#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LRP10	26020	hgsc.bcm.edu	37	14	23344347	23344348	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr14:23344347_23344348insT	ENST00000359591.4	+	4	990_991	c.299_300insT	c.(298-303)gcacctfs	p.P101fs	LRP10_ENST00000546834.1_Frame_Shift_Ins_p.P101fs	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	101	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		CTGTGTGAGGCACCTCCCAGCC	0.619																																					p.A100fs												.	.	0			c.299_300insT	14						.																																			22414188	SO:0001589	frameshift_variant	26020	exon4			AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	Exception_encountered	14.37:g.23344347_23344348insT	ENSP00000352601:p.Pro101fs	None		Capture	SOLID	Phase_I	22414187	NM_014045	A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Frame_Shift_Ins	INS	ENST00000359591.4	37	CCDS9578.1																																																																																				0.619	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071663.3		
GLI4	2738	hgsc.bcm.edu	37	8	144351680	144351681	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr8:144351680_144351681insC	ENST00000523522.1	+	1	153_154	c.114_115insC	c.(115-117)catfs	p.H39fs	GLI4_ENST00000517468.1_Frame_Shift_Ins_p.H39fs|GLI4_ENST00000521682.1_Frame_Shift_Ins_p.H39fs|GLI4_ENST00000344692.3_Frame_Shift_Ins_p.H39fs|ZFP41_ENST00000522452.1_Intron|GLI4_ENST00000340042.1_Frame_Shift_Ins_p.H39fs			P10075	GLI4_HUMAN	GLI family zinc finger 4	39					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H39fs*11(1)		endometrium(3)|large_intestine(1)|lung(5)	9	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			ACCTCCATGGGCATCAACATGG	0.644																																					p.G38fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.114_115insC	8						.																																			144423056	SO:0001589	frameshift_variant	2738	exon2				CCDS6398.1	8q24.3	2013-01-08	2009-03-05		ENSG00000250571	ENSG00000250571		"""Zinc fingers, C2H2-type"""	4320	protein-coding gene	gene with protein product		165280	"""GLI-Kruppel family member GLI4"", ""glioma-associated oncogene family zinc finger 4"""			2850480	Standard	NM_138465		Approved	HKR4, ZNF928	uc003yxx.3	P10075	OTTHUMG00000164952	ENST00000523522.1:c.115dupC	8.37:g.144351681_144351681dupC	ENSP00000430987:p.His39fs	Somatic		Capture	SOLID	Phase_I	144423055	NM_138465	Q96CK9	Frame_Shift_Ins	INS	ENST00000523522.1	37	CCDS6398.1																																																																																				0.644	GLI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381128.2		
ZSCAN22	342945	hgsc.bcm.edu	37	19	58846346	58846347	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr19:58846346_58846347insCA	ENST00000329665.4	+	2	325_326	c.178_179insCA	c.(178-180)gcafs	p.A60fs		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	60	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		CTATGAGGAGGCATCTGGTCCA	0.644																																					p.A60fs												.	.	0			c.178_179insCA	19						.																																			63538159	SO:0001589	frameshift_variant	342945	exon2			M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.179_180dupCA	19.37:g.58846347_58846348dupCA	ENSP00000332433:p.Ala60fs	None		Capture	SOLID	Phase_I	63538158	NM_181846	Q15922|Q7Z3L8	Frame_Shift_Ins	INS	ENST00000329665.4	37	CCDS12975.1																																																																																				0.644	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466765.1	NM_181846	
FAM71A	149647	hgsc.bcm.edu	37	1	212799301	212799302	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:212799301_212799302insA	ENST00000294829.3	+	1	1513_1514	c.1082_1083insA	c.(1081-1086)agccttfs	p.SL361fs	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	361	Ala-rich.					nucleus (GO:0005634)		p.S361R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		GCATCCATGAGCCTTTCCCGAG	0.614																																					p.S361fs												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.1082_1083insA	1						.																																			210865925	SO:0001589	frameshift_variant	149647	exon1				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	Exception_encountered	1.37:g.212799301_212799302insA	ENSP00000294829:p.Ser361fs	None		Capture	SOLID	Phase_I	210865924	NM_153606	Q5VTZ1	Frame_Shift_Ins	INS	ENST00000294829.3	37	CCDS1507.1																																																																																				0.614	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	NM_153606	
COL11A2	1302	hgsc.bcm.edu	37	6	33152080	33152081	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:33152080_33152081insC	ENST00000341947.2	-	8	1187_1188	c.960_961insG	c.(958-963)gtccccfs	p.P321fs	COL11A2_ENST00000357486.1_Frame_Shift_Ins_p.P300fs|COL11A2_ENST00000361917.1_Intron|COL11A2_ENST00000374708.4_Intron|COL11A2_ENST00000395197.1_Intron|COL11A2_ENST00000374714.1_Frame_Shift_Ins_p.P295fs|COL11A2_ENST00000374712.1_Intron|COL11A2_ENST00000374713.1_Frame_Shift_Ins_p.P274fs	NM_080680.2	NP_542411.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	321	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.P321fs*21(1)		biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GCTGTGGGGGGGACCTGGAGAT	0.604																																					p.P321fs	Melanoma(1;90 116 3946 5341 17093)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.961_962insG	6						.																																			33260059	SO:0001589	frameshift_variant	1302	exon8			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000341947.2:c.960_961insG	6.37:g.33152080_33152081insC	ENSP00000339915:p.Pro321fs	Somatic		Capture	SOLID	Phase_I	33260058	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Frame_Shift_Ins	INS	ENST00000341947.2	37																																																																																					0.604	COL11A2-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
UNC13D	201294	hgsc.bcm.edu	37	17	73826157	73826158	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:73826157_73826158insG	ENST00000207549.4	-	30	3284_3285	c.2905_2906insC	c.(2905-2907)cagfs	p.Q969fs	UNC13D_ENST00000412096.2_Frame_Shift_Ins_p.Q969fs	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	969	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)		p.Q969fs*12(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTTGTGCTTCTGGGTCTCCCGG	0.599									Familial Hemophagocytic Lymphohistiocytosis		OREG0024741	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q969fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2906_2907insC	17						.																																			71337753	SO:0001589	frameshift_variant	201294	exon30	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.2906dupC	17.37:g.73826160_73826160dupG	ENSP00000207549:p.Gln969fs	Somatic	1148	Capture	SOLID	Phase_I	71337752	NM_199242	B4DWG9|Q9H7K5	Frame_Shift_Ins	INS	ENST00000207549.4	37	CCDS11730.1																																																																																				0.599	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	XM_113950	
PLCH1	23007	hgsc.bcm.edu	37	3	155199643	155199644	+	Frame_Shift_Ins	INS	-	-	GCAG			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr3:155199643_155199644insGCAG	ENST00000340059.7	-	23	4194_4195	c.4195_4196insCTGC	c.(4195-4197)cacfs	p.H1399fs	PLCH1_ENST00000334686.6_Frame_Shift_Ins_p.H1361fs|PLCH1_ENST00000460012.1_Frame_Shift_Ins_p.H1361fs|PLCH1_ENST00000414191.1_Frame_Shift_Ins_p.H1361fs|PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000447496.2_3'UTR	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1399					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TCTTTGAAAGTGTTCTACCACA	0.391																																					p.H1361fs												.	.	0			c.4082_4083insCTGC	3						.																																			156682338	SO:0001589	frameshift_variant	23007	exon22			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4195_4196insCTGC	3.37:g.155199643_155199644insGCAG	ENSP00000345988:p.His1399fs	None		Capture	SOLID	Phase_I	156682337	NM_014996	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Frame_Shift_Ins	INS	ENST00000340059.7	37	CCDS46939.1																																																																																				0.391	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
WFS1	7466	hgsc.bcm.edu	37	4	6296872	6296873	+	Frame_Shift_Ins	INS	-	-	C	rs142428158|rs546948362		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr4:6296872_6296873insC	ENST00000226760.1	+	7	987_988	c.817_818insC	c.(817-819)gagfs	p.E273fs	WFS1_ENST00000503569.1_Frame_Shift_Ins_p.E273fs	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	273					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)	p.E273fs*8(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		AGATGATGACGAGCTGGCGGGG	0.609																																					p.E273fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.817_818insC	4	GRCh37	CM992980	WFS1	M	rs142428158	.																																			6347774	SO:0001589	frameshift_variant	7466	exon7			AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	Exception_encountered	4.37:g.6296872_6296873insC	ENSP00000226760:p.Glu273fs	Somatic		Capture	SOLID	Phase_I	6347773	NM_001145853	B2R797|D3DVT1|Q8N6I3|Q9UNW6	Frame_Shift_Ins	INS	ENST00000226760.1	37	CCDS3386.1																																																																																				0.609	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206863.1		
PCDHA7	56141	hgsc.bcm.edu	37	5	140214964	140214965	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr5:140214964_140214965insCC	ENST00000525929.1	+	1	996_997	c.996_997insCC	c.(997-999)catfs	p.H333fs	PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000378125.3_Frame_Shift_Ins_p.H333fs|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	333	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCTGGCTGGTCATTGTACAGT	0.495																																					p.G332fs	NSCLC(160;258 2013 5070 22440 28951)											.	.	0			c.996_997insCC	5						.																																			140195149	SO:0001589	frameshift_variant	56141	exon1			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		Exception_encountered	5.37:g.140214964_140214965insCC	ENSP00000436426:p.His333fs	None		Capture	SOLID	Phase_I	140195148	NM_018910	O75282	Frame_Shift_Ins	INS	ENST00000525929.1	37	CCDS54918.1																																																																																				0.495	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
TSPAN33	340348	hgsc.bcm.edu	37	7	128806746	128806746	+	Splice_Site	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:128806746A>G	ENST00000289407.4	+	6	696	c.587A>G	c.(586-588)cAg>cGg	p.Q196R	RP11-286H14.6_ENST00000498745.1_RNA|Y_RNA_ENST00000363759.1_RNA	NM_178562.3	NP_848657.1	Q86UF1	TSN33_HUMAN	tetraspanin 33	196					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)	p.Q196R(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14						ACTCCTGACCAGGTGAGCCAG	0.557																																					p.Q196R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A587G	7						.						216.0	192.0	200.0					7																	128806746		2203	4300	6503	128593982	SO:0001630	splice_region_variant	340348	exon6				CCDS5810.1	7q32.3	2013-02-14			ENSG00000158457	ENSG00000158457		"""Tetraspanins"""	28743	protein-coding gene	gene with protein product		610120				16213355, 16242907	Standard	XM_006715960		Approved	MGC50844, Penumbra	uc003vop.2	Q86UF1	OTTHUMG00000158420	ENST00000289407.4:c.588+1A>G	7.37:g.128806746A>G		Somatic		Capture	SOLID	Phase_I	128593982	NM_178562		Missense_Mutation	SNP	ENST00000289407.4	37	CCDS5810.1	.	.	.	.	.	.	.	.	.	.	A	17.88	3.498171	0.64186	.	.	ENSG00000158457	ENST00000289407	T	0.30448	1.53	5.56	5.56	0.83823	Tetraspanin, EC2 domain (1);	0.205077	0.44285	D	0.000477	T	0.31040	0.0784	L	0.47016	1.485	0.53005	D	0.999968	B	0.30146	0.27	B	0.36335	0.222	T	0.07028	-1.0794	10	0.22109	T	0.4	-23.2379	13.6651	0.62389	1.0:0.0:0.0:0.0	.	196	Q86UF1	TSN33_HUMAN	R	196	ENSP00000289407:Q196R	ENSP00000289407:Q196R	Q	+	2	0	TSPAN33	128593982	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	4.598000	0.61069	2.104000	0.64026	0.533000	0.62120	CAG		0.557	TSPAN33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350983.1	NM_178562	Missense_Mutation
NUP205	23165	hgsc.bcm.edu	37	7	135304403	135304403	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:135304403T>G	ENST00000285968.6	+	29	4222	c.4196T>G	c.(4195-4197)aTa>aGa	p.I1399R		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1399					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CTTTACATCATATTGAAGAAA	0.313																																					p.I1399R												.	.	0			c.T4196G	7						.						52.0	54.0	53.0					7																	135304403		2203	4300	6503	134954943	SO:0001583	missense	23165	exon29			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.4196T>G	7.37:g.135304403T>G	ENSP00000285968:p.Ile1399Arg	None		Capture	SOLID	Phase_I	134954943	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.301279	0.81136	.	.	ENSG00000155561	ENST00000285968	T	0.36878	1.23	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.61664	0.2365	M	0.77486	2.375	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.66681	-0.5862	10	0.87932	D	0	0.1499	15.9152	0.79508	0.0:0.0:0.0:1.0	.	1399	Q92621	NU205_HUMAN	R	1399	ENSP00000285968:I1399R	ENSP00000285968:I1399R	I	+	2	0	NUP205	134954943	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.823000	0.86660	2.159000	0.67721	0.397000	0.26171	ATA		0.313	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
PRSS58	136541	hgsc.bcm.edu	37	7	141955063	141955063	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:141955063C>T	ENST00000552471.1	-	3	567	c.248G>A	c.(247-249)gGc>gAc	p.G83D	PRSS58_ENST00000547058.2_Missense_Mutation_p.G83D			Q8IYP2	PRS58_HUMAN	protease, serine, 58	83	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						CTTCTCATAGCCAATCACTTG	0.403																																					p.G83D												.	.	0			c.G248A	7						.						187.0	170.0	176.0					7																	141955063		2203	4300	6503	141601540	SO:0001583	missense	136541	exon4				CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.248G>A	7.37:g.141955063C>T	ENSP00000446916:p.Gly83Asp	None		Capture	SOLID	Phase_I	141601540	NM_001001317	B3KVJ6|D3DXD2	Missense_Mutation	SNP	ENST00000552471.1	37	CCDS5871.1	.	.	.	.	.	.	.	.	.	.	C	2.355	-0.347993	0.05208	.	.	ENSG00000258223	ENST00000547058;ENST00000552471	D;D	0.87491	-2.26;-2.26	4.77	-0.659	0.11424	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.71558	0.3354	N	0.16016	0.355	0.09310	N	1	B	0.23806	0.091	B	0.25759	0.063	T	0.56450	-0.7977	9	0.17832	T	0.49	.	5.2501	0.15517	0.0:0.4607:0.1462:0.3931	.	83	Q8IYP2	PRS58_HUMAN	D	83	ENSP00000447588:G83D;ENSP00000446916:G83D	ENSP00000307206:G83D	G	-	2	0	PRSS58	141601540	0.000000	0.05858	0.007000	0.13788	0.019000	0.09904	-1.432000	0.02430	-0.012000	0.14223	-0.355000	0.07637	GGC		0.403	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351328.2	NM_001001317	
SDK1	221935	hgsc.bcm.edu	37	7	4198113	4198113	+	Silent	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:4198113G>T	ENST00000404826.2	+	31	4798	c.4659G>T	c.(4657-4659)ctG>ctT	p.L1553L	SDK1_ENST00000389531.3_Silent_p.L1553L	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1553	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.L1553L(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGCTGCGCCTGAAAGCCACCA	0.627																																					p.L1553L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4659T	7						.						99.0	86.0	90.0					7																	4198113		2203	4300	6503	4164639	SO:0001819	synonymous_variant	221935	exon31			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4659G>T	7.37:g.4198113G>T		Somatic		Capture	SOLID	Phase_I	4164639	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	CCDS34590.1																																																																																				0.627	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
KLHL7	55975	hgsc.bcm.edu	37	7	23180535	23180535	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:23180535A>G	ENST00000339077.5	+	5	833	c.590A>G	c.(589-591)gAc>gGc	p.D197G	KLHL7_ENST00000322231.7_Missense_Mutation_p.D175G|KLHL7_ENST00000542558.1_5'UTR|KLHL7_ENST00000409689.1_Missense_Mutation_p.D149G|KLHL7_ENST00000539124.1_Missense_Mutation_p.D121G|KLHL7_ENST00000545443.1_Missense_Mutation_p.D175G|KLHL7_ENST00000479288.1_3'UTR	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	197	BACK.				protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.D175G(1)|p.D197G(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CTCAACCAGGACACTCTGACT	0.358																																					p.D197G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A590G	7						.						115.0	109.0	111.0					7																	23180535		2203	4300	6503	23147060	SO:0001583	missense	55975	exon5				CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.590A>G	7.37:g.23180535A>G	ENSP00000343273:p.Asp197Gly	Somatic		Capture	SOLID	Phase_I	23147060	NM_001031710	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	ENST00000339077.5	37	CCDS34609.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.605560	0.87157	.	.	ENSG00000122550	ENST00000536369;ENST00000322231;ENST00000339077;ENST00000539124;ENST00000409689;ENST00000545443	T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92	5.39	5.39	0.77823	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.86892	0.6042	M	0.87180	2.865	0.80722	D	1	D;D	0.67145	0.99;0.996	P;D	0.64237	0.901;0.923	D	0.89435	0.3719	10	0.87932	D	0	.	15.7035	0.77560	1.0:0.0:0.0:0.0	.	197;175	Q8IXQ5;Q8IXQ5-2	KLHL7_HUMAN;.	G	163;175;197;121;149;175	ENSP00000322958:D175G;ENSP00000343273:D197G;ENSP00000441136:D121G;ENSP00000386263:D149G;ENSP00000442366:D175G	ENSP00000322958:D175G	D	+	2	0	KLHL7	23147060	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.649000	0.91067	2.167000	0.68274	0.482000	0.46254	GAC		0.358	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846	
NUPL2	11097	hgsc.bcm.edu	37	7	23239956	23239956	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:23239956T>G	ENST00000258742.5	+	7	1123	c.864T>G	c.(862-864)ttT>ttG	p.F288L		NM_007342.2	NP_031368.1	O15504	NUPL2_HUMAN	nucleoporin like 2	288	Ser-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclear export signal receptor activity (GO:0005049)|poly(A) RNA binding (GO:0044822)	p.F288L(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CTCCAGCTTTTGGATTTGGGA	0.502																																					p.F288L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T864G	7						.						49.0	45.0	46.0					7																	23239956		2203	4300	6503	23206481	SO:0001583	missense	11097	exon7			U97198	CCDS5379.1	7p15	2003-08-07			ENSG00000136243	ENSG00000136243			17010	protein-coding gene	gene with protein product	"""nucleoporin-like protein 1"""					10358091, 9450185	Standard	NM_007342		Approved	NLP_1, CG1, hCG1, H_RG271G13.9	uc003svu.3	O15504	OTTHUMG00000096955	ENST00000258742.5:c.864T>G	7.37:g.23239956T>G	ENSP00000258742:p.Phe288Leu	Somatic		Capture	SOLID	Phase_I	23206481	NM_007342	A4D143|B4DP42|Q49AE7|Q9BS49	Missense_Mutation	SNP	ENST00000258742.5	37	CCDS5379.1	.	.	.	.	.	.	.	.	.	.	T	15.00	2.704281	0.48412	.	.	ENSG00000136243	ENST00000258742;ENST00000413919	T;T	0.34275	1.39;1.37	5.35	4.17	0.49024	.	0.320112	0.38778	N	0.001574	T	0.28067	0.0692	L	0.59436	1.845	0.80722	D	1	B	0.14438	0.01	B	0.13407	0.009	T	0.07404	-1.0774	10	0.08837	T	0.75	-7.0698	6.4311	0.21796	0.1389:0.075:0.0:0.7861	.	288	O15504	NUPL2_HUMAN	L	288;313	ENSP00000258742:F288L;ENSP00000401475:F313L	ENSP00000258742:F288L	F	+	3	2	NUPL2	23206481	1.000000	0.71417	0.996000	0.52242	0.967000	0.64934	1.873000	0.39558	1.014000	0.39417	0.533000	0.62120	TTT		0.502	NUPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214017.2	NM_007342	
PKD1L1	168507	hgsc.bcm.edu	37	7	47872770	47872770	+	Silent	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:47872770G>T	ENST00000289672.2	-	41	6305	c.6255C>A	c.(6253-6255)gcC>gcA	p.A2085A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2085					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.A2085A(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GCAGCTTAGGGGCTGGACAAG	0.567																																					p.A2085A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6255A	7						.						60.0	48.0	52.0					7																	47872770		2203	4300	6503	47839295	SO:0001819	synonymous_variant	168507	exon41			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6255C>A	7.37:g.47872770G>T		Somatic		Capture	SOLID	Phase_I	47839295	NM_138295	Q6UWK1	Silent	SNP	ENST00000289672.2	37	CCDS34633.1																																																																																				0.567	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
CLIP2	7461	hgsc.bcm.edu	37	7	73791001	73791001	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:73791001C>T	ENST00000395060.1	+	9	2270	c.2270C>T	c.(2269-2271)tCg>tTg	p.S757L	CLIP2_ENST00000223398.6_Missense_Mutation_p.S757L|CLIP2_ENST00000361545.5_Missense_Mutation_p.S722L			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	757						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)		p.S722L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						GAGCAGATCTCGCTGGCCGAG	0.627																																					p.S757L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2270T	7						.						30.0	37.0	34.0					7																	73791001		2203	4300	6503	73428937	SO:0001583	missense	7461	exon10			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.2270C>T	7.37:g.73791001C>T	ENSP00000378500:p.Ser757Leu	Somatic		Capture	SOLID	Phase_I	73428937	NM_003388	O14527|O43611	Missense_Mutation	SNP	ENST00000395060.1	37	CCDS5569.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.067471	0.36470	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.60040	0.22;0.23;0.22	4.8	4.8	0.61643	.	0.805527	0.11859	N	0.522539	T	0.45677	0.1354	L	0.27053	0.805	0.24286	N	0.995189	B;B;B	0.30211	0.273;0.165;0.103	B;B;B	0.20184	0.028;0.023;0.01	T	0.30179	-0.9987	10	0.32370	T	0.25	-1.8861	16.4567	0.84019	0.0:1.0:0.0:0.0	.	722;722;757	A7E2F7;Q9UDT6-2;Q9UDT6	.;.;CLIP2_HUMAN	L	757;757;722;757	ENSP00000223398:S757L;ENSP00000355151:S722L;ENSP00000378500:S757L	ENSP00000223398:S757L	S	+	2	0	CLIP2	73428937	0.999000	0.42202	0.992000	0.48379	0.989000	0.77384	3.411000	0.52672	2.216000	0.71823	0.449000	0.29647	TCG		0.627	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
GTF2IRD1	9569	hgsc.bcm.edu	37	7	74016741	74016741	+	Missense_Mutation	SNP	C	C	A	rs373017607		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:74016741C>A	ENST00000265755.3	+	27	3254	c.2861C>A	c.(2860-2862)cCg>cAg	p.P954Q	GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.P939Q|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.P971Q|GTF2IRD1_ENST00000476977.1_3'UTR	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	954					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GTGCAGCTCCCGGGACCTCTT	0.453																																					p.P939Q												.	.	0			c.C2816A	7						.						127.0	117.0	121.0					7																	74016741		2203	4300	6503	73654677	SO:0001583	missense	9569	exon27			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.2861C>A	7.37:g.74016741C>A	ENSP00000265755:p.Pro954Gln	None		Capture	SOLID	Phase_I	73654677	NM_005685	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712467	0.68730	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337	T;T;T	0.58060	0.36;0.37;0.4	5.66	3.86	0.44501	.	0.000000	0.85682	D	0.000000	T	0.65678	0.2714	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.942;0.999;0.999	T	0.66364	-0.5942	10	0.87932	D	0	-12.5032	10.9828	0.47506	0.0:0.8499:0.0:0.1501	.	971;954;939	Q6DSU6;Q9UHL9;Q9UHL9-2	.;GT2D1_HUMAN;.	Q	954;971;939	ENSP00000265755:P954Q;ENSP00000397566:P971Q;ENSP00000408477:P939Q	ENSP00000265755:P954Q	P	+	2	0	GTF2IRD1	73654677	0.999000	0.42202	0.942000	0.38095	0.976000	0.68499	5.117000	0.64667	0.743000	0.32719	0.561000	0.74099	CCG		0.453	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
SEMA3D	223117	hgsc.bcm.edu	37	7	84671595	84671595	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:84671595C>T	ENST00000284136.6	-	8	911	c.868G>A	c.(868-870)Gta>Ata	p.V290I	SEMA3D_ENST00000484038.1_5'Flank	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	290	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TGTCCTCCTACATCATTCTGA	0.373																																					p.V290I	Ovarian(63;442 1191 17318 29975 31528)											.	.	0			c.G868A	7						.						223.0	206.0	212.0					7																	84671595		2203	4300	6503	84509531	SO:0001583	missense	223117	exon8			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.868G>A	7.37:g.84671595C>T	ENSP00000284136:p.Val290Ile	None		Capture	SOLID	Phase_I	84509531	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359008	0.24598	.	.	ENSG00000153993	ENST00000284136	T	0.11169	2.8	5.7	2.91	0.33838	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.356204	0.32918	N	0.005494	T	0.05914	0.0154	N	0.25201	0.72	0.80722	D	1	B	0.14438	0.01	B	0.15484	0.013	T	0.38908	-0.9639	10	0.17832	T	0.49	.	4.6538	0.12608	0.0:0.5043:0.1519:0.3438	.	290	O95025	SEM3D_HUMAN	I	290	ENSP00000284136:V290I	ENSP00000284136:V290I	V	-	1	0	SEMA3D	84509531	1.000000	0.71417	0.823000	0.32752	0.841000	0.47740	2.133000	0.42093	0.330000	0.23485	0.650000	0.86243	GTA		0.373	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
ABCB1	5243	hgsc.bcm.edu	37	7	87190676	87190676	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:87190676G>A	ENST00000265724.3	-	9	1147	c.730C>T	c.(730-732)Ctc>Ttc	p.L244F	ABCB1_ENST00000543898.1_Missense_Mutation_p.L180F	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	244	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	TACGCTAAGAGTTCTTTATCA	0.313																																					p.L244F												.	.	0			c.C730T	7						.						58.0	58.0	58.0					7																	87190676		2202	4300	6502	87028612	SO:0001583	missense	5243	exon9			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.730C>T	7.37:g.87190676G>A	ENSP00000265724:p.Leu244Phe	None		Capture	SOLID	Phase_I	87028612	NM_000927	A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497448	0.64186	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.90261	-2.64;-2.64	5.74	4.85	0.62838	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.062472	0.64402	D	0.000003	D	0.94440	0.8211	M	0.81614	2.55	0.41743	D	0.989624	D;D	0.63880	0.983;0.993	B;D	0.68483	0.143;0.958	D	0.94398	0.7620	10	0.66056	D	0.02	-16.321	11.3353	0.49500	0.1399:0.0:0.8601:0.0	.	180;244	B5AK60;P08183	.;MDR1_HUMAN	F	25;244;180	ENSP00000265724:L244F;ENSP00000444095:L180F	ENSP00000265724:L244F	L	-	1	0	ABCB1	87028612	1.000000	0.71417	0.997000	0.53966	0.886000	0.51366	5.019000	0.64060	2.709000	0.92574	0.655000	0.94253	CTC		0.313	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
CASD1	64921	hgsc.bcm.edu	37	7	94166883	94166883	+	Silent	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:94166883C>T	ENST00000297273.4	+	9	1230	c.943C>T	c.(943-945)Cta>Tta	p.L315L		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	315						integral component of membrane (GO:0016021)		p.L315L(1)		NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CATACAGAAGCTAGCTGCTTG	0.368																																					p.L315L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C943T	7						.						114.0	120.0	118.0					7																	94166883		2203	4300	6503	94004819	SO:0001819	synonymous_variant	64921	exon9			AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.943C>T	7.37:g.94166883C>T		Somatic		Capture	SOLID	Phase_I	94004819	NM_022900	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Silent	SNP	ENST00000297273.4	37	CCDS5636.1																																																																																				0.368	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255216.1	NM_022900	
GIMAP7	168537	hgsc.bcm.edu	37	7	150217531	150217531	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr7:150217531G>A	ENST00000313543.4	+	2	626	c.469G>A	c.(469-471)Gtc>Atc	p.V157I		NM_153236.3	NP_694968.1	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	157	AIG1-type G.				GTP catabolic process (GO:0006184)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)	p.V157I(1)		breast(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AAAAAGCATCGTCAAGGAGTG	0.502																																					p.V157I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G469A	7						.						71.0	61.0	64.0					7																	150217531		2203	4300	6503	149848464	SO:0001583	missense	168537	exon2			BC027613	CCDS5903.1	7q36.1	2014-04-04			ENSG00000179144	ENSG00000179144		"""GTPases, IMAP"""	22404	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 7"""					15474311	Standard	NM_153236		Approved	MGC27027, IAN7	uc003whk.3	Q8NHV1	OTTHUMG00000157626	ENST00000313543.4:c.469G>A	7.37:g.150217531G>A	ENSP00000315474:p.Val157Ile	Somatic		Capture	SOLID	Phase_I	149848464	NM_153236		Missense_Mutation	SNP	ENST00000313543.4	37	CCDS5903.1	.	.	.	.	.	.	.	.	.	.	G	0.957	-0.704414	0.03255	.	.	ENSG00000179144	ENST00000313543	T	0.05786	3.39	5.09	-10.2	0.00374	AIG1 (1);	1.128570	0.06602	N	0.754086	T	0.01730	0.0055	N	0.03115	-0.41	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.39603	-0.9606	10	0.07644	T	0.81	.	4.5568	0.12140	0.185:0.321:0.3955:0.0985	.	157	Q8NHV1	GIMA7_HUMAN	I	157	ENSP00000315474:V157I	ENSP00000315474:V157I	V	+	1	0	GIMAP7	149848464	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.311000	0.08124	-2.028000	0.00931	-1.093000	0.02169	GTC		0.502	GIMAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349277.1	NM_153236	
