#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DNMBP	23268	broad.mit.edu	37	10	101716730	101716730	+	Silent	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr10:101716730C>T	ENST00000324109.4	-	4	592	c.501G>A	c.(499-501)agG>agA	p.R167R	DNMBP-AS1_ENST00000434409.1_RNA|DNMBP_ENST00000342239.3_Silent_p.R167R	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	167	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R167R(1)		central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CATCCCCTTCCCTGAAGTCCA	0.527																																					p.R167R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G501A	10						.						71.0	71.0	71.0					10																	101716730		2203	4300	6503	101706720	SO:0001819	synonymous_variant	23268	exon4			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.501G>A	10.37:g.101716730C>T		Somatic		Capture	Illumina HiSeq	Phase_I	101706720	NM_015221	Q8IVY3|Q9Y2L3	Silent	SNP	ENST00000324109.4	37	CCDS7485.1																																																																																				0.527	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
CUBN	8029	broad.mit.edu	37	10	16962025	16962025	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr10:16962025G>T	ENST00000377833.4	-	44	6823	c.6758C>A	c.(6757-6759)gCt>gAt	p.A2253D		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2253	CUB 16. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.A2253D(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTCCGGTGGAGCCGCTAAGAT	0.458																																					p.A2253D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6758A	10						.						71.0	63.0	66.0					10																	16962025		2203	4300	6503	17002031	SO:0001583	missense	8029	exon44			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6758C>A	10.37:g.16962025G>T	ENSP00000367064:p.Ala2253Asp	Somatic		Capture	Illumina HiSeq	Phase_I	17002031	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.234231	0.39498	.	.	ENSG00000107611	ENST00000377833	T	0.39787	1.06	5.11	4.08	0.47627	CUB (5);	0.168895	0.28268	N	0.015969	T	0.70911	0.3278	H	0.95917	3.74	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.77338	-0.2625	10	0.72032	D	0.01	.	8.8754	0.35343	0.2061:0.0:0.7939:0.0	.	2253	O60494	CUBN_HUMAN	D	2253	ENSP00000367064:A2253D	ENSP00000367064:A2253D	A	-	2	0	CUBN	17002031	1.000000	0.71417	0.199000	0.23439	0.046000	0.14306	4.851000	0.62896	2.395000	0.81488	0.471000	0.43371	GCT		0.458	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
GAD2	2572	broad.mit.edu	37	10	26581413	26581413	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr10:26581413C>T	ENST00000376261.3	+	14	1909	c.1406C>T	c.(1405-1407)gCg>gTg	p.A469V	GAD2_ENST00000259271.3_Missense_Mutation_p.A469V	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	469					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)	p.A469V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GGGTTTGAAGCGCATGTTGAT	0.448																																					p.A469V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1406T	10						.						125.0	115.0	118.0					10																	26581413		2203	4300	6503	26621419	SO:0001583	missense	2572	exon14			AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.1406C>T	10.37:g.26581413C>T	ENSP00000365437:p.Ala469Val	Somatic		Capture	Illumina HiSeq	Phase_I	26621419	NM_001134366	Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	37	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	C	15.73	2.919788	0.52653	.	.	ENSG00000136750	ENST00000376261;ENST00000259271	T;T	0.39997	1.05;1.05	5.59	3.75	0.43078	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.050000	0.85682	N	0.000000	T	0.34366	0.0895	L	0.42686	1.345	0.80722	D	1	D	0.56287	0.975	B	0.41619	0.361	T	0.06303	-1.0834	10	0.31617	T	0.26	-6.3124	12.7195	0.57134	0.0:0.8714:0.0:0.1286	.	469	Q05329	DCE2_HUMAN	V	469	ENSP00000365437:A469V;ENSP00000259271:A469V	ENSP00000259271:A469V	A	+	2	0	GAD2	26621419	1.000000	0.71417	0.996000	0.52242	0.522000	0.34438	4.409000	0.59768	0.845000	0.35118	-0.793000	0.03317	GCG		0.448	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
EXOC6	54536	broad.mit.edu	37	10	94675594	94675594	+	Missense_Mutation	SNP	G	G	A	rs566672685	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr10:94675594G>A	ENST00000260762.6	+	7	757	c.743G>A	c.(742-744)cGt>cAt	p.R248H	EXOC6_ENST00000371552.4_Missense_Mutation_p.R243H|EXOC6_ENST00000371547.4_Missense_Mutation_p.R264H|EXOC6_ENST00000443748.2_Missense_Mutation_p.R248H|EXOC6_ENST00000497262.1_3'UTR	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	248					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)		p.R243H(1)|p.R248H(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				TATATAAATCGTGATAGAATT	0.328													G|||	2	0.000399361	0.0	0.0	5008	,	,		14827	0.0		0.0	False		,,,				2504	0.002				p.R243H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G728A	10						.						74.0	80.0	78.0					10																	94675594		2201	4292	6493	94665574	SO:0001583	missense	54536	exon7			BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.743G>A	10.37:g.94675594G>A	ENSP00000260762:p.Arg248His	Somatic		Capture	Illumina HiSeq	Phase_I	94665574	NM_001013848	E9PHI3|Q5VXH8|Q9NZ24	Missense_Mutation	SNP	ENST00000260762.6	37	CCDS7424.2	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.760125	0.00657	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000443748;ENST00000260762	T;T;T;T	0.30714	1.57;1.57;1.52;1.57	3.1	1.94	0.25998	.	1.619920	0.04431	N	0.369232	T	0.17874	0.0429	N	0.17082	0.46	0.09310	N	1	B;B;B;B;B	0.10296	0.001;0.0;0.001;0.001;0.003	B;B;B;B;B	0.09377	0.003;0.0;0.003;0.004;0.003	T	0.22765	-1.0207	10	0.12766	T	0.61	-0.0427	4.8473	0.13519	0.7051:0.0:0.2949:0.0	.	264;248;240;248;243	F2Z2Q3;E7EW84;B4DEZ1;Q8TAG9;E9PHI3	.;.;.;EXOC6_HUMAN;.	H	264;243;248;248	ENSP00000360602:R264H;ENSP00000360607:R243H;ENSP00000396206:R248H;ENSP00000260762:R248H	ENSP00000260762:R248H	R	+	2	0	EXOC6	94665574	1.000000	0.71417	0.158000	0.22627	0.015000	0.08874	1.419000	0.34793	0.371000	0.24564	-0.294000	0.09567	CGT		0.328	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049410.2	NM_019053	
NHLRC2	374354	broad.mit.edu	37	10	115661632	115661632	+	Silent	SNP	C	C	T	rs146402410	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr10:115661632C>T	ENST00000369301.3	+	7	1559	c.1347C>T	c.(1345-1347)ctC>ctT	p.L449L		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	449								p.L449L(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		TGAAGCACCTCGTAGGAGGAG	0.478																																					p.L449L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1347T	10						.	C		2,4404	4.2+/-10.8	0,2,2201	117.0	118.0	118.0		1347	-11.2	0.0	10	dbSNP_134	118	0,8600		0,0,4300	no	coding-synonymous	NHLRC2	NM_198514.3		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		449/727	115661632	2,13004	2203	4300	6503	115651622	SO:0001819	synonymous_variant	374354	exon7			AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.1347C>T	10.37:g.115661632C>T		Somatic		Capture	Illumina HiSeq	Phase_I	115651622	NM_198514	Q8N1H1|Q8N5A6	Silent	SNP	ENST00000369301.3	37	CCDS7585.1																																																																																				0.478	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050446.1	NM_198514	
MFRP	83552	broad.mit.edu	37	11	119213687	119213688	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:119213687_119213688insG	ENST00000530681.1	-	10	1294_1295	c.1150_1151insC	c.(1150-1152)cacfs	p.H384fs	MFRP_ENST00000360167.4_Frame_Shift_Ins_p.T309fs|MFRP_ENST00000529147.1_5'Flank|C1QTNF5_ENST00000445041.2_5'UTR|C1QTNF5_ENST00000525657.1_5'Flank|MFRP_ENST00000555262.1_Frame_Shift_Ins_p.H384fs|C1QTNF5_ENST00000528368.1_5'Flank|MFRP_ENST00000449574.2_Frame_Shift_Ins_p.H384fs	NM_001278431.1	NP_001265360.1	Q9BY79	MFRP_HUMAN	membrane frizzled-related protein	384	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				embryo development (GO:0009790)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H384fs*8(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|urinary_tract(1)	18		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		GGAGACGAGGTGGGGGGGTGGC	0.624																																					p.H384fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1151_1152insC	11	GRCh37	CI052547	MFRP	I		.																																			118718898	SO:0001589	frameshift_variant	83552	exon10			AB055505	CCDS8421.1	11q23.3	2014-01-28			ENSG00000235718	ENSG00000235718			18121	protein-coding gene	gene with protein product	"""membrane-type frizzled-related protein"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 1"""	606227				11263980	Standard	NM_031433		Approved	FLJ30570, rd6, NNO2, C1QTNF5	uc001pwj.2	Q9BY79		ENST00000530681.1:c.1151dupC	11.37:g.119213694_119213694dupG	ENSP00000456533:p.His384fs	Somatic		Capture	Illumina HiSeq	Phase_I	118718897	NM_031433	B0YJ36|B0YJ37|B4DHN8|Q335M3|Q96DQ9	Frame_Shift_Ins	INS	ENST00000530681.1	37	CCDS8421.1																																																																																				0.624	MFRP-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000415179.1	NM_031433	
MAPK8IP1	9479	broad.mit.edu	37	11	45923969	45923970	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:45923969_45923970insCC	ENST00000241014.2	+	5	821_822	c.651_652insCC	c.(652-654)cccfs	p.P218fs	MAPK8IP1_ENST00000395629.2_Frame_Shift_Ins_p.P208fs	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	218	JNK-binding domain (JBD).				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		GCGATGAGCTGCCCCCCCAGAG	0.678																																					p.L217fs												.	.	0			c.651_652insCC	11						.																																			45880546	SO:0001589	frameshift_variant	9479	exon5				CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.656_657dupCC	11.37:g.45923974_45923975dupCC	ENSP00000241014:p.Pro218fs	None		Capture	Illumina HiSeq	Phase_I	45880545	NM_005456	D3DQP4|O43407	Frame_Shift_Ins	INS	ENST00000241014.2	37	CCDS7916.1																																																																																				0.678	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456	
LTBP3	4054	broad.mit.edu	37	11	65320992	65320993	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:65320992_65320993insC	ENST00000301873.5	-	4	1141_1142	c.873_874insG	c.(871-876)agcaacfs	p.N292fs	LTBP3_ENST00000536982.1_Intron|LTBP3_ENST00000322147.4_Frame_Shift_Ins_p.N292fs	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	292	TB 1.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)	p.N292fs*15(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						GGGAGGGGGTTGCTGCCACACT	0.668																																					p.N292fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.874_875insG	11						.																																			65077569	SO:0001589	frameshift_variant	4054	exon4			AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.873_874insG	11.37:g.65320992_65320993insC	ENSP00000301873:p.Asn292fs	Somatic		Capture	Illumina HiSeq	Phase_I	65077568	NM_001130144	O15107|Q96HB9|Q9H7K2|Q9UFN4	Frame_Shift_Ins	INS	ENST00000301873.5	37	CCDS44647.1																																																																																				0.668	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	
GVINP1	387751	broad.mit.edu	37	11	6735847	6735848	+	RNA	INS	-	-	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:6735847_6735848insT	ENST00000526769.3	-	0	7356_7357					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										GAGTATTACTGTTTTTTCAAGT	0.371																																					.												.	.	0			.	11						.																																			6692424			387751	.			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6735853_6735853dupT		Somatic		Capture	Illumina HiSeq	Phase_I	6692423	.	A6NFL2|Q9H8N5	Frame_Shift_Ins	INS	ENST00000526769.3	37																																																																																					0.371	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000386960.3	NR_003945	
NPAT	4863	broad.mit.edu	37	11	108044081	108044081	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:108044081G>C	ENST00000278612.8	-	13	1735	c.1630C>G	c.(1630-1632)Cca>Gca	p.P544A	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	544					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.P544A(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TTTTTAGATGGCTTTCCAGTT	0.303																																					p.P544A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1630G	11						.						44.0	42.0	42.0					11																	108044081		1791	4066	5857	107549291	SO:0001583	missense	4863	exon13			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.1630C>G	11.37:g.108044081G>C	ENSP00000278612:p.Pro544Ala	Somatic		Capture	Illumina HiSeq	Phase_I	107549291	NM_002519	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	37	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	G	8.268	0.812631	0.16537	.	.	ENSG00000149308	ENST00000278612	T	0.24538	1.85	6.08	0.61	0.17580	.	0.703521	0.14380	N	0.323216	T	0.12944	0.0314	N	0.22421	0.69	0.09310	N	1	B;B	0.14438	0.01;0.002	B;B	0.11329	0.006;0.004	T	0.21621	-1.0240	10	0.28530	T	0.3	-2.5836	3.1278	0.06413	0.1403:0.0959:0.4059:0.3579	.	544;544	B9EG70;Q14207	.;NPAT_HUMAN	A	544	ENSP00000278612:P544A	ENSP00000278612:P544A	P	-	1	0	NPAT	107549291	0.006000	0.16342	0.222000	0.23844	0.996000	0.88848	-0.175000	0.09825	0.409000	0.25649	0.655000	0.94253	CCA		0.303	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
OR51I1	390063	broad.mit.edu	37	11	5461990	5461990	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:5461990G>C	ENST00000380211.1	-	1	754	c.755C>G	c.(754-756)gCc>gGc	p.A252G	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	252			A -> S (in dbSNP:rs1498486).		detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A252G(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACATAAAAGGCCAGCACTGC	0.488																																					p.A252G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C755G	11						.						126.0	107.0	113.0					11																	5461990		2201	4297	6498	5418566	SO:0001583	missense	390063	exon1			BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.755C>G	11.37:g.5461990G>C	ENSP00000369559:p.Ala252Gly	Somatic		Capture	Illumina HiSeq	Phase_I	5418566	NM_001005288	B9EKW2|Q6IF33	Missense_Mutation	SNP	ENST00000380211.1	37	CCDS31382.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837278	0.50951	.	.	ENSG00000167359	ENST00000321307;ENST00000380211	T	0.00169	8.63	5.47	0.348	0.16026	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000035	T	0.00271	0.0008	M	0.66439	2.03	0.09310	N	1	P	0.48016	0.904	P	0.48552	0.581	T	0.44907	-0.9297	10	0.87932	D	0	.	9.1025	0.36678	0.4514:0.0:0.5486:0.0	.	252	Q9H343	O51I1_HUMAN	G	249;252	ENSP00000369559:A252G	ENSP00000439622:A249G	A	-	2	0	OR51I1	5418566	0.000000	0.05858	0.219000	0.23793	0.974000	0.67602	0.757000	0.26433	0.291000	0.22468	0.551000	0.68910	GCC		0.488	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143399.1	NM_001005288	
OR51I2	390064	broad.mit.edu	37	11	5475146	5475146	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:5475146C>A	ENST00000341449.2	+	1	509	c.428C>A	c.(427-429)gCa>gAa	p.A143E	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	143					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A143E(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTCATTGCTGCAATGGGTTTA	0.483																																					p.A143E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C428A	11						.						163.0	150.0	154.0					11																	5475146		2201	4297	6498	5431722	SO:0001583	missense	390064	exon1			BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.428C>A	11.37:g.5475146C>A	ENSP00000341987:p.Ala143Glu	Somatic		Capture	Illumina HiSeq	Phase_I	5431722	NM_001004754	Q6IF81	Missense_Mutation	SNP	ENST00000341449.2	37	CCDS31383.1	.	.	.	.	.	.	.	.	.	.	C	8.177	0.793018	0.16327	.	.	ENSG00000187918	ENST00000341449	T	0.38560	1.13	5.58	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.303301	0.28499	N	0.015123	T	0.34395	0.0896	L	0.45581	1.43	0.09310	N	1	P	0.35242	0.492	B	0.36418	0.224	T	0.20009	-1.0288	10	0.38643	T	0.18	.	8.9592	0.35836	0.0:0.1692:0.6705:0.1603	.	143	Q9H344	O51I2_HUMAN	E	143	ENSP00000341987:A143E	ENSP00000341987:A143E	A	+	2	0	OR51I2	5431722	0.000000	0.05858	0.098000	0.21074	0.285000	0.27093	-0.934000	0.03955	1.594000	0.50039	-0.165000	0.13383	GCA		0.483	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	NM_001004754	
OR56A1	120796	broad.mit.edu	37	11	6048918	6048918	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:6048918G>A	ENST00000316650.5	-	1	53	c.17C>T	c.(16-18)gCg>gTg	p.A6V		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A6V(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCTGGGTGACGCCATAGGCTG	0.488																																					p.A6V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C17T	11						.						118.0	120.0	119.0					11																	6048918		2201	4296	6497	6005494	SO:0001583	missense	120796	exon1			AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.17C>T	11.37:g.6048918G>A	ENSP00000321246:p.Ala6Val	Somatic		Capture	Illumina HiSeq	Phase_I	6005494	NM_001001917	B2RNI2|Q6IFL0	Missense_Mutation	SNP	ENST00000316650.5	37	CCDS31405.1	.	.	.	.	.	.	.	.	.	.	G	11.13	1.548288	0.27652	.	.	ENSG00000180934	ENST00000316650	T	0.37235	1.21	3.55	0.362	0.16113	.	0.859973	0.09626	U	0.776893	T	0.14960	0.0361	N	0.03608	-0.345	0.09310	N	1	B	0.21606	0.058	B	0.14023	0.01	T	0.20874	-1.0262	10	0.46703	T	0.11	.	4.9723	0.14123	0.1055:0.0:0.5266:0.368	.	6	Q8NGH5	O56A1_HUMAN	V	6	ENSP00000321246:A6V	ENSP00000321246:A6V	A	-	2	0	OR56A1	6005494	0.000000	0.05858	0.006000	0.13384	0.237000	0.25408	0.092000	0.15066	-0.023000	0.13963	0.563000	0.77884	GCG		0.488	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383757.1	NM_001001917	
TSG101	7251	broad.mit.edu	37	11	18524108	18524108	+	Missense_Mutation	SNP	G	G	A	rs536807993	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:18524108G>A	ENST00000251968.3	-	7	980	c.565C>T	c.(565-567)Cct>Tct	p.P189S	TSG101_ENST00000543087.1_5'UTR|TSG101_ENST00000536719.1_Missense_Mutation_p.P189S|TSG101_ENST00000357193.3_Missense_Mutation_p.P84S	NM_006292.3	NP_006283.1	Q99816	TS101_HUMAN	tumor susceptibility 101	189					cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cellular protein modification process (GO:0006464)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|keratinocyte differentiation (GO:0030216)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell growth (GO:0001558)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral budding (GO:0046755)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transcription corepressor activity (GO:0003714)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.P189S(1)		kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	22						GGTGGGTAAGGACAGCCTGGG	0.428													G|||	3	0.000599042	0.0	0.0	5008	,	,		17386	0.003		0.0	False		,,,				2504	0.0				p.P189S	GBM(99;1348 1396 8611 26475 50572)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C565T	11						.						83.0	77.0	79.0					11																	18524108		2199	4293	6492	18480684	SO:0001583	missense	7251	exon7			U82130	CCDS7842.1	11p15	2013-08-22	2013-08-22		ENSG00000074319	ENSG00000074319			15971	protein-coding gene	gene with protein product		601387	"""tumor susceptibility gene 10"", ""tumor susceptibility gene 101"""	TSG10		9019400, 9241264	Standard	NM_006292		Approved	VPS23	uc001mor.3	Q99816	OTTHUMG00000167725	ENST00000251968.3:c.565C>T	11.37:g.18524108G>A	ENSP00000251968:p.Pro189Ser	Somatic		Capture	Illumina HiSeq	Phase_I	18480684	NM_006292	Q9BUM5	Missense_Mutation	SNP	ENST00000251968.3	37	CCDS7842.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407624	0.42715	.	.	ENSG00000074319	ENST00000536719;ENST00000251968;ENST00000357193	T;T;T	0.22539	1.95;1.95;1.95	5.29	3.39	0.38822	.	0.402394	0.25009	N	0.033851	T	0.22704	0.0548	M	0.75615	2.305	0.48185	D	0.999609	P	0.43352	0.804	B	0.39840	0.311	T	0.06679	-1.0813	10	0.16896	T	0.51	-10.7463	10.6909	0.45870	0.1613:0.0:0.8387:0.0	.	189	Q99816	TS101_HUMAN	S	189;189;84	ENSP00000438471:P189S;ENSP00000251968:P189S;ENSP00000349721:P84S	ENSP00000251968:P189S	P	-	1	0	TSG101	18480684	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.541000	0.60670	1.370000	0.46153	-0.339000	0.08088	CCT		0.428	TSG101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395906.1	NM_006292	
ANO5	203859	broad.mit.edu	37	11	22225377	22225377	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:22225377A>T	ENST00000324559.8	+	2	385	c.68A>T	c.(67-69)tAc>tTc	p.Y23F		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	23					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)	p.Y23F(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CATATAGACTACTCTTTCCAA	0.284																																					p.Y23F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A68T	11						.						32.0	33.0	33.0					11																	22225377		2162	4254	6416	22181953	SO:0001583	missense	203859	exon2			AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.68A>T	11.37:g.22225377A>T	ENSP00000315371:p.Tyr23Phe	Somatic		Capture	Illumina HiSeq	Phase_I	22181953	NM_001142649		Missense_Mutation	SNP	ENST00000324559.8	37	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	A	6.943	0.543721	0.13250	.	.	ENSG00000171714	ENST00000324559	T	0.71222	-0.55	4.02	-8.05	0.01106	.	3.983760	0.00559	N	0.000265	T	0.38799	0.1054	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42481	-0.9449	10	0.10111	T	0.7	.	0.5732	0.00699	0.18:0.2737:0.186:0.3603	.	23	Q75V66	ANO5_HUMAN	F	23	ENSP00000315371:Y23F	ENSP00000315371:Y23F	Y	+	2	0	ANO5	22181953	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.042000	0.12063	-1.656000	0.01495	-0.297000	0.09499	TAC		0.284	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599	
TMEM132A	54972	broad.mit.edu	37	11	60704066	60704066	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:60704066delA	ENST00000453848.2	+	11	2917	c.2759delA	c.(2758-2760)gagfs	p.E920fs	TMEM132A_ENST00000005286.4_Frame_Shift_Del_p.E921fs			Q24JP5	T132A_HUMAN	transmembrane protein 132A	920	Confers cellular localization similar to full-length form. {ECO:0000250}.					endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.E921fs*44(1)		breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CCCAAGGGGGAGGGGAGCTGC	0.731																																					p.E921fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2762delA	11						.																																			60460642	SO:0001589	frameshift_variant	54972	exon11			AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.2759delA	11.37:g.60704066delA	ENSP00000405823:p.Glu920fs	Somatic		Capture	Illumina HiSeq	Phase_I	60460642	NM_017870	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Frame_Shift_Del	DEL	ENST00000453848.2	37	CCDS44618.1																																																																																				0.731	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
MYO7A	4647	broad.mit.edu	37	11	76917223	76917223	+	Silent	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:76917223C>T	ENST00000409709.3	+	41	5990	c.5718C>T	c.(5716-5718)gtC>gtT	p.V1906V	MYO7A_ENST00000605744.1_3'UTR|MYO7A_ENST00000409619.2_Silent_p.V1857V|MYO7A_ENST00000458637.2_Silent_p.V1868V	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1906	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)	p.V1906V(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TCCACAAAGTCTACTTCCCTG	0.607																																					p.V1906V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5718T	11						.						79.0	90.0	87.0					11																	76917223		2008	4155	6163	76594871	SO:0001819	synonymous_variant	4647	exon41			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5718C>T	11.37:g.76917223C>T		Somatic		Capture	Illumina HiSeq	Phase_I	76594871	NM_000260	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	CCDS53683.1																																																																																				0.607	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
TECTA	7007	broad.mit.edu	37	11	121016468	121016468	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr11:121016468G>T	ENST00000392793.1	+	12	4019	c.3748G>T	c.(3748-3750)Gat>Tat	p.D1250Y	TECTA_ENST00000264037.2_Missense_Mutation_p.D1250Y|TECTA_ENST00000478058.1_3'UTR			O75443	TECTA_HUMAN	tectorin alpha	1250	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.D1250Y(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CAACCCTGATGATGACCTGGA	0.562																																					p.D1250Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3748T	11						.						150.0	123.0	132.0					11																	121016468		2203	4299	6502	120521678	SO:0001583	missense	7007	exon11			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.3748G>T	11.37:g.121016468G>T	ENSP00000376543:p.Asp1250Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	120521678	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125055	0.77436	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.67345	-0.26;-0.26	5.76	5.76	0.90799	von Willebrand factor, type D domain (3);	0.000000	0.64402	D	0.000004	D	0.85265	0.5657	M	0.91140	3.18	0.51767	D	0.999939	D	0.56287	0.975	P	0.61533	0.89	D	0.87827	0.2642	10	0.87932	D	0	.	19.958	0.97231	0.0:0.0:1.0:0.0	.	1250	O75443	TECTA_HUMAN	Y	1250	ENSP00000376543:D1250Y;ENSP00000264037:D1250Y	ENSP00000264037:D1250Y	D	+	1	0	TECTA	120521678	1.000000	0.71417	0.459000	0.27081	0.919000	0.55068	7.235000	0.78143	2.721000	0.93114	0.591000	0.81541	GAT		0.562	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
