#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DOCK1	1793	broad.mit.edu	37	10	129207382	129207382	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr10:129207382G>A	ENST00000280333.6	+	41	4250	c.4141G>A	c.(4141-4143)Gcc>Acc	p.A1381T		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1381	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.A1381T(1)		NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GTTTCCAAACGCCGAGAAAAT	0.448																																					p.A1381T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4141A	10						.						20.0	19.0	20.0					10																	129207382		1849	4104	5953	129097372	SO:0001583	missense	1793	exon41			D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.4141G>A	10.37:g.129207382G>A	ENSP00000280333:p.Ala1381Thr	Somatic		Capture	Illumina HiSeq	Phase_I	129097372	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	G	29.9	5.047857	0.93740	.	.	ENSG00000150760	ENST00000280333	T	0.06849	3.25	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.40595	0.1123	M	0.93720	3.45	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;P	0.72338	0.952;0.977;0.884	T	0.55854	-0.8075	10	0.87932	D	0	.	18.4444	0.90678	0.0:0.0:1.0:0.0	.	1381;1447;1381	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	T	1381	ENSP00000280333:A1381T	ENSP00000280333:A1381T	A	+	1	0	DOCK1	129097372	1.000000	0.71417	0.321000	0.25320	0.844000	0.47949	9.519000	0.98025	2.652000	0.90054	0.655000	0.94253	GCC		0.448	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
OR4C11	219429	broad.mit.edu	37	11	55370958	55370958	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr11:55370958T>A	ENST00000302231.4	-	1	916	c.892A>T	c.(892-894)Aag>Tag	p.K298*		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K298*(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						TGCCATAACTTTCTCATGGCA	0.363																																					p.K298X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A892T	11						.						52.0	47.0	49.0					11																	55370958		2178	3997	6175	55127534	SO:0001587	stop_gained	219429	exon1			AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.892A>T	11.37:g.55370958T>A	ENSP00000306651:p.Lys298*	Somatic		Capture	Illumina HiSeq	Phase_I	55127534	NM_001004700	B9EIL4|Q8NGL8	Nonsense_Mutation	SNP	ENST00000302231.4	37	CCDS31503.1	.	.	.	.	.	.	.	.	.	.	T	14.45	2.538876	0.45176	.	.	ENSG00000172188	ENST00000302231	.	.	.	4.33	0.546	0.17196	.	0.123212	0.35936	U	0.002883	.	.	.	.	.	.	0.29102	N	0.88141	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.0265	0.24942	0.0:0.083:0.2777:0.6393	.	.	.	.	X	298	.	ENSP00000306651:K298X	K	-	1	0	OR4C11	55127534	0.005000	0.15991	0.000000	0.03702	0.429000	0.31625	0.281000	0.18810	-0.272000	0.09259	-2.603000	0.00161	AAG		0.363	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700	
OR10AG1	282770	broad.mit.edu	37	11	55735460	55735460	+	Silent	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr11:55735460G>A	ENST00000312345.2	-	1	530	c.480C>T	c.(478-480)tgC>tgT	p.C160C		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C160C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					TGTTAGTTCCGCAAAAGGGCA	0.393																																					p.C160C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C480T	11						.						81.0	78.0	79.0					11																	55735460		2201	4296	6497	55492036	SO:0001819	synonymous_variant	282770	exon1			AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.480C>T	11.37:g.55735460G>A		Somatic		Capture	Illumina HiSeq	Phase_I	55492036	NM_001005491	B2RNH4|Q6IEU3	Silent	SNP	ENST00000312345.2	37	CCDS31514.1																																																																																				0.393	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491	
TNKS1BP1	85456	broad.mit.edu	37	11	57077855	57077855	+	Missense_Mutation	SNP	T	T	G	rs150510361	byFrequency	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr11:57077855T>G	ENST00000532437.1	-	5	2641	c.2330A>C	c.(2329-2331)aAg>aCg	p.K777T	TNKS1BP1_ENST00000530920.1_5'UTR|TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.K777T			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	777	Acidic.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.K777T(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				TTGCCCATACTTGCTGGTCCA	0.622													T|||	7	0.00139776	0.0045	0.0014	5008	,	,		18620	0.0		0.0	False		,,,				2504	0.0				p.K777T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2330C	11						.	T	THR/LYS	19,4383	26.2+/-53.5	0,19,2182	98.0	77.0	84.0		2330	0.5	0.3	11	dbSNP_134	84	0,8592		0,0,4296	yes	missense	TNKS1BP1	NM_033396.2	78	0,19,6478	GG,GT,TT		0.0,0.4316,0.1462	probably-damaging	777/1730	57077855	19,12975	2201	4296	6497	56834431	SO:0001583	missense	85456	exon6			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.2330A>C	11.37:g.57077855T>G	ENSP00000437271:p.Lys777Thr	Somatic		Capture	Illumina HiSeq	Phase_I	56834431	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	T	17.32	3.359105	0.61403	0.004316	0.0	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.32753	1.44;1.44	5.56	0.483	0.16820	.	0.701416	0.12324	N	0.478967	T	0.18467	0.0443	L	0.34521	1.04	0.09310	N	1	P	0.42518	0.782	B	0.40256	0.324	T	0.12091	-1.0561	10	0.44086	T	0.13	-19.0318	1.1968	0.01877	0.1495:0.1658:0.1556:0.5291	.	777	Q9C0C2	TB182_HUMAN	T	777	ENSP00000350990:K777T;ENSP00000437271:K777T	ENSP00000350990:K777T	K	-	2	0	TNKS1BP1	56834431	0.000000	0.05858	0.262000	0.24481	0.940000	0.58332	-1.125000	0.03257	0.048000	0.15891	0.379000	0.24179	AAG		0.622	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
PIWIL4	143689	broad.mit.edu	37	11	94340776	94340776	+	Missense_Mutation	SNP	G	G	A	rs371297833		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr11:94340776G>A	ENST00000299001.6	+	14	2021	c.1810G>A	c.(1810-1812)Gga>Aga	p.G604R	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	604	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)	p.G604R(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTGCAAGCTCGGAGGCGAGCT	0.428																																					p.G604R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1810A	11						.	G	ARG/GLY	1,4401	2.1+/-5.4	0,1,2200	70.0	68.0	69.0		1810	4.8	0.8	11		69	0,8596		0,0,4298	no	missense	PIWIL4	NM_152431.2	125	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	604/853	94340776	1,12997	2201	4298	6499	93980424	SO:0001583	missense	143689	exon14			AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1810G>A	11.37:g.94340776G>A	ENSP00000299001:p.Gly604Arg	Somatic		Capture	Illumina HiSeq	Phase_I	93980424	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	37	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469598	0.63625	2.27E-4	0.0	ENSG00000134627	ENST00000299001	T	0.66995	-0.24	4.75	4.75	0.60458	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.309960	0.27302	N	0.019989	D	0.88175	0.6366	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.92413	0.5939	10	0.87932	D	0	-9.3702	16.6598	0.85238	0.0:0.0:1.0:0.0	.	604	Q7Z3Z4	PIWL4_HUMAN	R	604	ENSP00000299001:G604R	ENSP00000299001:G604R	G	+	1	0	PIWIL4	93980424	1.000000	0.71417	0.832000	0.32986	0.155000	0.21991	9.130000	0.94437	2.454000	0.82982	0.557000	0.71058	GGA		0.428	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
TECTA	7007	broad.mit.edu	37	11	120996279	120996279	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr11:120996279G>A	ENST00000392793.1	+	8	1743	c.1472G>A	c.(1471-1473)cGt>cAt	p.R491H	TECTA_ENST00000264037.2_Missense_Mutation_p.R491H			O75443	TECTA_HUMAN	tectorin alpha	491	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.R491H(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GAGAGCTGGCGTGTGTACCAC	0.582																																					p.R491H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1472A	11						.						76.0	81.0	79.0					11																	120996279		2203	4299	6502	120501489	SO:0001583	missense	7007	exon7			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.1472G>A	11.37:g.120996279G>A	ENSP00000376543:p.Arg491His	Somatic		Capture	Illumina HiSeq	Phase_I	120501489	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328667	0.81690	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.38560	1.13;1.13	5.02	5.02	0.67125	von Willebrand factor, type D domain (1);	0.000000	0.85682	D	0.000000	T	0.69015	0.3064	M	0.88775	2.98	0.42195	D	0.991745	D	0.89917	1.0	D	0.85130	0.997	T	0.75351	-0.3348	10	0.66056	D	0.02	.	14.0124	0.64505	0.0755:0.0:0.9245:0.0	.	491	O75443	TECTA_HUMAN	H	491	ENSP00000376543:R491H;ENSP00000264037:R491H	ENSP00000264037:R491H	R	+	2	0	TECTA	120501489	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	4.291000	0.59025	2.511000	0.84671	0.563000	0.77884	CGT		0.582	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
DDX23	9416	broad.mit.edu	37	12	49239528	49239528	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr12:49239528G>T	ENST00000308025.3	-	2	117	c.38C>A	c.(37-39)gCa>gAa	p.A13E	DDX23_ENST00000553182.1_5'UTR	NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	13					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)	p.A13E(1)		NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						GGAAGGTGATGCATCACGGTC	0.483																																					p.A13E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C38A	12						.						60.0	49.0	53.0					12																	49239528		2203	4300	6503	47525795	SO:0001583	missense	9416	exon2			AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.38C>A	12.37:g.49239528G>T	ENSP00000310723:p.Ala13Glu	Somatic		Capture	Illumina HiSeq	Phase_I	47525795	NM_004818	B2R600|B4DH15|O43188	Missense_Mutation	SNP	ENST00000308025.3	37	CCDS8770.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530677	0.45073	.	.	ENSG00000174243	ENST00000308025;ENST00000552512;ENST00000551468	T	0.19105	2.17	6.04	-0.464	0.12160	.	0.534882	0.21355	N	0.075913	T	0.09069	0.0224	N	0.12182	0.205	0.19575	N	0.999964	B	0.19583	0.037	B	0.09377	0.004	T	0.20207	-1.0282	10	0.40728	T	0.16	0.0953	5.6365	0.17540	0.375:0.2175:0.4075:0.0	.	13	Q9BUQ8	DDX23_HUMAN	E	13	ENSP00000310723:A13E	ENSP00000310723:A13E	A	-	2	0	DDX23	47525795	0.002000	0.14202	0.945000	0.38365	0.677000	0.39632	0.363000	0.20301	-0.073000	0.12842	-0.291000	0.09656	GCA		0.483	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408897.2	NM_004818	
C12orf50	160419	broad.mit.edu	37	12	88381685	88381685	+	Silent	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr12:88381685C>T	ENST00000298699.2	-	9	939	c.759G>A	c.(757-759)acG>acA	p.T253T	C12orf50_ENST00000550553.1_Intron	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50	253								p.T253T(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						TTAATACATGCGTTGTAGGTA	0.358																																					p.T253T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G759A	12						.						157.0	139.0	145.0					12																	88381685		2203	4300	6503	86905816	SO:0001819	synonymous_variant	160419	exon9			AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.759G>A	12.37:g.88381685C>T		Somatic		Capture	Illumina HiSeq	Phase_I	86905816	NM_152589	Q6P674	Silent	SNP	ENST00000298699.2	37	CCDS9031.1																																																																																				0.358	C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406328.1	NM_152589	
TEX26	122046	broad.mit.edu	37	13	31526870	31526870	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr13:31526870G>C	ENST00000380473.3	+	3	233	c.220G>C	c.(220-222)Gat>Cat	p.D74H		NM_152325.1	NP_689538.1	Q8N6G2	TEX26_HUMAN	testis expressed 26	74								p.D74H(1)									ACAATATAGTGATGAGTACAC	0.338																																					p.D74H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G220C	13						.						109.0	103.0	105.0					13																	31526870		2203	4296	6499	30424870	SO:0001583	missense	122046	exon3			BC030277	CCDS9339.1	13q12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000175664	ENSG00000175664			28622	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 26"""	C13orf26		12477932	Standard	NM_152325		Approved	MGC40178	uc001uti.3	Q8N6G2	OTTHUMG00000016682	ENST00000380473.3:c.220G>C	13.37:g.31526870G>C	ENSP00000369840:p.Asp74His	Somatic		Capture	Illumina HiSeq	Phase_I	30424870	NM_152325		Missense_Mutation	SNP	ENST00000380473.3	37	CCDS9339.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.197602	0.38806	.	.	ENSG00000175664	ENST00000380473	T	0.54866	0.55	4.31	4.31	0.51392	.	0.164928	0.39615	N	0.001320	T	0.68081	0.2962	M	0.68952	2.095	0.41164	D	0.986112	D	0.89917	1.0	D	0.72982	0.979	T	0.72197	-0.4363	10	0.87932	D	0	-6.4403	12.1505	0.54048	0.0:0.0:1.0:0.0	.	74	Q8N6G2	CM026_HUMAN	H	74	ENSP00000369840:D74H	ENSP00000369840:D74H	D	+	1	0	C13orf26	30424870	1.000000	0.71417	0.993000	0.49108	0.230000	0.25150	4.299000	0.59073	2.217000	0.71921	0.467000	0.42956	GAT		0.338	TEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044380.2	NM_152325	
PCDH17	27253	broad.mit.edu	37	13	58299360	58299360	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr13:58299360G>A	ENST00000377918.3	+	4	3438	c.3412G>A	c.(3412-3414)Gtt>Att	p.V1138I		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	1138					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V1138I(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TGCAGAGGAAGTTGTGAGAGA	0.488																																					p.V1138I	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3412A	13						.						157.0	170.0	166.0					13																	58299360		2203	4300	6503	57197361	SO:0001583	missense	27253	exon4			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.3412G>A	13.37:g.58299360G>A	ENSP00000367151:p.Val1138Ile	Somatic		Capture	Illumina HiSeq	Phase_I	57197361	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.685614	0.68157	.	.	ENSG00000118946	ENST00000377918	T	0.53423	0.62	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.64193	0.2576	L	0.48642	1.525	0.58432	D	0.999998	D	0.58970	0.984	D	0.68192	0.956	T	0.56372	-0.7990	9	.	.	.	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	1138	O14917	PCD17_HUMAN	I	1138	ENSP00000367151:V1138I	.	V	+	1	0	PCDH17	57197361	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.230000	0.95299	2.885000	0.99019	0.655000	0.94253	GTT		0.488	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