AHCY	191	hgsc.bcm.edu	37	20	32883282	32883282	+	Silent	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr20:32883282C>T	ENST00000217426.2	-	2	215	c.138G>A	c.(136-138)aaG>aaA	p.K46K	AHCY_ENST00000538132.1_Silent_p.K18K|AHCY_ENST00000468908.1_5'UTR	NM_000687.2	NP_000678.1	P23526	SAHH_HUMAN	adenosylhomocysteinase	46					cellular nitrogen compound metabolic process (GO:0034641)|chronic inflammatory response to antigenic stimulus (GO:0002439)|circadian sleep/wake cycle (GO:0042745)|homocysteine biosynthetic process (GO:0071268)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|S-adenosylhomocysteine catabolic process (GO:0019510)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	adenosylhomocysteinase activity (GO:0004013)|adenyl nucleotide binding (GO:0030554)|NAD binding (GO:0051287)	p.K46K(1)		endometrium(6)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TGCGGGCGCCCTTCAGTGGCT	0.657																																					p.K46K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G138A	20						.						36.0	33.0	34.0					20																	32883282		2203	4300	6503	32346943	SO:0001819	synonymous_variant	191	exon2			M61832	CCDS13233.1, CCDS54457.1	20q11.22	2009-06-12	2009-06-12		ENSG00000101444	ENSG00000101444	3.3.1.1		343	protein-coding gene	gene with protein product		180960	"""S-adenosylhomocysteine hydrolase"""			7079734, 6580258	Standard	NM_001161766		Approved	SAHH	uc002xai.3	P23526	OTTHUMG00000140098	ENST00000217426.2:c.138G>A	20.37:g.32883282C>T		Somatic		Capture	SOLID	Phase_I	32346943	NM_000687	A8K307|B3KUN3|E1P5P2|F5H737|Q96A36	Silent	SNP	ENST00000217426.2	37	CCDS13233.1																																																																																				0.657	AHCY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078773.2	NM_000687	
FAM83C	128876	hgsc.bcm.edu	37	20	33879793	33879793	+	Silent	SNP	G	G	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr20:33879793G>C	ENST00000374408.3	-	1	411	c.315C>G	c.(313-315)ctC>ctG	p.L105L		NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	105								p.L105L(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			AGAGCAGGCTGAGGCGGTCTG	0.667																																					p.L105L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C315G	20						.						49.0	56.0	53.0					20																	33879793		2203	4300	6503	33343207	SO:0001819	synonymous_variant	128876	exon1			AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.315C>G	20.37:g.33879793G>C		Somatic		Capture	SOLID	Phase_I	33343207	NM_178468	Q14D67|Q5JWN6|Q8N276	Silent	SNP	ENST00000374408.3	37	CCDS13251.1																																																																																				0.667	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3		
SRC	6714	hgsc.bcm.edu	37	20	36022368	36022368	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr20:36022368G>A	ENST00000373578.2	+	6	770	c.421G>A	c.(421-423)Gcg>Acg	p.A141T	SRC_ENST00000358208.4_Missense_Mutation_p.A141T|SRC_ENST00000373558.2_Missense_Mutation_p.A147T|SRC_ENST00000373567.2_Missense_Mutation_p.A141T|SRC_ENST00000360723.4_Missense_Mutation_p.A147T|SRC_ENST00000445403.1_Missense_Mutation_p.A141T	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	141	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)	p.A141T(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	CAACTACGTGGCGCCCTCCGA	0.637																																					p.A141T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G421A	20						.						64.0	51.0	55.0					20																	36022368		2203	4300	6503	35455782	SO:0001583	missense	6714	exon6			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.421G>A	20.37:g.36022368G>A	ENSP00000362680:p.Ala141Thr	Somatic		Capture	SOLID	Phase_I	35455782	NM_005417	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	37	CCDS13294.1	.	.	.	.	.	.	.	.	.	.	G	35	5.425736	0.96131	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55	4.69	4.69	0.59074	Src homology-3 domain (3);SH2 motif (1);	0.000000	0.85682	D	0.000000	T	0.51432	0.1674	L	0.60957	1.885	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.53655	-0.8408	10	0.72032	D	0.01	.	15.1632	0.72801	0.0:0.0:1.0:0.0	.	141	P12931	SRC_HUMAN	T	141;141;147;141;141;147	ENSP00000408503:A141T;ENSP00000362680:A141T;ENSP00000353950:A147T;ENSP00000350941:A141T;ENSP00000362668:A141T;ENSP00000362659:A147T	ENSP00000350941:A141T	A	+	1	0	SRC	35455782	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.657000	0.98554	2.424000	0.82194	0.561000	0.74099	GCG		0.637	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417	
SMOX	54498	hgsc.bcm.edu	37	20	4168036	4168036	+	Silent	SNP	C	C	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr20:4168036C>G	ENST00000305958.4	+	7	1875	c.1650C>G	c.(1648-1650)ctC>ctG	p.L550L	SMOX_ENST00000346595.2_Silent_p.L185L|SMOX_ENST00000278795.3_Silent_p.L527L|SMOX_ENST00000379460.2_Silent_p.L550L|SMOX_ENST00000339123.6_Silent_p.L497L	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	550					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)	p.L550L(1)|p.L527L(1)		breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	ACCGAGACCTCTTCCAGCAGG	0.637																																					p.L185L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C555G	20						.						63.0	56.0	58.0					20																	4168036		2203	4300	6503	4116036	SO:0001819	synonymous_variant	54498	exon4			AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.1650C>G	20.37:g.4168036C>G		Somatic		Capture	SOLID	Phase_I	4116036	NM_175841	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Silent	SNP	ENST00000305958.4	37	CCDS13075.1																																																																																				0.637	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
SRC	6714	hgsc.bcm.edu	37	20	36022370	36022370	+	Silent	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr20:36022370G>T	ENST00000373578.2	+	6	772	c.423G>T	c.(421-423)gcG>gcT	p.A141A	SRC_ENST00000358208.4_Silent_p.A141A|SRC_ENST00000373558.2_Silent_p.A147A|SRC_ENST00000373567.2_Silent_p.A141A|SRC_ENST00000360723.4_Silent_p.A147A|SRC_ENST00000445403.1_Silent_p.A141A	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	141	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)	p.A141A(2)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	ACTACGTGGCGCCCTCCGACT	0.637																																					p.A141A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G423T	20						.						63.0	51.0	55.0					20																	36022370		2203	4300	6503	35455784	SO:0001819	synonymous_variant	6714	exon6			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.423G>T	20.37:g.36022370G>T		Somatic		Capture	SOLID	Phase_I	35455784	NM_005417	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Silent	SNP	ENST00000373578.2	37	CCDS13294.1																																																																																				0.637	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417	
PLCB4	5332	hgsc.bcm.edu	37	20	9371202	9371202	+	Silent	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr20:9371202C>T	ENST00000378493.1	+	14	1278	c.1263C>T	c.(1261-1263)tcC>tcT	p.S421S	PLCB4_ENST00000378473.3_Silent_p.S421S|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378501.2_Silent_p.S421S|PLCB4_ENST00000278655.4_Silent_p.S421S|PLCB4_ENST00000334005.3_Silent_p.S421S|PLCB4_ENST00000414679.2_Silent_p.S421S			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	421	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.S421S(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						ACAAGATGTCCAAATATTGCG	0.358																																					p.S421S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1263T	20						.						72.0	71.0	71.0					20																	9371202		2203	4299	6502	9319202	SO:0001819	synonymous_variant	5332	exon14				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.1263C>T	20.37:g.9371202C>T		Somatic		Capture	SOLID	Phase_I	9319202	NM_000933	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	37	CCDS13105.1																																																																																				0.358	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PTPN1	5770	hgsc.bcm.edu	37	20	49181556	49181556	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr20:49181556G>A	ENST00000371621.3	+	3	379	c.205G>A	c.(205-207)Gct>Act	p.A69T	Y_RNA_ENST00000364631.1_RNA|PTPN1_ENST00000541713.1_5'UTR	NM_001278618.1|NM_002827.2	NP_001265547.1|NP_002818.1	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type 1	69	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine dephosphorylation involved in inactivation of protein kinase activity (GO:1990264)|platelet activation (GO:0030168)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|regulation of endocytosis (GO:0030100)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of signal transduction (GO:0009966)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|sorting endosome (GO:0097443)	enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|zinc ion binding (GO:0008270)	p.A69T(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(2)	16		Lung NSC(126;0.163)			Tiludronate(DB01133)	CTATATCAACGCTAGTTTGAT	0.358																																					p.A69T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G205A	20						.						91.0	92.0	92.0					20																	49181556		2203	4300	6503	48614963	SO:0001583	missense	5770	exon3				CCDS13430.1, CCDS63309.1	20q13.1-q13.2	2011-06-09			ENSG00000196396	ENSG00000196396		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9642	protein-coding gene	gene with protein product		176885		PTP1B		2164224	Standard	NM_002827		Approved		uc002xvl.3	P18031	OTTHUMG00000032729	ENST00000371621.3:c.205G>A	20.37:g.49181556G>A	ENSP00000360683:p.Ala69Thr	Somatic		Capture	SOLID	Phase_I	48614963	NM_002827	Q5TGD8|Q9BQV9|Q9NQQ4	Missense_Mutation	SNP	ENST00000371621.3	37	CCDS13430.1	.	.	.	.	.	.	.	.	.	.	G	34	5.293578	0.95546	.	.	ENSG00000196396	ENST00000371621	D	0.91843	-2.92	5.13	5.13	0.70059	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.000000	0.64402	D	0.000003	D	0.98295	0.9435	H	0.99887	4.895	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.99727	1.1011	10	0.87932	D	0	.	17.7196	0.88347	0.0:0.0:1.0:0.0	.	69	P18031	PTN1_HUMAN	T	69	ENSP00000360683:A69T	ENSP00000360683:A69T	A	+	1	0	PTPN1	48614963	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.011000	0.93618	2.551000	0.86045	0.655000	0.94253	GCT		0.358	PTPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079694.2		
CDC42BPB	9578	hgsc.bcm.edu	37	14	103410401	103410401	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr14:103410401T>C	ENST00000361246.2	-	30	4523	c.4235A>G	c.(4234-4236)aAt>aGt	p.N1412S		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		CGAGGGGTCATTGGGATTTAC	0.577																																					p.N1412S												.	.	0			c.A4235G	14						.						124.0	112.0	116.0					14																	103410401		2203	4299	6502	102480154	SO:0001583	missense	9578	exon30			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.4235A>G	14.37:g.103410401T>C	ENSP00000355237:p.Asn1412Ser	None		Capture	SOLID	Phase_I	102480154	NM_006035		Missense_Mutation	SNP	ENST00000361246.2	37	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	T	12.29	1.893050	0.33442	.	.	ENSG00000198752	ENST00000361246;ENST00000541396	T	0.04551	3.6	5.67	-6.37	0.01963	Citron-like (3);	0.929991	0.09375	N	0.810772	T	0.03053	0.0090	N	0.25380	0.74	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.10450	0.002;0.005	T	0.45234	-0.9275	10	0.22109	T	0.4	.	8.6334	0.33933	0.0:0.3707:0.3096:0.3197	.	1412;1412	A9JR72;Q9Y5S2	.;MRCKB_HUMAN	S	1412;523	ENSP00000355237:N1412S	ENSP00000355237:N1412S	N	-	2	0	CDC42BPB	102480154	0.512000	0.26186	0.002000	0.10522	0.998000	0.95712	0.316000	0.19469	-1.357000	0.02180	0.533000	0.62120	AAT		0.577	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035	
ARHGAP5	394	hgsc.bcm.edu	37	14	32561639	32561639	+	Silent	SNP	C	C	T	rs539449668		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr14:32561639C>T	ENST00000345122.3	+	2	2079	c.1764C>T	c.(1762-1764)caC>caT	p.H588H	ARHGAP5_ENST00000539826.2_Silent_p.H588H|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000556611.1_Silent_p.H588H|ARHGAP5_ENST00000432921.1_Silent_p.H588H|ARHGAP5_ENST00000433497.1_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	588					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.H588H(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GATTATATCACGATAGTACCA	0.373													c|||	1	0.000199681	0.0	0.0014	5008	,	,		19543	0.0		0.0	False		,,,				2504	0.0				p.H588H	NSCLC(9;77 350 3443 29227 41353)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1764T	14						.						70.0	69.0	70.0					14																	32561639		2203	4298	6501	31631390	SO:0001819	synonymous_variant	394	exon2			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1764C>T	14.37:g.32561639C>T		Somatic		Capture	SOLID	Phase_I	31631390	NM_001030055	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Silent	SNP	ENST00000345122.3	37	CCDS32062.1																																																																																				0.373	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
SSTR1	6751	hgsc.bcm.edu	37	14	38679625	38679625	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr14:38679625A>G	ENST00000267377.2	+	3	1648	c.1031A>G	c.(1030-1032)gAc>gGc	p.D344G		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	344					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.D344G(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	AGCTGGATGGACAACGCCGCG	0.587																																					p.D344G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1031G	14						.						102.0	99.0	100.0					14																	38679625		2203	4300	6503	37749376	SO:0001583	missense	6751	exon3				CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.1031A>G	14.37:g.38679625A>G	ENSP00000267377:p.Asp344Gly	Somatic		Capture	SOLID	Phase_I	37749376	NM_001049		Missense_Mutation	SNP	ENST00000267377.2	37	CCDS9666.1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.825522	0.32237	.	.	ENSG00000139874	ENST00000267377	T	0.70516	-0.49	4.82	4.82	0.62117	.	1.186530	0.06469	N	0.730831	T	0.47060	0.1425	N	0.01874	-0.695	0.58432	D	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.09930	-1.0652	10	0.10902	T	0.67	.	13.7174	0.62705	1.0:0.0:0.0:0.0	.	344	P30872	SSR1_HUMAN	G	344	ENSP00000267377:D344G	ENSP00000267377:D344G	D	+	2	0	SSTR1	37749376	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.253000	0.78320	2.034000	0.60081	0.459000	0.35465	GAC		0.587	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2		
SLC8A3	6547	hgsc.bcm.edu	37	14	70634936	70634936	+	Silent	SNP	A	A	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr14:70634936A>T	ENST00000381269.2	-	2	957	c.204T>A	c.(202-204)ccT>ccA	p.P68P	SLC8A3_ENST00000357887.3_Silent_p.P68P|SLC8A3_ENST00000356921.2_Silent_p.P68P|SLC8A3_ENST00000534137.1_Silent_p.P68P|SLC8A3_ENST00000528359.1_Silent_p.P68P	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	68					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)	p.P68P(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		CCCCAAGGGAAGGGTTCTCCG	0.537																																					p.P68P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T204A	14						.						73.0	63.0	67.0					14																	70634936		2203	4300	6503	69704689	SO:0001819	synonymous_variant	6547	exon2			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.204T>A	14.37:g.70634936A>T		Somatic		Capture	SOLID	Phase_I	69704689	NM_033262	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	CCDS35498.1																																																																																				0.537	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
ISM2	145501	hgsc.bcm.edu	37	14	77950768	77950768	+	Silent	SNP	G	G	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr14:77950768G>C	ENST00000342219.4	-	3	581	c.525C>G	c.(523-525)gcC>gcG	p.A175A	ISM2_ENST00000393684.3_Silent_p.A87A|ISM2_ENST00000412904.1_Intron|ISM2_ENST00000429906.1_Silent_p.A94A|ISM2_ENST00000493585.1_Silent_p.A175A	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	175						extracellular region (GO:0005576)		p.A175A(1)		endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						TGGGAGGCGTGGCATTCCCTG	0.597																																					p.A175A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C525G	14						.						115.0	104.0	108.0					14																	77950768		2203	4300	6503	77020521	SO:0001819	synonymous_variant	145501	exon3			AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.525C>G	14.37:g.77950768G>C		Somatic		Capture	SOLID	Phase_I	77020521	NM_182509	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Silent	SNP	ENST00000342219.4	37	CCDS9864.1																																																																																				0.597	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351309.1	NM_182509	
CDC42BPB	9578	hgsc.bcm.edu	37	14	103442091	103442091	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr14:103442091G>C	ENST00000361246.2	-	11	1725	c.1437C>G	c.(1435-1437)agC>agG	p.S479R		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		GGTTTGAATTGCTGAGGGCCC	0.507																																					p.S479R												.	.	0			c.C1437G	14						.						141.0	149.0	147.0					14																	103442091		2203	4300	6503	102511844	SO:0001583	missense	9578	exon11			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.1437C>G	14.37:g.103442091G>C	ENSP00000355237:p.Ser479Arg	None		Capture	SOLID	Phase_I	102511844	NM_006035		Missense_Mutation	SNP	ENST00000361246.2	37	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	G	9.624	1.134680	0.21123	.	.	ENSG00000198752	ENST00000361246	T	0.64085	-0.08	5.34	0.967	0.19674	.	0.146599	0.64402	D	0.000008	T	0.32645	0.0836	N	0.08118	0	0.24101	N	0.995877	B	0.06786	0.001	B	0.20955	0.032	T	0.13098	-1.0522	10	0.16420	T	0.52	.	4.1579	0.10270	0.0879:0.0897:0.3627:0.4597	.	479	Q9Y5S2	MRCKB_HUMAN	R	479	ENSP00000355237:S479R	ENSP00000355237:S479R	S	-	3	2	CDC42BPB	102511844	0.965000	0.33210	0.044000	0.18714	0.892000	0.51952	2.285000	0.43487	-0.018000	0.14079	0.650000	0.86243	AGC		0.507	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035	
SEZ6L	23544	hgsc.bcm.edu	37	22	26747069	26747069	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr22:26747069C>T	ENST00000248933.6	+	12	2554	c.2459C>T	c.(2458-2460)tCg>tTg	p.S820L	SEZ6L_ENST00000529632.2_Missense_Mutation_p.S820L|SEZ6L_ENST00000402979.1_Missense_Mutation_p.S593L|SEZ6L_ENST00000343706.4_Missense_Mutation_p.S820L|SEZ6L_ENST00000403121.1_Missense_Mutation_p.S593L|SEZ6L_ENST00000360929.3_Intron|SEZ6L_ENST00000404234.3_Missense_Mutation_p.S820L|SEZ6L_ENST00000411842.2_Missense_Mutation_p.S17L			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	820	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.S820L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CGCTTAATTTCGGATCCTGTG	0.547																																					p.S820L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2459T	22						.						117.0	102.0	107.0					22																	26747069		2203	4300	6503	25077069	SO:0001583	missense	23544	exon12			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2459C>T	22.37:g.26747069C>T	ENSP00000248933:p.Ser820Leu	Somatic		Capture	SOLID	Phase_I	25077069	NM_001184775	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	c	32	5.110140	0.94292	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979;ENST00000411842	T;T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12	4.54	4.54	0.55810	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.47852	D	0.000205	T	0.79604	0.4474	M	0.86268	2.805	0.80722	D	1	D;D;P;P;D;D	0.71674	0.997;0.998;0.862;0.865;0.996;0.998	P;D;P;B;P;D	0.65573	0.904;0.936;0.686;0.368;0.907;0.936	T	0.80999	-0.1131	10	0.39692	T	0.17	.	16.5016	0.84259	0.0:1.0:0.0:0.0	.	820;820;593;820;820;820	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	L	820;820;820;820;593;593;17	ENSP00000384772:S820L;ENSP00000437037:S820L;ENSP00000248933:S820L;ENSP00000342661:S820L;ENSP00000384838:S593L;ENSP00000384733:S593L;ENSP00000397274:S17L	ENSP00000248933:S820L	S	+	2	0	SEZ6L	25077069	1.000000	0.71417	0.689000	0.30133	0.899000	0.52679	6.976000	0.76135	2.381000	0.81170	0.539000	0.68188	TCG		0.547	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
MYH9	4627	hgsc.bcm.edu	37	22	36722665	36722665	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr22:36722665A>G	ENST00000216181.5	-	5	790	c.560T>C	c.(559-561)gTc>gCc	p.V187A	MYH9_ENST00000401701.1_Missense_Mutation_p.V187A	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	187	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						ATACTGGATGACCTTCTTGGT	0.587			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.V187A			Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	.	0			c.T560C	22						.						238.0	188.0	205.0					22																	36722665		2203	4300	6503	35052611	SO:0001583	missense	4627	exon5	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.560T>C	22.37:g.36722665A>G	ENSP00000216181:p.Val187Ala	None		Capture	SOLID	Phase_I	35052611	NM_002473	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.649152	0.87958	.	.	ENSG00000100345	ENST00000337818;ENST00000216181;ENST00000401701	D;D	0.89939	-2.59;-2.59	4.81	4.81	0.61882	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.93265	0.7854	M	0.78801	2.425	0.58432	D	0.999998	P;P	0.52170	0.951;0.569	P;B	0.60117	0.869;0.355	D	0.94149	0.7404	10	0.87932	D	0	.	14.4002	0.67037	1.0:0.0:0.0:0.0	.	187;187	Q5BKV1;P35579	.;MYH9_HUMAN	A	51;187;187	ENSP00000216181:V187A;ENSP00000384631:V187A	ENSP00000216181:V187A	V	-	2	0	MYH9	35052611	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.249000	0.95470	1.797000	0.52628	0.454000	0.30748	GTC		0.587	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
MKL1	57591	hgsc.bcm.edu	37	22	40813048	40813048	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr22:40813048T>G	ENST00000355630.3	-	14	2810	c.2220A>C	c.(2218-2220)gaA>gaC	p.E740D	MKL1_ENST00000396617.3_Missense_Mutation_p.E740D|MKL1_ENST00000407029.1_Missense_Mutation_p.E740D|RP5-1042K10.13_ENST00000609279.1_RNA|MKL1_ENST00000402042.1_Missense_Mutation_p.E690D	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	740	Pro-rich.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						AGGAACCATTTTCCTGTGGGA	0.522			T	RBM15	acute megakaryocytic leukemia																																p.E740D			Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	.	0			c.A2220C	22						.						49.0	44.0	46.0					22																	40813048		2202	4298	6500	39142994	SO:0001583	missense	57591	exon14			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.2220A>C	22.37:g.40813048T>G	ENSP00000347847:p.Glu740Asp	None		Capture	SOLID	Phase_I	39142994	NM_020831	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.527895	0.44969	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.51071	0.8;0.72;0.8;0.8	4.23	-5.37	0.02681	.	0.131649	0.49305	D	0.000146	T	0.43765	0.1262	N	0.14661	0.345	0.31388	N	0.678158	B;D;D	0.64830	0.053;0.994;0.994	B;D;D	0.70716	0.016;0.97;0.97	T	0.51068	-0.8752	10	0.20519	T	0.43	-16.6434	17.1311	0.86726	0.0:0.7648:0.0:0.2352	.	690;740;740	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	D	740;740;690;740	ENSP00000347847:E740D;ENSP00000379861:E740D;ENSP00000385584:E690D;ENSP00000385835:E740D	ENSP00000347847:E740D	E	-	3	2	MKL1	39142994	0.987000	0.35691	0.923000	0.36655	0.580000	0.36256	0.118000	0.15605	-1.245000	0.02513	-0.371000	0.07208	GAA		0.522	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
KIAA0930	23313	hgsc.bcm.edu	37	22	45593828	45593828	+	Splice_Site	SNP	G	G	A	rs370540971		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr22:45593828G>A	ENST00000336156.5	-	9	1082	c.1017C>T	c.(1015-1017)gcC>gcT	p.A339A	KIAA0930_ENST00000391627.2_Splice_Site_p.A305A|KIAA0930_ENST00000474515.1_5'UTR|KIAA0930_ENST00000251993.7_Splice_Site_p.A344A|KIAA0930_ENST00000443310.3_Splice_Site_p.A321A	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	339								p.A344A(1)		endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						TGTGCAGATCGGCTGGAGGAA	0.637																																					p.A344A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1032T	22						.	G	,	1,4405	2.1+/-5.4	0,1,2202	109.0	104.0	106.0		1017,1032	-8.5	0.4	22		106	0,8600		0,0,4300	no	coding-synonymous-near-splice,coding-synonymous-near-splice	KIAA0930	NM_001009880.1,NM_015264.1	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	339/405,344/410	45593828	1,13005	2203	4300	6503	43972492	SO:0001630	splice_region_variant	23313	exon9			AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.1016-1C>T	22.37:g.45593828G>A		Somatic		Capture	SOLID	Phase_I	43972492	NM_015264	B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Silent	SNP	ENST00000336156.5	37	CCDS33665.1																																																																																				0.637	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321975.2	NM_001009880	Silent
TRMU	55687	hgsc.bcm.edu	37	22	46746206	46746206	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr22:46746206C>G	ENST00000290846.4	+	5	837	c.497C>G	c.(496-498)gCa>gGa	p.A166G	TRMU_ENST00000424260.2_Intron|TRMU_ENST00000381019.3_Missense_Mutation_p.A166G	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	166					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)	p.A166G(1)		NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		CTCCTCCAGGCAGCTGACAGC	0.438																																					p.A166G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C497G	22						.						92.0	102.0	99.0					22																	46746206		2203	4300	6503	45124870	SO:0001583	missense	55687	exon5			AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.497C>G	22.37:g.46746206C>G	ENSP00000290846:p.Ala166Gly	Somatic		Capture	SOLID	Phase_I	45124870	NM_018006	A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Missense_Mutation	SNP	ENST00000290846.4	37	CCDS14075.1	.	.	.	.	.	.	.	.	.	.	C	2.738	-0.262850	0.05754	.	.	ENSG00000100416	ENST00000290846;ENST00000381019	T;T	0.72725	-0.68;-0.68	4.92	3.86	0.44501	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.172638	0.50627	D	0.000109	T	0.44307	0.1287	N	0.03238	-0.38	0.80722	D	1	B;B;B	0.12630	0.005;0.002;0.006	B;B;B	0.20184	0.014;0.006;0.028	T	0.46884	-0.9159	10	0.02654	T	1	-13.7762	15.505	0.75731	0.0:0.8015:0.1984:0.0	.	166;166;166	B4DHM1;O75648-2;O75648	.;.;MTU1_HUMAN	G	166	ENSP00000290846:A166G;ENSP00000370407:A166G	ENSP00000290846:A166G	A	+	2	0	TRMU	45124870	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.783000	0.47766	2.279000	0.76181	0.591000	0.81541	GCA		0.438	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318042.2	NM_018006	
ILF3	3609	hgsc.bcm.edu	37	19	10782186	10782186	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr19:10782186C>T	ENST00000590261.1	+	3	386	c.386C>T	c.(385-387)gCc>gTc	p.A129V	ILF3_ENST00000250241.8_Missense_Mutation_p.A129V|ILF3_ENST00000318511.3_Missense_Mutation_p.A129V|ILF3_ENST00000420083.1_Missense_Mutation_p.A129V|ILF3_ENST00000592763.1_Missense_Mutation_p.A129V|ILF3_ENST00000449870.1_Missense_Mutation_p.A129V|ILF3_ENST00000407004.3_Missense_Mutation_p.A129V|ILF3_ENST00000589998.1_Missense_Mutation_p.A129V|ILF3_ENST00000588657.1_Missense_Mutation_p.A129V			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa	129	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			GACAAGGTGGCCGACAACCTG	0.632																																					p.A129V												.	.	0			c.C386T	19						.						51.0	46.0	48.0					19																	10782186		2202	4300	6502	10643186	SO:0001583	missense	3609	exon4			U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.386C>T	19.37:g.10782186C>T	ENSP00000468156:p.Ala129Val	None		Capture	SOLID	Phase_I	10643186	NM_012218	A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Missense_Mutation	SNP	ENST00000590261.1	37	CCDS12246.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.959170	0.92726	.	.	ENSG00000129351	ENST00000336059;ENST00000449870;ENST00000318511;ENST00000420083;ENST00000407004;ENST00000250241	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	5.06	5.06	0.68205	DZF (2);	0.128143	0.52532	D	0.000062	T	0.62986	0.2473	L	0.37561	1.115	0.58432	D	0.999996	D;D;B;D;P	0.64830	0.993;0.994;0.365;0.972;0.925	D;D;B;P;P	0.66716	0.91;0.946;0.3;0.797;0.691	T	0.60362	-0.7278	10	0.41790	T	0.15	.	17.7181	0.88343	0.0:1.0:0.0:0.0	.	129;129;129;129;129	G5E9M5;Q12906;Q12906-6;Q12906-2;Q12906-5	.;ILF3_HUMAN;.;.;.	V	129	ENSP00000404121:A129V;ENSP00000315205:A129V;ENSP00000405436:A129V;ENSP00000384660:A129V;ENSP00000250241:A129V	ENSP00000250241:A129V	A	+	2	0	ILF3	10643186	1.000000	0.71417	0.970000	0.41538	0.928000	0.56348	4.665000	0.61547	2.790000	0.95986	0.655000	0.94253	GCC		0.632	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452074.1		
GNA11	2767	hgsc.bcm.edu	37	19	3121039	3121039	+	Silent	SNP	G	G	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr19:3121039G>C	ENST00000078429.4	+	7	1184	c.942G>C	c.(940-942)gtG>gtC	p.V314V	GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA|AC005262.2_ENST00000585980.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	314					action potential (GO:0001508)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cellular response to pH (GO:0071467)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|regulation of melanocyte differentiation (GO:0045634)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.V314V(1)		endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		AGATGTTCGTGGACCTGAACC	0.652			Mis		uveal melanoma																																p.V314V			Dom	yes		19	19p13.3	2767	"""guanine nucleotide binding protein (G protein), alpha 11 (Gq class)"""		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G942C	19						.						106.0	76.0	86.0					19																	3121039		2202	4300	6502	3072039	SO:0001819	synonymous_variant	2767	exon7			AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256			4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2		1302014, 23802516	Standard	NM_002067		Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.942G>C	19.37:g.3121039G>C		Somatic		Capture	SOLID	Phase_I	3072039	NM_002067	O15109|Q14350|Q6IB00	Silent	SNP	ENST00000078429.4	37	CCDS12103.1																																																																																				0.652	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2	NM_002067	
