#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADRA2A	150	broad.mit.edu	37	10	112837855	112837856	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr10:112837855_112837856insG	ENST00000280155.2	+	1	1066_1067	c.101_102insG	c.(100-105)ccggggfs	p.PG34fs		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	19					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)	p.G22fs*>430(1)		breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ACCGAggcgccggggggcggcg	0.723																																					p.P34fs	Esophageal Squamous(173;605 2658 7278 49362)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.101_102insG	10						.																																			112827846	SO:0001589	frameshift_variant	150	exon1			AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.107dupG	10.37:g.112837861_112837861dupG	ENSP00000280155:p.Pro34fs	Somatic		Capture	Illumina HiSeq	Phase_I	112827845	NM_000681	B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Frame_Shift_Ins	INS	ENST00000280155.2	37	CCDS7569.2																																																																																				0.723	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050372.2	NM_000681	
DHTKD1	55526	broad.mit.edu	37	10	12126673	12126673	+	Missense_Mutation	SNP	C	C	T	rs141125831		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr10:12126673C>T	ENST00000263035.4	+	3	507	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W	DHTKD1_ENST00000465617.1_Intron	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	149					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.R149W(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GTTTGCCAAGCGGTTTGAGGA	0.448																																					p.R149W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C445T	10						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	160.0	163.0	162.0		445	-5.9	0.2	10	dbSNP_134	162	0,8600		0,0,4300	no	missense	DHTKD1	NM_018706.5	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	149/920	12126673	1,13005	2203	4300	6503	12166679	SO:0001583	missense	55526	exon3			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.445C>T	10.37:g.12126673C>T	ENSP00000263035:p.Arg149Trp	Somatic		Capture	Illumina HiSeq	Phase_I	12166679	NM_018706	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	CCDS7087.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655357	0.67586	2.27E-4	0.0	ENSG00000181192	ENST00000263035;ENST00000437298	T;T	0.15603	2.41;2.41	5.39	-5.95	0.02241	.	0.091412	0.64402	D	0.000001	T	0.38639	0.1048	M	0.77712	2.385	0.42829	D	0.99401	D	0.89917	1.0	D	0.68765	0.96	T	0.58509	-0.7624	10	0.87932	D	0	-13.7078	20.7673	0.99721	0.784:0.216:0.0:0.0	.	149	Q96HY7	DHTK1_HUMAN	W	149	ENSP00000263035:R149W;ENSP00000388163:R149W	ENSP00000263035:R149W	R	+	1	2	DHTKD1	12166679	0.879000	0.30193	0.221000	0.23827	0.987000	0.75469	0.484000	0.22308	-0.625000	0.05604	-0.249000	0.11873	CGG		0.448	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
ITGB1	3688	broad.mit.edu	37	10	33224470	33224470	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr10:33224470A>C	ENST00000396033.2	-	2	152	c.17T>G	c.(16-18)aTt>aGt	p.I6S	ITGB1_ENST00000302278.3_Missense_Mutation_p.I6S|ITGB1_ENST00000374956.4_Missense_Mutation_p.I6S|ITGB1_ENST00000423113.1_Missense_Mutation_p.I6S|ITGB1_ENST00000484088.1_5'UTR	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	6					axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)	p.I6S(2)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	AATCCAGAAAATTGGTTGTAA	0.299																																					p.I6S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T17G	10						.						67.0	68.0	68.0					10																	33224470		2203	4300	6503	33264476	SO:0001583	missense	3688	exon2			BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.17T>G	10.37:g.33224470A>C	ENSP00000379350:p.Ile6Ser	Somatic		Capture	Illumina HiSeq	Phase_I	33264476	NM_133376	A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Missense_Mutation	SNP	ENST00000396033.2	37	CCDS7174.1	.	.	.	.	.	.	.	.	.	.	A	9.350	1.065341	0.20067	.	.	ENSG00000150093	ENST00000396033;ENST00000423113;ENST00000302278;ENST00000374956;ENST00000480226;ENST00000488494;ENST00000534049;ENST00000437302;ENST00000475184;ENST00000528877;ENST00000417122;ENST00000414670	D;D;D;D;D;D;D;D;D;D;D;D	0.96200	-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;-3.94	5.45	4.32	0.51571	.	0.543623	0.20775	N	0.085909	D	0.86682	0.5991	N	0.08118	0	0.19300	N	0.99997	B;B;B;B;B	0.23249	0.034;0.007;0.026;0.05;0.082	B;B;B;B;B	0.23419	0.022;0.013;0.046;0.023;0.023	T	0.74478	-0.3652	10	0.14656	T	0.56	.	7.1794	0.25763	0.8255:0.0:0.1745:0.0	.	6;6;6;6;6	P05556-2;P05556;P05556-5;P05556-3;P05556-4	.;ITB1_HUMAN;.;.;.	S	6	ENSP00000379350:I6S;ENSP00000388694:I6S;ENSP00000303351:I6S;ENSP00000364094:I6S;ENSP00000417537:I6S;ENSP00000418725:I6S;ENSP00000431326:I6S;ENSP00000398029:I6S;ENSP00000417243:I6S;ENSP00000436214:I6S;ENSP00000404546:I6S;ENSP00000400544:I6S	ENSP00000303351:I6S	I	-	2	0	ITGB1	33264476	0.945000	0.32115	0.714000	0.30535	0.289000	0.27227	1.659000	0.37387	1.021000	0.39600	0.533000	0.62120	ATT		0.299	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1	NM_002211	
PCDH15	65217	broad.mit.edu	37	10	55912863	55912863	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr10:55912863C>T	ENST00000320301.6	-	14	2175	c.1781G>A	c.(1780-1782)cGa>cAa	p.R594Q	PCDH15_ENST00000373965.2_Missense_Mutation_p.R601Q|PCDH15_ENST00000414778.1_Missense_Mutation_p.R599Q|PCDH15_ENST00000395432.2_Missense_Mutation_p.R557Q|PCDH15_ENST00000395430.1_Missense_Mutation_p.R594Q|PCDH15_ENST00000395433.1_Missense_Mutation_p.R572Q|PCDH15_ENST00000409834.1_Missense_Mutation_p.R205Q|PCDH15_ENST00000395446.1_Missense_Mutation_p.R594Q|PCDH15_ENST00000395445.1_Missense_Mutation_p.R601Q|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373955.1_Missense_Mutation_p.R594Q|PCDH15_ENST00000361849.3_Missense_Mutation_p.R594Q|PCDH15_ENST00000395438.1_Missense_Mutation_p.R594Q|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000437009.1_Missense_Mutation_p.R594Q|PCDH15_ENST00000373957.3_Missense_Mutation_p.R572Q	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	594	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.R594Q(1)|p.R599Q(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AAATTACCTTCGCTCTGCAGG	0.458										HNSCC(58;0.16)																											p.R557Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1670A	10						.						83.0	75.0	78.0					10																	55912863		2203	4300	6503	55582869	SO:0001583	missense	65217	exon13			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1781G>A	10.37:g.55912863C>T	ENSP00000322604:p.Arg594Gln	Somatic		Capture	Illumina HiSeq	Phase_I	55582869	NM_001142767	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949240	0.73787	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.72;0.7	5.83	5.83	0.93111	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.59891	0.2227	L	0.48218	1.51	0.37526	D	0.91773	P;D;D;D;D;D;P;P;P;P;D;P;P;P;D	0.71674	0.946;0.986;0.976;0.986;0.998;0.986;0.896;0.922;0.896;0.802;0.987;0.924;0.904;0.706;0.973	B;P;P;P;D;P;B;P;B;B;P;P;B;B;P	0.65684	0.416;0.643;0.6;0.692;0.937;0.771;0.277;0.474;0.324;0.277;0.73;0.507;0.343;0.166;0.547	T	0.62737	-0.6791	9	0.49607	T	0.09	.	13.9732	0.64255	0.0:0.927:0.0:0.073	.	572;594;594;599;594;557;594;594;601;601;594;599;594;572;594	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	Q	601;599;594;594;205;601;594;557;594;572;572;594;594;599;594;594	ENSP00000363076:R601Q;ENSP00000410304:R599Q;ENSP00000378826:R594Q;ENSP00000386693:R205Q;ENSP00000378832:R601Q;ENSP00000378833:R594Q;ENSP00000378820:R557Q;ENSP00000354950:R594Q;ENSP00000378821:R572Q;ENSP00000363068:R572Q;ENSP00000322604:R594Q;ENSP00000378818:R594Q;ENSP00000412628:R594Q;ENSP00000363066:R594Q	ENSP00000322604:R594Q	R	-	2	0	PCDH15	55582869	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.602000	0.67612	2.764000	0.94973	0.650000	0.86243	CGA		0.458	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
OR52H1	390067	broad.mit.edu	37	11	5566075	5566075	+	Missense_Mutation	SNP	C	C	T	rs371667578		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr11:5566075C>T	ENST00000322653.4	-	1	704	c.679G>A	c.(679-681)Gca>Aca	p.A227T	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A227T(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGATGTGTGCGTAGGAAACA	0.498																																					p.A227T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G679A	11						.	C	THR/ALA	1,4401	2.1+/-5.4	0,1,2200	121.0	101.0	108.0		679	-3.1	0.0	11		108	0,8594		0,0,4297	no	missense	OR52H1	NM_001005289.1	58	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	benign	227/321	5566075	1,12995	2201	4297	6498	5522651	SO:0001583	missense	390067	exon1			AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.679G>A	11.37:g.5566075C>T	ENSP00000326259:p.Ala227Thr	Somatic		Capture	Illumina HiSeq	Phase_I	5522651	NM_001005289	B9EH26|Q6IF79	Missense_Mutation	SNP	ENST00000322653.4	37	CCDS31386.1	.	.	.	.	.	.	.	.	.	.	C	0.170	-1.072259	0.01918	2.27E-4	0.0	ENSG00000181616	ENST00000322653	T	0.00137	8.68	5.37	-3.14	0.05250	GPCR, rhodopsin-like superfamily (1);	0.974151	0.08441	N	0.945420	T	0.00039	0.0001	N	0.01742	-0.745	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.02437	-1.1159	10	0.12103	T	0.63	.	2.0156	0.03497	0.1202:0.2882:0.1243:0.4672	.	227	Q8NGJ2	O52H1_HUMAN	T	227	ENSP00000326259:A227T	ENSP00000326259:A227T	A	-	1	0	OR52H1	5522651	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.552000	0.02176	-0.532000	0.06332	-0.300000	0.09419	GCA		0.498	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143400.1	NM_001005289	
ANO3	63982	broad.mit.edu	37	11	26538391	26538391	+	Silent	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr11:26538391C>T	ENST00000256737.3	+	6	1461	c.609C>T	c.(607-609)ccC>ccT	p.P203P	ANO3_ENST00000531568.1_Silent_p.P57P|ANO3_ENST00000525139.1_Silent_p.P187P|ANO3_ENST00000537978.1_Silent_p.P187P	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	203					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)	p.P203P(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						TTGCAAGCCCCGATATCATGT	0.388																																					p.P203P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C609T	11						.						83.0	80.0	81.0					11																	26538391		2203	4299	6502	26494967	SO:0001819	synonymous_variant	63982	exon6			AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.609C>T	11.37:g.26538391C>T		Somatic		Capture	Illumina HiSeq	Phase_I	26494967	NM_031418	B7Z3F5	Silent	SNP	ENST00000256737.3	37	CCDS31447.1																																																																																				0.388	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418	
RAG1	5896	broad.mit.edu	37	11	36596863	36596863	+	Missense_Mutation	SNP	C	C	T	rs139863630	byFrequency	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr11:36596863C>T	ENST00000299440.5	+	2	2121	c.2009C>T	c.(2008-2010)aCg>aTg	p.T670M		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	670					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T670M(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				GACCACGAGACGCTGACTGCC	0.488									Familial Hemophagocytic Lymphohistiocytosis																												p.T670M	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2009T	11						.	C	MET/THR	0,4404		0,0,2202	65.0	58.0	60.0		2009	6.0	1.0	11	dbSNP_134	60	2,8594	2.2+/-6.3	0,2,4296	yes	missense	RAG1	NM_000448.2	81	0,2,6498	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	670/1044	36596863	2,12998	2202	4298	6500	36553439	SO:0001583	missense	5896	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2009C>T	11.37:g.36596863C>T	ENSP00000299440:p.Thr670Met	Somatic		Capture	Illumina HiSeq	Phase_I	36553439	NM_000448	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	37	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635265	0.67130	0.0	2.33E-4	ENSG00000166349	ENST00000534663;ENST00000299440	D;D	0.90676	-2.71;-2.71	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.95671	0.8592	M	0.78285	2.405	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95333	0.8431	10	0.87932	D	0	.	20.5176	0.99214	0.0:1.0:0.0:0.0	.	670	P15918	RAG1_HUMAN	M	670	ENSP00000434610:T670M;ENSP00000299440:T670M	ENSP00000299440:T670M	T	+	2	0	RAG1	36553439	1.000000	0.71417	0.978000	0.43139	0.726000	0.41606	5.727000	0.68523	2.852000	0.98041	0.644000	0.83932	ACG		0.488	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448	
OR4A15	81328	broad.mit.edu	37	11	55136125	55136125	+	Missense_Mutation	SNP	C	C	A	rs117954374	byFrequency	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr11:55136125C>A	ENST00000314706.3	+	1	766	c.766C>A	c.(766-768)Cag>Aag	p.Q256K		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q256K(1)		NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						TCTTAAGACTCAGAGTTTGGA	0.448																																					p.Q256K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C766A	11						.						163.0	143.0	150.0					11																	55136125		2201	4296	6497	54892701	SO:0001583	missense	81328	exon1			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.766C>A	11.37:g.55136125C>A	ENSP00000325065:p.Gln256Lys	Somatic		Capture	Illumina HiSeq	Phase_I	54892701	NM_001005275	Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	37	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	-	13.90	2.374636	0.42105	.	.	ENSG00000181958	ENST00000314706	T	0.35973	1.28	3.65	1.69	0.24217	GPCR, rhodopsin-like superfamily (1);	0.266848	0.26582	N	0.023570	T	0.21186	0.0510	N	0.11131	0.1	0.09310	N	1	B	0.19073	0.033	B	0.32393	0.145	T	0.26224	-1.0109	10	0.66056	D	0.02	.	7.734	0.28804	0.0:0.7786:0.0:0.2214	.	256	Q8NGL6	O4A15_HUMAN	K	256	ENSP00000325065:Q256K	ENSP00000325065:Q256K	Q	+	1	0	OR4A15	54892701	0.000000	0.05858	0.000000	0.03702	0.566000	0.35808	-0.984000	0.03755	0.216000	0.20781	0.492000	0.49549	CAG		0.448	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275	
TSGA10IP	254187	broad.mit.edu	37	11	65715588	65715588	+	RNA	SNP	C	C	T	rs199848127		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr11:65715588C>T	ENST00000532620.1	+	0	1351				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						CCTCCCTAATCGCACCTTCCA	0.537																																					p.R374C												.	.	0			c.C1120T	11						.						31.0	30.0	30.0					11																	65715588		1958	4143	6101	65472164			254187	exon4			AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65715588C>T		Somatic		Capture	Illumina HiSeq	Phase_I	65472164	NM_152762	Q3SXZ9|Q3SY01|Q96M26	Missense_Mutation	SNP	ENST00000532620.1	37																																																																																					0.537	TSGA10IP-001	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000391373.2	NM_152762	
TECTA	7007	broad.mit.edu	37	11	120998733	120998733	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr11:120998733G>A	ENST00000392793.1	+	9	2318	c.2047G>A	c.(2047-2049)Gtc>Atc	p.V683I	TECTA_ENST00000264037.2_Missense_Mutation_p.V683I			O75443	TECTA_HUMAN	tectorin alpha	683					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.V683I(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GGGCGGGGACGTCTACTGCTT	0.657																																					p.V683I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2047A	11						.						73.0	62.0	66.0					11																	120998733		2203	4299	6502	120503943	SO:0001583	missense	7007	exon8			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2047G>A	11.37:g.120998733G>A	ENSP00000376543:p.Val683Ile	Somatic		Capture	Illumina HiSeq	Phase_I	120503943	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.702970	0.30232	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.03468	3.92;3.92	5.67	1.71	0.24356	.	0.280132	0.34906	N	0.003596	T	0.03739	0.0106	L	0.41356	1.27	0.24134	N	0.99576	B	0.12630	0.006	B	0.12837	0.008	T	0.43653	-0.9378	10	0.17369	T	0.5	.	12.4252	0.55542	0.2598:0.0:0.7402:0.0	.	683	O75443	TECTA_HUMAN	I	683	ENSP00000376543:V683I;ENSP00000264037:V683I	ENSP00000264037:V683I	V	+	1	0	TECTA	120503943	0.945000	0.32115	0.993000	0.49108	0.859000	0.49053	1.341000	0.33907	0.067000	0.16545	-0.940000	0.02684	GTC		0.657	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
RPH3A	22895	broad.mit.edu	37	12	113314488	113314488	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr12:113314488G>C	ENST00000389385.4	+	13	1485	c.988G>C	c.(988-990)Gag>Cag	p.E330Q	RPH3A_ENST00000447659.2_Missense_Mutation_p.E281Q|RPH3A_ENST00000420983.2_Missense_Mutation_p.E330Q|RPH3A_ENST00000543106.2_Missense_Mutation_p.E330Q|RPH3A_ENST00000549913.2_3'UTR|RPH3A_ENST00000551052.1_Missense_Mutation_p.E326Q|RPH3A_ENST00000415485.3_Missense_Mutation_p.E330Q|RPH3A_ENST00000548866.1_Missense_Mutation_p.E281Q	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	330	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)	p.E326Q(1)		breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		CCCACCCCGAGAGGAGAGAAC	0.617																																					p.E326Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G976C	12						.						34.0	31.0	32.0					12																	113314488		2202	4300	6502	111798871	SO:0001583	missense	22895	exon12			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.988G>C	12.37:g.113314488G>C	ENSP00000374036:p.Glu330Gln	Somatic		Capture	Illumina HiSeq	Phase_I	111798871	NM_014954	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.818921	0.32145	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T	0.61040	0.15;0.15;0.14;0.15;0.15;0.14;0.15	5.15	5.15	0.70609	.	0.407961	0.22760	N	0.055974	T	0.46698	0.1406	L	0.43152	1.355	0.29686	N	0.841315	P;B;B;P	0.37864	0.61;0.017;0.017;0.61	B;B;B;B	0.32864	0.154;0.006;0.006;0.154	T	0.48779	-0.9005	10	0.24483	T	0.36	.	14.1157	0.65151	0.0:0.0:1.0:0.0	.	281;330;330;326	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	Q	330;330;281;326;330;281;330	ENSP00000440384:E330Q;ENSP00000374036:E330Q;ENSP00000413254:E281Q;ENSP00000448297:E326Q;ENSP00000405357:E330Q;ENSP00000450347:E281Q;ENSP00000408889:E330Q	ENSP00000374036:E330Q	E	+	1	0	RPH3A	111798871	1.000000	0.71417	0.949000	0.38748	0.236000	0.25371	3.224000	0.51238	2.385000	0.81259	0.511000	0.50034	GAG		0.617	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
RILPL1	353116	broad.mit.edu	37	12	123970320	123970320	+	Silent	SNP	G	G	A	rs370215117		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr12:123970320G>A	ENST00000376874.4	-	5	1069	c.834C>T	c.(832-834)gaC>gaT	p.D278D	RILPL1_ENST00000544468.1_5'Flank|RILPL1_ENST00000340724.6_Silent_p.D126D	NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	278					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)		p.D278D(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CCTTCTCTGCGTCGGAGATGC	0.612																																					p.D278D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C834T	12						.	G		0,4070		0,0,2035	40.0	43.0	42.0		834	-1.2	0.0	12		42	1,8381		0,1,4190	no	coding-synonymous	RILPL1	NM_178314.3		0,1,6225	AA,AG,GG		0.0119,0.0,0.0080		278/404	123970320	1,12451	2035	4191	6226	122536273	SO:0001819	synonymous_variant	353116	exon5			AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.834C>T	12.37:g.123970320G>A		Somatic		Capture	Illumina HiSeq	Phase_I	122536273	NM_178314	Q66K36|Q8N1M0	Silent	SNP	ENST00000376874.4	37	CCDS45006.1																																																																																				0.612	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400595.1	NM_178314	