MBD6	114785	broad.mit.edu	37	12	57921001	57921002	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr12:57921001_57921002insC	ENST00000355673.3	+	7	2429_2430	c.2073_2074insC	c.(2074-2076)cccfs	p.P692fs	MBD6_ENST00000431731.2_Frame_Shift_Ins_p.P692fs	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	692	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.Q694fs*23(2)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						CCTCGGGGACACCCCCCCAGGT	0.559																																					p.T691fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.2073_2074insC	12						.																																			56207269	SO:0001589	frameshift_variant	114785	exon7			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.2080dupC	12.37:g.57921008_57921008dupC	ENSP00000347896:p.Pro692fs	Somatic		Capture	Illumina HiSeq	Phase_I	56207268	NM_052897	Q8N3M0|Q8NA81|Q96Q00	Frame_Shift_Ins	INS	ENST00000355673.3	37	CCDS8944.1																																																																																				0.559	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1		
KLRC1	3821	broad.mit.edu	37	12	10601884	10601884	+	Silent	SNP	A	A	G			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr12:10601884A>G	ENST00000359151.3	-	5	622	c.441T>C	c.(439-441)tgT>tgC	p.C147C	KLRC1_ENST00000544822.1_Silent_p.C147C|KLRC1_ENST00000536188.1_Silent_p.C147C|KLRC1_ENST00000347831.5_Silent_p.C129C|KLRC1_ENST00000408006.3_Silent_p.C129C	NM_002259.4	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C, member 1	147	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.C147C(1)		NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16						TCTTCGAAGTACAGGCCAGCA	0.378																																					p.C147C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T441C	12						.						183.0	190.0	188.0					12																	10601884		2203	4297	6500	10493151	SO:0001819	synonymous_variant	3821	exon6			U54782	CCDS8625.1, CCDS8626.1	12p13	2010-06-30			ENSG00000134545	ENSG00000134545		"""Killer cell lectin-like receptors"", ""CD molecules"""	6374	protein-coding gene	gene with protein product	"""NKG2-1/B activating NK receptor"""	161555		NKG2		9598306	Standard	NM_002259		Approved	NKG2-A, NKG2-B, CD159a	uc001qyl.3	P26715		ENST00000359151.3:c.441T>C	12.37:g.10601884A>G		Somatic		Capture	Illumina HiSeq	Phase_I	10493151	NM_213658		Silent	SNP	ENST00000359151.3	37	CCDS8625.1	.	.	.	.	.	.	.	.	.	.	A	4.504	0.093508	0.08632	.	.	ENSG00000134545	ENST00000543893	.	.	.	4.46	0.149	0.14863	.	.	.	.	.	T	0.30885	0.0779	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28004	-1.0057	4	.	.	.	.	6.4759	0.22034	0.563:0.0:0.437:0.0	.	.	.	.	A	27	.	.	V	-	2	0	KLRC1	10493151	0.090000	0.21635	0.054000	0.19295	0.096000	0.18686	0.285000	0.18883	0.079000	0.16929	0.460000	0.39030	GTA		0.378	KLRC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400115.1	NM_002259	
CAPZA3	93661	broad.mit.edu	37	12	18892062	18892062	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr12:18892062T>C	ENST00000317658.3	+	1	1018	c.860T>C	c.(859-861)gTc>gCc	p.V287A	PLCZ1_ENST00000266505.7_5'Flank|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000539875.1_5'Flank|PLCZ1_ENST00000447925.2_5'Flank|PLCZ1_ENST00000435379.1_5'Flank	NM_033328.2	NP_201585.1	Q96KX2	CAZA3_HUMAN	capping protein (actin filament) muscle Z-line, alpha 3	287					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cortical cytoskeleton (GO:0030863)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|nucleus (GO:0005634)|WASH complex (GO:0071203)		p.V287A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)	19	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				TTAGGATATGTCATTTATTCA	0.373																																					p.V287A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T860C	12						.						53.0	55.0	54.0					12																	18892062		2196	4244	6440	18783329	SO:0001583	missense	93661	exon1			AB053259	CCDS8681.1	12p12.3	2008-02-05			ENSG00000177938	ENSG00000177938			24205	protein-coding gene	gene with protein product		608722				12029070	Standard	NM_033328		Approved	Gsg3, CAPPA3	uc001rdy.3	Q96KX2	OTTHUMG00000169001	ENST00000317658.3:c.860T>C	12.37:g.18892062T>C	ENSP00000326238:p.Val287Ala	Somatic		Capture	Illumina HiSeq	Phase_I	18783329	NM_033328	Q969J0	Missense_Mutation	SNP	ENST00000317658.3	37	CCDS8681.1	.	.	.	.	.	.	.	.	.	.	T	14.15	2.448752	0.43531	.	.	ENSG00000177938	ENST00000317658	.	.	.	4.54	4.54	0.55810	.	0.461885	0.20088	U	0.099506	T	0.18635	0.0447	N	0.08118	0	0.30340	N	0.78586	P	0.38767	0.646	B	0.33339	0.162	T	0.12293	-1.0553	9	0.87932	D	0	-15.0026	11.3515	0.49589	0.0:0.0:0.0:1.0	.	287	Q96KX2	CAZA3_HUMAN	A	287	.	ENSP00000326238:V287A	V	+	2	0	CAPZA3	18783329	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.666000	0.37460	1.910000	0.55303	0.379000	0.24179	GTC		0.373	CAPZA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401902.1	NM_033328	
SYT10	341359	broad.mit.edu	37	12	33559935	33559935	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr12:33559935C>A	ENST00000228567.3	-	3	1162	c.866G>T	c.(865-867)aGa>aTa	p.R289I	RP11-438D14.2_ENST00000561632.1_lincRNA|SYT10_ENST00000567656.1_5'Flank|SYT10_ENST00000535526.1_Missense_Mutation_p.R108I	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	289	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.R289I(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					TAAAGTCTTTCTGTGCACGCG	0.368																																					p.R289I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G866T	12						.						91.0	90.0	90.0					12																	33559935		2203	4300	6503	33451202	SO:0001583	missense	341359	exon3			AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.866G>T	12.37:g.33559935C>A	ENSP00000228567:p.Arg289Ile	Somatic		Capture	Illumina HiSeq	Phase_I	33451202	NM_198992	Q495U2	Missense_Mutation	SNP	ENST00000228567.3	37	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846617	0.91277	.	.	ENSG00000110975	ENST00000228567;ENST00000535526	T;T	0.70516	-0.49;-0.49	4.79	4.79	0.61399	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.43919	U	0.000516	D	0.88187	0.6369	M	0.93638	3.44	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.91290	0.5058	10	0.87932	D	0	.	17.7196	0.88347	0.0:1.0:0.0:0.0	.	289	Q6XYQ8	SYT10_HUMAN	I	289;108	ENSP00000228567:R289I;ENSP00000438691:R108I	ENSP00000228567:R289I	R	-	2	0	SYT10	33451202	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.496000	0.81526	2.577000	0.86979	0.563000	0.77884	AGA		0.368	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992	
KMT2D	8085	broad.mit.edu	37	12	49427667	49427667	+	Silent	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr12:49427667C>T	ENST00000301067.7	-	39	10820	c.10821G>A	c.(10819-10821)caG>caA	p.Q3607Q	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3607	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q3337Q(1)|p.Q3607Q(1)									gctgttgttgctgctgctgct	0.587																																					p.Q3607Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G10821A	12						.						9.0	10.0	10.0					12																	49427667		2180	4267	6447	47713934	SO:0001819	synonymous_variant	8085	exon39			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.10821G>A	12.37:g.49427667C>T		Somatic		Capture	Illumina HiSeq	Phase_I	47713934	NM_003482	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																				0.587	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
SUOX	6821	broad.mit.edu	37	12	56398448	56398448	+	Silent	SNP	C	C	G			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr12:56398448C>G	ENST00000394109.3	+	3	1999	c.1275C>G	c.(1273-1275)gtC>gtG	p.V425V	IKZF4_ENST00000262032.5_5'Flank|SUOX_ENST00000551841.2_3'UTR|SUOX_ENST00000548274.1_Silent_p.V425V|SUOX_ENST00000266971.3_Silent_p.V425V|SUOX_ENST00000356124.4_Silent_p.V425V|SUOX_ENST00000394115.2_Silent_p.V425V			P51687	SUOX_HUMAN	sulfite oxidase	425	Homodimerization. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)	p.V425V(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			AACTTCCTGTCCAGTCGGCCA	0.557																																					p.V425V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1275G	12						.						100.0	102.0	101.0					12																	56398448		2203	4300	6503	54684715	SO:0001819	synonymous_variant	6821	exon6			BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.1275C>G	12.37:g.56398448C>G		Somatic		Capture	Illumina HiSeq	Phase_I	54684715	NM_000456		Silent	SNP	ENST00000394109.3	37	CCDS8901.2																																																																																				0.557	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250309.1	NM_000456	
NEDD1	121441	broad.mit.edu	37	12	97313768	97313768	+	Silent	SNP	T	T	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr12:97313768T>C	ENST00000266742.4	+	6	693	c.354T>C	c.(352-354)caT>caC	p.H118H	NEDD1_ENST00000557644.1_Silent_p.H125H|NEDD1_ENST00000411739.2_Silent_p.H29H|NEDD1_ENST00000555114.1_3'UTR|NEDD1_ENST00000429527.2_Silent_p.H118H|NEDD1_ENST00000457368.2_Silent_p.H29H	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	118					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)		p.H118H(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						TTCAGGATCATAAAGATCAAG	0.333																																					p.H118H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T354C	12						.						144.0	130.0	135.0					12																	97313768		2203	4297	6500	95837899	SO:0001819	synonymous_variant	121441	exon6				CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.354T>C	12.37:g.97313768T>C		Somatic		Capture	Illumina HiSeq	Phase_I	95837899	NM_152905	B0AZN0|B4E145|G3V3F1|Q8NA30	Silent	SNP	ENST00000266742.4	37	CCDS9063.1																																																																																				0.333	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409792.1		
C12orf45	121053	broad.mit.edu	37	12	105388460	105388460	+	Frame_Shift_Del	DEL	A	A	-	rs377159683		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr12:105388460delA	ENST00000552951.1	+	4	587	c.544delA	c.(544-546)aaafs	p.K185fs	C12orf45_ENST00000548583.1_Intron|C12orf45_ENST00000280749.5_3'UTR	NM_152318.2	NP_689531.2	Q8N5I9	CL045_HUMAN	chromosome 12 open reading frame 45	185								p.K184fs*>2(1)		large_intestine(1)|lung(2)	3						TCCAGCAAGTAAAAAAAAGAA	0.353																																					p.K182fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.544delA	12						.						53.0	49.0	50.0					12																	105388460		1814	4077	5891	103912590	SO:0001589	frameshift_variant	121053	exon4			BC032326	CCDS41825.1	12q23.3	2012-05-30			ENSG00000151131	ENSG00000151131			28628	protein-coding gene	gene with protein product						12477932	Standard	NM_152318		Approved	MGC40397	uc001tlb.3	Q8N5I9	OTTHUMG00000169822	ENST00000552951.1:c.544delA	12.37:g.105388460delA	ENSP00000447057:p.Lys185fs	Somatic		Capture	Illumina HiSeq	Phase_I	103912590	NM_152318		Frame_Shift_Del	DEL	ENST00000552951.1	37	CCDS41825.1																																																																																				0.353	C12orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406076.1	NM_152318	
CCDC60	160777	broad.mit.edu	37	12	119968782	119968782	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr12:119968782C>T	ENST00000327554.2	+	13	1930	c.1465C>T	c.(1465-1467)Cgg>Tgg	p.R489W	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	489								p.R489W(1)		endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		CCTGGACTTGCGGATTCGACC	0.512																																					p.R489W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1465T	12						.						118.0	104.0	109.0					12																	119968782		2203	4300	6503	118453165	SO:0001583	missense	160777	exon13			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1465C>T	12.37:g.119968782C>T	ENSP00000333374:p.Arg489Trp	Somatic		Capture	Illumina HiSeq	Phase_I	118453165	NM_178499		Missense_Mutation	SNP	ENST00000327554.2	37	CCDS9190.1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.521605	0.64747	.	.	ENSG00000183273	ENST00000327554	T	0.27557	1.66	5.55	1.64	0.23874	.	0.087499	0.47455	D	0.000223	T	0.51193	0.1660	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.50381	-0.8835	9	.	.	.	-44.7697	13.0562	0.58982	0.4231:0.5769:0.0:0.0	.	489	Q8IWA6	CCD60_HUMAN	W	489	ENSP00000333374:R489W	.	R	+	1	2	CCDC60	118453165	0.996000	0.38824	0.999000	0.59377	0.936000	0.57629	0.260000	0.18424	0.371000	0.24564	-0.262000	0.10625	CGG		0.512	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499	
DOCK9	23348	broad.mit.edu	37	13	99452623	99452623	+	Silent	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr13:99452623C>T	ENST00000376460.1	-	53	5957	c.5877G>A	c.(5875-5877)gcG>gcA	p.A1959A	DOCK9_ENST00000339416.2_Silent_p.A1946A	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1960	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A1960A(1)		breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCCGGAGCTCCGCCACCTTCT	0.582																																					p.R1959Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5876A	13						.						49.0	52.0	51.0					13																	99452623		2146	4256	6402	98250624	SO:0001819	synonymous_variant	23348	exon52			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.5877G>A	13.37:g.99452623C>T		Somatic		Capture	Illumina HiSeq	Phase_I	98250624	NM_015296	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Silent	SNP	ENST00000376460.1	37	CCDS45062.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.666|7.666	0.686056|0.686056	0.14973|0.14973	.|.	.|.	ENSG00000088387|ENSG00000088387	ENST00000400228|ENST00000419908	.|.	.|.	.|.	5.32|5.32	-10.6|-10.6	0.00265|0.00265	.|.	.|.	.|.	.|.	.|.	T|T	0.40595|0.40595	0.1123|0.1123	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.49370|0.49370	-0.8947|-0.8947	4|4	.|.	.|.	.|.	.|.	4.1071|4.1071	0.10041|0.10041	0.0904:0.2373:0.4693:0.203|0.0904:0.2373:0.4693:0.203	.|.	.|.	.|.	.|.	R|Q	522|363	.|.	.|.	G|R	-|-	1|2	0|0	DOCK9|DOCK9	98250624|98250624	0.000000|0.000000	0.05858|0.05858	0.112000|0.112000	0.21494|0.21494	0.890000|0.890000	0.51754|0.51754	-2.828000|-2.828000	0.00745|0.00745	-3.131000|-3.131000	0.00236|0.00236	-2.299000|-2.299000	0.00261|0.00261	GGA|CGG		0.582	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
COL4A1	1282	broad.mit.edu	37	13	110835388	110835388	+	Missense_Mutation	SNP	C	C	T	rs569001394		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr13:110835388C>T	ENST00000375820.4	-	28	2168	c.2047G>A	c.(2047-2049)Gct>Act	p.A683T		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	683	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.A683T(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			TGGCCCACAGCGCCCTTCTCT	0.622																																					p.A683T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2047A	13						.						17.0	20.0	19.0					13																	110835388		2202	4298	6500	109633389	SO:0001583	missense	1282	exon28			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.2047G>A	13.37:g.110835388C>T	ENSP00000364979:p.Ala683Thr	Somatic		Capture	Illumina HiSeq	Phase_I	109633389	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	C	4.935	0.173789	0.09391	.	.	ENSG00000187498	ENST00000375820	D	0.93426	-3.22	4.7	-2.86	0.05717	.	0.399236	0.26237	N	0.025527	T	0.81772	0.4893	L	0.35288	1.05	0.09310	N	0.999991	P	0.47034	0.889	B	0.35510	0.204	T	0.79546	-0.1759	10	0.12430	T	0.62	.	6.8064	0.23780	0.5542:0.2879:0.0929:0.0649	.	683	P02462	CO4A1_HUMAN	T	683	ENSP00000364979:A683T	ENSP00000364979:A683T	A	-	1	0	COL4A1	109633389	0.002000	0.14202	0.001000	0.08648	0.143000	0.21401	0.008000	0.13197	-0.425000	0.07371	-0.314000	0.08810	GCT		0.622	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
METTL3	56339	broad.mit.edu	37	14	21968724	21968724	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr14:21968724T>C	ENST00000298717.4	-	6	1368	c.1217A>G	c.(1216-1218)tAt>tGt	p.Y406C		NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	406					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)	p.Y406C(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		CAGGGTCCCATAGGGCAGTTC	0.507																																					p.Y406C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1217G	14						.						161.0	129.0	140.0					14																	21968724		2203	4300	6503	21038564	SO:0001583	missense	56339	exon6			AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1217A>G	14.37:g.21968724T>C	ENSP00000298717:p.Tyr406Cys	Somatic		Capture	Illumina HiSeq	Phase_I	21038564	NM_019852	O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	ENST00000298717.4	37	CCDS32044.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.119560	0.77323	.	.	ENSG00000165819	ENST00000298717	T	0.52983	0.64	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.79411	0.4441	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86667	0.1908	10	0.87932	D	0	-11.9254	14.2804	0.66208	0.0:0.0:0.0:1.0	.	406	Q86U44	MTA70_HUMAN	C	406	ENSP00000298717:Y406C	ENSP00000298717:Y406C	Y	-	2	0	METTL3	21038564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.373000	0.79623	2.210000	0.71456	0.482000	0.46254	TAT		0.507	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401227.1	NM_019852	
NIN	51199	broad.mit.edu	37	14	51259466	51259466	+	Silent	SNP	C	C	T	rs372665883	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr14:51259466C>T	ENST00000382041.3	-	5	589	c.399G>A	c.(397-399)gcG>gcA	p.A133A	NIN_ENST00000530997.2_Silent_p.A133A|NIN_ENST00000453196.1_Silent_p.A133A|NIN_ENST00000486200.1_5'UTR|NIN_ENST00000389868.3_Silent_p.A133A|NIN_ENST00000245441.5_Silent_p.A133A|NIN_ENST00000324330.9_Silent_p.A133A|NIN_ENST00000382043.4_Silent_p.A133A	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	133					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)	p.A139A(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					GTGAAGGCCGCGCTTCTTCAT	0.577			T	PDGFRB	MPD								C|||	2	0.000399361	0.0	0.0	5008	,	,		18620	0.002		0.0	False		,,,				2504	0.0				p.A133A			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G399A	14						.						108.0	85.0	93.0					14																	51259466		2203	4300	6503	50329216	SO:0001819	synonymous_variant	51199	exon5			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.399G>A	14.37:g.51259466C>T		Somatic		Capture	Illumina HiSeq	Phase_I	50329216	NM_182944	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Silent	SNP	ENST00000382041.3	37	CCDS32079.1																																																																																				0.577	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
PRKCH	5583	broad.mit.edu	37	14	61919982	61919982	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr14:61919982G>A	ENST00000332981.5	+	7	1256	c.871G>A	c.(871-873)Gtg>Atg	p.V291M	PRKCH_ENST00000555082.1_Missense_Mutation_p.V130M	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	291					blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.V291M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		TCAAGCGAACGTGGCCCCTAA	0.468																																					p.V291M	Melanoma(135;863 1779 8064 14443 26348)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G871A	14						.						127.0	108.0	115.0					14																	61919982		2203	4300	6503	60989735	SO:0001583	missense	5583	exon7			M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.871G>A	14.37:g.61919982G>A	ENSP00000329127:p.Val291Met	Somatic		Capture	Illumina HiSeq	Phase_I	60989735	NM_006255	B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	ENST00000332981.5	37	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	G	34	5.379998	0.95945	.	.	ENSG00000027075	ENST00000332981;ENST00000555082;ENST00000553726;ENST00000557585	D;D;D;D	0.94537	-3.45;-3.45;-3.45;-3.45	6.17	6.17	0.99709	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.64402	D	0.000009	D	0.97841	0.9291	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97066	0.9774	10	0.48119	T	0.1	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	291	P24723	KPCL_HUMAN	M	291;130;22;130	ENSP00000329127:V291M;ENSP00000450981:V130M;ENSP00000451793:V22M;ENSP00000451930:V130M	ENSP00000329127:V291M	V	+	1	0	PRKCH	60989735	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GTG		0.468	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255	
GABRG3	2567	broad.mit.edu	37	15	27772702	27772702	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr15:27772702C>T	ENST00000333743.6	+	8	1243	c.989C>T	c.(988-990)gCg>gTg	p.A330V	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	330					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.A330V(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTCTTCGCCGCGCTGATGGAG	0.547																																					p.A330V	NSCLC(114;800 1656 7410 37729 45293)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C989T	15						.						113.0	103.0	106.0					15																	27772702		2155	4263	6418	25446297	SO:0001583	missense	2567	exon8				CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.989C>T	15.37:g.27772702C>T	ENSP00000331912:p.Ala330Val	Somatic		Capture	Illumina HiSeq	Phase_I	25446297	NM_033223	G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	CCDS45195.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.4|21.4	4.150729|4.150729	0.78001|0.78001	.|.	.|.	ENSG00000182256|ENSG00000182256	ENST00000333743|ENST00000451330	D|.	0.87256|.	-2.23|.	5.48|5.48	4.56|4.56	0.56223|0.56223	Neurotransmitter-gated ion-channel transmembrane domain (2);|.	0.052637|.	0.85682|.	N|.	0.000000|.	T|T	0.69314|0.69314	0.3097|0.3097	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.80764|.	0.994|.	T|T	0.68277|0.68277	-0.5451|-0.5451	10|5	0.87932|.	D|.	0|.	.|.	13.4591|13.4591	0.61217|0.61217	0.0:0.9246:0.0:0.0754|0.0:0.9246:0.0:0.0754	.|.	330|.	Q99928|.	GBRG3_HUMAN|.	V|C	330|93	ENSP00000331912:A330V|.	ENSP00000331912:A330V|.	A|R	+|+	2|1	0|0	GABRG3|GABRG3	25446297|25446297	1.000000|1.000000	0.71417|0.71417	0.515000|0.515000	0.27774|0.27774	0.397000|0.397000	0.30659|0.30659	7.461000|7.461000	0.80834|0.80834	1.306000|1.306000	0.44926|0.44926	0.563000|0.563000	0.77884|0.77884	GCG|CGC		0.547	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
TRIM69	140691	broad.mit.edu	37	15	45047132	45047132	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr15:45047132G>A	ENST00000559390.1	+	3	969	c.41G>A	c.(40-42)gGc>gAc	p.G14D	TRIM69_ENST00000338264.4_Intron|TRIM69_ENST00000558329.1_Intron|TRIM69_ENST00000558173.1_5'UTR|TRIM69_ENST00000561043.1_Intron|TRIM69_ENST00000329464.4_Missense_Mutation_p.G14D|TRIM69_ENST00000560442.1_Intron			Q86WT6	TRI69_HUMAN	tripartite motif containing 69	14	Necessary for nuclear localization. {ECO:0000250}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G14D(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(9)|skin(1)	20		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)		ATCGATCCAGGCGACTATGTT	0.418																																					p.G14D	Pancreas(84;519 1450 1802 20427 34706)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G41A	15						.						133.0	124.0	127.0					15																	45047132		2198	4298	6496	42834424	SO:0001583	missense	140691	exon2			AF302088	CCDS10114.1, CCDS32220.1, CCDS73719.1	15q15-q21	2013-01-09	2011-01-25	2006-09-26	ENSG00000185880	ENSG00000185880		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	17857	protein-coding gene	gene with protein product			"""ring finger protein 36"", ""tripartite motif-containing 69"""	RNF36			Standard	XM_005254162		Approved	Trif, TRIMLESS	uc001zug.1	Q86WT6	OTTHUMG00000131246	ENST00000559390.1:c.41G>A	15.37:g.45047132G>A	ENSP00000453177:p.Gly14Asp	Somatic		Capture	Illumina HiSeq	Phase_I	42834424	NM_182985	A8MX03|Q309B0|Q4G1A5|Q6W897|Q8IYY3|Q8WY16|Q8WY17	Missense_Mutation	SNP	ENST00000559390.1	37	CCDS32220.1	.	.	.	.	.	.	.	.	.	.	G	7.452	0.642980	0.14451	.	.	ENSG00000185880	ENST00000329464	T	0.37584	1.19	5.07	-1.73	0.08081	.	0.719560	0.12565	N	0.457867	T	0.15565	0.0375	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29366	-1.0014	10	0.11485	T	0.65	.	4.3462	0.11134	0.5194:0.0:0.3137:0.1669	.	14	Q86WT6	TRI69_HUMAN	D	14	ENSP00000332284:G14D	ENSP00000332284:G14D	G	+	2	0	TRIM69	42834424	0.000000	0.05858	0.003000	0.11579	0.024000	0.10985	0.078000	0.14761	-0.161000	0.10983	-1.059000	0.02297	GGC		0.418	TRIM69-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416171.1		
LRRC49	54839	broad.mit.edu	37	15	71276571	71276571	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr15:71276571C>A	ENST00000260382.5	+	11	1404	c.1144C>A	c.(1144-1146)Ctc>Atc	p.L382I	LRRC49_ENST00000443425.2_Missense_Mutation_p.L338I|LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000560158.2_Missense_Mutation_p.L70I|LRRC49_ENST00000544974.2_Missense_Mutation_p.L372I|LRRC49_ENST00000560691.1_Missense_Mutation_p.L88I|LRRC49_ENST00000560369.1_Missense_Mutation_p.L387I	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	382						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.L382I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						TGGAAGCACCCTCTCTGCATT	0.403																																					p.L382I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1144A	15						.						109.0	99.0	102.0					15																	71276571		2199	4297	6496	69063625	SO:0001583	missense	54839	exon11				CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1144C>A	15.37:g.71276571C>A	ENSP00000260382:p.Leu382Ile	Somatic		Capture	Illumina HiSeq	Phase_I	69063625	NM_017691	B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Missense_Mutation	SNP	ENST00000260382.5	37	CCDS32282.1	.	.	.	.	.	.	.	.	.	.	C	4.152	0.026564	0.08054	.	.	ENSG00000137821	ENST00000544974;ENST00000260382;ENST00000443425;ENST00000436542	T;T;T	0.20738	2.05;2.05;2.05	4.31	-3.45	0.04781	.	0.946288	0.08829	N	0.887560	T	0.07458	0.0188	N	0.03608	-0.345	0.09310	N	0.999998	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.001;0.001;0.0;0.0	T	0.41945	-0.9480	10	0.16896	T	0.51	-6.0E-4	8.0733	0.30701	0.2811:0.1711:0.5478:0.0	.	387;354;338;382;372	B7Z366;G5E9Q1;G5E9T5;Q8IUZ0;F5H1J4	.;.;.;LRC49_HUMAN;.	I	372;382;338;354	ENSP00000439600:L372I;ENSP00000260382:L382I;ENSP00000414065:L338I	ENSP00000260382:L382I	L	+	1	0	LRRC49	69063625	0.000000	0.05858	0.775000	0.31657	0.870000	0.49936	-0.113000	0.10774	-0.543000	0.06240	0.467000	0.42956	CTC		0.403	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417209.3	NM_017691	