GNA15	2769	hgsc.bcm.edu	37	19	3148635	3148635	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr19:3148635C>G	ENST00000262958.3	+	2	450	c.192C>G	c.(190-192)atC>atG	p.I64M	AC005264.2_ENST00000587587.1_RNA	NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	64					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		AGATGCGGATCATCCACGGCG	0.657																																					p.I64M												.	.	0			c.C192G	19						.						33.0	25.0	28.0					19																	3148635		2199	4296	6495	3099635	SO:0001583	missense	2769	exon2				CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.192C>G	19.37:g.3148635C>G	ENSP00000262958:p.Ile64Met	None		Capture	SOLID	Phase_I	3099635	NM_002068	E9KL40|E9KL47|O75247|Q53XK2	Missense_Mutation	SNP	ENST00000262958.3	37	CCDS12104.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414359	0.42817	.	.	ENSG00000060558	ENST00000262958	D	0.89552	-2.53	5.02	2.82	0.32997	G protein alpha subunit, helical insertion (1);	0.000000	0.85682	D	0.000000	D	0.93973	0.8070	M	0.86502	2.82	0.44092	D	0.996854	D	0.71674	0.998	D	0.76575	0.988	D	0.93835	0.7131	10	0.87932	D	0	.	10.171	0.42911	0.0:0.8265:0.0:0.1735	.	64	P30679	GNA15_HUMAN	M	64	ENSP00000262958:I64M	ENSP00000262958:I64M	I	+	3	3	GNA15	3099635	0.996000	0.38824	1.000000	0.80357	0.198000	0.23893	0.518000	0.22847	1.100000	0.41517	0.462000	0.41574	ATC		0.657	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452320.2	NM_002068	
DHPS	1725	hgsc.bcm.edu	37	19	12790981	12790981	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr19:12790981G>T	ENST00000210060.7	-	2	501	c.366C>A	c.(364-366)caC>caA	p.H122Q	DHPS_ENST00000351660.5_Missense_Mutation_p.H122Q|DHPS_ENST00000599481.1_Intron|CTD-2192J16.26_ENST00000593554.1_lincRNA|DHPS_ENST00000594424.1_Missense_Mutation_p.H80Q	NM_001930.3	NP_001921.1	P49366	DHYS_HUMAN	deoxyhypusine synthase	122					cellular protein metabolic process (GO:0044267)|deoxyhypusine biosynthetic process from spermidine (GO:0050983)|glucose homeostasis (GO:0042593)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell proliferation (GO:0042102)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|translation (GO:0006412)	cytosol (GO:0005829)	deoxyhypusine synthase activity (GO:0034038)	p.H122Q(1)		central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)	8						CCACCATGTTGTGCTGCACAA	0.542																																					p.H122Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C366A	19						.						329.0	318.0	322.0					19																	12790981		2203	4300	6503	12651981	SO:0001583	missense	1725	exon2			U79262	CCDS12276.1, CCDS12277.1, CCDS59354.1	19p13.2	2011-11-24			ENSG00000095059	ENSG00000095059			2869	protein-coding gene	gene with protein product	"""migration-inducing gene 13"""	600944				7673224	Standard	NM_001930		Approved	MIG13	uc002muh.2	P49366		ENST00000210060.7:c.366C>A	19.37:g.12790981G>T	ENSP00000210060:p.His122Gln	Somatic		Capture	SOLID	Phase_I	12651981	NM_001930	A8K688|M0R1I5|Q13184|Q13276|Q9UDG0	Missense_Mutation	SNP	ENST00000210060.7	37	CCDS12276.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093266	0.76756	.	.	ENSG00000095059	ENST00000210060;ENST00000351660	T;T	0.45668	0.89;0.89	5.2	3.09	0.35607	.	0.000000	0.85682	D	0.000000	T	0.68183	0.2973	M	0.92122	3.275	0.58432	D	0.999997	D;P;D	0.76494	0.999;0.565;0.968	D;P;P	0.74023	0.982;0.688;0.814	T	0.71842	-0.4470	10	0.87932	D	0	-34.3454	9.532	0.39200	0.1733:0.0:0.8267:0.0	.	122;122;122	Q5J8M5;P49366-2;P49366	.;.;DHYS_HUMAN	Q	122	ENSP00000210060:H122Q;ENSP00000221303:H122Q	ENSP00000210060:H122Q	H	-	3	2	DHPS	12651981	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.513000	0.53414	0.597000	0.29811	0.561000	0.74099	CAC		0.542	DHPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462708.1	NM_001930	
ZNF536	9745	hgsc.bcm.edu	37	19	30936159	30936159	+	Missense_Mutation	SNP	C	C	T	rs372107821		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr19:30936159C>T	ENST00000355537.3	+	2	1837	c.1690C>T	c.(1690-1692)Cgg>Tgg	p.R564W		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	564					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.R564W(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TAAGGAGAAGCGGGAGTACGT	0.522																																					p.R564W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1690T	19						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	82.0	89.0	86.0		1690	5.5	1.0	19		86	0,8600		0,0,4300	no	missense	ZNF536	NM_014717.1	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	564/1301	30936159	1,13005	2203	4300	6503	35627999	SO:0001583	missense	9745	exon2				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1690C>T	19.37:g.30936159C>T	ENSP00000347730:p.Arg564Trp	Somatic		Capture	SOLID	Phase_I	35627999	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.100047	0.56183	2.27E-4	0.0	ENSG00000198597	ENST00000355537	T	0.46819	0.86	5.53	5.53	0.82687	.	0.125035	0.56097	D	0.000021	T	0.59321	0.2185	L	0.50333	1.59	0.44762	D	0.997766	D;D	0.89917	1.0;1.0	P;P	0.60415	0.874;0.874	T	0.61317	-0.7087	10	0.72032	D	0.01	-32.3428	14.3162	0.66452	0.1484:0.8516:0.0:0.0	.	564;564	A7E228;O15090	.;ZN536_HUMAN	W	564	ENSP00000347730:R564W	ENSP00000347730:R564W	R	+	1	2	ZNF536	35627999	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.592000	0.67543	2.582000	0.87167	0.655000	0.94253	CGG		0.522	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF649	65251	hgsc.bcm.edu	37	19	52394717	52394717	+	Silent	SNP	G	G	A	rs143659118	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr19:52394717G>A	ENST00000354957.3	-	5	956	c.672C>T	c.(670-672)caC>caT	p.H224H	CTC-429C10.2_ENST00000600329.1_RNA|ZNF649_ENST00000600738.1_Intron	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H224H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		GAGCTCTCTCGTGTTCAGTGA	0.498													g|||	3	0.000599042	0.0015	0.0	5008	,	,		20073	0.001		0.0	False		,,,				2504	0.0				p.H224H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C672T	19						.	G		0,4406		0,0,2203	116.0	112.0	114.0		672	-1.5	0.0	19	dbSNP_134	114	10,8590	7.7+/-29.5	0,10,4290	no	coding-synonymous	ZNF649	NM_023074.3		0,10,6493	AA,AG,GG		0.1163,0.0,0.0769		224/506	52394717	10,12996	2203	4300	6503	57086529	SO:0001819	synonymous_variant	65251	exon5			BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.672C>T	19.37:g.52394717G>A		Somatic		Capture	SOLID	Phase_I	57086529	NM_023074	A8MYJ5|B2RDC4|Q9H9N2	Silent	SNP	ENST00000354957.3	37	CCDS12843.1																																																																																				0.498	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074	
GTF2F1	2962	hgsc.bcm.edu	37	19	6383405	6383405	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr19:6383405C>A	ENST00000394456.5	-	6	1063	c.599G>T	c.(598-600)aGg>aTg	p.R200M	GTF2F1_ENST00000429701.2_Missense_Mutation_p.R115M	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	200					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						GCTCGCCTTCCTGCGGCCACG	0.617																																					p.R200M												.	.	0			c.G599T	19						.						173.0	106.0	129.0					19																	6383405		2203	4300	6503	6334405	SO:0001583	missense	2962	exon6				CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.599G>T	19.37:g.6383405C>A	ENSP00000377969:p.Arg200Met	None		Capture	SOLID	Phase_I	6334405	NM_002096	B2RCS0|Q9BWN0	Missense_Mutation	SNP	ENST00000394456.5	37	CCDS12165.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151556	0.38021	.	.	ENSG00000125651	ENST00000394456;ENST00000429701;ENST00000542045;ENST00000543921	T;T	0.45276	0.9;0.9	4.62	2.54	0.30619	.	0.513470	0.22309	N	0.061758	T	0.25531	0.0621	N	0.08118	0	0.30837	N	0.736065	B;B;B	0.33826	0.427;0.427;0.427	B;B;B	0.40565	0.205;0.333;0.333	T	0.21690	-1.0238	10	0.49607	T	0.09	-32.568	7.6683	0.28445	0.0:0.185:0.0:0.815	.	115;101;200	E7EUG6;B4DDB5;P35269	.;.;T2FA_HUMAN	M	200;115;260;116	ENSP00000377969:R200M;ENSP00000392107:R115M	ENSP00000377969:R200M	R	-	2	0	GTF2F1	6334405	0.816000	0.29132	0.764000	0.31436	0.229000	0.25112	0.608000	0.24223	0.304000	0.22809	-0.302000	0.09304	AGG		0.617	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398033.1	NM_002096	
ZNF613	79898	hgsc.bcm.edu	37	19	52447856	52447856	+	Silent	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr19:52447856C>T	ENST00000293471.6	+	6	1399	c.720C>T	c.(718-720)gcC>gcT	p.A240A	ZNF613_ENST00000391794.4_Silent_p.A204A	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	240					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A240A(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		GTGGGAAAGCCTTCTCCAGAA	0.488																																					p.A204A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C612T	19						.						98.0	102.0	101.0					19																	52447856		2203	4300	6503	57139668	SO:0001819	synonymous_variant	79898	exon6			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.720C>T	19.37:g.52447856C>T		Somatic		Capture	SOLID	Phase_I	57139668	NM_024840	Q96SS9	Silent	SNP	ENST00000293471.6	37	CCDS33089.1																																																																																				0.488	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461104.2	NM_024840	
TNFRSF11B	4982	hgsc.bcm.edu	37	8	119936994	119936994	+	Silent	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr8:119936994G>A	ENST00000297350.4	-	5	1203	c.825C>T	c.(823-825)gaC>gaT	p.D275D		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	275	Death 2.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)	p.D275D(1)		breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			TTTCACAGAGGTCAATATCTG	0.448																																					p.D275D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C825T	8						.						68.0	60.0	63.0					8																	119936994		2203	4300	6503	120006175	SO:0001819	synonymous_variant	4982	exon5			U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.825C>T	8.37:g.119936994G>A		Somatic		Capture	SOLID	Phase_I	120006175	NM_002546	B2R9A8|O60236|Q53FX6|Q9UHP4	Silent	SNP	ENST00000297350.4	37	CCDS6326.1																																																																																				0.448	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381220.1		
MOS	4342	hgsc.bcm.edu	37	8	57026150	57026150	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr8:57026150G>C	ENST00000311923.1	-	1	391	c.392C>G	c.(391-393)tCc>tGc	p.S131C		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	131	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			TAGGCTATTGGACCCTGCGGG	0.632																																					p.S131C	Esophageal Squamous(124;373 2870 4778)											.	.	0			c.C392G	8						.						86.0	83.0	84.0					8																	57026150		2203	4300	6503	57188704	SO:0001583	missense	4342	exon1				CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.392C>G	8.37:g.57026150G>C	ENSP00000310722:p.Ser131Cys	None		Capture	SOLID	Phase_I	57188704	NM_005372	Q3KPG9|Q3KPH0	Missense_Mutation	SNP	ENST00000311923.1	37	CCDS6164.1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580323	0.28180	.	.	ENSG00000172680	ENST00000311923	D	0.93811	-3.29	5.5	2.09	0.27110	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.175790	0.06056	N	0.657495	D	0.94627	0.8268	L	0.58925	1.835	0.09310	N	1	D	0.56035	0.974	P	0.61874	0.895	T	0.83299	-0.0029	10	0.72032	D	0.01	.	4.4777	0.11752	0.2596:0.0:0.4677:0.2727	.	131	P00540	MOS_HUMAN	C	131	ENSP00000310722:S131C	ENSP00000310722:S131C	S	-	2	0	MOS	57188704	0.000000	0.05858	0.001000	0.08648	0.326000	0.28443	0.469000	0.22067	0.547000	0.28938	0.557000	0.71058	TCC		0.632	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378174.1	NM_005372	
TRMT12	55039	hgsc.bcm.edu	37	8	125463608	125463608	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr8:125463608G>A	ENST00000328599.3	+	1	561	c.440G>A	c.(439-441)tGt>tAt	p.C147Y	TRMT12_ENST00000521443.1_Intron	NM_017956.3	NP_060426.2	Q53H54	TYW2_HUMAN	tRNA methyltransferase 12 homolog (S. cerevisiae)	147					tRNA processing (GO:0008033)		transferase activity (GO:0016740)	p.C147Y(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			AGTGAAGACTGTTTCCAAGCC	0.562																																					p.C147Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G440A	8						.						77.0	78.0	78.0					8																	125463608		2203	4300	6503	125532789	SO:0001583	missense	55039	exon1			AF313041	CCDS6349.1	8q24.13	2011-05-09	2006-11-16		ENSG00000183665	ENSG00000183665			26091	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 2"""	611244	"""tRNA methyltranferase 12 homolog (S. cerevisiae)"""			16005430, 17150819	Standard	NM_017956		Approved	FLJ20772, Trm12, TYW2	uc003yra.4	Q53H54	OTTHUMG00000165022	ENST00000328599.3:c.440G>A	8.37:g.125463608G>A	ENSP00000329858:p.Cys147Tyr	Somatic		Capture	SOLID	Phase_I	125532789	NM_017956	Q6PKB9|Q96F21|Q9NWK6	Missense_Mutation	SNP	ENST00000328599.3	37	CCDS6349.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765626	0.69878	.	.	ENSG00000183665	ENST00000328599	T	0.21191	2.02	4.55	4.55	0.56014	.	0.093026	0.85682	D	0.000000	T	0.38134	0.1029	L	0.59436	1.845	0.51767	D	0.999935	D	0.61697	0.99	D	0.63381	0.914	T	0.03898	-1.0994	10	0.23302	T	0.38	-12.8598	15.6246	0.76845	0.0:0.0:1.0:0.0	.	147	Q53H54	TYW2_HUMAN	Y	147	ENSP00000329858:C147Y	ENSP00000329858:C147Y	C	+	2	0	TRMT12	125532789	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.742000	0.68646	2.459000	0.83118	0.561000	0.74099	TGT		0.562	TRMT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381465.1	NM_017956	
MTOR	2475	hgsc.bcm.edu	37	1	11184573	11184573	+	Missense_Mutation	SNP	G	G	T	rs587777894		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:11184573G>T	ENST00000361445.4	-	47	6720	c.6644C>A	c.(6643-6645)tCt>tAt	p.S2215Y	MTOR_ENST00000376838.1_Missense_Mutation_p.S420Y	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2215	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		S -> Y (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.S2215Y(4)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TTTCCGAAGAGATGTTGGGTC	0.438																																					p.S2215Y												FRAP1,large_intestine,NS,Substitution - Missense,0	.	4	Substitution - Missense(4)	large_intestine(2)|kidney(1)|endometrium(1)	c.C6644A	1						.						101.0	98.0	99.0					1																	11184573		2203	4300	6503	11107160	SO:0001583	missense	2475	exon47			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6644C>A	1.37:g.11184573G>T	ENSP00000354558:p.Ser2215Tyr	Somatic		Capture	SOLID	Phase_I	11107160	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903707	0.92035	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.78364	-1.17;-1.17	5.8	5.8	0.92144	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.88862	0.6552	M	0.86651	2.83	0.80722	D	1	D	0.58970	0.984	P	0.60541	0.876	D	0.90182	0.4243	10	0.87932	D	0	-14.2436	18.2956	0.90145	0.0:0.0:1.0:0.0	.	2215	P42345	MTOR_HUMAN	Y	2215;420	ENSP00000354558:S2215Y;ENSP00000366034:S420Y	ENSP00000354558:S2215Y	S	-	2	0	MTOR	11107160	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.362000	0.97126	2.761000	0.94854	0.650000	0.86243	TCT		0.438	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
PRDM2	7799	hgsc.bcm.edu	37	1	14108531	14108531	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:14108531C>A	ENST00000235372.7	+	8	5097	c.4241C>A	c.(4240-4242)tCg>tAg	p.S1414*	PRDM2_ENST00000311066.5_Nonsense_Mutation_p.S1414*|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000343137.4_Nonsense_Mutation_p.S1213*|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000413440.1_Nonsense_Mutation_p.S1213*	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1414	Arg/Lys-rich (basic).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S1414*(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		AAAATGTCGTCGAATAAGCTC	0.393																																					p.S1213X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3638A	1						.						69.0	74.0	73.0					1																	14108531		2203	4300	6503	13981118	SO:0001587	stop_gained	7799	exon3			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.4241C>A	1.37:g.14108531C>A	ENSP00000235372:p.Ser1414*	Somatic		Capture	SOLID	Phase_I	13981118	NM_001007257	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Nonsense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	C	41	8.577150	0.98870	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	.	.	.	6.08	6.08	0.98989	.	0.468781	0.24891	N	0.034771	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.2359	0.93858	0.0:1.0:0.0:0.0	.	.	.	.	X	1414;1414;1414;1213;1213	.	ENSP00000235372:S1414X	S	+	2	0	PRDM2	13981118	0.434000	0.25570	0.012000	0.15200	0.696000	0.40369	3.975000	0.56859	2.894000	0.99253	0.591000	0.81541	TCG		0.393	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
RXFP4	339403	hgsc.bcm.edu	37	1	155912409	155912409	+	Silent	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:155912409C>T	ENST00000368318.3	+	1	930	c.909C>T	c.(907-909)tgC>tgT	p.C303C		NM_181885.2	NP_871001.1	Q8TDU9	RL3R2_HUMAN	relaxin/insulin-like family peptide receptor 4	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)	p.C303C(1)		endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	13	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GCAATAGCTGCCTCAACCCTG	0.582																																					p.C303C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C909T	1						.						89.0	83.0	85.0					1																	155912409		2203	4300	6503	154179033	SO:0001819	synonymous_variant	339403	exon1			AB065617	CCDS1124.1	1q22	2012-08-08	2006-05-09	2006-03-15	ENSG00000173080	ENSG00000173080		"""GPCR / Class A : Relaxin family peptide receptors"""	14666	protein-coding gene	gene with protein product		609043	"""G protein-coupled receptor 100"", ""relaxin 3 receptor 2"", ""relaxin family peptide receptor 4"""	GPR100, RLN3R2		15956688, 16507880	Standard	NM_181885		Approved	GPCR142, RXFPR4	uc010pgs.2	Q8TDU9	OTTHUMG00000017463	ENST00000368318.3:c.909C>T	1.37:g.155912409C>T		Somatic		Capture	SOLID	Phase_I	154179033	NM_181885	B0M0L4|Q3MJB1|Q8NGZ8	Silent	SNP	ENST00000368318.3	37	CCDS1124.1																																																																																				0.582	RXFP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046203.1	NM_181885	
NTRK1	4914	hgsc.bcm.edu	37	1	156849880	156849880	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:156849880C>A	ENST00000524377.1	+	16	2177	c.2136C>A	c.(2134-2136)agC>agA	p.S712R	NTRK1_ENST00000392302.2_Missense_Mutation_p.S676R|NTRK1_ENST00000531606.1_3'UTR|NTRK1_ENST00000358660.3_Missense_Mutation_p.S709R|NTRK1_ENST00000368196.3_Missense_Mutation_p.S706R	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	712	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S712R(1)|p.S676R(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	ACGTGTGGAGCTTCGGCGTGG	0.652			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.S706R			Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2118A	1						.						95.0	87.0	89.0					1																	156849880		2203	4300	6503	155116504	SO:0001583	missense	4914	exon15			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.2136C>A	1.37:g.156849880C>A	ENSP00000431418:p.Ser712Arg	Somatic		Capture	SOLID	Phase_I	155116504	NM_001012331	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.252521	0.80135	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.95518	-3.73;-3.73;-3.73;-3.73	4.23	4.23	0.50019	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	D	0.98670	0.9554	H	0.98276	4.19	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;P;D	0.87578	0.998;0.994;0.897;0.984	D	0.99376	1.0921	10	0.87932	D	0	.	15.7052	0.77573	0.0:1.0:0.0:0.0	.	709;706;712;676	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	R	676;706;712;709	ENSP00000376120:S676R;ENSP00000357179:S706R;ENSP00000431418:S712R;ENSP00000351486:S709R	ENSP00000351486:S709R	S	+	3	2	NTRK1	155116504	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.597000	0.61062	2.362000	0.80069	0.561000	0.74099	AGC		0.652	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
NECAP2	55707	hgsc.bcm.edu	37	1	16778493	16778493	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:16778493C>T	ENST00000337132.5	+	6	740	c.650C>T	c.(649-651)gCa>gTa	p.A217V	NECAP2_ENST00000406746.1_Missense_Mutation_p.A217V|NECAP2_ENST00000504551.2_Missense_Mutation_p.A156V|NECAP2_ENST00000457722.2_Missense_Mutation_p.A191V|NECAP2_ENST00000443980.2_Missense_Mutation_p.A217V	NM_001145278.1|NM_018090.4	NP_001138750.1|NP_060560.1	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2	217					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|intracellular (GO:0005622)|plasma membrane (GO:0005886)		p.A217V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		GTCCAGCCAGCAGTTGCTCCC	0.662																																					p.A217V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C650T	1						.						71.0	74.0	73.0					1																	16778493		2203	4300	6503	16651080	SO:0001583	missense	55707	exon6			AK021938	CCDS173.1, CCDS44066.1, CCDS44067.1	1p36.13	2008-02-05			ENSG00000157191	ENSG00000157191			25528	protein-coding gene	gene with protein product		611624				14555962, 15494011	Standard	NM_001145277		Approved	FLJ10420	uc001ayq.3	Q9NVZ3	OTTHUMG00000002313	ENST00000337132.5:c.650C>T	1.37:g.16778493C>T	ENSP00000338746:p.Ala217Val	Somatic		Capture	SOLID	Phase_I	16651080	NM_018090	B4DY19|E9PGQ8|Q5VSU4|Q5VSU5|Q9H7L1|Q9H8L1	Missense_Mutation	SNP	ENST00000337132.5	37	CCDS173.1	.	.	.	.	.	.	.	.	.	.	C	9.454	1.091374	0.20471	.	.	ENSG00000157191	ENST00000337132;ENST00000504551;ENST00000457722;ENST00000406746;ENST00000443980;ENST00000492095	T;T;T;T;T;T	0.44083	1.51;1.46;1.5;1.51;0.93;1.51	5.24	4.27	0.50696	.	0.735003	0.13723	N	0.367238	T	0.34308	0.0893	L	0.41236	1.265	0.20821	N	0.999842	B;B;B	0.12013	0.001;0.005;0.0	B;B;B	0.18871	0.005;0.023;0.003	T	0.09773	-1.0659	10	0.24483	T	0.36	-1.1835	12.2825	0.54771	0.1703:0.8297:0.0:0.0	.	191;217;217	Q9NVZ3-4;Q9NVZ3-2;Q9NVZ3	.;.;NECP2_HUMAN	V	217;156;191;217;217;217	ENSP00000338746:A217V;ENSP00000424509:A156V;ENSP00000407091:A191V;ENSP00000383925:A217V;ENSP00000391942:A217V;ENSP00000427620:A217V	ENSP00000338746:A217V	A	+	2	0	NECAP2	16651080	0.001000	0.12720	0.285000	0.24819	0.253000	0.25986	0.555000	0.23422	2.461000	0.83175	0.561000	0.74099	GCA		0.662	NECAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006680.2	NM_018090	
ETV3L	440695	hgsc.bcm.edu	37	1	157062532	157062532	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:157062532G>A	ENST00000454449.2	-	5	1279	c.995C>T	c.(994-996)cCa>cTa	p.P332L		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	332					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.P332L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				GCGGGTCTCTGGGCAGAAGAC	0.577																																					p.P332L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C995T	1						.						76.0	76.0	76.0					1																	157062532		2203	4300	6503	155329156	SO:0001583	missense	440695	exon5			AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.995C>T	1.37:g.157062532G>A	ENSP00000430271:p.Pro332Leu	Somatic		Capture	SOLID	Phase_I	155329156	NM_001004341		Missense_Mutation	SNP	ENST00000454449.2	37	CCDS30893.1	.	.	.	.	.	.	.	.	.	.	G	6.959	0.546825	0.13312	.	.	ENSG00000253831	ENST00000454449	T	0.29397	1.57	4.06	1.07	0.20283	.	121.173000	0.00166	N	0.000000	T	0.06325	0.0163	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18429	-1.0337	10	0.30078	T	0.28	.	7.4131	0.27029	0.2954:0.0:0.7046:0.0	.	332	Q6ZN32	ETV3L_HUMAN	L	332	ENSP00000430271:P332L	ENSP00000430271:P332L	P	-	2	0	ETV3L	155329156	0.002000	0.14202	0.002000	0.10522	0.005000	0.04900	0.758000	0.26447	0.037000	0.15575	0.561000	0.74099	CCA		0.577	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099024.2	NM_001004341	
IRF6	3664	hgsc.bcm.edu	37	1	209964204	209964204	+	Silent	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:209964204G>A	ENST00000367021.3	-	7	868	c.696C>T	c.(694-696)taC>taT	p.Y232Y	IRF6_ENST00000542854.1_Silent_p.Y137Y	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	232					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y232Y(1)		cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		CCTTCCCACGGTACTGAAACT	0.562										HNSCC(57;0.16)																											p.Y232Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C696T	1						.						99.0	88.0	92.0					1																	209964204		2203	4300	6503	208030827	SO:0001819	synonymous_variant	3664	exon7			AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.696C>T	1.37:g.209964204G>A		Somatic		Capture	SOLID	Phase_I	208030827	NM_006147	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Silent	SNP	ENST00000367021.3	37	CCDS1492.1																																																																																				0.562	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147	
FAM71A	149647	hgsc.bcm.edu	37	1	212799302	212799302	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:212799302C>A	ENST00000294829.3	+	1	1514	c.1083C>A	c.(1081-1083)agC>agA	p.S361R	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	361	Ala-rich.					nucleus (GO:0005634)		p.S361R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		CATCCATGAGCCTTTCCCGAG	0.612																																					p.S361R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1083A	1						.						67.0	69.0	69.0					1																	212799302		2203	4300	6503	210865925	SO:0001583	missense	149647	exon1				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.1083C>A	1.37:g.212799302C>A	ENSP00000294829:p.Ser361Arg	Somatic		Capture	SOLID	Phase_I	210865925	NM_153606	Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	37	CCDS1507.1	.	.	.	.	.	.	.	.	.	.	C	9.835	1.189374	0.21954	.	.	ENSG00000162771	ENST00000294829;ENST00000545975	T	0.06849	3.25	4.43	1.31	0.21738	.	.	.	.	.	T	0.06690	0.0171	L	0.39898	1.24	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.38436	-0.9661	9	0.48119	T	0.1	-13.6528	2.7084	0.05167	0.1843:0.5294:0.1787:0.1076	.	361	Q8IYT1	FA71A_HUMAN	R	361;136	ENSP00000294829:S361R	ENSP00000294829:S361R	S	+	3	2	FAM71A	210865925	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.563000	0.23547	0.171000	0.19730	-0.150000	0.13652	AGC		0.612	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	NM_153606	
CAPN2	824	hgsc.bcm.edu	37	1	223939751	223939751	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:223939751C>T	ENST00000295006.5	+	8	1261	c.952C>T	c.(952-954)Cgg>Tgg	p.R318W	CAPN2_ENST00000433674.2_Missense_Mutation_p.R240W	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	318	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)	p.R318W(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		GCTGACCAGACGGCATGAAGA	0.458																																					p.R318W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C952T	1						.						104.0	110.0	108.0					1																	223939751		2203	4300	6503	222006374	SO:0001583	missense	824	exon8			J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.952C>T	1.37:g.223939751C>T	ENSP00000295006:p.Arg318Trp	Somatic		Capture	SOLID	Phase_I	222006374	NM_001748	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Missense_Mutation	SNP	ENST00000295006.5	37	CCDS31035.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658564	0.67586	.	.	ENSG00000162909	ENST00000433674;ENST00000295006;ENST00000366869	D;D	0.88354	-2.37;-2.37	6.17	5.25	0.73442	Peptidase C2, calpain, catalytic domain (3);	0.457681	0.23969	N	0.042800	D	0.93605	0.7958	M	0.86651	2.83	0.22096	N	0.99936	D;D	0.71674	0.998;0.998	P;D	0.63488	0.877;0.915	D	0.87701	0.2560	10	0.87932	D	0	.	8.9419	0.35736	0.2276:0.6986:0.0:0.0738	.	240;318	B7ZA96;P17655	.;CAN2_HUMAN	W	240;318;347	ENSP00000413158:R240W;ENSP00000295006:R318W	ENSP00000295006:R318W	R	+	1	2	CAPN2	222006374	0.002000	0.14202	0.406000	0.26421	0.993000	0.82548	0.816000	0.27267	2.941000	0.99782	0.655000	0.94253	CGG		0.458	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748	
URB2	9816	hgsc.bcm.edu	37	1	229771437	229771437	+	Silent	SNP	T	T	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:229771437T>C	ENST00000258243.2	+	4	1213	c.1077T>C	c.(1075-1077)gtT>gtC	p.V359V		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	359						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.V359V(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						AGCTTTTGGTTGTGGAACAGC	0.512																																					p.V359V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1077C	1						.						49.0	49.0	49.0					1																	229771437		2203	4300	6503	227838060	SO:0001819	synonymous_variant	9816	exon4			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.1077T>C	1.37:g.229771437T>C		Somatic		Capture	SOLID	Phase_I	227838060	NM_014777	Q5VYC9	Silent	SNP	ENST00000258243.2	37	CCDS31052.1																																																																																				0.512	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	
ACTN2	88	hgsc.bcm.edu	37	1	236899008	236899008	+	Silent	SNP	G	G	A	rs201545916		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:236899008G>A	ENST00000366578.4	+	8	937	c.771G>A	c.(769-771)gcG>gcA	p.A257A	ACTN2_ENST00000546208.1_Intron|ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Intron	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	257					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.A257A(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			ACGCTTTTGCGGGCGCGGAGC	0.502																																					p.A257A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G771A	1						.						159.0	117.0	131.0					1																	236899008		2203	4300	6503	234965631	SO:0001819	synonymous_variant	88	exon8			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.771G>A	1.37:g.236899008G>A		Somatic		Capture	SOLID	Phase_I	234965631	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Silent	SNP	ENST00000366578.4	37	CCDS1613.1																																																																																				0.502	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