RBM26	64062	broad.mit.edu	37	13	79894769	79894769	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr13:79894769G>C	ENST00000438737.2	-	22	3451	c.3011C>G	c.(3010-3012)tCt>tGt	p.S1004C	RBM26_ENST00000267229.7_Missense_Mutation_p.S977C|RBM26_ENST00000438724.1_Missense_Mutation_p.S980C			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	1004					mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S977C(1)|p.S1004C(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		TCTTCTCCAAGAACGAGATTC	0.328																																					p.S977C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2930G	13						.						130.0	109.0	116.0					13																	79894769		2201	4297	6498	78792770	SO:0001583	missense	64062	exon21			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.3011C>G	13.37:g.79894769G>C	ENSP00000387531:p.Ser1004Cys	Somatic		Capture	Illumina HiSeq	Phase_I	78792770	NM_022118	B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Missense_Mutation	SNP	ENST00000438737.2	37		.	.	.	.	.	.	.	.	.	.	G	14.13	2.443163	0.43429	.	.	ENSG00000139746	ENST00000267229;ENST00000438737;ENST00000327303;ENST00000438724	T;T	0.68903	-0.29;-0.36	5.88	5.88	0.94601	.	0.059832	0.64402	D	0.000001	T	0.71307	0.3324	L	0.36672	1.1	0.80722	D	1	D;D;D	0.61697	0.99;0.983;0.99	P;P;P	0.53450	0.726;0.536;0.726	T	0.73279	-0.4033	10	0.87932	D	0	-9.3787	20.3016	0.98615	0.0:0.0:1.0:0.0	.	980;1004;977	Q5T8P6-2;Q5T8P6;Q5T8P6-3	.;RBM26_HUMAN;.	C	977;1005;1004;980	ENSP00000267229:S977C;ENSP00000390222:S980C	ENSP00000267229:S977C	S	-	2	0	RBM26	78792770	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.356000	0.90085	2.806000	0.96561	0.644000	0.83932	TCT		0.328	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045373.4	NM_022118	
BIVM	54841	broad.mit.edu	37	13	103492027	103492027	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr13:103492027C>G	ENST00000257336.1	+	11	2003	c.1324C>G	c.(1324-1326)Cca>Gca	p.P442A	BIVM_ENST00000448849.2_Missense_Mutation_p.P220A|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.S413C|BIVM_ENST00000419638.1_3'UTR	NM_017693.3	NP_060163.2	Q86UB2	BIVM_HUMAN	basic, immunoglobulin-like variable motif containing	442						cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.P442A(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|skin(2)|urinary_tract(1)	25	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					ATCACAACCTCCAACACATGC	0.448																																					p.P220A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C658G	13						.						101.0	97.0	98.0					13																	103492027		2203	4300	6503	102290028	SO:0001583	missense	2073	exon9			AF411385	CCDS9505.1, CCDS53879.1	13q33.1	2008-05-14			ENSG00000134897	ENSG00000134897			16034	protein-coding gene	gene with protein product						12036287	Standard	NM_017693		Approved	FLJ20159		Q86UB2	OTTHUMG00000017309	ENST00000257336.1:c.1324C>G	13.37:g.103492027C>G	ENSP00000257336:p.Pro442Ala	Somatic		Capture	Illumina HiSeq	Phase_I	102290028	NM_001159596	Q2M1J2|Q9NXM4	Missense_Mutation	SNP	ENST00000257336.1	37	CCDS9505.1	.	.	.	.	.	.	.	.	.	.	C	8.379	0.837072	0.16891	.	.	ENSG00000134897;ENSG00000134897;ENSG00000134899	ENST00000257336;ENST00000448849;ENST00000418659	.	.	.	5.4	4.56	0.56223	.	0.663319	0.14101	N	0.341341	T	0.29684	0.0741	N	0.22421	0.69	0.09310	N	1	B;B;B	0.22346	0.015;0.068;0.003	B;B;B	0.14023	0.009;0.01;0.003	T	0.20273	-1.0280	9	0.59425	D	0.04	-1.7178	10.0679	0.42315	0.1363:0.792:0.0:0.0717	.	220;413;442	Q86UB2-2;Q59FZ7;Q86UB2	.;.;BIVM_HUMAN	A	442;220;413	.	ENSP00000257336:P442A	P	+	1	0	ERCC5;BIVM	102290028	0.960000	0.32886	0.879000	0.34478	0.968000	0.65278	2.195000	0.42677	1.267000	0.44247	0.563000	0.77884	CCA		0.448	BIVM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045704.2		
OR4M1	441670	broad.mit.edu	37	14	20248657	20248657	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr14:20248657T>C	ENST00000315957.4	+	1	257	c.176T>C	c.(175-177)aTg>aCg	p.M59T		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M59T(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ACTTCTCCTATGTATTTCCTG	0.393																																					p.M59T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T176C	14						.						314.0	332.0	326.0					14																	20248657		2203	4300	6503	19318497	SO:0001583	missense	441670	exon1				CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.176T>C	14.37:g.20248657T>C	ENSP00000319654:p.Met59Thr	Somatic		Capture	Illumina HiSeq	Phase_I	19318497	NM_001005500	B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	15.40	2.821119	0.50633	.	.	ENSG00000176299	ENST00000315957	T	0.09817	2.94	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000022	T	0.36496	0.0969	M	0.91920	3.255	0.38301	D	0.942973	D	0.69078	0.997	D	0.63488	0.915	T	0.51896	-0.8647	10	0.72032	D	0.01	-21.4932	11.5315	0.50614	0.0:0.0:0.0:1.0	.	59	Q8NGD0	OR4M1_HUMAN	T	59	ENSP00000319654:M59T	ENSP00000319654:M59T	M	+	2	0	OR4M1	19318497	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	4.481000	0.60250	1.894000	0.54839	0.330000	0.21533	ATG		0.393	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1		
CEMIP	57214	broad.mit.edu	37	15	81176608	81176608	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr15:81176608A>T	ENST00000394685.3	+	7	1129	c.710A>T	c.(709-711)aAt>aTt	p.N237I	KIAA1199_ENST00000356249.5_Missense_Mutation_p.N237I|KIAA1199_ENST00000220244.3_Missense_Mutation_p.N237I			Q8WUJ3	CEMIP_HUMAN		237					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.N237I(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GTTGCAGTGAATGATGAAGGT	0.478																																					p.N237I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A710T	15						.						165.0	154.0	158.0					15																	81176608		2203	4300	6503	78963663	SO:0001583	missense	57214	exon6																														ENST00000394685.3:c.710A>T	15.37:g.81176608A>T	ENSP00000378177:p.Asn237Ile	Somatic		Capture	Illumina HiSeq	Phase_I	78963663	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.463016	0.84425	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.65549	-0.16;-0.16;-0.16	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.72431	0.3459	L	0.50333	1.59	0.58432	D	0.999997	D	0.65815	0.995	D	0.66602	0.945	T	0.70916	-0.4742	10	0.34782	T	0.22	-30.622	15.3842	0.74684	1.0:0.0:0.0:0.0	.	237	Q8WUJ3	K1199_HUMAN	I	237	ENSP00000220244:N237I;ENSP00000378177:N237I;ENSP00000348583:N237I	ENSP00000220244:N237I	N	+	2	0	KIAA1199	78963663	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.216000	0.89764	2.029000	0.59856	0.523000	0.50628	AAT		0.478	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
FAM86A	196483	broad.mit.edu	37	16	5140312	5140312	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr16:5140312C>G	ENST00000427587.4	-	6	583	c.515G>C	c.(514-516)gGc>gCc	p.G172A	FAM86A_ENST00000458008.4_Missense_Mutation_p.G138A|FAM86A_ENST00000587133.1_Missense_Mutation_p.G111A	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	172						cytoplasm (GO:0005737)		p.G172A(1)		endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						GATGGCCAGGCCTGTGAGGCC	0.632																																					p.G172A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G515C	16						.						33.0	40.0	37.0					16																	5140312		1503	2704	4207	5080313	SO:0001583	missense	196483	exon6			BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.515G>C	16.37:g.5140312C>G	ENSP00000398502:p.Gly172Ala	Somatic		Capture	Illumina HiSeq	Phase_I	5080313	NM_201400	D3DUF0|Q96S85	Missense_Mutation	SNP	ENST00000427587.4	37	CCDS10529.1	.	.	.	.	.	.	.	.	.	.	c	19.98	3.926625	0.73327	.	.	ENSG00000118894	ENST00000458008;ENST00000427587	T;T	0.39406	1.08;1.08	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.79614	2.46	0.80722	D	1	P;P	0.50066	0.852;0.931	P;P	0.56474	0.799;0.739	T	0.66139	-0.5998	10	0.66056	D	0.02	.	17.1053	0.86660	0.0:1.0:0.0:0.0	.	138;172	Q96G04-2;Q96G04	.;FA86A_HUMAN	A	138;172	ENSP00000389710:G138A;ENSP00000398502:G172A	ENSP00000398502:G172A	G	-	2	0	FAM86A	5080313	1.000000	0.71417	1.000000	0.80357	0.383000	0.30230	5.320000	0.65841	2.620000	0.88729	0.450000	0.29827	GGC		0.632	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251713.1	NM_201400	
CIRH1A	84916	broad.mit.edu	37	16	69199374	69199374	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr16:69199374C>T	ENST00000314423.7	+	15	1955	c.1778C>T	c.(1777-1779)cCg>cTg	p.P593L	CIRH1A_ENST00000352319.4_Missense_Mutation_p.P478L|CIRH1A_ENST00000563094.1_Missense_Mutation_p.P593L			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	593					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)	p.P593L(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		CCCAAGAGACCGATGCACATC	0.458																																					p.P593L	Melanoma(69;1156 1278 4951 8715 52012)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1778T	16						.						188.0	145.0	160.0					16																	69199374		2198	4300	6498	67756875	SO:0001583	missense	84916	exon15			AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.1778C>T	16.37:g.69199374C>T	ENSP00000327179:p.Pro593Leu	Somatic		Capture	Illumina HiSeq	Phase_I	67756875	NM_032830	Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	ENST00000314423.7	37	CCDS10872.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.031817	0.93575	.	.	ENSG00000141076	ENST00000314423;ENST00000352319	T;T	0.32023	1.47;2.27	6.17	6.17	0.99709	.	0.101143	0.64402	D	0.000001	T	0.52370	0.1730	M	0.73598	2.24	0.80722	D	1	D;D	0.76494	0.996;0.999	P;P	0.55011	0.509;0.766	T	0.50800	-0.8785	10	0.62326	D	0.03	.	19.6509	0.95805	0.0:1.0:0.0:0.0	.	593;593	Q969X6;Q969X6-3	CIR1A_HUMAN;.	L	593;478	ENSP00000327179:P593L;ENSP00000339164:P478L	ENSP00000327179:P593L	P	+	2	0	CIRH1A	67756875	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	4.002000	0.57053	2.941000	0.99782	0.655000	0.94253	CCG		0.458	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268950.2	NM_032830	
VMO1	284013	broad.mit.edu	37	17	4688755	4688756	+	Frame_Shift_Ins	INS	-	-	GGGG			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr17:4688755_4688756insGGGG	ENST00000328739.5	-	3	589_590	c.510_511insCCCC	c.(508-513)cccaagfs	p.K171fs	VMO1_ENST00000416307.2_3'UTR|VMO1_ENST00000441199.2_3'UTR|VMO1_ENST00000354194.4_3'UTR	NM_182566.2	NP_872372.1	Q7Z5L0	VMO1_HUMAN	vitelline membrane outer layer 1 homolog (chicken)	171						extracellular vesicular exosome (GO:0070062)		p.K171fs*15(1)		kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|pancreas(1)	11						CACGCGCCCTTGGGGCAATGGT	0.634																																					p.K171fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.511_512insCCCC	17						.																																			4635496	SO:0001589	frameshift_variant	284013	exon3			AF521892	CCDS11055.1, CCDS45585.1, CCDS45586.1, CCDS45587.1	17p13.2	2013-03-07	2005-11-14						30387	protein-coding gene	gene with protein product						22025569	Standard	NM_182566		Approved		uc002fyx.3	Q7Z5L0		ENST00000328739.5:c.507_510dupCCCC	17.37:g.4688756_4688759dupGGGG	ENSP00000328397:p.Lys171fs	Somatic		Capture	Illumina HiSeq	Phase_I	4635495	NM_182566	C9JQ15|E9PAU9|E9PGP4|Q3SXP1|Q8IUY1	Frame_Shift_Ins	INS	ENST00000328739.5	37	CCDS11055.1																																																																																				0.634	VMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439587.1	NM_182566	
RPA1	6117	broad.mit.edu	37	17	1787173	1787173	+	Missense_Mutation	SNP	G	G	T	rs142406311		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr17:1787173G>T	ENST00000254719.5	+	13	1419	c.1309G>T	c.(1309-1311)Ggg>Tgg	p.G437W		NM_002945.3	NP_002936.1	P27694	RFA1_HUMAN	replication protein A1, 70kDa	437					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of cell proliferation (GO:0008284)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|DNA replication factor A complex (GO:0005662)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|single-stranded DNA binding (GO:0003697)	p.G437W(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)	10						CGGAGTCGGAGGGAGTAACAC	0.507								Nucleotide excision repair (NER)																													p.G437W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1309T	17						.						162.0	133.0	143.0					17																	1787173		2203	4300	6503	1733923	SO:0001583	missense	6117	exon13			M63488	CCDS11014.1	17p13.3	2008-02-05	2002-08-29		ENSG00000132383	ENSG00000132383			10289	protein-coding gene	gene with protein product		179835	"""replication protein A1 (70kD)"""			8454588	Standard	NM_002945		Approved	REPA1, RPA70, HSSB, RF-A, RP-A	uc002fto.2	P27694	OTTHUMG00000090579	ENST00000254719.5:c.1309G>T	17.37:g.1787173G>T	ENSP00000254719:p.Gly437Trp	Somatic		Capture	Illumina HiSeq	Phase_I	1733923	NM_002945	A8K0Y9|Q59ES9	Missense_Mutation	SNP	ENST00000254719.5	37	CCDS11014.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284806	0.40394	.	.	ENSG00000132383	ENST00000254719	T	0.51325	0.71	5.7	4.73	0.59995	.	0.097992	0.64402	D	0.000001	T	0.73877	0.3643	M	0.91818	3.245	0.58432	D	0.999999	D	0.71674	0.998	D	0.70716	0.97	T	0.81035	-0.1115	10	0.87932	D	0	-7.2706	14.4752	0.67541	0.07:0.0:0.93:0.0	.	437	P27694	RFA1_HUMAN	W	437	ENSP00000254719:G437W	ENSP00000254719:G437W	G	+	1	0	RPA1	1733923	1.000000	0.71417	0.006000	0.13384	0.026000	0.11368	6.130000	0.71663	1.409000	0.46915	0.655000	0.94253	GGG		0.507	RPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207118.2	NM_002945	
UBE2G1	7326	broad.mit.edu	37	17	4200087	4200087	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr17:4200087G>A	ENST00000396981.2	-	3	337	c.172C>T	c.(172-174)Cat>Tat	p.H58Y	UBE2G1_ENST00000572484.1_5'UTR	NM_003342.4	NP_003333.1	P62253	UB2G1_HUMAN	ubiquitin-conjugating enzyme E2G 1	58					protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|ubiquitin-dependent protein catabolic process (GO:0006511)	extracellular vesicular exosome (GO:0070062)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)	p.H58Y(1)		large_intestine(2)|lung(4)|skin(1)	7						AAAGTAAGATGAGCCTTAAAA	0.323																																					p.H58Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C172T	17						.						153.0	160.0	158.0					17																	4200087		2203	4300	6503	4146836	SO:0001583	missense	7326	exon3			BC026288	CCDS32532.1	17p13.2	2014-05-30	2011-05-19		ENSG00000132388	ENSG00000132388		"""Ubiquitin-conjugating enzymes E2"""	12482	protein-coding gene	gene with protein product		601569	"""ubiquitin-conjugating enzyme E2G 1 (homologous to C. elegans UBC7)"", ""ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans)"", ""ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast)"""	UBE2G		8893823	Standard	NM_003342		Approved	UBC7	uc002fxs.3	P62253	OTTHUMG00000177826	ENST00000396981.2:c.172C>T	17.37:g.4200087G>A	ENSP00000380178:p.His58Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	4146836	NM_003342	B2R7P2|D3DTK0|Q99462	Missense_Mutation	SNP	ENST00000396981.2	37	CCDS32532.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.049399	0.36181	.	.	ENSG00000132388	ENST00000396981	T	0.37752	1.18	5.42	5.42	0.78866	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.36358	0.0964	L	0.45744	1.44	0.80722	D	1	B	0.19445	0.036	B	0.21708	0.036	T	0.07214	-1.0784	10	0.33940	T	0.23	-15.342	18.5912	0.91214	0.0:0.0:1.0:0.0	.	58	P62253	UB2G1_HUMAN	Y	58	ENSP00000380178:H58Y	ENSP00000380178:H58Y	H	-	1	0	UBE2G1	4146836	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.444000	0.97578	2.715000	0.92844	0.655000	0.94253	CAT		0.323	UBE2G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439099.1	NM_003342	