MYO9A	4649	broad.mit.edu	37	15	72118930	72118930	+	Silent	SNP	A	A	G			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr15:72118930A>G	ENST00000356056.5	-	42	8110	c.7638T>C	c.(7636-7638)ttT>ttC	p.F2546F	MYO9A_ENST00000564571.1_3'UTR|MYO9A_ENST00000424560.1_Silent_p.F2617F|MYO9A_ENST00000444904.1_Silent_p.F2527F	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2546					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)	p.F2546F(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TTCAGACCATAAATTCATTAT	0.502																																					p.F2546F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T7638C	15						.						103.0	106.0	105.0					15																	72118930		2199	4297	6496	69905984	SO:0001819	synonymous_variant	4649	exon42			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.7638T>C	15.37:g.72118930A>G		Somatic		Capture	Illumina HiSeq	Phase_I	69905984	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Silent	SNP	ENST00000356056.5	37	CCDS10239.1																																																																																				0.502	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
HOMER2	9455	broad.mit.edu	37	15	83561566	83561566	+	Silent	SNP	C	C	T	rs201522712		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr15:83561566C>T	ENST00000304231.8	-	2	225	c.33G>A	c.(31-33)gcG>gcA	p.A11A	HOMER2_ENST00000426485.1_Silent_p.A11A|HOMER2_ENST00000399166.2_Silent_p.A11A|HOMER2_ENST00000450735.2_Silent_p.A11A	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	11	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.A11A(1)		cervix(1)|endometrium(2)|lung(6)	9						GGAAGACATGCGCTCGGGTGG	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		17338	0.0		0.001	False		,,,				2504	0.0				p.A11A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G33A	15						.						141.0	140.0	141.0					15																	83561566		2008	4172	6180	81352570	SO:0001819	synonymous_variant	9455	exon2			AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.33G>A	15.37:g.83561566C>T		Somatic		Capture	Illumina HiSeq	Phase_I	81352570	NM_199331	O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Silent	SNP	ENST00000304231.8	37	CCDS45334.1																																																																																				0.483	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418689.1		
NR2F2	7026	broad.mit.edu	37	15	96875543	96875545	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	AGC	AGC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr15:96875543_96875545delAGC	ENST00000394166.3	+	1	1598_1600	c.209_211delAGC	c.(208-213)aagcag>aag	p.Q75del	NR2F2_ENST00000453270.2_5'Flank|NR2F2_ENST00000394171.2_5'Flank|NR2F2_ENST00000421109.2_Intron|MIR1469_ENST00000410719.1_RNA	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	75	Poly-Gln.		Q -> QQ (in CHTD4; the mutation results in reduced transcription activation of the EGR1 promoter; does not affect transcription activation of the APOB FT promoter). {ECO:0000269|PubMed:24702954}.		anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.Q75delQ(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			GGTAGCGACAAGCAGCAGCAGCA	0.695																																					p.70_71del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.209_211del	15						.																																			94676549	SO:0001651	inframe_deletion	7026	exon1			M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.209_211delAGC	15.37:g.96875552_96875554delAGC	ENSP00000377721:p.Gln75del	Somatic		Capture	Illumina HiSeq	Phase_I	94676547	NM_021005	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	In_Frame_Del	DEL	ENST00000394166.3	37	CCDS10375.1																																																																																				0.695	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
ARMC5	79798	broad.mit.edu	37	16	31475899	31475900	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr16:31475899_31475900insG	ENST00000563544.1	+	5	2101_2102	c.1555_1556insG	c.(1555-1557)tggfs	p.W519fs	ARMC5_ENST00000538189.1_Frame_Shift_Ins_p.W551fs|ARMC5_ENST00000412665.2_Frame_Shift_Ins_p.W163fs|ARMC5_ENST00000268314.4_Frame_Shift_Ins_p.W519fs|ARMC5_ENST00000408912.3_Frame_Shift_Ins_p.W614fs|ARMC5_ENST00000457010.2_Frame_Shift_Ins_p.W519fs			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	519								p.R616fs*17(1)		central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CGAGGAGCCTTGGGGACGCGAA	0.748																																					p.W519fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1555_1556insG	16						.																																			31383401	SO:0001589	frameshift_variant	79798	exon4			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1559dupG	16.37:g.31475903_31475903dupG	ENSP00000456877:p.Trp519fs	Somatic		Capture	Illumina HiSeq	Phase_I	31383400	NM_001105247	Q86WM9|Q9H7P8|Q9H925	Frame_Shift_Ins	INS	ENST00000563544.1	37	CCDS45472.1																																																																																				0.748	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742	
CDH11	1009	broad.mit.edu	37	16	64984700	64984700	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr16:64984700C>T	ENST00000268603.4	-	12	2479	c.1864G>A	c.(1864-1866)Gcc>Acc	p.A622T	CDH11_ENST00000566827.1_Missense_Mutation_p.A496T|CDH11_ENST00000394156.3_Missense_Mutation_p.A622T	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	622					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A622T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GCGAGGATGGCGATCAGGGCG	0.622			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.A622T			Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1864A	16						.						66.0	51.0	56.0					16																	64984700		2203	4300	6503	63542201	SO:0001583	missense	1009	exon12			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1864G>A	16.37:g.64984700C>T	ENSP00000268603:p.Ala622Thr	Somatic		Capture	Illumina HiSeq	Phase_I	63542201	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.093907	0.76870	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.62232	0.04;0.27	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.80319	0.4601	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.963	T	0.81202	-0.1040	10	0.72032	D	0.01	.	19.0707	0.93134	0.0:1.0:0.0:0.0	.	622;622	P55287-2;P55287	.;CAD11_HUMAN	T	622;622;605	ENSP00000268603:A622T;ENSP00000377711:A622T	ENSP00000268603:A622T	A	-	1	0	CDH11	63542201	1.000000	0.71417	0.994000	0.49952	0.333000	0.28666	7.818000	0.86416	2.746000	0.94184	0.655000	0.94253	GCC		0.622	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
ZNF720	124411	broad.mit.edu	37	16	31766200	31766200	+	Intron	DEL	C	C	-			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr16:31766200delC	ENST00000316491.9	+	4	560				ZNF720_ENST00000534369.1_Intron|ZNF720_ENST00000398696.3_3'UTR|ZNF720_ENST00000531864.2_Intron|ZNF720_ENST00000399681.3_Frame_Shift_Del_p.Y196fs|ZNF720_ENST00000539915.1_Intron	NM_001130913.1	NP_001124385.1	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)	p.Y196fs*1(1)		endometrium(1)|kidney(1)|lung(1)|stomach(1)	4						AGAAACCATACAAATGTAAAG	0.333																																					.												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	.	16						.																																			31673701	SO:0001627	intron_variant	124411	.			AK128671	CCDS45473.1	16p11.2	2013-01-08				ENSG00000197302		"""Zinc fingers, C2H2-type"", ""-"""	26987	protein-coding gene	gene with protein product							Standard	NM_001130913		Approved		uc002ecq.3	Q7Z2F6		ENST00000316491.9:c.361+979C>-	16.37:g.31766200delC		Somatic		Capture	Illumina HiSeq	Phase_I	31673701	.	Q6ZQX1	Frame_Shift_Del	DEL	ENST00000316491.9	37	CCDS45473.1																																																																																				0.333	ZNF720-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394883.3	NM_001004300	
ANKRD11	29123	broad.mit.edu	37	16	89351863	89351863	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr16:89351863C>T	ENST00000301030.4	-	9	1547	c.1087G>A	c.(1087-1089)Gac>Aac	p.D363N	ANKRD11_ENST00000378330.2_Missense_Mutation_p.D363N	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	363					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.D363N(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		AGGTGCTTGTCGTCCACCGGA	0.463																																					p.D363N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1087A	16						.						164.0	167.0	166.0					16																	89351863		2198	4300	6498	87879364	SO:0001583	missense	29123	exon9			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1087G>A	16.37:g.89351863C>T	ENSP00000301030:p.Asp363Asn	Somatic		Capture	Illumina HiSeq	Phase_I	87879364	NM_013275	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450112	0.84101	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000378332	T;T	0.56941	0.43;0.43	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.73125	0.3547	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.75581	-0.3268	10	0.72032	D	0.01	.	19.1694	0.93570	0.0:1.0:0.0:0.0	.	363	Q6UB99	ANR11_HUMAN	N	363;363;377	ENSP00000301030:D363N;ENSP00000367581:D363N	ENSP00000301030:D363N	D	-	1	0	ANKRD11	87879364	1.000000	0.71417	0.998000	0.56505	0.524000	0.34500	7.622000	0.83099	2.539000	0.85634	0.563000	0.77884	GAC		0.463	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
WSCD1	23302	broad.mit.edu	37	17	5991335	5991335	+	Silent	SNP	C	C	T	rs199602819		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr17:5991335C>T	ENST00000574946.1	+	3	843	c.453C>T	c.(451-453)gaC>gaT	p.D151D	WSCD1_ENST00000574232.1_Silent_p.D151D|WSCD1_ENST00000539421.1_Silent_p.D151D|WSCD1_ENST00000573634.1_Silent_p.D35D|WSCD1_ENST00000317744.5_Silent_p.D151D			Q658N2	WSCD1_HUMAN	WSC domain containing 1	151	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.D151D(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						GCTTCAGTGACGATGGCCACG	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		19234	0.0		0.001	False		,,,				2504	0.0				p.D151D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C453T	17						.						149.0	127.0	134.0					17																	5991335		2203	4300	6503	5932059	SO:0001819	synonymous_variant	23302	exon3				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.453C>T	17.37:g.5991335C>T		Somatic		Capture	Illumina HiSeq	Phase_I	5932059	NM_015253	A8K0N8|D3DTM3|O60276|Q96G45	Silent	SNP	ENST00000574946.1	37	CCDS32538.1																																																																																				0.542	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253	
CDK12	51755	broad.mit.edu	37	17	37682320	37682320	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr17:37682320G>A	ENST00000447079.4	+	13	3544	c.3511G>A	c.(3511-3513)Gag>Aag	p.E1171K	CDK12_ENST00000430627.2_Missense_Mutation_p.E1171K	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	1171					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.E1171K(1)|p.E1171Q(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GCAGGACTCAGAGACCATGGC	0.567			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																											p.E1171K			Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	.	2	Substitution - Missense(2)	large_intestine(1)|NS(1)	c.G3511A	17						.						73.0	66.0	68.0					17																	37682320		2203	4300	6503	34935846	SO:0001583	missense	51755	exon13			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.3511G>A	17.37:g.37682320G>A	ENSP00000398880:p.Glu1171Lys	Somatic		Capture	Illumina HiSeq	Phase_I	34935846	NM_016507	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901634	0.52227	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.68624	-0.34;-0.33	5.28	5.28	0.74379	.	0.000000	0.48286	D	0.000192	T	0.53158	0.1779	L	0.34521	1.04	0.37768	D	0.926558	B;B;B	0.32829	0.267;0.267;0.386	B;B;B	0.28011	0.039;0.039;0.085	T	0.56553	-0.7960	10	0.29301	T	0.29	-14.0043	13.6707	0.62422	0.0:0.1546:0.8454:0.0	.	1170;1171;1171	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	K	1171	ENSP00000407720:E1171K;ENSP00000398880:E1171K	ENSP00000407720:E1171K	E	+	1	0	CDK12	34935846	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.951000	0.63610	2.636000	0.89361	0.650000	0.86243	GAG		0.567	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
SOX9	6662	broad.mit.edu	37	17	70119734	70119734	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr17:70119734C>T	ENST00000245479.2	+	3	1108	c.736C>T	c.(736-738)Cag>Tag	p.Q246*		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	246					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q246*(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			AACCGACGTGCAGCCGGGCAA	0.632																																					p.Q246X	Pancreas(42;83 1041 2320 35205 39456)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C736T	17	GRCh37	CI962352	SOX9	I		.						76.0	99.0	91.0					17																	70119734		2203	4300	6503	67631329	SO:0001587	stop_gained	6662	exon3			S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.736C>T	17.37:g.70119734C>T	ENSP00000245479:p.Gln246*	Somatic		Capture	Illumina HiSeq	Phase_I	67631329	NM_000346	Q53Y80	Nonsense_Mutation	SNP	ENST00000245479.2	37	CCDS11689.1	.	.	.	.	.	.	.	.	.	.	C	39	7.763682	0.98477	.	.	ENSG00000125398	ENST00000245479;ENST00000455872	.	.	.	4.53	4.53	0.55603	.	0.433499	0.23519	N	0.047319	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	16.8595	0.86014	0.0:1.0:0.0:0.0	.	.	.	.	X	246	.	ENSP00000245479:Q246X	Q	+	1	0	SOX9	67631329	0.997000	0.39634	1.000000	0.80357	0.794000	0.44872	3.560000	0.53763	2.062000	0.61559	0.462000	0.41574	CAG		0.632	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
LAMA1	284217	broad.mit.edu	37	18	7002366	7002366	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr18:7002366C>T	ENST00000389658.3	-	30	4372	c.4279G>A	c.(4279-4281)Gca>Aca	p.A1427T		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1427	Laminin EGF-like 15. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.A1427T(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TGGTCACCTGCTGTGTTATCG	0.488																																					p.A1427T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4279A	18						.						218.0	180.0	193.0					18																	7002366		2203	4300	6503	6992366	SO:0001583	missense	284217	exon30			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4279G>A	18.37:g.7002366C>T	ENSP00000374309:p.Ala1427Thr	Somatic		Capture	Illumina HiSeq	Phase_I	6992366	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	9.914	1.210220	0.22289	.	.	ENSG00000101680	ENST00000389658	T	0.61627	0.09	6.17	-6.47	0.01902	EGF-like, laminin (4);	0.818534	0.11504	N	0.557354	T	0.33177	0.0854	N	0.13235	0.315	0.09310	N	1	B	0.16802	0.019	B	0.19666	0.026	T	0.32587	-0.9901	10	0.13853	T	0.58	.	13.3221	0.60438	0.1642:0.7001:0.0:0.1356	.	1427	P25391	LAMA1_HUMAN	T	1427	ENSP00000374309:A1427T	ENSP00000374309:A1427T	A	-	1	0	LAMA1	6992366	0.000000	0.05858	0.000000	0.03702	0.319000	0.28217	-0.567000	0.05916	-1.349000	0.02202	0.655000	0.94253	GCA		0.488	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
TRAPPC8	22878	broad.mit.edu	37	18	29426742	29426742	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr18:29426742T>A	ENST00000283351.4	-	26	4109	c.3774A>T	c.(3772-3774)gaA>gaT	p.E1258D	RP11-210K20.2_ENST00000582269.1_RNA|TRAPPC8_ENST00000582539.1_Missense_Mutation_p.E1204D	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	1258					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.E1258D(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GATGTTGACCTTCCAAAATAA	0.383																																					p.E1258D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3774T	18						.						208.0	199.0	202.0					18																	29426742		2203	4300	6503	27680740	SO:0001583	missense	22878	exon26			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.3774A>T	18.37:g.29426742T>A	ENSP00000283351:p.Glu1258Asp	Somatic		Capture	Illumina HiSeq	Phase_I	27680740	NM_014939	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	T	14.35	2.509270	0.44660	.	.	ENSG00000153339	ENST00000283351	T	0.18016	2.24	5.65	5.65	0.86999	.	0.093435	0.64402	D	0.000001	T	0.17704	0.0425	M	0.67953	2.075	0.80722	D	1	P	0.35944	0.529	B	0.28465	0.09	T	0.02683	-1.1124	10	0.34782	T	0.22	.	11.7496	0.51841	0.0:0.0706:0.0:0.9294	.	1258	Q9Y2L5	TPPC8_HUMAN	D	1258	ENSP00000283351:E1258D	ENSP00000283351:E1258D	E	-	3	2	TRAPPC8	27680740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.060000	0.49955	2.146000	0.66826	0.533000	0.62120	GAA		0.383	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
PRR12	57479	broad.mit.edu	37	19	50099983	50099984	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr19:50099983_50099984insC	ENST00000418929.2	+	4	2403_2404	c.2391_2392insC	c.(2392-2394)cccfs	p.P798fs		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)	p.Q800fs*26(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		TGCCTCCGCCTCCCCCCCAGCT	0.723																																					p.P797fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2391_2392insC	19						.																																			54791796	SO:0001589	frameshift_variant	57479	exon4			AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.2398dupC	19.37:g.50099990_50099990dupC	ENSP00000394510:p.Pro798fs	Somatic		Capture	Illumina HiSeq	Phase_I	54791795	NM_020719	E9PB06|Q8N4J6	Frame_Shift_Ins	INS	ENST00000418929.2	37	CCDS46143.1																																																																																				0.723	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
ZNF443	10224	broad.mit.edu	37	19	12541522	12541522	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr19:12541522G>C	ENST00000301547.5	-	4	1661	c.1464C>G	c.(1462-1464)ttC>ttG	p.F488L	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	488					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F488L(2)		breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						GAAAGGAACAGAAATCAATAC	0.418																																					p.F488L												.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.C1464G	19						.						64.0	67.0	66.0					19																	12541522		2202	4300	6502	12402522	SO:0001583	missense	10224	exon4			AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1464C>G	19.37:g.12541522G>C	ENSP00000301547:p.Phe488Leu	Somatic		Capture	Illumina HiSeq	Phase_I	12402522	NM_005815		Missense_Mutation	SNP	ENST00000301547.5	37	CCDS32918.1	.	.	.	.	.	.	.	.	.	.	G	0.030	-1.343342	0.01277	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	T	0.07216	3.21	1.33	-1.34	0.09143	Zinc finger, C2H2-like (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02767	0.0083	N	0.02697	-0.525	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.48007	-0.9072	9	0.15066	T	0.55	.	5.8886	0.18896	0.0:0.2111:0.5728:0.2161	.	488	Q9Y2A4	ZN443_HUMAN	L	488	ENSP00000301547:F488L	ENSP00000301547:F488L	F	-	3	2	ZNF443	12402522	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.795000	0.04580	-0.284000	0.09102	-0.376000	0.06991	TTC		0.418	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815	
SYT3	84258	broad.mit.edu	37	19	51128782	51128782	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr19:51128782C>T	ENST00000338916.4	-	6	2075	c.1442G>A	c.(1441-1443)cGt>cAt	p.R481H	SYT3_ENST00000593901.1_Missense_Mutation_p.R481H|SYT3_ENST00000544769.1_Missense_Mutation_p.R481H|SYT3_ENST00000600079.1_Missense_Mutation_p.R481H	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	481	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.R481H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CTTCTTCAGACGCCGCCCCTC	0.582																																					p.R481H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1442A	19						.						64.0	57.0	59.0					19																	51128782		2203	4300	6503	55820594	SO:0001583	missense	84258	exon6			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1442G>A	19.37:g.51128782C>T	ENSP00000340914:p.Arg481His	Somatic		Capture	Illumina HiSeq	Phase_I	55820594	NM_032298	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.198400	0.79015	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.72615	-0.67;-0.67	3.47	3.47	0.39725	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.086035	0.43110	U	0.000609	T	0.76793	0.4037	M	0.76433	2.335	0.51767	D	0.99993	D	0.67145	0.996	P	0.51297	0.665	T	0.82000	-0.0674	10	0.87932	D	0	.	14.1811	0.65574	0.0:1.0:0.0:0.0	.	481	Q9BQG1	SYT3_HUMAN	H	481	ENSP00000340914:R481H;ENSP00000438883:R481H	ENSP00000340914:R481H	R	-	2	0	SYT3	55820594	0.949000	0.32298	0.997000	0.53966	0.607000	0.37147	7.614000	0.82996	1.689000	0.51079	0.549000	0.68633	CGT		0.582	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
SIGLEC8	27181	broad.mit.edu	37	19	51958726	51958726	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr19:51958726C>T	ENST00000321424.3	-	4	1063	c.997G>A	c.(997-999)Gct>Act	p.A333T	SIGLEC8_ENST00000430817.1_Missense_Mutation_p.A224T|SIGLEC8_ENST00000597352.1_5'Flank|SIGLEC8_ENST00000340550.5_Missense_Mutation_p.A240T	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	333	Ig-like C2-type 2.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.A333T(1)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GAGCCCTGAGCGTTCTGAGCT	0.637																																					p.A333T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G997A	19						.						58.0	55.0	56.0					19																	51958726		2203	4300	6503	56650538	SO:0001583	missense	27181	exon4			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.997G>A	19.37:g.51958726C>T	ENSP00000321077:p.Ala333Thr	Somatic		Capture	Illumina HiSeq	Phase_I	56650538	NM_014442	Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	12.97	2.097248	0.37048	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.11063	2.81;2.81;2.81	2.19	-3.0	0.05480	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.662100	0.04068	N	0.307580	T	0.06872	0.0175	N	0.25332	0.735	0.09310	N	1	P;P;B	0.41624	0.757;0.589;0.188	B;B;B	0.38755	0.281;0.068;0.108	T	0.11251	-1.0595	10	0.49607	T	0.09	.	1.0693	0.01618	0.2472:0.1928:0.3955:0.1645	.	224;240;333	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	T	224;333;240	ENSP00000389142:A224T;ENSP00000321077:A333T;ENSP00000339448:A240T	ENSP00000321077:A333T	A	-	1	0	SIGLEC8	56650538	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.893000	0.04127	-1.144000	0.02862	-2.124000	0.00347	GCT		0.637	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
IZUMO4	113177	broad.mit.edu	37	19	2097297	2097297	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr19:2097297delG	ENST00000395301.3	+	2	328	c.264delG	c.(262-264)atgfs	p.M88fs	IZUMO4_ENST00000395296.1_Frame_Shift_Del_p.M88fs|IZUMO4_ENST00000395307.2_Frame_Shift_Del_p.M88fs|IZUMO4_ENST00000588003.1_3'UTR|MOB3A_ENST00000357066.3_5'Flank	NM_001039846.1	NP_001034935.1	Q1ZYL8	IZUM4_HUMAN	IZUMO family member 4	88						extracellular region (GO:0005576)|nucleus (GO:0005634)		p.D89fs*83(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	6						ACCAGATGATGGATCAGCTGT	0.697											OREG0025135	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M88fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.264delG	19						.						41.0	47.0	45.0					19																	2097297		2203	4299	6502	2048297	SO:0001589	frameshift_variant	113177	exon2			BC014609	CCDS35499.1, CCDS42458.1	19p13.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000099840	ENSG00000099840		"""-"""	26950	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 36"""	C19orf36		12975309, 19658160, 22957301	Standard	XM_005259480		Approved		uc002luw.1	Q1ZYL8	OTTHUMG00000141290	ENST00000395301.3:c.264delG	19.37:g.2097297delG	ENSP00000378712:p.Met88fs	Somatic	9	Capture	Illumina HiSeq	Phase_I	2048297	NM_001039846	A7RA93|A7RA94|Q6UXA2|Q96FT6|Q96L02	Frame_Shift_Del	DEL	ENST00000395301.3	37	CCDS42458.1																																																																																				0.697	IZUMO4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280536.3	NM_052878	