SLC2A5	6518	hgsc.bcm.edu	37	1	9098558	9098558	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:9098558A>T	ENST00000377424.4	-	10	1285	c.1106T>A	c.(1105-1107)gTg>gAg	p.V369E	SLC2A5_ENST00000536305.1_Missense_Mutation_p.V310E|SLC2A5_ENST00000535586.1_Missense_Mutation_p.V254E	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	369					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)	p.V369E(1)		endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CATCCAGGACACTGTGTCCTG	0.602																																					p.V369E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1106A	1						.						105.0	95.0	98.0					1																	9098558		2203	4300	6503	9021145	SO:0001583	missense	6518	exon10			BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1106T>A	1.37:g.9098558A>T	ENSP00000366641:p.Val369Glu	Somatic		Capture	SOLID	Phase_I	9021145	NM_003039	Q14770|Q5T977|Q8IVB3	Missense_Mutation	SNP	ENST00000377424.4	37	CCDS99.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.853648	0.71719	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000536305;ENST00000535586	T;T;T	0.58652	0.32;0.32;0.32	5.35	4.23	0.50019	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.414294	0.25532	N	0.030025	T	0.68007	0.2954	M	0.76433	2.335	0.09310	N	1	P;D;P	0.56968	0.854;0.978;0.93	P;P;P	0.57846	0.765;0.828;0.765	T	0.59467	-0.7449	10	0.33940	T	0.23	.	9.9465	0.41611	0.9192:0.0:0.0808:0.0	.	325;310;369	B4DG19;B4DU31;P22732	.;.;GTR5_HUMAN	E	369;352;310;254	ENSP00000366641:V369E;ENSP00000440688:V310E;ENSP00000442744:V254E	ENSP00000366641:V369E	V	-	2	0	SLC2A5	9021145	0.692000	0.27719	0.029000	0.17559	0.106000	0.19336	5.963000	0.70372	0.885000	0.36088	0.533000	0.62120	GTG		0.602	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039	
NCMAP	400746	hgsc.bcm.edu	37	1	24932113	24932113	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:24932113C>T	ENST00000374392.2	+	4	250	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W	NCMAP_ENST00000486262.1_3'UTR	NM_001010980.4	NP_001010980.1	Q5T1S8	NCMAP_HUMAN	noncompact myelin associated protein	62					peripheral nervous system myelin formation (GO:0032290)|positive regulation of myelination (GO:0031643)	integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|Schmidt-Lanterman incisure (GO:0043220)	structural constituent of myelin sheath (GO:0019911)	p.R62W(1)									GAGGACGAGGCGGGAACTAGA	0.587																																					p.R62W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C184T	1						.						71.0	63.0	66.0					1																	24932113		2203	4300	6503	24804700	SO:0001583	missense	400746	exon4			AK124519	CCDS30632.1	1p36.11	2012-07-31	2012-07-31	2012-07-31	ENSG00000184454	ENSG00000184454			29332	protein-coding gene	gene with protein product	"""myelin protein of 11 kDa"""		"""chromosome 1 open reading frame 130"""	C1orf130		18650334	Standard	NM_001010980		Approved	FLJ42528, MP11	uc001bjk.2	Q5T1S8	OTTHUMG00000003317	ENST00000374392.2:c.184C>T	1.37:g.24932113C>T	ENSP00000363513:p.Arg62Trp	Somatic		Capture	SOLID	Phase_I	24804700	NM_001010980	A0PK04|B2RV34	Missense_Mutation	SNP	ENST00000374392.2	37	CCDS30632.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944971	0.73672	.	.	ENSG00000184454	ENST00000374392	.	.	.	5.71	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.64951	0.2645	L	0.36672	1.1	0.38190	D	0.939888	D	0.89917	1.0	D	0.68765	0.96	T	0.70872	-0.4754	9	0.87932	D	0	-10.4034	11.7988	0.52114	0.3181:0.6819:0.0:0.0	.	62	Q5T1S8	CA130_HUMAN	W	62	.	ENSP00000363513:R62W	R	+	1	2	C1orf130	24804700	0.939000	0.31865	0.972000	0.41901	0.939000	0.58152	0.384000	0.20668	1.492000	0.48499	0.650000	0.86243	CGG		0.587	NCMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009288.2	NM_001010980	
MAP3K6	9064	hgsc.bcm.edu	37	1	27682176	27682176	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:27682176T>A	ENST00000493901.1	-	29	4011	c.3772A>T	c.(3772-3774)Atc>Ttc	p.I1258F	MAP3K6_ENST00000357582.2_Missense_Mutation_p.I1258F|MAP3K6_ENST00000374040.3_Missense_Mutation_p.I1250F	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	1258					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)	p.I1250F(1)		breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CGGGTGTAGATGAGGTCATCT	0.542																																					p.I1258F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3772T	1						.						146.0	134.0	138.0					1																	27682176		2203	4300	6503	27554763	SO:0001583	missense	9064	exon28			AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.3772A>T	1.37:g.27682176T>A	ENSP00000419591:p.Ile1258Phe	Somatic		Capture	SOLID	Phase_I	27554763	NM_004672	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	ENST00000493901.1	37	CCDS299.1	.	.	.	.	.	.	.	.	.	.	T	12.81	2.050912	0.36181	.	.	ENSG00000142733	ENST00000374040;ENST00000493901;ENST00000357582	D;D;D	0.87729	-2.29;-2.29;-2.29	5.26	-3.4	0.04853	Sterile alpha motif/pointed domain (1);	.	.	.	.	T	0.78130	0.4235	L	0.36672	1.1	0.20563	N	0.999882	B;B	0.16802	0.019;0.011	B;B	0.18871	0.023;0.01	T	0.63699	-0.6578	9	0.45353	T	0.12	.	7.67	0.28453	0.0:0.3483:0.4418:0.2099	.	1250;1258	O95382-3;O95382	.;M3K6_HUMAN	F	1250;1258;1258	ENSP00000363152:I1250F;ENSP00000419591:I1258F;ENSP00000350195:I1258F	ENSP00000350195:I1258F	I	-	1	0	MAP3K6	27554763	0.101000	0.21875	0.843000	0.33291	0.854000	0.48673	-0.588000	0.05774	-0.436000	0.07254	-1.209000	0.01634	ATC		0.542	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	NM_004672	
EYA3	2140	hgsc.bcm.edu	37	1	28326513	28326513	+	Silent	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:28326513A>G	ENST00000373871.3	-	12	1281	c.1041T>C	c.(1039-1041)atT>atC	p.I347I	EYA3_ENST00000436342.2_Silent_p.I221I|EYA3_ENST00000545175.1_Silent_p.I294I|EYA3_ENST00000471498.1_5'UTR|EYA3_ENST00000540618.1_Silent_p.I301I|EYA3_ENST00000373864.1_Silent_p.I190I|EYA3_ENST00000373863.3_Silent_p.I301I	NM_001282561.1|NM_001282562.1	NP_001269490.1|NP_001269491.1	Q99504	EYA3_HUMAN	EYA transcriptional coactivator and phosphatase 3	347					anatomical structure morphogenesis (GO:0009653)|double-strand break repair (GO:0006302)|histone dephosphorylation (GO:0016576)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of DNA repair (GO:0045739)|regulation of transcription, DNA-templated (GO:0006355)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.I347I(1)		breast(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		CCACTTCAAAAATCATTTCTT	0.353																																					p.I347I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1041C	1						.						101.0	105.0	104.0					1																	28326513		2203	4300	6503	28199100	SO:0001819	synonymous_variant	2140	exon12			U81602	CCDS316.1, CCDS60050.1, CCDS60051.1, CCDS60052.1	1p36	2014-06-19	2014-06-19		ENSG00000158161	ENSG00000158161		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3521	protein-coding gene	gene with protein product		601655	"""eyes absent (Drosophila) homolog 3"", ""eyes absent homolog 3 (Drosophila)"""			9020840	Standard	NM_001990		Approved	DKFZp686C132	uc001bpi.2	Q99504	OTTHUMG00000003916	ENST00000373871.3:c.1041T>C	1.37:g.28326513A>G		Somatic		Capture	SOLID	Phase_I	28199100	NM_001990	A8K190|B4DIR7|B4DNZ7|O95463|Q8IVX7|Q99813	Silent	SNP	ENST00000373871.3	37	CCDS316.1																																																																																				0.353	EYA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011184.1	NM_001990	
KIAA0319L	79932	hgsc.bcm.edu	37	1	35915960	35915960	+	Splice_Site	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:35915960C>T	ENST00000325722.3	-	14	2447	c.2213G>A	c.(2212-2214)gGg>gAg	p.G738E	KIAA0319L_ENST00000485551.1_5'UTR|KIAA0319L_ENST00000373266.4_Splice_Site_p.G175E	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	738	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CACACTTACCCCTGCTGCTGG	0.542																																					p.G738E												.	.	0			c.G2213A	1						.						89.0	85.0	87.0					1																	35915960		2203	4300	6503	35688547	SO:0001630	splice_region_variant	79932	exon14			AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.2214+1G>A	1.37:g.35915960C>T		None		Capture	SOLID	Phase_I	35688547	NM_024874	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	ENST00000325722.3	37	CCDS390.1	.	.	.	.	.	.	.	.	.	.	C	32	5.121022	0.94385	.	.	ENSG00000142687	ENST00000325722;ENST00000373266;ENST00000426982	T;T;T	0.68903	2.69;-0.36;2.7	5.87	5.87	0.94306	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD/REJ-like protein (1);PKD domain (2);	0.000000	0.85682	D	0.000000	D	0.83986	0.5373	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	D	0.84525	0.0630	10	0.56958	D	0.05	-9.3057	19.2028	0.93717	0.0:1.0:0.0:0.0	.	738;738;180	Q8IZA0-2;Q8IZA0;Q8IZA0-3	.;K319L_HUMAN;.	E	738;175;738	ENSP00000318406:G738E;ENSP00000362363:G175E;ENSP00000395883:G738E	ENSP00000318406:G738E	G	-	2	0	KIAA0319L	35688547	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.247000	0.78257	2.785000	0.95823	0.591000	0.81541	GGG		0.542	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012684.2	NM_024874	Missense_Mutation
C1orf50	79078	hgsc.bcm.edu	37	1	43239277	43239277	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:43239277T>C	ENST00000372525.5	+	3	282	c.239T>C	c.(238-240)gTc>gCc	p.V80A	C1orf50_ENST00000468913.2_3'UTR|RP5-994D16.9_ENST00000447572.1_RNA|C1orf50_ENST00000536543.1_5'UTR	NM_024097.3	NP_077002.2	Q9BV19	CA050_HUMAN	chromosome 1 open reading frame 50	80								p.V80A(1)		large_intestine(2)|ovary(1)|pancreas(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AAGCTGACAGTCATAGCTGAG	0.408																																					p.V80A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T239C	1						.						101.0	86.0	91.0					1																	43239277		2203	4300	6503	43011864	SO:0001583	missense	79078	exon3			BC001711	CCDS473.1	1p34.2	2012-06-25			ENSG00000164008	ENSG00000164008			28795	protein-coding gene	gene with protein product						12477932	Standard	NM_024097		Approved	MGC955	uc001cia.4	Q9BV19	OTTHUMG00000007568	ENST00000372525.5:c.239T>C	1.37:g.43239277T>C	ENSP00000361603:p.Val80Ala	Somatic		Capture	SOLID	Phase_I	43011864	NM_024097		Missense_Mutation	SNP	ENST00000372525.5	37	CCDS473.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.554787	0.65425	.	.	ENSG00000164008	ENST00000372525	T	0.55760	0.5	6.03	4.91	0.64330	.	0.061371	0.64402	D	0.000004	T	0.58793	0.2147	M	0.88377	2.95	0.21967	N	0.999448	P	0.40250	0.709	B	0.40134	0.32	T	0.75079	-0.3444	9	0.52906	T	0.07	.	9.6799	0.40063	0.0:0.0802:0.0:0.9198	.	80	Q9BV19	CA050_HUMAN	A	80	ENSP00000361603:V80A	ENSP00000361603:V80A	V	+	2	0	C1orf50	43011864	1.000000	0.71417	0.995000	0.50966	0.725000	0.41563	5.763000	0.68818	2.308000	0.77769	0.533000	0.62120	GTC		0.408	C1orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020001.2	NM_024097	
FPGT	8790	hgsc.bcm.edu	37	1	74671111	74671111	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:74671111G>A	ENST00000609362.1	+	4	1417	c.1380G>A	c.(1378-1380)atG>atA	p.M460I	FPGT_ENST00000370898.3_Missense_Mutation_p.M473I|FPGT_ENST00000524915.1_Intron|FPGT-TNNI3K_ENST00000533006.1_Intron|TNNI3K_ENST00000370891.2_Intron|FPGT_ENST00000534056.1_Missense_Mutation_p.M206I|FPGT-TNNI3K_ENST00000370895.1_Intron|FPGT-TNNI3K_ENST00000557284.2_Intron|FPGT-TNNI3K_ENST00000370893.1_Intron|FPGT-TNNI3K_ENST00000370899.3_Intron|FPGT_ENST00000370894.5_3'UTR	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	460					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)			breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						GCTTAAAGATGAATAGATGCT	0.358																																					p.M206I												.	.	0			c.G618A	1						.						91.0	89.0	90.0					1																	74671111		2203	4300	6503	74443699	SO:0001583	missense	8790	exon5			AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.1380G>A	1.37:g.74671111G>A	ENSP00000476680:p.Met460Ile	None		Capture	SOLID	Phase_I	74443699	NM_001199328	A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Missense_Mutation	SNP	ENST00000609362.1	37	CCDS663.1	.	.	.	.	.	.	.	.	.	.	G	0.602	-0.828705	0.02734	.	.	ENSG00000254685	ENST00000370898;ENST00000534056	T;T	0.29142	1.58;1.58	5.3	0.687	0.18020	L-fucokinase (1);	.	.	.	.	T	0.02929	0.0087	N	0.03115	-0.41	0.09310	N	0.999996	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.41822	-0.9487	9	0.28530	T	0.3	.	0.478	0.00543	0.3835:0.1248:0.1997:0.2921	.	206;85;460	E9PNQ2;B4E2Y7;O14772	.;.;FPGT_HUMAN	I	460;206	ENSP00000359935:M460I;ENSP00000432819:M206I	ENSP00000359935:M460I	M	+	3	0	TNNI3K	74443699	0.000000	0.05858	0.994000	0.49952	0.656000	0.38851	-0.611000	0.05622	0.110000	0.17919	0.563000	0.77884	ATG		0.358	FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
FAM73A	374986	hgsc.bcm.edu	37	1	78338709	78338709	+	Silent	SNP	C	C	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:78338709C>G	ENST00000370791.3	+	15	1616	c.1584C>G	c.(1582-1584)gcC>gcG	p.A528A	FAM73A_ENST00000443751.2_Silent_p.A491A	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	528						integral component of membrane (GO:0016021)		p.A528A(1)		breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		GATTTTTTGCCCATTTTTATG	0.388																																					p.A528A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1584G	1						.						221.0	211.0	214.0					1																	78338709		2203	4300	6503	78111297	SO:0001819	synonymous_variant	374986	exon15				CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.1584C>G	1.37:g.78338709C>G		Somatic		Capture	SOLID	Phase_I	78111297	NM_198549	Q6MZG0	Silent	SNP	ENST00000370791.3	37	CCDS681.1																																																																																				0.388	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	
SEMA4A	64218	hgsc.bcm.edu	37	1	156126289	156126290	+	Frame_Shift_Del	DEL	CT	CT	-	rs570859927		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	CT	CT	CT	-	CT	CT	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:156126289_156126290delCT	ENST00000368285.3	+	3	491_492	c.224_225delCT	c.(223-225)actfs	p.T75fs	SEMA4A_ENST00000487358.1_3'UTR|SEMA4A_ENST00000368286.2_5'UTR|SEMA4A_ENST00000368284.1_5'UTR|SEMA4A_ENST00000368282.1_Frame_Shift_Del_p.T75fs|SEMA4A_ENST00000355014.2_Frame_Shift_Del_p.T75fs	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	75	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.Y77fs*30(1)		breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					GATGGAAATACTCTCTACGTGG	0.535																																					p.75_75del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.224_225del	1						.																																			154392914	SO:0001589	frameshift_variant	64218	exon3			AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.224_225delCT	1.37:g.156126293_156126294delCT	ENSP00000357268:p.Thr75fs	Somatic		Capture	SOLID	Phase_I	154392913	NM_022367	B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Frame_Shift_Del	DEL	ENST00000368285.3	37	CCDS1132.1																																																																																				0.535	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039484.2	NM_022367	
RGS7	6000	hgsc.bcm.edu	37	1	240975291	240975291	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr1:240975291C>G	ENST00000407727.1	-	13	1008	c.1009G>C	c.(1009-1011)Gca>Cca	p.A337P	RGS7_ENST00000366565.1_Missense_Mutation_p.A337P|RGS7_ENST00000331110.7_Missense_Mutation_p.A311P|RGS7_ENST00000366563.1_Missense_Mutation_p.A337P|RGS7_ENST00000446183.2_Missense_Mutation_p.A253P|RGS7_ENST00000348120.2_Missense_Mutation_p.A284P|RGS7_ENST00000366562.4_Missense_Mutation_p.A337P|RGS7_ENST00000401882.1_Missense_Mutation_p.A284P|RGS7_ENST00000366564.1_Missense_Mutation_p.A337P			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	337	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.A337P(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TCTTTCAATGCCTCGTCCATG	0.393																																					p.A337P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1009C	1						.						104.0	106.0	105.0					1																	240975291		2203	4300	6503	239041914	SO:0001583	missense	6000	exon14			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.1009G>C	1.37:g.240975291C>G	ENSP00000384428:p.Ala337Pro	Somatic		Capture	SOLID	Phase_I	239041914	NM_002924	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37		.	.	.	.	.	.	.	.	.	.	C	35	5.474581	0.96291	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T;T;T	0.01981	4.52;4.52;4.52;4.52;4.52;4.52;4.52;4.52;4.52;4.52	5.8	5.8	0.92144	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.051735	0.85682	D	0.000000	T	0.08537	0.0212	L	0.50333	1.59	0.51233	D	0.99991	P;D;D;P;D;P;D	0.59357	0.833;0.973;0.985;0.846;0.967;0.944;0.973	P;P;P;P;P;P;P	0.57244	0.503;0.803;0.795;0.61;0.795;0.491;0.816	T	0.00899	-1.1522	10	0.87932	D	0	.	19.0419	0.93004	0.0:1.0:0.0:0.0	.	253;311;284;337;337;337;337	B7Z223;B7Z257;P49802-4;P49802-2;P49802-5;P49802-3;P49802	.;.;.;.;.;.;RGS7_HUMAN	P	311;337;337;337;168;284;253;337;337;284	ENSP00000331485:A311P;ENSP00000355523:A337P;ENSP00000355522:A337P;ENSP00000355521:A337P;ENSP00000404399:A168P;ENSP00000341242:A284P;ENSP00000390138:A253P;ENSP00000355520:A337P;ENSP00000384428:A337P;ENSP00000385508:A284P	ENSP00000331485:A311P	A	-	1	0	RGS7	239041914	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.758000	0.94735	0.561000	0.74099	GCA		0.393	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	
ODF3	113746	hgsc.bcm.edu	37	11	200028	200028	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr11:200028G>C	ENST00000325113.4	+	7	1077	c.760G>C	c.(760-762)Gaa>Caa	p.E254Q	BET1L_ENST00000410108.1_Intron|ODF3_ENST00000525282.1_Missense_Mutation_p.E207Q	NM_053280.3	NP_444510.2	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	254					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	outer dense fiber (GO:0001520)		p.E254Q(1)		biliary_tract(1)|breast(1)|kidney(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)	9		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGTTGATGTGGAATAACGCCA	0.617																																					p.E254Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G760C	11						.						119.0	89.0	99.0					11																	200028		2203	4300	6503	190028	SO:0001583	missense	113746	exon7			AB067774	CCDS7688.1, CCDS65981.1	11p15.5	2010-04-23			ENSG00000177947	ENSG00000177947			19905	protein-coding gene	gene with protein product	"""cancer/testis antigen 135"""	608356				11870087	Standard	NM_001286136		Approved	SHIPPO1, hSHIPPO, CT135	uc001lob.3	Q96PU9	OTTHUMG00000119073	ENST00000325113.4:c.760G>C	11.37:g.200028G>C	ENSP00000325868:p.Glu254Gln	Somatic		Capture	SOLID	Phase_I	190028	NM_053280	B7ZLT0|Q69YX0	Missense_Mutation	SNP	ENST00000325113.4	37	CCDS7688.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.535744	0.27475	.	.	ENSG00000177947	ENST00000325113;ENST00000540150;ENST00000525282	T;T	0.36878	1.43;1.23	4.96	4.96	0.65561	.	0.128921	0.35646	N	0.003065	T	0.28466	0.0704	L	0.29908	0.895	0.80722	D	1	B;B	0.26635	0.155;0.048	B;B	0.25140	0.039;0.058	T	0.07829	-1.0752	10	0.52906	T	0.07	-11.8381	13.5648	0.61810	0.0:0.0:1.0:0.0	.	207;254	B7ZLT0;Q96PU9	.;ODF3A_HUMAN	Q	254;124;207	ENSP00000325868:E254Q;ENSP00000436588:E207Q	ENSP00000325868:E254Q	E	+	1	0	ODF3	190028	1.000000	0.71417	0.994000	0.49952	0.012000	0.07955	4.873000	0.63057	2.562000	0.86427	0.555000	0.69702	GAA		0.617	ODF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239287.1		
AGBL2	79841	hgsc.bcm.edu	37	11	47711724	47711724	+	Missense_Mutation	SNP	C	C	T	rs550419569	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr11:47711724C>T	ENST00000525123.1	-	10	1820	c.1535G>A	c.(1534-1536)cGg>cAg	p.R512Q	AGBL2_ENST00000298861.4_Missense_Mutation_p.R512Q|AGBL2_ENST00000528244.1_Missense_Mutation_p.R474Q|AGBL2_ENST00000357610.3_Missense_Mutation_p.R512Q|AGBL2_ENST00000529712.1_5'UTR	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	512						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R512Q(1)		NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						CAAGGAACACCGATAATTCCC	0.443																																					p.R512Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1535A	11						.						84.0	76.0	78.0					11																	47711724		2201	4298	6499	47668300	SO:0001583	missense	79841	exon9				CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.1535G>A	11.37:g.47711724C>T	ENSP00000435582:p.Arg512Gln	Somatic		Capture	SOLID	Phase_I	47668300	NM_024783	A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	ENST00000525123.1	37	CCDS7944.1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.324297	0.60634	.	.	ENSG00000165923	ENST00000525123;ENST00000357610;ENST00000298861;ENST00000528244	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	5.96	5.96	0.96718	Peptidase M14, carboxypeptidase A (1);	0.000000	0.85682	D	0.000000	T	0.70090	0.3184	H	0.97783	4.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	T	0.81136	-0.1070	10	0.87932	D	0	-28.1492	20.422	0.99049	0.0:1.0:0.0:0.0	.	474;474;512	F6U0I4;B4DZS1;Q5U5Z8	.;.;CBPC2_HUMAN	Q	512;512;512;474	ENSP00000435582:R512Q;ENSP00000350228:R512Q;ENSP00000298861:R512Q;ENSP00000436630:R474Q	ENSP00000298861:R512Q	R	-	2	0	AGBL2	47668300	1.000000	0.71417	0.995000	0.50966	0.838000	0.47535	5.611000	0.67674	2.832000	0.97577	0.655000	0.94253	CGG		0.443	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	NM_024783	
FAM111B	374393	hgsc.bcm.edu	37	11	58893362	58893362	+	Nonsense_Mutation	SNP	C	C	T	rs200211922		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr11:58893362C>T	ENST00000343597.3	+	4	1983	c.1792C>T	c.(1792-1794)Cga>Tga	p.R598*	FAM111B_ENST00000529618.1_Nonsense_Mutation_p.R568*|FAM111B_ENST00000411426.1_Nonsense_Mutation_p.R568*	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	598							catalytic activity (GO:0003824)	p.R598*(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						TCTAAACGAACGATTGAAAAA	0.363																																					p.R568X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1702T	11						.						122.0	107.0	112.0					11																	58893362		2201	4295	6496	58649938	SO:0001587	stop_gained	374393	exon3			BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.1792C>T	11.37:g.58893362C>T	ENSP00000341565:p.Arg598*	Somatic		Capture	SOLID	Phase_I	58649938	NM_001142703	B4E2G2|Q6P661	Nonsense_Mutation	SNP	ENST00000343597.3	37	CCDS7972.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.931508	0.73442	.	.	ENSG00000189057	ENST00000411426;ENST00000529618;ENST00000343597	.	.	.	4.66	-1.15	0.09709	.	0.379769	0.20051	N	0.100283	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.9957	0.14237	0.4016:0.4334:0.0:0.165	.	.	.	.	X	568;568;598	.	ENSP00000341565:R598X	R	+	1	2	FAM111B	58649938	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.220000	0.09215	-0.057000	0.13199	-0.133000	0.14855	CGA		0.363	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947	
PC	5091	hgsc.bcm.edu	37	11	66638341	66638341	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr11:66638341C>T	ENST00000393958.2	-	7	749	c.656G>A	c.(655-657)cGg>cAg	p.R219Q	PC_ENST00000393960.1_Missense_Mutation_p.R219Q|PC_ENST00000524491.1_Missense_Mutation_p.R179Q|PC_ENST00000355677.3_Missense_Mutation_p.R219Q|PC_ENST00000393955.2_Missense_Mutation_p.R219Q	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	219	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)	p.R219Q(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	TGAGTAGGCCCGGGTGTAATT	0.627																																					p.R219Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G656A	11						.						95.0	110.0	105.0					11																	66638341		2200	4295	6495	66394917	SO:0001583	missense	5091	exon8			U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.656G>A	11.37:g.66638341C>T	ENSP00000377530:p.Arg219Gln	Somatic		Capture	SOLID	Phase_I	66394917	NM_001040716	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	C	36	5.835220	0.97003	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960;ENST00000524491;ENST00000355677	D;D;D;D;D	0.97598	-4.45;-4.45;-4.45;-4.45;-4.45	5.29	5.29	0.74685	ATP-grasp fold (1);ATP-grasp fold, subdomain 1 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.97673	0.9237	L	0.52759	1.655	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	D	0.98593	1.0655	10	0.87932	D	0	-25.086	16.425	0.83812	0.0:1.0:0.0:0.0	.	219	P11498	PYC_HUMAN	Q	219;219;219;179;219	ENSP00000377527:R219Q;ENSP00000377530:R219Q;ENSP00000377532:R219Q;ENSP00000434192:R179Q;ENSP00000347900:R219Q	ENSP00000347900:R219Q	R	-	2	0	PC	66394917	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.065000	0.76727	2.483000	0.83821	0.462000	0.41574	CGG		0.627	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
TPCN2	219931	hgsc.bcm.edu	37	11	68846256	68846256	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr11:68846256C>G	ENST00000294309.3	+	15	1506	c.1405C>G	c.(1405-1407)Ctg>Gtg	p.L469V	TPCN2_ENST00000442692.2_3'UTR|TPCN2_ENST00000542467.1_Missense_Mutation_p.L469V	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	469					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)	p.L469V(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TGACTTCATCCTGGGGGTAAG	0.642																																					p.L469V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1405G	11						.						103.0	94.0	97.0					11																	68846256		2200	4294	6494	68602832	SO:0001583	missense	219931	exon15			AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.1405C>G	11.37:g.68846256C>G	ENSP00000294309:p.Leu469Val	Somatic		Capture	SOLID	Phase_I	68602832	NM_139075	Q9NT82	Missense_Mutation	SNP	ENST00000294309.3	37	CCDS8189.1	.	.	.	.	.	.	.	.	.	.	C	9.761	1.170142	0.21621	.	.	ENSG00000162341	ENST00000294309;ENST00000535009;ENST00000542467	D;D	0.98164	-4.76;-4.76	4.69	1.71	0.24356	.	0.107771	0.39146	N	0.001456	D	0.98191	0.9402	M	0.73962	2.25	0.23126	N	0.998258	D;P;D	0.67145	0.994;0.847;0.996	P;B;P	0.62560	0.849;0.197;0.904	D	0.94600	0.7795	9	.	.	.	-12.93	10.3239	0.43781	0.0:0.691:0.0:0.309	.	469;469;384	E7ETX0;Q8NHX9;F5H1G5	.;TPC2_HUMAN;.	V	469;384;469	ENSP00000294309:L469V;ENSP00000445551:L469V	.	L	+	1	2	TPCN2	68602832	0.199000	0.23386	0.977000	0.42913	0.018000	0.09664	0.239000	0.18023	0.417000	0.25871	-1.598000	0.00824	CTG		0.642	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075	
WNT11	7481	hgsc.bcm.edu	37	11	75902685	75902685	+	Silent	SNP	C	C	T	rs111832264	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr11:75902685C>T	ENST00000322563.3	-	4	937	c.813G>A	c.(811-813)tcG>tcA	p.S271S	RP11-619A14.2_ENST00000527314.1_RNA	NM_004626.2	NP_004617.2	O96014	WNT11_HUMAN	wingless-type MMTV integration site family, member 11	271				S -> W (in Ref. 1; CAA74159/CAA73223). {ECO:0000305}.	adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|bone mineralization (GO:0030282)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cloacal septation (GO:0060197)|embryonic skeletal system development (GO:0048706)|lung-associated mesenchyme development (GO:0060484)|mesonephric duct development (GO:0072177)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroendocrine cell differentiation (GO:0061101)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway (GO:0035567)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta2 production (GO:0032915)|protein localization to cell surface (GO:0034394)|protein phosphorylation (GO:0006468)|response to nutrient levels (GO:0031667)|tight junction assembly (GO:0070830)|ureteric bud morphogenesis (GO:0060675)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|protein kinase activator activity (GO:0030295)|Ras GTPase activator activity (GO:0005099)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20						AGACGAGTTCCGAGTCCTTCA	0.597													C|||	37	0.00738818	0.0265	0.0014	5008	,	,		18710	0.0		0.001	False		,,,				2504	0.0				p.S271S												.	.	0			c.G813A	11						.	C		111,4289	85.3+/-124.0	2,107,2091	84.0	88.0	86.0		813	-8.0	0.4	11	dbSNP_132	86	2,8582		0,2,4290	no	coding-synonymous	WNT11	NM_004626.2		2,109,6381	TT,TC,CC		0.0233,2.5227,0.8703		271/355	75902685	113,12871	2200	4292	6492	75580333	SO:0001819	synonymous_variant	7481	exon4			Y12692	CCDS8242.1	11q13.5	2008-02-05			ENSG00000085741	ENSG00000085741		"""Wingless-type MMTV integration sites"""	12776	protein-coding gene	gene with protein product		603699				9757009	Standard	NM_004626		Approved		uc001oxe.3	O96014	OTTHUMG00000165264	ENST00000322563.3:c.813G>A	11.37:g.75902685C>T		None		Capture	SOLID	Phase_I	75580333	NM_004626	B2R8Z6|Q14DE8|Q8WZ98	Silent	SNP	ENST00000322563.3	37	CCDS8242.1																																																																																				0.597	WNT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383083.1	NM_004626	
MICAL1	64780	hgsc.bcm.edu	37	6	109771706	109771706	+	Silent	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:109771706G>A	ENST00000358807.3	-	8	1299	c.988C>T	c.(988-990)Ctg>Ttg	p.L330L	MICAL1_ENST00000358577.3_Intron|MICAL1_ENST00000483856.1_5'Flank|MICAL1_ENST00000368952.4_Silent_p.L349L	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	330	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.L330L(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		AAGCGCTGCAGAGCCTCGGGC	0.602																																					p.L330L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C988T	6						.						35.0	32.0	33.0					6																	109771706		2203	4300	6503	109878399	SO:0001819	synonymous_variant	64780	exon8			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.988C>T	6.37:g.109771706G>A		Somatic		Capture	SOLID	Phase_I	109878399	NM_022765	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Silent	SNP	ENST00000358807.3	37	CCDS5076.1																																																																																				0.602	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
SYNE1	23345	hgsc.bcm.edu	37	6	152558009	152558009	+	Silent	SNP	G	G	A	rs201908045	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:152558009G>A	ENST00000367255.5	-	109	20743	c.20142C>T	c.(20140-20142)agC>agT	p.S6714S	SYNE1_ENST00000448038.1_Silent_p.S6643S|SYNE1_ENST00000341594.5_Silent_p.S6326S|SYNE1_ENST00000265368.4_Silent_p.S6714S|SYNE1_ENST00000356820.4_Silent_p.S1238S|SYNE1_ENST00000423061.1_Silent_p.S6643S	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6714					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.S6714S(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCAGACCCACGCTTGGGATGC	0.527										HNSCC(10;0.0054)			G|||	5	0.000998403	0.0	0.0	5008	,	,		17779	0.005		0.0	False		,,,				2504	0.0				p.S1238S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3714T	6						.						131.0	99.0	110.0					6																	152558009		2203	4300	6503	152599702	SO:0001819	synonymous_variant	23345	exon24			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20142C>T	6.37:g.152558009G>A		Somatic		Capture	SOLID	Phase_I	152599702	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																				0.527	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