TP53	7157	broad.mit.edu	37	17	7578411	7578412	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr17:7578411_7578412delCA	ENST00000269305.4	-	5	707_708	c.518_519delTG	c.(517-519)gtgfs	p.V173fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.V173fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.V173fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.V173fs|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Frame_Shift_Del_p.V173fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.V173fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	173	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V173A(12)|p.V173V(8)|p.0?(8)|p.V173G(6)|p.V173fs*7(3)|p.V173fs*59(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.V173fs*69(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.V173E(1)|p.V41fs*7(1)|p.E171fs*1(1)|p.V173W(1)|p.H168fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.V80fs*7(1)|p.R174fs*7(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAGCGCCTCACAACCTCCGT	0.658		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.173_173del	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,autonomic_ganglia,NS,Substitution - Missense,-2 	.	55	Substitution - Missense(20)|Deletion - Frameshift(13)|Whole gene deletion(8)|Substitution - coding silent(8)|Deletion - In frame(5)|Insertion - Frameshift(1)	large_intestine(10)|central_nervous_system(8)|lung(7)|haematopoietic_and_lymphoid_tissue(5)|bone(5)|stomach(4)|biliary_tract(3)|oesophagus(3)|upper_aerodigestive_tract(2)|cervix(2)|liver(2)|endometrium(1)|ovary(1)|prostate(1)|breast(1)	c.518_519del	17						.																																			7519137	SO:0001589	frameshift_variant	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.518_519delTG	17.37:g.7578413_7578414delCA	ENSP00000269305:p.Val173fs	Somatic		Capture	Illumina HiSeq	Phase_I	7519136	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																				0.658	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PITPNC1	26207	broad.mit.edu	37	17	65688748	65688748	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr17:65688748A>G	ENST00000581322.1	+	9	743	c.743A>G	c.(742-744)aAa>aGa	p.K248R	PITPNC1_ENST00000335257.6_Missense_Mutation_p.K248R|PITPNC1_ENST00000580974.1_3'UTR|PITPNC1_ENST00000299954.9_3'UTR			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1	248					phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)	p.K248R(1)		breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			ACCAACAAGAAAATCGGCATT	0.488																																					p.K248R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A743G	17						.						140.0	146.0	144.0					17																	65688748		1969	4148	6117	63119210	SO:0001583	missense	26207	exon9			AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.743A>G	17.37:g.65688748A>G	ENSP00000464006:p.Lys248Arg	Somatic		Capture	Illumina HiSeq	Phase_I	63119210	NM_012417	A8K473|J3QR20|Q96I07	Missense_Mutation	SNP	ENST00000581322.1	37	CCDS58588.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.340871	0.81911	.	.	ENSG00000154217	ENST00000335257	T	0.45668	0.89	5.99	5.99	0.97316	START-like domain (1);	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	L	0.34521	1.04	0.80722	D	1	P	0.42203	0.773	P	0.44647	0.456	T	0.35968	-0.9767	10	0.66056	D	0.02	0.8606	16.4943	0.84223	1.0:0.0:0.0:0.0	.	248	Q9UKF7	PITC1_HUMAN	R	248	ENSP00000335618:K248R	ENSP00000335618:K248R	K	+	2	0	PITPNC1	63119210	1.000000	0.71417	1.000000	0.80357	0.596000	0.36781	9.210000	0.95106	2.291000	0.77112	0.533000	0.62120	AAA		0.488	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447194.1	NM_012417	
OR10H5	284433	broad.mit.edu	37	19	15905258	15905258	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr19:15905258G>A	ENST00000308940.8	+	1	498	c.400G>A	c.(400-402)Gtg>Atg	p.V134M		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V134M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						GCGTTACAACGTGCTCATGAG	0.627																																					p.V134M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G400A	19						.						117.0	98.0	105.0					19																	15905258		2203	4300	6503	15766258	SO:0001583	missense	284433	exon1			AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.400G>A	19.37:g.15905258G>A	ENSP00000310704:p.Val134Met	Somatic		Capture	Illumina HiSeq	Phase_I	15766258	NM_001004466	Q6IFJ0|Q96R60	Missense_Mutation	SNP	ENST00000308940.8	37	CCDS32940.1	.	.	.	.	.	.	.	.	.	.	.	11.28	1.591015	0.28357	.	.	ENSG00000172519	ENST00000308940	T	0.03607	3.87	3.47	3.47	0.39725	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000407	T	0.05593	0.0147	M	0.73319	2.225	0.09310	N	1	P	0.52316	0.952	B	0.40038	0.317	T	0.31861	-0.9928	10	0.56958	D	0.05	.	9.1734	0.37096	0.0:0.2244:0.7756:0.0	.	134	Q8NGA6	O10H5_HUMAN	M	134	ENSP00000310704:V134M	ENSP00000310704:V134M	V	+	1	0	OR10H5	15766258	0.000000	0.05858	0.982000	0.44146	0.978000	0.69477	-0.221000	0.09202	1.647000	0.50633	0.585000	0.79938	GTG		0.627	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1		
FFAR2	2867	broad.mit.edu	37	19	35941265	35941265	+	Missense_Mutation	SNP	C	C	T	rs200165905		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr19:35941265C>T	ENST00000599180.2	+	2	729	c.649C>T	c.(649-651)Cgg>Tgg	p.R217W	FFAR2_ENST00000601590.1_Intron|FFAR2_ENST00000246549.2_Missense_Mutation_p.R217W			O15552	FFAR2_HUMAN	free fatty acid receptor 2	217					cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to fatty acid (GO:0071398)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipid storage (GO:0019915)|mucosal immune response (GO:0002385)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of interleukin-8 secretion (GO:2000484)|regulation of acute inflammatory response (GO:0002673)|regulation of peptide hormone secretion (GO:0090276)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.R217W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(6)|skin(1)|urinary_tract(1)	22	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GGCCCAGAGGCGGCGCCGAGC	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		16209	0.001		0.0	False		,,,				2504	0.0				p.R217W	GBM(40;139 809 9833 23358 48736)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C649T	19						.						67.0	69.0	69.0					19																	35941265		2203	4300	6503	40633105	SO:0001583	missense	2867	exon1			AF024690	CCDS12461.1	19q13.1	2012-08-08	2006-02-15	2006-02-15		ENSG00000126262		"""GPCR / Class A : Fatty acid receptors"""	4501	protein-coding gene	gene with protein product		603823	"""G protein-coupled receptor 43"""	GPR43		9344866	Standard	NM_005306		Approved	FFA2R	uc010eea.3	O15552		ENST00000599180.2:c.649C>T	19.37:g.35941265C>T	ENSP00000473159:p.Arg217Trp	Somatic		Capture	Illumina HiSeq	Phase_I	40633105	NM_005306	B0M0J9|Q4VAZ3|Q4VAZ5|Q4VBL5	Missense_Mutation	SNP	ENST00000599180.2	37	CCDS12461.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	13.04	2.118539	0.37436	.	.	ENSG00000126262	ENST00000246549	T	0.42131	0.98	5.49	4.45	0.53987	GPCR, rhodopsin-like superfamily (1);	0.259510	0.35970	N	0.002864	T	0.59046	0.2165	M	0.67517	2.055	0.26193	N	0.979552	D	0.89917	1.0	D	0.75484	0.986	T	0.53365	-0.8449	10	0.87932	D	0	-27.7286	9.4748	0.38864	0.1622:0.6813:0.1565:0.0	.	217	O15552	FFAR2_HUMAN	W	217	ENSP00000246549:R217W	ENSP00000246549:R217W	R	+	1	2	FFAR2	40633105	0.142000	0.22610	0.904000	0.35570	0.073000	0.16967	0.591000	0.23969	1.439000	0.47511	0.563000	0.77884	CGG		0.602	FFAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466120.3	NM_005306	
NKG7	4818	broad.mit.edu	37	19	51875222	51875222	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr19:51875222C>A	ENST00000221978.5	-	3	590	c.411G>T	c.(409-411)tgG>tgT	p.W137C	CLDND2_ENST00000291715.1_5'Flank|NKG7_ENST00000600427.1_Intron|NKG7_ENST00000595217.1_Missense_Mutation_p.G131V|CLDND2_ENST00000601435.1_5'Flank	NM_005601.3	NP_005592.1	Q16617	NKG7_HUMAN	natural killer cell granule protein 7	137						integral component of plasma membrane (GO:0005887)		p.W137C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000211)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TAGCTGAGACCCAGCCCAGGT	0.627																																					p.W137C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G411T	19						.						82.0	89.0	87.0					19																	51875222		2203	4300	6503	56567034	SO:0001583	missense	4818	exon3				CCDS12830.1	19q13.41	2014-03-07	2014-03-07		ENSG00000105374	ENSG00000105374			7830	protein-coding gene	gene with protein product	"""granule membrane protein 17"""	606008	"""natural killer cell group 7 sequence"""			8458737	Standard	NM_005601		Approved	GIG1, GMP-17	uc002pwj.3	Q16617	OTTHUMG00000182898	ENST00000221978.5:c.411G>T	19.37:g.51875222C>A	ENSP00000221978:p.Trp137Cys	Somatic		Capture	Illumina HiSeq	Phase_I	56567034	NM_005601		Missense_Mutation	SNP	ENST00000221978.5	37	CCDS12830.1	.	.	.	.	.	.	.	.	.	.	c	17.94	3.511993	0.64522	.	.	ENSG00000105374	ENST00000221978	D	0.93488	-3.23	5.47	5.47	0.80525	.	0.204155	0.25657	N	0.029162	D	0.96005	0.8699	M	0.65498	2.005	0.54753	D	0.999989	D	0.89917	1.0	D	0.91635	0.999	D	0.96173	0.9124	10	0.87932	D	0	.	14.8334	0.70164	0.0:1.0:0.0:0.0	.	137	Q16617	NKG7_HUMAN	C	137	ENSP00000221978:W137C	ENSP00000221978:W137C	W	-	3	0	NKG7	56567034	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	3.879000	0.56138	2.587000	0.87381	0.486000	0.48141	TGG		0.627	NKG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464260.2	NM_005601	
ZNF528	84436	broad.mit.edu	37	19	52918615	52918615	+	Silent	SNP	T	T	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr19:52918615T>C	ENST00000360465.3	+	7	936	c.510T>C	c.(508-510)gcT>gcC	p.A170A	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A170A(1)		breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		TTGATCATGCTCCATTACTTC	0.373																																					p.A170A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T510C	19						.						51.0	56.0	54.0					19																	52918615		2197	4298	6495	57610427	SO:0001819	synonymous_variant	84436	exon7			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.510T>C	19.37:g.52918615T>C		Somatic		Capture	Illumina HiSeq	Phase_I	57610427	NM_032423	B3KPN4|Q86T88|Q96JK0	Silent	SNP	ENST00000360465.3	37	CCDS33091.1																																																																																				0.373	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	NM_032423	
ZNF415	55786	broad.mit.edu	37	19	53612963	53612963	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr19:53612963G>A	ENST00000500065.4	-	4	668	c.335C>T	c.(334-336)aCg>aTg	p.T112M	ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000421033.1_Missense_Mutation_p.T124M|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.T99M|ZNF415_ENST00000601493.1_De_novo_Start_InFrame|ZNF415_ENST00000455735.2_Missense_Mutation_p.T160M|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000448501.1_Missense_Mutation_p.T160M|ZNF415_ENST00000243643.4_Missense_Mutation_p.T112M|ZNF415_ENST00000601215.1_3'UTR|ZNF415_ENST00000597503.1_3'UTR	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	160					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T112M(1)		breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		TTTTGGGGCCGTAGTCACTTT	0.383																																					p.T112M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C335T	19						.						129.0	117.0	121.0					19																	53612963		2203	4300	6503	58304775	SO:0001583	missense	55786	exon4			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.335C>T	19.37:g.53612963G>A	ENSP00000439435:p.Thr112Met	Somatic		Capture	Illumina HiSeq	Phase_I	58304775	NM_001136038	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	ENST00000500065.4	37	CCDS54313.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.356544	0.00217	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.07444	3.19;3.19;3.19;3.19;3.19;3.19	2.74	-1.3	0.09259	.	.	.	.	.	T	0.02455	0.0075	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B;B	0.15473	0.003;0.0;0.006;0.013;0.003;0.003	B;B;B;B;B;B	0.06405	0.002;0.0;0.001;0.0;0.002;0.002	T	0.46428	-0.9192	9	0.07325	T	0.83	.	6.3476	0.21357	0.5236:0.0:0.4764:0.0	.	112;160;160;112;99;124	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	M	112;112;160;124;160;99	ENSP00000243643:T112M;ENSP00000439435:T112M;ENSP00000396492:T160M;ENSP00000395055:T124M;ENSP00000388787:T160M;ENSP00000414601:T99M	ENSP00000243643:T112M	T	-	2	0	ZNF415	58304775	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-3.248000	0.00541	-0.530000	0.06349	-0.959000	0.02639	ACG		0.383	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
LELP1	149018	broad.mit.edu	37	1	153177307	153177307	+	Missense_Mutation	SNP	C	C	T	rs573106359		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr1:153177307C>T	ENST00000368747.1	+	2	234	c.124C>T	c.(124-126)Cgc>Tgc	p.R42C		NM_001010857.1	NP_001010857.1	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	42	Cys/Pro-rich.							p.R42C(2)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|pancreas(1)|prostate(1)	19	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCTGCTGCAACGCTGTTTCGA	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		19136	0.0		0.0	False		,,,				2504	0.001				p.R42C												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C124T	1						.						172.0	150.0	157.0					1																	153177307		2203	4300	6503	151443931	SO:0001583	missense	149018	exon2				CCDS30869.1	1q21.3	2008-02-05			ENSG00000203784	ENSG00000203784			32046	protein-coding gene	gene with protein product		611042					Standard	NM_001010857		Approved		uc001fbl.4	Q5T871	OTTHUMG00000013935	ENST00000368747.1:c.124C>T	1.37:g.153177307C>T	ENSP00000357736:p.Arg42Cys	Somatic		Capture	Illumina HiSeq	Phase_I	151443931	NM_001010857	A1L4E1	Missense_Mutation	SNP	ENST00000368747.1	37	CCDS30869.1	.	.	.	.	.	.	.	.	.	.	C	8.982	0.975532	0.18736	.	.	ENSG00000203784	ENST00000368747	.	.	.	5.41	3.53	0.40419	.	0.000000	0.39407	N	0.001373	T	0.60235	0.2253	.	.	.	0.38639	D	0.951557	D	0.89917	1.0	D	0.67382	0.951	T	0.64153	-0.6474	8	0.56958	D	0.05	-16.5011	6.4963	0.22144	0.1797:0.7304:0.0:0.0899	.	42	Q5T871	LELP1_HUMAN	C	42	.	ENSP00000357736:R42C	R	+	1	0	LELP1	151443931	0.972000	0.33761	0.994000	0.49952	0.613000	0.37349	0.691000	0.25467	0.826000	0.34661	0.561000	0.74099	CGC		0.552	LELP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039104.1	NM_001010857	
