M	0.92738	3.34	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.05989	-1.0852	9	.	.	.	.	5.5785	0.17236	0.2496:0.0:0.7504:0.0	.	50	Q9UKF5	ADA29_HUMAN	V	50	ENSP00000352177:G50V;ENSP00000414544:G50V;ENSP00000427674:G50V;ENSP00000384229:G50V;ENSP00000423517:G50V	.	G	+	2	0	ADAM29	176133400	0.001000	0.12720	0.007000	0.13788	0.076000	0.17211	0.367000	0.20382	0.563000	0.29222	0.637000	0.83480	GGC		0.512	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
PCDHGB7	56099	broad.mit.edu	37	5	140798199	140798199	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr5:140798199G>A	ENST00000398594.2	+	1	773	c.773G>A	c.(772-774)gGc>gAc	p.G258D	PCDHGA10_ENST00000398610.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	258	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G258D(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCTCCAGGCACCTCCATC	0.532																																					p.G258D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G773A	5						.						67.0	69.0	68.0					5																	140798199		2044	4195	6239	140778383	SO:0001583	missense	56099	exon1			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.773G>A	5.37:g.140798199G>A	ENSP00000381594:p.Gly258Asp	Somatic		Capture	Illumina HiSeq	Phase_I	140778383	NM_032101	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	g	18.17	3.565458	0.65651	.	.	ENSG00000254122	ENST00000398594	T	0.68624	-0.34	5.7	5.7	0.88788	Cadherin (4);Cadherin-like (1);	0.000000	0.33515	U	0.004830	D	0.82838	0.5124	M	0.86651	2.83	0.35683	D	0.81425	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.992	D	0.87522	0.2447	10	0.49607	T	0.09	.	12.7639	0.57380	0.0755:0.0:0.9245:0.0	.	258;258	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	D	258	ENSP00000381594:G258D	ENSP00000381594:G258D	G	+	2	0	PCDHGB7	140778383	1.000000	0.71417	0.144000	0.22314	0.858000	0.48976	3.927000	0.56499	2.711000	0.92665	0.561000	0.74099	GGC		0.532	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
PRDM9	56979	broad.mit.edu	37	5	23526621	23526621	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr5:23526621C>A	ENST00000296682.3	+	11	1606	c.1424C>A	c.(1423-1425)gCc>gAc	p.A475D		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	475					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.A475D(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						ATTTCAAGGGCCTTTTCTAGC	0.458										HNSCC(3;0.000094)																											p.A475D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1424A	5						.						33.0	35.0	34.0					5																	23526621		2150	4264	6414	23562378	SO:0001583	missense	56979	exon11			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1424C>A	5.37:g.23526621C>A	ENSP00000296682:p.Ala475Asp	Somatic		Capture	Illumina HiSeq	Phase_I	23562378	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	C	8.307	0.821280	0.16678	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.09350	2.99	2.71	1.83	0.25207	.	0.962749	0.08463	N	0.942140	T	0.16599	0.0399	L	0.58101	1.795	0.09310	N	1	D	0.54964	0.969	P	0.48654	0.585	T	0.20273	-1.0280	10	0.51188	T	0.08	-1.331	7.8406	0.29395	0.0:0.8622:0.0:0.1378	.	475	Q9NQV7	PRDM9_HUMAN	D	475;269	ENSP00000296682:A475D	ENSP00000253473:A269D	A	+	2	0	PRDM9	23562378	0.000000	0.05858	0.012000	0.15200	0.006000	0.05464	-0.015000	0.12634	0.669000	0.31146	-0.362000	0.07510	GCC		0.458	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
GPR98	84059	broad.mit.edu	37	5	89969926	89969926	+	Missense_Mutation	SNP	G	G	A	rs193222107		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr5:89969926G>A	ENST00000405460.2	+	23	5081	c.4985G>A	c.(4984-4986)cGt>cAt	p.R1662H	GPR98_ENST00000450321.2_3'UTR	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1662	Calx-beta 11. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.R1662H(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GAGTATTTCCGTGTGACATTG	0.393													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17997	0.0		0.0	False		,,,				2504	0.0				p.R1662H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4985A	5						.						124.0	115.0	118.0					5																	89969926		1889	4113	6002	90005682	SO:0001583	missense	84059	exon23			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4985G>A	5.37:g.89969926G>A	ENSP00000384582:p.Arg1662His	Somatic		Capture	Illumina HiSeq	Phase_I	90005682	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	16.82	3.227409	0.58668	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.28895	1.59	5.07	3.29	0.37713	Na-Ca exchanger/integrin-beta4 (1);	0.334101	0.34362	N	0.004022	T	0.49167	0.1541	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.40403	-0.9565	10	0.45353	T	0.12	.	9.9027	0.41357	0.222:0.0:0.778:0.0	.	1662	Q8WXG9	GPR98_HUMAN	H	1662	ENSP00000384582:R1662H	ENSP00000296619:R1662H	R	+	2	0	GPR98	90005682	1.000000	0.71417	0.981000	0.43875	0.997000	0.91878	1.729000	0.38115	0.658000	0.30925	0.555000	0.69702	CGT		0.393	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
APC	324	broad.mit.edu	37	5	112175761	112175761	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr5:112175761delT	ENST00000457016.1	+	16	4850	c.4470delT	c.(4468-4470)catfs	p.H1490fs	APC_ENST00000257430.4_Frame_Shift_Del_p.H1490fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.H1490fs			P25054	APC_HUMAN	adenomatous polyposis coli	1490	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.F1491fs*16(2)|p.H1490fs*15(2)|p.L1489fs*23(1)|p.F1491fs*17(1)|p.?(1)|p.K1454fs*3(1)|p.L1488fs*13(1)|p.K1192fs*3(1)|p.T1487fs*23(1)|p.L1488fs*22(1)|p.L1488fs*23(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTTTATTACATTTTGCCACGG	0.443		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.H1472fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Missense,-1 	.	13	Deletion - Frameshift(9)|Complex - frameshift(2)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(9)|thyroid(1)|lung(1)|soft_tissue(1)|skin(1)	c.4416delT	5						.						69.0	71.0	70.0					5																	112175761		2201	4300	6501	112203660	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4470delT	5.37:g.112175761delT	ENSP00000413133:p.His1490fs	Somatic		Capture	Illumina HiSeq	Phase_I	112203660	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.443	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