CACNA1C	775	broad.mit.edu	37	12	2706637	2706637	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr12:2706637T>C	ENST00000347598.4	+	22	2888	c.2888T>C	c.(2887-2889)aTc>aCc	p.I963T	CACNA1C_ENST00000399634.1_Intron|CACNA1C_ENST00000399603.1_Intron|CACNA1C_ENST00000399638.1_Intron|CACNA1C_ENST00000327702.7_Missense_Mutation_p.I943T|CACNA1C_ENST00000399637.1_Missense_Mutation_p.I943T|CACNA1C_ENST00000480911.1_Missense_Mutation_p.I943T|CACNA1C_ENST00000402845.3_Intron|CACNA1C_ENST00000399601.1_Missense_Mutation_p.I943T|CACNA1C_ENST00000344100.3_Intron|CACNA1C_ENST00000335762.5_Intron|CACNA1C_ENST00000399595.1_Intron|CACNA1C_ENST00000399649.1_Intron|CACNA1C_ENST00000406454.3_Intron|CACNA1C_ENST00000399606.1_Missense_Mutation_p.I963T|CACNA1C_ENST00000399655.1_Intron|CACNA1C_ENST00000399597.1_Intron|CACNA1C_ENST00000399641.1_Missense_Mutation_p.I943T|CACNA1C_ENST00000399617.1_Intron|CACNA1C_ENST00000399591.1_Missense_Mutation_p.I943T|CACNA1C_ENST00000399621.1_Intron|CACNA1C_ENST00000399644.1_Missense_Mutation_p.I943T|CACNA1C_ENST00000399629.1_Missense_Mutation_p.I943T	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	963					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.I993T(1)|p.I478T(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TTCACTAGTATCTTTACATTA	0.423																																					p.I943T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2828C	12						.						80.0	75.0	77.0					12																	2706637		1568	3582	5150	2576898	SO:0001583	missense	775	exon21			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.2888T>C	12.37:g.2706637T>C	ENSP00000266376:p.Ile963Thr	Somatic		Capture	Illumina HiSeq	Phase_I	2576898	NM_001129835	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.955224	0.73902	.	.	ENSG00000151067	ENST00000480911;ENST00000399644;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000399629;ENST00000327702	D;D;D;D;D;D;D;D;D;D	0.98937	-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25	5.0	5.0	0.66597	Ion transport (1);	.	.	.	.	D	0.99245	0.9737	M	0.90922	3.16	0.80722	D	1	B;D;P;B;P;P;P;B;P;P;P;B	0.64830	0.164;0.994;0.923;0.071;0.867;0.867;0.867;0.136;0.763;0.911;0.893;0.275	B;D;P;B;B;B;B;B;B;P;B;B	0.74348	0.196;0.983;0.72;0.177;0.382;0.382;0.382;0.124;0.382;0.571;0.36;0.221	D	0.99072	1.0834	9	0.72032	D	0.01	.	15.1687	0.72850	0.0:0.0:0.0:1.0	.	963;943;943;943;963;943;963;943;943;943;943;943	Q13936;Q13936-33;Q13936-32;Q13936-21;Q13936-30;Q13936-23;Q13936-11;Q13936-29;Q13936-19;Q13936-27;Q13936-20;F5H638	CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.	T	943;943;943;943;943;963;963;943;943;943	ENSP00000437936:I943T;ENSP00000382552:I943T;ENSP00000382546:I943T;ENSP00000382500:I943T;ENSP00000382549:I943T;ENSP00000266376:I963T;ENSP00000382515:I963T;ENSP00000382510:I943T;ENSP00000382537:I943T;ENSP00000329877:I943T	ENSP00000329877:I943T	I	+	2	0	CACNA1C	2576898	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.825000	0.86693	2.235000	0.73313	0.533000	0.62120	ATC		0.423	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
ERBB3	2065	broad.mit.edu	37	12	56478854	56478854	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr12:56478854G>A	ENST00000267101.3	+	3	750	c.310G>A	c.(310-312)Gtg>Atg	p.V104M	ERBB3_ENST00000411731.2_Missense_Mutation_p.V104M|ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000415288.2_Missense_Mutation_p.V45M	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	104			V -> M (in an ovarian mucinous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.V104M(7)|p.V104L(2)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CAACCTCCGCGTGGTGCGAGG	0.517																																					p.V104M												ERBB3,ovary,NS,Substitution - Missense,0 	.	9	Substitution - Missense(9)	large_intestine(5)|endometrium(2)|ovary(1)|NS(1)	c.G310A	12						.						186.0	159.0	168.0					12																	56478854		2203	4300	6503	54765121	SO:0001583	missense	2065	exon3			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.310G>A	12.37:g.56478854G>A	ENSP00000267101:p.Val104Met	Somatic		Capture	Illumina HiSeq	Phase_I	54765121	NM_001005915	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103691	0.56291	.	.	ENSG00000065361	ENST00000549282;ENST00000549061;ENST00000267101;ENST00000394099;ENST00000411731;ENST00000549672;ENST00000415288	T;T;T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48;-1.48;-1.48	5.82	4.93	0.64822	EGF receptor, L domain (1);	0.096412	0.43416	D	0.000573	D	0.87438	0.6177	M	0.82823	2.61	0.80722	D	1	D;D	0.76494	0.998;0.999	P;P	0.59221	0.698;0.854	D	0.88227	0.2901	10	0.59425	D	0.04	.	10.6531	0.45659	0.1547:0.0:0.8453:0.0	.	104;104	P21860;P21860-2	ERBB3_HUMAN;.	M	104;45;104;104;104;45;45	ENSP00000448636:V104M;ENSP00000449138:V45M;ENSP00000267101:V104M;ENSP00000415753:V104M;ENSP00000449713:V45M;ENSP00000408340:V45M	ENSP00000267101:V104M	V	+	1	0	ERBB3	54765121	1.000000	0.71417	0.892000	0.35008	0.052000	0.14988	4.300000	0.59079	1.450000	0.47717	0.655000	0.94253	GTG		0.517	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
IL26	55801	broad.mit.edu	37	12	68618976	68618976	+	Missense_Mutation	SNP	G	G	A	rs373868127		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr12:68618976G>A	ENST00000229134.4	-	3	380	c.316C>T	c.(316-318)Cgc>Tgc	p.R106C	IFNG-AS1_ENST00000536914.1_RNA	NM_018402.1	NP_060872.1	Q9NPH9	IL26_HUMAN	interleukin 26	106					cell-cell signaling (GO:0007267)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)	p.R106C(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		TCCACAAAGCGTATTTTCTTG	0.378																																					p.R106C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C316T	12						.	G	CYS/ARG	0,4406		0,0,2203	97.0	89.0	92.0		316	-2.7	0.0	12		92	1,8599	1.2+/-3.3	0,1,4299	no	missense	IL26	NM_018402.1	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	106/172	68618976	1,13005	2203	4300	6503	66905243	SO:0001583	missense	55801	exon3			AJ251549	CCDS8981.1	12q15	2008-08-04			ENSG00000111536	ENSG00000111536		"""Interleukins and interleukin receptors"""	17119	protein-coding gene	gene with protein product		605679				10729163, 11528524	Standard	NM_018402		Approved	AK155, IL-26	uc001stx.1	Q9NPH9	OTTHUMG00000169114	ENST00000229134.4:c.316C>T	12.37:g.68618976G>A	ENSP00000229134:p.Arg106Cys	Somatic		Capture	Illumina HiSeq	Phase_I	66905243	NM_018402		Missense_Mutation	SNP	ENST00000229134.4	37	CCDS8981.1	.	.	.	.	.	.	.	.	.	.	G	5.978	0.364462	0.11296	0.0	1.16E-4	ENSG00000111536	ENST00000229134	T	0.63580	-0.05	5.19	-2.71	0.05986	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.379230	0.04537	N	0.387323	T	0.49474	0.1559	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.29882	-0.9997	9	.	.	.	-3.4901	9.1952	0.37224	0.1552:0.4954:0.3494:0.0	.	106	Q9NPH9	IL26_HUMAN	C	106	ENSP00000229134:R106C	.	R	-	1	0	IL26	66905243	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	-0.527000	0.06200	-0.358000	0.08162	0.549000	0.68633	CGC		0.378	IL26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402302.1	NM_018402	
BBS10	79738	broad.mit.edu	37	12	76741056	76741056	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr12:76741056C>A	ENST00000393262.3	-	2	792	c.709G>T	c.(709-711)Gct>Tct	p.A237S		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	237					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)	p.A237S(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						ACAAGACCAGCTATGATCCTG	0.428									Bardet-Biedl syndrome																												p.A237S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G709T	12						.						88.0	78.0	81.0					12																	76741056		2203	4300	6503	75265187	SO:0001583	missense	79738	exon2	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.709G>T	12.37:g.76741056C>A	ENSP00000376946:p.Ala237Ser	Somatic		Capture	Illumina HiSeq	Phase_I	75265187	NM_024685	Q96CW2|Q9H5D2	Missense_Mutation	SNP	ENST00000393262.3	37	CCDS9014.2	.	.	.	.	.	.	.	.	.	.	C	6.811	0.518773	0.13005	.	.	ENSG00000179941	ENST00000393262	T	0.78246	-1.16	5.13	0.924	0.19418	.	0.601926	0.16594	N	0.207650	T	0.60843	0.2300	L	0.31207	0.915	0.09310	N	1	B	0.18610	0.029	B	0.18561	0.022	T	0.39820	-0.9595	10	0.08179	T	0.78	-0.1436	10.4567	0.44555	0.218:0.2839:0.4981:0.0	.	237	Q8TAM1	BBS10_HUMAN	S	237	ENSP00000376946:A237S	ENSP00000376946:A237S	A	-	1	0	BBS10	75265187	0.000000	0.05858	0.001000	0.08648	0.758000	0.43043	0.505000	0.22642	0.393000	0.25203	0.650000	0.86243	GCT		0.428	BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303983.2	NM_024685	
AMDHD1	144193	broad.mit.edu	37	12	96350678	96350678	+	Silent	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr12:96350678C>T	ENST00000266736.2	+	4	631	c.525C>T	c.(523-525)cgC>cgT	p.R175R		NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	175					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)	p.R175R(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						TGATTGAGCGCGCCCGGCGGG	0.612																																					p.R175R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C525T	12						.						95.0	101.0	99.0					12																	96350678		2203	4300	6503	94874809	SO:0001819	synonymous_variant	144193	exon4			AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.525C>T	12.37:g.96350678C>T		Somatic		Capture	Illumina HiSeq	Phase_I	94874809	NM_152435	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	37	CCDS9057.1																																																																																				0.612	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
ZNF10	7556	broad.mit.edu	37	12	133732096	133732096	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr12:133732096G>T	ENST00000248211.6	+	5	486	c.264G>T	c.(262-264)gaG>gaT	p.E88D	CTD-2140B24.4_ENST00000540096.2_Missense_Mutation_p.E88D|ZNF10_ENST00000426665.2_Missense_Mutation_p.E88D|ZNF268_ENST00000416488.1_Missense_Mutation_p.E88D|ZNF10_ENST00000402932.2_Missense_Mutation_p.E88D	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	88					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E88D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CAGATTCAGAGACTGCATTTG	0.353																																					p.E88D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G264T	12						.						36.0	37.0	37.0					12																	133732096		2203	4300	6503	132242169	SO:0001583	missense	7556	exon5			X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.264G>T	12.37:g.133732096G>T	ENSP00000248211:p.Glu88Asp	Somatic		Capture	Illumina HiSeq	Phase_I	132242169	NM_015394	B2RBS1|Q8TC91	Missense_Mutation	SNP	ENST00000248211.6	37	CCDS9283.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647637	0.29246	.	.	ENSG00000256223;ENSG00000256223;ENSG00000256223;ENSG00000256223;ENSG00000090612	ENST00000248211;ENST00000426665;ENST00000402932;ENST00000537119;ENST00000416488	T;T;T;T;T	0.06142	3.34;3.34;3.49;4.46;5.6	4.44	0.214	0.15249	.	1.596120	0.04216	N	0.332690	T	0.04770	0.0129	L	0.28400	0.85	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.38067	-0.9678	9	.	.	.	.	1.1197	0.01722	0.1753:0.1442:0.341:0.3395	.	88	P21506	ZNF10_HUMAN	D	88;88;88;46;88	ENSP00000248211:E88D;ENSP00000393814:E88D;ENSP00000384893:E88D;ENSP00000437397:E46D;ENSP00000409295:E88D	.	E	+	3	2	ZNF10;ZNF268	132242169	0.070000	0.21116	0.787000	0.31911	0.970000	0.65996	-0.189000	0.09629	-0.071000	0.12886	0.655000	0.94253	GAG		0.353	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397182.1	NM_015394	
THSD1	55901	broad.mit.edu	37	13	52952407	52952407	+	Silent	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr13:52952407C>T	ENST00000258613.4	-	5	1876	c.1698G>A	c.(1696-1698)gcG>gcA	p.A566A	THSD1_ENST00000544466.1_Silent_p.A187A|THSD1_ENST00000349258.4_Silent_p.A513A	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	566					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.A566A(1)		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CGCTGGGGGCCGCATCAATGG	0.542																																					p.A566A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1698A	13						.						81.0	88.0	86.0					13																	52952407		2203	4300	6503	51850408	SO:0001819	synonymous_variant	55901	exon5			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.1698G>A	13.37:g.52952407C>T		Somatic		Capture	Illumina HiSeq	Phase_I	51850408	NM_018676	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Silent	SNP	ENST00000258613.4	37	CCDS9432.1																																																																																				0.542	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3		
SLITRK1	114798	broad.mit.edu	37	13	84455488	84455488	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr13:84455488C>T	ENST00000377084.2	-	1	1040	c.155G>A	c.(154-156)cGt>cAt	p.R52H		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	52	LRRNT 1.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.R52H(2)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GGCAGTGAAACGCTGCAGACT	0.448																																					p.R52H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G155A	13						.						84.0	84.0	84.0					13																	84455488		2203	4300	6503	83353489	SO:0001583	missense	114798	exon1			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.155G>A	13.37:g.84455488C>T	ENSP00000366288:p.Arg52His	Somatic		Capture	Illumina HiSeq	Phase_I	83353489	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359937	0.24598	.	.	ENSG00000178235	ENST00000377084	T	0.58506	0.33	4.78	3.85	0.44370	.	0.054916	0.64402	D	0.000001	T	0.22859	0.0552	N	0.00926	-1.1	0.41002	D	0.984937	B	0.02656	0.0	B	0.01281	0.0	T	0.12837	-1.0532	10	0.39692	T	0.17	-5.765	4.7426	0.13022	0.0:0.7382:0.0:0.2618	.	52	Q96PX8	SLIK1_HUMAN	H	52	ENSP00000366288:R52H	ENSP00000366288:R52H	R	-	2	0	SLITRK1	83353489	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.917000	0.63369	2.475000	0.83589	0.561000	0.74099	CGT		0.448	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
GPC5	2262	broad.mit.edu	37	13	92101156	92101156	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr13:92101156G>A	ENST00000377067.3	+	2	677	c.305G>A	c.(304-306)cGa>cAa	p.R102Q		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	102					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.R102Q(1)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CTAATATCTCGAAATGCGGCT	0.438																																					p.R102Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G305A	13						.						98.0	91.0	94.0					13																	92101156		2203	4300	6503	90899157	SO:0001583	missense	2262	exon2			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.305G>A	13.37:g.92101156G>A	ENSP00000366267:p.Arg102Gln	Somatic		Capture	Illumina HiSeq	Phase_I	90899157	NM_004466	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	.	.	.	.	.	.	.	.	.	.	G	6.170	0.399540	0.11696	.	.	ENSG00000179399	ENST00000377067	T	0.45276	0.9	5.5	4.66	0.58398	.	0.561474	0.18255	N	0.146822	T	0.24509	0.0594	L	0.27053	0.805	0.33723	D	0.617235	B	0.20887	0.049	B	0.20767	0.031	T	0.24048	-1.0171	10	0.06891	T	0.86	.	7.0551	0.25095	0.2653:0.0:0.7347:0.0	.	102	P78333	GPC5_HUMAN	Q	102	ENSP00000366267:R102Q	ENSP00000366267:R102Q	R	+	2	0	GPC5	90899157	0.647000	0.27304	1.000000	0.80357	0.934000	0.57294	0.671000	0.25172	1.323000	0.45263	0.467000	0.42956	CGA		0.438	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466	
RNASE10	338879	broad.mit.edu	37	14	20978831	20978831	+	Silent	SNP	G	G	A	rs574467521		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr14:20978831G>A	ENST00000328444.5	+	1	220	c.201G>A	c.(199-201)acG>acA	p.T67T	RNASE10_ENST00000430083.1_Silent_p.T95T	NM_001012975.1	NP_001012993.1	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	67					epithelial cell morphogenesis (GO:0003382)|heterotypic cell-cell adhesion (GO:0034113)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of sperm motility (GO:1902093)|regulation of fertilization (GO:0080154)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)	extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)	p.T67T(1)		endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	12	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		CCACAGAAACGCTGGTGCTTA	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		20530	0.0		0.0	False		,,,				2504	0.001				p.T67T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G201A	14						.						83.0	82.0	82.0					14																	20978831		2203	4300	6503	20048671	SO:0001819	synonymous_variant	338879	exon1				CCDS32035.1	14q11.1	2004-11-16				ENSG00000182545		"""Ribonucleases, RNase A"""	19275	protein-coding gene	gene with protein product						12920233	Standard	XM_005267584		Approved	RNASE9	uc010tlj.2	Q5GAN6		ENST00000328444.5:c.201G>A	14.37:g.20978831G>A		Somatic		Capture	Illumina HiSeq	Phase_I	20048671	NM_001012975	A2RUQ3|B4DKY4	Silent	SNP	ENST00000328444.5	37	CCDS32035.1																																																																																				0.537	RNASE10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411088.1	XM_292225	
MYZAP	100820829	broad.mit.edu	37	15	57922017	57922017	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr15:57922017G>A	ENST00000267853.5	+	6	737	c.643G>A	c.(643-645)Gta>Ata	p.V215I	GCOM1_ENST00000380560.2_Missense_Mutation_p.V146I|GCOM1_ENST00000396180.1_Missense_Mutation_p.V184I|GCOM1_ENST00000587652.1_Missense_Mutation_p.V215I|POLR2M_ENST00000380563.2_5'UTR|MYZAP_ENST00000380565.4_Missense_Mutation_p.V215I|GCOM1_ENST00000380561.2_Missense_Mutation_p.V184I|GCOM1_ENST00000572390.1_Missense_Mutation_p.V215I|GCOM1_ENST00000380569.2_Missense_Mutation_p.V215I|GCOM1_ENST00000574161.1_Missense_Mutation_p.V215I|GCOM1_ENST00000380568.3_Missense_Mutation_p.V215I			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	215					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)		p.V215I(1)									GCAGTTGGAGGTAGCGCAAGT	0.408																																					p.V215I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G643A	15						.						101.0	95.0	97.0					15																	57922017		2192	4292	6484	55709309	SO:0001583	missense	145781	exon6			FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.643G>A	15.37:g.57922017G>A	ENSP00000267853:p.Val215Ile	Somatic		Capture	Illumina HiSeq	Phase_I	55709309	NM_152451	D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	ENST00000267853.5	37	CCDS10162.1	.	.	.	.	.	.	.	.	.	.	G	7.659	0.684629	0.14973	.	.	ENSG00000137878	ENST00000380569;ENST00000380561;ENST00000396180;ENST00000380560;ENST00000267853;ENST00000380565;ENST00000380568	T;T;T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69;1.69;1.69	5.43	4.46	0.54185	.	0.789406	0.12236	N	0.487036	T	0.16428	0.0395	N	0.22421	0.69	0.23577	N	0.997374	B;B;B;B	0.23650	0.089;0.089;0.026;0.015	B;B;B;B	0.26969	0.075;0.075;0.046;0.046	T	0.08166	-1.0735	10	0.54805	T	0.06	0.0444	3.9424	0.09333	0.0863:0.1624:0.5828:0.1685	.	215;215;215;215	P0CAP1-2;P0CAP1-11;P0CAP1-4;P0CAP1	.;.;.;GCOM1_HUMAN	I	215;184;184;146;215;215;215	ENSP00000369943:V215I;ENSP00000369935:V184I;ENSP00000379483:V184I;ENSP00000369933:V146I;ENSP00000267853:V215I;ENSP00000369939:V215I;ENSP00000369942:V215I	ENSP00000267853:V215I	V	+	1	0	GCOM1	55709309	0.113000	0.22115	0.044000	0.18714	0.041000	0.13682	2.194000	0.42668	2.540000	0.85666	0.650000	0.86243	GTA		0.408	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255716.2	NM_001018100	
COQ9	57017	broad.mit.edu	37	16	57486812	57486812	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr16:57486812C>A	ENST00000262507.6	+	3	411	c.342C>A	c.(340-342)caC>caA	p.H114Q	COQ9_ENST00000567072.1_Missense_Mutation_p.H114Q|COQ9_ENST00000567933.1_Missense_Mutation_p.H114Q	NM_020312.3	NP_064708.1	O75208	COQ9_HUMAN	coenzyme Q9	114					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)		p.H114Q(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)	16						TGCCCGCCCACGGGTGGACAG	0.607																																					p.H114Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C342A	16						.						100.0	88.0	92.0					16																	57486812		2198	4300	6498	56044313	SO:0001583	missense	57017	exon3			BC064946	CCDS32459.1	16q13	2013-10-18	2013-10-18	2006-01-13	ENSG00000088682	ENSG00000088682			25302	protein-coding gene	gene with protein product		612837	"""chromosome 16 open reading frame 49"", ""coenzyme Q9 homolog (yeast)"", ""coenzyme Q9 homolog (S. cerevisiae)"""	C16orf49		19375058	Standard	NM_020312		Approved	DKFZP434K046	uc002elq.3	O75208		ENST00000262507.6:c.342C>A	16.37:g.57486812C>A	ENSP00000262507:p.His114Gln	Somatic		Capture	Illumina HiSeq	Phase_I	56044313	NM_020312	A8K3L2|Q7L5V7|Q7Z5T6|Q8NBL4|Q9NTJ2|Q9P056	Missense_Mutation	SNP	ENST00000262507.6	37	CCDS32459.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.185006	0.38609	.	.	ENSG00000088682	ENST00000262507	.	.	.	5.01	-10.0	0.00425	.	0.096480	0.64402	D	0.000001	T	0.54447	0.1859	M	0.79475	2.455	0.28206	N	0.927147	B;D;D;D;B	0.89917	0.141;1.0;1.0;0.999;0.351	B;D;D;D;B	0.79784	0.082;0.993;0.979;0.949;0.067	T	0.61667	-0.7016	9	0.36615	T	0.2	-4.8007	7.5228	0.27637	0.0967:0.5116:0.099:0.2927	.	114;114;114;114;114	B4E0U3;B4DIV2;B4DEE3;O75208;O75208-2	.;.;.;COQ9_HUMAN;.	Q	114	.	ENSP00000262507:H114Q	H	+	3	2	COQ9	56044313	0.008000	0.16893	0.348000	0.25681	0.689000	0.40095	-1.030000	0.03581	-2.727000	0.00386	-1.223000	0.01593	CAC		0.607	COQ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432598.3	NM_020312	