KCNN3	3782	broad.mit.edu	37	1	154841924	154841924	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr1:154841924T>C	ENST00000271915.4	-	1	832	c.517A>G	c.(517-519)Atc>Gtc	p.I173V	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	178					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.I173V(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	CTCATGGCGATCTCCGTGAAG	0.667																																					p.I173V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A517G	1						.						37.0	39.0	38.0					1																	154841924		2203	4300	6503	153108548	SO:0001583	missense	3782	exon1			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.517A>G	1.37:g.154841924T>C	ENSP00000271915:p.Ile173Val	Somatic		Capture	Illumina HiSeq	Phase_I	153108548	NM_002249	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	37	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	T	12.80	2.045751	0.36085	.	.	ENSG00000143603	ENST00000271915	D	0.97279	-4.32	4.75	4.75	0.60458	.	0.397474	0.19426	N	0.114574	D	0.94571	0.8251	N	0.14661	0.345	0.80722	D	1	D;P	0.53885	0.963;0.803	D;P	0.64877	0.93;0.847	D	0.94242	0.7486	10	0.35671	T	0.21	-25.8295	12.2631	0.54661	0.0:0.0:0.0:1.0	.	179;178	Q6JXY2;Q9UGI6	.;KCNN3_HUMAN	V	173	ENSP00000271915:I173V	ENSP00000271915:I173V	I	-	1	0	KCNN3	153108548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.958000	0.70330	1.992000	0.58205	0.460000	0.39030	ATC		0.667	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
PPOX	5498	broad.mit.edu	37	1	161139480	161139480	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr1:161139480G>C	ENST00000367999.4	+	8	1104	c.838G>C	c.(838-840)Gac>Cac	p.D280H	PPOX_ENST00000352210.5_Missense_Mutation_p.D280H|PPOX_ENST00000432542.2_Intron|B4GALT3_ENST00000470882.1_5'Flank|PPOX_ENST00000544598.1_Intron|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000495483.1_3'UTR	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	280					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)	p.D280H(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TCTGGAGGCTGACCACGTTAT	0.473																																					p.D280H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G838C	1						.						141.0	122.0	129.0					1																	161139480		2203	4300	6503	159406104	SO:0001583	missense	5498	exon8			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.838G>C	1.37:g.161139480G>C	ENSP00000356978:p.Asp280His	Somatic		Capture	Illumina HiSeq	Phase_I	159406104	NM_000309	D3DVG0|Q5VTW8	Missense_Mutation	SNP	ENST00000367999.4	37	CCDS1221.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.209860	0.79240	.	.	ENSG00000143224	ENST00000352210;ENST00000367999;ENST00000435935	D;D	0.96885	-4.16;-4.16	5.85	3.87	0.44632	Amine oxidase (1);	0.046798	0.85682	D	0.000000	D	0.97798	0.9277	M	0.91300	3.195	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.987;0.998;0.998	D	0.98156	1.0444	10	0.87932	D	0	-12.5253	8.7714	0.34735	0.0815:0.1516:0.7669:0.0	.	247;118;280	B4DY76;B3KT30;P50336	.;.;PPOX_HUMAN	H	280;280;247	ENSP00000343943:D280H;ENSP00000356978:D280H	ENSP00000343943:D280H	D	+	1	0	PPOX	159406104	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.378000	0.59568	1.454000	0.47793	0.650000	0.86243	GAC		0.473	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082993.1	NM_000309	
HMCN1	83872	broad.mit.edu	37	1	186121912	186121913	+	Missense_Mutation	DNP	GG	GG	AT	rs201563661		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr1:186121912_186121913GG>AT	ENST00000271588.4	+	96	15156_15157	c.14927_14928GG>AT	c.(14926-14928)cGG>cAT	p.R4976H	HMCN1_ENST00000367492.2_Missense_Mutation_p.R4976H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4976	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R4976R(1)|p.R4976>?(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CATATTGCCCGGGGCTTGGATT	0.431																																					.												.	.	2	Complex(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.14927_14928AT	1						.																																			184388536	SO:0001583	missense	83872	exon96			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	Exception_encountered	1.37:g.186121912_186121913delinsAT	ENSP00000271588:p.Arg4976His	Somatic		Capture	Illumina HiSeq	Phase_I	184388535	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	DNP	ENST00000271588.4	37	CCDS30956.1																																																																																				0.431	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
CFHR5	81494	broad.mit.edu	37	1	196963240	196963240	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr1:196963240C>T	ENST00000256785.4	+	4	570	c.461C>T	c.(460-462)gCc>gTc	p.A154V	CFHR5_ENST00000367414.5_Missense_Mutation_p.A178V			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	154	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)		p.A154V(1)		NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						ATTTTAGAAGCCAATGTAGAT	0.308																																					p.A154V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C461T	1						.						72.0	82.0	79.0					1																	196963240		2203	4300	6503	195229863	SO:0001583	missense	81494	exon4			AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.461C>T	1.37:g.196963240C>T	ENSP00000256785:p.Ala154Val	Somatic		Capture	Illumina HiSeq	Phase_I	195229863	NM_030787	Q2NKK2	Missense_Mutation	SNP	ENST00000256785.4	37	CCDS1387.1	.	.	.	.	.	.	.	.	.	.	C	14.37	2.514831	0.44763	.	.	ENSG00000134389	ENST00000367414;ENST00000256785	T;T	0.66995	-0.24;-0.24	3.98	-6.86	0.01676	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.52709	0.1751	L	0.27053	0.805	0.09310	N	1	D	0.54601	0.967	P	0.50270	0.636	T	0.52801	-0.8527	9	0.29301	T	0.29	.	7.6973	0.28602	0.5126:0.2694:0.218:0.0	.	154	Q9BXR6	FHR5_HUMAN	V	178;154	ENSP00000356384:A178V;ENSP00000256785:A154V	ENSP00000256785:A154V	A	+	2	0	CFHR5	195229863	0.000000	0.05858	0.000000	0.03702	0.225000	0.24961	-1.812000	0.01726	-0.651000	0.05415	0.297000	0.19635	GCC		0.308	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088814.2	NM_030787	
ROR1	4919	broad.mit.edu	37	1	64643492	64643492	+	Missense_Mutation	SNP	G	G	A	rs374512783		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr1:64643492G>A	ENST00000371079.1	+	9	2143	c.1768G>A	c.(1768-1770)Gga>Aga	p.G590R	ROR1_ENST00000545203.1_Missense_Mutation_p.G41R	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	590	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.G590R(1)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						CCTGGACCACGGAGATTTTCT	0.478													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20528	0.0		0.0	False		,,,				2504	0.0				p.G590R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1768A	1						.	G	ARG/GLY	0,4406		0,0,2203	70.0	73.0	72.0		1768	6.0	0.7	1		72	1,8599	1.2+/-3.3	0,1,4299	no	missense	ROR1	NM_005012.2	125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	590/938	64643492	1,13005	2203	4300	6503	64416080	SO:0001583	missense	4919	exon9			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.1768G>A	1.37:g.64643492G>A	ENSP00000360120:p.Gly590Arg	Somatic		Capture	Illumina HiSeq	Phase_I	64416080	NM_005012	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.987330	0.53934	0.0	1.16E-4	ENSG00000185483	ENST00000371079;ENST00000544776;ENST00000545203	D;D	0.82081	-1.57;-1.57	5.97	5.97	0.96955	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42682	D	0.000666	T	0.58666	0.2138	N	0.04387	-0.21	0.80722	D	1	P	0.39060	0.657	B	0.38020	0.263	T	0.65084	-0.6254	10	0.23302	T	0.38	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	590	Q01973	ROR1_HUMAN	R	590;593;41	ENSP00000360120:G590R;ENSP00000441637:G41R	ENSP00000360120:G590R	G	+	1	0	ROR1	64416080	1.000000	0.71417	0.670000	0.29842	0.988000	0.76386	6.361000	0.73070	2.836000	0.97738	0.655000	0.94253	GGA		0.478	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
USH2A	7399	broad.mit.edu	37	1	216258103	216258103	+	Missense_Mutation	SNP	C	C	T	rs201799575		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr1:216258103C>T	ENST00000307340.3	-	25	5490	c.5104G>A	c.(5104-5106)Gtg>Atg	p.V1702M	RP11-22M7.2_ENST00000445619.1_RNA|RP11-22M7.2_ENST00000442606.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.V1702M|RP11-22M7.2_ENST00000446411.1_RNA|RP11-22M7.2_ENST00000430890.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1702	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.V1702M(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGTTATACACGTTGATTTGT	0.418										HNSCC(13;0.011)			C|||	1	0.000199681	0.0	0.0	5008	,	,		16634	0.001		0.0	False		,,,				2504	0.0				p.V1702M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5104A	1						.						127.0	124.0	125.0					1																	216258103		2203	4300	6503	214324726	SO:0001583	missense	7399	exon25			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5104G>A	1.37:g.216258103C>T	ENSP00000305941:p.Val1702Met	Somatic		Capture	Illumina HiSeq	Phase_I	214324726	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	18.22	3.576711	0.65878	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.16196	2.37;2.36	4.93	4.01	0.46588	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (1);	0.184747	0.25857	N	0.027842	T	0.30885	0.0779	M	0.62723	1.935	0.28514	N	0.913386	D	0.67145	0.996	P	0.53689	0.732	T	0.17198	-1.0377	10	0.87932	D	0	.	14.6071	0.68486	0.147:0.853:0.0:0.0	.	1702	O75445	USH2A_HUMAN	M	1702	ENSP00000305941:V1702M;ENSP00000355910:V1702M	ENSP00000305941:V1702M	V	-	1	0	USH2A	214324726	0.411000	0.25384	0.032000	0.17829	0.978000	0.69477	2.505000	0.45424	1.048000	0.40298	0.650000	0.86243	GTG		0.418	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
CASS4	57091	broad.mit.edu	37	20	55033540	55033540	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr20:55033540G>A	ENST00000360314.3	+	7	2323	c.2098G>A	c.(2098-2100)Gcg>Acg	p.A700T	AL121914.1_ENST00000390795.2_RNA|CASS4_ENST00000434344.1_Missense_Mutation_p.A263T|CASS4_ENST00000371336.3_Missense_Mutation_p.A700T	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	700					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.A700T(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						CAGCCAGCCCGCGGAGATCAT	0.587																																					p.A700T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2098A	20						.						71.0	64.0	66.0					20																	55033540		2203	4300	6503	54466947	SO:0001583	missense	57091	exon6			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.2098G>A	20.37:g.55033540G>A	ENSP00000353462:p.Ala700Thr	Somatic		Capture	Illumina HiSeq	Phase_I	54466947	NM_020356	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059268	0.36373	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.23552	1.9;1.9;1.9	5.91	3.98	0.46160	CAS family, DUF3513 (1);	0.114404	0.64402	D	0.000013	T	0.15132	0.0365	N	0.08118	0	0.33541	D	0.594856	B;B;B	0.32829	0.386;0.008;0.224	B;B;B	0.32980	0.156;0.001;0.076	T	0.19031	-1.0318	10	0.87932	D	0	-26.9255	13.4889	0.61382	0.1237:0.7533:0.123:0.0	.	646;263;700	B4DII4;Q9NQ75-3;Q9NQ75	.;.;CASS4_HUMAN	T	700;700;263	ENSP00000353462:A700T;ENSP00000360387:A700T;ENSP00000410027:A263T	ENSP00000353462:A700T	A	+	1	0	CASS4	54466947	0.999000	0.42202	0.267000	0.24556	0.001000	0.01503	4.339000	0.59322	0.848000	0.35191	-0.785000	0.03343	GCG		0.587	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
APCDD1L	164284	broad.mit.edu	37	20	57036119	57036119	+	Silent	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr20:57036119G>A	ENST00000371149.3	-	4	1463	c.1233C>T	c.(1231-1233)taC>taT	p.Y411Y	APCDD1L_ENST00000439429.1_Silent_p.Y422Y|APCDD1L_ENST00000491015.1_5'Flank	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	411						integral component of membrane (GO:0016021)		p.Y411Y(1)		large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			TGAAAAGCTCGTACTCCACAT	0.627																																					p.Y411Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1233T	20						.						76.0	78.0	77.0					20																	57036119		2203	4300	6503	56469525	SO:0001819	synonymous_variant	164284	exon4			AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.1233C>T	20.37:g.57036119G>A		Somatic		Capture	Illumina HiSeq	Phase_I	56469525	NM_153360		Silent	SNP	ENST00000371149.3	37	CCDS13467.1																																																																																				0.627	APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000079881.2	NM_153360	
CDH26	60437	broad.mit.edu	37	20	58560084	58560084	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr20:58560084G>C	ENST00000244047.5	+	7	1048	c.737G>C	c.(736-738)aGa>aCa	p.R246T	CDH26_ENST00000348616.4_Missense_Mutation_p.R246T			Q8IXH8	CAD26_HUMAN	cadherin 26	246	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R246T(2)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			CTGCTAATCAGAGCCAGGGAC	0.468																																					p.R246T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G737C	20						.						65.0	56.0	59.0					20																	58560084		2203	4300	6503	57993479	SO:0001583	missense	60437	exon7			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.737G>C	20.37:g.58560084G>C	ENSP00000244047:p.Arg246Thr	Somatic		Capture	Illumina HiSeq	Phase_I	57993479	NM_177980	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	37		.	.	.	.	.	.	.	.	.	.	G	15.68	2.904472	0.52333	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.60171	0.21;0.21	4.44	1.32	0.21799	.	1.202600	0.05641	N	0.583325	T	0.47377	0.1442	N	0.25485	0.75	0.09310	N	1	P	0.45672	0.864	P	0.44518	0.452	T	0.40720	-0.9548	10	0.72032	D	0.01	.	4.9641	0.14082	0.1987:0.177:0.6244:0.0	.	246	Q8IXH8-4	.	T	246	ENSP00000244047:R246T;ENSP00000339390:R246T	ENSP00000244047:R246T	R	+	2	0	CDH26	57993479	0.022000	0.18835	0.004000	0.12327	0.245000	0.25701	0.361000	0.20267	0.306000	0.22856	0.591000	0.81541	AGA		0.468	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	