GRIA1	2890	broad.mit.edu	37	5	153026596	153026596	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr5:153026596C>T	ENST00000285900.5	+	3	672	c.329C>T	c.(328-330)aCg>aTg	p.T110M	GRIA1_ENST00000521843.2_Missense_Mutation_p.T41M|GRIA1_ENST00000518862.1_3'UTR|GRIA1_ENST00000518142.1_Intron|GRIA1_ENST00000518783.1_Missense_Mutation_p.T120M|GRIA1_ENST00000340592.5_Missense_Mutation_p.T110M|GRIA1_ENST00000448073.4_Missense_Mutation_p.T120M	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	110					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.T110M(3)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TGCTTCATTACGCCGAGCTTT	0.502																																					p.T110M												.	.	3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)	c.C329T	5						.						170.0	154.0	160.0					5																	153026596		2203	4300	6503	153006789	SO:0001583	missense	2890	exon3				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.329C>T	5.37:g.153026596C>T	ENSP00000285900:p.Thr110Met	Somatic		Capture	Illumina HiSeq	Phase_I	153006789	NM_001114183	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669632	0.88348	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	5.55	5.55	0.83447	Extracellular ligand-binding receptor (1);	0.047603	0.85682	D	0.000000	D	0.92100	0.7496	M	0.73217	2.22	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.981	D	0.92611	0.6099	10	0.87932	D	0	.	18.489	0.90839	0.0:1.0:0.0:0.0	.	120;120;120;110;110	E7ESV8;B7Z9G9;B7Z2W8;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	M	110;110;64;110;41;41;120;120	ENSP00000285900:T110M;ENSP00000339343:T110M;ENSP00000427864:T41M;ENSP00000442108:T41M;ENSP00000428994:T120M;ENSP00000415569:T120M	ENSP00000285900:T110M	T	+	2	0	GRIA1	153006789	1.000000	0.71417	0.359000	0.25824	0.866000	0.49608	7.581000	0.82535	2.612000	0.88384	0.655000	0.94253	ACG		0.502	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
NUP43	348995	broad.mit.edu	37	6	150067178	150067179	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	CC	CC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr6:150067178_150067179CC>AA	ENST00000340413.2	-	2	216_217	c.140_141GG>TT	c.(139-141)tGG>tTT	p.W47F	NUP43_ENST00000460354.2_Missense_Mutation_p.W47F|NUP43_ENST00000367403.3_Missense_Mutation_p.W108F|NUP43_ENST00000367404.4_Missense_Mutation_p.W47F|NUP43_ENST00000463048.3_5'UTR	NM_198887.1	NP_942590.1	Q8NFH3	NUP43_HUMAN	nucleoporin 43kDa	47					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.W47>?(1)		breast(1)|large_intestine(2)|lung(8)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)		CTCCAATAGACCACAGTGAAAT	0.386																																					.												.	.	1	Complex(1)	large_intestine(1)	c.140_141TT	6						.																																			150108872	SO:0001583	missense	348995	exon2			AF514997	CCDS5218.1	6q25.1	2013-01-10			ENSG00000120253	ENSG00000120253		"""WD repeat domain containing"""	21182	protein-coding gene	gene with protein product		608141				12196509	Standard	XM_005266961		Approved	bA350J20.1, FLJ13287	uc003qmz.3	Q8NFH3	OTTHUMG00000015795	ENST00000340413.2:c.140_141delinsAA	6.37:g.150067178_150067179delinsAA	ENSP00000342262:p.Trp47Phe	Somatic		Capture	Illumina HiSeq	Phase_I	150108871	NM_198887	B4E2F0|Q9H8S0	Missense_Mutation	DNP	ENST00000340413.2	37	CCDS5218.1																																																																																				0.386	NUP43-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396947.1	NM_198887	
SYNE1	23345	broad.mit.edu	37	6	152771777	152771777	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr6:152771777C>T	ENST00000367255.5	-	27	3979	c.3378G>A	c.(3376-3378)tgG>tgA	p.W1126*	SYNE1_ENST00000265368.4_Nonsense_Mutation_p.W1126*|SYNE1_ENST00000367253.4_Nonsense_Mutation_p.W1126*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.W1133*|SYNE1_ENST00000413186.2_Nonsense_Mutation_p.W1126*|SYNE1_ENST00000367248.3_Nonsense_Mutation_p.W1116*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.W1133*|SYNE1_ENST00000341594.5_Nonsense_Mutation_p.W1192*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1126					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGTAGTCCTTCCACTTGTCTG	0.483										HNSCC(10;0.0054)																											p.W1133X												.	.	0			c.G3399A	6						.						171.0	167.0	169.0					6																	152771777		2203	4300	6503	152813470	SO:0001587	stop_gained	23345	exon27			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3378G>A	6.37:g.152771777C>T	ENSP00000356224:p.Trp1126*	None		Capture	Illumina HiSeq	Phase_I	152813470	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	46	12.433993	0.99667	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	.	.	.	5.78	5.78	0.91487	.	0.000000	0.56097	D	0.000022	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.3668	0.98882	0.0:1.0:0.0:0.0	.	.	.	.	X	1126;1133;1126;1133;1192;1126;1116;1126	.	ENSP00000265368:W1126X	W	-	3	0	SYNE1	152813470	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.445000	0.80570	2.894000	0.99253	0.655000	0.94253	TGG		0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	broad.mit.edu	37	6	152771956	152771956	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr6:152771956C>T	ENST00000367255.5	-	27	3800	c.3199G>A	c.(3199-3201)Gac>Aac	p.D1067N	SYNE1_ENST00000265368.4_Missense_Mutation_p.D1067N|SYNE1_ENST00000367253.4_Missense_Mutation_p.D1067N|SYNE1_ENST00000448038.1_Missense_Mutation_p.D1074N|SYNE1_ENST00000413186.2_Missense_Mutation_p.D1067N|SYNE1_ENST00000367248.3_Missense_Mutation_p.D1057N|SYNE1_ENST00000423061.1_Missense_Mutation_p.D1074N|SYNE1_ENST00000341594.5_Missense_Mutation_p.D1133N	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1067					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGACCTTTGTCACTGAAGAAA	0.428										HNSCC(10;0.0054)																											p.D1074N												.	.	0			c.G3220A	6						.						97.0	97.0	97.0					6																	152771956		2203	4300	6503	152813649	SO:0001583	missense	23345	exon27			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3199G>A	6.37:g.152771956C>T	ENSP00000356224:p.Asp1067Asn	None		Capture	Illumina HiSeq	Phase_I	152813649	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112013	0.77210	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;D;D;D	0.87412	0.75;0.74;0.65;0.74;0.86;-2.11;-2.25;-2.25	5.78	5.78	0.91487	.	0.087623	0.49305	D	0.000151	D	0.86785	0.6016	L	0.51422	1.61	0.80722	D	1	P;P;P;D;P;P	0.55385	0.9;0.745;0.835;0.971;0.745;0.835	P;B;B;P;B;P	0.57846	0.598;0.276;0.39;0.828;0.276;0.466	T	0.81901	-0.0720	10	0.09590	T	0.72	.	20.3668	0.98882	0.0:1.0:0.0:0.0	.	1050;1067;1057;1067;1067;1074	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	N	1067;1074;1067;1074;1133;1067;1057;1067	ENSP00000356224:D1067N;ENSP00000396024:D1074N;ENSP00000265368:D1067N;ENSP00000390975:D1074N;ENSP00000341887:D1133N;ENSP00000356222:D1067N;ENSP00000356217:D1057N;ENSP00000414510:D1067N	ENSP00000265368:D1067N	D	-	1	0	SYNE1	152813649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.634000	0.67833	2.894000	0.99253	0.655000	0.94253	GAC		0.428	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