C3	718	broad.mit.edu	37	19	6720581	6720581	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr19:6720581G>A	ENST00000245907.6	-	1	112	c.20C>T	c.(19-21)cCc>cTc	p.P7L		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	7					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.P7L(1)		breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CAGCAGGCTGGGACCTGAGGT	0.627																																					p.P7L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C20T	19						.						38.0	33.0	35.0					19																	6720581		2200	4298	6498	6671581	SO:0001583	missense	718	exon1			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.20C>T	19.37:g.6720581G>A	ENSP00000245907:p.Pro7Leu	Somatic		Capture	Illumina HiSeq	Phase_I	6671581	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	G	4.754	0.140213	0.09083	.	.	ENSG00000125730	ENST00000245907	T	0.76968	-1.06	4.12	1.98	0.26296	.	1.094840	0.07096	N	0.839575	T	0.63343	0.2503	L	0.31420	0.93	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.45056	-0.9287	10	0.11794	T	0.64	.	6.6656	0.23039	0.2156:0.0:0.7844:0.0	.	7	P01024	CO3_HUMAN	L	7	ENSP00000245907:P7L	ENSP00000245907:P7L	P	-	2	0	C3	6671581	0.500000	0.26091	0.023000	0.16930	0.037000	0.13140	0.808000	0.27154	0.690000	0.31570	-0.378000	0.06908	CCC		0.627	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
MUC16	94025	broad.mit.edu	37	19	9091401	9091401	+	Silent	SNP	T	T	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr19:9091401T>C	ENST00000397910.4	-	1	617	c.414A>G	c.(412-414)ggA>ggG	p.G138G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	138	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.G138G(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTAAAATTTCCTTCTGTGG	0.493																																					p.G138G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A414G	19						.						91.0	91.0	91.0					19																	9091401		1962	4156	6118	8952401	SO:0001819	synonymous_variant	94025	exon1			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.414A>G	19.37:g.9091401T>C		Somatic		Capture	Illumina HiSeq	Phase_I	8952401	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF560	147741	broad.mit.edu	37	19	9579828	9579828	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr19:9579828G>T	ENST00000301480.4	-	9	778	c.565C>A	c.(565-567)Ctt>Att	p.L189I		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	189					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L189I(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TCTTGCCAAAGGGCTGGCCCT	0.308																																					p.L189I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C565A	19						.						28.0	28.0	28.0					19																	9579828		2201	4298	6499	9440828	SO:0001583	missense	147741	exon9			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.565C>A	19.37:g.9579828G>T	ENSP00000301480:p.Leu189Ile	Somatic		Capture	Illumina HiSeq	Phase_I	9440828	NM_152476	Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	G	3.483	-0.105442	0.06967	.	.	ENSG00000198028	ENST00000301480	T	0.06849	3.25	1.99	-3.98	0.04082	.	.	.	.	.	T	0.03651	0.0104	N	0.19112	0.55	0.09310	N	1	B	0.26744	0.158	B	0.19946	0.027	T	0.43343	-0.9397	9	0.21540	T	0.41	.	2.3484	0.04277	0.1244:0.3337:0.373:0.1689	.	189	Q96MR9	ZN560_HUMAN	I	189	ENSP00000301480:L189I	ENSP00000301480:L189I	L	-	1	0	ZNF560	9440828	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-1.294000	0.02767	-1.021000	0.03350	0.555000	0.69702	CTT		0.308	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	
KCNC3	3748	broad.mit.edu	37	19	50831719	50831719	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr19:50831719delG	ENST00000477616.1	-	1	915	c.621delC	c.(619-621)cccfs	p.P207fs	KCNC3_ENST00000474951.1_Intron|KCNC3_ENST00000376959.2_Frame_Shift_Del_p.P207fs|NR1H2_ENST00000542413.1_5'Flank|KCNC3_ENST00000391818.2_Intron	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	207					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)	p.A208fs*116(1)		endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	CGGCGCCCGCGGGGTCGGGCG	0.776																																					p.P207fs	Melanoma(91;1496 2324 50908)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.621delC	19						.						6.0	8.0	7.0					19																	50831719		2056	4117	6173	55523531	SO:0001589	frameshift_variant	3748	exon1			AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.621delC	19.37:g.50831719delG	ENSP00000434241:p.Pro207fs	Somatic		Capture	Illumina HiSeq	Phase_I	55523531	NM_004977		Frame_Shift_Del	DEL	ENST00000477616.1	37	CCDS12793.1																																																																																				0.776	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314288.2	NM_004977	
ZNF135	7694	broad.mit.edu	37	19	58571403	58571403	+	Splice_Site	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr19:58571403G>A	ENST00000313434.5	+	2	134	c.33G>A	c.(31-33)ccG>ccA	p.P11P	ZNF135_ENST00000439855.2_Splice_Site_p.P11P|ZNF135_ENST00000401053.4_Intron|ZNF135_ENST00000511556.1_Splice_Site_p.P11P|ZNF135_ENST00000359978.6_Intron|ZNF135_ENST00000506786.1_De_novo_Start_InFrame	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	11					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P11P(1)		breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CCACAGACCCGGTGAGAATCT	0.697																																					p.P11P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G33A	19						.						82.0	67.0	72.0					19																	58571403		2203	4300	6503	63263215	SO:0001630	splice_region_variant	7694	exon2			U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.33+1G>A	19.37:g.58571403G>A		Somatic		Capture	Illumina HiSeq	Phase_I	63263215	NM_003436	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Silent	SNP	ENST00000313434.5	37																																																																																					0.697	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	Silent
KIF26B	55083	broad.mit.edu	37	1	245851079	245851080	+	Frame_Shift_Ins	INS	-	-	C	rs372309449		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:245851079_245851080insC	ENST00000407071.2	+	12	5234_5235	c.4794_4795insC	c.(4795-4797)cccfs	p.P1599fs	KIF26B_ENST00000366518.4_Frame_Shift_Ins_p.P1218fs	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1599					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CTCCCCCTCTGCCCCCTGTCCG	0.688																																					p.L1598fs												.	.	0			c.4794_4795insC	1						.																																			243917703	SO:0001589	frameshift_variant	55083	exon12			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4799dupC	1.37:g.245851084_245851084dupC	ENSP00000385545:p.Pro1599fs	None		Capture	Illumina HiSeq	Phase_I	243917702	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Frame_Shift_Ins	INS	ENST00000407071.2	37	CCDS44342.1																																																																																				0.688	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
COL16A1	1307	broad.mit.edu	37	1	32149776	32149777	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:32149776_32149777insC	ENST00000373672.3	-	32	2732_2733	c.2216_2217insG	c.(2215-2217)ggafs	p.G739fs	COL16A1_ENST00000271069.6_Frame_Shift_Ins_p.G738fs|COL16A1_ENST00000373668.3_Frame_Shift_Ins_p.G739fs	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	739	Triple-helical region 5 (COL5) with 3 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GCCCAGGCCGTCCTGCCATGTC	0.693																																					p.G739fs	Colon(143;498 1786 21362 25193 36625)											.	.	0			c.2217_2218insG	1						.																																			31922364	SO:0001589	frameshift_variant	1307	exon32			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2217dupG	1.37:g.32149778_32149778dupC	ENSP00000362776:p.Gly739fs	None		Capture	Illumina HiSeq	Phase_I	31922363	NM_001856	Q16593|Q59F89|Q71RG9	Frame_Shift_Ins	INS	ENST00000373672.3	37	CCDS41297.1																																																																																				0.693	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
PRDM2	7799	broad.mit.edu	37	1	14107534	14107534	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:14107534T>A	ENST00000235372.7	+	8	4100	c.3244T>A	c.(3244-3246)Tca>Aca	p.S1082T	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.S881T|PRDM2_ENST00000343137.4_Missense_Mutation_p.S881T|PRDM2_ENST00000311066.5_Missense_Mutation_p.S1082T	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1082					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S1082T(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		CTCCGCAATATCATCTGTTGT	0.453																																					p.S881T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2641A	1						.						55.0	50.0	52.0					1																	14107534		2203	4300	6503	13980121	SO:0001583	missense	7799	exon3			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.3244T>A	1.37:g.14107534T>A	ENSP00000235372:p.Ser1082Thr	Somatic		Capture	Illumina HiSeq	Phase_I	13980121	NM_001007257	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	T	7.846	0.723009	0.15439	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01787	4.74;4.64;4.64;4.64	5.97	5.97	0.96955	.	0.063541	0.64402	D	0.000004	T	0.09202	0.0227	M	0.71581	2.175	0.48901	D	0.999726	D;D;D	0.71674	0.997;0.997;0.998	D;D;D	0.78314	0.98;0.98;0.991	T	0.25537	-1.0129	10	0.29301	T	0.29	.	15.2744	0.73732	0.0:0.0:0.0:1.0	.	940;1082;1082	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	T	1082;1082;1082;881;881	ENSP00000235372:S1082T;ENSP00000312352:S1082T;ENSP00000411103:S881T;ENSP00000341621:S881T	ENSP00000235372:S1082T	S	+	1	0	PRDM2	13980121	0.842000	0.29525	0.802000	0.32245	0.137000	0.21094	3.143000	0.50608	2.288000	0.76882	0.533000	0.62120	TCA		0.453	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
ASH1L	55870	broad.mit.edu	37	1	155450605	155450605	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:155450605C>A	ENST00000368346.3	-	3	2695	c.2056G>T	c.(2056-2058)Gca>Tca	p.A686S	ASH1L_ENST00000392403.3_Missense_Mutation_p.A686S			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	686					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.A686S(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GCAGATACTGCACCCAGTTTT	0.363																																					p.A686S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2056T	1						.						41.0	43.0	42.0					1																	155450605		2200	4297	6497	153717229	SO:0001583	missense	55870	exon3			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.2056G>T	1.37:g.155450605C>A	ENSP00000357330:p.Ala686Ser	Somatic		Capture	Illumina HiSeq	Phase_I	153717229	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	C	11.36	1.615212	0.28801	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.90133	-2.62;-2.61	5.39	4.46	0.54185	.	0.077703	0.52532	D	0.000062	T	0.73466	0.3590	N	0.14661	0.345	0.80722	D	1	P;P	0.40180	0.58;0.705	B;B	0.38264	0.138;0.269	T	0.74642	-0.3597	10	0.24483	T	0.36	.	11.8618	0.52469	0.0:0.8626:0.0:0.1374	.	686;686	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	S	686	ENSP00000357330:A686S;ENSP00000376204:A686S	ENSP00000357330:A686S	A	-	1	0	ASH1L	153717229	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.936000	0.40183	2.795000	0.96236	0.655000	0.94253	GCA		0.363	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
SMG5	23381	broad.mit.edu	37	1	156238159	156238159	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:156238159C>T	ENST00000361813.5	-	8	905	c.761G>A	c.(760-762)cGg>cAg	p.R254Q	SMG5_ENST00000489907.2_5'Flank|SMG5_ENST00000368267.5_Missense_Mutation_p.R254Q	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	254					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.R254Q(2)		NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					GTCATACAGCCGCTTGAGGTT	0.522																																					p.R254Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G761A	1						.						200.0	199.0	199.0					1																	156238159		2203	4300	6503	154504783	SO:0001583	missense	23381	exon8			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.761G>A	1.37:g.156238159C>T	ENSP00000355261:p.Arg254Gln	Somatic		Capture	Illumina HiSeq	Phase_I	154504783	NM_015327	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	37	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.574895	0.65878	.	.	ENSG00000198952	ENST00000361813;ENST00000368267	T;T	0.31510	1.49;1.49	6.02	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.18087	0.0434	L	0.38531	1.155	0.53005	D	0.999963	P	0.47350	0.894	P	0.44732	0.459	T	0.00778	-1.1570	10	0.36615	T	0.2	-12.3258	13.4621	0.61233	0.0:0.9249:0.0:0.0751	.	254	Q9UPR3	SMG5_HUMAN	Q	254	ENSP00000355261:R254Q;ENSP00000357250:R254Q	ENSP00000355261:R254Q	R	-	2	0	SMG5	154504783	1.000000	0.71417	0.995000	0.50966	0.803000	0.45373	5.726000	0.68515	2.865000	0.98341	0.655000	0.94253	CGG		0.522	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
OR6K2	81448	broad.mit.edu	37	1	158670397	158670397	+	Missense_Mutation	SNP	C	C	T	rs183333879	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:158670397C>T	ENST00000359610.2	-	1	89	c.46G>A	c.(46-48)Gct>Act	p.A16T		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A16T(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					TAAGGGAAAGCGGAGAAGATA	0.453													C|||	2	0.000399361	0.0	0.0	5008	,	,		21041	0.002		0.0	False		,,,				2504	0.0				p.A16T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G46A	1						.						109.0	111.0	110.0					1																	158670397		2203	4300	6503	156937021	SO:0001583	missense	81448	exon1			BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.46G>A	1.37:g.158670397C>T	ENSP00000352626:p.Ala16Thr	Somatic		Capture	Illumina HiSeq	Phase_I	156937021	NM_001005279	B9EH33|Q6IFR6	Missense_Mutation	SNP	ENST00000359610.2	37	CCDS30902.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	11.86	1.764729	0.31228	.	.	ENSG00000196171	ENST00000359610	T	0.00580	6.43	4.48	2.59	0.31030	.	0.000000	0.38326	N	0.001723	T	0.00271	0.0008	M	0.66439	2.03	0.09310	N	1	P	0.39883	0.693	B	0.30029	0.11	T	0.48670	-0.9015	10	0.87932	D	0	-2.9665	8.7487	0.34602	0.0:0.7625:0.1521:0.0854	.	16	Q8NGY2	OR6K2_HUMAN	T	16	ENSP00000352626:A16T	ENSP00000352626:A16T	A	-	1	0	OR6K2	156937021	0.023000	0.18921	0.189000	0.23252	0.745000	0.42441	1.895000	0.39778	0.503000	0.28060	0.561000	0.74099	GCT		0.453	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279	
PAPPA2	60676	broad.mit.edu	37	1	176668417	176668417	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:176668417G>T	ENST00000367662.3	+	8	4092	c.2928G>T	c.(2926-2928)gaG>gaT	p.E976D		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	976					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E976D(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TCTTCATGGAGTCCTCGCAGG	0.567																																					p.E976D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2928T	1						.						186.0	186.0	186.0					1																	176668417		2082	4216	6298	174935040	SO:0001583	missense	60676	exon8			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2928G>T	1.37:g.176668417G>T	ENSP00000356634:p.Glu976Asp	Somatic		Capture	Illumina HiSeq	Phase_I	174935040	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.493317	0.01009	.	.	ENSG00000116183	ENST00000367662	T	0.01572	4.76	5.38	-1.01	0.10169	Fibronectin, type III (2);	0.416511	0.30686	N	0.009095	T	0.00608	0.0020	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47636	-0.9102	10	0.02654	T	1	-8.2314	6.0161	0.19603	0.0:0.4149:0.1354:0.4498	.	976	Q9BXP8	PAPP2_HUMAN	D	976	ENSP00000356634:E976D	ENSP00000356634:E976D	E	+	3	2	PAPPA2	174935040	0.272000	0.24172	0.271000	0.24616	0.295000	0.27426	0.339000	0.19875	-0.059000	0.13154	-0.133000	0.14855	GAG		0.567	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
HMCN1	83872	broad.mit.edu	37	1	186050516	186050516	+	Missense_Mutation	SNP	G	G	A	rs377760099		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:186050516G>A	ENST00000271588.4	+	56	9006	c.8777G>A	c.(8776-8778)cGa>cAa	p.R2926Q	HMCN1_ENST00000367492.2_Missense_Mutation_p.R2926Q	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2926	Ig-like C2-type 27.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R2926Q(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCTAATGGACGAATTCTGCAG	0.338																																					p.R2926Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8777A	1						.	G	GLN/ARG	0,4406		0,0,2203	79.0	80.0	79.0		8777	5.9	1.0	1		79	1,8599	1.2+/-3.3	0,1,4299	no	missense	HMCN1	NM_031935.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	2926/5636	186050516	1,13005	2203	4300	6503	184317139	SO:0001583	missense	83872	exon56			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.8777G>A	1.37:g.186050516G>A	ENSP00000271588:p.Arg2926Gln	Somatic		Capture	Illumina HiSeq	Phase_I	184317139	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.817605	0.70912	0.0	1.16E-4	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66280	-0.2;-0.2	5.86	5.86	0.93980	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.61464	0.2349	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.56251	-0.8010	10	0.08179	T	0.78	.	20.1772	0.98182	0.0:0.0:1.0:0.0	.	2926	Q96RW7	HMCN1_HUMAN	Q	2926	ENSP00000271588:R2926Q;ENSP00000356462:R2926Q	ENSP00000271588:R2926Q	R	+	2	0	HMCN1	184317139	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	9.430000	0.97488	2.778000	0.95560	0.655000	0.94253	CGA		0.338	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
RNPEP	6051	broad.mit.edu	37	1	201966638	201966638	+	Missense_Mutation	SNP	G	G	A	rs144833089		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:201966638G>A	ENST00000295640.4	+	5	1089	c.1046G>A	c.(1045-1047)gGt>gAt	p.G349D	RNPEP_ENST00000367286.3_Missense_Mutation_p.G310D|RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.4_ENST00000419190.1_RNA|RP11-465N4.5_ENST00000608886.1_RNA|RP11-465N4.4_ENST00000415582.1_RNA	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	349					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)	p.G349D(1)		breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		CTCAATGAAGGTTTCACCATG	0.542																																					p.G349D	GBM(19;39 479 7473 13131 19462)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1046A	1						.						101.0	88.0	92.0					1																	201966638		2203	4300	6503	200233261	SO:0001583	missense	6051	exon5			BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.1046G>A	1.37:g.201966638G>A	ENSP00000295640:p.Gly349Asp	Somatic		Capture	Illumina HiSeq	Phase_I	200233261	NM_020216	Q9BVM9|Q9H1D4|Q9NPT7	Missense_Mutation	SNP	ENST00000295640.4	37	CCDS1418.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.440263	0.83993	.	.	ENSG00000176393	ENST00000295640;ENST00000367286;ENST00000447312;ENST00000449524	T;T;T;T	0.24350	1.86;1.86;1.86;1.86	5.1	4.18	0.49190	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.60945	0.2308	H	0.95043	3.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.72027	-0.4414	10	0.87932	D	0	-21.843	11.9113	0.52741	0.086:0.0:0.914:0.0	.	357;349	Q7RU04;Q9H4A4	.;AMPB_HUMAN	D	349;310;218;95	ENSP00000295640:G349D;ENSP00000356255:G310D;ENSP00000389602:G218D;ENSP00000407614:G95D	ENSP00000295640:G349D	G	+	2	0	RNPEP	200233261	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.257000	0.72480	2.361000	0.80049	0.643000	0.83706	GGT		0.542	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087345.1	NM_020216	
NPHP4	261734	broad.mit.edu	37	1	5935110	5935110	+	Silent	SNP	G	G	A	rs138025088	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:5935110G>A	ENST00000378156.4	-	21	3133	c.2868C>T	c.(2866-2868)gcC>gcT	p.A956A	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	956					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)	p.A956A(1)		NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CCCGGTAGGCGGCGATGACCT	0.672													g|||	49	0.00978435	0.0	0.0	5008	,	,		16833	0.0486		0.0	False		,,,				2504	0.0				p.A956A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2868T	1						.						55.0	66.0	62.0					1																	5935110		2190	4282	6472	5857697	SO:0001819	synonymous_variant	261734	exon21			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.2868C>T	1.37:g.5935110G>A		Somatic		Capture	Illumina HiSeq	Phase_I	5857697	NM_015102	Q8IWC0	Silent	SNP	ENST00000378156.4	37	CCDS44052.1																																																																																				0.672	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2		
TTLL7	79739	broad.mit.edu	37	1	84356137	84356137	+	Missense_Mutation	SNP	G	G	A	rs371072730		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:84356137G>A	ENST00000260505.8	-	19	2613	c.2236C>T	c.(2236-2238)Cgt>Tgt	p.R746C	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	746					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)	p.R746C(1)		kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		AGAACTGTACGAATACTTGTT	0.378																																					p.R746C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2236T	1						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	55.0	54.0	54.0		2236	5.3	0.3	1		54	0,8600		0,0,4300	no	missense	TTLL7	NM_024686.4	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	746/888	84356137	1,13005	2203	4300	6503	84128725	SO:0001583	missense	79739	exon19			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.2236C>T	1.37:g.84356137G>A	ENSP00000260505:p.Arg746Cys	Somatic		Capture	Illumina HiSeq	Phase_I	84128725	NM_024686	Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	ENST00000260505.8	37	CCDS690.2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080527	0.76528	2.27E-4	0.0	ENSG00000137941	ENST00000260505;ENST00000370704	T	0.04970	3.52	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.18045	0.0433	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.00643	-1.1630	10	0.87932	D	0	.	19.2731	0.94018	0.0:0.0:1.0:0.0	.	746	Q6ZT98	TTLL7_HUMAN	C	746;523	ENSP00000260505:R746C	ENSP00000260505:R746C	R	-	1	0	TTLL7	84128725	1.000000	0.71417	0.325000	0.25375	0.466000	0.32739	5.999000	0.70665	2.617000	0.88574	0.650000	0.86243	CGT		0.378	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686	
MTR	4548	broad.mit.edu	37	1	236973881	236973881	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr1:236973881A>G	ENST00000366577.5	+	5	882	c.488A>G	c.(487-489)gAt>gGt	p.D163G	MTR_ENST00000418145.2_Missense_Mutation_p.D219G|MTR_ENST00000535889.1_Missense_Mutation_p.D163G	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	163	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.D163G(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	GAAAGGCCGGATTATAGGAAC	0.413																																					p.D163G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A488G	1						.						123.0	127.0	126.0					1																	236973881		2203	4300	6503	235040504	SO:0001583	missense	4548	exon5			U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.488A>G	1.37:g.236973881A>G	ENSP00000355536:p.Asp163Gly	Somatic		Capture	Illumina HiSeq	Phase_I	235040504	NM_000254	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	ENST00000366577.5	37	CCDS1614.1	.	.	.	.	.	.	.	.	.	.	A	12.16	1.853277	0.32699	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000418145;ENST00000535889	T;T;T	0.09073	3.02;3.02;3.02	5.95	5.95	0.96441	Homocysteine S-methyltransferase (4);	0.049997	0.85682	D	0.000000	T	0.02610	0.0079	N	0.00510	-1.415	0.58432	D	0.999994	B;B;B	0.14805	0.011;0.011;0.011	B;B;B	0.20384	0.029;0.029;0.029	T	0.40384	-0.9566	10	0.02654	T	1	-26.7381	16.4237	0.83790	1.0:0.0:0.0:0.0	.	163;163;163	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	G	163;163;219;163	ENSP00000355536:D163G;ENSP00000402255:D219G;ENSP00000441845:D163G	ENSP00000355536:D163G	D	+	2	0	MTR	235040504	1.000000	0.71417	0.999000	0.59377	0.621000	0.37620	8.495000	0.90481	2.279000	0.76181	0.533000	0.62120	GAT		0.413	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254	
BPIFB6	128859	broad.mit.edu	37	20	31623427	31623427	+	Missense_Mutation	SNP	G	G	A	rs151337960	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr20:31623427G>A	ENST00000349552.1	+	6	526	c.526G>A	c.(526-528)Gcc>Acc	p.A176T		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	176						extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.A176T(1)									GATGTGTCCCGCCATCGATGC	0.577																																					p.A176T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G526A	20						.	G	THR/ALA	0,4406		0,0,2203	237.0	169.0	192.0		526	4.5	0.9	20	dbSNP_134	192	4,8596	3.7+/-12.6	0,4,4296	no	missense	BPIFB6	NM_174897.2	58	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging	176/454	31623427	4,13002	2203	4300	6503	31087088	SO:0001583	missense	128859	exon6			AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.526G>A	20.37:g.31623427G>A	ENSP00000344929:p.Ala176Thr	Somatic		Capture	Illumina HiSeq	Phase_I	31087088	NM_174897		Missense_Mutation	SNP	ENST00000349552.1	37	CCDS13211.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.626740	0.46840	0.0	4.65E-4	ENSG00000167104	ENST00000349552	T	0.05199	3.48	4.51	4.51	0.55191	.	0.000000	0.53938	D	0.000041	T	0.20820	0.0501	M	0.73598	2.24	0.34065	D	0.657731	D	0.89917	1.0	D	0.97110	1.0	T	0.24512	-1.0158	10	0.15066	T	0.55	.	12.7144	0.57107	0.0:0.0:1.0:0.0	.	176	Q8NFQ5	BPIB6_HUMAN	T	176	ENSP00000344929:A176T	ENSP00000344929:A176T	A	+	1	0	BPIFB6	31087088	1.000000	0.71417	0.882000	0.34594	0.114000	0.19823	4.688000	0.61715	2.042000	0.60477	0.561000	0.74099	GCC		0.577	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078658.2	NM_174897	