ADAMTS5	11096	broad.mit.edu	37	21	28304408	28304408	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr21:28304408T>C	ENST00000284987.5	-	6	2085	c.1964A>G	c.(1963-1965)aAa>aGa	p.K655R	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	655	Cys-rich.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.K655R(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						ACCTGCATATTTGGGAACCCA	0.453																																					p.K655R	Esophageal Squamous(53;683 1080 10100 14424 45938)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1964G	21						.						131.0	114.0	120.0					21																	28304408		2203	4300	6503	27226279	SO:0001583	missense	11096	exon6			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1964A>G	21.37:g.28304408T>C	ENSP00000284987:p.Lys655Arg	Somatic		Capture	Illumina HiSeq	Phase_I	27226279	NM_007038	Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.800294	0.90538	.	.	ENSG00000154736	ENST00000284987	T	0.03524	3.9	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.11537	0.0281	L	0.39397	1.21	0.53688	D	0.999978	D	0.69078	0.997	D	0.75020	0.985	T	0.31779	-0.9931	10	0.25106	T	0.35	.	16.162	0.81727	0.0:0.0:0.0:1.0	.	655	Q9UNA0	ATS5_HUMAN	R	655	ENSP00000284987:K655R	ENSP00000284987:K655R	K	-	2	0	ADAMTS5	27226279	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	7.655000	0.83696	2.224000	0.72417	0.533000	0.62120	AAA		0.453	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1		
MED15	51586	broad.mit.edu	37	22	20920813	20920814	+	In_Frame_Ins	INS	-	-	CAG	rs67182670|rs361923|rs535773989|rs539945336	byFrequency	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr22:20920813_20920814insCAG	ENST00000263205.7	+	7	819_820	c.750_751insCAG	c.(751-753)cag>CAGcag	p.251_251Q>QQ	MED15_ENST00000406969.1_In_Frame_Ins_p.225_225Q>QQ|MED15_ENST00000382974.2_In_Frame_Ins_p.180_180Q>QQ|MED15_ENST00000425759.2_In_Frame_Ins_p.140_140Q>QQ|MED15_ENST00000478831.1_3'UTR|MED15_ENST00000542773.1_In_Frame_Ins_p.56_56Q>QQ|MED15_ENST00000292733.7_In_Frame_Ins_p.251_251Q>QQ|MED15_ENST00000541476.1_In_Frame_Ins_p.225_225Q>QQ	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	251	Poly-Gln.			Missing (in Ref. 3; BAB85034). {ECO:0000305}.	gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Q250_Q251insQ(4)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			aacaacagcaacagcagcagca	0.589																																					p.Q250delinsQQ												.	.	4	Insertion - In frame(4)	ovary(2)|large_intestine(2)	c.750_751insCAG	22						.																																			19250814	SO:0001652	inframe_insertion	51586	exon7			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.784_786dupCAG	22.37:g.20920820_20920822dupCAG	ENSP00000263205:p.Gln262dup	Somatic		Capture	Illumina HiSeq	Phase_I	19250813	NM_001003891	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	In_Frame_Ins	INS	ENST00000263205.7	37	CCDS33602.1																																																																																				0.589	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2	NM_015889	
MYO18B	84700	broad.mit.edu	37	22	26422700	26422700	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr22:26422700G>A	ENST00000407587.2	+	43	6932	c.6763G>A	c.(6763-6765)Gtg>Atg	p.V2255M	MYO18B_ENST00000536101.1_Missense_Mutation_p.V2254M|MYO18B_ENST00000335473.7_Missense_Mutation_p.V2254M			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2254						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.V2255M(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CTCGGAGTTCGTGGAAGGGCT	0.617																																					p.V2254M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6760A	22						.						19.0	20.0	20.0					22																	26422700		1878	4090	5968	24752700	SO:0001583	missense	84700	exon43			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6763G>A	22.37:g.26422700G>A	ENSP00000386096:p.Val2255Met	Somatic		Capture	Illumina HiSeq	Phase_I	24752700	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	G	17.32	3.360344	0.61403	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.89485	-2.5;-2.5;-2.52	4.77	2.52	0.30459	.	0.146169	0.28853	N	0.013929	D	0.90229	0.6945	M	0.62723	1.935	0.28981	N	0.888625	D;D;D;D;D	0.76494	0.999;0.998;0.998;0.999;0.999	P;P;P;D;D	0.63192	0.884;0.819;0.819;0.912;0.912	T	0.83005	-0.0175	10	0.66056	D	0.02	.	4.9733	0.14127	0.0872:0.1462:0.6164:0.1501	.	1767;2256;2254;2255;2254	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.;.;MY18B_HUMAN;.;.	M	2254;2254;2255	ENSP00000441229:V2254M;ENSP00000334563:V2254M;ENSP00000386096:V2255M	ENSP00000334563:V2254M	V	+	1	0	MYO18B	24752700	0.983000	0.35010	1.000000	0.80357	0.967000	0.64934	1.897000	0.39799	2.211000	0.71520	0.313000	0.20887	GTG		0.617	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
CHST10	9486	broad.mit.edu	37	2	101009724	101009724	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr2:101009724C>T	ENST00000264249.3	-	7	1439	c.1054G>A	c.(1054-1056)Gac>Aac	p.D352N	CHST10_ENST00000542617.1_Missense_Mutation_p.D400N|CHST10_ENST00000409701.1_Missense_Mutation_p.D352N	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	352					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						AGCAAAAAGTCTGGTTTCTGG	0.458																																					p.D352N												.	.	0			c.G1054A	2						.						109.0	109.0	109.0					2																	101009724		2203	4300	6503	100376156	SO:0001583	missense	9486	exon7			BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.1054G>A	2.37:g.101009724C>T	ENSP00000264249:p.Asp352Asn	None		Capture	Illumina HiSeq	Phase_I	100376156	NM_004854	Q53T18	Missense_Mutation	SNP	ENST00000264249.3	37	CCDS2047.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598442	0.66332	.	.	ENSG00000115526	ENST00000264249;ENST00000542617;ENST00000409701	T;T;T	0.71103	-0.51;-0.54;-0.51	5.91	5.03	0.67393	.	0.336202	0.38778	N	0.001579	T	0.60625	0.2283	L	0.46157	1.445	0.44447	D	0.997376	B	0.27559	0.181	B	0.21708	0.036	T	0.56360	-0.7992	10	0.23891	T	0.37	-12.4226	10.9266	0.47195	0.0:0.8582:0.0:0.1418	.	352	O43529	CHSTA_HUMAN	N	352;400;352	ENSP00000264249:D352N;ENSP00000438869:D400N;ENSP00000387309:D352N	ENSP00000264249:D352N	D	-	1	0	CHST10	100376156	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	3.804000	0.55568	1.519000	0.48950	0.655000	0.94253	GAC		0.458	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253162.1	NM_004854	
PTPN18	26469	broad.mit.edu	37	2	131127666	131127666	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr2:131127666C>T	ENST00000175756.5	+	8	693	c.592C>T	c.(592-594)Cgt>Tgt	p.R198C	PTPN18_ENST00000347849.3_Missense_Mutation_p.R91C	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	198	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.R198C(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					CTGGCCAGACCGTGGGGTCCC	0.527																																					p.R198C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C592T	2						.						110.0	121.0	117.0					2																	131127666		2203	4300	6503	130844136	SO:0001583	missense	26469	exon8			X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.592C>T	2.37:g.131127666C>T	ENSP00000175756:p.Arg198Cys	Somatic		Capture	Illumina HiSeq	Phase_I	130844136	NM_014369	B4E1E6|Q53P42	Missense_Mutation	SNP	ENST00000175756.5	37	CCDS2161.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.269669	0.80469	.	.	ENSG00000072135	ENST00000175756;ENST00000347849;ENST00000409022	T;D	0.83992	2.75;-1.79	4.9	2.91	0.33838	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.420081	0.17492	N	0.172312	D	0.85944	0.5815	L	0.46819	1.47	0.40508	D	0.980713	D;D;D	0.89917	0.999;0.999;1.0	P;P;P	0.60886	0.88;0.793;0.85	D	0.85921	0.1446	10	0.87932	D	0	.	12.8224	0.57700	0.2247:0.7753:0.0:0.0	.	177;198;91	E7EMB8;Q99952;B4E1E6	.;PTN18_HUMAN;.	C	198;91;177	ENSP00000175756:R198C;ENSP00000310092:R91C	ENSP00000175756:R198C	R	+	1	0	PTPN18	130844136	0.999000	0.42202	0.700000	0.30305	0.937000	0.57800	2.023000	0.41040	0.604000	0.29930	0.650000	0.86243	CGT		0.527	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254523.2		
UPP2	151531	broad.mit.edu	37	2	158977989	158977989	+	Missense_Mutation	SNP	C	C	G	rs148797309		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr2:158977989C>G	ENST00000005756.4	+	5	717	c.523C>G	c.(523-525)Cag>Gag	p.Q175E	UPP2_ENST00000605860.1_Missense_Mutation_p.Q232E|UPP2_ENST00000409859.4_Missense_Mutation_p.Q232E|UPP2_ENST00000460456.1_Intron	NM_173355.3	NP_775491.1	O95045	UPP2_HUMAN	uridine phosphorylase 2	175					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)|type III intermediate filament (GO:0045098)	uridine phosphorylase activity (GO:0004850)	p.Q175E(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31					Fluorouracil(DB00544)	CCGGTTTGAACAGGTCATTTT	0.428																																					p.Q232E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C694G	2						.						208.0	207.0	207.0					2																	158977989		2203	4299	6502	158686235	SO:0001583	missense	151531	exon7			AY225131	CCDS2207.1, CCDS46435.1	2q24.2	2008-02-05			ENSG00000007001	ENSG00000007001			23061	protein-coding gene	gene with protein product						12849978	Standard	NM_173355		Approved	UPASE2, UP2, UDRPASE2	uc002tzo.3	O95045	OTTHUMG00000131969	ENST00000005756.4:c.523C>G	2.37:g.158977989C>G	ENSP00000005756:p.Gln175Glu	Somatic		Capture	Illumina HiSeq	Phase_I	158686235	NM_001135098	B3KV87	Missense_Mutation	SNP	ENST00000005756.4	37	CCDS2207.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935490	0.34189	.	.	ENSG00000007001	ENST00000409859;ENST00000005756	T;T	0.41758	0.99;0.99	5.75	3.91	0.45181	Nucleoside phosphorylase domain (1);	0.123548	0.56097	D	0.000022	T	0.48554	0.1506	M	0.84948	2.725	0.58432	D	0.999999	P	0.46220	0.874	B	0.43225	0.412	T	0.50849	-0.8779	10	0.41790	T	0.15	.	10.3004	0.43648	0.0:0.8358:0.0:0.1642	.	175	O95045	UPP2_HUMAN	E	232;175	ENSP00000387230:Q232E;ENSP00000005756:Q175E	ENSP00000005756:Q175E	Q	+	1	0	UPP2	158686235	1.000000	0.71417	0.914000	0.36105	0.041000	0.13682	3.192000	0.50989	0.734000	0.32515	0.655000	0.94253	CAG		0.428	UPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254929.2	NM_173355	
ABCA12	26154	broad.mit.edu	37	2	215914417	215914417	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr2:215914417T>C	ENST00000272895.7	-	6	845	c.626A>G	c.(625-627)aAa>aGa	p.K209R		NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	209					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.K209R(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AAGGCAAAATTTGTTAAAAAC	0.383																																					p.K209R	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A626G	2						.						84.0	84.0	84.0					2																	215914417		2203	4300	6503	215622662	SO:0001583	missense	26154	exon6			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.626A>G	2.37:g.215914417T>C	ENSP00000272895:p.Lys209Arg	Somatic		Capture	Illumina HiSeq	Phase_I	215622662	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.725349	0.30593	.	.	ENSG00000144452	ENST00000272895	D	0.88431	-2.38	6.05	0.707	0.18139	.	0.376195	0.25951	N	0.027256	T	0.71443	0.3340	N	0.14661	0.345	0.45515	D	0.998473	B	0.23735	0.09	B	0.16722	0.016	T	0.53634	-0.8411	10	0.21014	T	0.42	.	1.0895	0.01660	0.1418:0.1602:0.2251:0.4728	.	209	Q86UK0	ABCAC_HUMAN	R	209	ENSP00000272895:K209R	ENSP00000272895:K209R	K	-	2	0	ABCA12	215622662	0.207000	0.23482	0.997000	0.53966	0.610000	0.37248	0.064000	0.14437	0.162000	0.19483	0.533000	0.62120	AAA		0.383	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
RPSA	3921	broad.mit.edu	37	3	39453789	39453789	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr3:39453789C>T	ENST00000301821.6	+	7	927	c.818C>T	c.(817-819)aCg>aTg	p.T273M	SNORA62_ENST00000365493.1_RNA|RPSA_ENST00000478027.1_3'UTR|RPSA_ENST00000443003.1_Missense_Mutation_p.T278M	NM_001012321.1|NM_002295.4	NP_001012321.1|NP_002286.2			ribosomal protein SA											endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)		CAGCCTGCCACGGAAGACTGG	0.502																																					p.T273M												.	.	0			c.C818T	3						.						37.0	39.0	38.0					3																	39453789		2203	4300	6503	39428793	SO:0001583	missense	3921	exon7			S37431	CCDS2686.1	3p21.3	2014-09-17	2002-08-29	2005-02-11	ENSG00000168028	ENSG00000168028			6502	protein-coding gene	gene with protein product		150370	"""laminin receptor 1 (67kD, ribosomal protein SA)"""	LAMR1		1534510, 8760291	Standard	NM_001012321		Approved	LRP, 37LRP, p40, SA	uc003cjp.3	P08865	OTTHUMG00000131296	ENST00000301821.6:c.818C>T	3.37:g.39453789C>T	ENSP00000346067:p.Thr273Met	None		Capture	Illumina HiSeq	Phase_I	39428793	NM_002295		Missense_Mutation	SNP	ENST00000301821.6	37	CCDS2686.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634105	0.47049	.	.	ENSG00000168028	ENST00000301821;ENST00000443003	T;T	0.47528	0.85;0.84	4.52	4.52	0.55395	.	0.000000	0.64402	U	0.000001	T	0.41166	0.1147	L	0.41492	1.28	0.53005	D	0.999964	B	0.27117	0.168	B	0.26094	0.066	T	0.38824	-0.9643	10	0.51188	T	0.08	.	15.1724	0.72884	0.0:1.0:0.0:0.0	.	273	P08865	RSSA_HUMAN	M	273;278	ENSP00000346067:T273M;ENSP00000389351:T278M	ENSP00000346067:T273M	T	+	2	0	RPSA	39428793	1.000000	0.71417	0.980000	0.43619	0.958000	0.62258	4.588000	0.60999	2.227000	0.72691	0.558000	0.71614	ACG		0.502	RPSA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254064.3	NM_002295	
MYLK	4638	broad.mit.edu	37	3	123457851	123457851	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr3:123457851G>A	ENST00000475616.1	-	4	480	c.481C>T	c.(481-483)Cca>Tca	p.P161S	MYLK_ENST00000360304.3_Missense_Mutation_p.P161S|MYLK_ENST00000346322.5_Missense_Mutation_p.P161S|MYLK_ENST00000360772.3_Missense_Mutation_p.P161S|MYLK_ENST00000359169.1_Missense_Mutation_p.P161S			Q15746	MYLK_HUMAN	myosin light chain kinase	161	Ig-like C2-type 2.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.P161S(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GCAAACTTTGGTGGGCACTCC	0.562																																					p.P161S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C481T	3						.						73.0	62.0	66.0					3																	123457851		2203	4300	6503	124940541	SO:0001583	missense	4638	exon7			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.481C>T	3.37:g.123457851G>A	ENSP00000418335:p.Pro161Ser	Somatic		Capture	Illumina HiSeq	Phase_I	124940541	NM_053025	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711995	0.89112	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	D;D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03;-3.03	4.52	4.52	0.55395	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.97551	0.9198	H	0.97491	4.015	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.983;0.999;0.998;0.983;0.998;0.99	D	0.98869	1.0765	9	0.87932	D	0	.	16.5127	0.84290	0.0:0.0:1.0:0.0	.	161;161;161;161;161;161	Q15746-6;Q15746-5;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	S	161	ENSP00000354004:P161S;ENSP00000353452:P161S;ENSP00000352088:P161S;ENSP00000320622:P161S;ENSP00000418335:P161S	ENSP00000320622:P161S	P	-	1	0	MYLK	124940541	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.180000	0.89694	2.497000	0.84241	0.655000	0.94253	CCA		0.562	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