KIAA0319	9856	broad.mit.edu	37	6	24566973	24566974	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	TT	TT	TT	-	TT	TT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr6:24566973_24566974delTT	ENST00000378214.3	-	14	2667_2668	c.2143_2144delAA	c.(2143-2145)aatfs	p.N716fs	KIAA0319_ENST00000543707.1_Frame_Shift_Del_p.N716fs|KIAA0319_ENST00000535378.1_Frame_Shift_Del_p.N707fs|KIAA0319_ENST00000430948.2_Frame_Shift_Del_p.N671fs|KIAA0319_ENST00000537886.1_Frame_Shift_Del_p.N716fs	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	716					negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N715fs*1(1)		breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						AGGACTATTATTTTCTAAGTCA	0.396																																					p.715_715del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2143_2144del	6						.																																			24674953	SO:0001589	frameshift_variant	9856	exon14			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.2143_2144delAA	6.37:g.24566975_24566976delTT	ENSP00000367459:p.Asn716fs	Somatic		Capture	Illumina HiSeq	Phase_I	24674952	NM_001168377	A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Frame_Shift_Del	DEL	ENST00000378214.3	37	CCDS34348.1																																																																																				0.396	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1	NM_014809	
DST	667	broad.mit.edu	37	6	56328446	56328446	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr6:56328446C>T	ENST00000361203.3	-	96	21923	c.21916G>A	c.(21916-21918)Gct>Act	p.A7306T	DST_ENST00000370769.4_Missense_Mutation_p.A7417T|DST_ENST00000370788.2_Missense_Mutation_p.A5220T|DST_ENST00000421834.2_Missense_Mutation_p.A5302T|DST_ENST00000370754.5_Missense_Mutation_p.A7595T|DST_ENST00000244364.6_Missense_Mutation_p.A4979T|DST_ENST00000312431.6_3'UTR|DST_ENST00000446842.2_Missense_Mutation_p.A7091T			Q03001	DYST_HUMAN	dystonin	7415	GAR. {ECO:0000255|PROSITE- ProRule:PRU00792}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.A7390T(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTGGGTGAAGCGCCTCGTGAT	0.592																																					p.A4979T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G14935A	6						.						92.0	102.0	99.0					6																	56328446		2018	4166	6184	56436405	SO:0001583	missense	667	exon81			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.21916G>A	6.37:g.56328446C>T	ENSP00000354508:p.Ala7306Thr	Somatic		Capture	Illumina HiSeq	Phase_I	56436405	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	21.9	4.222020	0.79464	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.65732	1.14;-0.16;-0.17;-0.08;0.78;-0.04;-0.11	5.73	5.73	0.89815	.	0.000000	0.53938	D	0.000046	T	0.75917	0.3915	M	0.71206	2.165	0.32935	D	0.517689	D;P;D;D;B;D;D;B	0.89917	1.0;0.743;1.0;1.0;0.018;0.999;1.0;0.007	D;B;D;D;B;D;D;B	0.83275	0.996;0.153;0.995;0.996;0.012;0.985;0.995;0.002	T	0.74542	-0.3631	9	0.48119	T	0.1	.	19.8853	0.96910	0.0:1.0:0.0:0.0	.	5302;7417;7595;7415;4979;103;66;5220	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8;Q9BSP9;Q86T18;E7ERU0	.;.;.;DYST_HUMAN;.;.;.;.	T	4979;7595;7417;5302;7091;5220;7306	ENSP00000244364:A4979T;ENSP00000359790:A7595T;ENSP00000359805:A7417T;ENSP00000400883:A5302T;ENSP00000393645:A7091T;ENSP00000359824:A5220T;ENSP00000354508:A7306T	ENSP00000244364:A4979T	A	-	1	0	DST	56436405	1.000000	0.71417	0.993000	0.49108	0.915000	0.54546	5.886000	0.69743	2.701000	0.92244	0.655000	0.94253	GCT		0.592	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
TTK	7272	broad.mit.edu	37	6	80745010	80745010	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr6:80745010G>T	ENST00000369798.2	+	16	1911	c.1800G>T	c.(1798-1800)atG>atT	p.M600I	TTK_ENST00000230510.3_Missense_Mutation_p.M599I|TTK_ENST00000509894.1_Missense_Mutation_p.M599I	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.M584I(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		ACATCTACATGGTAATGGAGT	0.313																																					p.M599I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1797T	6						.						112.0	108.0	109.0					6																	80745010		2203	4300	6503	80801729	SO:0001583	missense	7272	exon16				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.1800G>T	6.37:g.80745010G>T	ENSP00000358813:p.Met600Ile	Somatic		Capture	Illumina HiSeq	Phase_I	80801729	NM_001166691	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	37	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754612	0.69648	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.70869	-0.52;-0.52;-0.52	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.125232	0.85682	D	0.000000	T	0.51652	0.1687	N	0.03115	-0.41	0.80722	D	1	P;P	0.43909	0.821;0.818	P;P	0.54706	0.732;0.759	T	0.58126	-0.7691	10	0.17369	T	0.5	.	18.6865	0.91567	0.0:0.0:1.0:0.0	.	600;599	P33981;A8K8U5	TTK_HUMAN;.	I	599;599;600	ENSP00000422936:M599I;ENSP00000230510:M599I;ENSP00000358813:M600I	ENSP00000230510:M599I	M	+	3	0	TTK	80801729	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.357000	0.97099	2.669000	0.90835	0.460000	0.39030	ATG		0.313	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2		
SYNE1	23345	broad.mit.edu	37	6	152772237	152772237	+	Missense_Mutation	SNP	C	C	T	rs199888697		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr6:152772237C>T	ENST00000367255.5	-	26	3732	c.3131G>A	c.(3130-3132)cGa>cAa	p.R1044Q	SYNE1_ENST00000265368.4_Missense_Mutation_p.R1044Q|SYNE1_ENST00000367253.4_Missense_Mutation_p.R1044Q|SYNE1_ENST00000448038.1_Missense_Mutation_p.R1051Q|SYNE1_ENST00000413186.2_Missense_Mutation_p.R1044Q|SYNE1_ENST00000367248.3_Missense_Mutation_p.R1034Q|SYNE1_ENST00000423061.1_Missense_Mutation_p.R1051Q|SYNE1_ENST00000341594.5_Missense_Mutation_p.R1110Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1044					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTTGGTCTCTCGATCCAGCTC	0.463										HNSCC(10;0.0054)																											p.R1051Q												.	.	0			c.G3152A	6						.						215.0	191.0	199.0					6																	152772237		2203	4300	6503	152813930	SO:0001583	missense	23345	exon26			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3131G>A	6.37:g.152772237C>T	ENSP00000356224:p.Arg1044Gln	None		Capture	Illumina HiSeq	Phase_I	152813930	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	20.3	3.959870	0.74016	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;D;D;D	0.88201	0.62;0.61;0.53;0.61;0.69;-2.21;-2.35;-2.34	5.84	4.96	0.65561	.	0.271234	0.26052	N	0.026637	T	0.73969	0.3655	L	0.28694	0.88	0.80722	D	1	B;B;B;B;B;B	0.28233	0.005;0.004;0.204;0.067;0.004;0.197	B;B;B;B;B;B	0.29077	0.007;0.003;0.098;0.063;0.003;0.056	T	0.72161	-0.4374	10	0.16420	T	0.52	.	15.7642	0.78114	0.0:0.9338:0.0:0.0662	.	1027;1044;1034;1044;1044;1051	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	Q	1044;1051;1044;1051;1110;1044;1034;1044	ENSP00000356224:R1044Q;ENSP00000396024:R1051Q;ENSP00000265368:R1044Q;ENSP00000390975:R1051Q;ENSP00000341887:R1110Q;ENSP00000356222:R1044Q;ENSP00000356217:R1034Q;ENSP00000414510:R1044Q	ENSP00000265368:R1044Q	R	-	2	0	SYNE1	152813930	1.000000	0.71417	0.691000	0.30163	0.997000	0.91878	5.526000	0.67116	1.592000	0.50018	0.650000	0.86243	CGA		0.463	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