CDH8	1006	broad.mit.edu	37	16	61689414	61689414	+	Silent	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr16:61689414G>A	ENST00000577390.1	-	11	2820	c.1866C>T	c.(1864-1866)ggC>ggT	p.G622G	CDH8_ENST00000299345.6_Silent_p.G622G|CDH8_ENST00000577730.1_Silent_p.G622G	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	622					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.G622G(2)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CAATTAAGGCGCCCATACTGA	0.448																																					p.G622G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1866T	16						.						113.0	94.0	100.0					16																	61689414		2203	4300	6503	60246915	SO:0001819	synonymous_variant	1006	exon11			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1866C>T	16.37:g.61689414G>A		Somatic		Capture	Illumina HiSeq	Phase_I	60246915	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	ENST00000577390.1	37	CCDS10802.1																																																																																				0.448	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
CDH11	1009	broad.mit.edu	37	16	65032635	65032635	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr16:65032635C>T	ENST00000268603.4	-	4	968	c.353G>A	c.(352-354)cGa>cAa	p.R118Q	CDH11_ENST00000566827.1_5'UTR|CDH11_ENST00000394156.3_Missense_Mutation_p.R118Q	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	118	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R118Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TCTCTCTTCTCGATCCAACGT	0.507			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.R118Q			Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G353A	16						.						156.0	118.0	131.0					16																	65032635		2203	4300	6503	63590136	SO:0001583	missense	1009	exon4			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.353G>A	16.37:g.65032635C>T	ENSP00000268603:p.Arg118Gln	Somatic		Capture	Illumina HiSeq	Phase_I	63590136	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	C	36	5.613474	0.96637	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390;ENST00000536902	T;T	0.59364	0.27;0.27	5.87	5.87	0.94306	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.87985	0.6316	H	0.99740	4.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.92678	0.6156	10	0.87932	D	0	.	19.5705	0.95413	0.0:1.0:0.0:0.0	.	118;118	P55287-2;P55287	.;CAD11_HUMAN	Q	118;118;101;118	ENSP00000268603:R118Q;ENSP00000377711:R118Q	ENSP00000268603:R118Q	R	-	2	0	CDH11	63590136	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.445000	0.80570	2.941000	0.99782	0.655000	0.94253	CGA		0.507	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
CHST4	10164	broad.mit.edu	37	16	71571215	71571215	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr16:71571215G>A	ENST00000338482.5	+	3	978	c.635G>A	c.(634-636)cGt>cAt	p.R212H	CHST4_ENST00000539698.3_Missense_Mutation_p.R212H|ZNF19_ENST00000568446.1_Intron|CHST4_ENST00000572450.1_Missense_Mutation_p.R212H|RP11-510M2.5_ENST00000568523.1_RNA			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	212					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.R212H(1)		cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						GCCGTGTTCCGTTCCCGAGAA	0.567																																					p.R212H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G635A	16						.						60.0	59.0	60.0					16																	71571215		2198	4300	6498	70128716	SO:0001583	missense	10164	exon2			AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.635G>A	16.37:g.71571215G>A	ENSP00000341206:p.Arg212His	Somatic		Capture	Illumina HiSeq	Phase_I	70128716	NM_001166395	Q8IV46|Q9Y5R3	Missense_Mutation	SNP	ENST00000338482.5	37	CCDS10902.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.981165	0.53827	.	.	ENSG00000140835	ENST00000338482;ENST00000539698	D;D	0.81996	-1.56;-1.56	5.65	4.68	0.58851	Sulfotransferase domain (1);	0.353337	0.26525	N	0.023884	T	0.78672	0.4320	L	0.53249	1.67	0.39186	D	0.962874	B	0.33299	0.407	B	0.36186	0.219	T	0.77968	-0.2388	10	0.48119	T	0.1	-26.4396	8.1057	0.30885	0.0834:0.1607:0.7559:0.0	.	212	Q8NCG5	CHST4_HUMAN	H	212	ENSP00000341206:R212H;ENSP00000441204:R212H	ENSP00000341206:R212H	R	+	2	0	CHST4	70128716	0.006000	0.16342	0.895000	0.35142	0.839000	0.47603	1.208000	0.32345	1.366000	0.46076	0.655000	0.94253	CGT		0.567	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268992.4	NM_005769	
PKD1L2	114780	broad.mit.edu	37	16	81249888	81249888	+	RNA	SNP	G	G	A	rs201649906	byFrequency	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr16:81249888G>A	ENST00000525539.1	-	0	424				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.S142L(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GGCGCAGTCCGAGGTCACCCA	0.662																																					p.S142L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C425T	16						.	G	LEU/SER,LEU/SER	0,4196		0,0,2098	65.0	83.0	77.0		425,425	-1.1	0.0	16		77	12,8430		0,12,4209	yes	missense,missense	PKD1L2	NM_001076780.1,NM_052892.3	145,145	0,12,6307	AA,AG,GG		0.1421,0.0,0.095	benign,benign	142/992,142/2460	81249888	12,12626	2098	4221	6319	79807389			114780	exon2			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81249888G>A		Somatic		Capture	Illumina HiSeq	Phase_I	79807389	NM_052892	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37		.	.	.	.	.	.	.	.	.	.	G	13.56	2.273198	0.40194	0.0	0.001421	ENSG00000166473	ENST00000337114	T	0.18810	2.19	5.09	-1.12	0.09808	C-type lectin fold (1);C-type lectin (3);	0.750296	0.11361	N	0.571921	T	0.09024	0.0223	.	.	.	0.09310	N	1	B;B	0.14805	0.011;0.007	B;B	0.10450	0.004;0.005	T	0.41698	-0.9494	9	0.09843	T	0.71	5.6239	7.5492	0.27786	0.29:0.1157:0.5943:0.0	.	142;142	Q7Z442-3;Q7Z442	.;PK1L2_HUMAN	L	142	ENSP00000337397:S142L	ENSP00000337397:S142L	S	-	2	0	PKD1L2	79807389	0.162000	0.22906	0.000000	0.03702	0.004000	0.04260	2.545000	0.45769	-0.055000	0.13244	0.650000	0.86243	TCG		0.662	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
RAB40B	10966	broad.mit.edu	37	17	80615785	80615786	+	Frame_Shift_Ins	INS	-	-	G	rs111549422	byFrequency	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	-	-	-	G	-	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr17:80615785_80615786insG	ENST00000571995.1	-	6	921_922	c.790_791insC	c.(790-792)cagfs	p.Q264fs	RAB40B_ENST00000571880.1_5'Flank|RAB40B_ENST00000269347.6_Frame_Shift_Ins_p.Q85fs	NM_006822.2	NP_006813.1	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	264					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.Q264P(1)|p.Q264fs*>15(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(2)	10	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GGGGGGGCTCTGGGGGGGGCGG	0.569																																					p.Q264fs												.	.	2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|central_nervous_system(1)	c.791_792insC	17						.																																			78209075	SO:0001589	frameshift_variant	10966	exon6			U05227	CCDS11816.1	17q25.3	2014-08-12			ENSG00000141542	ENSG00000141542		"""RAB, member RAS oncogene"""	18284	protein-coding gene	gene with protein product						11697911	Standard	NM_006822		Approved	SEC4L, RAR	uc002kft.3	Q12829	OTTHUMG00000177806	ENST00000571995.1:c.791dupC	17.37:g.80615793_80615793dupG	ENSP00000461785:p.Gln264fs	Germline		Capture	Illumina HiSeq	Phase_I	78209074	NM_006822	Q8WVG3	Frame_Shift_Ins	INS	ENST00000571995.1	37	CCDS11816.1																																																																																				0.569	RAB40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439007.1		
KCNJ12	3768	broad.mit.edu	37	17	21319109	21319109	+	Missense_Mutation	SNP	C	C	T	rs373025520		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr17:21319109C>T	ENST00000583088.1	+	3	1350	c.455C>T	c.(454-456)aCg>aTg	p.T152M	KCNJ12_ENST00000331718.5_Missense_Mutation_p.T152M	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	152					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.T152M(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CGCTGTGTGACGGAGGAGTGC	0.622										Prostate(3;0.18)																											p.T152M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C455T	17						.	C	MET/THR	0,4406		0,0,2203	59.0	57.0	57.0		455	5.3	1.0	17		57	2,8598	2.2+/-6.3	0,2,4298	no	missense	KCNJ12	NM_021012.4	81	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	152/434	21319109	2,13004	2203	4300	6503	21259702	SO:0001583	missense	3768	exon3			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.455C>T	17.37:g.21319109C>T	ENSP00000463778:p.Thr152Met	Somatic		Capture	Illumina HiSeq	Phase_I	21259702	NM_021012	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479090	0.84747	0.0	2.33E-4	ENSG00000184185	ENST00000331718	D	0.95788	-3.81	5.32	5.32	0.75619	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.98658	0.9550	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99679	1.0998	10	0.87932	D	0	.	18.9979	0.92821	0.0:1.0:0.0:0.0	.	152	Q14500	IRK12_HUMAN	M	152	ENSP00000328150:T152M	ENSP00000328150:T152M	T	+	2	0	KCNJ12	21259702	1.000000	0.71417	0.956000	0.39512	0.998000	0.95712	7.680000	0.84062	2.496000	0.84212	0.655000	0.94253	ACG		0.622	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
TP53	7157	broad.mit.edu	37	17	7577142	7577142	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr17:7577142C>A	ENST00000269305.4	-	8	985	c.796G>T	c.(796-798)Gga>Tga	p.G266*	TP53_ENST00000359597.4_Nonsense_Mutation_p.G266*|TP53_ENST00000445888.2_Nonsense_Mutation_p.G266*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Nonsense_Mutation_p.G266*|TP53_ENST00000455263.2_Nonsense_Mutation_p.G266*|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	266	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G266R(46)|p.G266*(14)|p.0?(8)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*79(2)|p.N263fs*5(1)|p.G266T(1)|p.L265_K305del41(1)|p.G266_E271delGRNSFE(1)|p.E258fs*71(1)|p.G266fs*9(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGTTCCGTCCCAGTAGATTA	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.G266X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0 	.	86	Substitution - Missense(47)|Substitution - Nonsense(14)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(3)|Insertion - Frameshift(1)	lung(16)|large_intestine(11)|ovary(8)|central_nervous_system(6)|urinary_tract(6)|oesophagus(6)|upper_aerodigestive_tract(5)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|stomach(3)|liver(2)|skin(2)|pancreas(2)|biliary_tract(1)|peritoneum(1)|salivary_gland(1)|endometrium(1)|eye(1)|pleura(1)	c.G796T	17						.						49.0	44.0	46.0					17																	7577142		2203	4300	6503	7517867	SO:0001587	stop_gained	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.796G>T	17.37:g.7577142C>A	ENSP00000269305:p.Gly266*	Somatic		Capture	Illumina HiSeq	Phase_I	7517867	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	37	6.155854	0.97334	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.0798	16.1198	0.81342	0.0:1.0:0.0:0.0	.	.	.	.	X	266;266;266;266;266;255;134	.	ENSP00000269305:G266X	G	-	1	0	TP53	7517867	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GGA		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRTAP4-12	83755	broad.mit.edu	37	17	39280087	39280087	+	Silent	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr17:39280087G>A	ENST00000394014.1	-	1	332	c.288C>T	c.(286-288)tgC>tgT	p.C96C		NM_031854.2	NP_114060.1	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	96	31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament (GO:0045095)		p.C96C(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGGTGGGCTGGCAGCACACAG	0.667																																					p.C96C												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C288T	17						.						31.0	36.0	34.0					17																	39280087		2139	4174	6313	36533613	SO:0001819	synonymous_variant	83755	exon1			AJ406943	CCDS32649.1	17q21.2	2013-06-25			ENSG00000213416	ENSG00000213416		"""Keratin associated proteins"""	16776	protein-coding gene	gene with protein product						11279113	Standard	NM_031854		Approved	KAP4.12	uc002hwa.3	Q9BQ66	OTTHUMG00000133632	ENST00000394014.1:c.288C>T	17.37:g.39280087G>A		Somatic		Capture	Illumina HiSeq	Phase_I	36533613	NM_031854	A3KMC5|Q495I0	Silent	SNP	ENST00000394014.1	37	CCDS32649.1																																																																																				0.667	KRTAP4-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257777.1		
ZNF521	25925	broad.mit.edu	37	18	22804425	22804425	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr18:22804425G>T	ENST00000361524.3	-	4	3605	c.3457C>A	c.(3457-3459)Ctc>Atc	p.L1153I	ZNF521_ENST00000538137.2_Missense_Mutation_p.L1153I|ZNF521_ENST00000584787.1_Missense_Mutation_p.L933I	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1153					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.L1153I(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGGTTCTGGAGTTCACTTTCA	0.517			T	PAX5	ALL																																p.L1153I			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3457A	18						.						182.0	160.0	168.0					18																	22804425		2203	4300	6503	21058423	SO:0001583	missense	25925	exon4			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3457C>A	18.37:g.22804425G>T	ENSP00000354794:p.Leu1153Ile	Somatic		Capture	Illumina HiSeq	Phase_I	21058423	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788515	0.31685	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.19938	2.67;2.11	5.98	5.98	0.97165	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.47097	0.1427	L	0.59436	1.845	0.41145	D	0.985981	D	0.76494	0.999	D	0.91635	0.999	T	0.30119	-0.9989	10	0.72032	D	0.01	-23.2016	20.4581	0.99154	0.0:0.0:1.0:0.0	.	1153	Q96K83	ZN521_HUMAN	I	1153;1187;1153	ENSP00000354794:L1153I;ENSP00000382352:L1153I	ENSP00000354794:L1153I	L	-	1	0	ZNF521	21058423	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.325000	0.65869	2.835000	0.97688	0.650000	0.86243	CTC		0.517	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
MYO5B	4645	broad.mit.edu	37	18	47431163	47431163	+	Missense_Mutation	SNP	A	A	C	rs201123859		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr18:47431163A>C	ENST00000285039.7	-	20	2749	c.2450T>G	c.(2449-2451)gTg>gGg	p.V817G	MYO5B_ENST00000324581.6_5'Flank	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	817	Arg-rich.|IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.|IQ 3. {ECO:0000255|PROSITE- ProRule:PRU00116}.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CTGGAGCACCACAGCCGCTCT	0.612																																					p.V817G												.	.	0			c.T2450G	18						.						37.0	43.0	41.0					18																	47431163		2004	4159	6163	45685161	SO:0001583	missense	4645	exon20			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.2450T>G	18.37:g.47431163A>C	ENSP00000285039:p.Val817Gly	None		Capture	Illumina HiSeq	Phase_I	45685161	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	A	11.93	1.784950	0.31593	.	.	ENSG00000167306	ENST00000285039	T	0.72725	-0.68	5.37	3.0	0.34707	.	0.784120	0.11677	N	0.540174	T	0.79505	0.4457	M	0.90814	3.15	0.20821	N	0.999841	B	0.30361	0.277	B	0.40825	0.341	T	0.72924	-0.4144	10	0.87932	D	0	.	9.1113	0.36730	0.8484:0.0:0.1516:0.0	.	817	Q9ULV0	MYO5B_HUMAN	G	817	ENSP00000285039:V817G	ENSP00000285039:V817G	V	-	2	0	MYO5B	45685161	0.721000	0.28007	0.074000	0.20217	0.007000	0.05969	5.944000	0.70219	0.869000	0.35703	-0.290000	0.09829	GTG		0.612	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
CNN1	1264	broad.mit.edu	37	19	11651941	11651941	+	Silent	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr19:11651941C>T	ENST00000252456.2	+	2	325	c.114C>T	c.(112-114)atC>atT	p.I38I	CNN1_ENST00000592923.1_5'UTR|CNN1_ENST00000544952.1_Silent_p.I18I|CNN1_ENST00000535659.2_5'UTR|CNN1_ENST00000588468.1_3'UTR	NM_001299.4	NP_001290.2	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle	38	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actomyosin structure organization (GO:0031032)|regulation of smooth muscle contraction (GO:0006940)	cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)		p.I38I(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9						GAGAGTGGATCGAGGGGGTGA	0.607																																					p.I38I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C114T	19						.						60.0	45.0	50.0					19																	11651941		2203	4300	6503	11512941	SO:0001819	synonymous_variant	1264	exon2			U37019	CCDS12263.1	19p13.2-p13.1	2008-07-16				ENSG00000130176			2155	protein-coding gene	gene with protein product		600806				8526917, 9332369	Standard	XM_005259741		Approved	SMCC, Sm-Calp	uc002msc.1	P51911		ENST00000252456.2:c.114C>T	19.37:g.11651941C>T		Somatic		Capture	Illumina HiSeq	Phase_I	11512941	NM_001299	B2R868|B4DUX6|O00638|Q15416|Q8IY93|Q99438	Silent	SNP	ENST00000252456.2	37	CCDS12263.1																																																																																				0.607	CNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458854.1	NM_001299	
ZNF208	7757	broad.mit.edu	37	19	22154662	22154662	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr19:22154662T>G	ENST00000397126.4	-	4	3322	c.3174A>C	c.(3172-3174)aaA>aaC	p.K1058N	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1058					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K930N(2)|p.K1058N(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATTCTTCACATTTGTAGGGTT	0.463																																					p.K1058N												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A3174C	19						.						127.0	128.0	127.0					19																	22154662		2129	4246	6375	21946502	SO:0001583	missense	7757	exon4			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3174A>C	19.37:g.22154662T>G	ENSP00000380315:p.Lys1058Asn	Somatic		Capture	Illumina HiSeq	Phase_I	21946502	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	T	12.42	1.933179	0.34096	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.58060	0.36	2.59	1.54	0.23209	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47581	0.1453	.	.	.	0.09310	N	1	P	0.46512	0.879	P	0.46940	0.532	T	0.37526	-0.9702	8	0.56958	D	0.05	.	3.5888	0.07981	0.0:0.1366:0.2261:0.6373	.	930	O43345	ZN208_HUMAN	N	1058;930	ENSP00000380315:K1058N	ENSP00000380315:K1058N	K	-	3	2	ZNF208	21946502	0.000000	0.05858	0.001000	0.08648	0.213000	0.24496	-1.356000	0.02609	0.017000	0.15025	0.246000	0.17985	AAA		0.463	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