IL21	59067	broad.mit.edu	37	4	123542048	123542048	+	Missense_Mutation	SNP	C	C	T	rs141748932		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr4:123542048C>T	ENST00000264497.3	-	1	176	c.119G>A	c.(118-120)cGt>cAt	p.R40H	IL21-AS1_ENST00000417927.1_RNA	NM_001207006.2|NM_021803.3	NP_001193935.1|NP_068575.1	Q9HBE4	IL21_HUMAN	interleukin 21	33					cell maturation (GO:0048469)|immune response (GO:0006955)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell cytokine production (GO:0002729)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	cytokine receptor binding (GO:0005126)|interleukin-2 receptor binding (GO:0005134)	p.R40H(2)		NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(3)	8						TATAAGTTGACGCATTCTAAT	0.363													C|||	1	0.000199681	0.0	0.0	5008	,	,		19969	0.0		0.001	False		,,,				2504	0.0				p.R40H												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G119A	4						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	125.0	121.0	122.0		119,119	-0.0	1.0	4	dbSNP_134	122	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	IL21	NM_021803.2,NM_001207006.1	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	40/163,40/154	123542048	2,13004	2203	4300	6503	123761498	SO:0001583	missense	59067	exon1			AF254069	CCDS3727.1, CCDS75189.1	4q26-q27	2011-07-15			ENSG00000138684	ENSG00000138684		"""Interleukins and interleukin receptors"""	6005	protein-coding gene	gene with protein product		605384				11081504, 17947662	Standard	NM_001207006		Approved	Za11, IL-21	uc003ies.3	Q9HBE4	OTTHUMG00000133073	ENST00000264497.3:c.119G>A	4.37:g.123542048C>T	ENSP00000264497:p.Arg40His	Somatic		Capture	Illumina HiSeq	Phase_I	123761498	NM_021803	A5J0L4	Missense_Mutation	SNP	ENST00000264497.3	37	CCDS3727.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	12.30	1.895179	0.33442	0.0	2.33E-4	ENSG00000138684	ENST00000264497	.	.	.	5.63	-0.0121	0.13989	.	0.724719	0.12759	N	0.441510	T	0.41328	0.1154	M	0.66939	2.045	0.09310	N	1	B;B	0.20261	0.035;0.043	B;B	0.19148	0.014;0.024	T	0.39210	-0.9625	9	0.52906	T	0.07	-2.9323	5.8143	0.18484	0.3248:0.4574:0.0:0.2178	.	33;33	Q9HBE4-2;Q9HBE4	.;IL21_HUMAN	H	40	.	ENSP00000264497:R40H	R	-	2	0	IL21	123761498	0.926000	0.31397	0.986000	0.45419	0.995000	0.86356	0.902000	0.28459	0.027000	0.15297	0.655000	0.94253	CGT		0.363	IL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256713.1	NM_021803	
JAKMIP1	152789	broad.mit.edu	37	4	6114473	6114473	+	Silent	SNP	G	G	A	rs142464221	byFrequency	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr4:6114473G>A	ENST00000282924.5	-	2	590	c.105C>T	c.(103-105)atC>atT	p.I35I	JAKMIP1_ENST00000457227.2_Intron|JAKMIP1_ENST00000409371.3_Silent_p.I35I|JAKMIP1_ENST00000410077.2_Silent_p.I35I|JAKMIP1_ENST00000409021.3_Silent_p.I35I|JAKMIP1_ENST00000409831.1_Silent_p.I35I	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	35	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)	p.I35I(2)		NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GCTGGAACTCGATCTGAATGC	0.607																																					p.I35I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C105T	4						.						138.0	121.0	127.0					4																	6114473		2203	4300	6503	6165374	SO:0001819	synonymous_variant	152789	exon2			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.105C>T	4.37:g.6114473G>A		Somatic		Capture	Illumina HiSeq	Phase_I	6165374	NM_144720	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Silent	SNP	ENST00000282924.5	37	CCDS3385.1																																																																																				0.607	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
CCSER1	401145	broad.mit.edu	37	4	91229476	91229476	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr4:91229476G>A	ENST00000509176.1	+	2	329	c.41G>A	c.(40-42)cGg>cAg	p.R14Q	CCSER1_ENST00000432775.2_Missense_Mutation_p.R14Q|CCSER1_ENST00000333691.8_Missense_Mutation_p.R14Q	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	14	Ser-rich.							p.R14Q(1)									CTGGTCTCCCGGTTGCCAATA	0.453																																					p.R14Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G41A	4						.						58.0	52.0	54.0					4																	91229476		1873	4103	5976	91448499	SO:0001583	missense	401145	exon2				CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.41G>A	4.37:g.91229476G>A	ENSP00000425040:p.Arg14Gln	Somatic		Capture	Illumina HiSeq	Phase_I	91448499	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.855360	0.91355	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.64803	0.31;-0.12;0.31	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.75583	0.3869	L	0.48642	1.525	0.38655	D	0.951945	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	T	0.78430	-0.2207	10	0.87932	D	0	-13.606	19.5936	0.95526	0.0:0.0:1.0:0.0	.	14;14;14	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	Q	14	ENSP00000425040:R14Q;ENSP00000389283:R14Q;ENSP00000329482:R14Q	ENSP00000329482:R14Q	R	+	2	0	FAM190A	91448499	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.125000	0.94402	2.793000	0.96121	0.655000	0.94253	CGG		0.453	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
TLL1	7092	broad.mit.edu	37	4	166915565	166915565	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr4:166915565G>T	ENST00000061240.2	+	4	1041	c.394G>T	c.(394-396)Gta>Tta	p.V132L	TLL1_ENST00000507499.1_Missense_Mutation_p.V132L|TLL1_ENST00000513213.1_Missense_Mutation_p.V132L	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	132					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V132L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TAAGGGAAAAGTACCTCTACA	0.413																																					p.V132L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G394T	4						.						74.0	70.0	72.0					4																	166915565		2203	4300	6503	167135015	SO:0001583	missense	7092	exon4			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.394G>T	4.37:g.166915565G>T	ENSP00000061240:p.Val132Leu	Somatic		Capture	Illumina HiSeq	Phase_I	167135015	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	G	5.629	0.300783	0.10678	.	.	ENSG00000038295	ENST00000061240;ENST00000507499;ENST00000513213;ENST00000506144	T;T;T;T	0.76448	0.53;0.46;0.41;-1.02	5.4	3.53	0.40419	.	0.966205	0.08527	N	0.932670	T	0.55878	0.1948	N	0.03608	-0.345	0.21627	N	0.999614	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43376	-0.9395	10	0.28530	T	0.3	.	8.0979	0.30840	0.0784:0.0:0.5967:0.3249	.	132;132	E9PD25;O43897	.;TLL1_HUMAN	L	132;132;132;32	ENSP00000061240:V132L;ENSP00000426082:V132L;ENSP00000422937:V132L;ENSP00000423748:V32L	ENSP00000061240:V132L	V	+	1	0	TLL1	167135015	0.955000	0.32602	0.979000	0.43373	0.006000	0.05464	1.477000	0.35431	0.494000	0.27859	0.655000	0.94253	GTA		0.413	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
MAN2A1	4124	broad.mit.edu	37	5	109117197	109117197	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr5:109117197A>T	ENST00000261483.4	+	9	2527	c.1475A>T	c.(1474-1476)gAt>gTt	p.D492V		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	492					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.D492V(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		TTAAGTGGAGATTTTTTCACT	0.383																																					p.D492V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1475T	5						.						132.0	129.0	130.0					5																	109117197		2202	4300	6502	109145096	SO:0001583	missense	4124	exon9				CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.1475A>T	5.37:g.109117197A>T	ENSP00000261483:p.Asp492Val	Somatic		Capture	Illumina HiSeq	Phase_I	109145096	NM_002372	Q16767	Missense_Mutation	SNP	ENST00000261483.4	37	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.929194	0.92389	.	.	ENSG00000112893	ENST00000261483	T	0.37584	1.19	6.06	6.06	0.98353	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.000000	0.85682	D	0.000000	T	0.76378	0.3979	H	0.98754	4.32	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	D	0.86489	0.1796	10	0.87932	D	0	-24.8789	16.6245	0.84952	1.0:0.0:0.0:0.0	.	492	Q16706	MA2A1_HUMAN	V	492	ENSP00000261483:D492V	ENSP00000261483:D492V	D	+	2	0	MAN2A1	109145096	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.932000	0.92897	2.323000	0.78572	0.528000	0.53228	GAT		0.383	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
CHSY3	337876	broad.mit.edu	37	5	129244011	129244011	+	Silent	SNP	C	C	T	rs373792516		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr5:129244011C>T	ENST00000305031.4	+	2	1402	c.1044C>T	c.(1042-1044)tgC>tgT	p.C348C	CHSY3_ENST00000507545.1_3'UTR|CTC-575N7.1_ENST00000515569.1_RNA|CTC-575N7.1_ENST00000503616.1_RNA	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	348					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.C348C(1)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		TAGGAAGATGCGTTCGCCGTT	0.438																																					p.C348C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1044T	5						.	T		0,4406		0,0,2203	168.0	144.0	152.0		1044	-2.6	1.0	5		152	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CHSY3	NM_175856.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		348/883	129244011	1,13005	2203	4300	6503	129271910	SO:0001819	synonymous_variant	337876	exon2			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1044C>T	5.37:g.129244011C>T		Somatic		Capture	Illumina HiSeq	Phase_I	129271910	NM_175856	B2RP97|Q76L22|Q86Y52	Silent	SNP	ENST00000305031.4	37	CCDS34223.1																																																																																				0.438	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
PCDHA5	56143	broad.mit.edu	37	5	140201827	140201827	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr5:140201827C>T	ENST00000529859.1	+	1	467	c.467C>T	c.(466-468)gCg>gTg	p.A156V	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.A156V|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.A156V|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	156	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A156V(4)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTAGAGGGCGCGTCGGATTTG	0.398																																					p.A156V												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C467T	5						.						50.0	55.0	54.0					5																	140201827		2203	4300	6503	140182011	SO:0001583	missense	56143	exon1			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.467C>T	5.37:g.140201827C>T	ENSP00000436557:p.Ala156Val	Somatic		Capture	Illumina HiSeq	Phase_I	140182011	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472423	0.84533	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.59364	0.27;0.27;0.27	4.02	4.02	0.46733	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.82815	0.5119	H	0.95079	3.62	0.42748	D	0.993768	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.89364	0.3670	9	0.87932	D	0	.	16.5119	0.84288	0.0:1.0:0.0:0.0	.	156;156;156	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	V	156	ENSP00000433416:A156V;ENSP00000436557:A156V;ENSP00000367366:A156V	ENSP00000367366:A156V	A	+	2	0	PCDHA5	140182011	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	7.815000	0.86186	1.946000	0.56461	0.591000	0.81541	GCG		0.398	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
GZMA	3001	broad.mit.edu	37	5	54405923	54405923	+	Silent	SNP	C	C	T	rs371339546		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr5:54405923C>T	ENST00000274306.6	+	5	737	c.702C>T	c.(700-702)tgC>tgT	p.C234C		NM_006144.3	NP_006135	P12544	GRAA_HUMAN	granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)	234	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|immune response (GO:0006955)|negative regulation of DNA binding (GO:0043392)|negative regulation of endodeoxyribonuclease activity (GO:0032078)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of apoptotic process (GO:0043065)|proteolysis involved in cellular protein catabolic process (GO:0051603)	extracellular region (GO:0005576)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.C234C(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	25		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				AAAATAAATGCGGAGACCCTC	0.468																																					p.C234C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C702T	5						.	C		0,4406		0,0,2203	97.0	97.0	97.0		702	-8.5	0.1	5		97	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	GZMA	NM_006144.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		234/263	54405923	1,13005	2203	4300	6503	54441680	SO:0001819	synonymous_variant	3001	exon5				CCDS3965.1	5q11-q12	2008-07-18			ENSG00000145649	ENSG00000145649			4708	protein-coding gene	gene with protein product	"""CTL tryptase"", ""Granzyme A (Cytotoxic T-lymphocyte-associated serine esterase-3; Hanukah factor serine protease)"""	140050		HFSP, CTLA3		3262682, 3533635	Standard	NM_006144		Approved		uc003jpm.3	P12544	OTTHUMG00000097011	ENST00000274306.6:c.702C>T	5.37:g.54405923C>T		Somatic		Capture	Illumina HiSeq	Phase_I	54441680	NM_006144	A4PHN1|Q6IB36	Silent	SNP	ENST00000274306.6	37	CCDS3965.1																																																																																				0.468	GZMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214100.2	NM_006144	
Unknown	0	broad.mit.edu	37	5	140568811	140568811	+	IGR	SNP	G	G	C	rs17844594	byFrequency	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr5:140568811G>C								PCDHB16 (3018 upstream) : PCDHB10 (3130 downstream)																							AGCACAGGCTGGTGGTGCTTG	0.687																																					p.W640S												.	.	0			c.G1919C	5						.						31.0	33.0	32.0					5																	140568811		2139	4173	6312	140548995	SO:0001628	intergenic_variant	56127	exon1																															5.37:g.140568811G>C		Somatic		Capture	Illumina HiSeq	Phase_I	140548995	NM_019119		Silent	SNP		37																																																																																				0	0.687								