LRRN3	54674	broad.mit.edu	37	7	110763472	110763472	+	Missense_Mutation	SNP	G	G	A	rs200291058		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr7:110763472G>A	ENST00000422987.3	+	2	1475	c.644G>A	c.(643-645)cGc>cAc	p.R215H	IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000437687.1_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.R215H|IMMP2L_ENST00000405709.2_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.R215H|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000489381.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	215					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R215H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		ATCAATCTTCGCAGCCTGGTT	0.383																																					p.R215H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G644A	7						.						72.0	72.0	72.0					7																	110763472		2203	4299	6502	110550708	SO:0001583	missense	54674	exon2			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.644G>A	7.37:g.110763472G>A	ENSP00000412417:p.Arg215His	Somatic		Capture	Illumina HiSeq	Phase_I	110550708	NM_018334	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.988101	0.53934	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987;ENST00000421101	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000007	T	0.70090	0.3184	L	0.41632	1.29	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.61926	-0.6962	10	0.27785	T	0.31	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	215	Q9H3W5	LRRN3_HUMAN	H	215	ENSP00000312001:R215H;ENSP00000397312:R215H;ENSP00000412417:R215H;ENSP00000407927:R215H	ENSP00000312001:R215H	R	+	2	0	LRRN3	110550708	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	CGC		0.383	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
CPA5	93979	broad.mit.edu	37	7	130007378	130007378	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr7:130007378G>A	ENST00000485477.1	+	10	2133	c.1004G>A	c.(1003-1005)cGa>cAa	p.R335Q	CPA5_ENST00000431780.2_Missense_Mutation_p.R335Q|CPA5_ENST00000393213.3_Missense_Mutation_p.R335Q|CPA5_ENST00000474905.1_Missense_Mutation_p.R335Q|CPA5_ENST00000355388.3_Missense_Mutation_p.R335Q|CPA5_ENST00000466363.2_Missense_Mutation_p.R335Q|CPA5_ENST00000461828.1_Missense_Mutation_p.R335Q			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	335						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R335Q(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					CCTTACGGCCGATTGCTGGAG	0.517																																					p.R335Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1004A	7						.						124.0	119.0	121.0					7																	130007378		2203	4300	6503	129794614	SO:0001583	missense	93979	exon12			AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.1004G>A	7.37:g.130007378G>A	ENSP00000420237:p.Arg335Gln	Somatic		Capture	Illumina HiSeq	Phase_I	129794614	NM_001127441	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Missense_Mutation	SNP	ENST00000485477.1	37	CCDS5819.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010796	0.35511	.	.	ENSG00000158525	ENST00000355388;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000431780;ENST00000474905;ENST00000393213	T;T;T;T;T;T;T	0.03272	3.99;3.99;3.99;3.99;3.99;3.99;3.99	5.61	1.63	0.23807	Peptidase M14, carboxypeptidase A (2);	0.570222	0.17125	N	0.186070	T	0.01661	0.0053	N	0.03608	-0.345	0.24000	N	0.996217	B;B	0.34161	0.439;0.355	B;B	0.32465	0.14;0.146	T	0.51044	-0.8755	9	.	.	.	.	8.3328	0.32197	0.7194:0.0:0.2806:0.0	.	335;335	G3V0G8;Q8WXQ8	.;CBPA5_HUMAN	Q	335	ENSP00000347549:R335Q;ENSP00000418183:R335Q;ENSP00000419025:R335Q;ENSP00000420237:R335Q;ENSP00000393045:R335Q;ENSP00000417314:R335Q;ENSP00000376907:R335Q	.	R	+	2	0	CPA5	129794614	1.000000	0.71417	0.739000	0.30968	0.009000	0.06853	1.632000	0.37102	0.328000	0.23435	-0.379000	0.06801	CGA		0.517	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441	
CEP41	95681	broad.mit.edu	37	7	130039953	130039953	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr7:130039953C>A	ENST00000223208.5	-	10	1170	c.900G>T	c.(898-900)tgG>tgT	p.W300C	CEP41_ENST00000343969.5_Intron|CEP41_ENST00000541543.1_Intron	NM_001257158.1|NM_018718.2	NP_001244087.1|NP_061188.1	Q9BYV8	CEP41_HUMAN	centrosomal protein 41kDa	300					cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein polyglutamylation (GO:0018095)|protein transport (GO:0015031)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|primary cilium (GO:0072372)		p.W300C(1)									GGGTAAATCTCCATTTATTCT	0.488																																					p.W300C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G900T	7						.						68.0	75.0	73.0					7																	130039953		2203	4300	6503	129827189	SO:0001583	missense	95681	exon10			AJ278890	CCDS5821.1, CCDS59078.1, CCDS59079.1, CCDS59080.1	7q32	2014-02-20	2011-10-04	2011-10-04	ENSG00000106477	ENSG00000106477			12370	protein-coding gene	gene with protein product		610523	"""testis specific, 14"""	TSGA14		14654843, 22246503	Standard	NM_018718		Approved	DKFZp762H1311, FLJ22445, JBTS15	uc003vpz.4	Q9BYV8	OTTHUMG00000157823	ENST00000223208.5:c.900G>T	7.37:g.130039953C>A	ENSP00000223208:p.Trp300Cys	Somatic		Capture	Illumina HiSeq	Phase_I	129827189	NM_018718	A4D1M0|B4DQ35|F5H0V6|Q7Z496|Q86TM1|Q8NFU8|Q9H6A3|Q9NPV3	Missense_Mutation	SNP	ENST00000223208.5	37	CCDS5821.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328970	0.60743	.	.	ENSG00000106477	ENST00000223208	D	0.88664	-2.41	5.79	5.79	0.91817	.	0.056326	0.85682	D	0.000000	D	0.83820	0.5337	L	0.45698	1.435	0.80722	D	1	P	0.39624	0.681	B	0.30716	0.119	T	0.82059	-0.0645	10	0.17832	T	0.49	-8.4124	18.6049	0.91263	0.0:1.0:0.0:0.0	.	300	Q9BYV8	CEP41_HUMAN	C	300	ENSP00000223208:W300C	ENSP00000223208:W300C	W	-	3	0	TSGA14	129827189	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.366000	0.66122	2.739000	0.93911	0.655000	0.94253	TGG		0.488	CEP41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349702.2	NM_018718	
PLXNA4	91584	broad.mit.edu	37	7	131866155	131866155	+	Silent	SNP	C	C	T	rs10248377	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr7:131866155C>T	ENST00000359827.3	-	18	4439	c.3477G>A	c.(3475-3477)acG>acA	p.T1159T	PLXNA4_ENST00000321063.4_Silent_p.T1159T			Q9HCM2	PLXA4_HUMAN	plexin A4	1159	IPT/TIG 4.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.T1159T(4)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGATGATGGGCGTGCCAGGCT	0.577													C|||	162	0.0323482	0.121	0.0029	5008	,	,		17066	0.0		0.0	False		,,,				2504	0.0				p.T1159T												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.G3477A	7						.	C		358,3534		16,326,1604	154.0	159.0	158.0		3477	-10.2	0.0	7	dbSNP_119	158	2,8278		0,2,4138	no	coding-synonymous	PLXNA4	NM_020911.1		16,328,5742	TT,TC,CC		0.0242,9.1984,2.9576		1159/1895	131866155	360,11812	1946	4140	6086	131516695	SO:0001819	synonymous_variant	91584	exon18			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.3477G>A	7.37:g.131866155C>T		Somatic		Capture	Illumina HiSeq	Phase_I	131516695	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	CCDS43646.1																																																																																				0.577	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