CD22	933	broad.mit.edu	37	19	35832607	35832607	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr19:35832607G>A	ENST00000085219.5	+	9	1840	c.1774G>A	c.(1774-1776)Gca>Aca	p.A592T	CD22_ENST00000419549.2_Missense_Mutation_p.A420T|CD22_ENST00000594250.1_Missense_Mutation_p.A415T|CD22_ENST00000536635.2_Missense_Mutation_p.A504T|CD22_ENST00000341773.6_Missense_Mutation_p.A415T|CD22_ENST00000544992.2_Missense_Mutation_p.A592T|CD22_ENST00000270311.6_Missense_Mutation_p.A472T	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	592					cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.A592T(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCATGCAGATGCACCCAGGAG	0.657																																					p.A592T	Ovarian(42;1009 1133 23674 26041)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1774A	19						.						74.0	62.0	66.0					19																	35832607		2203	4300	6503	40524447	SO:0001583	missense	933	exon9			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.1774G>A	19.37:g.35832607G>A	ENSP00000085219:p.Ala592Thr	Somatic		Capture	Illumina HiSeq	Phase_I	40524447	NM_001185100	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	ENST00000085219.5	37	CCDS12457.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744012	0.49151	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000544992;ENST00000270311;ENST00000419549	D;D;D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19;-2.19;-2.19	5.39	0.237	0.15475	Immunoglobulin-like fold (1);	0.388105	0.22144	N	0.064013	D	0.91439	0.7298	M	0.83384	2.64	0.29096	N	0.881777	D;D;D;D;D	0.89917	0.997;0.995;1.0;0.992;1.0	P;P;D;P;D	0.76071	0.907;0.894;0.987;0.889;0.983	D	0.84578	0.0659	10	0.36615	T	0.2	.	8.2491	0.31706	0.0878:0.4603:0.452:0.0	.	420;592;504;592;415	Q32M46;F5GYU4;F5H7U3;P20273;P20273-2	.;.;.;CD22_HUMAN;.	T	592;504;415;592;472;420	ENSP00000085219:A592T;ENSP00000442279:A504T;ENSP00000339349:A415T;ENSP00000441237:A592T;ENSP00000270311:A472T;ENSP00000403822:A420T	ENSP00000085219:A592T	A	+	1	0	CD22	40524447	0.695000	0.27747	0.641000	0.29422	0.406000	0.30931	0.445000	0.21677	0.205000	0.20568	0.561000	0.74099	GCA		0.657	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
HKR1	284459	broad.mit.edu	37	19	37853519	37853519	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr19:37853519G>A	ENST00000324411.4	+	6	1091	c.822G>A	c.(820-822)atG>atA	p.M274I	HKR1_ENST00000589392.1_Missense_Mutation_p.M256I|HKR1_ENST00000591471.1_Start_Codon_SNP_p.M1I|HKR1_ENST00000544914.1_Start_Codon_SNP_p.M1I|HKR1_ENST00000392153.3_Missense_Mutation_p.M255I|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000541583.2_Missense_Mutation_p.M213I	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	274					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M274I(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CACCTTACATGTACACTGAGT	0.483																																					p.M274I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G822A	19						.						46.0	43.0	44.0					19																	37853519		2203	4300	6503	42545359	SO:0001583	missense	284459	exon6			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.822G>A	19.37:g.37853519G>A	ENSP00000315505:p.Met274Ile	Somatic		Capture	Illumina HiSeq	Phase_I	42545359	NM_181786	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	G	2.099	-0.406545	0.04832	.	.	ENSG00000181666	ENST00000544914;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T;T	0.14266	3.41;2.52;2.52;2.52	2.49	1.45	0.22620	.	.	.	.	.	T	0.04182	0.0116	N	0.04018	-0.295	0.09310	N	0.999999	B;B;B;B	0.16802	0.006;0.019;0.006;0.0	B;B;B;B	0.20955	0.014;0.032;0.001;0.001	T	0.43766	-0.9371	9	0.02654	T	1	-5.9231	2.2797	0.04111	0.279:0.0:0.472:0.2489	.	213;255;274;256	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	I	1;255;310;274;213	ENSP00000437774:M1I;ENSP00000375994:M255I;ENSP00000315505:M274I;ENSP00000438261:M213I	ENSP00000315505:M274I	M	+	3	0	HKR1	42545359	0.000000	0.05858	0.007000	0.13788	0.122000	0.20287	-0.371000	0.07513	0.611000	0.30052	0.650000	0.86243	ATG		0.483	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786	
PSG7	5676	broad.mit.edu	37	19	43433772	43433772	+	RNA	SNP	G	G	T	rs372381292		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr19:43433772G>T	ENST00000406070.2	-	0	627				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				ACCACAGGTAGCTTGCATCTG	0.512																																					p.S177R												.	.	0			c.C531A	19						.	G	ARG/SER,ARG/SER	1,4401		0,1,2200	266.0	261.0	263.0		165,531	0.2	0.0	19		263	0,8600		0,0,4300	no	missense,missense	PSG7	NM_001206650.1,NM_002783.2	110,110	0,1,6500	TT,TG,GG		0.0,0.0227,0.0077	,	55/298,177/420	43433772	1,13001	2201	4300	6501	48125612			5676	exon3					19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43433772G>T		Somatic		Capture	Illumina HiSeq	Phase_I	48125612	NM_002783	Q15232	Missense_Mutation	SNP	ENST00000406070.2	37																																																																																					0.512	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650	
MLLT1	4298	broad.mit.edu	37	19	6230614	6230614	+	Silent	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr19:6230614C>T	ENST00000252674.7	-	4	550	c.387G>A	c.(385-387)acG>acA	p.T129T		NM_005934.3	NP_005925.2	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1	129					negative regulation of protein kinase activity (GO:0006469)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)	p.T129T(1)		endometrium(3)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|skin(2)	17						ACCGGAACTCCGTGGTGGGGT	0.667			T	MLL	AL																																p.T129T			Dom	yes		19	19p13.3	4298	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 (ENL)"""		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G387A	19						.						110.0	109.0	109.0					19																	6230614		2203	4300	6503	6181614	SO:0001819	synonymous_variant	4298	exon4				CCDS12160.1	19p13.3	2012-10-04	2001-11-28		ENSG00000130382	ENSG00000130382			7134	protein-coding gene	gene with protein product		159556	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 1"""				Standard	XM_005259561		Approved	ENL, LTG19, YEATS1	uc002mek.3	Q03111	OTTHUMG00000180757	ENST00000252674.7:c.387G>A	19.37:g.6230614C>T		Somatic		Capture	Illumina HiSeq	Phase_I	6181614	NM_005934	Q14768	Silent	SNP	ENST00000252674.7	37	CCDS12160.1																																																																																				0.667	MLLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452909.1	NM_005934	
INSR	3643	broad.mit.edu	37	19	7126641	7126641	+	Silent	SNP	T	T	C			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr19:7126641T>C	ENST00000302850.5	-	16	3109	c.2967A>G	c.(2965-2967)ggA>ggG	p.G989G	INSR_ENST00000341500.5_Silent_p.G977G	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	989					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.G989G(2)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CGTAAAGCGGTCCCAGCGGCC	0.537																																					p.G989G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A2967G	19						.						55.0	42.0	46.0					19																	7126641		2199	4288	6487	7077641	SO:0001819	synonymous_variant	3643	exon16			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2967A>G	19.37:g.7126641T>C		Somatic		Capture	Illumina HiSeq	Phase_I	7077641	NM_000208	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	ENST00000302850.5	37	CCDS12176.1																																																																																				0.537	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
OLFM2	93145	broad.mit.edu	37	19	9965378	9965378	+	Silent	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr19:9965378G>A	ENST00000264833.4	-	6	1034	c.849C>T	c.(847-849)taC>taT	p.Y283Y	OLFM2_ENST00000590841.1_Silent_p.Y205Y	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	283	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)		p.Y283Y(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						CGTTGCTCTGGTACTTGTTAT	0.592																																					p.Y283Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C849T	19						.						69.0	65.0	67.0					19																	9965378		2203	4300	6503	9826378	SO:0001819	synonymous_variant	93145	exon6			AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.849C>T	19.37:g.9965378G>A		Somatic		Capture	Illumina HiSeq	Phase_I	9826378	NM_058164	Q6IMJ3|Q96FC2	Silent	SNP	ENST00000264833.4	37	CCDS12221.1																																																																																				0.592	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451119.1		
NLRP12	91662	broad.mit.edu	37	19	54313928	54313928	+	Missense_Mutation	SNP	G	G	A	rs147810259		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr19:54313928G>A	ENST00000324134.6	-	3	1153	c.985C>T	c.(985-987)Cgg>Tgg	p.R329W	NLRP12_ENST00000391773.1_Missense_Mutation_p.R329W|NLRP12_ENST00000354278.3_Missense_Mutation_p.R329W|NLRP12_ENST00000345770.5_Missense_Mutation_p.R329W|NLRP12_ENST00000535162.1_Missense_Mutation_p.R329W|NLRP12_ENST00000351894.4_Missense_Mutation_p.R329W|NLRP12_ENST00000391775.3_Missense_Mutation_p.R329W|NLRP12_ENST00000391772.1_Missense_Mutation_p.R329W	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	329	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.R329W(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		AGCTTCTTCCGAATTAAGCTG	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17089	0.0		0.0	False		,,,				2504	0.0				p.R329W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C985T	19						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	56.0	59.0	58.0		985	-4.9	0.0	19	dbSNP_134	58	0,8600		0,0,4300	no	missense	NLRP12	NM_144687.2	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	329/1062	54313928	1,13005	2203	4300	6503	59005740	SO:0001583	missense	91662	exon3			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.985C>T	19.37:g.54313928G>A	ENSP00000319377:p.Arg329Trp	Somatic		Capture	Illumina HiSeq	Phase_I	59005740	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.873651	0.51695	2.27E-4	0.0	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.47	-4.89	0.03103	NACHT nucleoside triphosphatase (1);	1.762690	0.03454	N	0.211125	D	0.89336	0.6686	M	0.88377	2.95	0.09310	N	1	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	P;P;P;D	0.63597	0.877;0.877;0.877;0.916	T	0.82170	-0.0590	10	0.87932	D	0	.	10.7793	0.46369	0.0:0.5885:0.1906:0.2209	.	329;329;329;329	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	W	329	ENSP00000319377:R329W;ENSP00000438030:R329W;ENSP00000340473:R329W;ENSP00000346231:R329W;ENSP00000375655:R329W;ENSP00000375653:R329W;ENSP00000375652:R329W	ENSP00000319377:R329W	R	-	1	2	NLRP12	59005740	0.000000	0.05858	0.046000	0.18839	0.612000	0.37316	-0.122000	0.10627	-0.213000	0.10094	0.306000	0.20318	CGG		0.572	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
PYGO2	90780	broad.mit.edu	37	1	154932027	154932028	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr1:154932027_154932028insG	ENST00000368457.2	-	3	619_620	c.448_449insC	c.(448-450)cagfs	p.Q150fs	PYGO2_ENST00000483463.1_5'Flank|RP11-307C12.12_ENST00000605085.1_RNA|PYGO2_ENST00000368456.1_Frame_Shift_Ins_p.Q113fs	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	150	Pro-rich.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)	p.Q150fs*27(2)		endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCCAGGACCCTGGGGGGGCATG	0.619																																					p.Q150fs	NSCLC(87;357 1460 1955 21029 23522)											.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.449_450insC	1						.																																			153198652	SO:0001589	frameshift_variant	90780	exon3			BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.449dupC	1.37:g.154932034_154932034dupG	ENSP00000357442:p.Gln150fs	Somatic		Capture	Illumina HiSeq	Phase_I	153198651	NM_138300	Q8WYZ4|Q96CY2	Frame_Shift_Ins	INS	ENST00000368457.2	37	CCDS1075.1																																																																																				0.619	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090949.1	NM_138300	
SORT1	6272	broad.mit.edu	37	1	109883374	109883374	+	Silent	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr1:109883374G>A	ENST00000256637.6	-	10	1294	c.1236C>T	c.(1234-1236)ggC>ggT	p.G412G	SORT1_ENST00000538502.1_Silent_p.G275G	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	412					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)	p.G412G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		TTATGTAGACGCCGCGGAGGG	0.547																																					p.G412G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1236T	1						.						165.0	129.0	141.0					1																	109883374		2203	4300	6503	109684897	SO:0001819	synonymous_variant	6272	exon10			BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1236C>T	1.37:g.109883374G>A		Somatic		Capture	Illumina HiSeq	Phase_I	109684897	NM_002959	B4DWI3|C0JYZ0|Q8IZ49	Silent	SNP	ENST00000256637.6	37	CCDS798.1																																																																																				0.547	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	NM_002959	
LRRC7	57554	broad.mit.edu	37	1	70505190	70505190	+	Missense_Mutation	SNP	C	C	T	rs372250538		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr1:70505190C>T	ENST00000035383.5	+	19	3599	c.3569C>T	c.(3568-3570)cCg>cTg	p.P1190L	LRRC7_ENST00000415775.2_Missense_Mutation_p.P474L|LRRC7_ENST00000310961.5_Missense_Mutation_p.P1195L	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1190						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.P1190L(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GGAAGTTTTCCGGTTAAAAAC	0.488																																					p.P1190L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3569T	1						.	C	LEU/PRO	0,4406		0,0,2203	58.0	57.0	57.0		3569	5.9	1.0	1		57	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRRC7	NM_020794.2	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1190/1538	70505190	1,13005	2203	4300	6503	70277778	SO:0001583	missense	57554	exon19				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.3569C>T	1.37:g.70505190C>T	ENSP00000035383:p.Pro1190Leu	Somatic		Capture	Illumina HiSeq	Phase_I	70277778	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.776324	0.31411	0.0	1.16E-4	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.40756	1.02;1.07;2.18	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.45597	0.1350	M	0.62723	1.935	0.80722	D	1	D;D;D	0.67145	0.958;0.996;0.993	B;P;P	0.54100	0.366;0.742;0.557	T	0.47971	-0.9075	10	0.87932	D	0	.	14.2268	0.65866	0.149:0.851:0.0:0.0	.	474;1190;1190	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	L	1195;1190;474;1013	ENSP00000309245:P1195L;ENSP00000035383:P1190L;ENSP00000394867:P474L	ENSP00000035383:P1190L	P	+	2	0	LRRC7	70277778	1.000000	0.71417	0.972000	0.41901	0.002000	0.02628	5.389000	0.66255	2.820000	0.97059	0.650000	0.86243	CCG		0.488	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
NEXN	91624	broad.mit.edu	37	1	78399084	78399084	+	Nonsense_Mutation	SNP	C	C	T	rs200106758		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr1:78399084C>T	ENST00000334785.7	+	10	1355	c.1171C>T	c.(1171-1173)Cga>Tga	p.R391*	NEXN_ENST00000330010.8_Nonsense_Mutation_p.R327*|NEXN_ENST00000480732.2_3'UTR|NEXN_ENST00000457030.1_Nonsense_Mutation_p.R377*	NM_144573.3	NP_653174.3			nexilin (F actin binding protein)									p.R391*(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				Colorectal(170;0.114)		AGAAGAAAAACGACGAACAGA	0.343																																					p.R391X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1171T	1						.	C	stop/ARG,stop/ARG	0,3630		0,0,1815	37.0	36.0	37.0		979,1171	2.7	1.0	1		37	1,8143		0,1,4071	yes	stop-gained,stop-gained	NEXN	NM_001172309.1,NM_144573.3	,	0,1,5886	TT,TC,CC		0.0123,0.0,0.0085	,	327/612,391/676	78399084	1,11773	1815	4072	5887	78171672	SO:0001587	stop_gained	91624	exon10			AK057954	CCDS41351.1, CCDS53335.1	1p31.1	2014-09-17			ENSG00000162614	ENSG00000162614		"""Immunoglobulin superfamily / I-set domain containing"""	29557	protein-coding gene	gene with protein product		613121				12053183, 8227983	Standard	NM_144573		Approved	nexilin, NELIN	uc001dic.4	Q0ZGT2	OTTHUMG00000040533	ENST00000334785.7:c.1171C>T	1.37:g.78399084C>T	ENSP00000333938:p.Arg391*	Somatic		Capture	Illumina HiSeq	Phase_I	78171672	NM_144573		Nonsense_Mutation	SNP	ENST00000334785.7	37	CCDS41351.1	.	.	.	.	.	.	.	.	.	.	C	34	5.313275	0.95655	0.0	1.23E-4	ENSG00000162614	ENST00000457030;ENST00000330010;ENST00000334785;ENST00000440324	.	.	.	5.93	2.69	0.31865	.	0.000000	0.43260	D	0.000599	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.3337	13.7243	0.62748	0.5011:0.4988:0.0:0.0	.	.	.	.	X	377;327;391;377	.	ENSP00000327363:R327X	R	+	1	2	NEXN	78171672	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	3.506000	0.53364	1.453000	0.47775	0.655000	0.94253	CGA		0.343	NEXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097549.1	NM_144573	
LPPR4	9890	broad.mit.edu	37	1	99771998	99771998	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr1:99771998G>A	ENST00000370185.3	+	7	2221	c.1724G>A	c.(1723-1725)cGa>cAa	p.R575Q	LPPR4_ENST00000370184.1_Missense_Mutation_p.R417Q|LPPR4_ENST00000457765.1_Missense_Mutation_p.R517Q	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		575					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.R575Q(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		AGCCAGCCCCGAATCATGCAA	0.552																																					p.R575Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1724A	1						.						58.0	59.0	59.0					1																	99771998		2203	4300	6503	99544586	SO:0001583	missense	9890	exon7																														ENST00000370185.3:c.1724G>A	1.37:g.99771998G>A	ENSP00000359204:p.Arg575Gln	Somatic		Capture	Illumina HiSeq	Phase_I	99544586	NM_014839	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	CCDS757.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.842575	0.91197	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000370184	T;T;T	0.33654	1.95;1.79;1.4	5.85	5.85	0.93711	.	0.123358	0.51477	D	0.000085	T	0.54175	0.1842	M	0.65975	2.015	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.83275	0.99;0.996	T	0.46261	-0.9204	9	.	.	.	-14.862	20.1634	0.98142	0.0:0.0:1.0:0.0	.	517;575	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	Q	575;517;417	ENSP00000359204:R575Q;ENSP00000394913:R517Q;ENSP00000359203:R417Q	.	R	+	2	0	RP4-788L13.1	99544586	1.000000	0.71417	0.967000	0.41034	0.990000	0.78478	7.528000	0.81941	2.773000	0.95371	0.655000	0.94253	CGA		0.552	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
NRAS	4893	broad.mit.edu	37	1	115256530	115256530	+	Missense_Mutation	SNP	G	G	T	rs121913254		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr1:115256530G>T	ENST00000369535.4	-	3	434	c.181C>A	c.(181-183)Caa>Aaa	p.Q61K		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61K(595)|p.Q61E(9)|p.Q61L(3)|p.Q61R(2)|p.G60>?(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACTCTTCTTGTCCAGCTGTA	0.458	Q61K(CHP212_AUTONOMIC_GANGLIA)|Q61K(HCC15_LUNG)|Q61K(HS936T_SKIN)|Q61K(HS944T_SKIN)|Q61K(HT1080_SOFT_TISSUE)|Q61K(HUT78_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(M07E_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(NCIH1299_LUNG)|Q61K(NCIH2087_LUNG)|Q61K(OCILY19_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(SKNAS_AUTONOMIC_GANGLIA)|Q61K(SKNSH_AUTONOMIC_GANGLIA)|Q61K(TYKNU_OVARY)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61K			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	610	Substitution - Missense(609)|Complex(1)	skin(372)|haematopoietic_and_lymphoid_tissue(73)|thyroid(55)|NS(29)|large_intestine(28)|soft_tissue(16)|lung(12)|autonomic_ganglia(6)|liver(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|cervix(2)|endometrium(2)|pancreas(2)|meninges(1)|kidney(1)|biliary_tract(1)|stomach(1)|ovary(1)|bone(1)	c.C181A	1						.						180.0	156.0	164.0					1																	115256530		2203	4300	6503	115058053	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.181C>A	1.37:g.115256530G>T	ENSP00000358548:p.Gln61Lys	Somatic		Capture	Illumina HiSeq	Phase_I	115058053	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	G	33	5.255564	0.95336	.	.	ENSG00000213281	ENST00000369535	D	0.83506	-1.73	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.91845	0.7419	H	0.95850	3.73	0.80722	D	1	P	0.51791	0.948	P	0.54759	0.76	D	0.93711	0.7024	10	0.62326	D	0.03	.	18.6626	0.91477	0.0:0.0:1.0:0.0	.	61	P01111	RASN_HUMAN	K	61	ENSP00000358548:Q61K	ENSP00000358548:Q61K	Q	-	1	0	NRAS	115058053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.520000	0.98027	2.624000	0.88883	0.655000	0.94253	CAA		0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