MAP3K4	4216	hgsc.bcm.edu	37	6	161523788	161523788	+	Missense_Mutation	SNP	G	G	A	rs574843528		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:161523788G>A	ENST00000392142.4	+	19	3981	c.3833G>A	c.(3832-3834)cGg>cAg	p.R1278Q	MAP3K4_ENST00000348824.7_Missense_Mutation_p.R1224Q|MAP3K4_ENST00000366920.2_Missense_Mutation_p.R1274Q|MAP3K4_ENST00000366919.2_Missense_Mutation_p.R1228Q	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1278					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.R1277Q(1)|p.R1278Q(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TGGGAACTTCGGACACTAATC	0.348													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15259	0.0		0.0	False		,,,				2504	0.0				p.R1228Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3683A	6						.						47.0	47.0	47.0					6																	161523788		2203	4300	6503	161443778	SO:0001583	missense	4216	exon18			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3833G>A	6.37:g.161523788G>A	ENSP00000375986:p.Arg1278Gln	Somatic		Capture	SOLID	Phase_I	161443778	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.223466	0.79464	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.71222	-0.5;-0.53;-0.55;-0.5	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000001	T	0.45013	0.1321	L	0.29908	0.895	0.58432	D	0.999999	B;B;B;B	0.30511	0.281;0.015;0.116;0.282	B;B;B;B	0.26614	0.071;0.002;0.014;0.029	T	0.52711	-0.8539	10	0.48119	T	0.1	-30.1757	12.6201	0.56597	0.0756:0.0:0.9244:0.0	.	1274;214;1228;1278	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	Q	1228;1278;1228;1274;1224	ENSP00000355886:R1228Q;ENSP00000375986:R1278Q;ENSP00000355887:R1274Q;ENSP00000297332:R1224Q	ENSP00000297332:R1224Q	R	+	2	0	MAP3K4	161443778	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	7.399000	0.79935	2.555000	0.86185	0.655000	0.94253	CGG		0.348	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
GABBR1	2550	hgsc.bcm.edu	37	6	29599363	29599363	+	Silent	SNP	T	T	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:29599363T>A	ENST00000377034.4	-	3	434	c.99A>T	c.(97-99)atA>atT	p.I33I	GABBR1_ENST00000376977.3_Silent_p.I33I|GABBR1_ENST00000377016.4_Silent_p.I33I	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	33	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.I33I(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	AGGGCGGGTGTATGATCTGGC	0.577																																					p.I33I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A99T	6						.						56.0	62.0	60.0					6																	29599363		2203	4300	6503	29707342	SO:0001819	synonymous_variant	2550	exon3			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.99A>T	6.37:g.29599363T>A		Somatic		Capture	SOLID	Phase_I	29707342	NM_021904	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	ENST00000377034.4	37	CCDS4663.1																																																																																				0.577	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
ABCF1	23	hgsc.bcm.edu	37	6	30553070	30553070	+	Silent	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:30553070G>A	ENST00000326195.8	+	15	1537	c.1425G>A	c.(1423-1425)ctG>ctA	p.L475L	MIR877_ENST00000401282.1_RNA|ABCF1_ENST00000376545.3_Silent_p.L437L|ABCF1_ENST00000396515.4_Intron	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	475	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)	p.L475L(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						TGCTGATGCTGGATGAGCCCA	0.547																																					p.L475L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1425A	6						.						214.0	160.0	179.0					6																	30553070		1511	2709	4220	30661049	SO:0001819	synonymous_variant	23	exon15			AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.1425G>A	6.37:g.30553070G>A		Somatic		Capture	SOLID	Phase_I	30661049	NM_001025091	A2BF75|O14897|Q69YP6	Silent	SNP	ENST00000326195.8	37	CCDS34380.1																																																																																				0.547	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3		
COL11A2	1302	hgsc.bcm.edu	37	6	33152083	33152083	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:33152083C>A	ENST00000341947.2	-	8	1185	c.958G>T	c.(958-960)Gtc>Ttc	p.V320F	COL11A2_ENST00000357486.1_Missense_Mutation_p.V299F|COL11A2_ENST00000361917.1_Intron|COL11A2_ENST00000374708.4_Intron|COL11A2_ENST00000395197.1_Intron|COL11A2_ENST00000374714.1_Missense_Mutation_p.V294F|COL11A2_ENST00000374712.1_Intron|COL11A2_ENST00000374713.1_Missense_Mutation_p.V273F	NM_080680.2	NP_542411.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	320	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GTGGGGGGGACCTGGAGATCT	0.612																																					p.V320F	Melanoma(1;90 116 3946 5341 17093)											.	.	0			c.G958T	6						.						37.0	42.0	41.0					6																	33152083		2203	4299	6502	33260061	SO:0001583	missense	1302	exon8			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000341947.2:c.958G>T	6.37:g.33152083C>A	ENSP00000339915:p.Val320Phe	None		Capture	SOLID	Phase_I	33260061	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	ENST00000341947.2	37		.	.	.	.	.	.	.	.	.	.	C	11.39	1.625333	0.28889	.	.	ENSG00000204248	ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000457788	D;D;D;D;D	0.91011	-2.38;-2.46;-2.61;-2.44;-2.77	4.0	4.0	0.46444	.	0.951414	0.08670	N	0.911057	D	0.83880	0.5350	L	0.29908	0.895	0.80722	D	1	D	0.61080	0.989	P	0.53760	0.734	T	0.76462	-0.2950	10	0.10111	T	0.7	.	11.8917	0.52633	0.0:1.0:0.0:0.0	.	320	P13942	COBA2_HUMAN	F	320;299;294;273;320	ENSP00000339915:V320F;ENSP00000350079:V299F;ENSP00000363846:V294F;ENSP00000363845:V273F;ENSP00000405520:V320F	ENSP00000339915:V320F	V	-	1	0	COL11A2	33260061	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	1.446000	0.35090	2.511000	0.84671	0.549000	0.68633	GTC		0.612	COL11A2-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
ITPR3	3710	hgsc.bcm.edu	37	6	33639860	33639860	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:33639860T>A	ENST00000374316.5	+	23	3843	c.2783T>A	c.(2782-2784)gTg>gAg	p.V928E	ITPR3_ENST00000605930.1_Missense_Mutation_p.V928E			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	928					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TCCACCATGGTGCTGAGCCGC	0.617																																					p.V928E												.	.	0			c.T2783A	6						.						93.0	81.0	85.0					6																	33639860		2203	4300	6503	33747838	SO:0001583	missense	3710	exon22			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.2783T>A	6.37:g.33639860T>A	ENSP00000363435:p.Val928Glu	None		Capture	SOLID	Phase_I	33747838	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	T	32	5.128098	0.94473	.	.	ENSG00000096433	ENST00000374316	D	0.92595	-3.07	5.46	5.46	0.80206	.	0.061439	0.64402	D	0.000004	D	0.94545	0.8243	M	0.80982	2.52	0.58432	D	0.999998	D	0.63046	0.992	P	0.59546	0.859	D	0.95213	0.8327	10	0.72032	D	0.01	-30.6319	15.5417	0.76057	0.0:0.0:0.0:1.0	.	928	Q14573	ITPR3_HUMAN	E	928	ENSP00000363435:V928E	ENSP00000363435:V928E	V	+	2	0	ITPR3	33747838	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.981000	0.70524	2.072000	0.62099	0.533000	0.62120	GTG		0.617	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
SRSF3	6428	hgsc.bcm.edu	37	6	36564598	36564598	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:36564598A>G	ENST00000373715.6	+	2	175	c.59A>G	c.(58-60)aAt>aGt	p.N20S	SRSF3_ENST00000339436.7_Missense_Mutation_p.N20S	NM_003017.4	NP_003008.1	P84103	SRSF3_HUMAN	serine/arginine-rich splicing factor 3	20	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.|Sufficiernt for interaction with NXF1.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.N20S(2)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(2)	7						CTTGGAAACAATGGCAACAAG	0.408																																					p.N20S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A59G	6						.						147.0	145.0	145.0					6																	36564598		2203	4300	6503	36672576	SO:0001583	missense	6428	exon2			L10838	CCDS4823.1	6p21	2013-02-12	2010-06-22	2010-06-22	ENSG00000112081	ENSG00000112081		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10785	protein-coding gene	gene with protein product		603364	"""splicing factor, arginine/serine-rich 3"""	SFRS3		1577277, 20516191	Standard	NM_003017		Approved	SRp20	uc003omj.3	P84103	OTTHUMG00000014599	ENST00000373715.6:c.59A>G	6.37:g.36564598A>G	ENSP00000362820:p.Asn20Ser	Somatic		Capture	SOLID	Phase_I	36672576	NM_003017	B4E241|O08831|P23152|Q5R3K0	Missense_Mutation	SNP	ENST00000373715.6	37	CCDS4823.1	.	.	.	.	.	.	.	.	.	.	A	13.12	2.142784	0.37825	.	.	ENSG00000112081	ENST00000373715;ENST00000339436	T;T	0.73789	2.42;-0.78	5.32	5.32	0.75619	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.51109	0.1655	N	0.25789	0.76	0.80722	D	1	B;B	0.24963	0.015;0.115	B;B	0.33960	0.048;0.173	T	0.52358	-0.8586	10	0.16896	T	0.51	.	15.5789	0.76418	1.0:0.0:0.0:0.0	.	20;20	B4E241;P84103	.;SRSF3_HUMAN	S	20	ENSP00000362820:N20S;ENSP00000344762:N20S	ENSP00000344762:N20S	N	+	2	0	SRSF3	36672576	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.140000	0.66376	0.459000	0.35465	AAT		0.408	SRSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040347.2	NM_003017	
LRFN2	57497	hgsc.bcm.edu	37	6	40400556	40400556	+	Silent	SNP	G	G	A	rs187891955		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:40400556G>A	ENST00000338305.6	-	2	839	c.297C>T	c.(295-297)ctC>ctT	p.L99L		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	99						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.L99L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGAGGCTCTCGAGGTCCAGAA	0.602													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18201	0.0		0.0	False		,,,				2504	0.0				p.L99L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C297T	6						.						58.0	45.0	49.0					6																	40400556		2203	4300	6503	40508534	SO:0001819	synonymous_variant	57497	exon2			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.297C>T	6.37:g.40400556G>A		Somatic		Capture	SOLID	Phase_I	40508534	NM_020737	A5PKU3|Q5SYP9	Silent	SNP	ENST00000338305.6	37	CCDS34443.1																																																																																				0.602	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
GNMT	27232	hgsc.bcm.edu	37	6	42930888	42930888	+	Missense_Mutation	SNP	A	A	C	rs201256313		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:42930888A>C	ENST00000372808.3	+	4	540	c.530A>C	c.(529-531)cAt>cCt	p.H177P		NM_018960.4	NP_061833.1	Q14749	GNMT_HUMAN	glycine N-methyltransferase	177			H -> N (in GNMT deficiency; 75% wild-type activity, decreases stability of the tetramer). {ECO:0000269|PubMed:11810299}.		cellular protein modification process (GO:0006464)|glycogen metabolic process (GO:0005977)|methionine metabolic process (GO:0006555)|one-carbon metabolic process (GO:0006730)|protein homotetramerization (GO:0051289)|regulation of gluconeogenesis (GO:0006111)|S-adenosylmethionine metabolic process (GO:0046500)	cytoplasm (GO:0005737)	folic acid binding (GO:0005542)|glycine binding (GO:0016594)|glycine N-methyltransferase activity (GO:0017174)	p.H177P(1)		kidney(2)|large_intestine(1)|lung(1)	4	Colorectal(47;0.196)		all cancers(41;0.00196)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0461)		Glycine(DB00145)|S-Adenosylmethionine(DB00118)	GTCATTGATCATCGCAACTAC	0.622																																					p.H177P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A530C	6						.						41.0	40.0	40.0					6																	42930888		2203	4300	6503	43038866	SO:0001583	missense	27232	exon4			AF101475	CCDS4876.1	6p12	2008-02-05			ENSG00000124713	ENSG00000124713			4415	protein-coding gene	gene with protein product		606628				10843803, 9495250	Standard	NM_018960		Approved		uc003otd.3	Q14749	OTTHUMG00000014712	ENST00000372808.3:c.530A>C	6.37:g.42930888A>C	ENSP00000361894:p.His177Pro	Somatic		Capture	SOLID	Phase_I	43038866	NM_018960	Q5T8W2|Q9NNZ1|Q9NS24	Missense_Mutation	SNP	ENST00000372808.3	37	CCDS4876.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.370981	0.82573	.	.	ENSG00000124713	ENST00000372808	T	0.68765	-0.35	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.77519	0.4142	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77667	-0.2502	10	0.38643	T	0.18	-0.0392	15.7099	0.77620	1.0:0.0:0.0:0.0	.	177	Q14749	GNMT_HUMAN	P	177	ENSP00000361894:H177P	ENSP00000361894:H177P	H	+	2	0	GNMT	43038866	1.000000	0.71417	0.661000	0.29709	0.895000	0.52256	6.759000	0.74934	2.196000	0.70406	0.459000	0.35465	CAT		0.622	GNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040568.1	NM_018960	
MCM3	4172	hgsc.bcm.edu	37	6	52144207	52144207	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:52144207T>A	ENST00000229854.7	-	5	798	c.722A>T	c.(721-723)tAc>tTc	p.Y241F	MCM3_ENST00000419835.2_Missense_Mutation_p.Y195F|MCM3_ENST00000596288.1_Missense_Mutation_p.Y286F|MCM3_ENST00000476448.1_5'UTR			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	241					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					AAGGCAACGGTAGGTTCCCAC	0.552																																					p.Y241F												.	.	0			c.A722T	6						.						76.0	76.0	76.0					6																	52144207		2203	4300	6503	52252166	SO:0001583	missense	4172	exon5			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.722A>T	6.37:g.52144207T>A	ENSP00000229854:p.Tyr241Phe	None		Capture	SOLID	Phase_I	52252166	NM_002388	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	ENST00000229854.7	37		.	.	.	.	.	.	.	.	.	.	T	15.28	2.787321	0.49997	.	.	ENSG00000112118	ENST00000229854;ENST00000419835	T;T	0.54866	0.55;0.55	6.07	6.07	0.98685	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.33411	0.0862	L	0.45470	1.425	0.80722	D	1	B;B	0.23735	0.09;0.09	B;B	0.29353	0.101;0.053	T	0.23655	-1.0182	10	0.36615	T	0.2	-18.5558	12.274	0.54724	0.127:0.0:0.0:0.873	.	195;241	B4DUQ9;P25205	.;MCM3_HUMAN	F	241;195	ENSP00000229854:Y241F;ENSP00000388647:Y195F	ENSP00000229854:Y241F	Y	-	2	0	MCM3	52252166	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.939000	0.63526	2.326000	0.78906	0.533000	0.62120	TAC		0.552	MCM3-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470784.1		
MICAL1	64780	hgsc.bcm.edu	37	6	109770019	109770023	+	Frame_Shift_Del	DEL	CCCGG	CCCGG	-			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	CCCGG	CCCGG	CCCGG	CCCGG	CCCGG	CCCGG	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:109770019_109770023delCCCGG	ENST00000358807.3	-	12	1887_1891	c.1576_1580delCCGGG	c.(1576-1581)ccgggafs	p.PG526fs	MICAL1_ENST00000358577.3_Frame_Shift_Del_p.PG440fs|MICAL1_ENST00000483856.1_5'Flank|MICAL1_ENST00000368952.4_Frame_Shift_Del_p.PG545fs	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	526	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		GACGTGGACTCCCGGGTACCCAGCT	0.654																																					p.440_441del												.	.	0			c.1318_1322del	6						.																																			109876716	SO:0001589	frameshift_variant	64780	exon11			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.1576_1580delCCGGG	6.37:g.109770019_109770023delCCCGG	ENSP00000351664:p.Pro526fs	None		Capture	SOLID	Phase_I	109876712	NM_001159291	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Frame_Shift_Del	DEL	ENST00000358807.3	37	CCDS5076.1																																																																																				0.654	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
PDE10A	10846	hgsc.bcm.edu	37	6	165809905	165809905	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr6:165809905G>A	ENST00000366882.1	-	15	1446	c.1292C>T	c.(1291-1293)aCg>aTg	p.T431M	PDE10A_ENST00000539869.2_Missense_Mutation_p.T441M|PDE10A_ENST00000354448.4_Missense_Mutation_p.T431M			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	431					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.T431M(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	CTTTTCCATCGTTACCCGGTA	0.393																																					p.T431M	Esophageal Squamous(22;308 615 5753 12038 40624)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1292T	6						.						190.0	159.0	170.0					6																	165809905		2203	4300	6503	165729895	SO:0001583	missense	10846	exon15			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1292C>T	6.37:g.165809905G>A	ENSP00000355847:p.Thr431Met	Somatic		Capture	SOLID	Phase_I	165729895	NM_006661	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37		.	.	.	.	.	.	.	.	.	.	G	22.0	4.233162	0.79688	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.69806	-0.43;-0.43	5.34	5.34	0.76211	.	1.162770	0.06098	N	0.664795	T	0.79981	0.4540	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.80764	0.994;0.882	T	0.71823	-0.4476	10	0.52906	T	0.07	.	19.0469	0.93025	0.0:0.0:1.0:0.0	.	441;431	Q9ULW9;Q9Y233	.;PDE10_HUMAN	M	431;459;441;431;430	ENSP00000355847:T431M;ENSP00000346435:T431M	ENSP00000341187:T441M	T	-	2	0	PDE10A	165729895	1.000000	0.71417	0.148000	0.22405	0.607000	0.37147	9.409000	0.97331	2.508000	0.84585	0.650000	0.86243	ACG		0.393	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
LGALS9B	284194	hgsc.bcm.edu	37	17	20359952	20359952	+	Silent	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:20359952G>A	ENST00000423676.3	-	4	429	c.366C>T	c.(364-366)taC>taT	p.Y122Y	LGALS9B_ENST00000324290.5_Silent_p.Y122Y			Q3B8N2	LEG9B_HUMAN	lectin, galactoside-binding, soluble, 9B	122	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)	p.Y122Y(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	10						CGCGGTGGAAGTACTGCACGA	0.627																																					p.Y122Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C366T	17						.						4.0	5.0	5.0					17																	20359952		795	2163	2958	20300544	SO:0001819	synonymous_variant	284194	exon4				CCDS42283.1	17p11.2	2011-08-04			ENSG00000170298	ENSG00000170298		"""Lectins, galactoside-binding"""	24842	protein-coding gene	gene with protein product						11997339	Standard	NM_001042685		Approved		uc002gwz.1	Q3B8N2	OTTHUMG00000130730	ENST00000423676.3:c.366C>T	17.37:g.20359952G>A		Somatic		Capture	SOLID	Phase_I	20300544	NM_001042685	A6NLF8|A8K2J8	Silent	SNP	ENST00000423676.3	37																																																																																					0.627	LGALS9B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000253230.2	NM_001042685	
KCNJ12	3768	hgsc.bcm.edu	37	17	21319369	21319369	+	Missense_Mutation	SNP	G	G	A	rs77048459	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:21319369G>A	ENST00000583088.1	+	3	1610	c.715G>A	c.(715-717)Gag>Aag	p.E239K	KCNJ12_ENST00000331718.5_Missense_Mutation_p.E239K	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	239				E -> K (in Ref. 2; AAC50615). {ECO:0000305}.	muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GCGGGTCACCGAGGAGGGCGA	0.617										Prostate(3;0.18)																											p.E239K												.	.	0			c.G715A	17						.						104.0	78.0	87.0					17																	21319369		2203	4300	6503	21259962	SO:0001583	missense	3768	exon3			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.715G>A	17.37:g.21319369G>A	ENSP00000463778:p.Glu239Lys	None		Capture	SOLID	Phase_I	21259962	NM_021012	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.365207	0.24684	.	.	ENSG00000184185	ENST00000331718	D	0.93426	-3.22	5.32	4.34	0.51931	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.166245	0.52532	D	0.000067	D	0.84620	0.5512	N	0.16130	0.375	0.48135	D	0.999596	P	0.37708	0.606	B	0.35655	0.207	T	0.83156	-0.0101	10	0.02654	T	1	.	15.9443	0.79782	0.0:0.1354:0.8646:0.0	.	239	Q14500	IRK12_HUMAN	K	239	ENSP00000328150:E239K	ENSP00000328150:E239K	E	+	1	0	KCNJ12	21259962	1.000000	0.71417	0.858000	0.33744	0.959000	0.62525	4.708000	0.61859	1.219000	0.43474	0.655000	0.94253	GAG		0.617	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
GSG2	83903	hgsc.bcm.edu	37	17	3628884	3628884	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:3628884G>T	ENST00000325418.4	+	1	1674	c.1655G>T	c.(1654-1656)cGc>cTc	p.R552L	ITGAE_ENST00000263087.4_Intron|ITGAE_ENST00000571185.1_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	552	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										GTGTGCAACCGCACAGAAGGC	0.483																																					p.R552L												.	.	0			c.G1655T	17						.						74.0	70.0	71.0					17																	3628884		2203	4300	6503	3575633	SO:0001583	missense	83903	exon1			AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.1655G>T	17.37:g.3628884G>T	ENSP00000325290:p.Arg552Leu	None		Capture	SOLID	Phase_I	3575633	NM_031965	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	ENST00000325418.4	37	CCDS11036.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.080193	0.36662	.	.	ENSG00000177602	ENST00000325418	T	0.59502	0.26	4.87	3.9	0.45041	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.186179	0.33346	N	0.005002	T	0.53867	0.1823	L	0.43923	1.385	0.40478	D	0.980416	P	0.40302	0.712	B	0.44085	0.44	T	0.60383	-0.7274	10	0.87932	D	0	-20.5972	11.3283	0.49460	0.0867:0.0:0.9133:0.0	.	552	Q8TF76	HASP_HUMAN	L	552	ENSP00000325290:R552L	ENSP00000325290:R552L	R	+	2	0	GSG2	3575633	0.999000	0.42202	0.996000	0.52242	0.121000	0.20230	2.593000	0.46180	1.376000	0.46267	0.655000	0.94253	CGC		0.483	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965	
FBXL20	84961	hgsc.bcm.edu	37	17	37420484	37420484	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:37420484G>A	ENST00000264658.6	-	14	1407	c.1147C>T	c.(1147-1149)Cgg>Tgg	p.R383W	FBXL20_ENST00000577399.1_Missense_Mutation_p.R385W|FBXL20_ENST00000583610.1_Missense_Mutation_p.R383W|FBXL20_ENST00000394294.3_Missense_Mutation_p.R351W	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	383					behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)		p.R383W(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			AGTTCTATCCGCTCAAGGCTA	0.512																																					p.R383W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1147T	17						.						155.0	136.0	142.0					17																	37420484		2203	4300	6503	34674010	SO:0001583	missense	84961	exon14			BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.1147C>T	17.37:g.37420484G>A	ENSP00000264658:p.Arg383Trp	Somatic		Capture	SOLID	Phase_I	34674010	NM_032875	A8K729|Q38J52	Missense_Mutation	SNP	ENST00000264658.6	37	CCDS32640.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.856694	0.71834	.	.	ENSG00000108306	ENST00000264658;ENST00000394294	T;T	0.12361	2.69;2.69	5.9	1.04	0.20106	.	0.000000	0.85682	D	0.000000	T	0.38983	0.1061	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.993;0.995	T	0.34800	-0.9814	10	0.72032	D	0.01	.	9.363	0.38208	0.0748:0.0:0.4229:0.5023	.	351;383	Q96IG2-2;Q96IG2	.;FXL20_HUMAN	W	383;351	ENSP00000264658:R383W;ENSP00000377832:R351W	ENSP00000264658:R383W	R	-	1	2	FBXL20	34674010	1.000000	0.71417	0.992000	0.48379	0.966000	0.64601	3.486000	0.53215	0.362000	0.24319	-0.251000	0.11542	CGG		0.512	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444315.2	NM_032875	
CDC27	996	hgsc.bcm.edu	37	17	45216162	45216162	+	Missense_Mutation	SNP	A	A	C	rs111227623		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:45216162A>C	ENST00000066544.3	-	13	1740	c.1647T>G	c.(1645-1647)gaT>gaG	p.D549E	CDC27_ENST00000531206.1_Missense_Mutation_p.D555E|CDC27_ENST00000446365.2_Missense_Mutation_p.D488E|CDC27_ENST00000527547.1_Missense_Mutation_p.D548E	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	549					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.D549E(4)|p.D555E(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AAAGAGCAACATCTTTTTGAA	0.348																																					p.D555E												CDC27,lung,NS,Substitution - Missense,0	.	6	Substitution - Missense(6)	large_intestine(4)|ovary(1)|lung(1)	c.T1665G	17						.						46.0	51.0	49.0					17																	45216162		2202	4299	6501	42571161	SO:0001583	missense	996	exon13			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1647T>G	17.37:g.45216162A>C	ENSP00000066544:p.Asp549Glu	None		Capture	SOLID	Phase_I	42571161	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	6.981	0.550975	0.13374	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.65364	-0.14;-0.15;0.15;-0.12	5.57	-0.476	0.12100	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	N	0.01473	-0.845	0.48040	D	0.999577	B;B;B;B	0.27192	0.052;0.171;0.171;0.052	B;B;B;B	0.27715	0.021;0.082;0.082;0.021	T	0.36261	-0.9755	10	0.02654	T	1	-6.7614	9.4643	0.38802	0.6029:0.0:0.3971:0.0	.	488;548;555;549	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	E	549;555;488;548	ENSP00000066544:D549E;ENSP00000434614:D555E;ENSP00000392802:D488E;ENSP00000437339:D548E	ENSP00000066544:D549E	D	-	3	2	CDC27	42571161	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.462000	0.35266	-0.146000	0.11274	-0.256000	0.11100	GAT		0.348	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
EPX	8288	hgsc.bcm.edu	37	17	56281759	56281759	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:56281759A>G	ENST00000225371.5	+	12	2233	c.2123A>G	c.(2122-2124)aAc>aGc	p.N708S		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	708					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	CCCAGGTTGAACCTATCAGCC	0.562																																					p.N708S												.	.	0			c.A2123G	17						.						57.0	50.0	53.0					17																	56281759		2203	4300	6503	53636758	SO:0001583	missense	8288	exon12			M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.2123A>G	17.37:g.56281759A>G	ENSP00000225371:p.Asn708Ser	None		Capture	SOLID	Phase_I	53636758	NM_000502	Q4TVP3	Missense_Mutation	SNP	ENST00000225371.5	37	CCDS11602.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096641	0.56075	.	.	ENSG00000121053	ENST00000225371	T	0.74106	-0.81	5.62	5.62	0.85841	.	0.183666	0.64402	D	0.000015	T	0.75191	0.3816	M	0.77486	2.375	0.35971	D	0.835313	B	0.18166	0.026	B	0.12156	0.007	T	0.78406	-0.2216	10	0.72032	D	0.01	-5.1684	13.7891	0.63128	1.0:0.0:0.0:0.0	.	708	P11678	PERE_HUMAN	S	708	ENSP00000225371:N708S	ENSP00000225371:N708S	N	+	2	0	EPX	53636758	0.998000	0.40836	0.768000	0.31515	0.841000	0.47740	3.946000	0.56644	2.140000	0.66376	0.460000	0.39030	AAC		0.562	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502	
RNF43	54894	hgsc.bcm.edu	37	17	56435552	56435552	+	Missense_Mutation	SNP	G	G	A	rs62636625	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:56435552G>A	ENST00000584437.1	-	8	3540	c.1585C>T	c.(1585-1587)Cgg>Tgg	p.R529W	RNF43_ENST00000583753.1_Missense_Mutation_p.R488W|RNF43_ENST00000577625.1_Missense_Mutation_p.R402W|RNF43_ENST00000500597.2_Missense_Mutation_p.R488W|RNF43_ENST00000577716.1_Missense_Mutation_p.R529W|RNF43_ENST00000407977.2_Missense_Mutation_p.R529W|RNF43_ENST00000581868.1_Missense_Mutation_p.R402W|BZRAP1-AS1_ENST00000583841.1_RNA			Q68DV7	RNF43_HUMAN	ring finger protein 43	529					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R529W(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GAACGAGGCCGAGAGGTCACA	0.582													G|||	39	0.00778754	0.0287	0.0014	5008	,	,		16364	0.0		0.0	False		,,,				2504	0.0				p.R529W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1585T	17						.	G	TRP/ARG	118,4288	88.7+/-127.4	2,114,2087	79.0	77.0	77.0		1585	1.7	1.0	17	dbSNP_129	77	0,8600		0,0,4300	yes	missense	RNF43	NM_017763.4	101	2,114,6387	AA,AG,GG		0.0,2.6782,0.9073	probably-damaging	529/784	56435552	118,12888	2203	4300	6503	53790551	SO:0001583	missense	54894	exon9				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.1585C>T	17.37:g.56435552G>A	ENSP00000463069:p.Arg529Trp	Somatic		Capture	SOLID	Phase_I	53790551	NM_017763	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	37	CCDS11607.1	10	0.004578754578754579	10	0.02032520325203252	0	0.0	0	0.0	0	0.0	G	16.51	3.144828	0.57044	0.026782	0.0	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.13089	2.73;2.62	5.12	1.7	0.24286	.	0.166964	0.39274	N	0.001413	T	0.09291	0.0229	L	0.36672	1.1	0.36431	D	0.864906	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.05468	-1.0883	10	0.72032	D	0.01	-9.8864	12.8488	0.57846	0.0:0.0:0.5763:0.4237	.	488;529;529	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	W	529;488	ENSP00000385328:R529W;ENSP00000441969:R488W	ENSP00000385328:R529W	R	-	1	2	RNF43	53790551	0.999000	0.42202	0.993000	0.49108	0.622000	0.37654	1.256000	0.32921	0.492000	0.27815	0.174000	0.16983	CGG		0.582	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763	
MRC2	9902	hgsc.bcm.edu	37	17	60744792	60744792	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:60744792C>T	ENST00000303375.5	+	6	1417	c.1015C>T	c.(1015-1017)Cgc>Tgc	p.R339C		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	339	C-type lectin 1. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.R339C(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						TGGAGTGATCCGCACTGAGTC	0.672																																					p.R339C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1015T	17						.						55.0	54.0	55.0					17																	60744792		2203	4300	6503	58098524	SO:0001583	missense	9902	exon6			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.1015C>T	17.37:g.60744792C>T	ENSP00000307513:p.Arg339Cys	Somatic		Capture	SOLID	Phase_I	58098524	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.481507	0.84747	.	.	ENSG00000011028	ENST00000303375	T	0.20463	2.07	4.69	4.69	0.59074	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.057225	0.64402	N	0.000002	T	0.46288	0.1385	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.36407	-0.9749	10	0.38643	T	0.18	-35.4236	17.802	0.88590	0.0:1.0:0.0:0.0	.	339	Q9UBG0	MRC2_HUMAN	C	339	ENSP00000307513:R339C	ENSP00000307513:R339C	R	+	1	0	MRC2	58098524	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.577000	0.60922	2.425000	0.82216	0.462000	0.41574	CGC		0.672	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