SLC32A1	140679	broad.mit.edu	37	20	37353383	37353383	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr20:37353383C>A	ENST00000217420.1	+	1	279	c.16C>A	c.(16-18)Cgc>Agc	p.R6S		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	6					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.R6S(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CACCTTGCTCCGCAGCAAGCT	0.647																																					p.R6S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C16A	20						.						38.0	29.0	32.0					20																	37353383		2203	4299	6502	36786797	SO:0001583	missense	140679	exon1			AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.16C>A	20.37:g.37353383C>A	ENSP00000217420:p.Arg6Ser	Somatic		Capture	Illumina HiSeq	Phase_I	36786797	NM_080552	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155208	0.57259	.	.	ENSG00000101438	ENST00000217420	T	0.09073	3.02	4.85	4.85	0.62838	.	0.055577	0.64402	D	0.000002	T	0.06188	0.0160	N	0.19112	0.55	0.50313	D	0.999862	B	0.26602	0.154	B	0.21151	0.033	T	0.25710	-1.0124	10	0.72032	D	0.01	-24.5717	10.676	0.45787	0.1913:0.8086:0.0:0.0	.	6	Q9H598	VIAAT_HUMAN	S	6	ENSP00000217420:R6S	ENSP00000217420:R6S	R	+	1	0	SLC32A1	36786797	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	3.171000	0.50824	2.230000	0.72887	0.561000	0.74099	CGC		0.647	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
PTPRT	11122	broad.mit.edu	37	20	41306531	41306531	+	Silent	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr20:41306531G>A	ENST00000373187.1	-	7	1127	c.1128C>T	c.(1126-1128)ccC>ccT	p.P376P	PTPRT_ENST00000373193.3_Silent_p.P376P|PTPRT_ENST00000373190.1_Silent_p.P376P|PTPRT_ENST00000373201.1_Silent_p.P376P|PTPRT_ENST00000356100.2_Silent_p.P376P|PTPRT_ENST00000373198.4_Silent_p.P376P|PTPRT_ENST00000373184.1_Silent_p.P376P			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	376	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.P376P(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGGTGGTGAGGGGAGGCCCTG	0.547																																					p.P376P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1128T	20						.						76.0	76.0	76.0					20																	41306531		1896	4116	6012	40739945	SO:0001819	synonymous_variant	11122	exon7			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1128C>T	20.37:g.41306531G>A		Somatic		Capture	Illumina HiSeq	Phase_I	40739945	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	CCDS42874.1																																																																																				0.547	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
SRXN1	140809	broad.mit.edu	37	20	629547	629547	+	Silent	SNP	G	G	A	rs151033608	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr20:629547G>A	ENST00000381962.3	-	2	409	c.225C>T	c.(223-225)agC>agT	p.S75S	RP5-850E9.3_ENST00000488788.2_Missense_Mutation_p.R80C	NM_080725.1	NP_542763.1	Q9BYN0	SRXN1_HUMAN	sulfiredoxin 1	75					response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	ATP binding (GO:0005524)|oxidoreductase activity, acting on a sulfur group of donors (GO:0016667)|sulfiredoxin activity (GO:0032542)	p.S75S(1)		large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5						TGGGGGGCACGCTGTCTGGGT	0.577													G|||	2	0.000399361	0.0	0.0	5008	,	,		19386	0.0		0.002	False		,,,				2504	0.0				p.S75S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C225T	20						.	G		0,4406		0,0,2203	32.0	32.0	32.0		225	-5.3	0.6	20	dbSNP_134	32	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	SRXN1	NM_080725.1		0,5,6498	AA,AG,GG		0.0581,0.0,0.0384		75/138	629547	5,13001	2203	4300	6503	577547	SO:0001819	synonymous_variant	140809	exon2			AF075053	CCDS13005.1	20p13	2013-05-22	2010-06-24	2005-05-10	ENSG00000271303	ENSG00000271303			16132	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 139"", ""sulfiredoxin 1 homolog (S. cerevisiae)"""	C20orf139			Standard	NM_080725		Approved	Npn3, SRX1, YKL086W, dJ850E9.2	uc002wea.4	Q9BYN0	OTTHUMG00000031644	ENST00000381962.3:c.225C>T	20.37:g.629547G>A		Somatic		Capture	Illumina HiSeq	Phase_I	577547	NM_080725	B2R543|Q8NDM3|Q96AK6	Silent	SNP	ENST00000381962.3	37	CCDS13005.1																																																																																				0.577	SRXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077479.2	NM_080725	
GNAS	2778	broad.mit.edu	37	20	57484421	57484421	+	Missense_Mutation	SNP	G	G	A	rs121913495		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr20:57484421G>A	ENST00000371085.3	+	8	1026	c.602G>A	c.(601-603)cGt>cAt	p.R201H	GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTCGCTGCCGTGTCCTGACT	0.423			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.R187H	Colon(117;935 1597 6045 8307 46442)		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	GNAS,large_intestine,colon,Substitution - Missense,+1 	.	88	Substitution - Missense(88)	pancreas(28)|large_intestine(19)|thyroid(12)|pituitary(12)|liver(6)|biliary_tract(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)	c.G560A	20						.						80.0	78.0	79.0					20																	57484421		2203	4300	6503	56917816	SO:0001583	missense	2778	exon7			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.602G>A	20.37:g.57484421G>A	ENSP00000360126:p.Arg201His	Somatic		Capture	Illumina HiSeq	Phase_I	56917816	NM_080426	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	37	CCDS13472.1	.	.	.	.	.	.	.	.	.	.	G	35	5.430570	0.96150	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99458	-5.93;-5.93;-5.93;-5.93;-5.93;-2.96;-5.93	5.53	5.53	0.82687	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	H	0.98965	4.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.994;0.983;1.0	D	0.96812	0.9597	10	0.87932	D	0	.	19.4606	0.94915	0.0:0.0:1.0:0.0	.	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	H	844;830;187;201;202;186;187	ENSP00000360141:R844H;ENSP00000360143:R830H;ENSP00000360136:R187H;ENSP00000360126:R201H;ENSP00000346328:R202H;ENSP00000265620:R186H;ENSP00000304472:R187H	ENSP00000265620:R186H	R	+	2	0	GNAS	56917816	1.000000	0.71417	0.963000	0.40424	0.936000	0.57629	9.291000	0.96070	2.596000	0.87737	0.563000	0.77884	CGT		0.423	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	NM_000516	
IL17RA	23765	broad.mit.edu	37	22	17589490	17589491	+	Frame_Shift_Ins	INS	-	-	G	rs554211497	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr22:17589490_17589491insG	ENST00000319363.6	+	13	1514_1515	c.1381_1382insG	c.(1381-1383)cggfs	p.R461fs		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	461	SEFIR. {ECO:0000255|PROSITE- ProRule:PRU00867}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)	p.A463fs*48(1)		endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GCTCCTGGGCCGGGGGGCGCCT	0.668																																					p.R461fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1381_1382insG	22						.																																			15969491	SO:0001589	frameshift_variant	23765	exon13			U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.1387dupG	22.37:g.17589496_17589496dupG	ENSP00000320936:p.Arg461fs	Somatic		Capture	Illumina HiSeq	Phase_I	15969490	NM_014339	O43844|Q20WK1	Frame_Shift_Ins	INS	ENST00000319363.6	37	CCDS13739.1																																																																																				0.668	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339	
TOB2	10766	broad.mit.edu	37	22	41833206	41833207	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr22:41833206_41833207insT	ENST00000327492.3	-	2	849_850	c.143_144insA	c.(142-144)aagfs	p.K48fs		NM_016272.3	NP_057356.1	Q14106	TOB2_HUMAN	transducer of ERBB2, 2	48					female gamete generation (GO:0007292)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ossification (GO:0045778)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						CTTTCAGTGGCTTCTCAGGGTA	0.589																																					p.K48fs												.	.	0			c.144_145insA	22						.																																			40163153	SO:0001589	frameshift_variant	10766	exon2			D64109	CCDS14015.1	22q13.2	2010-02-26			ENSG00000183864	ENSG00000183864			11980	protein-coding gene	gene with protein product		607396		TROB2		10602502, 10591208	Standard	XM_005261315		Approved	TOBL, TOB4, bK223H9	uc003azz.1	Q14106	OTTHUMG00000150970	ENST00000327492.3:c.144dupA	22.37:g.41833208_41833208dupT	ENSP00000331305:p.Lys48fs	None		Capture	Illumina HiSeq	Phase_I	40163152	NM_016272	Q6FHR7|Q6PIT9|Q9BY97|Q9UBI0	Frame_Shift_Ins	INS	ENST00000327492.3	37	CCDS14015.1																																																																																				0.589	TOB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320699.1	NM_016272	
ALG12	79087	broad.mit.edu	37	22	50297545	50297546	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr22:50297545_50297546insG	ENST00000330817.6	-	10	1680_1681	c.1407_1408insC	c.(1405-1410)cccttcfs	p.F470fs	CITF22-1A6.3_ENST00000610245.1_lincRNA	NM_024105.3	NP_077010.1	Q9BV10	ALG12_HUMAN	ALG12, alpha-1,6-mannosyltransferase	470					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosyltransferase activity (GO:0000009)|dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase activity (GO:0052917)	p.F470fs*>20(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(3)	12		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		TGGACGTTGAAGGGGGGCAGTT	0.673																																					p.F470fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1408_1409insC	22						.																																			48683550	SO:0001589	frameshift_variant	79087	exon10			AJ303120	CCDS14081.1	22q13.33	2013-02-26	2013-02-26		ENSG00000182858	ENSG00000182858	2.4.1.260	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19358	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichol alpha-1,6-mannosyltransferase"", ""dol-P-Man dependent alpha-1,6-mannosyltransferase"""	607144	"""asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)"", ""asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)"""			11983712	Standard	NM_024105		Approved	ECM39	uc003biy.3	Q9BV10	OTTHUMG00000150289	ENST00000330817.6:c.1408dupC	22.37:g.50297551_50297551dupG	ENSP00000333813:p.Phe470fs	Somatic		Capture	Illumina HiSeq	Phase_I	48683549	NM_024105	A6PWM1|Q4KMH4|Q8NG10|Q96AA4	Frame_Shift_Ins	INS	ENST00000330817.6	37	CCDS14081.1																																																																																				0.673	ALG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317405.2	NM_024105	
AMER3	205147	broad.mit.edu	37	2	131522111	131522112	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:131522111_131522112insG	ENST00000423981.1	+	2	2576_2577	c.2466_2467insG	c.(2467-2469)gggfs	p.G823fs	AMER3_ENST00000321420.4_Frame_Shift_Ins_p.G823fs	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	823					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.V825fs*16(1)									GCCAGCAGGAAGGGGGGGTCTC	0.678																																					p.E822fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2466_2467insG	2						.																																			131238582	SO:0001589	frameshift_variant	205147	exon2			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.2473dupG	2.37:g.131522118_131522118dupG	ENSP00000392700:p.Gly823fs	Somatic		Capture	Illumina HiSeq	Phase_I	131238581	NM_001105193	B7ZLH6	Frame_Shift_Ins	INS	ENST00000423981.1	37	CCDS2164.1																																																																																				0.678	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
ZFP36L2	678	broad.mit.edu	37	2	43452342	43452343	+	Frame_Shift_Ins	INS	-	-	A	rs144371643		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:43452342_43452343insA	ENST00000282388.3	-	2	893_894	c.600_601insT	c.(598-603)tttcatfs	p.H201fs	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	201	RNA-binding.				cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H201fs*273(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				CCGATGGTATGAAAGGTGCGGC	0.673																																					p.H201fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.601_602insT	2						.																																			43305847	SO:0001589	frameshift_variant	678	exon2			X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.601dupT	2.37:g.43452345_43452345dupA	ENSP00000282388:p.His201fs	Somatic		Capture	Illumina HiSeq	Phase_I	43305846	NM_006887	Q53TB4|Q9BSJ3	Frame_Shift_Ins	INS	ENST00000282388.3	37	CCDS1811.1																																																																																				0.673	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250513.2	NM_006887	
TNFAIP6	7130	broad.mit.edu	37	2	152226551	152226551	+	Missense_Mutation	SNP	G	G	A	rs564029423		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:152226551G>A	ENST00000243347.3	+	4	487	c.412G>A	c.(412-414)Gtc>Atc	p.V138I	RN7SL124P_ENST00000498656.2_RNA|MIR4773-1_ENST00000585225.1_RNA	NM_007115.3	NP_009046.2	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	138	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)		hyaluronic acid binding (GO:0005540)	p.V138I(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.131)	Hyaluronan(DB08818)	GTGTGGTGGCGTCTTTACAGA	0.368													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17301	0.0		0.0	False		,,,				2504	0.0				p.V138I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G412A	2						.						98.0	98.0	98.0					2																	152226551		2203	4300	6503	151934797	SO:0001583	missense	7130	exon4				CCDS2193.1	2q23.3	2008-11-18			ENSG00000123610	ENSG00000123610			11898	protein-coding gene	gene with protein product		600410				1730767, 8568267, 15060082	Standard	NM_007115		Approved	TSG6, TSG-6	uc002txk.3	P98066	OTTHUMG00000131884	ENST00000243347.3:c.412G>A	2.37:g.152226551G>A	ENSP00000243347:p.Val138Ile	Somatic		Capture	Illumina HiSeq	Phase_I	151934797	NM_007115	Q53TI7|Q8WWI9	Missense_Mutation	SNP	ENST00000243347.3	37	CCDS2193.1	.	.	.	.	.	.	.	.	.	.	G	7.554	0.663227	0.14710	.	.	ENSG00000123610	ENST00000243347	T	0.18338	2.22	5.27	2.49	0.30216	CUB (5);	0.174439	0.49916	N	0.000127	T	0.10809	0.0264	L	0.27944	0.81	0.49798	D	0.999825	B	0.06786	0.001	B	0.04013	0.001	T	0.15263	-1.0443	10	0.23302	T	0.38	.	9.7695	0.40580	0.2232:0.0:0.7768:0.0	.	138	P98066	TSG6_HUMAN	I	138	ENSP00000243347:V138I	ENSP00000243347:V138I	V	+	1	0	TNFAIP6	151934797	0.666000	0.27475	0.916000	0.36221	0.233000	0.25261	0.987000	0.29603	0.607000	0.29982	0.555000	0.69702	GTC		0.368	TNFAIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254834.2	NM_007115	
DPP4	1803	broad.mit.edu	37	2	162865779	162865779	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:162865779T>C	ENST00000360534.3	-	21	2419	c.1859A>G	c.(1858-1860)gAc>gGc	p.D620G	DPP4_ENST00000491591.1_5'UTR	NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	620					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.D620G(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	TCGTTTGTTGTCCACAAATCC	0.368																																					p.D620G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1859G	2						.						150.0	141.0	144.0					2																	162865779		2203	4300	6503	162574025	SO:0001583	missense	1803	exon21			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1859A>G	2.37:g.162865779T>C	ENSP00000353731:p.Asp620Gly	Somatic		Capture	Illumina HiSeq	Phase_I	162574025	NM_001935	Q53TN1	Missense_Mutation	SNP	ENST00000360534.3	37	CCDS2216.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.606020	0.87157	.	.	ENSG00000197635	ENST00000360534	T	0.38887	1.11	5.48	5.48	0.80851	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79221	0.4409	H	0.98951	4.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88012	0.2763	10	0.87932	D	0	-23.1434	15.8539	0.78960	0.0:0.0:0.0:1.0	.	620	P27487	DPP4_HUMAN	G	620	ENSP00000353731:D620G	ENSP00000353731:D620G	D	-	2	0	DPP4	162574025	1.000000	0.71417	0.864000	0.33941	0.782000	0.44232	7.709000	0.84645	2.199000	0.70637	0.533000	0.62120	GAC		0.368	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2		
SCN9A	6335	broad.mit.edu	37	2	167168172	167168172	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:167168172G>C	ENST00000409435.1	-	1	94	c.95C>G	c.(94-96)tCa>tGa	p.S32*	SCN9A_ENST00000409672.1_Nonsense_Mutation_p.S32*|SCN9A_ENST00000375387.4_Nonsense_Mutation_p.S32*|SCN9A_ENST00000303354.6_Nonsense_Mutation_p.S32*			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	32					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.S32*(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGGTTCCTTTGATTTTCTTTC	0.463																																					p.S32X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C95G	2						.						111.0	111.0	111.0					2																	167168172		1955	4181	6136	166876418	SO:0001587	stop_gained	6335	exon2			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.95C>G	2.37:g.167168172G>C	ENSP00000386330:p.Ser32*	Somatic		Capture	Illumina HiSeq	Phase_I	166876418	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Nonsense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	g	40	7.952778	0.98580	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	.	.	.	5.43	4.49	0.54785	.	2.017790	0.02784	N	0.121286	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	11.8494	0.52403	0.0:0.0:0.7038:0.2962	.	.	.	.	X	32	.	ENSP00000304748:S32X	S	-	2	0	SCN9A	166876418	0.295000	0.24389	0.972000	0.41901	0.935000	0.57460	2.523000	0.45580	2.541000	0.85698	0.655000	0.94253	TCA		0.463	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
FSIP2	401024	broad.mit.edu	37	2	186672004	186672004	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:186672004G>A	ENST00000424728.1	+	17	17971	c.17971G>A	c.(17971-17973)Gcc>Acc	p.A5991T	FSIP2_ENST00000343098.5_Missense_Mutation_p.A6080T			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5991								p.A689T(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						CCAAAAGTTGGCCCAAACAGC	0.353																																					p.A6080T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G18238A	2						.						115.0	108.0	110.0					2																	186672004		1840	4067	5907	186380249	SO:0001583	missense	401024	exon17			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17971G>A	2.37:g.186672004G>A	ENSP00000401306:p.Ala5991Thr	Somatic		Capture	Illumina HiSeq	Phase_I	186380249	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	37		.	.	.	.	.	.	.	.	.	.	G	12.99	2.102874	0.37145	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.54071	0.59;0.6	4.8	0.862	0.19056	.	0.840954	0.10245	N	0.697955	T	0.37785	0.1016	L	0.29908	0.895	0.09310	N	1	.	.	.	.	.	.	T	0.29549	-1.0008	8	0.30854	T	0.27	.	4.1326	0.10156	0.2924:0.1726:0.535:0.0	.	.	.	.	T	6080;5991	ENSP00000344403:A6080T;ENSP00000401306:A5991T	ENSP00000344403:A6080T	A	+	1	0	FSIP2	186380249	0.000000	0.05858	0.000000	0.03702	0.790000	0.44656	0.634000	0.24614	-0.026000	0.13895	0.491000	0.48974	GCC		0.353	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
FN1	2335	broad.mit.edu	37	2	216289031	216289031	+	Missense_Mutation	SNP	C	C	T	rs13306372	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:216289031C>T	ENST00000359671.1	-	8	1319	c.1054G>A	c.(1054-1056)Ggt>Agt	p.G352S	FN1_ENST00000446046.1_Missense_Mutation_p.G352S|FN1_ENST00000443816.1_Missense_Mutation_p.G352S|FN1_ENST00000356005.4_Missense_Mutation_p.G352S|FN1_ENST00000354785.4_Missense_Mutation_p.G352S|FN1_ENST00000323926.6_Missense_Mutation_p.G352S|FN1_ENST00000336916.4_Missense_Mutation_p.G352S|FN1_ENST00000432072.2_Missense_Mutation_p.G352S|FN1_ENST00000346544.3_Missense_Mutation_p.G352S|FN1_ENST00000426059.1_Missense_Mutation_p.G352S|FN1_ENST00000357009.2_Missense_Mutation_p.G352S|FN1_ENST00000345488.5_Missense_Mutation_p.G352S|FN1_ENST00000357867.4_Missense_Mutation_p.G352S|FN1_ENST00000421182.1_Missense_Mutation_p.G352S			P02751	FINC_HUMAN	fibronectin 1	352	Collagen-binding.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.G352S(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GAGTTGCCACCGTAAGTCTGG	0.463																																					p.G352S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1054A	2						.						140.0	125.0	130.0					2																	216289031		2203	4300	6503	215997276	SO:0001583	missense	2335	exon8				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.1054G>A	2.37:g.216289031C>T	ENSP00000352696:p.Gly352Ser	Somatic		Capture	Illumina HiSeq	Phase_I	215997276	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	C	18.26	3.585503	0.66105	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05;-2.05;-2.05;-2.05;-2.05;-2.05;-2.05;-2.05;-2.05;-2.05	5.97	5.1	0.69264	.	0.077574	0.53938	N	0.000048	D	0.91858	0.7423	M	0.76328	2.33	0.80722	D	1	D;B;P;D;D;D;D;D;D;D;P	0.89917	1.0;0.034;0.774;0.992;1.0;1.0;0.992;1.0;1.0;1.0;0.571	D;B;B;P;D;D;P;D;D;D;B	0.91635	0.999;0.029;0.192;0.796;0.999;0.999;0.618;0.93;0.999;0.999;0.161	D	0.92662	0.6142	10	0.66056	D	0.02	.	15.5061	0.75743	0.0:0.934:0.0:0.066	rs13306372;rs13306372	352;352;352;352;352;352;352;352;352;352;352	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	S	352	ENSP00000394423:G352S;ENSP00000323534:G352S;ENSP00000338200:G352S;ENSP00000350534:G352S;ENSP00000346839:G352S;ENSP00000352696:G352S;ENSP00000265312:G352S;ENSP00000273049:G352S;ENSP00000349509:G352S;ENSP00000410422:G352S;ENSP00000415018:G352S;ENSP00000399538:G352S;ENSP00000348285:G352S;ENSP00000398907:G352S	ENSP00000265313:G352S	G	-	1	0	FN1	215997276	1.000000	0.71417	0.941000	0.38009	0.856000	0.48823	7.416000	0.80143	1.552000	0.49463	-0.122000	0.15005	GGT		0.463	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
MFF	56947	broad.mit.edu	37	2	228195480	228195480	+	Silent	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:228195480C>T	ENST00000353339.3	+	4	618	c.177C>T	c.(175-177)aaC>aaT	p.N59N	MFF_ENST00000409565.1_Silent_p.N33N|MFF_ENST00000409616.1_Silent_p.N33N|MFF_ENST00000349901.7_Silent_p.N33N|MFF_ENST00000304593.9_Silent_p.N33N|MFF_ENST00000354503.6_Silent_p.N33N|MFF_ENST00000392059.1_Silent_p.N59N|MFF_ENST00000476924.1_Intron|MFF_ENST00000524634.1_Intron|MFF_ENST00000337110.7_Silent_p.N33N	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	59					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)	p.N59N(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						CACCGCCAAACGCTGACCTGG	0.423																																					p.N59N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C177T	2						.						98.0	83.0	88.0					2																	228195480		2203	4300	6503	227903724	SO:0001819	synonymous_variant	56947	exon4			AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.177C>T	2.37:g.228195480C>T		Somatic		Capture	Illumina HiSeq	Phase_I	227903724	NM_020194	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Silent	SNP	ENST00000353339.3	37	CCDS2465.1																																																																																				0.423	MFF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256887.2	NM_020194	
LTBP1	4052	broad.mit.edu	37	2	33359896	33359896	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:33359896C>A	ENST00000404816.2	+	5	1423	c.1070C>A	c.(1069-1071)aCt>aAt	p.T357N	LTBP1_ENST00000390003.4_Missense_Mutation_p.T31N|LTBP1_ENST00000404525.1_Missense_Mutation_p.T31N|LTBP1_ENST00000407925.1_Missense_Mutation_p.T31N|LTBP1_ENST00000418533.2_Missense_Mutation_p.T31N|LTBP1_ENST00000354476.3_Missense_Mutation_p.T357N|LTBP1_ENST00000402934.1_Missense_Mutation_p.T31N			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	357					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.T357N(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GTGGTCTTTACTCCGAGCATC	0.507																																					p.T31N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C92A	2						.						108.0	94.0	99.0					2																	33359896		2203	4300	6503	33213400	SO:0001583	missense	4052	exon1				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1070C>A	2.37:g.33359896C>A	ENSP00000386043:p.Thr357Asn	Somatic		Capture	Illumina HiSeq	Phase_I	33213400	NM_000627	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	C	25.5	4.646041	0.87958	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000432635;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.85411	-1.98;-1.98;-1.77;-1.71;-1.8;-1.79;-1.74	5.57	5.57	0.84162	.	.	.	.	.	D	0.91744	0.7389	M	0.64170	1.965	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.997;0.996;1.0;0.999;0.999;0.999	D	0.92126	0.5708	9	0.87932	D	0	.	19.5412	0.95275	0.0:1.0:0.0:0.0	.	357;31;31;31;31;357	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	N	357;357;46;31;31;31;31;31	ENSP00000386043:T357N;ENSP00000346467:T357N;ENSP00000374653:T31N;ENSP00000393057:T31N;ENSP00000384373:T31N;ENSP00000385359:T31N;ENSP00000384091:T31N	ENSP00000346467:T357N	T	+	2	0	LTBP1	33213400	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.729000	0.84864	2.611000	0.88343	0.462000	0.41574	ACT		0.507	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
RASGRP3	25780	broad.mit.edu	37	2	33752230	33752230	+	Silent	SNP	C	C	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:33752230C>A	ENST00000403687.3	+	10	1574	c.834C>A	c.(832-834)gtC>gtA	p.V278V	RASGRP3_ENST00000407811.1_Silent_p.V278V|RASGRP3_ENST00000402538.3_Silent_p.V278V	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	278	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)	p.V278V(1)		large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					CAGAGTTGGTCTCCTCCAACG	0.488																																					p.V278V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C834A	2						.						52.0	50.0	51.0					2																	33752230		1892	4105	5997	33605734	SO:0001819	synonymous_variant	25780	exon11			AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.834C>A	2.37:g.33752230C>A		Somatic		Capture	Illumina HiSeq	Phase_I	33605734	NM_170672	D6W583|O94931|Q53SD7	Silent	SNP	ENST00000403687.3	37	CCDS46256.1																																																																																				0.488	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376	