NBPF20	100288142	broad.mit.edu	37	1	148342469	148342469	+	Splice_Site	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr1:148342469C>T	ENST00000369202.1	-	5	764		c.e5+1		NBPF20_ENST00000414710.2_Splice_Site			Q3BBV1	NBPFK_HUMAN	neuroblastoma breakpoint family, member 20							cytoplasm (GO:0005737)		p.?(1)		breast(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	27						TTCAGTGTTACCTGGGGGCAG	0.433																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	1						.						250.0	313.0	291.0					1																	148342469		1510	2707	4217	146709093	SO:0001630	splice_region_variant	200030	.				CCDS72856.1	1q21.2	2014-01-16			ENSG00000203832			"""neuroblastoma breakpoint family"""	32000	protein-coding gene	gene with protein product		614007				16079250	Standard	NM_001278267		Approved			Q3BBV1	OTTHUMG00000042439	ENST00000369202.1:c.566+1G>A	1.37:g.148342469C>T		Somatic		Capture	Illumina HiSeq	Phase_I	146709093	.		Splice_Site	SNP	ENST00000369202.1	37		.	.	.	.	.	.	.	.	.	.	.	3.313	-0.140486	0.06669	.	.	ENSG00000203832	ENST00000369202;ENST00000369188;ENST00000369189;ENST00000414710	.	.	.	0.386	0.386	0.16254	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	-	.	.	NBPF20	146709093	0.996000	0.38824	0.018000	0.16275	0.130000	0.20726	0.761000	0.26489	0.455000	0.26910	0.184000	0.17185	.		0.433	NBPF20-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000100689.2		Intron
BPIFA3	128861	broad.mit.edu	37	20	31811736	31811736	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr20:31811736G>A	ENST00000375454.3	+	2	457	c.247G>A	c.(247-249)Ggc>Agc	p.G83S	BPIFA3_ENST00000375452.3_Missense_Mutation_p.G83S|BPIFA3_ENST00000490499.1_3'UTR	NM_178466.3	NP_848561.2	Q9BQP9	BPIA3_HUMAN	BPI fold containing family A, member 3	83						extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.G83S(1)									GCTAATCAGCGGCAGGAAACA	0.542																																					p.G83S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G247A	20						.						80.0	69.0	73.0					20																	31811736		2203	4300	6503	31275397	SO:0001583	missense	128861	exon2				CCDS13216.2, CCDS42865.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131059	ENSG00000131059		"""BPI fold containing"""	16204	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 71"""	C20orf71		11971875, 21787333	Standard	XR_244132		Approved	bA49G10.4, SPLUNC3	uc002wyr.3	Q9BQP9	OTTHUMG00000032245	ENST00000375454.3:c.247G>A	20.37:g.31811736G>A	ENSP00000364603:p.Gly83Ser	Somatic		Capture	Illumina HiSeq	Phase_I	31275397	NM_178466	Q5JWG8|Q6NZ38	Missense_Mutation	SNP	ENST00000375454.3	37	CCDS13216.2	.	.	.	.	.	.	.	.	.	.	G	8.071	0.770172	0.15983	.	.	ENSG00000131059	ENST00000375454;ENST00000375452	T;T	0.21361	2.01;3.29	4.27	-0.239	0.13050	.	0.424841	0.20123	N	0.098769	T	0.06416	0.0165	N	0.08118	0	0.09310	N	1	P;B	0.36249	0.545;0.401	B;B	0.30572	0.083;0.117	T	0.39563	-0.9608	10	0.07030	T	0.85	-8.2757	6.7658	0.23566	0.6167:0.0:0.3833:0.0	.	83;83	Q9BQP9-2;Q9BQP9	.;BPIA3_HUMAN	S	83	ENSP00000364603:G83S;ENSP00000364601:G83S	ENSP00000364601:G83S	G	+	1	0	BPIFA3	31275397	0.004000	0.15560	0.011000	0.14972	0.001000	0.01503	0.206000	0.17375	-0.027000	0.13873	-0.749000	0.03505	GGC		0.542	BPIFA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078672.1	NM_178466	
SLC32A1	140679	broad.mit.edu	37	20	37356447	37356447	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr20:37356447C>T	ENST00000217420.1	+	2	1006	c.743C>T	c.(742-744)aCg>aTg	p.T248M		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	248					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.T248M(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	ATTATCGCCACGGCCGTGCTG	0.577																																					p.T248M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C743T	20						.						104.0	74.0	84.0					20																	37356447		2203	4300	6503	36789861	SO:0001583	missense	140679	exon2			AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.743C>T	20.37:g.37356447C>T	ENSP00000217420:p.Thr248Met	Somatic		Capture	Illumina HiSeq	Phase_I	36789861	NM_080552	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.714462	0.68730	.	.	ENSG00000101438	ENST00000217420	T	0.02446	4.29	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.11153	0.0272	L	0.55481	1.735	0.80722	D	1	D	0.71674	0.998	D	0.70016	0.967	T	0.06092	-1.0846	10	0.36615	T	0.2	-22.0914	15.8477	0.78903	0.0:1.0:0.0:0.0	.	248	Q9H598	VIAAT_HUMAN	M	248	ENSP00000217420:T248M	ENSP00000217420:T248M	T	+	2	0	SLC32A1	36789861	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.725000	0.84808	2.428000	0.82296	0.563000	0.77884	ACG		0.577	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
TSHZ2	128553	broad.mit.edu	37	20	51872931	51872931	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr20:51872931G>C	ENST00000371497.5	+	2	3821	c.2934G>C	c.(2932-2934)caG>caC	p.Q978H	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Missense_Mutation_p.Q975H|TSHZ2_ENST00000329613.6_Missense_Mutation_p.Q975H	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	978					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q978H(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CGTCGGCTCAGAGGTCTCCAG	0.493																																					p.Q978H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2934C	20						.						76.0	65.0	69.0					20																	51872931		2203	4300	6503	51306338	SO:0001583	missense	128553	exon2			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2934G>C	20.37:g.51872931G>C	ENSP00000360552:p.Gln978His	Somatic		Capture	Illumina HiSeq	Phase_I	51306338	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	G	9.724	1.160459	0.21454	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.14516	2.5;2.5	5.7	2.41	0.29592	.	0.053472	0.64402	D	0.000001	T	0.04724	0.0128	N	0.03608	-0.345	0.35046	D	0.760221	B	0.12630	0.006	B	0.09377	0.004	T	0.17379	-1.0371	10	0.49607	T	0.09	-6.2825	2.568	0.04788	0.4111:0.0:0.3744:0.2145	.	978	Q9NRE2	TSH2_HUMAN	H	978;975;504	ENSP00000360552:Q978H;ENSP00000333114:Q975H	ENSP00000333114:Q975H	Q	+	3	2	TSHZ2	51306338	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.674000	0.37544	0.769000	0.33313	0.643000	0.83706	CAG		0.493	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
PDGFB	5155	broad.mit.edu	37	22	39621782	39621782	+	Silent	SNP	C	C	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr22:39621782C>A	ENST00000331163.6	-	6	1459	c.672G>T	c.(670-672)cgG>cgT	p.R224R	PDGFB_ENST00000381551.4_Silent_p.R209R	NM_002608.2	NP_002599.1	P01127	PDGFB_HUMAN	platelet-derived growth factor beta polypeptide	224					actin cytoskeleton organization (GO:0030036)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|branching involved in salivary gland morphogenesis (GO:0060445)|cell chemotaxis (GO:0060326)|cell growth (GO:0016049)|cell projection assembly (GO:0030031)|cellular response to growth factor stimulus (GO:0071363)|cellular response to mycophenolic acid (GO:0071506)|DNA replication (GO:0006260)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|metanephric glomerular endothelium development (GO:0072264)|metanephric glomerular mesangial cell development (GO:0072255)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|monocyte chemotaxis (GO:0002548)|negative regulation of cell migration (GO:0030336)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|paracrine signaling (GO:0038001)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of metanephric mesenchymal cell migration (GO:2000591)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to wounding (GO:0009611)|substrate-dependent cell migration (GO:0006929)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|collagen binding (GO:0005518)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|superoxide-generating NADPH oxidase activator activity (GO:0016176)	p.R224R(2)|p.R209R(1)	COL1A1/PDGFB(429)	central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Melanoma(58;0.04)					GCTTGAATTTCCGGTGCTTGC	0.622			T	COL1A1	DFSP																																p.R209R			Dom	yes		22	22q12.3-q13.1	5155	platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)		M	.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G627T	22						.						170.0	126.0	141.0					22																	39621782		2203	4300	6503	37951728	SO:0001819	synonymous_variant	5155	exon6				CCDS13987.1, CCDS33650.1	22q13.1	2012-10-02	2011-05-19		ENSG00000100311	ENSG00000100311			8800	protein-coding gene	gene with protein product	"""oncogene SIS"", ""becaplermin"""	190040	"""platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)"""	SIS		2991848, 1661670	Standard	NM_002608		Approved	SSV	uc003axf.3	P01127	OTTHUMG00000151029	ENST00000331163.6:c.672G>T	22.37:g.39621782C>A		Somatic		Capture	Illumina HiSeq	Phase_I	37951728	NM_033016	G3XAG8|P78431|Q15354|Q6FHE7|Q9UF23	Silent	SNP	ENST00000331163.6	37	CCDS13987.1																																																																																				0.622	PDGFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321043.1	NM_002608	
POLR1A	25885	broad.mit.edu	37	2	86333064	86333065	+	5'UTR	INS	-	-	G			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr2:86333064_86333065insG	ENST00000263857.6	-	0	213_214				PTCD3_ENST00000254630.7_5'Flank|PTCD3_ENST00000409277.3_5'Flank|POLR1A_ENST00000409681.1_5'UTR			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa						gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						CACTTCTACATGGGGGGGGAAC	0.446																																					.												.	.	0			.	2						.																																			86186576	SO:0001623	5_prime_UTR_variant	25885	.			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.-166->C	2.37:g.86333072_86333072dupG		None		Capture	Illumina HiSeq	Phase_I	86186575	.	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	De_novo_Start_OutOfFrame	INS	ENST00000263857.6	37	CCDS42706.1																																																																																				0.446	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
SNTG2	54221	broad.mit.edu	37	2	1204905	1204905	+	Silent	SNP	G	G	A	rs202059053		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr2:1204905G>A	ENST00000308624.5	+	9	837	c.708G>A	c.(706-708)acG>acA	p.T236T	SNTG2_ENST00000407292.1_Silent_p.T109T|SNTG2_ENST00000467759.1_3'UTR	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	236					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)	p.T236T(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		AAGCCGGAACGGAAAAATTAA	0.542																																					p.T236T												.	.	2	Substitution - coding silent(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.G708A	2						.	G		0,3896		0,0,1948	137.0	142.0	140.0		708	-4.0	0.0	2		140	2,8314		0,2,4156	no	coding-synonymous	SNTG2	NM_018968.3		0,2,6104	AA,AG,GG		0.0241,0.0,0.0164		236/540	1204905	2,12210	1948	4158	6106	1194905	SO:0001819	synonymous_variant	54221	exon9			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.708G>A	2.37:g.1204905G>A		Somatic		Capture	Illumina HiSeq	Phase_I	1194905	NM_018968	Q05AH5	Silent	SNP	ENST00000308624.5	37	CCDS46220.1																																																																																				0.542	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
ALK	238	broad.mit.edu	37	2	29606700	29606700	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr2:29606700C>T	ENST00000389048.3	-	5	2086	c.1180G>A	c.(1180-1182)Ggg>Agg	p.G394R	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	394	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G394R(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	TCTGGACGCCCGATTCTTCCC	0.498			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.G394R		yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1180A	2						.						113.0	109.0	110.0					2																	29606700		2203	4300	6503	29460204	SO:0001583	missense	238	exon5	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.1180G>A	2.37:g.29606700C>T	ENSP00000373700:p.Gly394Arg	Somatic		Capture	Illumina HiSeq	Phase_I	29460204	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356283	0.61293	.	.	ENSG00000171094	ENST00000389048	T	0.02067	4.47	6.02	6.02	0.97574	Concanavalin A-like lectin/glucanase (1);MAM domain (2);	0.000000	0.36034	N	0.002836	T	0.05777	0.0151	N	0.14661	0.345	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.63377	-0.6651	9	.	.	.	.	17.6932	0.88275	0.0:1.0:0.0:0.0	.	394	Q9UM73	ALK_HUMAN	R	394	ENSP00000373700:G394R	.	G	-	1	0	ALK	29460204	1.000000	0.71417	1.000000	0.80357	0.164000	0.22412	4.731000	0.62022	2.857000	0.98124	0.650000	0.86243	GGG		0.498	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
ZBTB11	27107	broad.mit.edu	37	3	101384531	101384531	+	Silent	SNP	G	G	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:101384531G>T	ENST00000312938.4	-	4	1480	c.900C>A	c.(898-900)gtC>gtA	p.V300V		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	300					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V300V(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AAATCTCTAAGACTTCTGACA	0.393																																					p.V300V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C900A	3						.						94.0	95.0	94.0					3																	101384531		2203	4300	6503	102867221	SO:0001819	synonymous_variant	27107	exon4			U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.900C>A	3.37:g.101384531G>T		Somatic		Capture	Illumina HiSeq	Phase_I	102867221	NM_014415	Q2NKP9	Silent	SNP	ENST00000312938.4	37	CCDS2943.1																																																																																				0.393	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
TF	7018	broad.mit.edu	37	3	133494435	133494435	+	Missense_Mutation	SNP	G	G	A	rs146055081		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:133494435G>A	ENST00000402696.3	+	15	2331	c.1846G>A	c.(1846-1848)Gtc>Atc	p.V616I	TF_ENST00000264998.3_Missense_Mutation_p.V489I	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	616	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)	p.V616I(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	GGAAGCTTGCGTCCACAAGAT	0.527																																					p.V616I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1846A	3						.	G	ILE/VAL	0,4406		0,0,2203	140.0	133.0	135.0		1846	4.9	0.1	3	dbSNP_134	135	1,8599	1.2+/-3.3	0,1,4299	no	missense	TF	NM_001063.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	616/699	133494435	1,13005	2203	4300	6503	134977125	SO:0001583	missense	7018	exon15				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.1846G>A	3.37:g.133494435G>A	ENSP00000385834:p.Val616Ile	Somatic		Capture	Illumina HiSeq	Phase_I	134977125	NM_001063	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	ENST00000402696.3	37	CCDS3080.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778570	0.49786	0.0	1.16E-4	ENSG00000091513	ENST00000402696;ENST00000264998	T;T	0.25749	1.78;1.78	4.92	4.92	0.64577	.	0.117432	0.56097	D	0.000027	T	0.24314	0.0589	L	0.42581	1.335	0.58432	D	0.999997	P;P	0.39391	0.671;0.468	B;B	0.36030	0.216;0.156	T	0.02893	-1.1097	10	0.39692	T	0.17	-31.4077	17.0524	0.86523	0.0:0.0:1.0:0.0	.	342;616	B4DHZ6;P02787	.;TRFE_HUMAN	I	616;489	ENSP00000385834:V616I;ENSP00000264998:V489I	ENSP00000264998:V489I	V	+	1	0	TF	134977125	1.000000	0.71417	0.054000	0.19295	0.002000	0.02628	5.382000	0.66213	2.556000	0.86216	0.491000	0.48974	GTC		0.527	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317775.1	NM_001063	
CLSTN2	64084	broad.mit.edu	37	3	140275464	140275464	+	Missense_Mutation	SNP	C	C	T	rs368537354		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:140275464C>T	ENST00000458420.3	+	11	1974	c.1784C>T	c.(1783-1785)aCg>aTg	p.T595M		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	595					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.T595M(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CAGTTCCCAACGGCGGGTGTG	0.572										HNSCC(16;0.037)																											p.T595M	GBM(45;858 913 3709 36904 37282)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1784T	3						.	C	MET/THR	0,4406		0,0,2203	114.0	102.0	106.0		1784	5.4	0.1	3		106	1,8599	1.2+/-3.3	0,1,4299	no	missense	CLSTN2	NM_022131.2	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	595/956	140275464	1,13005	2203	4300	6503	141758154	SO:0001583	missense	64084	exon11			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1784C>T	3.37:g.140275464C>T	ENSP00000402460:p.Thr595Met	Somatic		Capture	Illumina HiSeq	Phase_I	141758154	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.547528	0.65311	0.0	1.16E-4	ENSG00000158258	ENST00000458420	T	0.35973	1.28	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.65176	0.2666	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.68526	-0.5385	9	.	.	.	-12.9896	16.9972	0.86371	0.0:1.0:0.0:0.0	.	595	Q9H4D0	CSTN2_HUMAN	M	595	ENSP00000402460:T595M	.	T	+	2	0	CLSTN2	141758154	1.000000	0.71417	0.082000	0.20525	0.276000	0.26787	7.776000	0.85560	2.692000	0.91855	0.563000	0.77884	ACG		0.572	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
OTOL1	131149	broad.mit.edu	37	3	161221480	161221480	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:161221480C>T	ENST00000327928.4	+	4	1184	c.1184C>T	c.(1183-1185)aCg>aTg	p.T395M		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	395	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)		p.T395M(1)		central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						TACCATATTACGGTGAGGGGG	0.448																																					p.T395M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1184T	3						.						59.0	53.0	55.0					3																	161221480		1930	4123	6053	162704174	SO:0001583	missense	131149	exon4				CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.1184C>T	3.37:g.161221480C>T	ENSP00000330808:p.Thr395Met	Somatic		Capture	Illumina HiSeq	Phase_I	162704174	NM_001080440		Missense_Mutation	SNP	ENST00000327928.4	37	CCDS46948.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868355	0.51588	.	.	ENSG00000182447	ENST00000327928	T	0.76060	-0.99	5.23	5.23	0.72850	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.86531	0.5955	M	0.78049	2.395	0.50632	D	0.999887	D	0.89917	1.0	D	0.97110	1.0	D	0.87953	0.2725	10	0.66056	D	0.02	.	17.3955	0.87444	0.0:1.0:0.0:0.0	.	395	A6NHN0	OTOL1_HUMAN	M	395	ENSP00000330808:T395M	ENSP00000330808:T395M	T	+	2	0	OTOL1	162704174	1.000000	0.71417	0.030000	0.17652	0.686000	0.39977	7.534000	0.82004	2.427000	0.82271	0.557000	0.71058	ACG		0.448	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440	
TTC14	151613	broad.mit.edu	37	3	180328082	180328082	+	Missense_Mutation	SNP	G	G	A	rs150698778		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:180328082G>A	ENST00000296015.4	+	12	2197	c.2065G>A	c.(2065-2067)Gct>Act	p.A689T	TTC14_ENST00000412756.2_3'UTR|TTC14_ENST00000382584.4_Intron	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	689							RNA binding (GO:0003723)	p.A689T(1)|p.A689S(1)		endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CAAAAAATACGCTCACTCTGG	0.408																																					p.A689T												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G2065A	3						.	G	,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	73.0	76.0	75.0		,2065	-5.8	0.0	3	dbSNP_134	75	0,8598		0,0,4299	no	utr-3,missense	TTC14	NM_001042601.2,NM_133462.3	,58	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,benign	,689/771	180328082	1,13003	2203	4299	6502	181810776	SO:0001583	missense	151613	exon12			AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.2065G>A	3.37:g.180328082G>A	ENSP00000296015:p.Ala689Thr	Somatic		Capture	Illumina HiSeq	Phase_I	181810776	NM_133462	G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	CCDS3237.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.687838	0.00738	2.27E-4	0.0	ENSG00000163728	ENST00000296015	T	0.16897	2.31	6.04	-5.82	0.02333	.	1.266050	0.05007	N	0.470222	T	0.05777	0.0151	N	0.12182	0.205	0.09310	N	1	B	0.25521	0.128	B	0.18561	0.022	T	0.33650	-0.9860	10	0.02654	T	1	0.706	3.8579	0.08984	0.3013:0.1911:0.4054:0.1022	.	689	Q96N46	TTC14_HUMAN	T	689	ENSP00000296015:A689T	ENSP00000296015:A689T	A	+	1	0	TTC14	181810776	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.282000	0.08445	-0.579000	0.05952	-0.339000	0.08088	GCT		0.408	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462	