PITPNM3	83394	hgsc.bcm.edu	37	17	6380486	6380486	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:6380486C>A	ENST00000262483.8	-	9	1035	c.948G>T	c.(946-948)aaG>aaT	p.K316N	PITPNM3_ENST00000421306.3_Missense_Mutation_p.K280N	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	316	Ser-rich.				phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)	p.K316N(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		TGCTGAGACGCTTGCTGCTGG	0.572																																					p.K316N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G948T	17						.						127.0	99.0	109.0					17																	6380486		2203	4300	6503	6321210	SO:0001583	missense	83394	exon9			AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.948G>T	17.37:g.6380486C>A	ENSP00000262483:p.Lys316Asn	Somatic		Capture	SOLID	Phase_I	6321210	NM_031220	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	ENST00000262483.8	37	CCDS11076.1	.	.	.	.	.	.	.	.	.	.	C	14.10	2.433536	0.43224	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.46063	0.88;0.88	5.2	3.19	0.36642	.	0.104484	0.64402	D	0.000005	T	0.31104	0.0786	L	0.36672	1.1	0.33944	D	0.643668	P;P	0.47302	0.734;0.893	B;B	0.41571	0.36;0.232	T	0.45381	-0.9265	10	0.39692	T	0.17	.	9.9369	0.41556	0.0:0.8512:0.0:0.1488	.	280;316	F8WEW5;Q9BZ71	.;PITM3_HUMAN	N	316;280	ENSP00000262483:K316N;ENSP00000407882:K280N	ENSP00000262483:K316N	K	-	3	2	PITPNM3	6321210	0.998000	0.40836	0.999000	0.59377	0.995000	0.86356	0.852000	0.27764	2.432000	0.82394	0.563000	0.77884	AAG		0.572	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220	
STRADA	92335	hgsc.bcm.edu	37	17	61781386	61781386	+	Silent	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:61781386C>A	ENST00000336174.6	-	12	1234	c.1122G>T	c.(1120-1122)ctG>ctT	p.L374L	STRADA_ENST00000447001.3_Nonstop_Mutation_p.*300L|RP11-51F16.8_ENST00000580553.1_3'UTR|STRADA_ENST00000245865.5_3'UTR|STRADA_ENST00000375840.4_Silent_p.L316L|STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000582137.1_Nonstop_Mutation_p.*315L|STRADA_ENST00000392950.4_3'UTR	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	374	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.L374L(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						AAGAGTGGTTCAGGAGGGTGC	0.547																																					p.X315L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G944T	17						.						89.0	82.0	84.0					17																	61781386		2203	4300	6503	59135118	SO:0001819	synonymous_variant	92335	exon10			AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.1122G>T	17.37:g.61781386C>A		Somatic		Capture	SOLID	Phase_I	59135118	NM_001165969	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Silent	SNP	ENST00000336174.6	37	CCDS32703.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.891861	0.52014	.	.	ENSG00000125695	ENST00000447001	.	.	.	4.99	4.0	0.46444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8148	0.46569	0.1304:0.4941:0.3755:0.0	.	.	.	.	L	300	.	.	X	-	2	2	STRADA	59135118	0.912000	0.30974	1.000000	0.80357	0.985000	0.73830	-0.167000	0.09940	1.288000	0.44600	0.555000	0.69702	TGA		0.547	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443894.1		
SLC2A4	6517	hgsc.bcm.edu	37	17	7189059	7189059	+	Silent	SNP	G	G	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:7189059G>C	ENST00000317370.8	+	10	1426	c.1158G>C	c.(1156-1158)gtG>gtC	p.V386V	SLC2A4_ENST00000571308.1_Silent_p.V386V|RP1-4G17.2_ENST00000576271.1_RNA|SLC2A4_ENST00000424875.2_Silent_p.V376V	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	386					amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)	p.V386V(1)		breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						TCTCCATTGTGGCCATCTTTG	0.587																																					p.V386V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1158C	17						.						95.0	87.0	90.0					17																	7189059		2203	4300	6503	7129783	SO:0001819	synonymous_variant	6517	exon10			M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.1158G>C	17.37:g.7189059G>C		Somatic		Capture	SOLID	Phase_I	7129783	NM_001042	Q05BQ3|Q14CX2	Silent	SNP	ENST00000317370.8	37	CCDS11097.1																																																																																				0.587	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220031.3		
KIAA0195	9772	hgsc.bcm.edu	37	17	73487443	73487443	+	Silent	SNP	T	T	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr17:73487443T>C	ENST00000314256.7	+	13	1687	c.1293T>C	c.(1291-1293)acT>acC	p.T431T	KIAA0195_ENST00000579208.1_Silent_p.T82T|KIAA0195_ENST00000375248.5_Silent_p.T441T	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	431						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.T431T(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCCCAGAGACTGTACTGTTCT	0.577																																					p.T431T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1293C	17						.						107.0	94.0	98.0					17																	73487443		2203	4300	6503	70999038	SO:0001819	synonymous_variant	9772	exon13				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.1293T>C	17.37:g.73487443T>C		Somatic		Capture	SOLID	Phase_I	70999038	NM_014738	O75536|Q86XF1	Silent	SNP	ENST00000314256.7	37	CCDS32732.1																																																																																				0.577	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738	
GRIK1	2897	hgsc.bcm.edu	37	21	31045406	31045406	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr21:31045406C>T	ENST00000399907.1	-	4	1034	c.623G>A	c.(622-624)gGg>gAg	p.G208E	GRIK1_ENST00000389124.2_Missense_Mutation_p.G208E|GRIK1_ENST00000309434.7_Missense_Mutation_p.G208E|GRIK1_ENST00000472429.1_5'UTR|GRIK1_ENST00000389125.3_Missense_Mutation_p.G208E|GRIK1_ENST00000535441.1_Missense_Mutation_p.G208E|GRIK1_ENST00000399909.1_Missense_Mutation_p.G208E|GRIK1_ENST00000399913.1_Missense_Mutation_p.G208E|GRIK1_ENST00000327783.4_Missense_Mutation_p.G208E|GRIK1_ENST00000399914.1_Missense_Mutation_p.G208E	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	208					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.G208E(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	ATCTTTATTCCCAGAGGGCAG	0.398																																					p.G208E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G623A	21						.						113.0	121.0	119.0					21																	31045406		2203	4300	6503	29967277	SO:0001583	missense	2897	exon4				CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.623G>A	21.37:g.31045406C>T	ENSP00000382791:p.Gly208Glu	Somatic		Capture	SOLID	Phase_I	29967277	NM_175611	Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	37	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366295	0.41902	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86	5.5	4.61	0.57282	Extracellular ligand-binding receptor (1);	0.640055	0.16045	N	0.232247	T	0.24586	0.0596	L	0.35854	1.095	0.80722	D	1	B;B;B;B;B;B	0.13594	0.0;0.008;0.001;0.008;0.008;0.007	B;B;B;B;B;B	0.23150	0.011;0.044;0.006;0.044;0.044;0.017	T	0.02975	-1.1087	10	0.32370	T	0.25	.	16.3278	0.82994	0.0:0.868:0.132:0.0	.	208;208;208;208;208;208	E7EPY9;E9PD61;E7EPZ0;B7Z3V7;P39086;P39086-2	.;.;.;.;GRIK1_HUMAN;.	E	208;208;208;208;208;152;208;208;208;208	ENSP00000327687:G208E;ENSP00000373777:G208E;ENSP00000382797:G208E;ENSP00000382798:G208E;ENSP00000446326:G208E;ENSP00000373776:G208E;ENSP00000382791:G208E;ENSP00000382793:G208E;ENSP00000311646:G208E	ENSP00000311646:G208E	G	-	2	0	GRIK1	29967277	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.900000	0.69853	1.523000	0.49018	0.650000	0.86243	GGG		0.398	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
PCP4	5121	hgsc.bcm.edu	37	21	41300964	41300964	+	Silent	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr21:41300964A>G	ENST00000328619.5	+	3	302	c.117A>G	c.(115-117)acA>acG	p.T39T	PCP4_ENST00000468717.1_3'UTR	NM_006198.2	NP_006189.2	P48539	PCP4_HUMAN	Purkinje cell protein 4	39	IQ.				central nervous system development (GO:0007417)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.T39T(1)		large_intestine(2)|lung(1)|skin(1)	4		Prostate(19;2.65e-06)|all_epithelial(19;0.138)				CACCAGAGACAGAACGTGCAG	0.473																																					p.T39T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A117G	21						.						113.0	103.0	107.0					21																	41300964		2203	4300	6503	40222834	SO:0001819	synonymous_variant	5121	exon3			X93349, U53709	CCDS33563.1	21q22.2	2006-12-01			ENSG00000183036	ENSG00000183036			8742	protein-coding gene	gene with protein product		601629				8931698, 8914602	Standard	NM_006198		Approved	PEP-19	uc002yyp.3	P48539	OTTHUMG00000086731	ENST00000328619.5:c.117A>G	21.37:g.41300964A>G		Somatic		Capture	SOLID	Phase_I	40222834	NM_006198	A6NDJ9|Q6ICS4|Q93059	Silent	SNP	ENST00000328619.5	37	CCDS33563.1																																																																																				0.473	PCP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195025.1	NM_006198	
SNRNP25	79622	hgsc.bcm.edu	37	16	105489	105489	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr16:105489G>T	ENST00000383018.3	+	2	261	c.100G>T	c.(100-102)Gcc>Tcc	p.A34S	POLR3K_ENST00000293860.5_5'Flank|SNRNP25_ENST00000493672.1_3'UTR	NM_024571.3	NP_078847.1	Q9BV90	SNR25_HUMAN	small nuclear ribonucleoprotein 25kDa (U11/U12)	34					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)		p.A34S(1)		large_intestine(1)|lung(2)	3						CTCCCAAATAGCCCTAGAATA	0.498																																					p.A34S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G100T	16						.						207.0	180.0	189.0					16																	105489		2203	4300	6503	45489	SO:0001583	missense	79622	exon2			BC001381	CCDS10396.1	16p13.3	2011-10-11	2008-10-29	2008-10-29	ENSG00000161981	ENSG00000161981			14161	protein-coding gene	gene with protein product	"""U11/U12 snRNP 25K"""		"""chromosome 16 open reading frame 33"""	C16orf33		15146077	Standard	NM_024571		Approved		uc002cfj.4	Q9BV90	OTTHUMG00000060720	ENST00000383018.3:c.100G>T	16.37:g.105489G>T	ENSP00000372482:p.Ala34Ser	Somatic		Capture	SOLID	Phase_I	45489	NM_024571	Q1W6H3|Q6IEF8|Q9H5W4	Missense_Mutation	SNP	ENST00000383018.3	37	CCDS10396.1	.	.	.	.	.	.	.	.	.	.	.	15.08	2.728610	0.48833	.	.	ENSG00000161981	ENST00000293861;ENST00000383018;ENST00000417493	.	.	.	5.58	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.75236	0.3822	L	0.61387	1.9	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.75918	-0.3148	9	0.48119	T	0.1	-14.2556	13.1714	0.59599	0.0772:0.0:0.9228:0.0	.	34	Q9BV90	SNR25_HUMAN	S	25;34;25	.	ENSP00000293861:A25S	A	+	1	0	SNRNP25	45489	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	8.545000	0.90657	1.379000	0.46325	-0.251000	0.11542	GCC		0.498	SNRNP25-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_024571	
ZNF200	7752	hgsc.bcm.edu	37	16	3282858	3282858	+	Missense_Mutation	SNP	G	G	T	rs147975246	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr16:3282858G>T	ENST00000431561.3	-	3	926	c.314C>A	c.(313-315)tCt>tAt	p.S105Y	ZNF200_ENST00000396871.4_Missense_Mutation_p.S105Y|ZNF200_ENST00000396870.4_Missense_Mutation_p.S105Y|ZNF200_ENST00000396868.3_Missense_Mutation_p.S105Y|ZNF200_ENST00000575948.1_Missense_Mutation_p.S105Y|ZNF200_ENST00000414144.2_Missense_Mutation_p.S105Y	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.S105Y(1)		breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						CAAATACAGAGACACTGTCTC	0.463																																					p.S105Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C314A	16						.						113.0	99.0	104.0					16																	3282858		2197	4299	6496	3222859	SO:0001583	missense	7752	exon3			AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.314C>A	16.37:g.3282858G>T	ENSP00000395723:p.Ser105Tyr	Somatic		Capture	SOLID	Phase_I	3222859	NM_003454	D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Missense_Mutation	SNP	ENST00000431561.3	37	CCDS10497.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.274297	0.40194	.	.	ENSG00000010539	ENST00000396870;ENST00000396868;ENST00000396871;ENST00000414144;ENST00000431561	T;T;T;T;T	0.06849	3.25;3.28;3.25;3.32;3.32	4.57	4.57	0.56435	.	0.201388	0.25076	N	0.033333	T	0.17450	0.0419	L	0.44542	1.39	0.09310	N	1	D;D;D	0.58620	0.971;0.971;0.983	P;P;P	0.58873	0.707;0.707;0.847	T	0.01468	-1.1347	10	0.72032	D	0.01	-18.7742	13.0489	0.58944	0.0:0.0:1.0:0.0	.	105;105;105	D3DUB7;P98182;P98182-2	.;ZN200_HUMAN;.	Y	105	ENSP00000380079:S105Y;ENSP00000380077:S105Y;ENSP00000380080:S105Y;ENSP00000405786:S105Y;ENSP00000395723:S105Y	ENSP00000380077:S105Y	S	-	2	0	ZNF200	3222859	0.002000	0.14202	0.613000	0.29037	0.096000	0.18686	1.041000	0.30291	2.548000	0.85928	0.650000	0.86243	TCT		0.463	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000437545.1		
UBN1	29855	hgsc.bcm.edu	37	16	4924504	4924504	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr16:4924504C>T	ENST00000396658.4	+	14	2796	c.2093C>T	c.(2092-2094)cCc>cTc	p.P698L	UBN1_ENST00000590769.1_Missense_Mutation_p.P698L|UBN1_ENST00000262376.6_Missense_Mutation_p.P698L|UBN1_ENST00000545171.1_Missense_Mutation_p.P698L	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	698					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P698L(1)		NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						CTGCCTGCACCCTCAAAAGCA	0.502																																					p.P698L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2093T	16						.						123.0	135.0	131.0					16																	4924504		2197	4300	6497	4864505	SO:0001583	missense	29855	exon14			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.2093C>T	16.37:g.4924504C>T	ENSP00000379894:p.Pro698Leu	Somatic		Capture	SOLID	Phase_I	4864505	NM_016936	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	C	12.67	2.007813	0.35415	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.49720	1.37;0.77;1.37	4.81	4.81	0.61882	.	0.386506	0.24698	N	0.036330	T	0.31575	0.0801	L	0.29908	0.895	0.09310	N	0.999993	B;P	0.34977	0.122;0.478	B;B	0.24541	0.054;0.048	T	0.35351	-0.9792	10	0.62326	D	0.03	-7.3281	10.7802	0.46374	0.0:0.9133:0.0:0.0867	.	698;698	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	L	698	ENSP00000262376:P698L;ENSP00000442379:P698L;ENSP00000379894:P698L	ENSP00000262376:P698L	P	+	2	0	UBN1	4864505	0.049000	0.20398	0.106000	0.21319	0.969000	0.65631	2.699000	0.47077	2.506000	0.84524	0.462000	0.41574	CCC		0.502	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936	
ERN2	10595	hgsc.bcm.edu	37	16	23706601	23706601	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr16:23706601C>G	ENST00000457008.2	-	14	1602	c.1564G>C	c.(1564-1566)Gtg>Ctg	p.V522L	ERN2_ENST00000256797.4_Missense_Mutation_p.V622L					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TAGCGGAGCACGTTGGGGTGC	0.632																																					p.V622L												.	.	0			c.G1864C	16						.						33.0	35.0	34.0					16																	23706601		2197	4300	6497	23614102	SO:0001583	missense	10595	exon15			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1564G>C	16.37:g.23706601C>G	ENSP00000413812:p.Val522Leu	None		Capture	SOLID	Phase_I	23614102	NM_033266		Missense_Mutation	SNP	ENST00000457008.2	37		.	.	.	.	.	.	.	.	.	.	C	35	5.468203	0.96274	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.52754	0.65;0.65	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.54271	0.1848	N	0.16016	0.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.60672	-0.7217	10	0.87932	D	0	.	17.5778	0.87956	0.0:1.0:0.0:0.0	.	522;574	E7ETG2;A5YM65	.;.	L	622;522	ENSP00000256797:V622L;ENSP00000413812:V522L	ENSP00000256797:V622L	V	-	1	0	ERN2	23614102	1.000000	0.71417	0.961000	0.40146	0.931000	0.56810	7.445000	0.80570	2.825000	0.97269	0.655000	0.94253	GTG		0.632	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
HYDIN	54768	hgsc.bcm.edu	37	16	71061731	71061731	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr16:71061731C>T	ENST00000393567.2	-	20	2966	c.2816G>A	c.(2815-2817)cGg>cAg	p.R939Q	HYDIN_ENST00000448089.2_Missense_Mutation_p.R939Q|HYDIN_ENST00000448691.1_Missense_Mutation_p.R939Q|HYDIN_ENST00000321489.5_Missense_Mutation_p.R939Q	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	939					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.R939Q(6)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CTGTTGGATCCGACGTCCCTT	0.498																																					p.R939Q												.	.	6	Substitution - Missense(6)	large_intestine(6)	c.G2816A	16						.						4.0	3.0	3.0					16																	71061731		1548	3175	4723	69619232	SO:0001583	missense	54768	exon20			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2816G>A	16.37:g.71061731C>T	ENSP00000377197:p.Arg939Gln	Somatic		Capture	SOLID	Phase_I	69619232	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	35	5.433403	0.96150	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489	T;T;T;T	0.07327	3.2;3.2;3.2;3.2	5.07	5.07	0.68467	.	0.000000	0.31020	U	0.008406	T	0.33323	0.0859	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.10314	-1.0635	10	0.29301	T	0.29	.	18.0946	0.89485	0.0:1.0:0.0:0.0	.	939;939	Q4G0P3-5;F8WD23	.;.	Q	939	ENSP00000377197:R939Q;ENSP00000398544:R939Q;ENSP00000394826:R939Q;ENSP00000314736:R939Q	ENSP00000313052:R939Q	R	-	2	0	HYDIN	69619232	1.000000	0.71417	0.990000	0.47175	0.947000	0.59692	4.720000	0.61944	2.400000	0.81607	0.499000	0.49734	CGG		0.498	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
MAF	4094	hgsc.bcm.edu	37	16	79632737	79632737	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr16:79632737C>T	ENST00000393350.1	-	1	1874	c.1063G>A	c.(1063-1065)Ggc>Agc	p.G355S	MAF_ENST00000326043.4_Missense_Mutation_p.G355S|MAF_ENST00000569649.1_Missense_Mutation_p.G355S	NM_001031804.2	NP_001026974.1	O75444	MAF_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog	355	Represses ARE-mediated transcription.				cell development (GO:0048468)|cytokine production (GO:0001816)|inner ear development (GO:0048839)|lens fiber cell differentiation (GO:0070306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of chondrocyte differentiation (GO:0032330)|transcription from RNA polymerase II promoter (GO:0006366)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G355S(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)	10		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		TCTCGGAAGCCGCTGCTCACC	0.577			T	IGH@	MM																																p.G355S			Dom	yes		16	16q22-q23	4094	v-maf musculoaponeurotic fibrosarcoma oncogene homolog		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1063A	16						.						63.0	63.0	63.0					16																	79632737		2198	4300	6498	78190238	SO:0001583	missense	4094	exon1				CCDS10928.1, CCDS42198.1	16q22-q23	2013-07-09	2013-07-09		ENSG00000178573	ENSG00000178573			6776	protein-coding gene	gene with protein product		177075				14998484	Standard	NM_005360		Approved	c-MAF	uc002ffm.3	O75444	OTTHUMG00000137621	ENST00000393350.1:c.1063G>A	16.37:g.79632737C>T	ENSP00000377019:p.Gly355Ser	Somatic		Capture	SOLID	Phase_I	78190238	NM_001031804	Q66I47|Q9UP93	Missense_Mutation	SNP	ENST00000393350.1	37	CCDS42198.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.794059	0.90453	.	.	ENSG00000178573	ENST00000326043;ENST00000393350	D;D	0.97430	-4.38;-4.36	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	D	0.93776	0.8010	L	0.41027	1.25	0.58432	D	0.999999	P;B	0.42827	0.791;0.395	B;B	0.34346	0.177;0.18	D	0.93817	0.7115	10	0.39692	T	0.17	-14.9415	17.0445	0.86498	0.0:1.0:0.0:0.0	.	355;355	O75444;O75444-1	MAF_HUMAN;.	S	355	ENSP00000327048:G355S;ENSP00000377019:G355S	ENSP00000327048:G355S	G	-	1	0	MAF	78190238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.499000	0.81566	2.085000	0.62840	0.549000	0.68633	GGC		0.577	MAF-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317037.1		
WFDC1	58189	hgsc.bcm.edu	37	16	84328646	84328646	+	Silent	SNP	A	A	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr16:84328646A>C	ENST00000219454.5	+	1	395	c.69A>C	c.(67-69)ctA>ctC	p.L23L	RP11-558A11.2_ENST00000569200.1_RNA|WFDC1_ENST00000568638.1_Silent_p.L23L	NM_001282466.1|NM_001282467.1	NP_001269395.1|NP_001269396.1	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1	23					negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|response to drug (GO:0042493)|response to estradiol (GO:0032355)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.L23L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)	9						GCCTCTTGCTACTTCTCCTCC	0.627																																					p.L23L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A69C	16						.						78.0	87.0	84.0					16																	84328646		2200	4300	6500	82886147	SO:0001819	synonymous_variant	58189	exon1			AF302109	CCDS10946.1	16q24.1	2013-01-21			ENSG00000103175	ENSG00000103175		"""WAP four-disulfide core domain containing"""	15466	protein-coding gene	gene with protein product		605322				10967136	Standard	NM_021197		Approved	PS20	uc002fhw.3	Q9HC57	OTTHUMG00000137641	ENST00000219454.5:c.69A>C	16.37:g.84328646A>C		Somatic		Capture	SOLID	Phase_I	82886147	NM_021197	D3DUL7|Q8NC27|Q9HAU1	Silent	SNP	ENST00000219454.5	37	CCDS10946.1																																																																																				0.627	WFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269083.2		
CA5A	763	hgsc.bcm.edu	37	16	87936077	87936077	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr16:87936077G>T	ENST00000309893.2	-	4	574	c.509C>A	c.(508-510)gCt>gAt	p.A170D		NM_001739.1	NP_001730.1	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial	170					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(80;0.0513)	Brinzolamide(DB01194)|Zonisamide(DB00909)	TCCCACGACAGCTTCCTTGTA	0.388																																					p.A170D												.	.	0			c.C509A	16						.						77.0	71.0	73.0					16																	87936077		2198	4300	6498	86493578	SO:0001583	missense	763	exon4			L19297	CCDS10965.1	16q24.2	2012-08-21			ENSG00000174990	ENSG00000174990	4.2.1.1	"""Carbonic anhydrases"""	1377	protein-coding gene	gene with protein product		114761		CA5		8356065, 7490083	Standard	NM_001739		Approved	CAV, CAVA	uc002fkn.1	P35218	OTTHUMG00000137677	ENST00000309893.2:c.509C>A	16.37:g.87936077G>T	ENSP00000309649:p.Ala170Asp	None		Capture	SOLID	Phase_I	86493578	NM_001739	B2RPF2	Missense_Mutation	SNP	ENST00000309893.2	37	CCDS10965.1	.	.	.	.	.	.	.	.	.	.	g	16.97	3.268637	0.59540	.	.	ENSG00000174990	ENST00000309893	T	0.78924	-1.22	4.82	4.82	0.62117	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.92443	0.7601	H	0.98542	4.26	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	D	0.95303	0.8405	10	0.87932	D	0	-17.7777	15.3837	0.74681	0.0:0.0:1.0:0.0	.	170	P35218	CAH5A_HUMAN	D	170	ENSP00000309649:A170D	ENSP00000309649:A170D	A	-	2	0	CA5A	86493578	1.000000	0.71417	0.042000	0.18584	0.498000	0.33706	6.823000	0.75282	2.223000	0.72356	0.484000	0.47621	GCT		0.388	CA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269164.1	NM_001739	
DYM	54808	hgsc.bcm.edu	37	18	46570466	46570466	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr18:46570466T>G	ENST00000269445.6	-	17	2426	c.1969A>C	c.(1969-1971)Aat>Cat	p.N657H	DYM_ENST00000442713.2_Missense_Mutation_p.N467H|RP11-15F12.1_ENST00000584252.1_RNA	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	657					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)	p.N657H(1)		NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						TCCTGTGGATTCCAGTACAGG	0.507																																					p.N657H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1969C	18						.						138.0	151.0	147.0					18																	46570466		2203	4300	6503	44824464	SO:0001583	missense	54808	exon17			AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.1969A>C	18.37:g.46570466T>G	ENSP00000269445:p.Asn657His	Somatic		Capture	SOLID	Phase_I	44824464	NM_017653	A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Missense_Mutation	SNP	ENST00000269445.6	37	CCDS11937.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.950876	0.73787	.	.	ENSG00000141627	ENST00000442713;ENST00000269445	T;D	0.83673	-1.16;-1.75	5.91	5.91	0.95273	.	0.306933	0.33217	N	0.005144	D	0.84334	0.5449	L	0.49126	1.545	0.80722	D	1	P;B	0.35656	0.514;0.38	P;B	0.44518	0.452;0.265	D	0.85020	0.0911	10	0.66056	D	0.02	-11.9907	16.0218	0.80503	0.0:0.0:0.0:1.0	.	467;657	Q7RTS9-2;Q7RTS9	.;DYM_HUMAN	H	467;657	ENSP00000395942:N467H;ENSP00000269445:N657H	ENSP00000269445:N657H	N	-	1	0	DYM	44824464	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	5.933000	0.70130	2.254000	0.74563	0.533000	0.62120	AAT		0.507	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255912.3	NM_017653	
SMAD4	4089	hgsc.bcm.edu	37	18	48591919	48591919	+	Missense_Mutation	SNP	G	G	A	rs377767347		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr18:48591919G>A	ENST00000342988.3	+	9	1620	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	SMAD4_ENST00000398417.2_Missense_Mutation_p.R361H|SMAD4_ENST00000588745.1_Missense_Mutation_p.R265H	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361H(12)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGAGGAGATCGCTTTTGTTTG	0.413																																					p.R361H												SMAD4,small_intestine,duodenum,Substitution - Missense,+1	.	50	Whole gene deletion(36)|Substitution - Missense(12)|Unknown(2)	pancreas(26)|large_intestine(13)|lung(3)|breast(3)|upper_aerodigestive_tract(2)|stomach(2)|oesophagus(1)	c.G1082A	18	GRCh37	CM004254	SMAD4	M		.						167.0	138.0	148.0					18																	48591919		2203	4300	6503	46845917	SO:0001583	missense	4089	exon9			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1082G>A	18.37:g.48591919G>A	ENSP00000341551:p.Arg361His	Somatic		Capture	SOLID	Phase_I	46845917	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	35	5.477304	0.96291	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98120	-4.73;-4.73	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99741	1.1015	10	0.87932	D	0	.	18.9646	0.92691	0.0:0.0:1.0:0.0	.	361	Q13485	SMAD4_HUMAN	H	361	ENSP00000341551:R361H;ENSP00000381452:R361H	ENSP00000341551:R361H	R	+	2	0	SMAD4	46845917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.828000	0.86729	2.771000	0.95319	0.563000	0.77884	CGC		0.413	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
HCLS1	3059	hgsc.bcm.edu	37	3	121376175	121376175	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr3:121376175G>A	ENST00000314583.3	-	3	200	c.109C>T	c.(109-111)Cga>Tga	p.R37*	RNU4-62P_ENST00000410125.1_RNA|HCLS1_ENST00000428394.2_Nonsense_Mutation_p.R37*	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	37	Involved in HAX-1 binding.				actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)	p.R37*(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		GCTCCCCATCGTTGCTCCTTT	0.517																																					p.R37X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C109T	3						.						221.0	190.0	201.0					3																	121376175		2203	4300	6503	122858865	SO:0001587	stop_gained	3059	exon3				CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.109C>T	3.37:g.121376175G>A	ENSP00000320176:p.Arg37*	Somatic		Capture	SOLID	Phase_I	122858865	NM_005335	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Nonsense_Mutation	SNP	ENST00000314583.3	37	CCDS3003.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.636148	0.87760	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.5621	16.1002	0.81166	0.0:0.0:1.0:0.0	.	.	.	.	X	37	.	ENSP00000320176:R37X	R	-	1	2	HCLS1	122858865	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	1.809000	0.38922	2.661000	0.90470	0.655000	0.94253	CGA		0.517	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355144.1	NM_005335	
SCN10A	6336	hgsc.bcm.edu	37	3	38755505	38755505	+	Nonsense_Mutation	SNP	G	G	A	rs202134330		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr3:38755505G>A	ENST00000449082.2	-	21	3747	c.3748C>T	c.(3748-3750)Cga>Tga	p.R1250*		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1250					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R1250*(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CGAAGGGTTCGAAGGGCTTTG	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		18237	0.0		0.001	False		,,,				2504	0.0				p.R1250X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3748T	3						.						101.0	102.0	101.0					3																	38755505		2203	4300	6503	38730509	SO:0001587	stop_gained	6336	exon21			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3748C>T	3.37:g.38755505G>A	ENSP00000390600:p.Arg1250*	Somatic		Capture	SOLID	Phase_I	38730509	NM_006514	A6NDQ1	Nonsense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	37	6.483951	0.97603	.	.	ENSG00000185313	ENST00000449082	.	.	.	4.23	3.3	0.37823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1971	0.54303	0.0:0.0:0.6636:0.3364	.	.	.	.	X	1250	.	ENSP00000390600:R1250X	R	-	1	2	SCN10A	38730509	0.997000	0.39634	0.998000	0.56505	0.093000	0.18481	2.542000	0.45744	2.181000	0.69327	0.411000	0.27672	CGA		0.522	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
TRAK1	22906	hgsc.bcm.edu	37	3	42226218	42226218	+	Silent	SNP	G	G	A	rs141558684		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr3:42226218G>A	ENST00000327628.5	+	4	805	c.405G>A	c.(403-405)tcG>tcA	p.S135S	TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000341421.3_Silent_p.S77S|TRAK1_ENST00000449246.1_Silent_p.S61S|TRAK1_ENST00000396175.1_Silent_p.S77S	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	135	HAP1 N-terminal.				endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.S77S(2)|p.S135S(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						TCGGCCAGTCGTTGTTGAAGA	0.512																																					p.S135S	GBM(44;195 884 22595 31865 41850)											.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G405A	3						.	G	,	1,4405	2.1+/-5.4	0,1,2202	113.0	115.0	114.0		405,231	0.7	1.0	3	dbSNP_134	114	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TRAK1	NM_001042646.1,NM_014965.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	135/954,77/687	42226218	1,13005	2203	4300	6503	42201222	SO:0001819	synonymous_variant	22906	exon4				CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.405G>A	3.37:g.42226218G>A		Somatic		Capture	SOLID	Phase_I	42201222	NM_001042646	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Silent	SNP	ENST00000327628.5	37	CCDS43072.1																																																																																				0.512	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