ARHGEF5	7984	broad.mit.edu	37	7	144060801	144060801	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr7:144060801A>G	ENST00000056217.5	+	2	1213	c.1039A>G	c.(1039-1041)Acc>Gcc	p.T347A	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	347					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T347A(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					AAAGAGTCAAACCTTTTTGGG	0.527																																					p.T347A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1039G	7						.						64.0	58.0	60.0					7																	144060801		2079	3983	6062	143691734	SO:0001583	missense	7984	exon2			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.1039A>G	7.37:g.144060801A>G	ENSP00000056217:p.Thr347Ala	Somatic		Capture	Illumina HiSeq	Phase_I	143691734	NM_005435	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	A	8.677	0.904325	0.17760	.	.	ENSG00000050327	ENST00000056217	T	0.72394	-0.65	3.54	2.37	0.29283	.	.	.	.	.	T	0.45034	0.1322	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24261	-1.0165	8	.	.	.	-0.3178	5.9916	0.19470	0.8525:0.0:0.1475:0.0	.	347	Q12774	ARHG5_HUMAN	A	347	ENSP00000056217:T347A	.	T	+	1	0	ARHGEF5	143691734	0.008000	0.16893	0.002000	0.10522	0.008000	0.06430	2.439000	0.44846	1.471000	0.48121	0.454000	0.30748	ACC		0.527	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
ZNF746	155061	broad.mit.edu	37	7	149191481	149191481	+	Silent	SNP	C	C	T			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr7:149191481C>T	ENST00000340622.3	-	2	418	c.138G>A	c.(136-138)ctG>ctA	p.L46L	ZNF746_ENST00000458143.2_Silent_p.L46L|ZNF746_ENST00000461958.2_Silent_p.L46L			Q6NUN9	ZN746_HUMAN	zinc finger protein 746	46					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.L46L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			CGCAATCAGCCAGCTTCTTCT	0.622																																					p.L46L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G138A	7						.						81.0	83.0	82.0					7																	149191481		2203	4300	6503	148822414	SO:0001819	synonymous_variant	155061	exon2			AK055975	CCDS5897.1, CCDS55180.1	7q36.1	2013-01-08			ENSG00000181220	ENSG00000181220		"""Zinc fingers, C2H2-type"", ""-"""	21948	protein-coding gene	gene with protein product		613914					Standard	NM_152557		Approved	FLJ31413	uc010lpi.2	Q6NUN9	OTTHUMG00000158972	ENST00000340622.3:c.138G>A	7.37:g.149191481C>T		Somatic		Capture	Illumina HiSeq	Phase_I	148822414	NM_001163474	A8K6Z9|Q6ZRF9	Silent	SNP	ENST00000340622.3	37	CCDS5897.1																																																																																				0.622	ZNF746-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352730.1	NM_152557	
COX19	90639	broad.mit.edu	37	7	1012877	1012877	+	Missense_Mutation	SNP	T	T	C	rs201971747		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr7:1012877T>C	ENST00000344111.3	-	2	223	c.134A>G	c.(133-135)aAt>aGt	p.N45S		NM_001031617.2	NP_001026788.1	Q49B96	COX19_HUMAN	cytochrome c oxidase assembly homolog 19 (S. cerevisiae)	45	CHCH.					cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	5		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;2.15e-15)		ATTTTCAAAATTATTGTTATG	0.353																																					p.N45S												.	.	0			c.A134G	7						.						118.0	107.0	111.0					7																	1012877		2203	4299	6502	979403	SO:0001583	missense	90639	exon2			AY957566	CCDS34582.1	7p22.3	2012-10-15	2012-10-15		ENSG00000240230	ENSG00000240230		"""Mitochondrial respiratory chain complex assembly factors"""	28074	protein-coding gene	gene with protein product		610429	"""COX19 cytochrome c oxidase assembly homolog (S. cerevisiae)"""			15596615, 16212937	Standard	NM_001031617		Approved	MGC104475	uc003sjp.1	Q49B96	OTTHUMG00000151476	ENST00000344111.3:c.134A>G	7.37:g.1012877T>C	ENSP00000342015:p.Asn45Ser	None		Capture	Illumina HiSeq	Phase_I	979403	NM_001031617	A4FTX0	Missense_Mutation	SNP	ENST00000344111.3	37	CCDS34582.1	.	.	.	.	.	.	.	.	.	.	T	0.267	-0.995478	0.02145	.	.	ENSG00000240230	ENST00000344111	T	0.73897	-0.79	4.77	2.34	0.29019	CHCH (1);	0.961447	0.08622	N	0.918411	T	0.52386	0.1731	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.32052	-0.9921	9	0.08837	T	0.75	2.5942	7.5445	0.27759	0.0:0.2536:0.0:0.7464	.	45	Q49B96	COX19_HUMAN	S	45	ENSP00000342015:N45S	ENSP00000342015:N45S	N	-	2	0	COX19	979403	0.036000	0.19791	0.002000	0.10522	0.103000	0.19146	0.201000	0.17276	0.266000	0.21894	-0.561000	0.04177	AAT		0.353	COX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322812.1	NM_001031617	
PCLO	27445	broad.mit.edu	37	7	82579490	82579490	+	Missense_Mutation	SNP	C	C	T	rs368126805		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr7:82579490C>T	ENST00000333891.9	-	6	10751	c.10414G>A	c.(10414-10416)Gtc>Atc	p.V3472I	PCLO_ENST00000423517.2_Missense_Mutation_p.V3472I|PCLO_ENST00000437081.1_Missense_Mutation_p.V192I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.V3472I(1)|p.V3403I(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCAGTTTGGACGCTTGTATCC	0.458																																					p.V3472I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G10414A	7						.	C	ILE/VAL,ILE/VAL	1,3981		0,1,1990	132.0	121.0	125.0		10414,10414	3.8	1.0	7		125	1,8317		0,1,4158	no	missense,missense	PCLO	NM_014510.2,NM_033026.5	29,29	0,2,6148	TT,TC,CC		0.012,0.0251,0.0163	probably-damaging,probably-damaging	3472/4936,3472/5143	82579490	2,12298	1991	4159	6150	82417426	SO:0001583	missense	27445	exon6			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10414G>A	7.37:g.82579490C>T	ENSP00000334319:p.Val3472Ile	Somatic		Capture	Illumina HiSeq	Phase_I	82417426	NM_033026		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.164535	0.57476	2.51E-4	1.2E-4	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T;T	0.35236	1.47;1.48;1.32	5.65	3.82	0.43975	.	.	.	.	.	T	0.45895	0.1365	M	0.74647	2.275	0.39816	D	0.97277	P;D;D	0.61697	0.739;0.99;0.99	B;P;P	0.49332	0.062;0.607;0.607	T	0.52601	-0.8554	9	0.87932	D	0	.	10.6694	0.45749	0.1328:0.7986:0.0:0.0686	.	3403;3472;3472	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	I	3403;3472;3472;192	ENSP00000334319:V3472I;ENSP00000388393:V3472I;ENSP00000393760:V192I	ENSP00000334319:V3472I	V	-	1	0	PCLO	82417426	1.000000	0.71417	0.999000	0.59377	0.931000	0.56810	5.921000	0.70028	0.723000	0.32274	0.655000	0.94253	GTC		0.458	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