LRRC3B	116135	broad.mit.edu	37	3	26751178	26751178	+	Silent	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:26751178C>T	ENST00000396641.2	+	2	607	c.15C>T	c.(13-15)gaC>gaT	p.D5D	LRRC3B_ENST00000456208.2_Silent_p.D5D|LRRC3B_ENST00000417744.1_Silent_p.D5D|AC114877.3_ENST00000446601.1_lincRNA	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	5						integral component of membrane (GO:0016021)		p.D5D(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						ATCTGGTAGACCTGTGGTTAA	0.473																																					p.D5D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C15T	3						.						185.0	177.0	180.0					3																	26751178		2203	4300	6503	26726182	SO:0001819	synonymous_variant	116135	exon2			AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.15C>T	3.37:g.26751178C>T		Somatic		Capture	Illumina HiSeq	Phase_I	26726182	NM_052953	Q5M8T0	Silent	SNP	ENST00000396641.2	37	CCDS2644.1																																																																																				0.473	LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252997.2	NM_052953	
FBXL2	25827	broad.mit.edu	37	3	33400494	33400494	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:33400494G>A	ENST00000542085.1	+	0	312				FBXL2_ENST00000507198.1_Missense_Mutation_p.R34Q|FBXL2_ENST00000283627.6_Intron|FBXL2_ENST00000446237.3_De_novo_Start_OutOfFrame|FBXL2_ENST00000538892.1_Missense_Mutation_p.R34Q|FBXL2_ENST00000538181.1_Intron|FBXL2_ENST00000484457.1_Missense_Mutation_p.R34Q					F-box and leucine-rich repeat protein 2									p.R34Q(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|urinary_tract(1)	15						ACTTTGTGCCGATGTGCACAG	0.289																																					p.R34Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G101A	3						.						46.0	46.0	46.0					3																	33400494		2200	4296	6496	33375498			25827	exon3			AF174589	CCDS2658.1, CCDS54560.1	3p22.3	2011-06-09			ENSG00000153558	ENSG00000153558		"""F-boxes / Leucine-rich repeats"""	13598	protein-coding gene	gene with protein product		605652				10508920, 10531035	Standard	NM_012157		Approved	FBL2, FBL3	uc003cfp.3	Q9UKC9	OTTHUMG00000130745	ENST00000542085.1:c.-770G>A	3.37:g.33400494G>A		Somatic		Capture	Illumina HiSeq	Phase_I	33375498	NM_001171713		Missense_Mutation	SNP	ENST00000542085.1	37		.	.	.	.	.	.	.	.	.	.	G	35	5.442150	0.96187	.	.	ENSG00000153558	ENST00000484457;ENST00000538892;ENST00000507198	T;T;T	0.50548	0.74;0.74;0.74	5.45	5.45	0.79879	F-box domain, cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.70202	0.3197	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.71879	-0.4459	10	0.66056	D	0.02	.	17.9385	0.89020	0.0:0.0:1.0:0.0	.	34	Q9UKC9	FBXL2_HUMAN	Q	34	ENSP00000417601:R34Q;ENSP00000441228:R34Q;ENSP00000426163:R34Q	ENSP00000408895:R34Q	R	+	2	0	FBXL2	33375498	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.265000	0.89869	2.941000	0.99782	0.655000	0.94253	CGA		0.289	FBXL2-204	KNOWN	basic	protein_coding	protein_coding		NM_012157	
TRANK1	9881	broad.mit.edu	37	3	36898485	36898485	+	Nonsense_Mutation	SNP	G	G	A	rs535417879		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:36898485G>A	ENST00000429976.2	-	12	2843	c.2596C>T	c.(2596-2598)Cga>Tga	p.R866*	TRANK1_ENST00000301807.6_Nonsense_Mutation_p.R316*|TRANK1_ENST00000428977.2_Nonsense_Mutation_p.R316*	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	866							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)	p.R316*(2)|p.R866*(1)		NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TCACTGCATCGAGGGGAGAAG	0.537																																					p.R866X												.	.	3	Substitution - Nonsense(3)	large_intestine(3)	c.C2596T	3						.						48.0	45.0	46.0					3																	36898485		1963	4181	6144	36873489	SO:0001587	stop_gained	9881	exon12			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.2596C>T	3.37:g.36898485G>A	ENSP00000416168:p.Arg866*	Somatic		Capture	Illumina HiSeq	Phase_I	36873489	NM_014831	Q8N8K0	Nonsense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	G	38	7.242719	0.98157	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	.	.	.	5.51	4.62	0.57501	.	0.000000	0.53938	D	0.000059	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8672	0.79074	0.0:0.0:0.8633:0.1367	.	.	.	.	X	316;866;316	.	ENSP00000301807:R316X	R	-	1	2	TRANK1	36873489	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	5.743000	0.68655	1.435000	0.47434	0.561000	0.74099	CGA		0.537	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
RHOA	387	broad.mit.edu	37	3	49394944	49394944	+	IGR	SNP	G	G	C			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:49394944G>C	ENST00000418115.1	-	0	2031				GPX1_ENST00000496791.1_5'Flank|GPX1_ENST00000419783.1_Missense_Mutation_p.N163K|GPX1_ENST00000419349.1_3'UTR	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.N163K(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		ACTTCTCAAAGTTCCAGGCAA	0.627																																					p.N163K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C489G	3						.						44.0	47.0	46.0					3																	49394944		2004	4164	6168	49369948	SO:0001628	intergenic_variant	2876	exon2			BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49394944G>C		Somatic		Capture	Illumina HiSeq	Phase_I	49369948	NM_000581	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.583866	0.65992	.	.	ENSG00000233276	ENST00000419783	T	0.05199	3.48	5.4	0.479	0.16796	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.30854	0.0778	H	0.95816	3.725	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.30208	-0.9986	10	0.87932	D	0	.	9.8605	0.41112	0.36:0.0:0.64:0.0	.	163	P07203	GPX1_HUMAN	K	163	ENSP00000407375:N163K	ENSP00000407375:N163K	N	-	3	2	GPX1	49369948	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	2.029000	0.41098	0.261000	0.21753	-0.291000	0.09656	AAC		0.627	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
LRTM1	57408	broad.mit.edu	37	3	54958795	54958795	+	Missense_Mutation	SNP	G	G	A	rs149325578		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:54958795G>A	ENST00000273286.5	-	2	617	c.455C>T	c.(454-456)gCg>gTg	p.A152V	CACNA2D3_ENST00000415676.2_Intron|LRTM1_ENST00000493075.1_Missense_Mutation_p.A76V|CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000490478.1_Intron|CACNA2D3_ENST00000288197.5_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	152						integral component of membrane (GO:0016021)		p.A152V(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		TTGTTGAACCGCAAGTATAGT	0.488																																					p.A152V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C455T	3						.						101.0	97.0	99.0					3																	54958795		2203	4300	6503	54933835	SO:0001583	missense	57408	exon2			AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.455C>T	3.37:g.54958795G>A	ENSP00000273286:p.Ala152Val	Somatic		Capture	Illumina HiSeq	Phase_I	54933835	NM_020678	Q8IUU2	Missense_Mutation	SNP	ENST00000273286.5	37	CCDS2876.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976415	0.74360	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	T;D	0.89810	4.33;-2.57	5.96	5.96	0.96718	.	0.228502	0.45606	D	0.000345	D	0.89986	0.6874	N	0.16307	0.4	0.34492	D	0.705051	D	0.89917	1.0	D	0.68353	0.957	D	0.90572	0.4523	10	0.33141	T	0.24	.	20.4123	0.99019	0.0:0.0:1.0:0.0	.	152	Q9HBL6	LRTM1_HUMAN	V	152;76	ENSP00000273286:A152V;ENSP00000419772:A76V	ENSP00000273286:A152V	A	-	2	0	LRTM1	54933835	0.991000	0.36638	0.887000	0.34795	0.574000	0.36063	4.737000	0.62066	2.824000	0.97209	0.655000	0.94253	GCG		0.488	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351399.1	NM_020678	
ROBO1	6091	broad.mit.edu	37	3	78711202	78711202	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:78711202C>A	ENST00000464233.1	-	15	2142	c.2029G>T	c.(2029-2031)Gtt>Ttt	p.V677F	ROBO1_ENST00000495273.1_Missense_Mutation_p.V641F|ROBO1_ENST00000436010.2_Missense_Mutation_p.V638F|ROBO1_ENST00000467549.1_Missense_Mutation_p.V641F	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	677	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.V654F(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AGGTGCAGAACAGCATTTCCC	0.483																																					p.V677F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2029T	3						.						88.0	97.0	94.0					3																	78711202		1977	4154	6131	78793892	SO:0001583	missense	6091	exon15			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2029G>T	3.37:g.78711202C>A	ENSP00000420321:p.Val677Phe	Somatic		Capture	Illumina HiSeq	Phase_I	78793892	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.143520	0.77888	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.62639	0.03;0.01;0.01;0.08	5.31	5.31	0.75309	Fibronectin, type III (3);	0.054018	0.64402	D	0.000001	T	0.76962	0.4061	M	0.64997	1.995	0.58432	D	0.999999	P;P;D;D;D;D	0.63880	0.904;0.932;0.992;0.993;0.969;0.961	P;D;D;D;D;P	0.68483	0.625;0.924;0.958;0.954;0.924;0.875	T	0.76066	-0.3095	9	.	.	.	.	18.9628	0.92682	0.0:1.0:0.0:0.0	.	641;641;677;641;641;638	Q9Y6N7-3;Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;.;ROBO1_HUMAN;.;.;.	F	638;641;677;641;641;681	ENSP00000406043:V638F;ENSP00000420321:V677F;ENSP00000420637:V641F;ENSP00000417992:V641F	.	V	-	1	0	ROBO1	78793892	0.999000	0.42202	0.778000	0.31720	0.694000	0.40290	4.018000	0.57174	2.456000	0.83038	0.555000	0.69702	GTT		0.483	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
CLCN2	1181	broad.mit.edu	37	3	184076771	184076771	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr3:184076771C>T	ENST00000265593.4	-	2	383	c.212G>A	c.(211-213)cGa>cAa	p.R71Q	CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000434054.2_Missense_Mutation_p.R71Q|POLR2H_ENST00000456318.1_5'Flank|CLCN2_ENST00000423355.2_5'UTR|CLCN2_ENST00000457512.1_Missense_Mutation_p.R71Q|POLR2H_ENST00000438240.1_5'Flank|CLCN2_ENST00000344937.7_Missense_Mutation_p.R71Q|EIF2B5_ENST00000444495.1_Intron	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	71					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)	p.R71Q(1)		breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	ACCGCGGCATCGGGCGCAACG	0.652																																					p.R71Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G212A	3						.						42.0	48.0	46.0					3																	184076771		2203	4299	6502	185559465	SO:0001583	missense	1181	exon2			S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.212G>A	3.37:g.184076771C>T	ENSP00000265593:p.Arg71Gln	Somatic		Capture	Illumina HiSeq	Phase_I	185559465	NM_004366	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	c	2.596	-0.293989	0.05568	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	4.6	-4.12	0.03916	Chloride channel, core (1);	0.437392	0.20342	N	0.094206	T	0.71796	0.3382	L	0.43152	1.355	0.19775	N	0.99996	P;P;P;P;P	0.46656	0.882;0.607;0.607;0.727;0.607	B;B;B;B;B	0.38683	0.279;0.054;0.033;0.072;0.033	T	0.67484	-0.5659	10	0.59425	D	0.04	1.812	11.6409	0.51233	0.0:0.2963:0.5185:0.1852	.	71;71;71;71;71	B4DYE3;E9PBD9;E9PCD2;P51788-3;P51788	.;.;.;.;CLCN2_HUMAN	Q	71	ENSP00000265593:R71Q;ENSP00000345056:R71Q;ENSP00000400425:R71Q;ENSP00000391928:R71Q	ENSP00000265593:R71Q	R	-	2	0	CLCN2	185559465	0.203000	0.23435	0.000000	0.03702	0.298000	0.27526	0.352000	0.20113	-1.719000	0.01382	-1.134000	0.01955	CGA		0.652	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
FAT4	79633	broad.mit.edu	37	4	126336306	126336306	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr4:126336306C>A	ENST00000394329.3	+	5	6201	c.6188C>A	c.(6187-6189)aCa>aAa	p.T2063K	FAT4_ENST00000335110.5_Missense_Mutation_p.T361K	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2063	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T2063K(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCAGAAAATACACCTATTGAT	0.398																																					p.T2063K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C6188A	4						.						148.0	149.0	149.0					4																	126336306		2203	4300	6503	126555756	SO:0001583	missense	79633	exon5			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6188C>A	4.37:g.126336306C>A	ENSP00000377862:p.Thr2063Lys	Somatic		Capture	Illumina HiSeq	Phase_I	126555756	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	19.38	3.817245	0.70912	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.50813	0.73;0.73	5.0	5.0	0.66597	Cadherin (3);Cadherin-like (1);	0.000000	0.35235	U	0.003348	T	0.63094	0.2482	L	0.54965	1.715	0.58432	D	0.999999	D;D	0.69078	0.997;0.996	D;D	0.83275	0.991;0.996	T	0.56733	-0.7930	10	0.15499	T	0.54	.	18.3262	0.90255	0.0:1.0:0.0:0.0	.	361;2063	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	K	2063;361	ENSP00000377862:T2063K;ENSP00000335169:T361K	ENSP00000335169:T361K	T	+	2	0	FAT4	126555756	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.807000	0.69157	2.308000	0.77769	0.557000	0.71058	ACA		0.398	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
TBC1D9	23158	broad.mit.edu	37	4	141598057	141598057	+	Silent	SNP	C	C	T	rs376544697		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr4:141598057C>T	ENST00000442267.2	-	6	1124	c.1050G>A	c.(1048-1050)ccG>ccA	p.P350P		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	350	GRAM 2.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.P350P(2)		endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CCTCACGGAGCGGGATAATGA	0.353																																					p.P350P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1050A	4						.	C		0,3718		0,0,1859	78.0	73.0	74.0		1050	-10.2	0.7	4		74	1,8199		0,1,4099	no	coding-synonymous	TBC1D9	NM_015130.2		0,1,5958	TT,TC,CC		0.0122,0.0,0.0084		350/1267	141598057	1,11917	1859	4100	5959	141817507	SO:0001819	synonymous_variant	23158	exon6			AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.1050G>A	4.37:g.141598057C>T		Somatic		Capture	Illumina HiSeq	Phase_I	141817507	NM_015130	A6H8U8|D3DNZ1|O94958	Silent	SNP	ENST00000442267.2	37	CCDS47136.1																																																																																				0.353	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
TMEM144	55314	broad.mit.edu	37	4	159136379	159136379	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr4:159136379G>A	ENST00000296529.6	+	4	666	c.146G>A	c.(145-147)tGg>tAg	p.W49*	TMEM144_ENST00000514558.1_Nonsense_Mutation_p.W49*	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	49						integral component of membrane (GO:0016021)		p.W49*(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		GCTGCCATATGGTTGGTTGCC	0.398																																					p.W49X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G146A	4						.						243.0	217.0	226.0					4																	159136379		2203	4300	6503	159355829	SO:0001587	stop_gained	55314	exon4			AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.146G>A	4.37:g.159136379G>A	ENSP00000296529:p.Trp49*	Somatic		Capture	Illumina HiSeq	Phase_I	159355829	NM_018342	D3DP24|Q49A05|Q9NUT3	Nonsense_Mutation	SNP	ENST00000296529.6	37	CCDS3799.1	.	.	.	.	.	.	.	.	.	.	G	39	7.396952	0.98258	.	.	ENSG00000164124	ENST00000505049;ENST00000505189;ENST00000508243;ENST00000296529;ENST00000512481;ENST00000504569;ENST00000514558;ENST00000503200;ENST00000502698;ENST00000514971	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.48	15.2498	0.73536	0.0:0.141:0.859:0.0	.	.	.	.	X	49	.	ENSP00000296529:W49X	W	+	2	0	TMEM144	159355829	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	6.461000	0.73522	2.796000	0.96246	0.643000	0.83706	TGG		0.398	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365597.1	NM_018342	
MAN2A1	4124	broad.mit.edu	37	5	109125208	109125208	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr5:109125208A>G	ENST00000261483.4	+	12	2975	c.1923A>G	c.(1921-1923)atA>atG	p.I641M		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	641					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.I641M(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		AAAATATAATAAGGCTGAGTG	0.299																																					p.I641M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1923G	5						.						30.0	33.0	32.0					5																	109125208		2194	4292	6486	109153107	SO:0001583	missense	4124	exon12				CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.1923A>G	5.37:g.109125208A>G	ENSP00000261483:p.Ile641Met	Somatic		Capture	Illumina HiSeq	Phase_I	109153107	NM_002372	Q16767	Missense_Mutation	SNP	ENST00000261483.4	37	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	A	7.835	0.720747	0.15372	.	.	ENSG00000112893	ENST00000261483	D	0.84370	-1.84	5.09	3.9	0.45041	Glycosyl hydrolase, family 13, all-beta (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.224174	0.46758	D	0.000270	T	0.81969	0.4935	M	0.73217	2.22	0.20074	N	0.999934	B	0.34372	0.451	B	0.35971	0.215	T	0.75531	-0.3285	10	0.62326	D	0.03	-12.5662	5.4633	0.16630	0.7645:0.0:0.0813:0.1543	.	641	Q16706	MA2A1_HUMAN	M	641	ENSP00000261483:I641M	ENSP00000261483:I641M	I	+	3	3	MAN2A1	109153107	0.990000	0.36364	0.021000	0.16686	0.336000	0.28762	2.223000	0.42936	0.916000	0.36871	0.482000	0.46254	ATA		0.299	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
APC	324	broad.mit.edu	37	5	112173992	112173992	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr5:112173992C>T	ENST00000457016.1	+	16	3081	c.2701C>T	c.(2701-2703)Cag>Tag	p.Q901*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.Q901*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q901*			P25054	APC_HUMAN	adenomatous polyposis coli	901	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q901*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCATACCTCTCAGGAAGACAG	0.453		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q883X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.C2647T	5						.						79.0	78.0	78.0					5																	112173992		2202	4300	6502	112201891	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2701C>T	5.37:g.112173992C>T	ENSP00000413133:p.Gln901*	Somatic		Capture	Illumina HiSeq	Phase_I	112201891	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.297858	0.97453	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.92	5.92	0.95590	.	0.072624	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-1.1818	20.3167	0.98654	0.0:1.0:0.0:0.0	.	.	.	.	X	901;883;901;901;901	.	ENSP00000257430:Q901X	Q	+	1	0	APC	112201891	0.999000	0.42202	1.000000	0.80357	0.957000	0.61999	4.296000	0.59055	2.809000	0.96659	0.557000	0.71058	CAG		0.453	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DMXL1	1657	broad.mit.edu	37	5	118469797	118469797	+	Silent	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr5:118469797C>T	ENST00000311085.8	+	12	2258	c.2178C>T	c.(2176-2178)gcC>gcT	p.A726A	DMXL1_ENST00000539542.1_Silent_p.A726A	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	726								p.A726A(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		CTGAGCTTGCCCGGATTAATT	0.448																																					p.A726A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2178T	5						.						101.0	98.0	99.0					5																	118469797		2202	4298	6500	118497696	SO:0001819	synonymous_variant	1657	exon12			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.2178C>T	5.37:g.118469797C>T		Somatic		Capture	Illumina HiSeq	Phase_I	118497696	NM_005509		Silent	SNP	ENST00000311085.8	37	CCDS4125.1																																																																																				0.448	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