ATRIP	84126	hgsc.bcm.edu	37	3	48501641	48501641	+	Silent	SNP	T	T	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr3:48501641T>G	ENST00000320211.3	+	8	1301	c.1188T>G	c.(1186-1188)cgT>cgG	p.R396R	ATRIP_ENST00000412052.1_Silent_p.R303R|ATRIP_ENST00000346691.4_Silent_p.R396R|ATRIP_ENST00000357105.6_Silent_p.R269R	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	396					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R396R(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGTGCTCACGTGATGGAGACC	0.552								Other conserved DNA damage response genes																													p.R396R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1188G	3						.						104.0	97.0	99.0					3																	48501641		2203	4300	6503	48476645	SO:0001819	synonymous_variant	84126	exon8			AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.1188T>G	3.37:g.48501641T>G		Somatic		Capture	SOLID	Phase_I	48476645	NM_130384	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Silent	SNP	ENST00000320211.3	37	CCDS2768.1																																																																																				0.552	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384	
ATRIP	84126	hgsc.bcm.edu	37	3	48502037	48502037	+	Silent	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr3:48502037G>A	ENST00000320211.3	+	8	1697	c.1584G>A	c.(1582-1584)ggG>ggA	p.G528G	ATRIP_ENST00000412052.1_Silent_p.G435G|ATRIP_ENST00000346691.4_Silent_p.G528G|ATRIP_ENST00000357105.6_Silent_p.G401G	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	528					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G528G(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCCTAAGGGGGGTTGCTGATG	0.527								Other conserved DNA damage response genes																													p.G528G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1584A	3						.						88.0	85.0	86.0					3																	48502037		2203	4300	6503	48477041	SO:0001819	synonymous_variant	84126	exon8			AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.1584G>A	3.37:g.48502037G>A		Somatic		Capture	SOLID	Phase_I	48477041	NM_130384	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Silent	SNP	ENST00000320211.3	37	CCDS2768.1																																																																																				0.527	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384	
ATRIP	84126	hgsc.bcm.edu	37	3	48502041	48502042	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	GC	GC	GC	GC	GC	GC	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr3:48502041_48502042delGC	ENST00000320211.3	+	8	1701_1702	c.1588_1589delGC	c.(1588-1590)gctfs	p.A530fs	ATRIP_ENST00000412052.1_Frame_Shift_Del_p.A437fs|ATRIP_ENST00000346691.4_Frame_Shift_Del_p.A530fs|ATRIP_ENST00000357105.6_Frame_Shift_Del_p.A403fs	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	530					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AAGGGGGGTTGCTGATGACCAA	0.545								Other conserved DNA damage response genes																													p.530_530del												.	.	0			c.1588_1589del	3						.																																			48477046	SO:0001589	frameshift_variant	84126	exon8			AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.1588_1589delGC	3.37:g.48502041_48502042delGC	ENSP00000323099:p.Ala530fs	None		Capture	SOLID	Phase_I	48477045	NM_130384	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Frame_Shift_Del	DEL	ENST00000320211.3	37	CCDS2768.1																																																																																				0.545	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384	
RBM15B	29890	hgsc.bcm.edu	37	3	51430003	51430003	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr3:51430003T>G	ENST00000323686.4	+	1	1273	c.1173T>G	c.(1171-1173)caT>caG	p.H391Q		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	391	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.H391Q(1)		endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ACATGGCCCATAGGGCTAAGG	0.592																																					p.H391Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1173G	3						.						47.0	44.0	45.0					3																	51430003		2203	4300	6503	51405043	SO:0001583	missense	29890	exon1			AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.1173T>G	3.37:g.51430003T>G	ENSP00000313890:p.His391Gln	Somatic		Capture	SOLID	Phase_I	51405043	NM_013286	A4QPG7|Q6QE19|Q9BV96	Missense_Mutation	SNP	ENST00000323686.4	37	CCDS33764.1	.	.	.	.	.	.	.	.	.	.	T	17.22	3.335147	0.60853	.	.	ENSG00000179837	ENST00000323686;ENST00000541145	T	0.14640	2.49	4.56	3.65	0.41850	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.	.	.	.	T	0.14227	0.0344	N	0.11698	0.16	0.58432	D	0.999998	D	0.58620	0.983	P	0.60286	0.872	T	0.08806	-1.0704	9	0.42905	T	0.14	-16.3334	7.1818	0.25776	0.0:0.7888:0.0:0.2112	.	391	Q8NDT2	RB15B_HUMAN	Q	391;64	ENSP00000313890:H391Q	ENSP00000313890:H391Q	H	+	3	2	RBM15B	51405043	0.782000	0.28689	1.000000	0.80357	0.999000	0.98932	0.664000	0.25068	1.065000	0.40693	0.533000	0.62120	CAT		0.592	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	NM_013286	
CACNA1D	776	hgsc.bcm.edu	37	3	53804022	53804022	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr3:53804022C>A	ENST00000350061.5	+	31	4404	c.3893C>A	c.(3892-3894)cCt>cAt	p.P1298H	CACNA1D_ENST00000288139.4_Missense_Mutation_p.P1318H|CACNA1D_ENST00000422281.2_Intron|CACNA1D_ENST00000540742.1_Intron	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1298					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.P1318H(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GAAAATGTCCCTGTCCCAACT	0.438																																					p.P1298H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3893A	3						.						167.0	177.0	173.0					3																	53804022		2203	4300	6503	53779062	SO:0001583	missense	776	exon31			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.3893C>A	3.37:g.53804022C>A	ENSP00000288133:p.Pro1298His	Somatic		Capture	SOLID	Phase_I	53779062	NM_001128840	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.984767	0.35036	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000481478	D;D;D	0.96365	-3.96;-3.99;-3.97	5.93	5.93	0.95920	Ion transport (1);	0.896444	0.09340	N	0.815612	D	0.95063	0.8401	L	0.42632	1.34	0.80722	D	1	B;P;B	0.38978	0.0;0.652;0.027	B;B;B	0.42282	0.002;0.382;0.029	D	0.89631	0.3855	10	0.22706	T	0.39	.	15.841	0.78845	0.0:1.0:0.0:0.0	.	991;1298;1318	Q59GD8;Q01668;Q01668-2	.;CAC1D_HUMAN;.	H	1298;1318;991	ENSP00000288133:P1298H;ENSP00000288139:P1318H;ENSP00000418014:P991H	ENSP00000288139:P1318H	P	+	2	0	CACNA1D	53779062	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.549000	0.53681	2.814000	0.96858	0.655000	0.94253	CCT		0.438	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
MME	4311	hgsc.bcm.edu	37	3	154884730	154884730	+	Missense_Mutation	SNP	C	C	T	rs202024179		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr3:154884730C>T	ENST00000460393.1	+	18	1820	c.1700C>T	c.(1699-1701)gCc>gTc	p.A567V	MME_ENST00000492661.1_Missense_Mutation_p.A567V|MME_ENST00000493237.1_Missense_Mutation_p.A567V|MME-AS1_ENST00000484721.1_RNA|MME_ENST00000360490.2_Missense_Mutation_p.A567V|MME_ENST00000462745.1_Missense_Mutation_p.A567V	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	567					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)	p.A567V(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	TTCTTTAGTGCCCAGCAGTCC	0.433																																					p.A567V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1700T	3						.						136.0	133.0	134.0					3																	154884730		2203	4300	6503	156367424	SO:0001583	missense	4311	exon18				CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1700C>T	3.37:g.154884730C>T	ENSP00000418525:p.Ala567Val	Somatic		Capture	SOLID	Phase_I	156367424	NM_000902	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.235849	0.79800	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	D;D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67;-2.67	5.9	5.03	0.67393	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.177663	0.64402	D	0.000011	D	0.84642	0.5517	N	0.12663	0.25	0.38476	D	0.947592	D	0.58268	0.982	P	0.49301	0.606	D	0.86195	0.1615	10	0.51188	T	0.08	-11.6918	9.7795	0.40640	0.1395:0.7909:0.0:0.0695	.	567	P08473	NEP_HUMAN	V	567	ENSP00000420389:A567V;ENSP00000418525:A567V;ENSP00000419653:A567V;ENSP00000417079:A567V;ENSP00000353679:A567V	ENSP00000353679:A567V	A	+	2	0	MME	156367424	0.998000	0.40836	0.997000	0.53966	0.998000	0.95712	4.114000	0.57858	1.502000	0.48669	0.650000	0.86243	GCC		0.433	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
STAB2	55576	hgsc.bcm.edu	37	12	104031908	104031908	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:104031908G>C	ENST00000388887.2	+	8	1028	c.824G>C	c.(823-825)tGc>tCc	p.C275S		NM_017564.9	NP_060034.9			stabilin 2									p.C275S(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GGCCAAGTGTGCTTGCCTGTG	0.502																																					p.C275S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G824C	12						.						156.0	133.0	141.0					12																	104031908		2203	4300	6503	102556038	SO:0001583	missense	55576	exon8			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.824G>C	12.37:g.104031908G>C	ENSP00000373539:p.Cys275Ser	Somatic		Capture	SOLID	Phase_I	102556038	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.962056	0.53400	.	.	ENSG00000136011	ENST00000388887	D	0.99953	-8.81	5.34	5.34	0.76211	EGF domain, merozoite surface protein 1-like (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99963	0.9985	H	0.96460	3.825	0.58432	D	0.999999	D	0.61080	0.989	D	0.68039	0.955	D	0.96304	0.9223	10	0.62326	D	0.03	.	18.6371	0.91383	0.0:0.0:1.0:0.0	.	275	Q8WWQ8	STAB2_HUMAN	S	275	ENSP00000373539:C275S	ENSP00000373539:C275S	C	+	2	0	STAB2	102556038	1.000000	0.71417	0.864000	0.33941	0.091000	0.18340	7.907000	0.87430	2.498000	0.84270	0.561000	0.74099	TGC		0.502	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
POLR3B	55703	hgsc.bcm.edu	37	12	106895190	106895190	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:106895190G>A	ENST00000228347.4	+	26	3296	c.3074G>A	c.(3073-3075)cGg>cAg	p.R1025Q	POLR3B_ENST00000539066.1_Missense_Mutation_p.R967Q|RP11-144F15.1_ENST00000551505.1_Intron	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	1025					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.R1025Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						GCCCGGGCCCGGGGCCCACGA	0.448																																					p.R1025Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3074A	12						.						41.0	48.0	46.0					12																	106895190		2203	4300	6503	105419320	SO:0001583	missense	55703	exon26			AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.3074G>A	12.37:g.106895190G>A	ENSP00000228347:p.Arg1025Gln	Somatic		Capture	SOLID	Phase_I	105419320	NM_018082	A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	37	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988896	0.93106	.	.	ENSG00000013503	ENST00000228347;ENST00000539066	T;T	0.72835	-0.69;-0.69	5.5	5.5	0.81552	DNA-directed RNA polymerase, subunit 2, domain 6 (1);	0.000000	0.85682	D	0.000000	T	0.75860	0.3907	M	0.81802	2.56	0.80722	D	1	B	0.33135	0.399	B	0.34931	0.192	T	0.78013	-0.2370	10	0.66056	D	0.02	-17.1944	19.4046	0.94643	0.0:0.0:1.0:0.0	.	1025	Q9NW08	RPC2_HUMAN	Q	1025;967	ENSP00000228347:R1025Q;ENSP00000445721:R967Q	ENSP00000228347:R1025Q	R	+	2	0	POLR3B	105419320	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.856000	0.99531	2.566000	0.86566	0.655000	0.94253	CGG		0.448	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082	
PLEKHG6	55200	hgsc.bcm.edu	37	12	6427996	6427996	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:6427996C>A	ENST00000396988.3	+	12	1591	c.1361C>A	c.(1360-1362)cCc>cAc	p.P454H	PLEKHG6_ENST00000449001.2_Missense_Mutation_p.P422H|PLEKHG6_ENST00000536531.1_Missense_Mutation_p.P454H|PLEKHG6_ENST00000011684.7_Missense_Mutation_p.P454H|PLEKHG6_ENST00000304581.8_5'Flank	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	454	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P454H(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						GTCATCCGACCCCCTCTCATG	0.602																																					p.P422H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1265A	12						.						138.0	121.0	127.0					12																	6427996		2203	4300	6503	6298257	SO:0001583	missense	55200	exon11			AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.1361C>A	12.37:g.6427996C>A	ENSP00000380185:p.Pro454His	Somatic		Capture	SOLID	Phase_I	6298257	NM_001144857	Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Missense_Mutation	SNP	ENST00000396988.3	37	CCDS8541.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446936	0.63178	.	.	ENSG00000008323	ENST00000011684;ENST00000536531;ENST00000396988;ENST00000449001	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	4.51	4.51	0.55191	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000001	T	0.76047	0.3933	M	0.69823	2.125	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.72625	0.959;0.978;0.915	T	0.78690	-0.2106	10	0.72032	D	0.01	-4.8448	12.5834	0.56403	0.0:1.0:0.0:0.0	.	422;454;454	Q3KR16-2;F5H731;Q3KR16	.;.;PKHG6_HUMAN	H	454;454;454;422	ENSP00000011684:P454H;ENSP00000442836:P454H;ENSP00000380185:P454H;ENSP00000393194:P422H	ENSP00000011684:P454H	P	+	2	0	PLEKHG6	6298257	0.998000	0.40836	0.955000	0.39395	0.957000	0.61999	2.421000	0.44688	2.340000	0.79590	0.491000	0.48974	CCC		0.602	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399031.1	NM_018173	
NCAPD2	9918	hgsc.bcm.edu	37	12	6623983	6623983	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:6623983C>G	ENST00000315579.5	+	9	1683	c.884C>G	c.(883-885)tCa>tGa	p.S295*	NCAPD2_ENST00000545962.1_Nonsense_Mutation_p.S250*	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	295	Interactions with SMC2 and SMC4.				mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)	p.S295*(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						CGAGACCCTTCAGGGACAAAG	0.478																																					p.S295X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C884G	12						.						137.0	122.0	127.0					12																	6623983		2203	4300	6503	6494244	SO:0001587	stop_gained	9918	exon9			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.884C>G	12.37:g.6623983C>G	ENSP00000325017:p.Ser295*	Somatic		Capture	SOLID	Phase_I	6494244	NM_014865	D3DUR4|Q8N6U3	Nonsense_Mutation	SNP	ENST00000315579.5	37	CCDS8548.1	.	.	.	.	.	.	.	.	.	.	C	34	5.349342	0.95830	.	.	ENSG00000010292	ENST00000315579;ENST00000382457;ENST00000545962;ENST00000535602	.	.	.	5.63	2.77	0.32553	.	0.650602	0.16445	N	0.214138	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	0.2452	10.4154	0.44318	0.0:0.7834:0.0:0.2166	.	.	.	.	X	295;167;250;167	.	ENSP00000325017:S295X	S	+	2	0	NCAPD2	6494244	0.010000	0.17322	0.002000	0.10522	0.811000	0.45836	2.158000	0.42329	0.298000	0.22638	0.655000	0.94253	TCA		0.478	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
ING4	51147	hgsc.bcm.edu	37	12	6762117	6762117	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:6762117T>A	ENST00000396807.4	-	4	414	c.376A>T	c.(376-378)Agc>Tgc	p.S126C	ING4_ENST00000412586.2_Missense_Mutation_p.S126C|ING4_ENST00000341550.4_Missense_Mutation_p.S126C|ING4_ENST00000446105.2_Missense_Mutation_p.S126C|ING4_ENST00000444704.2_Missense_Mutation_p.S102C|ING4_ENST00000423703.2_Missense_Mutation_p.S126C|ING4_ENST00000486287.1_5'UTR	NM_001127582.1|NM_001127585.1|NM_001127586.1|NM_016162.3	NP_001121054.1|NP_001121057.1|NP_001121058.1|NP_057246.2	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4	126					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|protein acetylation (GO:0006473)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.S126C(1)		central_nervous_system(3)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	10						TTGCCTTTGCTGGAAGAGCTG	0.542																																					p.S126C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A376T	12						.						65.0	68.0	67.0					12																	6762117		2203	4300	6503	6632378	SO:0001583	missense	51147	exon4			AF063594	CCDS8555.1, CCDS44812.1, CCDS44813.1, CCDS44814.1, CCDS44815.1, CCDS44816.1	12p13.32	2013-01-28			ENSG00000111653	ENSG00000111653		"""Zinc fingers, PHD-type"""	19423	protein-coding gene	gene with protein product		608524				12750254	Standard	NM_001127582		Approved	p29ING4, my036	uc001qpw.4	Q9UNL4	OTTHUMG00000141274	ENST00000396807.4:c.376A>T	12.37:g.6762117T>A	ENSP00000380024:p.Ser126Cys	Somatic		Capture	SOLID	Phase_I	6632378	NM_001127586	A4KYM4|A4KYM6|D3DUR8|Q0EF62|Q0EF63|Q4VBQ6|Q96E15|Q9H3J0	Missense_Mutation	SNP	ENST00000396807.4	37	CCDS44813.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.224721	0.58668	.	.	ENSG00000111653	ENST00000341550;ENST00000396807;ENST00000446105;ENST00000444704;ENST00000423703;ENST00000412586	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	4.7	3.56	0.40772	.	0.000000	0.85682	D	0.000000	T	0.62073	0.2398	M	0.62723	1.935	0.48511	D	0.999668	D;D;D;D;D;D	0.76494	0.99;0.997;0.999;0.995;0.991;0.999	P;P;D;P;P;D	0.81914	0.879;0.808;0.995;0.879;0.76;0.99	T	0.61898	-0.6968	10	0.56958	D	0.05	-6.4799	10.0051	0.41953	0.0:0.0791:0.0:0.9209	.	102;126;126;126;126;126	Q9UNL4-3;A4KYM6;Q9UNL4-4;Q9UNL4-5;Q9UNL4;Q4VBQ6	.;.;.;.;ING4_HUMAN;.	C	126;126;126;102;126;126	ENSP00000343396:S126C;ENSP00000380024:S126C;ENSP00000415903:S126C;ENSP00000397343:S102C;ENSP00000412705:S126C	ENSP00000343396:S126C	S	-	1	0	ING4	6632378	1.000000	0.71417	0.959000	0.39883	0.997000	0.91878	4.566000	0.60843	0.840000	0.34995	0.533000	0.62120	AGC		0.542	ING4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280467.2	NM_198287	
C2CD5	9847	hgsc.bcm.edu	37	12	22677466	22677466	+	Silent	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:22677466G>T	ENST00000333957.4	-	6	796	c.541C>A	c.(541-543)Cga>Aga	p.R181R	C2CD5_ENST00000545552.1_Silent_p.R181R|C2CD5_ENST00000544930.1_5'UTR|C2CD5_ENST00000446597.1_Silent_p.R181R|C2CD5_ENST00000542676.1_Silent_p.R181R|C2CD5_ENST00000540703.1_5'UTR|C2CD5_ENST00000536386.1_Silent_p.R181R|C2CD5_ENST00000396028.2_Silent_p.R181R	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	181					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.R181R(1)									GTGCGAATTCGATCAATCCAC	0.363																																					p.R181R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C541A	12						.						136.0	121.0	126.0					12																	22677466		2203	4300	6503	22568733	SO:0001819	synonymous_variant	9847	exon6			AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.541C>A	12.37:g.22677466G>T		Somatic		Capture	SOLID	Phase_I	22568733	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Silent	SNP	ENST00000333957.4	37	CCDS31758.1																																																																																				0.363	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	Somatic		Capture	SOLID	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
H1FNT	341567	hgsc.bcm.edu	37	12	48723599	48723599	+	Silent	SNP	C	C	T	rs200066912		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:48723599C>T	ENST00000335017.1	+	1	837	c.525C>T	c.(523-525)aaC>aaT	p.N175N		NM_181788.1	NP_861453.1	Q75WM6	H1FNT_HUMAN	H1 histone family, member N, testis-specific	175	Arg-rich.				chromosome condensation (GO:0030261)|multicellular organismal development (GO:0007275)|sperm chromatin condensation (GO:0035092)|spermatid nucleus elongation (GO:0007290)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.N175N(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	13						GGAGACGGAACGCGAGGGCGA	0.716													C|||	1	0.000199681	0.0	0.0	5008	,	,		13022	0.0		0.001	False		,,,				2504	0.0				p.N175N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C525T	12						.						34.0	30.0	31.0					12																	48723599		2180	4288	6468	47009866	SO:0001819	synonymous_variant	341567	exon1			AY302593	CCDS8762.1	12q13.11	2011-01-27				ENSG00000187166		"""Histones / Replication-independent"""	24893	protein-coding gene	gene with protein product						15710904	Standard	NM_181788		Approved	HANP1, H1T2	uc001rrm.3	Q75WM6		ENST00000335017.1:c.525C>T	12.37:g.48723599C>T		Somatic		Capture	SOLID	Phase_I	47009866	NM_181788	Q147U8|Q5GKZ5|Q7Z694	Silent	SNP	ENST00000335017.1	37	CCDS8762.1																																																																																				0.716	H1FNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406516.1	NM_181788	
ADCY6	112	hgsc.bcm.edu	37	12	49176639	49176639	+	Silent	SNP	C	C	G	rs376782087		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:49176639C>G	ENST00000307885.4	-	1	1273	c.579G>C	c.(577-579)ggG>ggC	p.G193G	ADCY6_ENST00000550422.1_Silent_p.G193G|ADCY6_ENST00000357869.3_Silent_p.G193G	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	193					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.G193G(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						CCACCATGAGCCCCACGAACA	0.677																																					p.G193G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G579C	12						.						45.0	45.0	45.0					12																	49176639		2203	4300	6503	47462906	SO:0001819	synonymous_variant	112	exon1				CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.579G>C	12.37:g.49176639C>G		Somatic		Capture	SOLID	Phase_I	47462906	NM_015270	Q9NR75|Q9UDB0	Silent	SNP	ENST00000307885.4	37	CCDS8767.1																																																																																				0.677	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	NM_020983	
KRT7	3855	hgsc.bcm.edu	37	12	52636851	52636851	+	Missense_Mutation	SNP	G	G	A	rs368558949		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:52636851G>A	ENST00000331817.5	+	6	1097	c.914G>A	c.(913-915)cGg>cAg	p.R305Q	RP3-416H24.1_ENST00000546686.1_RNA	NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	305	Coil 2.|Rod.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.R305Q(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	CGGAATACCCGGAATGAGATT	0.577																																					p.R305Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G914A	12						.	G	GLN/ARG	0,4406		0,0,2203	73.0	68.0	70.0		914	3.0	0.8	12		70	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRT7	NM_005556.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	305/470	52636851	1,13005	2203	4300	6503	50923118	SO:0001583	missense	3855	exon6				CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.914G>A	12.37:g.52636851G>A	ENSP00000329243:p.Arg305Gln	Somatic		Capture	SOLID	Phase_I	50923118	NM_005556	Q92676|Q9BUD8|Q9Y3R7	Missense_Mutation	SNP	ENST00000331817.5	37	CCDS8822.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.714479	0.48622	0.0	1.16E-4	ENSG00000135480	ENST00000331817;ENST00000422319;ENST00000551537	D	0.88818	-2.43	3.94	2.98	0.34508	Prefoldin (1);Filament (1);	0.633028	0.12219	N	0.488548	D	0.82472	0.5044	L	0.41236	1.265	0.29909	N	0.823742	P;P	0.42039	0.769;0.754	B;B	0.39465	0.3;0.206	T	0.78505	-0.2178	10	0.87932	D	0	.	5.0177	0.14345	0.4361:0.0:0.5639:0.0	.	305;305	F8VZY5;P08729	.;K2C7_HUMAN	Q	305;281;305	ENSP00000329243:R305Q	ENSP00000329243:R305Q	R	+	2	0	KRT7	50923118	0.904000	0.30761	0.802000	0.32245	0.634000	0.38068	2.003000	0.40844	0.926000	0.37118	-0.367000	0.07326	CGG		0.577	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
NCKAP1L	3071	hgsc.bcm.edu	37	12	54902263	54902263	+	Missense_Mutation	SNP	C	C	T	rs555850869		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:54902263C>T	ENST00000293373.6	+	5	533	c.454C>T	c.(454-456)Cgg>Tgg	p.R152W	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.R102W	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	152					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)	p.R152W(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TGAAGATCGGCGGATACTCAT	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		21489	0.0		0.0	False		,,,				2504	0.001				p.R102W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C304T	12						.						258.0	240.0	246.0					12																	54902263		2203	4300	6503	53188530	SO:0001583	missense	3071	exon5			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.454C>T	12.37:g.54902263C>T	ENSP00000293373:p.Arg152Trp	Somatic		Capture	SOLID	Phase_I	53188530	NM_001184976	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119851	0.77323	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.36520	1.25;1.25	6.07	2.56	0.30785	.	0.059618	0.64402	D	0.000004	T	0.43897	0.1268	L	0.29908	0.895	0.36169	D	0.848676	D	0.76494	0.999	D	0.63283	0.913	T	0.56426	-0.7981	10	0.87932	D	0	-14.9414	13.8235	0.63338	0.5615:0.4385:0.0:0.0	.	152	P55160	NCKPL_HUMAN	W	152;102	ENSP00000293373:R152W;ENSP00000445596:R102W	ENSP00000293373:R152W	R	+	1	2	NCKAP1L	53188530	0.140000	0.22579	0.664000	0.29753	0.977000	0.68977	0.931000	0.28871	0.668000	0.31126	0.655000	0.94253	CGG		0.428	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
FICD	11153	hgsc.bcm.edu	37	12	108912294	108912294	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr12:108912294T>A	ENST00000552695.1	+	3	654	c.419T>A	c.(418-420)gTg>gAg	p.V140E	FICD_ENST00000361549.2_3'UTR	NM_007076.2	NP_009007.2	Q9BVA6	FICD_HUMAN	FIC domain containing	140					negative regulation of Rho GTPase activity (GO:0034259)|protein adenylylation (GO:0018117)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein adenylyltransferase activity (GO:0070733)			NS(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|upper_aerodigestive_tract(2)	15						CCGGACTTCGTGGACGCGCTC	0.562																																					p.V140E												.	.	0			c.T419A	12						.						115.0	93.0	100.0					12																	108912294		2203	4300	6503	107436424	SO:0001583	missense	11153	exon3			AF049611	CCDS9116.1	12q24.1	2007-12-05				ENSG00000198855			18416	protein-coding gene	gene with protein product	"""huntingtin interacting protein 13"", ""fic S-phase protein cell division homolog (E. coli)"""					9700202	Standard	NM_007076		Approved	HYPE, HIP13	uc001tmx.1	Q9BVA6		ENST00000552695.1:c.419T>A	12.37:g.108912294T>A	ENSP00000446479:p.Val140Glu	None		Capture	SOLID	Phase_I	107436424	NM_007076	O75406	Missense_Mutation	SNP	ENST00000552695.1	37	CCDS9116.1	.	.	.	.	.	.	.	.	.	.	T	12.27	1.889042	0.33348	.	.	ENSG00000198855	ENST00000552695	T	0.77098	-1.07	5.38	3.0	0.34707	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.110342	0.64402	D	0.000009	T	0.79839	0.4515	M	0.71581	2.175	0.80722	D	1	P	0.50710	0.938	P	0.50136	0.632	T	0.78723	-0.2093	10	0.62326	D	0.03	-14.0701	9.8257	0.40910	0.0:0.1403:0.0:0.8597	.	140	Q9BVA6	FICD_HUMAN	E	140	ENSP00000446479:V140E	ENSP00000446479:V140E	V	+	2	0	FICD	107436424	1.000000	0.71417	0.075000	0.20258	0.225000	0.24961	3.512000	0.53407	0.429000	0.26202	0.533000	0.62120	GTG		0.562	FICD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404842.1	NM_007076	
ATP10A	57194	hgsc.bcm.edu	37	15	26026201	26026201	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr15:26026201T>A	ENST00000356865.6	-	2	730	c.619A>T	c.(619-621)Aag>Tag	p.K207*		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	207					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.K207*(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TGCCGCCGCTTCAGGTTGGTC	0.602																																					p.K207X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A619T	15						.						76.0	77.0	77.0					15																	26026201		2203	4300	6503	23577294	SO:0001587	stop_gained	57194	exon2			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.619A>T	15.37:g.26026201T>A	ENSP00000349325:p.Lys207*	Somatic		Capture	SOLID	Phase_I	23577294	NM_024490	Q4G0S9|Q969I4	Nonsense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	T	40	8.044115	0.98627	.	.	ENSG00000206190	ENST00000356865	.	.	.	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-32.7946	13.4539	0.61187	0.0:0.0:0.0:1.0	.	.	.	.	X	207	.	ENSP00000349325:K207X	K	-	1	0	ATP10A	23577294	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.564000	0.82326	1.967000	0.57214	0.459000	0.35465	AAG		0.602	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
C15orf57	90416	hgsc.bcm.edu	37	15	40846183	40846183	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr15:40846183G>A	ENST00000358005.3	-	4	818	c.545C>T	c.(544-546)gCa>gTa	p.A182V	C15orf57_ENST00000558113.1_Intron|C15orf57_ENST00000560305.1_Intron|RP11-111A22.1_ENST00000561460.1_RNA|C15orf57_ENST00000416810.2_Missense_Mutation_p.A182V|C15orf57_ENST00000559911.1_Intron|RP11-111A22.1_ENST00000561039.1_RNA|C15orf57_ENST00000558750.1_Missense_Mutation_p.A191V|C15orf57_ENST00000561011.1_Intron	NM_001080791.1|NM_052849.2	NP_001074260.1|NP_443081.1	Q9BV29	CO057_HUMAN	chromosome 15 open reading frame 57	182								p.A182V(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	9						CTGTTCTGCTGCTGCTGGCTT	0.572																																					p.A182V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C545T	15						.						46.0	41.0	43.0					15																	40846183		2203	4300	6503	38633475	SO:0001583	missense	90416	exon4			BC012189	CCDS10060.1, CCDS42022.1, CCDS73706.1	15q15.1	2008-05-30	2008-05-30	2008-05-30	ENSG00000128891	ENSG00000128891			28295	protein-coding gene	gene with protein product			"""coiled-coil domain containing 32"""	CCDC32		12477932	Standard	NM_001080791		Approved	MGC20481	uc001zma.1	Q9BV29	OTTHUMG00000129993	ENST00000358005.3:c.545C>T	15.37:g.40846183G>A	ENSP00000350695:p.Ala182Val	Somatic		Capture	SOLID	Phase_I	38633475	NM_001080792	A8KAL4|Q86TC4|Q8N788|Q8NAR7	Missense_Mutation	SNP	ENST00000358005.3	37	CCDS10060.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230437	0.58777	.	.	ENSG00000128891	ENST00000358005;ENST00000416810	T	0.47177	0.85	5.05	4.13	0.48395	.	0.358875	0.28555	N	0.014934	T	0.36358	0.0964	L	0.36672	1.1	0.27174	N	0.960844	B;B	0.22909	0.077;0.077	B;B	0.20767	0.031;0.031	T	0.33879	-0.9851	10	0.59425	D	0.04	-11.9422	9.3001	0.37840	0.1674:0.0:0.8326:0.0	.	182;191	Q9BV29;Q9BV29-2	CO057_HUMAN;.	V	182;191	ENSP00000350695:A182V	ENSP00000350695:A182V	A	-	2	0	C15orf57	38633475	0.921000	0.31238	0.846000	0.33378	0.355000	0.29361	2.393000	0.44442	1.487000	0.48415	0.655000	0.94253	GCA		0.572	C15orf57-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252259.2	NM_052849	