COL9A1	1297	broad.mit.edu	37	6	70990707	70990708	+	Splice_Site	INS	-	-	G			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	-	-	-	G	-	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr6:70990707_70990708insG	ENST00000357250.6	-	9	1069_1070	c.911_912insC	c.(910-912)ccg>ccCg	p.P304fs	COL9A1_ENST00000370496.3_Splice_Site_p.P304fs|COL9A1_ENST00000370499.4_Splice_Site_p.P61fs|COL9A1_ENST00000489611.1_5'Flank|COL9A1_ENST00000320755.7_Splice_Site_p.P61fs	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	304	Collagen-like 1.|Triple-helical region (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						ATCAACTTACCGGGGGGCCCGG	0.569																																					p.P61fs												.	.	0			c.183_184insC	6						.																																			71047429	SO:0001630	splice_region_variant	1297	exon3				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.912+1->C	6.37:g.70990713_70990713dupG		Germline		Capture	Illumina HiSeq	Phase_I	71047428	NM_078485	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Frame_Shift_Ins	INS	ENST00000357250.6	37	CCDS4971.1																																																																																				0.569	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		Frame_Shift_Ins
LRFN2	57497	broad.mit.edu	37	6	40359913	40359913	+	Silent	SNP	C	C	T	rs377714768		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr6:40359913C>T	ENST00000338305.6	-	3	2681	c.2139G>A	c.(2137-2139)ccG>ccA	p.P713P		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	713						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.P713P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					TGCCCTCCAACGGCAAGGGGA	0.736																																					p.P713P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2139A	6						.	G		2,4378		0,2,2188	11.0	11.0	11.0		2139	2.4	1.0	6		11	0,8574		0,0,4287	no	coding-synonymous	LRFN2	NM_020737.1		0,2,6475	TT,TC,CC		0.0,0.0457,0.0154		713/790	40359913	2,12952	2190	4287	6477	40467891	SO:0001819	synonymous_variant	57497	exon3			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.2139G>A	6.37:g.40359913C>T		Somatic		Capture	Illumina HiSeq	Phase_I	40467891	NM_020737	A5PKU3|Q5SYP9	Silent	SNP	ENST00000338305.6	37	CCDS34443.1																																																																																				0.736	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
GSTA2	2939	broad.mit.edu	37	6	52615450	52615450	+	Silent	SNP	T	T	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr6:52615450T>C	ENST00000493422.1	-	7	749	c.594A>G	c.(592-594)ctA>ctG	p.L198L		NM_000846.4	NP_000837.3	P09210	GSTA2_HUMAN	glutathione S-transferase alpha 2	198	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)	p.L198L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Chloroquine(DB00608)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Vitamin E(DB00163)	TGCCAGGCTGTAGAAACTTCT	0.453																																					p.L198L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A594G	6						.						118.0	119.0	119.0					6																	52615450		2203	4300	6503	52723409	SO:0001819	synonymous_variant	2939	exon7			AL109918	CCDS4944.1	6p12.2	2012-06-21	2008-11-26		ENSG00000244067	ENSG00000244067	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4627	protein-coding gene	gene with protein product		138360	"""glutathione S-transferase A2"""	GST2			Standard	NM_000846		Approved		uc003pay.3	P09210	OTTHUMG00000016263	ENST00000493422.1:c.594A>G	6.37:g.52615450T>C		Somatic		Capture	Illumina HiSeq	Phase_I	52723409	NM_000846	Q12759|Q16491|Q9NTY6	Silent	SNP	ENST00000493422.1	37	CCDS4944.1																																																																																				0.453	GSTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043589.1	NM_000846	
MDN1	23195	broad.mit.edu	37	6	90380739	90380739	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr6:90380739C>A	ENST00000369393.3	-	83	13970	c.13855G>T	c.(13855-13857)Gac>Tac	p.D4619Y	MDN1_ENST00000468568.1_5'UTR|RP1-122O8.7_ENST00000438877.1_RNA|MDN1_ENST00000428876.1_Missense_Mutation_p.D4619Y			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4619					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.D4619Y(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AGGACGAGGTCTGAGTAGCTG	0.522																																					p.D4619Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13855T	6						.						84.0	75.0	78.0					6																	90380739		2203	4300	6503	90437460	SO:0001583	missense	23195	exon83			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.13855G>T	6.37:g.90380739C>A	ENSP00000358400:p.Asp4619Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	90437460	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770742	0.69992	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03386	3.95;3.95	6.02	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.04497	0.0123	M	0.75447	2.3	0.49687	D	0.999815	D	0.64830	0.994	P	0.57371	0.819	T	0.26326	-1.0106	10	0.02654	T	1	.	12.312	0.54933	0.0:0.865:0.0:0.135	.	4619	Q9NU22	MDN1_HUMAN	Y	4619	ENSP00000358400:D4619Y;ENSP00000413970:D4619Y	ENSP00000358400:D4619Y	D	-	1	0	MDN1	90437460	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	4.784000	0.62411	1.570000	0.49709	0.655000	0.94253	GAC		0.522	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
CALD1	800	broad.mit.edu	37	7	134552485	134552485	+	Start_Codon_SNP	SNP	A	A	G			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr7:134552485A>G	ENST00000361675.2	+	3	230	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	CALD1_ENST00000422748.1_Start_Codon_SNP_p.M1V|CALD1_ENST00000361388.2_Start_Codon_SNP_p.M1V|CALD1_ENST00000417172.1_Start_Codon_SNP_p.M1V|CALD1_ENST00000361901.2_Start_Codon_SNP_p.M1V			Q05682	CALD1_HUMAN	caldesmon 1	1					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)	p.M1V(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						AAATCACACCATGGATGATTT	0.443																																					p.M1V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1G	7						.						72.0	67.0	69.0					7																	134552485		2203	4300	6503	134203025	SO:0001582	initiator_codon_variant	800	exon3			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.1A>G	7.37:g.134552485A>G	ENSP00000354826:p.Met1Val	Somatic		Capture	Illumina HiSeq	Phase_I	134203025	NM_033157	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	ENST00000361675.2	37	CCDS5835.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.132294	0.37630	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000454108;ENST00000361675;ENST00000361901;ENST00000445569;ENST00000435928	T;T;T;T;T;T	0.47869	1.74;0.83;1.77;1.77;1.28;1.74	5.6	5.6	0.85130	.	0.538237	0.15894	N	0.239383	T	0.69557	0.3124	.	.	.	0.80722	D	1	P;P;P;P;P	0.52842	0.924;0.954;0.954;0.956;0.924	P;D;D;D;P	0.66351	0.878;0.943;0.943;0.931;0.878	T	0.72097	-0.4393	9	0.87932	D	0	-21.0385	15.4591	0.75339	1.0:0.0:0.0:0.0	.	1;1;1;1;1	A8K0X1;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;CALD1_HUMAN;.	V	1	ENSP00000398826:M1V;ENSP00000411476:M1V;ENSP00000355000:M1V;ENSP00000395710:M1V;ENSP00000354826:M1V;ENSP00000354513:M1V	ENSP00000355000:M1V	M	+	1	0	CALD1	134203025	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.732000	0.74790	2.110000	0.64415	0.533000	0.62120	ATG		0.443	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	NM_033138	Missense_Mutation
CROT	54677	broad.mit.edu	37	7	87022264	87022264	+	Splice_Site	SNP	C	C	T	rs143172549	byFrequency	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr7:87022264C>T	ENST00000331536.3	+	17	1784	c.1599C>T	c.(1597-1599)agC>agT	p.S533S	CROT_ENST00000419147.2_Splice_Site_p.S561S|CROT_ENST00000442291.1_Splice_Site_p.S533S	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	533					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)	p.S533S(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TGCCACACAGCGGAGGAGGTG	0.383																																					p.S533S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1599T	7						.	C	,	1,4405	2.1+/-5.4	0,1,2202	189.0	182.0	184.0		1683,1599	4.8	1.0	7	dbSNP_134	184	0,8600		0,0,4300	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	CROT	NM_001143935.1,NM_021151.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	561/641,533/613	87022264	1,13005	2203	4300	6503	86860200	SO:0001630	splice_region_variant	54677	exon17				CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.1599-1C>T	7.37:g.87022264C>T		Somatic		Capture	Illumina HiSeq	Phase_I	86860200	NM_021151	A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Silent	SNP	ENST00000331536.3	37	CCDS5604.1																																																																																				0.383	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	NM_021151	Silent
ABCB4	5244	broad.mit.edu	37	7	87056136	87056136	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr7:87056136T>C	ENST00000265723.4	-	16	2105	c.1994A>G	c.(1993-1995)cAt>cGt	p.H665R	ABCB4_ENST00000358400.3_Missense_Mutation_p.H665R|ABCB4_ENST00000359206.3_Missense_Mutation_p.H665R|ABCB4_ENST00000545634.1_Missense_Mutation_p.H665R|ABCB4_ENST00000453593.1_Missense_Mutation_p.H665R	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	665					cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.H665R(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	CTGAGTAGAATGCCTAAATAG	0.388																																					p.H665R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1994G	7						.						113.0	111.0	112.0					7																	87056136		2203	4300	6503	86894072	SO:0001583	missense	5244	exon16			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.1994A>G	7.37:g.87056136T>C	ENSP00000265723:p.His665Arg	Somatic		Capture	Illumina HiSeq	Phase_I	86894072	NM_018849	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.134611	0.00338	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.86366	-2.05;-2.11;-2.1;-2.11;-2.05	4.8	2.26	0.28386	.	0.861239	0.10139	N	0.711064	T	0.57755	0.2075	N	0.00325	-1.645	0.22541	N	0.99901	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.52646	-0.8548	10	0.11182	T	0.66	-5.2701	6.3693	0.21473	0.0:0.2147:0.0:0.7853	.	665;665;665	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	R	665	ENSP00000352135:H665R;ENSP00000351172:H665R;ENSP00000265723:H665R;ENSP00000392983:H665R;ENSP00000437465:H665R	ENSP00000265723:H665R	H	-	2	0	ABCB4	86894072	0.021000	0.18746	0.984000	0.44739	0.085000	0.17905	-0.422000	0.07043	0.270000	0.21984	0.460000	0.39030	CAT		0.388	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
ZNF862	643641	broad.mit.edu	37	7	149545092	149545092	+	Silent	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr7:149545092C>T	ENST00000223210.4	+	4	755	c.510C>T	c.(508-510)atC>atT	p.I170I		NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.I170I(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						ACCCCTCCATCAGGGACAAAC	0.507																																					p.I170I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C510T	7						.						49.0	48.0	48.0					7																	149545092		2043	4202	6245	149176025	SO:0001819	synonymous_variant	643641	exon4			AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.510C>T	7.37:g.149545092C>T		Somatic		Capture	Illumina HiSeq	Phase_I	149176025	NM_001099220	A0AUL8	Silent	SNP	ENST00000223210.4	37	CCDS47741.1																																																																																				0.507	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350165.1	NM_001099220	
CSMD3	114788	broad.mit.edu	37	8	113504827	113504827	+	Silent	SNP	G	G	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr8:113504827G>T	ENST00000297405.5	-	31	5413	c.5169C>A	c.(5167-5169)gtC>gtA	p.V1723V	CSMD3_ENST00000455883.2_Silent_p.V1619V|CSMD3_ENST00000343508.3_Silent_p.V1683V|CSMD3_ENST00000352409.3_Silent_p.V1723V	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1723	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V1723V(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGTAATAGGTGACTGTTGACC	0.418										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.V1723V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5169A	8						.						188.0	164.0	172.0					8																	113504827		2203	4300	6503	113574003	SO:0001819	synonymous_variant	114788	exon31			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5169C>A	8.37:g.113504827G>T		Somatic		Capture	Illumina HiSeq	Phase_I	113574003	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																				0.418	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CCAR2	57805	broad.mit.edu	37	8	22463613	22463613	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr8:22463613C>T	ENST00000308511.4	+	3	323	c.74C>T	c.(73-75)tCt>tTt	p.S25F	CCAR2_ENST00000389279.3_Missense_Mutation_p.S25F|CCAR2_ENST00000520861.1_5'Flank|CCAR2_ENST00000521301.1_Missense_Mutation_p.S25F			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	25					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										GCTTCAACATCTCTTCTGGGC	0.537																																					p.S25F												.	.	0			c.C74T	8						.						276.0	284.0	282.0					8																	22463613		2203	4300	6503	22519558	SO:0001583	missense	57805	exon3			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.74C>T	8.37:g.22463613C>T	ENSP00000310670:p.Ser25Phe	None		Capture	Illumina HiSeq	Phase_I	22519558	NM_021174	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	ENST00000308511.4	37	CCDS34863.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.603212	0.87157	.	.	ENSG00000158941	ENST00000308511;ENST00000521301;ENST00000389279;ENST00000521837;ENST00000523349	T;T	0.35605	1.3;1.3	5.45	5.45	0.79879	.	0.000000	0.56097	D	0.000027	T	0.41719	0.1171	N	0.08118	0	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	T	0.51052	-0.8754	10	0.72032	D	0.01	-24.988	17.0485	0.86511	0.0:1.0:0.0:0.0	.	25	Q8N163	K1967_HUMAN	F	25	ENSP00000310670:S25F;ENSP00000373930:S25F	ENSP00000310670:S25F	S	+	2	0	KIAA1967	22519558	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.044000	0.57361	2.941000	0.99782	0.655000	0.94253	TCT		0.537	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375865.1	NM_021174	