PCDHB15	56121	broad.mit.edu	37	5	140626676	140626676	+	Silent	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr5:140626676C>T	ENST00000231173.3	+	1	1530	c.1530C>T	c.(1528-1530)aaC>aaT	p.N510N		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	510	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N510N(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACACGGACAACGGCCACCTGT	0.682																																					p.N510N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1530T	5						.						100.0	108.0	105.0					5																	140626676		2203	4300	6503	140606860	SO:0001819	synonymous_variant	56121	exon1			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1530C>T	5.37:g.140626676C>T		Somatic		Capture	Illumina HiSeq	Phase_I	140606860	NM_018935	Q8IUX5	Silent	SNP	ENST00000231173.3	37	CCDS4257.1																																																																																				0.682	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
PCDHGA2	56113	broad.mit.edu	37	5	140720406	140720406	+	Missense_Mutation	SNP	C	C	T	rs370683887		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr5:140720406C>T	ENST00000394576.2	+	1	1868	c.1868C>T	c.(1867-1869)aCg>aTg	p.T623M	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	623	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T623M(1)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTCTGCACACGGGCGAGGTG	0.687																																					p.T623M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1868T	5						.	C	,MET/THR,MET/THR	1,4389		0,1,2194	34.0	42.0	39.0		,1868,1868	5.1	1.0	5		39	1,8559		0,1,4279	no	intron,missense,missense	PCDHGA2,PCDHGA1	NM_018912.2,NM_018915.2,NM_032009.1	,81,81	0,2,6473	TT,TC,CC		0.0117,0.0228,0.0154	,,	,623/933,623/824	140720406	2,12948	2195	4280	6475	140700590	SO:0001583	missense	56113	exon1			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1868C>T	5.37:g.140720406C>T	ENSP00000378077:p.Thr623Met	Somatic		Capture	Illumina HiSeq	Phase_I	140700590	NM_032009	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	12.11	1.840122	0.32513	2.28E-4	1.17E-4	ENSG00000081853	ENST00000394576	T	0.58060	0.36	5.14	5.14	0.70334	Cadherin (4);Cadherin-like (1);	0.179052	0.25951	U	0.027248	T	0.79936	0.4532	H	0.94183	3.505	0.23827	N	0.996738	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.75764	-0.3203	10	0.87932	D	0	.	15.3383	0.74277	0.0:0.8598:0.1401:0.0	.	623;623	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	M	623	ENSP00000378077:T623M	ENSP00000378077:T623M	T	+	2	0	PCDHGA2	140700590	0.007000	0.16637	0.969000	0.41365	0.150000	0.21749	0.099000	0.15210	2.589000	0.87451	0.485000	0.47835	ACG		0.687	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
APC	324	broad.mit.edu	37	5	112175530	112175530	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr5:112175530delG	ENST00000457016.1	+	16	4619	c.4239delG	c.(4237-4239)atgfs	p.M1413fs	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.M1413fs|APC_ENST00000508376.2_Frame_Shift_Del_p.M1413fs			P25054	APC_HUMAN	adenomatous polyposis coli	1413	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.V1414fs*9(6)|p.V1414fs*1(6)|p.Y1376fs*41(1)|p.?(1)|p.S1411fs*41(1)|p.M1413fs*5(1)|p.P1409fs*6(1)|p.K1192fs*3(1)|p.V1414fs*3(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCAGTGGAATGGTAAGTGGCA	0.483		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.M1395fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	19	Deletion - Frameshift(12)|Insertion - Frameshift(6)|Unknown(1)	large_intestine(16)|soft_tissue(1)|breast(1)|skin(1)	c.4185delG	5						.						117.0	107.0	110.0					5																	112175530		2202	4300	6502	112203429	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4239delG	5.37:g.112175530delG	ENSP00000413133:p.Met1413fs	Somatic		Capture	Illumina HiSeq	Phase_I	112203429	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.483	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PDGFRB	5159	broad.mit.edu	37	5	149516599	149516599	+	Silent	SNP	C	C	T	rs138641101	byFrequency	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr5:149516599C>T	ENST00000261799.4	-	2	481	c.12G>A	c.(10-12)ccG>ccA	p.P4P		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	4					adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)	p.P4P(1)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCATCGCACCCGGAAGCCGCA	0.637			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""								C|||	6	0.00119808	0.0038	0.0	5008	,	,		18269	0.001		0.0	False		,,,				2504	0.0				p.P4P			Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G12A	5						.	C		15,4391	22.3+/-47.3	0,15,2188	56.0	54.0	55.0		12	-0.4	0.0	5	dbSNP_134	55	0,8600		0,0,4300	no	coding-synonymous	PDGFRB	NM_002609.3		0,15,6488	TT,TC,CC		0.0,0.3404,0.1153		4/1107	149516599	15,12991	2203	4300	6503	149496792	SO:0001819	synonymous_variant	5159	exon2			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.12G>A	5.37:g.149516599C>T		Somatic		Capture	Illumina HiSeq	Phase_I	149496792	NM_002609	B5A957|Q8N5L4	Silent	SNP	ENST00000261799.4	37	CCDS4303.1																																																																																				0.637	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609	
DDO	8528	broad.mit.edu	37	6	110714041	110714041	+	Silent	SNP	G	G	A	rs143597733		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr6:110714041G>A	ENST00000368924.3	-	5	1062	c.1047C>T	c.(1045-1047)gcC>gcT	p.A349A	DDO_ENST00000368923.3_Silent_p.A290A	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	321					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)	p.A349A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		CCAGCCTGGCGGCCTCCAGAG	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18476	0.0		0.0	False		,,,				2504	0.0				p.A349A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1047T	6						.	G	,	10,4396	16.8+/-37.8	0,10,2193	52.0	46.0	48.0		1047,870	-10.8	0.0	6	dbSNP_134	48	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	DDO	NM_003649.2,NM_004032.2	,	0,11,6492	AA,AG,GG		0.0116,0.227,0.0846	,	349/370,290/311	110714041	11,12995	2203	4300	6503	110820734	SO:0001819	synonymous_variant	8528	exon5			D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.1047C>T	6.37:g.110714041G>A		Somatic		Capture	Illumina HiSeq	Phase_I	110820734	NM_003649	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Silent	SNP	ENST00000368924.3	37	CCDS5082.1																																																																																				0.577	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1		
HDGFL1	154150	broad.mit.edu	37	6	22569849	22569849	+	Silent	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr6:22569849G>A	ENST00000230012.3	+	1	172	c.45G>A	c.(43-45)gtG>gtA	p.V15V	HDGFL1_ENST00000510882.2_Silent_p.V15V	NM_138574.2	NP_612641.2	Q5TGJ6	HDGL1_HUMAN	hepatoma derived growth factor-like 1	15	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.							p.V15V(1)		kidney(1)|large_intestine(3)|lung(7)	11	Ovarian(93;0.163)					GGGACCTGGTGTTTGCCAAGT	0.617																																					p.V15V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G45A	6						.						66.0	68.0	67.0					6																	22569849		2203	4300	6503	22677828	SO:0001819	synonymous_variant	154150	exon1			AK056824	CCDS34347.1	6p22.2	2008-02-05	2005-04-07	2005-04-07	ENSG00000112273	ENSG00000112273			21095	protein-coding gene	gene with protein product			"""PWWP domain containing 1"""	PWWP1			Standard	NM_138574		Approved	dJ309H15.1	uc003nds.3	Q5TGJ6	OTTHUMG00000016206	ENST00000230012.3:c.45G>A	6.37:g.22569849G>A		Somatic		Capture	Illumina HiSeq	Phase_I	22677828	NM_138574	Q96MJ6	Silent	SNP	ENST00000230012.3	37	CCDS34347.1																																																																																				0.617	HDGFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043500.1	NM_138574	
SRSF12	135295	broad.mit.edu	37	6	89808303	89808303	+	Silent	SNP	A	A	G			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr6:89808303A>G	ENST00000452027.2	-	5	973	c.780T>C	c.(778-780)agT>agC	p.S260S		NM_080743.4	NP_542781.3	Q8WXF0	SRS12_HUMAN	serine/arginine-rich splicing factor 12	260					cytoplasmic transport (GO:0016482)|mRNA 5'-splice site recognition (GO:0000395)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|spliceosomal tri-snRNP complex assembly (GO:0000244)	nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RS domain binding (GO:0050733)|unfolded protein binding (GO:0051082)	p.S261S(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)	8						CTGTTCACCAACTGTTTTTAT	0.353																																					p.S260S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T780C	6						.						137.0	127.0	130.0					6																	89808303		1879	4112	5991	89865022	SO:0001819	synonymous_variant	135295	exon5			AF449428	CCDS47459.1	6q16.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000154548	ENSG00000154548		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	21220	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 19"", ""SR splicing factor 12"""		"""splicing factor, arginine/serine-rich 13B"""	SFRS13B		11684676, 20516191	Standard	NM_080743		Approved	SRrp35, SFRS19	uc021zcq.1	Q8WXF0	OTTHUMG00000015192	ENST00000452027.2:c.780T>C	6.37:g.89808303A>G		Somatic		Capture	Illumina HiSeq	Phase_I	89865022	NM_080743	B2RA22|Q5T7K0|Q8WW25	Silent	SNP	ENST00000452027.2	37	CCDS47459.1																																																																																				0.353	SRSF12-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041474.2	NM_080743	
AHI1	54806	broad.mit.edu	37	6	135763775	135763775	+	Silent	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr6:135763775G>A	ENST00000367800.4	-	12	2073	c.1857C>T	c.(1855-1857)caC>caT	p.H619H	AHI1_ENST00000327035.6_Silent_p.H619H|AHI1_ENST00000417892.2_5'UTR|AHI1_ENST00000457866.2_Silent_p.H619H	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	619					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)		p.H619H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		TTCTTCCATTGTGGGAGAAAT	0.398																																					p.H619H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1857T	6						.						66.0	61.0	62.0					6																	135763775		1856	4102	5958	135805468	SO:0001819	synonymous_variant	54806	exon13			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.1857C>T	6.37:g.135763775G>A		Somatic		Capture	Illumina HiSeq	Phase_I	135805468	NM_017651	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Silent	SNP	ENST00000367800.4	37	CCDS47483.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814073	0.70912	.	.	ENSG00000135541	ENST00000367799	.	.	.	5.96	-1.79	0.07932	.	.	.	.	.	T	0.25606	0.0623	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27640	-1.0068	4	.	.	.	-8.185	3.2969	0.06969	0.3254:0.1843:0.4039:0.0864	.	.	.	.	I	119	.	.	T	-	2	0	AHI1	135805468	0.294000	0.24380	0.992000	0.48379	0.995000	0.86356	-0.411000	0.07142	-0.234000	0.09782	0.655000	0.94253	ACA		0.398	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651	
IMMP2L	83943	broad.mit.edu	37	7	110526752	110526753	+	Splice_Site	INS	-	-	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr7:110526752_110526753insA	ENST00000405709.2	-	5	748		c.e5-1		IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000415362.1_Splice_Site|IMMP2L_ENST00000452895.1_Splice_Site|IMMP2L_ENST00000450877.1_Splice_Site|IMMP2L_ENST00000331762.3_Splice_Site	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)						ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)	p.?(1)		endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		TCCTATGGTTCTGGAAATAAAC	0.396																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	7						.																																			110313989	SO:0001630	splice_region_variant	83943	.			AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.306-1->T	7.37:g.110526752_110526753insA		Somatic		Capture	Illumina HiSeq	Phase_I	110313988	.	Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	Splice_Site	INS	ENST00000405709.2	37	CCDS5753.1																																																																																				0.396	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338109.4	NM_032549	Intron
FAM188B	84182	broad.mit.edu	37	7	30868343	30868343	+	Silent	SNP	C	C	T	rs545068622		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr7:30868343C>T	ENST00000265299.6	+	6	1199	c.1122C>T	c.(1120-1122)gcC>gcT	p.A374A	INMT-FAM188B_ENST00000458257.1_3'UTR	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	374								p.A374A(1)		endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGCTGGGTGCCCTGCGGCTCG	0.572																																					p.A374A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1122T	7						.						127.0	132.0	130.0					7																	30868343		2038	4192	6230	30834868	SO:0001819	synonymous_variant	84182	exon6			AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.1122C>T	7.37:g.30868343C>T		Somatic		Capture	Illumina HiSeq	Phase_I	30834868	NM_032222	Q71AZ7|Q9H6D2	Silent	SNP	ENST00000265299.6	37	CCDS43565.1																																																																																				0.572	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327962.1	NM_032222	
PCLO	27445	broad.mit.edu	37	7	82579616	82579616	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr7:82579616T>C	ENST00000333891.9	-	6	10625	c.10288A>G	c.(10288-10290)Atg>Gtg	p.M3430V	PCLO_ENST00000437081.1_Missense_Mutation_p.M150V|PCLO_ENST00000423517.2_Missense_Mutation_p.M3430V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.M3361V(1)|p.M3430V(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCATCTGTCATATTTTCTCCC	0.423																																					p.M3430V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A10288G	7						.						122.0	113.0	115.0					7																	82579616		1892	4114	6006	82417552	SO:0001583	missense	27445	exon6			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10288A>G	7.37:g.82579616T>C	ENSP00000334319:p.Met3430Val	Somatic		Capture	Illumina HiSeq	Phase_I	82417552	NM_033026		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	0.577	-0.838561	0.02692	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T;T	0.34275	2.55;2.55;1.37	5.85	-2.85	0.05734	.	.	.	.	.	T	0.09905	0.0243	N	0.00707	-1.245	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.24476	-1.0159	9	0.87932	D	0	.	4.301	0.10925	0.1038:0.3688:0.3656:0.1618	.	3361;3430;3430	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	V	3361;3430;3430;150	ENSP00000334319:M3430V;ENSP00000388393:M3430V;ENSP00000393760:M150V	ENSP00000334319:M3430V	M	-	1	0	PCLO	82417552	0.000000	0.05858	0.027000	0.17364	0.632000	0.37999	-0.275000	0.08525	-0.392000	0.07751	-0.256000	0.11100	ATG		0.423	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
NOS3	4846	broad.mit.edu	37	7	150706300	150706300	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr7:150706300delA	ENST00000297494.3	+	19	2626	c.2269delA	c.(2269-2271)aagfs	p.K757fs	NOS3_ENST00000461406.1_Frame_Shift_Del_p.K551fs	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.K757fs*43(1)		NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCACAGGCGGAAGATGTTCCA	0.632											OREG0018442	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K757fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2269delA	7						.						74.0	64.0	67.0					7																	150706300		2203	4300	6503	150337233	SO:0001589	frameshift_variant	4846	exon19				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.2269delA	7.37:g.150706300delA	ENSP00000297494:p.Lys757fs	Somatic	1734	Capture	Illumina HiSeq	Phase_I	150337233	NM_000603	Q495E5	Frame_Shift_Del	DEL	ENST00000297494.3	37	CCDS5912.1																																																																																				0.632	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350750.2	NM_000603	
HR	55806	broad.mit.edu	37	8	21980067	21980067	+	Missense_Mutation	SNP	C	C	T	rs376088952		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr8:21980067C>T	ENST00000381418.4	-	8	3540	c.2060G>A	c.(2059-2061)cGg>cAg	p.R687Q	HR_ENST00000312841.8_Missense_Mutation_p.R687Q	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	687					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R687Q(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		GCAGTGCCCCCGGATATCAAA	0.637																																					p.R687Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2060A	8						.	C	GLN/ARG,GLN/ARG	0,4404		0,0,2202	23.0	22.0	23.0		2060,2060	5.8	1.0	8		23	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	HR	NM_005144.4,NM_018411.4	43,43	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	687/1190,687/1135	21980067	1,13003	2202	4300	6502	22036012	SO:0001583	missense	55806	exon8			AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.2060G>A	8.37:g.21980067C>T	ENSP00000370826:p.Arg687Gln	Somatic		Capture	Illumina HiSeq	Phase_I	22036012	NM_018411	Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	ENST00000381418.4	37	CCDS6022.1	.	.	.	.	.	.	.	.	.	.	C	33	5.263599	0.95399	0.0	1.16E-4	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.71698	-0.58;-0.59	5.84	5.84	0.93424	.	0.000000	0.53938	D	0.000052	T	0.81064	0.4745	L	0.54323	1.7	0.36577	D	0.873313	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	D	0.83569	0.0111	10	0.51188	T	0.08	-32.3954	15.6279	0.76878	0.0:1.0:0.0:0.0	.	687;687	O43593-2;O43593	.;HAIR_HUMAN	Q	687	ENSP00000370826:R687Q;ENSP00000326765:R687Q	ENSP00000326765:R687Q	R	-	2	0	HR	22036012	0.735000	0.28153	1.000000	0.80357	0.989000	0.77384	1.283000	0.33237	2.768000	0.95171	0.561000	0.74099	CGG		0.637	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1		
STMN4	81551	broad.mit.edu	37	8	27098615	27098615	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr8:27098615C>T	ENST00000265770.7	-	4	410	c.274G>A	c.(274-276)Gaa>Aaa	p.E92K	STMN4_ENST00000519997.1_Missense_Mutation_p.E83K|STMN4_ENST00000519614.1_Missense_Mutation_p.E92K|STMN4_ENST00000523048.1_Missense_Mutation_p.E119K|STMN4_ENST00000350889.4_Missense_Mutation_p.E119K|STMN4_ENST00000522908.1_Missense_Mutation_p.E119K			Q9H169	STMN4_HUMAN	stathmin-like 4	92	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				regulation of microtubule polymerization or depolymerization (GO:0031110)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)		p.E119K(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	11		Ovarian(32;0.00167)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0214)|Epithelial(17;9.82e-10)|Colorectal(74;0.142)	Lomustine(DB01206)	TGGATCTCTTCCAGGGATGGG	0.567																																					p.E119K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G355A	8						.						74.0	72.0	73.0					8																	27098615		2203	4300	6503	27154532	SO:0001583	missense	81551	exon5				CCDS6055.1, CCDS64851.1, CCDS64852.1, CCDS64854.1	8p21.2	2006-12-09			ENSG00000015592	ENSG00000015592			16078	protein-coding gene	gene with protein product						11230166	Standard	NM_001283054		Approved	RB3	uc003xfj.3	Q9H169	OTTHUMG00000099461	ENST00000265770.7:c.274G>A	8.37:g.27098615C>T	ENSP00000265770:p.Glu92Lys	Somatic		Capture	Illumina HiSeq	Phase_I	27154532	NM_030795	B7Z2Z7|B7Z4I9|D3DSS8|D3DSS9|G5EA16|Q2TAB9	Missense_Mutation	SNP	ENST00000265770.7	37		.	.	.	.	.	.	.	.	.	.	C	36	5.817970	0.96982	.	.	ENSG00000015592	ENST00000350889;ENST00000519997;ENST00000265770;ENST00000523048;ENST00000519614;ENST00000522908	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.80265	0.4591	M	0.80183	2.485	0.80722	D	1	D;D;D;D;D;D	0.71674	0.996;0.995;0.998;0.998;0.993;0.998	D;D;P;D;P;P	0.72075	0.91;0.94;0.809;0.976;0.639;0.854	T	0.81015	-0.1124	9	0.52906	T	0.07	1.138	17.3478	0.87314	0.0:1.0:0.0:0.0	.	119;83;119;92;92;119	E7EVN3;B7Z2Z7;G5EA16;E5RIR6;Q9H169;Q9H169-2	.;.;.;.;STMN4_HUMAN;.	K	119;83;92;119;92;119	.	ENSP00000265770:E92K	E	-	1	0	STMN4	27154532	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.699000	0.92147	0.462000	0.41574	GAA		0.567	STMN4-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000375941.1	NM_030795	