NRXN1	9378	broad.mit.edu	37	2	51255220	51255220	+	Silent	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:51255220G>A	ENST00000406316.2	-	2	1668	c.192C>T	c.(190-192)cgC>cgT	p.R64R	NRXN1_ENST00000405581.1_Silent_p.R64R|NRXN1_ENST00000405472.3_Silent_p.R64R|NRXN1_ENST00000401669.2_Silent_p.R64R|NRXN1_ENST00000406859.3_Silent_p.R64R|NRXN1_ENST00000404971.1_Silent_p.R64R|NRXN1_ENST00000402717.3_Silent_p.R64R	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	64	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.R64R(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GCACGAGGCCGCGGGCGCTGC	0.652																																					p.R64R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C192T	2						.						10.0	15.0	13.0					2																	51255220		1985	4157	6142	51108724	SO:0001819	synonymous_variant	9378	exon2			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.192C>T	2.37:g.51255220G>A		Somatic		Capture	Illumina HiSeq	Phase_I	51108724	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1																																																																																				0.652	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
UGT1A4	54657	broad.mit.edu	37	2	234628080	234628080	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr2:234628080T>C	ENST00000373409.3	+	1	657	c.614T>C	c.(613-615)aTg>aCg	p.M205T	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A9_ENST00000354728.4_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	205					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.M205T(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	TCAGACCACATGACATTCCTG	0.448																																					p.M205T	Melanoma(99;1011 1962 13201 26492)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T614C	2						.						174.0	166.0	169.0					2																	234628080		2203	4297	6500	234292819	SO:0001583	missense	54657	exon1			M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.614T>C	2.37:g.234628080T>C	ENSP00000362508:p.Met205Thr	Somatic		Capture	Illumina HiSeq	Phase_I	234292819	NM_007120	B2R937|B8K288|Q5DT00	Missense_Mutation	SNP	ENST00000373409.3	37	CCDS33405.1	.	.	.	.	.	.	.	.	.	.	T	15.81	2.941987	0.53079	.	.	ENSG00000244474	ENST00000373409	T	0.64085	-0.08	4.49	4.49	0.54785	.	.	.	.	.	D	0.85230	0.5649	H	0.96691	3.865	0.50632	D	0.999883	D;D	0.63880	0.99;0.993	D;D	0.81914	0.977;0.995	D	0.90043	0.4143	9	0.87932	D	0	.	13.7922	0.63148	0.0:0.0:0.0:1.0	.	205;205	B8K288;P22310	.;UD14_HUMAN	T	205	ENSP00000362508:M205T	ENSP00000362508:M205T	M	+	2	0	UGT1A4	234292819	1.000000	0.71417	0.623000	0.29173	0.454000	0.32378	7.957000	0.87870	1.656000	0.50722	0.402000	0.26972	ATG		0.448	UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130984.1	NM_007120	
SCAP	22937	broad.mit.edu	37	3	47459188	47459189	+	Frame_Shift_Ins	INS	-	-	G	rs142311061		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr3:47459188_47459189insG	ENST00000265565.5	-	17	2987_2988	c.2575_2576insC	c.(2575-2577)cggfs	p.R859fs	SCAP_ENST00000465628.1_5'Flank|SCAP_ENST00000441517.2_Frame_Shift_Ins_p.R603fs|SCAP_ENST00000545718.1_Frame_Shift_Ins_p.R466fs	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	859	Interaction with SREBF2. {ECO:0000250}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)	p.R859fs*14(1)		endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CGGAGGGCCCCGGGGGCGGTGT	0.649																																					p.R859fs	Pancreas(149;978 1908 29304 37806 46700)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2576_2577insC	3						.																																			47434193	SO:0001589	frameshift_variant	22937	exon17			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.2576dupC	3.37:g.47459193_47459193dupG	ENSP00000265565:p.Arg859fs	Somatic		Capture	Illumina HiSeq	Phase_I	47434192	NM_012235	Q8N2E0|Q8WUA1	Frame_Shift_Ins	INS	ENST00000265565.5	37	CCDS2755.2																																																																																				0.649	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235	
DOCK3	1795	broad.mit.edu	37	3	51418863	51418864	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr3:51418863_51418864insT	ENST00000266037.9	+	53	5989_5990	c.5966_5967insT	c.(5965-5970)gaggggfs	p.E1989fs		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1989					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GAGCACGATGAGGGGGTGCTGC	0.698																																					p.X1975delinsX												.	.	0			c.5925_5926insT	3						.																																			51393904	SO:0001589	frameshift_variant	1795	exon53			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	Exception_encountered	3.37:g.51418863_51418864insT	ENSP00000266037:p.Glu1989fs	None		Capture	Illumina HiSeq	Phase_I	51393903	NM_004947	O15017	Frame_Shift_Ins	INS	ENST00000266037.9	37	CCDS46835.1																																																																																				0.698	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
PLCXD2	257068	broad.mit.edu	37	3	111426847	111426847	+	Missense_Mutation	SNP	C	C	T	rs147048469		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr3:111426847C>T	ENST00000477665.1	+	2	562	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C	PLCXD2_ENST00000393934.3_Missense_Mutation_p.R80C	NM_001185106.1	NP_001172035.1	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 2	80	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)	p.R80C(1)		endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)	17						AGCTATCAAACGCCTCGCCAG	0.498																																					p.R80C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C238T	3						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	55.0	59.0	57.0		238,238	5.8	1.0	3	dbSNP_134	57	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	PLCXD2	NM_001185106.1,NM_153268.3	180,180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	80/306,80/305	111426847	2,13004	2203	4300	6503	112909537	SO:0001583	missense	257068	exon2			AK056141	CCDS2961.1, CCDS54619.1	3q13.2	2004-09-09			ENSG00000240891	ENSG00000240891			26462	protein-coding gene	gene with protein product							Standard	NM_001185106		Approved	FLJ31579	uc003dxz.3	Q0VAA5	OTTHUMG00000159279	ENST00000477665.1:c.238C>T	3.37:g.111426847C>T	ENSP00000420686:p.Arg80Cys	Somatic		Capture	Illumina HiSeq	Phase_I	112909537	NM_153268	Q96N12	Missense_Mutation	SNP	ENST00000477665.1	37	CCDS54619.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.800858	0.70567	0.0	2.33E-4	ENSG00000240891	ENST00000393934;ENST00000477665	.	.	.	5.77	5.77	0.91146	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (1);	.	.	.	.	T	0.75413	0.3846	L	0.55990	1.75	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.68621	0.959;0.931	T	0.74671	-0.3587	8	0.54805	T	0.06	-18.23	17.8364	0.88699	0.0:1.0:0.0:0.0	.	80;80	Q0VAA5;Q0VAA5-2	PLCX2_HUMAN;.	C	80	.	ENSP00000377511:R80C	R	+	1	0	PLCXD2	112909537	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.547000	0.53663	2.884000	0.98904	0.655000	0.94253	CGC		0.498	PLCXD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354322.1	NM_153268	
TMEM108	66000	broad.mit.edu	37	3	133114727	133114727	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr3:133114727G>A	ENST00000321871.6	+	6	1835	c.1625G>A	c.(1624-1626)cGc>cAc	p.R542H	TMEM108_ENST00000508711.1_Missense_Mutation_p.R72H|TMEM108_ENST00000393130.3_Missense_Mutation_p.R542H	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	542						integral component of membrane (GO:0016021)		p.R542H(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TCAGAGCCCCGCTCCCCAGCC	0.507																																					p.R542H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1625A	3						.						87.0	85.0	86.0					3																	133114727		2203	4300	6503	134597417	SO:0001583	missense	66000	exon6			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.1625G>A	3.37:g.133114727G>A	ENSP00000324651:p.Arg542His	Somatic		Capture	Illumina HiSeq	Phase_I	134597417	NM_001136469	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	ENST00000321871.6	37	CCDS33858.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.589450	0.86851	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000508711	T;T	0.58210	0.35;0.35	5.72	4.85	0.62838	.	0.000000	0.52532	D	0.000072	T	0.49847	0.1581	M	0.66939	2.045	0.80722	D	1	B;P	0.47034	0.003;0.889	B;B	0.36922	0.003;0.236	T	0.57528	-0.7796	10	0.54805	T	0.06	-5.4197	14.8258	0.70110	0.0691:0.0:0.9309:0.0	.	72;542	B3KT64;Q6UXF1	.;TM108_HUMAN	H	542;542;72	ENSP00000324651:R542H;ENSP00000376838:R542H	ENSP00000324651:R542H	R	+	2	0	TMEM108	134597417	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	8.950000	0.93019	1.428000	0.47296	0.561000	0.74099	CGC		0.507	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
ROBO1	6091	broad.mit.edu	37	3	78717339	78717339	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr3:78717339G>T	ENST00000464233.1	-	13	1857	c.1744C>A	c.(1744-1746)Caa>Aaa	p.Q582K	ROBO1_ENST00000436010.2_Missense_Mutation_p.Q543K|ROBO1_ENST00000495273.1_Missense_Mutation_p.Q546K|ROBO1_ENST00000467549.1_Missense_Mutation_p.Q546K	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	582	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.Q559K(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AAATTTGGTTGCCACGATAAT	0.413																																					p.Q582K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1744A	3						.						109.0	99.0	102.0					3																	78717339		1848	4102	5950	78800029	SO:0001583	missense	6091	exon13			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.1744C>A	3.37:g.78717339G>T	ENSP00000420321:p.Gln582Lys	Somatic		Capture	Illumina HiSeq	Phase_I	78800029	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	9.193	1.026640	0.19512	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414;ENST00000495961	T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5	5.84	5.84	0.93424	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.143817	0.64402	D	0.000006	T	0.33059	0.0850	N	0.10664	0.02	0.49798	D	0.999827	B;B;B;B;B;B	0.06786	0.001;0.0;0.001;0.0;0.001;0.0	B;B;B;B;B;B	0.12837	0.001;0.006;0.008;0.003;0.008;0.003	T	0.16928	-1.0386	9	.	.	.	.	15.7119	0.77635	0.0:0.0:0.8627:0.1372	.	546;546;582;546;546;543	Q9Y6N7-3;Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;.;ROBO1_HUMAN;.;.;.	K	543;546;582;546;546;586;119	ENSP00000406043:Q543K;ENSP00000420321:Q582K;ENSP00000420637:Q546K;ENSP00000417992:Q546K;ENSP00000418553:Q119K	.	Q	-	1	0	ROBO1	78800029	1.000000	0.71417	1.000000	0.80357	0.300000	0.27592	5.356000	0.66052	2.764000	0.94973	0.655000	0.94253	CAA		0.413	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
FGF12	2257	broad.mit.edu	37	3	192125880	192125880	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr3:192125880C>T	ENST00000454309.2	-	1	958	c.133G>A	c.(133-135)Gtc>Atc	p.V45I	FGF12_ENST00000430714.1_Intron|FGF12_ENST00000445105.2_Intron|FGF12_ENST00000264730.3_Intron|FGF12_ENST00000450716.1_Intron	NM_021032.4	NP_066360.1	P61328	FGF12_HUMAN	fibroblast growth factor 12	45					adult locomotory behavior (GO:0008344)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell-cell signaling (GO:0007267)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|JNK cascade (GO:0007254)|negative regulation of cation channel activity (GO:2001258)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|regulation of membrane depolarization (GO:0003254)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)	p.V45I(1)		endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		ACCCCGAGGACGTGCCTCTCG	0.682																																					p.V45I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G133A	3						.						71.0	82.0	79.0					3																	192125880		2198	4283	6481	193608574	SO:0001583	missense	2257	exon1			U66197	CCDS3301.1, CCDS46983.1	3q28	2008-07-18			ENSG00000114279	ENSG00000114279			3668	protein-coding gene	gene with protein product	"""fibroblast growth factor 12B"", ""fibroblast growth factor homologous factor 1"", ""myocyte-activating factor"", ""fibroblast growth factor FGF-12b"""	601513		FGF12B		8790420, 9345906	Standard	NM_021032		Approved	FHF1	uc003fsx.3	P61328	OTTHUMG00000156132	ENST00000454309.2:c.133G>A	3.37:g.192125880C>T	ENSP00000413496:p.Val45Ile	Somatic		Capture	Illumina HiSeq	Phase_I	193608574	NM_021032	B2R6B7|B2R976|O35339|P70376|Q8TBG5|Q92912|Q93001	Missense_Mutation	SNP	ENST00000454309.2	37	CCDS3301.1	.	.	.	.	.	.	.	.	.	.	C	9.310	1.055263	0.19907	.	.	ENSG00000114279	ENST00000454309	T	0.76186	-1.0	5.39	5.39	0.77823	.	0.130187	0.52532	D	0.000063	T	0.51958	0.1705	N	0.01874	-0.695	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49457	-0.8938	10	0.31617	T	0.26	.	18.1342	0.89612	0.0:1.0:0.0:0.0	.	45	P61328	FGF12_HUMAN	I	45	ENSP00000413496:V45I	ENSP00000413496:V45I	V	-	1	0	FGF12	193608574	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.924000	0.48876	2.526000	0.85167	0.555000	0.69702	GTC		0.682	FGF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343160.1	NM_021032	
HAND2	9464	broad.mit.edu	37	4	174448220	174448221	+	3'UTR	INS	-	-	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr4:174448220_174448221insT	ENST00000359562.4	-	0	1800_1801				HAND2_ENST00000505300.1_5'Flank|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000512099.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2						adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CAAATATCCACTTTTTTTTTGG	0.446																																					.												.	.	0			.	4						.																																			174684796	SO:0001624	3_prime_UTR_variant	9464	.			AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.*208->A	4.37:g.174448229_174448229dupT		None		Capture	Illumina HiSeq	Phase_I	174684795	.	B6ECG9|O95300|O95301|P97833|Q494T1	Frame_Shift_Ins	INS	ENST00000359562.4	37	CCDS3819.1																																																																																				0.446	HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362241.3		
FAT4	79633	broad.mit.edu	37	4	126329607	126329607	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr4:126329607G>T	ENST00000394329.3	+	4	5591	c.5578G>T	c.(5578-5580)Gta>Tta	p.V1860L	FAT4_ENST00000335110.5_Missense_Mutation_p.V158L	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1860	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V1860L(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AGGTTCTTTGGTAGCAGCCAT	0.318																																					p.V1860L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5578T	4						.						85.0	87.0	86.0					4																	126329607		2203	4300	6503	126549057	SO:0001583	missense	79633	exon4			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.5578G>T	4.37:g.126329607G>T	ENSP00000377862:p.Val1860Leu	Somatic		Capture	Illumina HiSeq	Phase_I	126549057	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085462	0.76642	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01767	4.65;4.65	5.03	5.03	0.67393	Cadherin (3);Cadherin-like (1);	0.000000	0.31221	U	0.008026	T	0.08891	0.0220	L	0.58428	1.81	0.58432	D	0.999999	D;D	0.71674	0.997;0.998	D;D	0.80764	0.992;0.994	T	0.11792	-1.0573	10	0.45353	T	0.12	.	18.3766	0.90437	0.0:0.0:1.0:0.0	.	158;1860	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	L	1860;158	ENSP00000377862:V1860L;ENSP00000335169:V158L	ENSP00000335169:V158L	V	+	1	0	FAT4	126549057	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.027000	0.93706	2.337000	0.79520	0.591000	0.81541	GTA		0.318	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
CNGA1	1259	broad.mit.edu	37	4	47953378	47953378	+	Silent	SNP	T	T	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr4:47953378T>A	ENST00000514170.1	-	5	547	c.228A>T	c.(226-228)ccA>ccT	p.P76P	CNGA1_ENST00000402813.3_Silent_p.P145P|CNGA1_ENST00000420489.2_Silent_p.P76P|CNGA1_ENST00000544810.1_Silent_p.P76P|CNGA1_ENST00000358519.4_Silent_p.P76P			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	76					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.P76P(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						ACCTCTGTGATGGTCCTCCCT	0.418																																					p.P76P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A228T	4						.						111.0	103.0	106.0					4																	47953378		1905	4128	6033	47648135	SO:0001819	synonymous_variant	1259	exon5			M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.228A>T	4.37:g.47953378T>A		Somatic		Capture	Illumina HiSeq	Phase_I	47648135	NM_000087	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Silent	SNP	ENST00000514170.1	37	CCDS43226.1																																																																																				0.418	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372070.2	NM_000087	
PCDH10	57575	broad.mit.edu	37	4	134111298	134111298	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr4:134111298C>T	ENST00000264360.5	+	5	3932	c.3106C>T	c.(3106-3108)Cgg>Tgg	p.R1036W		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	1036					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R1036W(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TTTCACAGCACGGAAAAGGAT	0.328																																					p.R1036W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3106T	4						.						80.0	79.0	79.0					4																	134111298		2203	4300	6503	134330748	SO:0001583	missense	57575	exon5			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.3106C>T	4.37:g.134111298C>T	ENSP00000264360:p.Arg1036Trp	Somatic		Capture	Illumina HiSeq	Phase_I	134330748	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996742	0.54147	.	.	ENSG00000138650	ENST00000264360	T	0.55930	0.49	4.97	4.97	0.65823	.	1.410380	0.05386	U	0.538155	T	0.46347	0.1388	N	0.19112	0.55	0.43296	D	0.995285	D	0.56968	0.978	B	0.40285	0.325	T	0.54840	-0.8233	10	0.66056	D	0.02	.	18.1873	0.89796	0.0:1.0:0.0:0.0	.	1036	Q9P2E7	PCD10_HUMAN	W	1036	ENSP00000264360:R1036W	ENSP00000264360:R1036W	R	+	1	2	PCDH10	134330748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.096000	0.57734	2.451000	0.82905	0.585000	0.79938	CGG		0.328	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
LARP1	23367	broad.mit.edu	37	5	154135672	154135673	+	Intron	INS	-	-	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr5:154135672_154135673insC	ENST00000336314.4	+	2	229					NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1						cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.P122fs*8(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTTCGTGGAAGCCCCCCCGCCC	0.743																																					.												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	.	5						.																																			154115866	SO:0001627	intron_variant	23367	.			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.206-34212->C	5.37:g.154135679_154135679dupC		Somatic		Capture	Illumina HiSeq	Phase_I	154115865	.	O94836|Q8N4M2|Q8NB73|Q9UFD7	Frame_Shift_Ins	INS	ENST00000336314.4	37	CCDS4328.1																																																																																				0.743	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	
APC	324	broad.mit.edu	37	5	112128143	112128143	+	Splice_Site	SNP	C	C	T	rs62619935		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr5:112128143C>T	ENST00000457016.1	+	7	1026	c.646C>T	c.(646-648)Cga>Tga	p.R216*	APC_ENST00000508376.2_Splice_Site_p.R216*|APC_ENST00000257430.4_Splice_Site_p.R216*			P25054	APC_HUMAN	adenomatous polyposis coli	216	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R216*(12)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTTATTTTAGCGAAGAATAGC	0.323		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R216X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	12	Substitution - Nonsense(12)	large_intestine(12)	c.C646T	5	GRCh37	CM992133	APC	M	rs62619935	.						52.0	51.0	51.0					5																	112128143		2202	4300	6502	112156042	SO:0001630	splice_region_variant	324	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.646-1C>T	5.37:g.112128143C>T		Somatic		Capture	Illumina HiSeq	Phase_I	112156042	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	39	7.466758	0.98302	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.19	2.99	0.34606	.	0.630262	0.16042	N	0.232387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2274	1.7088	0.02888	0.2899:0.3634:0.2259:0.1208	rs62619935	.	.	.	X	216	.	.	R	+	1	2	APC	112156042	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	0.662000	0.25038	1.304000	0.44892	-0.158000	0.13435	CGA		0.323	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	Nonsense_Mutation
CDH10	1008	broad.mit.edu	37	5	24488079	24488079	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr5:24488079C>T	ENST00000264463.4	-	12	2567	c.2060G>A	c.(2059-2061)cGg>cAg	p.R687Q	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	687					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R687Q(2)|p.R687L(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		AATATCTCGCCGGAGCTTTTT	0.478										HNSCC(23;0.051)																											p.R687Q												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G2060A	5						.						60.0	65.0	63.0					5																	24488079		2203	4300	6503	24523836	SO:0001583	missense	1008	exon12			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2060G>A	5.37:g.24488079C>T	ENSP00000264463:p.Arg687Gln	Somatic		Capture	Illumina HiSeq	Phase_I	24523836	NM_006727	Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853381	0.91355	.	.	ENSG00000040731	ENST00000264463	T	0.78246	-1.16	5.46	5.46	0.80206	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.89605	0.6763	M	0.86651	2.83	0.50171	D	0.999859	D	0.89917	1.0	D	0.72625	0.978	D	0.90413	0.4411	10	0.54805	T	0.06	.	18.2978	0.90153	0.0:1.0:0.0:0.0	.	687	Q9Y6N8	CAD10_HUMAN	Q	687	ENSP00000264463:R687Q	ENSP00000264463:R687Q	R	-	2	0	CDH10	24523836	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.657000	0.83745	2.580000	0.87095	0.655000	0.94253	CGG		0.478	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
LIFR	3977	broad.mit.edu	37	5	38485968	38485968	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr5:38485968C>T	ENST00000263409.4	-	17	2612	c.2450G>A	c.(2449-2451)gGt>gAt	p.G817D	LIFR_ENST00000453190.2_Missense_Mutation_p.G817D	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	817	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.G817D(3)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					GCCCACTCCACCATCTGTATA	0.433			T	PLAG1	salivary adenoma																																p.G817D	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	3	Substitution - Missense(3)	skin(2)|large_intestine(1)	c.G2450A	5						.						136.0	122.0	127.0					5																	38485968		2203	4300	6503	38521725	SO:0001583	missense	3977	exon17			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2450G>A	5.37:g.38485968C>T	ENSP00000263409:p.Gly817Asp	Somatic		Capture	Illumina HiSeq	Phase_I	38521725	NM_001127671	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290229	0.80914	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.54279	0.58;0.58	5.42	5.42	0.78866	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.527380	0.21440	N	0.074518	T	0.70675	0.3251	M	0.62723	1.935	0.49299	D	0.999773	D	0.89917	1.0	D	0.74674	0.984	T	0.72334	-0.4325	10	0.66056	D	0.02	-22.2699	17.4047	0.87470	0.0:1.0:0.0:0.0	.	817	P42702	LIFR_HUMAN	D	817	ENSP00000263409:G817D;ENSP00000398368:G817D	ENSP00000263409:G817D	G	-	2	0	LIFR	38521725	0.994000	0.37717	0.187000	0.23214	0.850000	0.48378	3.298000	0.51818	2.522000	0.85027	0.557000	0.71058	GGT		0.433	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
PARP8	79668	broad.mit.edu	37	5	50093022	50093022	+	Silent	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr5:50093022G>A	ENST00000281631.5	+	14	1688	c.1530G>A	c.(1528-1530)gtG>gtA	p.V510V	PARP8_ENST00000505697.2_Silent_p.V510V|PARP8_ENST00000514342.2_Silent_p.V263V|PARP8_ENST00000503750.2_Silent_p.V510V|PARP8_ENST00000514067.2_Silent_p.V510V|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000505554.1_Silent_p.V489V	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	510						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.V510V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				AATATTGTGTGGTTTGTGATG	0.338																																					p.V510V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1530A	5						.						130.0	117.0	121.0					5																	50093022		2203	4300	6503	50128779	SO:0001819	synonymous_variant	79668	exon15			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.1530G>A	5.37:g.50093022G>A		Somatic		Capture	Illumina HiSeq	Phase_I	50128779	NM_001178055	Q3KRB7|Q6DHZ1|Q9H754	Silent	SNP	ENST00000281631.5	37	CCDS3954.1																																																																																				0.338	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214035.3	NM_024615	
GABRG2	2566	broad.mit.edu	37	5	161580200	161580200	+	Silent	SNP	C	C	T	rs113085352		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr5:161580200C>T	ENST00000361925.4	+	9	1450	c.1230C>T	c.(1228-1230)gaC>gaT	p.D410D	GABRG2_ENST00000356592.3_Silent_p.D418D|GABRG2_ENST00000393933.4_Silent_p.D315D|GABRG2_ENST00000414552.2_Silent_p.D458D			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	410					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.D418D(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGTGTCTGGACGGCAAGGACT	0.463													c|||	1	0.000199681	0.0	0.0	5008	,	,		21402	0.001		0.0	False		,,,				2504	0.0				p.D418D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1254T	5						.						205.0	189.0	195.0					5																	161580200		2203	4300	6503	161512778	SO:0001819	synonymous_variant	2566	exon10				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1230C>T	5.37:g.161580200C>T		Somatic		Capture	Illumina HiSeq	Phase_I	161512778	NM_198904	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Silent	SNP	ENST00000361925.4	37	CCDS4358.1																																																																																				0.463	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