ASIC3	9311	broad.mit.edu	37	7	150746232	150746232	+	Missense_Mutation	SNP	C	C	A	rs140048490		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr7:150746232C>A	ENST00000349064.5	+	1	458	c.260C>A	c.(259-261)cCg>cAg	p.P87Q	ASIC3_ENST00000297512.8_Missense_Mutation_p.P87Q|ASIC3_ENST00000357922.4_Missense_Mutation_p.P87Q	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	87					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)	p.P87Q(4)									CTCATCTTCCCGGCTGTCACC	0.647																																					p.P87Q												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.C260A	7						.						116.0	93.0	101.0					7																	150746232		2203	4300	6503	150377165	SO:0001583	missense	9311	exon1			AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.260C>A	7.37:g.150746232C>A	ENSP00000344838:p.Pro87Gln	Somatic		Capture	Illumina HiSeq	Phase_I	150377165	NM_020321	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Missense_Mutation	SNP	ENST00000349064.5	37	CCDS5916.1	.	.	.	.	.	.	.	.	.	.	C	17.87	3.495626	0.64186	.	.	ENSG00000213199	ENST00000357922;ENST00000349064;ENST00000297512	D;D;D	0.87256	-2.23;-2.23;-2.23	5.11	5.11	0.69529	.	0.000000	0.33813	U	0.004536	D	0.94159	0.8126	M	0.86805	2.84	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.987;1.0;1.0	D	0.94873	0.8032	10	0.72032	D	0.01	-16.9416	16.3968	0.83610	0.0:1.0:0.0:0.0	.	87;87;87	Q9UHC3-2;Q9UHC3-3;Q9UHC3	.;.;ACCN3_HUMAN	Q	87	ENSP00000350600:P87Q;ENSP00000344838:P87Q;ENSP00000297512:P87Q	ENSP00000297512:P87Q	P	+	2	0	ACCN3	150377165	1.000000	0.71417	0.964000	0.40570	0.022000	0.10575	6.044000	0.71012	2.549000	0.85964	0.561000	0.74099	CCG		0.647	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
XKR6	286046	broad.mit.edu	37	8	10756084	10756084	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr8:10756084T>A	ENST00000416569.2	-	3	1330	c.1304A>T	c.(1303-1305)gAa>gTa	p.E435V	XKR6_ENST00000304437.2_Missense_Mutation_p.E156V	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	435						integral component of membrane (GO:0016021)		p.E435V(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		AGTCCGCCCTTCCTTGACGTT	0.473																																					p.E435V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1304T	8						.						137.0	116.0	123.0					8																	10756084		2203	4300	6503	10793494	SO:0001583	missense	286046	exon3			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.1304A>T	8.37:g.10756084T>A	ENSP00000416707:p.Glu435Val	Somatic		Capture	Illumina HiSeq	Phase_I	10793494	NM_173683	Q8TBA0	Missense_Mutation	SNP	ENST00000416569.2	37	CCDS5978.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.65|16.65	3.181206|3.181206	0.57800|0.57800	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000304437;ENST00000416569|ENST00000382461	T;T|.	0.79940|.	-1.32;-1.32|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.76076|.	0.3937|.	M|M	0.80616|0.80616	2.505|2.505	0.58432|0.58432	D|D	0.999999|0.999999	P|.	0.46859|.	0.885|.	P|.	0.51324|.	0.666|.	T|.	0.77996|.	-0.2377|.	10|.	0.87932|.	D|.	0|.	-12.6893|-12.6893	14.3724|14.3724	0.66849|0.66849	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	435|.	Q5GH73|.	XKR6_HUMAN|.	V|X	156;435|212	ENSP00000307120:E156V;ENSP00000416707:E435V|.	ENSP00000307120:E156V|.	E|K	-|-	2|1	0|0	XKR6|XKR6	10793494|10793494	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.259000|6.259000	0.72494|0.72494	1.988000|1.988000	0.58038|0.58038	0.459000|0.459000	0.35465|0.35465	GAA|AAG		0.473	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683	
TAF2	6873	broad.mit.edu	37	8	120772951	120772951	+	Silent	SNP	C	C	T	rs149454623		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr8:120772951C>T	ENST00000378164.2	-	20	2884	c.2586G>A	c.(2584-2586)caG>caA	p.Q862Q	TAF2_ENST00000519355.1_5'UTR	NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	862					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q862Q(2)		NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GTCCGTTCTTCTGAAGTACCC	0.393																																					p.Q862Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2586A	8						.						131.0	122.0	125.0					8																	120772951		2203	4300	6503	120842132	SO:0001819	synonymous_variant	6873	exon20			AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.2586G>A	8.37:g.120772951C>T		Somatic		Capture	Illumina HiSeq	Phase_I	120842132	NM_003184	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Silent	SNP	ENST00000378164.2	37	CCDS34937.1																																																																																				0.393	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184	
VDAC3	7419	broad.mit.edu	37	8	42260947	42260947	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr8:42260947A>G	ENST00000022615.4	+	8	738	c.670A>G	c.(670-672)Aag>Gag	p.K224E	VDAC3_ENST00000522572.1_Intron|VDAC3_ENST00000521158.1_Missense_Mutation_p.K225E|VDAC3_ENST00000392935.3_Missense_Mutation_p.K225E			Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3	224					adenine transport (GO:0015853)	extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)	p.K224E(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	CATTGCTGCTAAGTACATGCT	0.418																																					p.K225E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A673G	8						.						209.0	182.0	191.0					8																	42260947		2203	4300	6503	42380104	SO:0001583	missense	7419	exon8			AF038962	CCDS6131.1, CCDS47850.1	8p11.21	2011-11-15			ENSG00000078668	ENSG00000078668		"""Voltage-dependent anion channels"""	12674	protein-coding gene	gene with protein product		610029				9653160, 9781040	Standard	NM_001135694		Approved	HD-VDAC3	uc003xpc.3	Q9Y277	OTTHUMG00000164168	ENST00000022615.4:c.670A>G	8.37:g.42260947A>G	ENSP00000022615:p.Lys224Glu	Somatic		Capture	Illumina HiSeq	Phase_I	42380104	NM_001135694	Q9UIS0	Missense_Mutation	SNP	ENST00000022615.4	37	CCDS6131.1	.	.	.	.	.	.	.	.	.	.	A	32	5.147401	0.94603	.	.	ENSG00000078668	ENST00000392935;ENST00000521158;ENST00000022615	T;T;T	0.49432	0.78;0.78;0.78	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.75867	0.3908	H	0.94698	3.57	0.80722	D	1	D	0.63880	0.993	D	0.65443	0.935	T	0.82794	-0.0281	10	0.72032	D	0.01	-15.1174	14.5226	0.67863	1.0:0.0:0.0:0.0	.	224	Q9Y277	VDAC3_HUMAN	E	225;225;224	ENSP00000442811:K225E;ENSP00000428845:K225E;ENSP00000022615:K224E	ENSP00000022615:K224E	K	+	1	0	VDAC3	42380104	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.287000	0.95975	2.371000	0.80710	0.533000	0.62120	AAG		0.418	VDAC3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377574.1		