OPRK1	4986	broad.mit.edu	37	8	54142245	54142245	+	Missense_Mutation	SNP	C	C	T	rs200672427		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr8:54142245C>T	ENST00000265572.3	-	4	1052	c.755G>A	c.(754-756)cGt>cAt	p.R252H	RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000524278.1_Missense_Mutation_p.R163H|OPRK1_ENST00000520287.1_Missense_Mutation_p.R252H	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	252					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)	p.R252H(3)		NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	GCTCTTGAGACGCAGGATCAT	0.552																																					p.R252H												.	.	3	Substitution - Missense(3)	breast(2)|large_intestine(1)	c.G755A	8						.						87.0	93.0	91.0					8																	54142245		2203	4300	6503	54304798	SO:0001583	missense	4986	exon4				CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.755G>A	8.37:g.54142245C>T	ENSP00000265572:p.Arg252His	Somatic		Capture	Illumina HiSeq	Phase_I	54304798	NM_000912	E5RHC9|Q499G4	Missense_Mutation	SNP	ENST00000265572.3	37	CCDS6152.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.790636	0.90367	.	.	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.37752	1.18;1.18;1.18	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.106321	0.64402	D	0.000006	T	0.63593	0.2524	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65882	-0.6060	10	0.87932	D	0	.	19.7123	0.96100	0.0:1.0:0.0:0.0	.	252	P41145	OPRK_HUMAN	H	252;163;252;238	ENSP00000265572:R252H;ENSP00000430923:R163H;ENSP00000429706:R252H	ENSP00000265572:R252H	R	-	2	0	OPRK1	54304798	1.000000	0.71417	0.990000	0.47175	0.601000	0.36947	7.818000	0.86416	2.664000	0.90586	0.650000	0.86243	CGT		0.552	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
ZHX2	22882	broad.mit.edu	37	8	123966118	123966118	+	Missense_Mutation	SNP	G	G	A	rs148101741	byFrequency	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr8:123966118G>A	ENST00000314393.4	+	3	3203	c.2368G>A	c.(2368-2370)Gtt>Att	p.V790I		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	790					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.V790I(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GGAGTCGAGCGTTGTGGATTA	0.602													G|||	6	0.00119808	0.0008	0.0058	5008	,	,		21034	0.001		0.0	False		,,,				2504	0.0				p.V790I	Esophageal Squamous(94;1056 1388 11767 13799 49639)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2368A	8						.	G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	114.0	98.0	104.0		2368	3.9	0.0	8	dbSNP_134	104	0,8600		0,0,4300	yes	missense	ZHX2	NM_014943.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	790/838	123966118	1,13005	2203	4300	6503	124035299	SO:0001583	missense	22882	exon3			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2368G>A	8.37:g.123966118G>A	ENSP00000314709:p.Val790Ile	Somatic		Capture	Illumina HiSeq	Phase_I	124035299	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	5	0.0022893772893772895	1	0.0020325203252032522	4	0.011049723756906077	0	0.0	0	0.0	G	4.875	0.162564	0.09287	2.27E-4	0.0	ENSG00000178764	ENST00000314393	T	0.17370	2.28	6.04	3.89	0.44902	.	0.357633	0.22308	N	0.061772	T	0.04452	0.0122	N	0.03608	-0.345	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.31447	-0.9943	10	0.33141	T	0.24	-7.2949	5.6221	0.17463	0.2588:0.1353:0.6059:0.0	.	790	Q9Y6X8	ZHX2_HUMAN	I	790	ENSP00000314709:V790I	ENSP00000314709:V790I	V	+	1	0	ZHX2	124035299	0.928000	0.31464	0.028000	0.17463	0.694000	0.40290	2.472000	0.45136	0.635000	0.30488	0.561000	0.74099	GTT		0.602	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
OR13C9	286362	broad.mit.edu	37	9	107379960	107379960	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr9:107379960G>A	ENST00000259362.1	-	1	525	c.526C>T	c.(526-528)Cat>Tat	p.H176Y		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H176Y(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						CATGAGAAATGATTGATGACA	0.433																																					p.H176Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C526T	9						.						129.0	107.0	115.0					9																	107379960		2203	4300	6503	106419781	SO:0001583	missense	286362	exon1				CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.526C>T	9.37:g.107379960G>A	ENSP00000259362:p.His176Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	106419781	NM_001001956	Q6IFL2	Missense_Mutation	SNP	ENST00000259362.1	37	CCDS35093.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.164635	0.38217	.	.	ENSG00000136839	ENST00000259362	T	0.00183	8.6	4.51	3.6	0.41247	GPCR, rhodopsin-like superfamily (1);	0.125660	0.36034	N	0.002832	T	0.00384	0.0012	M	0.86420	2.815	0.22552	N	0.999	B	0.32188	0.359	B	0.41646	0.362	T	0.04307	-1.0961	10	0.72032	D	0.01	.	11.5989	0.50990	0.0:0.0:0.8203:0.1797	.	176	Q8NGT0	O13C9_HUMAN	Y	176	ENSP00000259362:H176Y	ENSP00000259362:H176Y	H	-	1	0	OR13C9	106419781	0.997000	0.39634	1.000000	0.80357	0.911000	0.54048	2.749000	0.47492	1.076000	0.40961	0.643000	0.83706	CAT		0.433	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053490.1		
EPB41L4B	54566	broad.mit.edu	37	9	112004066	112004066	+	Intron	SNP	G	G	A	rs368537840		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr9:112004066G>A	ENST00000374566.3	-	15	1927				EPB41L4B_ENST00000374557.4_Missense_Mutation_p.S478L	NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B						actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)	p.S478L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTTCCAATGCGACCTGTCATC	0.448																																					p.S478L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1433T	9						.	G	LEU/SER,	0,3978		0,0,1989	185.0	179.0	181.0		1433,	4.0	0.9	9		181	1,8347		0,1,4173	no	missense,intron	EPB41L4B	NM_018424.2,NM_019114.3	145,	0,1,6162	AA,AG,GG		0.012,0.0,0.0081	,	478/519,	112004066	1,12325	1989	4174	6163	111043887	SO:0001627	intron_variant	54566	exon16			AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.1409+1831C>T	9.37:g.112004066G>A		Somatic		Capture	Illumina HiSeq	Phase_I	111043887	NM_018424	Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Missense_Mutation	SNP	ENST00000374566.3	37	CCDS43859.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.334989	0.41398	0.0	1.2E-4	ENSG00000095203	ENST00000374557;ENST00000311609	D	0.84442	-1.85	4.92	4.03	0.46877	.	.	.	.	.	T	0.71434	0.3339	N	0.14661	0.345	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.57347	-0.7827	9	0.25751	T	0.34	.	8.2723	0.31851	0.2366:0.0:0.7634:0.0	.	478	Q9H329-2	.	L	478;400	ENSP00000363685:S478L	ENSP00000311274:S400L	S	-	2	0	EPB41L4B	111043887	0.997000	0.39634	0.872000	0.34217	0.998000	0.95712	2.363000	0.44178	1.428000	0.47296	0.651000	0.88453	TCG		0.448	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053592.1	NM_018424	
SVEP1	79987	broad.mit.edu	37	9	113208197	113208197	+	Silent	SNP	G	G	A	rs368920627		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr9:113208197G>A	ENST00000401783.2	-	26	4719	c.4383C>T	c.(4381-4383)gaC>gaT	p.D1461D	SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Silent_p.D1438D|SVEP1_ENST00000302728.8_Silent_p.D1461D	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1461	Pentaxin.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.D1461D(2)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						AGTTCATGTCGTCAGAGGATT	0.453																																					p.D1461D												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C4383T	9						.	G		0,3950		0,0,1975	160.0	154.0	156.0		4383	1.4	0.4	9		156	1,8345		0,1,4172	no	coding-synonymous	SVEP1	NM_153366.3		0,1,6147	AA,AG,GG		0.012,0.0,0.0081		1461/3572	113208197	1,12295	1975	4173	6148	112248018	SO:0001819	synonymous_variant	79987	exon26			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.4383C>T	9.37:g.113208197G>A		Somatic		Capture	Illumina HiSeq	Phase_I	112248018	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	ENST00000401783.2	37	CCDS48004.1																																																																																				0.453	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
C9orf114	51490	broad.mit.edu	37	9	131591126	131591126	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr9:131591126T>A	ENST00000361256.5	-	3	136	c.96A>T	c.(94-96)aaA>aaT	p.K32N		NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114	32							poly(A) RNA binding (GO:0044822)	p.K32N(1)		kidney(2)|large_intestine(4)|ovary(1)	7						TCCATTTTTTTTTCTCCTCTT	0.527																																					p.K32N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A96T	9						.						114.0	121.0	119.0					9																	131591126		2203	4300	6503	130630947	SO:0001583	missense	51490	exon3				CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.96A>T	9.37:g.131591126T>A	ENSP00000354812:p.Lys32Asn	Somatic		Capture	Illumina HiSeq	Phase_I	130630947	NM_016390	Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	Missense_Mutation	SNP	ENST00000361256.5	37	CCDS6913.1	.	.	.	.	.	.	.	.	.	.	T	16.29	3.080621	0.55753	.	.	ENSG00000198917	ENST00000361256;ENST00000372618	T	0.26223	1.75	5.16	-0.046	0.13849	.	0.309416	0.38164	N	0.001790	T	0.23171	0.0560	M	0.68952	2.095	0.38431	D	0.946431	P;B	0.39665	0.682;0.361	B;B	0.35550	0.205;0.118	T	0.14504	-1.0470	10	0.66056	D	0.02	-3.4906	9.7065	0.40218	0.0:0.4435:0.0:0.5565	.	32;32	E7ESY7;Q5T280	.;CI114_HUMAN	N	32	ENSP00000354812:K32N	ENSP00000354812:K32N	K	-	3	2	C9orf114	130630947	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	0.384000	0.20668	0.042000	0.15717	0.459000	0.35465	AAA		0.527	C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054500.1	NM_016390	
FIBCD1	84929	broad.mit.edu	37	9	133780706	133780706	+	Silent	SNP	G	G	A	rs202150215	byFrequency	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr9:133780706G>A	ENST00000372338.4	-	6	1283	c.1041C>T	c.(1039-1041)taC>taT	p.Y347Y	FIBCD1_ENST00000253018.4_Intron|FIBCD1_ENST00000448616.1_Silent_p.Y347Y|FIBCD1_ENST00000372337.2_Silent_p.Y189Y	NM_032843.4	NP_116232.3	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	347	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitin binding (GO:0008061)|metal ion binding (GO:0046872)	p.Y347Y(1)		kidney(1)|large_intestine(3)|lung(2)|prostate(5)|urinary_tract(1)	12	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		CGAAGCTCCCGTAGCGGGCAT	0.632													G|||	2	0.000399361	0.0	0.0	5008	,	,		16843	0.001		0.0	False		,,,				2504	0.001				p.Y347Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1041T	9						.						63.0	54.0	57.0					9																	133780706		2203	4300	6503	132770527	SO:0001819	synonymous_variant	84929	exon7			AK027716	CCDS6937.1	9q34.2	2013-02-06			ENSG00000130720	ENSG00000130720		"""Fibrinogen C domain containing"""	25922	protein-coding gene	gene with protein product		613357				12975309	Standard	NM_001145106		Approved	FLJ14810	uc004bzz.3	Q8N539	OTTHUMG00000020814	ENST00000372338.4:c.1041C>T	9.37:g.133780706G>A		Somatic		Capture	Illumina HiSeq	Phase_I	132770527	NM_001145106	A3KFK0|Q6UXK6|Q96SJ7	Silent	SNP	ENST00000372338.4	37	CCDS6937.1																																																																																				0.632	FIBCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054687.2	NM_032843	
UNC13B	10497	broad.mit.edu	37	9	35237788	35237788	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr9:35237788A>C	ENST00000378495.3	+	5	581	c.359A>C	c.(358-360)aAa>aCa	p.K120T	UNC13B_ENST00000396787.1_Missense_Mutation_p.K120T|UNC13B_ENST00000378496.4_Missense_Mutation_p.K120T	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	120					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.K120T(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			ACTCCTCATAAAATTTTGCTT	0.353																																					p.K120T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A359C	9						.						96.0	95.0	95.0					9																	35237788		2203	4300	6503	35227788	SO:0001583	missense	10497	exon5			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.359A>C	9.37:g.35237788A>C	ENSP00000367756:p.Lys120Thr	Somatic		Capture	Illumina HiSeq	Phase_I	35227788	NM_006377	Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	37	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.583888	0.46110	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496	T;T;T	0.70749	-0.51;-0.51;-0.51	5.46	5.46	0.80206	C2 calcium/lipid-binding domain, CaLB (1);	0.188055	0.45606	D	0.000360	T	0.46190	0.1380	N	0.08118	0	0.31880	N	0.618592	B;B;P	0.38922	0.19;0.137;0.651	B;B;B	0.33960	0.073;0.173;0.15	T	0.58696	-0.7591	10	0.49607	T	0.09	-2.9846	8.1332	0.31039	0.8497:0.0:0.1503:0.0	.	120;120;120	Q2NKJ5;F8W8M9;O14795	.;.;UN13B_HUMAN	T	120	ENSP00000380006:K120T;ENSP00000367756:K120T;ENSP00000367757:K120T	ENSP00000367756:K120T	K	+	2	0	UNC13B	35227788	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.703000	0.47110	2.305000	0.77605	0.529000	0.55759	AAA		0.353	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	
NTNG2	84628	broad.mit.edu	37	9	135102320	135102320	+	Silent	SNP	C	C	T	rs145479097		TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chr9:135102320C>T	ENST00000393229.3	+	4	1718	c.942C>T	c.(940-942)ccC>ccT	p.P314P	NTNG2_ENST00000360670.3_Silent_p.P314P|NTNG2_ENST00000372179.3_Silent_p.P314P|NTNG2_ENST00000393228.4_Silent_p.P314P	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	314	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)		p.P314P(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		CCACCGGCCCCGACTGCGGCA	0.667																																					p.P314P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C942T	9						.						48.0	42.0	44.0					9																	135102320		2203	4299	6502	134092141	SO:0001819	synonymous_variant	84628	exon4			AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.942C>T	9.37:g.135102320C>T		Somatic		Capture	Illumina HiSeq	Phase_I	134092141	NM_032536	Q5JUJ2|Q6UXY0|Q96JH0	Silent	SNP	ENST00000393229.3	37	CCDS6946.1																																																																																				0.667	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	NM_032536	
ARSH	347527	broad.mit.edu	37	X	2936583	2936583	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chrX:2936583G>A	ENST00000381130.2	+	5	773	c.773G>A	c.(772-774)aGg>aAg	p.R258K		NM_001011719.1	NP_001011719.1	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	258					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.R258K(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(6)|lung(13)|skin(1)|stomach(1)	34		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGGTACAAAAGGGAACCTTTT	0.393																																					p.R258K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G773A	X						.						103.0	94.0	97.0					X																	2936583		2203	4300	6503	2946583	SO:0001583	missense	347527	exon5			AY875940	CCDS35198.1	Xp22.33	2013-02-14	2006-03-07		ENSG00000205667	ENSG00000205667		"""Arylsulfatase family"""	32488	protein-coding gene	gene with protein product		300586	"""arylsulfatase H"""			16174644	Standard	NM_001011719		Approved		uc011mhj.2	Q5FYA8	OTTHUMG00000159612	ENST00000381130.2:c.773G>A	X.37:g.2936583G>A	ENSP00000370522:p.Arg258Lys	Somatic		Capture	Illumina HiSeq	Phase_I	2946583	NM_001011719		Missense_Mutation	SNP	ENST00000381130.2	37	CCDS35198.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.727838	0.00694	.	.	ENSG00000205667	ENST00000381130	D	0.93247	-3.19	3.63	0.693	0.18056	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.778419	0.12164	N	0.493668	T	0.74023	0.3662	N	0.00572	-1.36	0.09310	N	1	B	0.14012	0.009	B	0.14023	0.01	T	0.67565	-0.5638	10	0.16896	T	0.51	.	6.2896	0.21053	0.6061:0.0:0.3939:0.0	.	258	Q5FYA8	ARSH_HUMAN	K	258	ENSP00000370522:R258K	ENSP00000370522:R258K	R	+	2	0	ARSH	2946583	0.010000	0.17322	0.000000	0.03702	0.005000	0.04900	0.407000	0.21049	0.404000	0.25506	0.594000	0.82650	AGG		0.393	ARSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356489.1	NM_001011719	
CYBB	1536	broad.mit.edu	37	X	37653050	37653050	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chrX:37653050G>A	ENST00000378588.4	+	5	537	c.470G>A	c.(469-471)cGa>cAa	p.R157Q	TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000536160.1_Intron|CYBB_ENST00000545017.1_Missense_Mutation_p.R125Q	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	157	Ferric oxidoreductase.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)	p.R157Q(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	AATTTTGCTCGAAAGAGAATA	0.398													G|||	1	0.000264901	0.0	0.0	3775	,	,		15934	0.001		0.0	False		,,,				2504	0.0				p.R157Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G470A	X						.						86.0	75.0	79.0					X																	37653050		2201	4300	6501	37537990	SO:0001583	missense	1536	exon5			X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.470G>A	X.37:g.37653050G>A	ENSP00000367851:p.Arg157Gln	Somatic		Capture	Illumina HiSeq	Phase_I	37537990	NM_000397	A8K138|Q2PP16	Missense_Mutation	SNP	ENST00000378588.4	37	CCDS14242.1	.	.	.	.	.	.	.	.	.	.	G	7.335	0.619807	0.14193	.	.	ENSG00000165168	ENST00000378588;ENST00000545017	D;D	0.91011	-2.77;-2.77	5.67	1.03	0.20045	Flavoprotein transmembrane component (1);	0.536654	0.20672	N	0.087813	D	0.84678	0.5525	L	0.45352	1.415	0.09310	N	0.999998	B;P	0.46621	0.056;0.881	B;B	0.43360	0.014;0.417	T	0.74896	-0.3508	10	0.27785	T	0.31	.	7.5069	0.27551	0.2133:0.1893:0.5974:0.0	.	125;157	F5GWD2;P04839	.;CY24B_HUMAN	Q	157;125	ENSP00000367851:R157Q;ENSP00000441896:R125Q	ENSP00000367851:R157Q	R	+	2	0	CYBB	37537990	0.107000	0.21998	0.142000	0.22268	0.004000	0.04260	1.976000	0.40579	0.585000	0.29608	-0.196000	0.12772	CGA		0.398	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080881.1		
MED12	9968	broad.mit.edu	37	X	70338703	70338703	+	Splice_Site	SNP	G	G	T			TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3976-01A-01W-0995-10	TCGA-AA-3976-10A-01W-0999-10	g.chrX:70338703G>T	ENST00000374080.3	+	1	131	c.99G>T	c.(97-99)gaG>gaT	p.E33D	MED12_ENST00000374102.1_Splice_Site_p.E33D|MED12_ENST00000333646.6_Splice_Site_p.E33D			Q93074	MED12_HUMAN	mediator complex subunit 12	33					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.E33D(1)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AACAGAAGGAGGTGCGTTCGA	0.677			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																														p.E33D			Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G99T	X						.						13.0	14.0	14.0					X																	70338703		1813	4046	5859	70255428	SO:0001630	splice_region_variant	9968	exon1			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.99+1G>T	X.37:g.70338703G>T		Somatic		Capture	Illumina HiSeq	Phase_I	70255428	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	CCDS43970.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	28.8|28.8	4.954621|4.954621	0.92726|0.92726	.|.	.|.	ENSG00000184634|ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072|ENST00000429213	T;T;T;T|.	0.72942|.	-0.69;-0.69;-0.7;-0.19|.	4.13|4.13	3.25|3.25	0.37280|0.37280	.|.	0.148358|.	0.43747|.	D|.	0.000535|.	T|.	0.65228|.	0.2671|.	M|M	0.68317|0.68317	2.08|2.08	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.69078|.	0.994;0.981;0.997|.	D;P;D|.	0.66847|.	0.947;0.798;0.913|.	T|.	0.65265|.	-0.6210|.	10|.	0.87932|.	D|.	0|.	-9.9108|-9.9108	11.3051|11.3051	0.49329|0.49329	0.0953:0.0:0.9047:0.0|0.0953:0.0:0.9047:0.0	.|.	33;33;33|.	F5H3Y1;Q93074-3;Q93074|.	.;.;MED12_HUMAN|.	D|X	33;33;33;33;1|7	ENSP00000333125:E33D;ENSP00000363215:E33D;ENSP00000363193:E33D;ENSP00000414203:E1D|.	ENSP00000333125:E33D|.	E|G	+|+	3|1	2|0	MED12|MED12	70255428|70255428	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.752000|0.752000	0.42762|0.42762	6.708000|6.708000	0.74660|0.74660	2.007000|2.007000	0.58848|0.58848	0.431000|0.431000	0.28591|0.28591	GAG|GGA		0.677	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	Missense_Mutation