ADAT2	134637	broad.mit.edu	37	6	143749805	143749805	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr6:143749805C>T	ENST00000237283.8	-	5	490	c.476G>A	c.(475-477)cGg>cAg	p.R159Q	ADAT2_ENST00000606514.1_Missense_Mutation_p.R112Q	NM_182503.2	NP_872309.2	Q7Z6V5	ADAT2_HUMAN	adenosine deaminase, tRNA-specific 2	159					tRNA wobble adenosine to inosine editing (GO:0002100)		tRNA-specific adenosine deaminase activity (GO:0008251)|zinc ion binding (GO:0008270)	p.R159Q(1)		endometrium(2)|large_intestine(3)|lung(3)	8				OV - Ovarian serous cystadenocarcinoma(155;5.61e-06)|GBM - Glioblastoma multiforme(68;0.0115)		TTCCTCAGCCCGATATCCAGG	0.368																																					p.R159Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G476A	6						.						62.0	59.0	60.0					6																	143749805		1852	4093	5945	143791498	SO:0001583	missense	134637	exon5			BC037955	CCDS43511.1, CCDS69219.1	6q24.2	2014-01-28	2011-05-19	2007-08-16	ENSG00000189007	ENSG00000189007			21172	protein-coding gene	gene with protein product	tRNA-specific adenosine deaminase 2 homolog (S. cerevisiae)	615388	"""deaminase domain containing 1"", ""adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae)"""	DEADC1		12457566	Standard	NM_182503		Approved	dJ20N2.1, TAD2	uc003qjj.3	Q7Z6V5	OTTHUMG00000015725	ENST00000237283.8:c.476G>A	6.37:g.143749805C>T	ENSP00000237283:p.Arg159Gln	Somatic		Capture	Illumina HiSeq	Phase_I	143791498	NM_182503	A6NL12|B3KWY3|Q7Z327|Q8IY39	Missense_Mutation	SNP	ENST00000237283.8	37	CCDS43511.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607489	0.46527	.	.	ENSG00000189007	ENST00000367594;ENST00000237283	.	.	.	5.68	4.63	0.57726	Cytidine deaminase-like (1);	0.118609	0.56097	D	0.000027	T	0.33411	0.0862	L	0.45228	1.405	0.80722	D	1	B	0.29162	0.235	B	0.11329	0.006	T	0.40459	-0.9562	9	0.59425	D	0.04	-16.8867	11.9682	0.53049	0.0:0.8524:0.0:0.1476	.	159	Q7Z6V5	ADAT2_HUMAN	Q	112;159	.	ENSP00000237283:R159Q	R	-	2	0	ADAT2	143791498	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.726000	0.47302	2.695000	0.91970	0.650000	0.86243	CGG		0.368	ADAT2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042517.1	XM_059727	
SYNE1	23345	broad.mit.edu	37	6	152510431	152510431	+	Missense_Mutation	SNP	G	G	A	rs138747167		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr6:152510431G>A	ENST00000367255.5	-	128	23858	c.23257C>T	c.(23257-23259)Cgc>Tgc	p.R7753C	SYNE1_ENST00000341594.5_Missense_Mutation_p.R7365C|SYNE1_ENST00000265368.4_Missense_Mutation_p.R7753C|SYNE1_ENST00000423061.1_Missense_Mutation_p.R7682C|SYNE1_ENST00000448038.1_Missense_Mutation_p.R7682C|SYNE1_ENST00000356820.4_Missense_Mutation_p.R2277C	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7753					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.R7753C(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGCTCTACGCGTTCATTAAGA	0.443										HNSCC(10;0.0054)			G|||	0	0.0	0.0	0.0	5008	,	,		14012	0.0		0.0	False		,,,				2504	0.0				p.R2277C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C6829T	6						.						149.0	141.0	144.0					6																	152510431		2203	4300	6503	152552124	SO:0001583	missense	23345	exon43			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.23257C>T	6.37:g.152510431G>A	ENSP00000356224:p.Arg7753Cys	Somatic		Capture	Illumina HiSeq	Phase_I	152552124	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	De_novo_Start_OutOfFrame	SNP	ENST00000367255.5	37	CCDS5236.2	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	G	30	5.050781	0.93740	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	5.99	5.99	0.97316	.	0.000000	0.64402	D	0.000017	D	0.88720	0.6513	M	0.82630	2.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.88817	0.3296	10	0.87932	D	0	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	7753;7753;7682;7682	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	C	7753;399;7682;7753;7682;7365;2277;675	ENSP00000356224:R7753C;ENSP00000356226:R399C;ENSP00000396024:R7682C;ENSP00000265368:R7753C;ENSP00000390975:R7682C;ENSP00000341887:R7365C;ENSP00000349276:R2277C;ENSP00000356220:R675C	ENSP00000265368:R7753C	R	-	1	0	SYNE1	152552124	1.000000	0.71417	0.975000	0.42487	0.947000	0.59692	7.929000	0.87595	2.840000	0.97914	0.655000	0.94253	CGC		0.443	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
NOX3	50508	broad.mit.edu	37	6	155764485	155764485	+	Silent	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr6:155764485C>T	ENST00000159060.2	-	5	510	c.408G>A	c.(406-408)caG>caA	p.Q136Q		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	136	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)	p.Q136Q(1)		cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		CCAGAAGTCCCTGGGCCTCCT	0.572																																					p.Q136Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G408A	6						.						106.0	89.0	95.0					6																	155764485		2203	4300	6503	155806177	SO:0001819	synonymous_variant	50508	exon5			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.408G>A	6.37:g.155764485C>T		Somatic		Capture	Illumina HiSeq	Phase_I	155806177	NM_015718	Q9HBJ9	Silent	SNP	ENST00000159060.2	37	CCDS5250.1																																																																																				0.572	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		
HIST1H2AD	3013	broad.mit.edu	37	6	26199471	26199471	+	Splice_Site	SNP	T	T	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr6:26199471T>C	ENST00000341023.1	-	1	0	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000377831.5_5'UTR|HIST1H3D_ENST00000356476.2_5'Flank	NM_021065.2	NP_066409.1	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	1						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.M1V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6		all_hematologic(11;0.196)				CGTCCGGACATTTTGAATTCT	0.473																																					p.M1V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1G	6						.						17.0	20.0	19.0					6																	26199471		2201	4300	6501	26307450	SO:0001630	splice_region_variant	3013	exon1			Z80776	CCDS4591.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196866	ENSG00000196866		"""Histones / Replication-dependent"""	4729	protein-coding gene	gene with protein product		602792	"""H2A histone family, member G"", ""histone 1, H2ad"""	H2AFG		9119399, 12408966	Standard	NM_021065		Approved	H2A/g, H2A.3	uc003ngw.4	P20671	OTTHUMG00000014437	ENST00000341023.1:c.1-1A>G	6.37:g.26199471T>C		Somatic		Capture	Illumina HiSeq	Phase_I	26307450	NM_021065	A0PK91|P57754|Q6FGY6	Missense_Mutation	SNP	ENST00000341023.1	37	CCDS4591.1	.	.	.	.	.	.	.	.	.	.	.	7.478	0.648148	0.14516	.	.	ENSG00000196866	ENST00000341023	D	0.92699	-3.09	4.82	3.63	0.41609	.	0.286415	0.24745	U	0.035944	D	0.82806	0.5117	.	.	.	0.80722	D	1	B	0.11235	0.004	B	0.04013	0.001	T	0.80264	-0.1455	9	0.87932	D	0	.	11.0849	0.48080	0.0:0.0:0.1557:0.8443	.	1	P20671	H2A1D_HUMAN	V	1	ENSP00000341094:M1V	ENSP00000341094:M1V	M	-	1	0	HIST1H2AD	26307450	0.998000	0.40836	0.967000	0.41034	0.134000	0.20937	3.988000	0.56951	0.764000	0.33197	0.533000	0.62120	ATG		0.473	HIST1H2AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040100.1	NM_021065	Missense_Mutation
IER3	8870	broad.mit.edu	37	6	30709605	30709605	+	IGR	SNP	C	C	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr6:30709605C>A	ENST00000259874.5	-	0	1244				FLOT1_ENST00000456573.2_Missense_Mutation_p.R28L|FLOT1_ENST00000376389.3_Missense_Mutation_p.R28L|FLOT1_ENST00000470643.1_5'UTR|XXbac-BPG252P9.10_ENST00000607333.1_RNA	NM_003897.3	NP_003888.2	P46695	IEX1_HUMAN	immediate early response 3						anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glycolytic process (GO:0045820)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|negative regulation of systemic arterial blood pressure (GO:0003085)|positive regulation of protein catabolic process (GO:0045732)|regulation of DNA repair (GO:0006282)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of response to DNA damage stimulus (GO:2001020)|response to protozoan (GO:0001562)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.R28L(1)		NS(1)	1						GACAAAGACACGCCCTCCAGC	0.567																																					p.R28L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G83T	6						.						59.0	60.0	60.0					6																	30709605		1509	2708	4217	30817584	SO:0001628	intergenic_variant	10211	exon3			AF083421	CCDS4689.1	6p21.3	2010-02-17			ENSG00000137331	ENSG00000137331			5392	protein-coding gene	gene with protein product		602996				8603392, 9703517	Standard	NM_003897		Approved	IEX-1, DIF-2, PRG1, IEX-1L	uc003nrn.3	P46695	OTTHUMG00000031265		6.37:g.30709605C>A		Somatic		Capture	Illumina HiSeq	Phase_I	30817584	NM_005803	Q5SU30|Q92691|Q93044	Missense_Mutation	SNP	ENST00000259874.5	37	CCDS4689.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062465	0.76187	.	.	ENSG00000137312	ENST00000376389;ENST00000456573;ENST00000438162;ENST00000445853;ENST00000416018;ENST00000454845	T;T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33;1.33	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.56659	0.2000	M	0.89785	3.06	0.58432	D	0.999999	P;D	0.71674	0.947;0.998	P;D	0.69479	0.72;0.964	T	0.61608	-0.7028	10	0.36615	T	0.2	3.32	14.5746	0.68238	0.0:1.0:0.0:0.0	.	28;28	B4DVY7;O75955	.;FLOT1_HUMAN	L	28	ENSP00000365569:R28L;ENSP00000394375:R28L;ENSP00000400615:R28L;ENSP00000398834:R28L;ENSP00000412058:R28L;ENSP00000391341:R28L	ENSP00000365569:R28L	R	-	2	0	FLOT1	30817584	0.984000	0.35163	0.071000	0.20095	0.921000	0.55340	6.673000	0.74482	2.356000	0.79943	0.462000	0.41574	CGT		0.567	IER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076578.2		
PRRC2A	7916	broad.mit.edu	37	6	31599917	31599917	+	Missense_Mutation	SNP	G	G	A	rs140216447	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr6:31599917G>A	ENST00000376033.2	+	16	3701	c.3467G>A	c.(3466-3468)cGg>cAg	p.R1156Q	PRRC2A_ENST00000376007.4_Missense_Mutation_p.R1156Q	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1156	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R1156Q(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						TTCACTGCCCGGGGTGGGCGA	0.701													G|||	3	0.000599042	0.0	0.0	5008	,	,		13895	0.0		0.003	False		,,,				2504	0.0				p.R1156Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3467A	6						.	G	GLN/ARG,GLN/ARG	4,3014		0,4,1505	27.0	36.0	33.0		3467,3467	5.3	1.0	6	dbSNP_134	33	9,5401		0,9,2696	no	missense,missense	PRRC2A	NM_004638.3,NM_080686.2	43,43	0,13,4201	AA,AG,GG		0.1664,0.1325,0.1542	probably-damaging,probably-damaging	1156/2158,1156/2158	31599917	13,8415	1509	2705	4214	31707896	SO:0001583	missense	7916	exon16			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3467G>A	6.37:g.31599917G>A	ENSP00000365201:p.Arg1156Gln	Somatic		Capture	Illumina HiSeq	Phase_I	31707896	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.52|13.52	2.260726|2.260726	0.39995|0.39995	0.001325|0.001325	0.001664|0.001664	ENSG00000204469|ENSG00000204469	ENST00000424184;ENST00000435052|ENST00000376007;ENST00000376033;ENST00000376010	.|T;T	.|0.01933	.|4.55;4.55	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	.|0.000000	.|0.49916	.|D	.|0.000128	T|T	0.01489|0.01489	0.0048|0.0048	L|L	0.38175|0.38175	1.15|1.15	0.44309|0.44309	D|D	0.997187|0.997187	.|P	.|0.52577	.|0.954	.|B	.|0.40602	.|0.334	T|T	0.63211|0.63211	-0.6688|-0.6688	6|10	0.87932|0.87932	D|D	0|0	-10.2574|-10.2574	15.9608|15.9608	0.79928|0.79928	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1156	.|P48634	.|PRC2A_HUMAN	R|Q	1153;1142|1156;1156;381	.|ENSP00000365175:R1156Q;ENSP00000365201:R1156Q	ENSP00000407986:G1153R|ENSP00000365175:R1156Q	G|R	+|+	1|2	0|0	PRRC2A|PRRC2A	31707896|31707896	0.930000|0.930000	0.31532|0.31532	0.992000|0.992000	0.48379|0.48379	0.987000|0.987000	0.75469|0.75469	2.321000|2.321000	0.43805|0.43805	2.761000|2.761000	0.94854|0.94854	0.655000|0.655000	0.94253|0.94253	GGG|CGG		0.701	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
PKHD1	5314	broad.mit.edu	37	6	51613095	51613095	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr6:51613095G>A	ENST00000371117.3	-	58	9594	c.9319C>T	c.(9319-9321)Cga>Tga	p.R3107*	PKHD1_ENST00000340994.4_Nonsense_Mutation_p.R3107*	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3107			R -> P.		cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.R3107*(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TTGTGGCCTCGGATGTGAAAG	0.493																																					p.R3107X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C9319T	6	GRCh37	CM032330	PKHD1	M		.						207.0	187.0	194.0					6																	51613095		2203	4300	6503	51721054	SO:0001587	stop_gained	5314	exon58			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.9319C>T	6.37:g.51613095G>A	ENSP00000360158:p.Arg3107*	Somatic		Capture	Illumina HiSeq	Phase_I	51721054	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Nonsense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	G	50	17.264273	0.99882	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	.	.	.	5.72	-0.155	0.13395	.	1.339720	0.04914	N	0.453813	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	9.2722	0.37679	0.0:0.1821:0.3643:0.4536	.	.	.	.	X	3107	.	ENSP00000341097:R3107X	R	-	1	2	PKHD1	51721054	0.000000	0.05858	0.002000	0.10522	0.797000	0.45037	0.304000	0.19228	0.031000	0.15407	0.655000	0.94253	CGA		0.493	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
MARCKS	4082	broad.mit.edu	37	6	114181210	114181210	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr6:114181210delA	ENST00000368635.4	+	2	835	c.454delA	c.(454-456)aaafs	p.K156fs		NM_002356.5	NP_002347.5	P29966	MARCS_HUMAN	myristoylated alanine-rich protein kinase C substrate	156	Calmodulin-binding (PSD).				energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|germinal vesicle (GO:0042585)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|calmodulin binding (GO:0005516)	p.K155fs*12(1)		breast(1)|kidney(1)|large_intestine(1)|lung(1)	4		all_cancers(87;7.65e-05)|all_epithelial(87;0.000296)|all_hematologic(75;0.0172)|Colorectal(196;0.0317)|all_lung(197;0.198)		Epithelial(106;1.59e-07)|all cancers(137;9.85e-07)|OV - Ovarian serous cystadenocarcinoma(136;0.000322)		CGAGACCCCGAAAAAAAAAAA	0.612																																					p.K152fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.454delA	6						.						9.0	11.0	10.0					6																	114181210		1892	3986	5878	114287903	SO:0001589	frameshift_variant	4082	exon2			M68956	CCDS5101.1	6q21	2014-04-10	2001-12-17	2001-12-20	ENSG00000155130	ENSG00000277443			6759	protein-coding gene	gene with protein product		177061	"""myristoylated alanine-rich protein kinase C substrate (MARCKS, 80K-L)"""	MACS		1560845, 8420923	Standard	NM_002356		Approved	PKCSL, 80K-L	uc003pvy.4	P29966	OTTHUMG00000188327	ENST00000368635.4:c.454delA	6.37:g.114181210delA	ENSP00000357624:p.Lys156fs	Somatic		Capture	Illumina HiSeq	Phase_I	114287903	NM_002356	E1P560|Q2LA83|Q5TDB7	Frame_Shift_Del	DEL	ENST00000368635.4	37	CCDS5101.1																																																																																				0.612	MARCKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041903.1	NM_002356	
UNC93A	54346	broad.mit.edu	37	6	167709636	167709636	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr6:167709636G>A	ENST00000230256.3	+	3	561	c.386G>A	c.(385-387)cGt>cAt	p.R129H	UNC93A_ENST00000366829.2_Missense_Mutation_p.R129H|UNC93A_ENST00000366830.2_3'UTR	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R129H(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GCGGGAAAGCGTGGCAAAGAC	0.547																																					p.R129H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G386A	6						.						243.0	220.0	228.0					6																	167709636		2203	4300	6503	167629626	SO:0001583	missense	54346	exon3			AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.386G>A	6.37:g.167709636G>A	ENSP00000230256:p.Arg129His	Somatic		Capture	Illumina HiSeq	Phase_I	167629626	NM_001143947	B3KRP5|Q4QQJ4|Q5JZD6	Missense_Mutation	SNP	ENST00000230256.3	37	CCDS5300.1	.	.	.	.	.	.	.	.	.	.	G	3.333	-0.136258	0.06711	.	.	ENSG00000112494	ENST00000503433;ENST00000230256;ENST00000366829	T;T;T	0.30981	1.51;3.48;3.53	5.29	-5.73	0.02398	Major facilitator superfamily domain, general substrate transporter (1);	2.016680	0.01974	N	0.044346	T	0.03827	0.0108	N	0.11427	0.14	0.09310	N	1	B;B	0.14438	0.01;0.002	B;B	0.18561	0.022;0.009	T	0.11665	-1.0578	10	0.41790	T	0.15	0.0084	0.9854	0.01445	0.1926:0.2532:0.2968:0.2574	.	129;129	Q4QQJ4;Q86WB7	.;UN93A_HUMAN	H	129	ENSP00000421484:R129H;ENSP00000230256:R129H;ENSP00000355794:R129H	ENSP00000230256:R129H	R	+	2	0	UNC93A	167629626	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.308000	0.08156	-1.904000	0.01092	-3.274000	0.00048	CGT		0.547	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974	
TFR2	7036	broad.mit.edu	37	7	100224412	100224413	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr7:100224412_100224413insT	ENST00000462107.1	-	18	2396_2397	c.2109_2110insA	c.(2107-2112)acacgcfs	p.R704fs	TFR2_ENST00000544242.1_Frame_Shift_Ins_p.R245fs|TFR2_ENST00000431692.1_3'UTR|TFR2_ENST00000223051.3_Frame_Shift_Ins_p.R704fs			Q9UP52	TFR2_HUMAN	transferrin receptor 2	704					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)	p.R704fs*88(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	TTGTACATGCGTGTCAGTCGCT	0.693																																					p.R704fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2110_2111insA	7						.																																			100062349	SO:0001589	frameshift_variant	7036	exon17			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.2110dupA	7.37:g.100224413_100224413dupT	ENSP00000420525:p.Arg704fs	Somatic		Capture	Illumina HiSeq	Phase_I	100062348	NM_003227	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Frame_Shift_Ins	INS	ENST00000462107.1	37	CCDS34707.1																																																																																				0.693	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
FERD3L	222894	broad.mit.edu	37	7	19184972	19184972	+	Missense_Mutation	SNP	G	G	A	rs145174585		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr7:19184972G>A	ENST00000275461.3	-	1	72	c.14C>T	c.(13-15)cCg>cTg	p.P5L	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	5					cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P5L(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						GCAGCTCTCCGGATAGGCCGC	0.637																																					p.P5L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C14T	7						.						27.0	26.0	26.0					7																	19184972		2203	4297	6500	19151497	SO:0001583	missense	222894	exon1			AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.14C>T	7.37:g.19184972G>A	ENSP00000275461:p.Pro5Leu	Somatic		Capture	Illumina HiSeq	Phase_I	19151497	NM_152898	Q495K0	Missense_Mutation	SNP	ENST00000275461.3	37	CCDS5368.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.048275	0.36181	.	.	ENSG00000146618	ENST00000275461	D	0.97731	-4.51	5.22	3.32	0.38043	.	0.489617	0.22055	N	0.065248	D	0.94108	0.8111	L	0.27053	0.805	0.22446	N	0.999094	B	0.25486	0.127	B	0.12837	0.008	D	0.88018	0.2767	10	0.87932	D	0	-16.9581	13.2439	0.60012	0.0:0.305:0.695:0.0	.	5	Q96RJ6	FER3L_HUMAN	L	5	ENSP00000275461:P5L	ENSP00000275461:P5L	P	-	2	0	FERD3L	19151497	0.329000	0.24696	0.247000	0.24249	0.792000	0.44763	0.545000	0.23268	0.645000	0.30675	0.650000	0.86243	CCG		0.637	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207627.1		
DNAH11	8701	broad.mit.edu	37	7	21778459	21778459	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr7:21778459C>T	ENST00000409508.3	+	47	7817	c.7786C>T	c.(7786-7788)Cgg>Tgg	p.R2596W	DNAH11_ENST00000328843.6_Missense_Mutation_p.R2603W	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2603	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R2603W(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CACCCTGATCCGGCAGCATAT	0.368									Kartagener syndrome																												p.P2603L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7808T	7						.						41.0	42.0	42.0					7																	21778459		2177	4282	6459	21744984	SO:0001583	missense	8701	exon47	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.7786C>T	7.37:g.21778459C>T	ENSP00000475939:p.Arg2596Trp	Somatic		Capture	Illumina HiSeq	Phase_I	21744984	NM_003777	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	C	15.11	2.734935	0.48939	.	.	ENSG00000105877	ENST00000328843	T	0.51574	0.7	5.41	4.52	0.55395	ATPase, AAA+ type, core (1);	0.061993	0.64402	D	0.000004	T	0.66752	0.2821	.	.	.	0.54753	D	0.999982	D	0.89917	1.0	D	0.97110	1.0	T	0.70160	-0.4948	9	0.87932	D	0	.	10.1426	0.42744	0.1387:0.7884:0.0:0.0729	.	2603	Q96DT5	DYH11_HUMAN	W	2603	ENSP00000330671:R2603W	ENSP00000330671:R2603W	R	+	1	2	DNAH11	21744984	1.000000	0.71417	0.475000	0.27278	0.287000	0.27160	2.440000	0.44855	1.392000	0.46585	-0.181000	0.13052	CGG		0.368	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
HECW1	23072	broad.mit.edu	37	7	43351609	43351609	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr7:43351609A>G	ENST00000395891.2	+	4	880	c.275A>G	c.(274-276)cAc>cGc	p.H92R	HECW1_ENST00000453890.1_Missense_Mutation_p.H92R	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	92					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.H71R(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						TCCATCGGGCACTCTCAGGAC	0.572																																					p.H92R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A275G	7						.						77.0	84.0	81.0					7																	43351609		2113	4238	6351	43318134	SO:0001583	missense	23072	exon4			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.275A>G	7.37:g.43351609A>G	ENSP00000379228:p.His92Arg	Somatic		Capture	Illumina HiSeq	Phase_I	43318134	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	A	14.12	2.440786	0.43326	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.35605	1.3;1.3	5.87	5.87	0.94306	.	0.154798	0.64402	D	0.000012	T	0.23094	0.0558	N	0.16790	0.44	0.51767	D	0.99993	B;B;B	0.28713	0.22;0.049;0.22	B;B;B	0.21708	0.036;0.026;0.036	T	0.08493	-1.0719	10	0.14252	T	0.57	.	16.2674	0.82597	1.0:0.0:0.0:0.0	.	92;124;92	B4DH42;B3KR18;Q76N89	.;.;HECW1_HUMAN	R	92;92;91	ENSP00000379228:H92R;ENSP00000407774:H92R	ENSP00000265522:H91R	H	+	2	0	HECW1	43318134	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.237000	0.95368	2.242000	0.73789	0.533000	0.62120	CAC		0.572	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
ZNF713	349075	broad.mit.edu	37	7	55991364	55991364	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr7:55991364A>C	ENST00000429591.2	+	3	278	c.240A>C	c.(238-240)gaA>gaC	p.E80D	MRPS17_ENST00000426595.1_Missense_Mutation_p.E80D|ZNF713_ENST00000482436.1_3'UTR	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	80	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E80D(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GGGTGATAGAAAGAGACAGCC	0.468																																					p.E80D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A240C	7						.						93.0	78.0	83.0					7																	55991364		2203	4300	6503	55958858	SO:0001583	missense	349075	exon3			AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.240A>C	7.37:g.55991364A>C	ENSP00000416662:p.Glu80Asp	Somatic		Capture	Illumina HiSeq	Phase_I	55958858	NM_182633		Missense_Mutation	SNP	ENST00000429591.2	37	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	A	5.330	0.246173	0.10130	.	.	ENSG00000249773;ENSG00000178665	ENST00000426595;ENST00000429591	T;T	0.07800	5.41;3.16	3.02	-0.946	0.10385	Krueppel-associated box (1);	1.081430	0.07279	N	0.870453	T	0.07593	0.0191	L	0.47716	1.5	0.09310	N	1	B	0.23316	0.083	B	0.18871	0.023	T	0.41893	-0.9483	10	0.66056	D	0.02	.	3.0216	0.06077	0.5031:0.2303:0.2666:0.0	.	80	Q8N859	ZN713_HUMAN	D	80	ENSP00000390331:E80D;ENSP00000416662:E80D	ENSP00000390331:E80D	E	+	3	2	RP11-15K19.2;ZNF713	55958858	0.088000	0.21588	0.001000	0.08648	0.132000	0.20833	0.690000	0.25451	-0.177000	0.10690	0.533000	0.62120	GAA		0.468	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633	