PREX2	80243	broad.mit.edu	37	8	69103989	69103989	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr8:69103989C>A	ENST00000288368.4	+	36	4656	c.4379C>A	c.(4378-4380)cCa>cAa	p.P1460Q		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1460					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.P1460Q(1)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AATTCACCACCAAACTCCACA	0.313																																					p.P1460Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4379A	8						.						105.0	105.0	105.0					8																	69103989		2203	4300	6503	69266543	SO:0001583	missense	80243	exon36			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4379C>A	8.37:g.69103989C>A	ENSP00000288368:p.Pro1460Gln	Somatic		Capture	Illumina HiSeq	Phase_I	69266543	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.262020	0.59431	.	.	ENSG00000046889	ENST00000288368	T	0.59083	0.29	5.48	5.48	0.80851	.	0.120771	0.56097	D	0.000026	T	0.52306	0.1726	L	0.36672	1.1	0.44754	D	0.99775	B	0.30763	0.294	B	0.30943	0.122	T	0.55029	-0.8204	10	0.87932	D	0	.	18.7115	0.91658	0.0:1.0:0.0:0.0	.	1460	Q70Z35	PREX2_HUMAN	Q	1460	ENSP00000288368:P1460Q	ENSP00000288368:P1460Q	P	+	2	0	PREX2	69266543	0.996000	0.38824	0.985000	0.45067	0.984000	0.73092	5.662000	0.68032	2.729000	0.93468	0.650000	0.86243	CCA		0.313	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
ATAD2	29028	broad.mit.edu	37	8	124346236	124346236	+	Silent	SNP	C	C	T	rs145891591	byFrequency	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr8:124346236C>T	ENST00000287394.5	-	24	3467	c.3360G>A	c.(3358-3360)ccG>ccA	p.P1120P	ATAD2_ENST00000521903.1_Silent_p.P438P	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1120					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.P1120P(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GGTAGTAAGACGGGGCATATT	0.383													C|||	5	0.000998403	0.0	0.0	5008	,	,		17424	0.0		0.0	False		,,,				2504	0.0051				p.P1120P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3360A	8						.	C		1,4405	2.1+/-5.4	0,1,2202	125.0	118.0	120.0		3360	-9.2	1.0	8	dbSNP_134	120	0,8600		0,0,4300	no	coding-synonymous	ATAD2	NM_014109.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1120/1391	124346236	1,13005	2203	4300	6503	124415417	SO:0001819	synonymous_variant	29028	exon24			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.3360G>A	8.37:g.124346236C>T		Somatic		Capture	Illumina HiSeq	Phase_I	124415417	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	ENST00000287394.5	37	CCDS6343.1																																																																																				0.383	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
DAPK1	1612	broad.mit.edu	37	9	90256923	90256923	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr9:90256923G>C	ENST00000408954.3	+	10	1203	c.868G>C	c.(868-870)Gca>Cca	p.A290P	DAPK1_ENST00000472284.1_Missense_Mutation_p.A290P|DAPK1_ENST00000469640.2_Missense_Mutation_p.A290P|DAPK1_ENST00000358077.5_Missense_Mutation_p.A290P|DAPK1_ENST00000491893.1_Missense_Mutation_p.A290P	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	290	Calmodulin-binding.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A290P(2)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						AAAAGCATCAGCAGTAAACAT	0.323									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.A290P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G868C	9						.						119.0	110.0	113.0					9																	90256923		1825	4074	5899	89446743	SO:0001583	missense	1612	exon10	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.868G>C	9.37:g.90256923G>C	ENSP00000386135:p.Ala290Pro	Somatic		Capture	Illumina HiSeq	Phase_I	89446743	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	ENST00000408954.3	37	CCDS43842.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426422	0.83667	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12	5.87	5.87	0.94306	Protein kinase-like domain (1);	0.000000	0.51477	D	0.000088	T	0.52789	0.1756	L	0.36672	1.1	0.80722	D	1	B;B;D	0.71674	0.146;0.031;0.998	B;B;P	0.57425	0.068;0.028;0.82	T	0.45086	-0.9285	10	0.49607	T	0.09	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	290;290;290	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	P	290	ENSP00000350785:A290P;ENSP00000417076:A290P;ENSP00000418885:A290P;ENSP00000386135:A290P;ENSP00000419026:A290P	ENSP00000350785:A290P	A	+	1	0	DAPK1	89446743	1.000000	0.71417	0.969000	0.41365	0.991000	0.79684	9.729000	0.98795	2.941000	0.99782	0.655000	0.94253	GCA		0.323	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
CNTRL	11064	broad.mit.edu	37	9	123930587	123930587	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chr9:123930587C>G	ENST00000373855.1	+	38	6318	c.6058C>G	c.(6058-6060)Ctc>Gtc	p.L2020V	CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Missense_Mutation_p.L1468V|CNTRL_ENST00000238341.5_Missense_Mutation_p.L2020V			Q7Z7A1	CNTRL_HUMAN	centriolin	2020	Required for centrosome localization.|Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.L2020V(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GGAGAAGACACTCTCCCAAAC	0.498																																					p.L2020V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6058G	9						.						91.0	96.0	94.0					9																	123930587		2203	4300	6503	122970408	SO:0001583	missense	11064	exon36			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6058C>G	9.37:g.123930587C>G	ENSP00000362962:p.Leu2020Val	Somatic		Capture	Illumina HiSeq	Phase_I	122970408	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	C	8.132	0.783342	0.16189	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000394368;ENST00000373850;ENST00000373845	T;T;T	0.37411	1.51;1.51;1.2	6.16	5.26	0.73747	.	.	.	.	.	T	0.36717	0.0977	M	0.61703	1.905	0.20975	N	0.999814	D	0.53312	0.959	B	0.43623	0.425	T	0.30387	-0.9980	9	0.27082	T	0.32	.	10.4691	0.44626	0.1329:0.7957:0.0:0.0714	.	2020	Q7Z7A1	CNTRL_HUMAN	V	2020;2020;2020;776;177;1468;702	ENSP00000362962:L2020V;ENSP00000238341:L2020V;ENSP00000362956:L1468V	ENSP00000238341:L2020V	L	+	1	0	CNTRL	122970408	0.315000	0.24571	0.594000	0.28785	0.086000	0.17979	0.948000	0.29096	2.937000	0.99478	0.650000	0.86243	CTC		0.498	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
RBM10	8241	broad.mit.edu	37	X	47039369	47039370	+	Frame_Shift_Ins	INS	-	-	G	rs145036791		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	-	-	-	G	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chrX:47039369_47039370insG	ENST00000377604.3	+	10	1734_1735	c.992_993insG	c.(991-996)gtgcgcfs	p.R332fs	RBM10_ENST00000478410.1_3'UTR|RBM10_ENST00000345781.6_Frame_Shift_Ins_p.R255fs|RBM10_ENST00000329236.7_Frame_Shift_Ins_p.R255fs	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	332	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.R332fs*49(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						TCCTCCAACGTGCGCGTCATAA	0.619																																					p.V331fs	Melanoma(171;120 2705 19495 39241)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.992_993insG	X						.																																			46924314	SO:0001589	frameshift_variant	8241	exon10			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.993dupG	X.37:g.47039370_47039370dupG	ENSP00000366829:p.Arg332fs	Somatic		Capture	Illumina HiSeq	Phase_I	46924313	NM_005676	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Frame_Shift_Ins	INS	ENST00000377604.3	37	CCDS14274.1																																																																																				0.619	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