EXTL3	2137	broad.mit.edu	37	8	28573945	28573945	+	Silent	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr8:28573945C>T	ENST00000220562.4	+	3	1271	c.369C>T	c.(367-369)aaC>aaT	p.N123N	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	123					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.N123N(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		GCATTGAGAACGCCAAGCAGG	0.562																																					p.N123N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C369T	8						.						46.0	40.0	42.0					8																	28573945		2203	4300	6503	28629864	SO:0001819	synonymous_variant	2137	exon3			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.369C>T	8.37:g.28573945C>T		Somatic		Capture	Illumina HiSeq	Phase_I	28629864	NM_001440	D3DST8|O00225|Q53XT3	Silent	SNP	ENST00000220562.4	37	CCDS6070.1																																																																																				0.562	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
CHD7	55636	broad.mit.edu	37	8	61750759	61750759	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr8:61750759G>A	ENST00000423902.2	+	19	4957	c.4478G>A	c.(4477-4479)cGt>cAt	p.R1493H	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1493					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R1493H(2)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ATCCTCCTACGTCGAACCCAC	0.448																																					p.R1493H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4478A	8						.						68.0	62.0	64.0					8																	61750759		1916	4130	6046	61913313	SO:0001583	missense	55636	exon19			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.4478G>A	8.37:g.61750759G>A	ENSP00000392028:p.Arg1493His	Somatic		Capture	Illumina HiSeq	Phase_I	61913313	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	G	33	5.287860	0.95517	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.84730	-1.89	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.93782	0.8012	M	0.89353	3.025	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94518	0.7724	10	0.87932	D	0	-17.9883	19.3797	0.94527	0.0:0.0:1.0:0.0	.	1493	Q9P2D1	CHD7_HUMAN	H	1493	ENSP00000392028:R1493H	ENSP00000307304:R1493H	R	+	2	0	CHD7	61913313	1.000000	0.71417	0.966000	0.40874	0.886000	0.51366	9.813000	0.99286	2.660000	0.90430	0.655000	0.94253	CGT		0.448	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
ADHFE1	137872	broad.mit.edu	37	8	67355039	67355039	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr8:67355039G>A	ENST00000396623.3	+	3	135	c.104G>A	c.(103-105)gGa>gAa	p.G35E	ADHFE1_ENST00000415254.1_5'UTR|ADHFE1_ENST00000496501.1_Intron|ADHFE1_ENST00000379385.4_Missense_Mutation_p.G35E	NM_144650.2	NP_653251.2	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1	35					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|molecular hydrogen transport (GO:0015993)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacid-oxoacid transhydrogenase activity (GO:0047988)|metal ion binding (GO:0046872)	p.G35E(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	29		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			CTAGCCCCTGGACTTTCACCT	0.308																																					p.G35E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G104A	8						.						97.0	90.0	92.0					8																	67355039		1799	4066	5865	67517593	SO:0001583	missense	137872	exon3			AK056992	CCDS6190.2	8q12.3	2013-05-21			ENSG00000147576	ENSG00000147576	1.1.99.24	"""Alcohol dehydrogenases"""	16354	protein-coding gene	gene with protein product	"""hydroxyacid-oxoacid transhydrogenase"""	611083				12592711	Standard	NM_144650		Approved	ADHFe1, FLJ32430	uc003xwb.4	Q8IWW8	OTTHUMG00000150215	ENST00000396623.3:c.104G>A	8.37:g.67355039G>A	ENSP00000379865:p.Gly35Glu	Somatic		Capture	Illumina HiSeq	Phase_I	67517593	NM_144650	B4DTJ8|Q49A19|Q68CI7|Q6P2B6|Q96MF9	Missense_Mutation	SNP	ENST00000396623.3	37	CCDS6190.2	.	.	.	.	.	.	.	.	.	.	G	18.25	3.583566	0.65992	.	.	ENSG00000147576	ENST00000379385;ENST00000396623	T	0.39997	1.05	5.84	4.02	0.46733	.	0.153660	0.41396	U	0.000899	T	0.12518	0.0304	N	0.02539	-0.55	0.49130	D	0.999759	B	0.09022	0.002	B	0.06405	0.002	T	0.17107	-1.0380	10	0.05833	T	0.94	-11.8976	2.6993	0.05143	0.1294:0.1667:0.5309:0.173	.	35	Q8IWW8	HOT_HUMAN	E	35	ENSP00000379865:G35E	ENSP00000368695:G35E	G	+	2	0	ADHFE1	67517593	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.252000	0.43196	1.456000	0.47831	-0.176000	0.13171	GGA		0.308	ADHFE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316867.3	NM_144650	
CRISPLD1	83690	broad.mit.edu	37	8	75928927	75928927	+	Silent	SNP	C	C	T	rs375398675		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr8:75928927C>T	ENST00000262207.4	+	7	1323	c.855C>T	c.(853-855)agC>agT	p.S285S	CRISPLD1_ENST00000517786.1_Silent_p.S99S|CRISPLD1_ENST00000523524.1_Silent_p.S97S	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	285					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.S285S(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			AAGTCATAAGCGCACAGCAAA	0.338																																					p.S285S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C855T	8						.	C		2,4404	4.2+/-10.8	0,2,2201	161.0	169.0	166.0		855	3.2	1.0	8		166	0,8600		0,0,4300	no	coding-synonymous	CRISPLD1	NM_031461.5		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		285/501	75928927	2,13004	2203	4300	6503	76091482	SO:0001819	synonymous_variant	83690	exon7			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.855C>T	8.37:g.75928927C>T		Somatic		Capture	Illumina HiSeq	Phase_I	76091482	NM_031461	B2RA60|B7Z929	Silent	SNP	ENST00000262207.4	37	CCDS6219.1																																																																																				0.338	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
TRPS1	7227	broad.mit.edu	37	8	116426763	116426763	+	Missense_Mutation	SNP	G	G	A	rs374896129		TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr8:116426763G>A	ENST00000220888.5	-	6	3493	c.3334C>T	c.(3334-3336)Cgg>Tgg	p.R1112W	TRPS1_ENST00000520276.1_Missense_Mutation_p.R1116W|TRPS1_ENST00000395715.3_Missense_Mutation_p.R1125W|TRPS1_ENST00000519076.1_Missense_Mutation_p.R866W			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1112	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R1112W(2)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CTCCAGAACCGCAGCCAATCA	0.463									Langer-Giedion syndrome				G|||	1	0.000199681	0.0	0.0	5008	,	,		17996	0.001		0.0	False		,,,				2504	0.0				p.R1125W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3373T	8						.	G	TRP/ARG	0,3818		0,0,1909	97.0	94.0	95.0		3373	5.7	1.0	8		95	1,8261		0,1,4130	no	missense	TRPS1	NM_014112.2	101	0,1,6039	AA,AG,GG		0.0121,0.0,0.0083	probably-damaging	1125/1295	116426763	1,12079	1909	4131	6040	116495939	SO:0001583	missense	7227	exon7	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3334C>T	8.37:g.116426763G>A	ENSP00000220888:p.Arg1112Trp	Somatic		Capture	Illumina HiSeq	Phase_I	116495939	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.91|15.91	2.971894|2.971894	0.53614|0.53614	0.0|0.0	1.21E-4|1.21E-4	ENSG00000104447|ENSG00000104447	ENST00000518018|ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	.|D;D;D;D	.|0.99376	.|-5.79;-5.76;-5.65;-5.76	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98579|0.98579	0.9525|0.9525	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.998;0.999	D|D	0.98530|0.98530	1.0627|1.0627	5|10	.|0.87932	.|D	.|0	.|.	12.8772|12.8772	0.57998|0.57998	0.0:0.0:0.7295:0.2705|0.0:0.0:0.7295:0.2705	.|.	.|1116;1112;1125	.|Q9UHF7-3;Q9UHF7;Q9UHF7-2	.|.;TRPS1_HUMAN;.	V|W	236|1125;1112;866;1116	.|ENSP00000379065:R1125W;ENSP00000220888:R1112W;ENSP00000428910:R866W;ENSP00000428680:R1116W	.|ENSP00000220888:R1112W	A|R	-|-	2|1	0|2	TRPS1|TRPS1	116495939|116495939	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	1.000000|1.000000	0.99986|0.99986	2.932000|2.932000	0.48940|0.48940	2.685000|2.685000	0.91497|0.91497	0.655000|0.655000	0.94253|0.94253	GCG|CGG		0.463	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
C9orf47	286223	broad.mit.edu	37	9	91606888	91606888	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr9:91606888T>G	ENST00000334490.5	+	3	662	c.594T>G	c.(592-594)ttT>ttG	p.F198L	S1PR3_ENST00000358157.2_Intron|C9orf47_ENST00000375850.3_Missense_Mutation_p.F231L|C9orf47_ENST00000375851.2_Missense_Mutation_p.F179L			Q6ZRZ4	CI047_HUMAN	chromosome 9 open reading frame 47	198						extracellular region (GO:0005576)		p.F198L(1)		endometrium(1)|large_intestine(1)|liver(1)|lung(1)	4						ATCAGTCGTTTTCCTTGGACA	0.532																																					p.F198L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T594G	9						.						102.0	94.0	97.0					9																	91606888		2203	4300	6503	90796708	SO:0001583	missense	286223	exon3			AK094842	CCDS35062.1, CCDS47989.1	9q22.1	2008-02-05	2004-11-04		ENSG00000186354	ENSG00000186354			23669	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 108"""	C9orf108			Standard	NM_001001938		Approved	FLJ37523, bA791O21.3	uc004aqc.2	Q6ZRZ4	OTTHUMG00000020172	ENST00000334490.5:c.594T>G	9.37:g.91606888T>G	ENSP00000335616:p.Phe198Leu	Somatic		Capture	Illumina HiSeq	Phase_I	90796708	NM_001001938	B7ZMC7|Q5SQD7|Q7Z568|Q8N1V4	Missense_Mutation	SNP	ENST00000334490.5	37	CCDS35062.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.613662	0.28712	.	.	ENSG00000186354	ENST00000375851;ENST00000375850;ENST00000334490	.	.	.	3.16	2.02	0.26589	.	.	.	.	.	T	0.16854	0.0405	N	0.08118	0	0.09310	N	0.999999	B;B	0.32573	0.376;0.376	B;B	0.29440	0.102;0.102	T	0.15178	-1.0446	8	0.87932	D	0	.	5.1424	0.14965	0.0:0.136:0.0:0.864	.	198;179	Q6ZRZ4;Q6ZRZ4-2	CI047_HUMAN;.	L	179;231;198	.	ENSP00000335616:F198L	F	+	3	2	C9orf47	90796708	0.001000	0.12720	0.003000	0.11579	0.040000	0.13550	0.422000	0.21296	0.604000	0.29930	0.459000	0.35465	TTT		0.532	C9orf47-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355972.1	NM_182599	
RABGAP1	23637	broad.mit.edu	37	9	125746783	125746783	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chr9:125746783A>C	ENST00000373647.4	+	3	304	c.170A>C	c.(169-171)gAa>gCa	p.E57A		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	57					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)	p.E57A(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						AATGGAAGTGAACAGCAGCTG	0.433																																					p.E57A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A170C	9						.						64.0	55.0	58.0					9																	125746783		2203	4300	6503	124786604	SO:0001583	missense	23637	exon3			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.170A>C	9.37:g.125746783A>C	ENSP00000362751:p.Glu57Ala	Somatic		Capture	Illumina HiSeq	Phase_I	124786604	NM_012197	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Missense_Mutation	SNP	ENST00000373647.4	37	CCDS6848.2	.	.	.	.	.	.	.	.	.	.	A	17.59	3.426311	0.62733	.	.	ENSG00000011454	ENST00000373647;ENST00000317419;ENST00000402311	T;T	0.63744	-0.06;-0.06	5.51	5.51	0.81932	.	.	.	.	.	T	0.75796	0.3898	M	0.62723	1.935	0.53688	D	0.999974	D;D	0.67145	0.976;0.996	P;D	0.73708	0.551;0.981	T	0.76391	-0.2976	9	0.46703	T	0.11	-11.4935	14.7982	0.69894	1.0:0.0:0.0:0.0	.	57;57	Q9Y3P9;Q9Y3P9-4	RBGP1_HUMAN;.	A	57	ENSP00000362751:E57A;ENSP00000384119:E57A	ENSP00000324973:E57A	E	+	2	0	RABGAP1	124786604	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.191000	0.89716	2.083000	0.62718	0.533000	0.62120	GAA		0.433	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197	
TLR8	51311	broad.mit.edu	37	X	12938219	12938219	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chrX:12938219C>T	ENST00000218032.6	+	2	1147	c.1060C>T	c.(1060-1062)Cca>Tca	p.P354S	TLR8_ENST00000311912.5_Missense_Mutation_p.P372S	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	354					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.P372S(1)		breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	GGGGAGTTATCCACAGCATAT	0.378																																					p.P354S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1060T	X						.						78.0	83.0	81.0					X																	12938219		2191	4293	6484	12848140	SO:0001583	missense	51311	exon2			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.1060C>T	X.37:g.12938219C>T	ENSP00000218032:p.Pro354Ser	Somatic		Capture	Illumina HiSeq	Phase_I	12848140	NM_138636	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	37	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.456177	0.26161	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.53206	0.63;0.83	5.29	-2.08	0.07254	.	1.027710	0.07812	N	0.958254	T	0.40015	0.1100	M	0.84219	2.685	0.09310	N	1	P;P	0.44627	0.839;0.839	B;B	0.36719	0.231;0.231	T	0.30268	-0.9984	10	0.20046	T	0.44	.	2.0843	0.03642	0.1065:0.2818:0.2066:0.4051	.	354;372	Q9NR97;D1CS70	TLR8_HUMAN;.	S	354;372	ENSP00000218032:P354S;ENSP00000312082:P372S	ENSP00000218032:P354S	P	+	1	0	TLR8	12848140	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.435000	0.21510	-0.981000	0.03520	-0.229000	0.12294	CCA		0.378	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610	
PCDH19	57526	broad.mit.edu	37	X	99662749	99662749	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A004-01A-01W-A00E-09	TCGA-AA-A004-10A-01W-A00E-09	g.chrX:99662749C>T	ENST00000373034.4	-	1	2522	c.847G>A	c.(847-849)Gac>Aac	p.D283N	PCDH19_ENST00000255531.7_Missense_Mutation_p.D283N|PCDH19_ENST00000420881.2_Missense_Mutation_p.D283N	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	283	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D283N(1)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CGCGTGCGGTCGTTGACGTAG	0.602																																					p.D283N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G847A	X						.						112.0	118.0	116.0					X																	99662749		2177	4254	6431	99549405	SO:0001583	missense	57526	exon1			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.847G>A	X.37:g.99662749C>T	ENSP00000362125:p.Asp283Asn	Somatic		Capture	Illumina HiSeq	Phase_I	99549405	NM_001105243	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	37	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740948	0.30865	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.63580	-0.05;-0.05;-0.05	5.95	5.95	0.96441	Cadherin (4);Cadherin-like (1);	0.191570	0.56097	D	0.000027	T	0.61912	0.2385	L	0.55990	1.75	0.58432	D	0.999994	B;B;B	0.20550	0.046;0.027;0.033	B;B;B	0.26693	0.018;0.043;0.072	T	0.55768	-0.8089	10	0.27785	T	0.31	.	19.254	0.93938	0.0:1.0:0.0:0.0	.	283;283;283	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	N	283	ENSP00000400327:D283N;ENSP00000362125:D283N;ENSP00000255531:D283N	ENSP00000255531:D283N	D	-	1	0	PCDH19	99549405	1.000000	0.71417	0.798000	0.32154	0.797000	0.45037	5.768000	0.68858	2.498000	0.84270	0.513000	0.50165	GAC		0.602	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