C7orf43	55262	broad.mit.edu	37	7	99753425	99753425	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr7:99753425G>A	ENST00000316937.3	-	9	1449	c.1264C>T	c.(1264-1266)Cgc>Tgc	p.R422C	MIR4658_ENST00000584344.1_RNA|C7orf43_ENST00000457641.1_Missense_Mutation_p.R153C|C7orf43_ENST00000498638.1_5'Flank|C7orf43_ENST00000419841.1_Missense_Mutation_p.R190C|C7orf43_ENST00000394035.2_5'UTR	NM_018275.3	NP_060745.3	Q8WVR3	CG043_HUMAN	chromosome 7 open reading frame 43	422								p.R422C(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(2)|prostate(1)	10	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ATGGCCCGGCGCTCCTCCTCA	0.627																																					p.R422C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1264T	7						.						44.0	41.0	42.0					7																	99753425		2202	4300	6502	99591361	SO:0001583	missense	55262	exon9				CCDS5687.1	7q22.1	2011-11-25			ENSG00000146826	ENSG00000146826			25604	protein-coding gene	gene with protein product						12477932	Standard	NM_018275		Approved	FLJ10925	uc003utr.3	Q8WVR3	OTTHUMG00000154862	ENST00000316937.3:c.1264C>T	7.37:g.99753425G>A	ENSP00000324741:p.Arg422Cys	Somatic		Capture	Illumina HiSeq	Phase_I	99591361	NM_018275	A4D2A9|D6W5U4|Q9BQJ1|Q9BUB6|Q9NV47	Missense_Mutation	SNP	ENST00000316937.3	37	CCDS5687.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.947477|3.947477	0.73672|0.73672	.|.	.|.	ENSG00000146826|ENSG00000146826	ENST00000456769|ENST00000457641;ENST00000316937;ENST00000275726;ENST00000419841	.|T;T;T	.|0.51817	.|0.69;0.69;0.69	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	.|0.068393	.|0.64402	.|D	.|0.000011	T|T	0.49133|0.49133	0.1539|0.1539	N|N	0.14661|0.14661	0.345|0.345	0.45427|0.45427	D|D	0.998408|0.998408	.|D;D;D;D	.|0.76494	.|0.989;0.999;0.999;0.999	.|B;P;P;P	.|0.60949	.|0.266;0.881;0.881;0.764	T|T	0.54153|0.54153	-0.8336|-0.8336	5|10	.|0.62326	.|D	.|0.03	-17.7693|-17.7693	15.235|15.235	0.73422|0.73422	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|190;44;48;422	.|E9PFF9;Q8WVR3-2;Q8WVR3-3;Q8WVR3	.|.;.;.;CG043_HUMAN	V|C	327|153;422;44;190	.|ENSP00000396432:R153C;ENSP00000324741:R422C;ENSP00000406326:R190C	.|ENSP00000275726:R44C	A|R	-|-	2|1	0|0	C7orf43|C7orf43	99591361|99591361	0.989000|0.989000	0.36119|0.36119	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.936000|4.936000	0.63506|0.63506	2.667000|2.667000	0.90743|0.90743	0.561000|0.561000	0.74099|0.74099	GCG|CGC		0.627	C7orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337395.2	NM_018275	
XKR6	286046	broad.mit.edu	37	8	10756047	10756047	+	Silent	SNP	C	C	T	rs200587252	byFrequency	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr8:10756047C>T	ENST00000416569.2	-	3	1367	c.1341G>A	c.(1339-1341)acG>acA	p.T447T	XKR6_ENST00000304437.2_Silent_p.T168T	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	447						integral component of membrane (GO:0016021)		p.T447T(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		TCAAGACTATCGTATAATATG	0.473													C|||	2	0.000399361	0.0	0.0029	5008	,	,		22275	0.0		0.0	False		,,,				2504	0.0				p.T447T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1341A	8						.						142.0	125.0	131.0					8																	10756047		2203	4300	6503	10793457	SO:0001819	synonymous_variant	286046	exon3			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.1341G>A	8.37:g.10756047C>T		Somatic		Capture	Illumina HiSeq	Phase_I	10793457	NM_173683	Q8TBA0	Silent	SNP	ENST00000416569.2	37	CCDS5978.2	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	3.476	-0.106967	0.06924	.	.	ENSG00000171044	ENST00000382461	.	.	.	5.27	1.34	0.21922	.	.	.	.	.	T	0.44726	0.1307	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21245	-1.0251	4	.	.	.	-13.3615	2.8826	0.05652	0.1356:0.4538:0.2632:0.1474	.	.	.	.	Q	224	.	.	R	-	2	0	XKR6	10793457	0.008000	0.16893	0.996000	0.52242	0.969000	0.65631	-1.188000	0.03064	-0.039000	0.13602	-0.254000	0.11334	CGA		0.473	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683	
CSMD1	64478	broad.mit.edu	37	8	3166020	3166020	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr8:3166020C>A	ENST00000520002.1	-	25	4195	c.3640G>T	c.(3640-3642)Gat>Tat	p.D1214Y	CSMD1_ENST00000602557.1_Missense_Mutation_p.D1214Y|CSMD1_ENST00000539096.1_Missense_Mutation_p.D1213Y|CSMD1_ENST00000602723.1_Missense_Mutation_p.D1214Y|CSMD1_ENST00000400186.3_Missense_Mutation_p.D1214Y|CSMD1_ENST00000537824.1_Missense_Mutation_p.D1213Y|CSMD1_ENST00000542608.1_Missense_Mutation_p.D1213Y			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1214						integral component of membrane (GO:0016021)		p.D1213Y(1)|p.D942Y(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTTACCAGATCAAAACCTGCA	0.458																																					p.X1213L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3638T	8						.						59.0	55.0	56.0					8																	3166020		1918	4133	6051	3153427	SO:0001583	missense	64478	exon24					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3640G>T	8.37:g.3166020C>A	ENSP00000430733:p.Asp1214Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	3153427	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.69|12.69	2.012769|2.012769	0.35511|0.35511	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.38077|.	1.16;1.16;1.16;1.16;1.16|.	5.1|5.1	5.1|5.1	0.69264|0.69264	CUB (2);|.	0.128533|.	0.49916|.	D|.	0.000130|.	T|.	0.68824|.	0.3043|.	L|L	0.47016|0.47016	1.485|1.485	0.80722|0.80722	D|D	1|1	P;P;P|.	0.45634|.	0.694;0.863;0.676|.	B;P;P|.	0.55455|.	0.278;0.62;0.776|.	T|.	0.65298|.	-0.6202|.	10|.	0.72032|.	D|.	0.01|.	.|.	18.8807|18.8807	0.92354|0.92354	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1214;1214;1214|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	Y|L	1214;1214;1076;1213;1213;1213|693	ENSP00000383047:D1214Y;ENSP00000430733:D1214Y;ENSP00000441462:D1213Y;ENSP00000446243:D1213Y;ENSP00000441675:D1213Y|.	ENSP00000320445:D1076Y|.	D|X	-|-	1|2	0|2	CSMD1|CSMD1	3153427|3153427	1.000000|1.000000	0.71417|0.71417	0.971000|0.971000	0.41717|0.41717	0.162000|0.162000	0.22319|0.22319	3.843000|3.843000	0.55865|0.55865	2.517000|2.517000	0.84864|0.84864	0.561000|0.561000	0.74099|0.74099	GAT|TGA		0.458	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
NEFL	4747	broad.mit.edu	37	8	24813798	24813798	+	RNA	SNP	C	C	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr8:24813798C>T	ENST00000221169.5	-	0	826				CTD-2168K21.2_ENST00000607735.1_RNA			P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)	p.A78T(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		TTGCTGATGGCGGCTACCTGG	0.637																																					p.A78T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G232A	8						.						30.0	34.0	32.0					8																	24813798		2173	4274	6447	24869715			4747	exon1				CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24813798C>T		Somatic		Capture	Illumina HiSeq	Phase_I	24869715	NM_006158	B9ZVN2|Q16154|Q8IU72	Missense_Mutation	SNP	ENST00000221169.5	37																																																																																					0.637	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000258943.4	NM_006158	
KAT6A	7994	broad.mit.edu	37	8	41792145	41792145	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr8:41792145G>A	ENST00000396930.3	-	18	4136	c.3593C>T	c.(3592-3594)gCt>gTt	p.A1198V	KAT6A_ENST00000406337.1_Missense_Mutation_p.A1198V|KAT6A_ENST00000265713.2_Missense_Mutation_p.A1198V	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1198					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A1198V(1)									TTTACGTCCAGCTTTAGGAAT	0.483																																					p.A1198V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3593T	8						.						153.0	145.0	148.0					8																	41792145		2203	4300	6503	41911302	SO:0001583	missense	7994	exon18			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3593C>T	8.37:g.41792145G>A	ENSP00000380136:p.Ala1198Val	Somatic		Capture	Illumina HiSeq	Phase_I	41911302	NM_001099413	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	G	5.493	0.275984	0.10403	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.59638	0.25;0.25;0.25	5.95	3.1	0.35709	.	0.931084	0.09154	N	0.841106	T	0.36496	0.0969	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.20207	-1.0282	10	0.25751	T	0.34	2.3009	10.0849	0.42412	0.0638:0.0:0.6898:0.2463	.	1198	Q92794	KAT6A_HUMAN	V	1198	ENSP00000265713:A1198V;ENSP00000385888:A1198V;ENSP00000380136:A1198V	ENSP00000265713:A1198V	A	-	2	0	KAT6A	41911302	0.123000	0.22298	0.003000	0.11579	0.113000	0.19764	2.840000	0.48215	0.848000	0.35191	0.655000	0.94253	GCT		0.483	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
GDF6	392255	broad.mit.edu	37	8	97157670	97157670	+	Silent	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr8:97157670G>A	ENST00000287020.5	-	2	588	c.489C>T	c.(487-489)ggC>ggT	p.G163G		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	163					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)		p.G163G(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					GCAGCTCCGCGCCCACCAGCT	0.597																																					p.G163G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C489T	8						.						8.0	11.0	10.0					8																	97157670		1717	3531	5248	97226846	SO:0001819	synonymous_variant	392255	exon2				CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.489C>T	8.37:g.97157670G>A		Somatic		Capture	Illumina HiSeq	Phase_I	97226846	NM_001001557	Q6PI58	Silent	SNP	ENST00000287020.5	37	CCDS34926.1																																																																																				0.597	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379862.2	NM_001001557	
KCNQ3	3786	broad.mit.edu	37	8	133152327	133152327	+	Missense_Mutation	SNP	C	C	T	rs143683496		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr8:133152327C>T	ENST00000388996.4	-	11	1984	c.1564G>A	c.(1564-1566)Gtc>Atc	p.V522I	KCNQ3_ENST00000521134.1_Missense_Mutation_p.V402I|KCNQ3_ENST00000519445.1_Missense_Mutation_p.V522I	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	522					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.V522I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CATTACCTGACGGCTCGGATG	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		16671	0.0		0.0	False		,,,				2504	0.001				p.V522I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1564A	8						.	C	ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	57.0	62.0	61.0		1204,1564	6.0	1.0	8	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KCNQ3	NM_001204824.1,NM_004519.3	29,29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging	402/753,522/873	133152327	2,13004	2203	4300	6503	133221509	SO:0001583	missense	3786	exon11			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1564G>A	8.37:g.133152327C>T	ENSP00000373648:p.Val522Ile	Somatic		Capture	Illumina HiSeq	Phase_I	133221509	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.386548	0.61956	2.27E-4	1.16E-4	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.99557	-6.16;-6.16;-6.16	6.03	6.03	0.97812	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.368443	0.29009	N	0.013435	D	0.97300	0.9117	N	0.10685	0.025	0.34149	D	0.667365	P;P	0.48162	0.906;0.906	B;B	0.39379	0.298;0.298	D	0.98376	1.0556	10	0.11794	T	0.64	.	19.545	0.95291	0.0:1.0:0.0:0.0	.	522;522	E7ET42;O43525	.;KCNQ3_HUMAN	I	522;402;522;511;401	ENSP00000373648:V522I;ENSP00000429799:V402I;ENSP00000428790:V522I	ENSP00000373648:V522I	V	-	1	0	KCNQ3	133221509	0.999000	0.42202	0.982000	0.44146	0.913000	0.54294	4.017000	0.57167	2.861000	0.98227	0.655000	0.94253	GTC		0.597	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
PLEC	5339	broad.mit.edu	37	8	144993915	144993915	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr8:144993915delG	ENST00000322810.4	-	32	10654	c.10485delC	c.(10483-10485)gccfs	p.A3495fs	PLEC_ENST00000354589.3_Frame_Shift_Del_p.A3358fs|PLEC_ENST00000356346.3_Frame_Shift_Del_p.A3344fs|PLEC_ENST00000357649.2_Frame_Shift_Del_p.A3362fs|PLEC_ENST00000436759.2_Frame_Shift_Del_p.A3385fs|PLEC_ENST00000398774.2_Frame_Shift_Del_p.A3326fs|PLEC_ENST00000354958.2_Frame_Shift_Del_p.A3336fs|PLEC_ENST00000527096.1_Frame_Shift_Del_p.A3381fs|PLEC_ENST00000345136.3_Frame_Shift_Del_p.A3358fs	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3495	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GGTAGATGCCGGCGAGGCAGC	0.662																																					p.A3362fs												.	.	0			c.10086delC	8						.						23.0	27.0	26.0					8																	144993915		2088	4177	6265	145065903	SO:0001589	frameshift_variant	5339	exon32			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10485delC	8.37:g.144993915delG	ENSP00000323856:p.Ala3495fs	None		Capture	Illumina HiSeq	Phase_I	145065903	NM_201383	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Frame_Shift_Del	DEL	ENST00000322810.4	37	CCDS43772.1																																																																																				0.662	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
OLFML2A	169611	broad.mit.edu	37	9	127549502	127549502	+	Silent	SNP	G	G	T	rs370096635		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr9:127549502G>T	ENST00000373580.3	+	2	339	c.339G>T	c.(337-339)gcG>gcT	p.A113A		NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	113					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.A113A(1)		endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						AAAAGCAGGCGCCCGAGCTCC	0.572																																					p.A113A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G339T	9						.						52.0	60.0	57.0					9																	127549502		2008	4169	6177	126589323	SO:0001819	synonymous_variant	169611	exon2			AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.339G>T	9.37:g.127549502G>T		Somatic		Capture	Illumina HiSeq	Phase_I	126589323	NM_182487	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Silent	SNP	ENST00000373580.3	37	CCDS6857.2																																																																																				0.572	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487	
COL5A1	1289	broad.mit.edu	37	9	137716565	137716565	+	Silent	SNP	C	C	T	rs190912679		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr9:137716565C>T	ENST00000371817.3	+	62	5232	c.4818C>T	c.(4816-4818)gaC>gaT	p.D1606D		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1606					axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.D1606D(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ACTACGCGGACGGCATGGAAG	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		18826	0.001		0.0	False		,,,				2504	0.0				p.D1606D												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C4818T	9						.	C		0,4406		0,0,2203	87.0	73.0	78.0		4818	-1.9	0.9	9		78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	COL5A1	NM_000093.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1606/1839	137716565	1,13005	2203	4300	6503	136856386	SO:0001819	synonymous_variant	1289	exon62			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4818C>T	9.37:g.137716565C>T		Somatic		Capture	Illumina HiSeq	Phase_I	136856386	NM_000093	Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	37	CCDS6982.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	4.549	0.101918	0.08731	0.0	1.16E-4	ENSG00000130635	ENST00000371820	.	.	.	4.34	-1.89	0.07689	.	.	.	.	.	T	0.55737	0.1939	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53041	-0.8494	4	.	.	.	.	10.6034	0.45379	0.0:0.3315:0.0:0.6685	.	.	.	.	W	26	.	.	R	+	1	2	COL5A1	136856386	0.004000	0.15560	0.930000	0.37139	0.356000	0.29392	-1.185000	0.03073	-0.193000	0.10415	-0.242000	0.12053	CGG		0.627	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
RIC1	57589	broad.mit.edu	37	9	5757384	5757384	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr9:5757384T>C	ENST00000414202.2	+	17	2116	c.1925T>C	c.(1924-1926)cTg>cCg	p.L642P	KIAA1432_ENST00000418622.3_Missense_Mutation_p.L563P|KIAA1432_ENST00000381532.2_Missense_Mutation_p.L563P|KIAA1432_ENST00000449720.2_Missense_Mutation_p.L526P|KIAA1432_ENST00000251879.6_Missense_Mutation_p.L642P	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.L563P(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		CACCCTTTCCTGGTGGTATCT	0.428																																					p.L563P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1688C	9						.						269.0	242.0	251.0					9																	5757384		2203	4300	6503	5747384	SO:0001583	missense	57589	exon16																														ENST00000414202.2:c.1925T>C	9.37:g.5757384T>C	ENSP00000416696:p.Leu642Pro	Somatic		Capture	Illumina HiSeq	Phase_I	5747384	NM_020829		Missense_Mutation	SNP	ENST00000414202.2	37	CCDS34982.2	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517038	0.85495	.	.	ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.68044	0.2958	L	0.54323	1.7	0.80722	D	1	D;D;P;P	0.67145	0.996;0.996;0.712;0.627	P;P;B;B	0.59703	0.862;0.806;0.1;0.155	T	0.64007	-0.6508	9	0.26408	T	0.33	-10.6273	16.6407	0.85098	0.0:0.0:0.0:1.0	.	526;563;642;642	B7ZM67;B2RN24;Q4ADV7;G5E932	.;.;RIC1_HUMAN;.	P	642;642;563;563;526	.	ENSP00000251879:L642P	L	+	2	0	KIAA1432	5747384	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.629000	0.83207	2.326000	0.78906	0.533000	0.62120	CTG		0.428	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
TEK	7010	broad.mit.edu	37	9	27168543	27168543	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr9:27168543G>A	ENST00000380036.4	+	3	857	c.415G>A	c.(415-417)Gtg>Atg	p.V139M	TEK_ENST00000406359.4_Missense_Mutation_p.V139M|TEK_ENST00000519097.1_Missense_Mutation_p.V35M	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	139					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V139M(1)		breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	GGGAGATAACGTGAACATATC	0.353																																					p.V139M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G415A	9						.						158.0	146.0	150.0					9																	27168543		2203	4300	6503	27158543	SO:0001583	missense	7010	exon3			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.415G>A	9.37:g.27168543G>A	ENSP00000369375:p.Val139Met	Somatic		Capture	Illumina HiSeq	Phase_I	27158543	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.786153	0.70337	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000346448;ENST00000406359	T;T;T	0.80909	-1.28;-1.33;-1.43	5.59	5.59	0.84812	Immunoglobulin-like fold (1);	0.000000	0.46145	D	0.000305	T	0.81432	0.4821	N	0.24115	0.695	0.37433	D	0.914113	D;D;D;D;D	0.89917	0.999;0.998;0.999;0.999;1.0	P;D;P;D;P	0.64595	0.862;0.927;0.861;0.921;0.902	D	0.84592	0.0667	10	0.66056	D	0.02	.	12.867	0.57946	0.0751:0.0:0.9248:0.0	.	35;172;139;139;139	E7EWI2;Q59HG2;B5A953;B4DHD3;Q02763	.;.;.;.;TIE2_HUMAN	M	35;139;139;139	ENSP00000430686:V35M;ENSP00000369375:V139M;ENSP00000383977:V139M	ENSP00000343716:V139M	V	+	1	0	TEK	27158543	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.719000	0.61937	2.784000	0.95788	0.643000	0.83706	GTG		0.353	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
FCN1	2219	broad.mit.edu	37	9	137805445	137805445	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chr9:137805445A>T	ENST00000371806.3	-	5	413	c.322T>A	c.(322-324)Tct>Act	p.S108T		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	108					cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)	p.S108T(1)		endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		CACGACTGAGACTGCCCAGCG	0.592																																					p.S108T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T322A	9						.						105.0	75.0	85.0					9																	137805445		2203	4300	6503	136945266	SO:0001583	missense	2219	exon5			D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.322T>A	9.37:g.137805445A>T	ENSP00000360871:p.Ser108Thr	Somatic		Capture	Illumina HiSeq	Phase_I	136945266	NM_002003	Q5VYV5|Q92596	Missense_Mutation	SNP	ENST00000371806.3	37	CCDS6985.1	.	.	.	.	.	.	.	.	.	.	A	0.024	-1.386643	0.01194	.	.	ENSG00000085265	ENST00000371807;ENST00000371806;ENST00000308299	D	0.93547	-3.24	2.77	-5.54	0.02544	.	.	.	.	.	T	0.76695	0.4023	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.15870	0.014	T	0.67894	-0.5552	9	0.05620	T	0.96	.	1.2065	0.01896	0.2279:0.3736:0.1507:0.2479	.	108	O00602	FCN1_HUMAN	T	108;108;96	ENSP00000360871:S108T	ENSP00000308877:S96T	S	-	1	0	FCN1	136945266	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.694000	0.05115	-2.790000	0.00356	-1.605000	0.00808	TCT		0.592	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054963.1	NM_002003	
TEX13A	56157	broad.mit.edu	37	X	104464408	104464409	+	Frame_Shift_Ins	INS	-	-	C	rs183367827		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chrX:104464408_104464409insC	ENST00000413579.1	-	3	580_581	c.469_470insG	c.(469-471)gcafs	p.A157fs	TEX13A_ENST00000372578.3_Frame_Shift_Ins_p.A157fs|IL1RAPL2_ENST00000344799.4_Intron|IL1RAPL2_ENST00000372582.1_Intron|TEX13A_ENST00000372575.1_Frame_Shift_Ins_p.A157fs			Q9BXU3	TX13A_HUMAN	testis expressed 13A	157							zinc ion binding (GO:0008270)	p.A157fs*19(1)		large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						TGGCCACCCTGCCCCCTGCTCC	0.658																																					p.A157fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.470_471insG	X						.																																			104351065	SO:0001589	frameshift_variant	56157	exon3			AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.470dupG	X.37:g.104464413_104464413dupC	ENSP00000399753:p.Ala157fs	Somatic		Capture	Illumina HiSeq	Phase_I	104351064	NM_031274	B1B1G8|Q32NB6	Frame_Shift_Ins	INS	ENST00000413579.1	37																																																																																					0.658	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_031274	
PLXNA3	55558	broad.mit.edu	37	X	153688564	153688565	+	Frame_Shift_Ins	INS	-	-	G	rs375310385		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chrX:153688564_153688565insG	ENST00000369682.3	+	2	216_217	c.41_42insG	c.(40-45)gtggggfs	p.VG14fs		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	14					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)	p.A17fs*39(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TTCCTTGCCGTGGGGGGGGCCC	0.683																																					p.V14fs												.	.	1	Insertion - Frameshift(1)	ovary(1)	c.41_42insG	X						.																																			153341759	SO:0001589	frameshift_variant	55558	exon2			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.49dupG	X.37:g.153688572_153688572dupG	ENSP00000358696:p.Val14fs	None		Capture	Illumina HiSeq	Phase_I	153341758	NM_017514	Q5HY36	Frame_Shift_Ins	INS	ENST00000369682.3	37	CCDS14752.1																																																																																				0.683	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	
ARX	170302	broad.mit.edu	37	X	25033717	25033717	+	Silent	SNP	G	G	T	rs144099565		TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chrX:25033717G>T	ENST00000379044.4	-	1	348	c.138C>A	c.(136-138)gcC>gcA	p.A46A		NM_139058.2	NP_620689.1	Q96QS3	ARX_HUMAN	aristaless related homeobox	46					axon guidance (GO:0007411)|cell proliferation in forebrain (GO:0021846)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex tangential migration (GO:0021800)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|epithelial cell fate commitment (GO:0072148)|globus pallidus development (GO:0021759)|lipid digestion (GO:0044241)|positive regulation of organ growth (GO:0046622)|regulation of cell proliferation (GO:0042127)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.A46A(1)		kidney(1)|large_intestine(2)|lung(1)	4						AGCTCTGCGCGGCTCCCAGCA	0.617																																					p.A46A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C138A	X						.	G		1,3831		0,1,1630,570	32.0	28.0	30.0		138	-1.6	1.0	X	dbSNP_134	30	0,6727		0,0,2428,1871	no	coding-synonymous	ARX	NM_139058.2		0,1,4058,2441	TT,TG,GG,G		0.0,0.0261,0.0095		46/563	25033717	1,10558	2201	4299	6500	24943638	SO:0001819	synonymous_variant	170302	exon1			AY038071	CCDS14215.1	Xp21.3	2011-06-20			ENSG00000004848	ENSG00000004848		"""Homeoboxes / PRD class"""	18060	protein-coding gene	gene with protein product	"""cancer/testis antigen 121"""	300382	"""mental retardation, X-linked 54"", ""mental retardation, X-linked 43"", ""mental retardation, X-linked 36"", ""mental retardation, X-linked 29"", ""mental retardation, X-linked 32"", ""mental retardation, X-linked 33"", ""mental retardation, X-linked 38"", ""mental retardation, X-linked 87"", ""mental retardation, X-linked 76"""	MRXS1, PRTS, MRX76, MRX54, MRX43, MRX36, MRX29, MRX32, MRX33, MRX38, MRX87		11889467, 15850492, 17480217	Standard	NM_139058		Approved	ISSX, CT121, EIEE1	uc004dbp.4	Q96QS3	OTTHUMG00000021275	ENST00000379044.4:c.138C>A	X.37:g.25033717G>T		Somatic		Capture	Illumina HiSeq	Phase_I	24943638	NM_139058		Silent	SNP	ENST00000379044.4	37	CCDS14215.1																																																																																				0.617	ARX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056109.1		
AGTR2	186	broad.mit.edu	37	X	115304083	115304083	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3989-01A-01W-0995-10	TCGA-AA-3989-10A-01W-0999-10	g.chrX:115304083G>A	ENST00000371906.4	+	3	740	c.550G>A	c.(550-552)Gtc>Atc	p.V184I		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	184					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)	p.V184I(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	TTTTCGAGACGTCAGAACCAT	0.408																																					p.V184I												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G550A	X						.						152.0	134.0	140.0					X																	115304083		2203	4300	6503	115218111	SO:0001583	missense	186	exon3			AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.550G>A	X.37:g.115304083G>A	ENSP00000360973:p.Val184Ile	Somatic		Capture	Illumina HiSeq	Phase_I	115218111	NM_000686	B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	ENST00000371906.4	37	CCDS14569.1	.	.	.	.	.	.	.	.	.	.	G	8.343	0.829126	0.16749	.	.	ENSG00000180772	ENST00000371906	T	0.72394	-0.65	4.58	2.64	0.31445	GPCR, rhodopsin-like superfamily (1);	0.257437	0.37715	N	0.001976	T	0.58935	0.2157	L	0.48642	1.525	0.24222	N	0.995433	B	0.09022	0.002	B	0.12837	0.008	T	0.49570	-0.8926	10	0.37606	T	0.19	-8.6212	7.2945	0.26385	0.2448:0.0:0.7552:0.0	.	184	P50052	AGTR2_HUMAN	I	184	ENSP00000360973:V184I	ENSP00000360973:V184I	V	+	1	0	AGTR2	115218111	1.000000	0.71417	0.999000	0.59377	0.946000	0.59487	4.045000	0.57368	0.943000	0.37553	0.506000	0.49869	GTC		0.408	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686	