RBBP7	5931	broad.mit.edu	37	X	16863189	16863189	+	Missense_Mutation	SNP	G	G	A	rs200756039		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chrX:16863189G>A	ENST00000380087.2	-	12	1607	c.1247C>T	c.(1246-1248)aCg>aTg	p.T416M	RBBP7_ENST00000380084.4_Missense_Mutation_p.T460M|RBBP7_ENST00000404022.1_Missense_Mutation_p.T407M			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	416					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)	p.T416M(1)		biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					TTCGGATGTCGTGACATCTGA	0.373													G|||	1	0.000264901	0.0	0.0014	3775	,	,		14478	0.0		0.0	False		,,,				2504	0.0				p.T460M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1379T	X						.						156.0	124.0	135.0					X																	16863189		2203	4300	6503	16773110	SO:0001583	missense	5931	exon12			U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.1247C>T	X.37:g.16863189G>A	ENSP00000369427:p.Thr416Met	Somatic		Capture	Illumina HiSeq	Phase_I	16773110	NM_001198719	Q5JP00	Missense_Mutation	SNP	ENST00000380087.2	37	CCDS14179.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	16.04	3.011343	0.54361	.	.	ENSG00000102054	ENST00000425696;ENST00000380087;ENST00000380084;ENST00000404022	T;T;T	0.72394	-0.45;-0.65;-0.53	5.61	5.61	0.85477	.	0.192040	0.56097	D	0.000038	T	0.65249	0.2673	N	0.22421	0.69	0.44439	D	0.997365	B;B;P	0.50819	0.335;0.212;0.939	B;B;P	0.46339	0.157;0.124;0.513	T	0.70784	-0.4778	10	0.72032	D	0.01	-34.4247	17.7398	0.88404	0.0:0.0:1.0:0.0	.	407;416;460	E9PC52;Q16576;Q5JP00	.;RBBP7_HUMAN;.	M	76;416;460;407	ENSP00000369427:T416M;ENSP00000369424:T460M;ENSP00000386068:T407M	ENSP00000369424:T460M	T	-	2	0	RBBP7	16773110	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.329000	0.79170	2.493000	0.84123	0.600000	0.82982	ACG		0.373	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055920.2	NM_002893	
HUWE1	10075	broad.mit.edu	37	X	53596606	53596606	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chrX:53596606G>C	ENST00000342160.3	-	47	6951	c.6494C>G	c.(6493-6495)gCt>gGt	p.A2165G	HUWE1_ENST00000262854.6_Missense_Mutation_p.A2165G			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2165					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.A2028G(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CTCAGCCATAGCCAGTGCCCG	0.542																																					p.A2165G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6494G	X						.						126.0	116.0	119.0					X																	53596606		2203	4300	6503	53613331	SO:0001583	missense	10075	exon48			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.6494C>G	X.37:g.53596606G>C	ENSP00000340648:p.Ala2165Gly	Somatic		Capture	Illumina HiSeq	Phase_I	53613331	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149470	0.37923	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.42900	0.96;0.96	5.24	5.24	0.73138	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.38983	0.1061	L	0.46157	1.445	0.48830	D	0.99971	B;B	0.11235	0.002;0.004	B;B	0.08055	0.001;0.003	T	0.14008	-1.0488	10	0.33141	T	0.24	.	16.6657	0.85253	0.0:0.0:1.0:0.0	.	2165;2165	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	G	2165	ENSP00000340648:A2165G;ENSP00000262854:A2165G	ENSP00000262854:A2165G	A	-	2	0	HUWE1	53613331	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.429000	0.80309	2.194000	0.70268	0.513000	0.50165	GCT		0.542	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
MSN	4478	broad.mit.edu	37	X	64958439	64958439	+	Missense_Mutation	SNP	G	G	A	rs371555667		TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chrX:64958439G>A	ENST00000360270.5	+	11	1476	c.1304G>A	c.(1303-1305)cGa>cAa	p.R435Q		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	435					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)	p.R435Q(1)	MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						GAGATGGCCCGACAGAAGAAG	0.532			T	ALK	ALCL																																p.R435Q			Dom	yes		X	Xq11.2-q12	4478	moesin		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1304A	X						.	G	GLN/ARG	0,3835		0,0,1632,571	65.0	57.0	59.0		1304	4.7	1.0	X		59	1,6726		0,1,2427,1871	no	missense	MSN	NM_002444.2	43	0,1,4059,2442	AA,AG,GG,G		0.0149,0.0,0.0095	benign	435/578	64958439	1,10561	2203	4299	6502	64875164	SO:0001583	missense	4478	exon11			M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1304G>A	X.37:g.64958439G>A	ENSP00000353408:p.Arg435Gln	Somatic		Capture	Illumina HiSeq	Phase_I	64875164	NM_002444		Missense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	g	18.17	3.565490	0.65651	0.0	1.49E-4	ENSG00000147065	ENST00000360270	D	0.83075	-1.68	4.67	4.67	0.58626	Ezrin/radixin/moesin, C-terminal (1);	0.270322	0.40302	N	0.001137	T	0.82075	0.4958	M	0.65498	2.005	0.50039	D	0.999843	B	0.22851	0.076	B	0.26094	0.066	T	0.79995	-0.1568	10	0.41790	T	0.15	.	15.4828	0.75542	0.0:0.0:1.0:0.0	.	435	P26038	MOES_HUMAN	Q	435	ENSP00000353408:R435Q	ENSP00000353408:R435Q	R	+	2	0	MSN	64875164	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.826000	0.69293	2.306000	0.77630	0.591000	0.81541	CGA		0.532	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
MAP7D3	79649	broad.mit.edu	37	X	135318471	135318471	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3941-01A-01W-0995-10	TCGA-AA-3941-10A-01W-0995-10	g.chrX:135318471G>A	ENST00000316077.9	-	7	888	c.668C>T	c.(667-669)tCt>tTt	p.S223F	MAP7D3_ENST00000370663.5_Missense_Mutation_p.S205F|MAP7D3_ENST00000370661.1_Missense_Mutation_p.S188F	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	223					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.S520F(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TCTATTTAAAGATGAGCTTCT	0.338																																					p.S188F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C563T	X						.						123.0	106.0	111.0					X																	135318471		1824	4067	5891	135146137	SO:0001583	missense	79649	exon6			AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.668C>T	X.37:g.135318471G>A	ENSP00000318086:p.Ser223Phe	Somatic		Capture	Illumina HiSeq	Phase_I	135146137	NM_001173517	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742000	0.49151	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.10860	4.2;2.83;2.83;2.83	5.81	2.74	0.32292	.	.	.	.	.	T	0.15652	0.0377	L	0.39147	1.195	0.09310	N	1	D;D;D;D	0.61697	0.983;0.99;0.983;0.99	P;P;P;P	0.57152	0.656;0.814;0.656;0.814	T	0.13764	-1.0497	9	0.30078	T	0.28	-5.1849	7.0383	0.25004	0.0786:0.1158:0.6697:0.1359	.	205;223;223;188	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	F	188;223;205;223	ENSP00000359695:S188F;ENSP00000318086:S223F;ENSP00000359697:S205F;ENSP00000359694:S223F	ENSP00000318086:S223F	S	-	2	0	MAP7D3	135146137	0.926000	0.31397	0.013000	0.15412	0.060000	0.15804	2.519000	0.45546	0.584000	0.29591	0.600000	0.82982	TCT		0.338	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