SLC24A5	283652	hgsc.bcm.edu	37	15	48428972	48428972	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr15:48428972G>A	ENST00000341459.3	+	6	756	c.683G>A	c.(682-684)tGc>tAc	p.C228Y	SLC24A5_ENST00000449382.2_Missense_Mutation_p.C168Y	NM_205850.2	NP_995322.1	Q71RS6	NCKX5_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 5	228					ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|negative regulation of melanin biosynthetic process (GO:0048022)|response to stimulus (GO:0050896)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.C228Y(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|skin(1)|upper_aerodigestive_tract(1)	27		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		ATAAAGAAATGCAGTCCTTGC	0.403																																					p.C228Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G683A	15						.						68.0	66.0	67.0					15																	48428972		2198	4297	6495	46216264	SO:0001583	missense	283652	exon6			AF348468	CCDS10128.1	15q21.1	2014-01-28	2013-07-18		ENSG00000188467	ENSG00000188467		"""Solute carriers"""	20611	protein-coding gene	gene with protein product	"""oculocutaneous albinism 6 (autosomal recessive)"""	609802	"""solute carrier family 24, member 5"""			23364476	Standard	XM_005254308		Approved	JSX, OCA6	uc001zwe.3	Q71RS6	OTTHUMG00000131494	ENST00000341459.3:c.683G>A	15.37:g.48428972G>A	ENSP00000341550:p.Cys228Tyr	Somatic		Capture	SOLID	Phase_I	46216264	NM_205850	A5X8Z8|A5X8Z9|Q14CT4|Q6DKH3	Missense_Mutation	SNP	ENST00000341459.3	37	CCDS10128.1	.	.	.	.	.	.	.	.	.	.	G	2.687	-0.273986	0.05679	.	.	ENSG00000188467	ENST00000341459;ENST00000449382	T;T	0.74526	-0.85;-0.84	5.42	2.23	0.28157	.	0.333929	0.32218	N	0.006403	T	0.60919	0.2306	L	0.44542	1.39	0.32540	N	0.533786	B;B	0.20887	0.049;0.047	B;B	0.19148	0.016;0.024	T	0.57015	-0.7883	10	0.02654	T	1	.	13.5638	0.61806	0.0:0.0:0.3584:0.6416	.	168;228	A5X8Z9;Q71RS6	.;NCKX5_HUMAN	Y	228;168	ENSP00000341550:C228Y;ENSP00000389966:C168Y	ENSP00000341550:C228Y	C	+	2	0	SLC24A5	46216264	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.590000	0.53979	0.712000	0.32039	0.655000	0.94253	TGC		0.403	SLC24A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254340.2	NM_205850	
LARP6	55323	hgsc.bcm.edu	37	15	71125192	71125192	+	Silent	SNP	T	T	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr15:71125192T>A	ENST00000299213.8	-	3	745	c.675A>T	c.(673-675)ggA>ggT	p.G225G	RP11-138H8.7_ENST00000592096.1_lincRNA	NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	225	RRM.				regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G225G(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						ATGAGATGACTCCAAAAGTCC	0.572																																					p.G225G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A675T	15						.						36.0	35.0	35.0					15																	71125192		2199	4297	6496	68912246	SO:0001819	synonymous_variant	55323	exon3			BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.675A>T	15.37:g.71125192T>A		Somatic		Capture	SOLID	Phase_I	68912246	NM_018357	Q5XKE4|Q8N3N2|Q9NUR0	Silent	SNP	ENST00000299213.8	37	CCDS32281.1																																																																																				0.572	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417197.2	NM_018357	
KIAA1024	23251	hgsc.bcm.edu	37	15	79749742	79749742	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr15:79749742A>T	ENST00000305428.3	+	2	1328	c.1253A>T	c.(1252-1254)aAg>aTg	p.K418M		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	418						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						CTTGTGCCAAAGGATCAACAG	0.488																																					p.K418M												.	.	0			c.A1253T	15						.						65.0	72.0	70.0					15																	79749742		2196	4293	6489	77536797	SO:0001583	missense	23251	exon2			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.1253A>T	15.37:g.79749742A>T	ENSP00000307461:p.Lys418Met	None		Capture	SOLID	Phase_I	77536797	NM_015206	A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	A	4.344	0.063355	0.08388	.	.	ENSG00000169330	ENST00000305428	T	0.34859	1.34	5.14	4.01	0.46588	.	0.338473	0.34750	N	0.003718	T	0.36717	0.0977	L	0.60455	1.87	0.37150	D	0.902119	P	0.40000	0.698	B	0.42882	0.401	T	0.33317	-0.9873	9	.	.	.	.	9.2707	0.37670	0.917:0.0:0.083:0.0	.	418	Q9UPX6	K1024_HUMAN	M	418	ENSP00000307461:K418M	.	K	+	2	0	KIAA1024	77536797	0.991000	0.36638	0.126000	0.21872	0.048000	0.14542	3.558000	0.53749	0.801000	0.34066	0.402000	0.26972	AAG		0.488	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206	
MRPL46	26589	hgsc.bcm.edu	37	15	89003034	89003034	+	Missense_Mutation	SNP	A	A	C	rs564581312		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr15:89003034A>C	ENST00000312475.4	-	4	691	c.650T>G	c.(649-651)tTc>tGc	p.F217C	MRPL46_ENST00000559538.1_5'UTR	NM_022163.3	NP_071446.2	Q9H2W6	RM46_HUMAN	mitochondrial ribosomal protein L46	217						mitochondrion (GO:0005739)|ribosome (GO:0005840)	hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TGCCTGGGGGAACTTGAATGT	0.478																																					p.F217C												.	.	0			c.T650G	15						.						83.0	78.0	80.0					15																	89003034		2201	4299	6500	86804038	SO:0001583	missense	26589	exon4			AF210056	CCDS10341.1	15q25.3	2012-10-08	2001-12-10	2001-12-14	ENSG00000259494	ENSG00000259494		"""Mitochondrial ribosomal proteins / large subunits"""	1192	protein-coding gene	gene with protein product		611851	"""chromosome 15 open reading frame 4"""	C15orf4		11761714, 11551941	Standard	NM_022163		Approved	LIECG2, P2ECSL	uc002bmj.2	Q9H2W6	OTTHUMG00000148683	ENST00000312475.4:c.650T>G	15.37:g.89003034A>C	ENSP00000312311:p.Phe217Cys	None		Capture	SOLID	Phase_I	86804038	NM_022163	B2RD75|Q9HBU8	Missense_Mutation	SNP	ENST00000312475.4	37	CCDS10341.1	.	.	.	.	.	.	.	.	.	.	A	14.98	2.697884	0.48307	.	.	ENSG00000173867	ENST00000312475	T	0.46451	0.87	6.17	5.01	0.66863	NUDIX hydrolase domain (1);	0.156867	0.56097	D	0.000024	T	0.58032	0.2094	M	0.74258	2.255	0.47511	D	0.999449	D	0.76494	0.999	P	0.59643	0.861	T	0.58713	-0.7588	10	0.40728	T	0.16	.	12.2454	0.54568	0.8733:0.0:0.0:0.1267	.	217	Q9H2W6	RM46_HUMAN	C	217	ENSP00000312311:F217C	ENSP00000312311:F217C	F	-	2	0	MRPL46	86804038	1.000000	0.71417	1.000000	0.80357	0.180000	0.23129	4.565000	0.60836	2.371000	0.80710	0.533000	0.62120	TTC		0.478	MRPL46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309073.1	NM_022163	
TCF12	6938	hgsc.bcm.edu	37	15	57526286	57526296	+	Frame_Shift_Del	DEL	TTGGAAAGGCT	TTGGAAAGGCT	-			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	TTGGAAAGGCT	TTGGAAAGGCT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr15:57526286_57526296delTTGGAAAGGCT	ENST00000267811.5	+	12	1320_1330	c.1016_1026delTTGGAAAGGCT	c.(1015-1026)cttggaaaggctfs	p.LGKA339fs	TCF12_ENST00000438423.2_Frame_Shift_Del_p.LGKA339fs|TCF12_ENST00000560764.1_3'UTR|TCF12_ENST00000333725.5_Frame_Shift_Del_p.LGKA339fs|TCF12_ENST00000452095.2_Frame_Shift_Del_p.LGKA335fs|TCF12_ENST00000557843.1_Frame_Shift_Del_p.LGKA339fs|TCF12_ENST00000543579.1_Frame_Shift_Del_p.LGKA169fs|TCF12_ENST00000537840.1_Frame_Shift_Del_p.LGKA103fs|TCF12_ENST00000343827.3_Frame_Shift_Del_p.LGKA169fs	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	339					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.K337fs*6(1)|p.K341fs*6(1)	TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		GGTGATGCACTTGGAAAGGCTTTGGCATCTG	0.341			T	TEC	extraskeletal myxoid chondrosarcoma																																p.339_342del			Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.1016_1026del	15						.																																			55313588	SO:0001589	frameshift_variant	6938	exon12			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.1016_1026delTTGGAAAGGCT	15.37:g.57526286_57526296delTTGGAAAGGCT	ENSP00000267811:p.Leu339fs	Somatic		Capture	SOLID	Phase_I	55313578	NM_207037	Q7Z3D9|Q86TC1|Q86VM2	Frame_Shift_Del	DEL	ENST00000267811.5	37	CCDS10159.1																																																																																				0.341	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255069.3	NM_003205	
PIF1	80119	hgsc.bcm.edu	37	15	65111385	65111386	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	AG	AG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr15:65111385_65111386delAG	ENST00000268043.4	-	9	1464_1465	c.1370_1371delCT	c.(1369-1371)cctfs	p.P457fs	PIF1_ENST00000333425.6_Frame_Shift_Del_p.P457fs|PIF1_ENST00000559239.1_Frame_Shift_Del_p.P457fs					PIF1 5'-to-3' DNA helicase									p.P457fs*13(1)		kidney(1)|lung(1)	2						TGGCCAGCTCAGGGTTGCTGTC	0.53																																					p.457_457del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1370_1371del	15						.																																			62898439	SO:0001589	frameshift_variant	80119	exon9			AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.1370_1371delCT	15.37:g.65111385_65111386delAG	ENSP00000268043:p.Pro457fs	Somatic		Capture	SOLID	Phase_I	62898438	NM_025049		Frame_Shift_Del	DEL	ENST00000268043.4	37	CCDS10195.2																																																																																				0.530	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256533.1	NM_025049	
NEO1	4756	hgsc.bcm.edu	37	15	73562770	73562771	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	AG	AG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr15:73562770_73562771delAG	ENST00000339362.5	+	19	3279_3280	c.2832_2833delAG	c.(2830-2835)acagccfs	p.A945fs	NEO1_ENST00000261908.6_Frame_Shift_Del_p.A945fs|NEO1_ENST00000560262.1_Frame_Shift_Del_p.A945fs|NEO1_ENST00000558964.1_Frame_Shift_Del_p.A945fs			Q92859	NEO1_HUMAN	neogenin 1	945	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.A945fs*6(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						GGAGTATGACAGCCCATGGGAC	0.426																																					p.944_945del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2832_2833del	15						.																																			71349824	SO:0001589	frameshift_variant	4756	exon18			U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.2832_2833delAG	15.37:g.73562770_73562771delAG	ENSP00000341198:p.Ala945fs	Somatic		Capture	SOLID	Phase_I	71349823	NM_001172623	B7ZKM9|B7ZKN0|O00340|Q17RX1	Frame_Shift_Del	DEL	ENST00000339362.5	37	CCDS10247.1																																																																																				0.426	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
SPATA8	145946	hgsc.bcm.edu	37	15	97327425	97327425	+	Silent	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr15:97327425C>T	ENST00000328504.3	+	2	399	c.132C>T	c.(130-132)tgC>tgT	p.C44C	SPATA8_ENST00000558553.1_Missense_Mutation_p.R4W|SPATA8-AS1_ENST00000560888.1_RNA|SPATA8-AS1_ENST00000558722.1_RNA	NM_173499.3	NP_775770.1	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	44								p.C44C(1)		large_intestine(4)|lung(8)|ovary(1)|skin(3)	16	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			CATGTCCCTGCGGCTGGAGGC	0.587																																					p.C44C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C132T	15						.						74.0	72.0	73.0					15																	97327425		2197	4298	6495	95128429	SO:0001819	synonymous_variant	145946	exon2			AY489187	CCDS10376.1	15q26	2008-02-05			ENSG00000185594	ENSG00000185594			28676	protein-coding gene	gene with protein product		613948					Standard	NM_173499		Approved	MGC44294	uc002bue.3	Q6RVD6	OTTHUMG00000149847	ENST00000328504.3:c.132C>T	15.37:g.97327425C>T		Somatic		Capture	SOLID	Phase_I	95128429	NM_173499	Q2KJ07	Silent	SNP	ENST00000328504.3	37	CCDS10376.1																																																																																				0.587	SPATA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313533.1	NM_173499	
PDE6B	5158	hgsc.bcm.edu	37	4	661714	661714	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr4:661714A>C	ENST00000496514.1	+	21	2443	c.2422A>C	c.(2422-2424)Aag>Cag	p.K808Q	PDE6B_ENST00000255622.6_Missense_Mutation_p.K808Q|PDE6B_ENST00000429163.2_Missense_Mutation_p.K529Q			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	808					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.K808Q(1)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GAAAGAGTGGAAGGCGCTGGC	0.562																																					p.K529Q	GBM(71;463 1194 9848 25922 46834)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1585C	4						.						144.0	148.0	147.0					4																	661714		2203	4300	6503	651714	SO:0001583	missense	5158	exon19			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.2422A>C	4.37:g.661714A>C	ENSP00000420295:p.Lys808Gln	Somatic		Capture	SOLID	Phase_I	651714	NM_001145292	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	a	16.44	3.122672	0.56613	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163	T;T;T	0.76448	-1.02;-1.02;-1.02	4.7	4.7	0.59300	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.099100	0.64402	D	0.000002	D	0.83912	0.5357	M	0.80982	2.52	0.54753	D	0.999981	D;D	0.56968	0.963;0.978	P;P	0.57846	0.678;0.828	T	0.82099	-0.0625	10	0.16420	T	0.52	.	12.3861	0.55333	1.0:0.0:0.0:0.0	.	808;808	P35913;P35913-2	PDE6B_HUMAN;.	Q	808;808;529	ENSP00000255622:K808Q;ENSP00000420295:K808Q;ENSP00000406334:K529Q	ENSP00000255622:K808Q	K	+	1	0	PDE6B	651714	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.647000	0.91057	1.882000	0.54519	0.529000	0.55759	AAG		0.562	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
ANAPC4	29945	hgsc.bcm.edu	37	4	25379094	25379094	+	Silent	SNP	A	A	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr4:25379094A>C	ENST00000315368.3	+	2	187	c.45A>C	c.(43-45)ggA>ggC	p.G15G	ANAPC4_ENST00000510092.1_Silent_p.G15G	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	15					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)	p.G15G(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				GGGTGGTGGGAGAGAAGCAGC	0.632																																					p.G15G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A45C	4						.						43.0	43.0	43.0					4																	25379094		2203	4300	6503	24988192	SO:0001819	synonymous_variant	29945	exon2			AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.45A>C	4.37:g.25379094A>C		Somatic		Capture	SOLID	Phase_I	24988192	NM_013367	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Silent	SNP	ENST00000315368.3	37	CCDS3434.1																																																																																				0.632	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1	NM_013367	
ANAPC4	29945	hgsc.bcm.edu	37	4	25379099	25379099	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr4:25379099A>T	ENST00000315368.3	+	2	192	c.50A>T	c.(49-51)aAg>aTg	p.K17M	ANAPC4_ENST00000510092.1_Missense_Mutation_p.K17M	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	17					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				GTGGGAGAGAAGCAGCTCCCG	0.637																																					p.K17M												.	.	0			c.A50T	4						.						43.0	42.0	42.0					4																	25379099		2203	4300	6503	24988197	SO:0001583	missense	29945	exon2			AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.50A>T	4.37:g.25379099A>T	ENSP00000318775:p.Lys17Met	None		Capture	SOLID	Phase_I	24988197	NM_013367	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Missense_Mutation	SNP	ENST00000315368.3	37	CCDS3434.1	.	.	.	.	.	.	.	.	.	.	A	32	5.190839	0.94923	.	.	ENSG00000053900	ENST00000315368;ENST00000510092;ENST00000505991	T;T	0.53206	0.63;0.63	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.68128	0.2967	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.73036	-0.4109	10	0.87932	D	0	-19.0894	14.6641	0.68893	1.0:0.0:0.0:0.0	.	17	Q9UJX5	APC4_HUMAN	M	17	ENSP00000318775:K17M;ENSP00000426654:K17M	ENSP00000318775:K17M	K	+	2	0	ANAPC4	24988197	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.261000	0.89860	1.856000	0.53863	0.459000	0.35465	AAG		0.637	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1	NM_013367	
ZAR1	326340	hgsc.bcm.edu	37	4	48496212	48496212	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr4:48496212G>T	ENST00000327939.4	+	4	1266	c.1226G>T	c.(1225-1227)gGc>gTc	p.G409V		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	409					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)		p.G409V(1)		endometrium(1)|large_intestine(4)	5						AGATGCAAAGGCAAACGCCTG	0.498																																					p.G409V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1226T	4						.						102.0	102.0	102.0					4																	48496212		2203	4300	6503	48190969	SO:0001583	missense	326340	exon4			AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.1226G>T	4.37:g.48496212G>T	ENSP00000329803:p.Gly409Val	Somatic		Capture	SOLID	Phase_I	48190969	NM_175619		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604446	0.46423	.	.	ENSG00000182223	ENST00000327939	T	0.21932	1.98	5.97	4.24	0.50183	.	0.061993	0.64402	D	0.000005	T	0.43344	0.1243	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.33879	-0.9851	10	0.87932	D	0	-15.7315	12.0092	0.53278	0.1408:0.0:0.8591:0.0	.	409	Q86SH2	ZAR1_HUMAN	V	409	ENSP00000329803:G409V	ENSP00000329803:G409V	G	+	2	0	ZAR1	48190969	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	7.581000	0.82535	0.849000	0.35215	-0.140000	0.14226	GGC		0.498	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
PDGFRA	5156	hgsc.bcm.edu	37	4	55141034	55141034	+	Silent	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr4:55141034G>A	ENST00000257290.5	+	12	2011	c.1680G>A	c.(1678-1680)agG>agA	p.R560R	FIP1L1_ENST00000507166.1_Intron	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	560					adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.R560_S564del(2)|p.R560R(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	TTCGCTGGAGGGTCATTGAAT	0.458			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											p.R560R	Pancreas(151;208 1913 7310 23853 37092)		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	.	.	3	Deletion - In frame(2)|Substitution - coding silent(1)	soft_tissue(2)|large_intestine(1)	c.G1680A	4						.						82.0	85.0	84.0					4																	55141034		2203	4300	6503	54835791	SO:0001819	synonymous_variant	5156	exon12	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.1680G>A	4.37:g.55141034G>A		Somatic		Capture	SOLID	Phase_I	54835791	NM_006206	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Silent	SNP	ENST00000257290.5	37	CCDS3495.1																																																																																				0.458	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206	
UCP1	7350	hgsc.bcm.edu	37	4	141484518	141484518	+	Silent	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr4:141484518C>T	ENST00000262999.3	-	3	555	c.480G>A	c.(478-480)gcG>gcA	p.A160A		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	160					brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)	p.A160A(1)		NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					TTATTCTGTACGCATTATAAG	0.443																																					p.A160A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G480A	4						.						152.0	135.0	141.0					4																	141484518		2203	4300	6503	141703968	SO:0001819	synonymous_variant	7350	exon3			X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.480G>A	4.37:g.141484518C>T		Somatic		Capture	SOLID	Phase_I	141703968	NM_021833	Q13218|Q4KMZ3|Q68G66	Silent	SNP	ENST00000262999.3	37	CCDS3753.1																																																																																				0.443	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257273.1		
MORF4L2	9643	hgsc.bcm.edu	37	X	102931342	102931342	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chrX:102931342G>A	ENST00000441076.2	-	4	918	c.614C>T	c.(613-615)cCc>cTc	p.P205L	MORF4L2_ENST00000492116.1_5'Flank|MORF4L2_ENST00000451301.1_Missense_Mutation_p.P205L|MORF4L2_ENST00000423833.2_Missense_Mutation_p.P205L|MORF4L2_ENST00000422154.2_Missense_Mutation_p.P205L|MORF4L2_ENST00000360458.1_Missense_Mutation_p.P205L|MORF4L2_ENST00000433176.2_Missense_Mutation_p.P205L	NM_001142419.1|NM_012286.2	NP_001135891.1|NP_036418.1	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	205	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.				chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA repair (GO:0006281)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P205L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)	13						AGCATACTGGGGCCTCTCAAA	0.423																																					p.P205L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C614T	X						.						73.0	66.0	68.0					X																	102931342		2203	4300	6503	102817998	SO:0001583	missense	9643	exon5			AF100620	CCDS14512.1	Xq22	2010-11-24			ENSG00000123562	ENSG00000123562			16849	protein-coding gene	gene with protein product	"""MORF-related gene X"""	300409				9891081, 7584026	Standard	NM_012286		Approved	KIAA0026, MRGX	uc011msa.2	Q15014	OTTHUMG00000022104	ENST00000441076.2:c.614C>T	X.37:g.102931342G>A	ENSP00000391969:p.Pro205Leu	Somatic		Capture	SOLID	Phase_I	102817998	NM_001142429	B3KP92|D3DXA5|Q567V0|Q8J026	Missense_Mutation	SNP	ENST00000441076.2	37	CCDS14512.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.826911	0.71143	.	.	ENSG00000123562	ENST00000360458;ENST00000372620;ENST00000433176;ENST00000422154;ENST00000451301;ENST00000372619;ENST00000441076;ENST00000423833	T;T;T;T;T;T;T	0.09163	3.01;3.01;3.01;3.01;3.01;3.01;3.01	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.22704	0.0548	L	0.44542	1.39	0.80722	D	1	D	0.61080	0.989	D	0.67103	0.949	T	0.00463	-1.1724	10	0.29301	T	0.29	-24.6295	14.5691	0.68200	0.0:0.0:1.0:0.0	.	205	Q15014	MO4L2_HUMAN	L	205;87;205;205;205;187;205;205	ENSP00000353643:P205L;ENSP00000361703:P87L;ENSP00000415476:P205L;ENSP00000394417:P205L;ENSP00000410532:P205L;ENSP00000391969:P205L;ENSP00000416120:P205L	ENSP00000353643:P205L	P	-	2	0	MORF4L2	102817998	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.540000	0.98080	2.618000	0.88619	0.600000	0.82982	CCC		0.423	MORF4L2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057732.1	NM_012286	
COL4A6	1288	hgsc.bcm.edu	37	X	107408223	107408223	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chrX:107408223G>A	ENST00000372216.4	-	39	3957	c.3857C>T	c.(3856-3858)tCg>tTg	p.S1286L	COL4A6_ENST00000538570.1_Missense_Mutation_p.S1261L|COL4A6_ENST00000394872.2_Missense_Mutation_p.S1286L|COL4A6_ENST00000334504.7_Missense_Mutation_p.S1285L|COL4A6_ENST00000545689.1_Missense_Mutation_p.S1261L	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1286	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.S1285L(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GCCTTGATTCGAGGATGGCCC	0.622									Alport syndrome with Diffuse Leiomyomatosis																												p.S1285L	Melanoma(87;1895 1945 2589 7165)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3854T	X						.						28.0	29.0	29.0					X																	107408223		2203	4300	6503	107294879	SO:0001583	missense	1288	exon39	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.3857C>T	X.37:g.107408223G>A	ENSP00000361290:p.Ser1286Leu	Somatic		Capture	SOLID	Phase_I	107294879	NM_033641	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.821352	0.50633	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.93426	-3.2;-3.2;-3.2;-3.22;-3.2	4.36	4.36	0.52297	.	0.258118	0.20645	N	0.088336	D	0.90072	0.6899	L	0.27053	0.805	0.34682	D	0.72477	D;P;D;D	0.63046	0.991;0.83;0.992;0.991	B;B;P;B	0.47786	0.422;0.242;0.557;0.422	D	0.93470	0.6818	10	0.87932	D	0	.	12.5613	0.56283	0.0883:0.0:0.9117:0.0	.	1261;1261;1286;1285	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	L	1286;1285;1286;1285;1261;1261	ENSP00000361290:S1286L;ENSP00000334733:S1285L;ENSP00000378340:S1286L;ENSP00000443707:S1261L;ENSP00000445236:S1261L	ENSP00000334733:S1285L	S	-	2	0	COL4A6	107294879	1.000000	0.71417	0.921000	0.36526	0.773000	0.43773	5.277000	0.65586	2.112000	0.64535	0.544000	0.68410	TCG		0.622	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
CT47A6	728062	hgsc.bcm.edu	37	X	120094405	120094405	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chrX:120094405C>A	ENST00000443600.2	-	1	932	c.678G>T	c.(676-678)gaG>gaT	p.E226D	CT47A5_ENST00000419194.2_Intron	NM_001080141.1	NP_001073610.1	Q5JQC4	CT47A_HUMAN	cancer/testis antigen family 47, member A6	226								p.E226D(1)		large_intestine(1)|lung(4)	5						CGTCTGGTTCCTCTGTGGCCT	0.682																																					p.E226D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G678T	X						.						17.0	55.0	45.0					X																	120094405		799	2462	3261	119922086	SO:0001583	missense	728062	exon1				CCDS35386.1	Xq24	2013-10-15			ENSG00000226023	ENSG00000226023			33287	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 6"""	300785				16382448	Standard	NM_001080141		Approved	CT47.6	uc004eth.3	Q5JQC4	OTTHUMG00000022316	ENST00000443600.2:c.678G>T	X.37:g.120094405C>A	ENSP00000415974:p.Glu226Asp	Somatic		Capture	SOLID	Phase_I	119922086	NM_001080146	Q8N747	Missense_Mutation	SNP	ENST00000443600.2	37	CCDS35386.1	.	.	.	.	.	.	.	.	.	.	-	7.063	0.566789	0.13560	.	.	ENSG00000226023	ENST00000443600	.	.	.	0.51	0.51	0.16983	.	.	.	.	.	T	0.31702	0.0805	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27365	-1.0076	4	0.28530	T	0.3	.	.	.	.	.	.	.	.	D	226	.	ENSP00000415974:E226D	E	-	3	2	CT47A6	119922086	0.004000	0.15560	0.004000	0.12327	0.006000	0.05464	0.103000	0.15292	0.508000	0.28173	0.110000	0.15639	GAG		0.682	CT47A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058129.1	NM_001080141	
SMARCA1	6594	hgsc.bcm.edu	37	X	128599925	128599925	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chrX:128599925G>A	ENST00000371122.4	-	22	2842	c.2713C>T	c.(2713-2715)Cgt>Tgt	p.R905C	SMARCA1_ENST00000371123.1_Missense_Mutation_p.R893C|SMARCA1_ENST00000371121.3_Missense_Mutation_p.R893C	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	905	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R905C(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						TCATTGCAACGTTCCCAAAAT	0.338																																					p.R905C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2713T	X						.						111.0	94.0	100.0					X																	128599925		2202	4300	6502	128427606	SO:0001583	missense	6594	exon22			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.2713C>T	X.37:g.128599925G>A	ENSP00000360163:p.Arg905Cys	Somatic		Capture	SOLID	Phase_I	128427606	NM_003069	Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	37	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765814	0.69878	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.22	5.79	5.79	0.91817	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.64402	D	0.000002	D	0.97539	0.9194	M	0.94142	3.5	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.995;0.998;0.995	D	0.98397	1.0566	10	0.87932	D	0	-6.649	13.8882	0.63721	0.0:0.0:0.8479:0.1521	.	884;905;893;905	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	C	893;893;905;884	ENSP00000360162:R893C;ENSP00000360164:R893C;ENSP00000360163:R905C;ENSP00000404275:R884C	ENSP00000360162:R893C	R	-	1	0	SMARCA1	128427606	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.577000	0.74027	2.430000	0.82344	0.600000	0.82982	CGT		0.338	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
ARSF	416	hgsc.bcm.edu	37	X	3028172	3028172	+	Silent	SNP	C	C	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chrX:3028172C>G	ENST00000381127.1	+	10	1490	c.1269C>G	c.(1267-1269)gtC>gtG	p.V423V	ARSF_ENST00000537104.1_Silent_p.V423V|ARSF_ENST00000359361.2_Silent_p.V423V	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	423					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.V423V(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCTGCAGGGTCATTGACGGCC	0.557																																					p.V423V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1269G	X						.						96.0	73.0	81.0					X																	3028172		2203	4300	6503	3038172	SO:0001819	synonymous_variant	416	exon10			X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.1269C>G	X.37:g.3028172C>G		Somatic		Capture	SOLID	Phase_I	3038172	NM_004042	Q8TCC5	Silent	SNP	ENST00000381127.1	37	CCDS14123.1																																																																																				0.557	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1		
DCAF8L1	139425	hgsc.bcm.edu	37	X	27998125	27998125	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chrX:27998125C>G	ENST00000441525.1	-	1	1441	c.1327G>C	c.(1327-1329)Gtt>Ctt	p.V443L		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	443								p.V443L(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						TAGAAATTAACACATTTGATT	0.428																																					p.V443L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1327C	X						.						49.0	44.0	46.0					X																	27998125		2202	4300	6502	27908046	SO:0001583	missense	139425	exon1				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1327G>C	X.37:g.27998125C>G	ENSP00000405222:p.Val443Leu	Somatic		Capture	SOLID	Phase_I	27908046	NM_001017930	B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586983	0.46110	.	.	ENSG00000226372	ENST00000441525	T	0.80738	-1.41	0.842	0.842	0.18927	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.159373	0.41194	D	0.000939	D	0.88930	0.6571	M	0.87328	2.875	0.42985	D	0.994479	D	0.76494	0.999	D	0.72982	0.979	D	0.89797	0.3972	9	0.72032	D	0.01	-11.0235	.	.	.	.	443	A6NGE4	DC8L1_HUMAN	L	443	ENSP00000405222:V443L	ENSP00000405222:V443L	V	-	1	0	DCAF8L1	27908046	1.000000	0.71417	0.071000	0.20095	0.115000	0.19883	4.373000	0.59537	0.691000	0.31592	0.284000	0.19432	GTT		0.428	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690	
MAGEB2	4113	hgsc.bcm.edu	37	X	30237205	30237205	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chrX:30237205A>G	ENST00000378988.4	+	2	609	c.508A>G	c.(508-510)Aaa>Gaa	p.K170E		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	170	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						TGAGCTGAATAAAGTCAACCC	0.498																																					p.K170E												.	.	0			c.A508G	X						.						52.0	45.0	47.0					X																	30237205		2202	4300	6502	30147126	SO:0001583	missense	4113	exon2			AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.508A>G	X.37:g.30237205A>G	ENSP00000368273:p.Lys170Glu	None		Capture	SOLID	Phase_I	30147126	NM_002364	O75860	Missense_Mutation	SNP	ENST00000378988.4	37	CCDS14219.1	.	.	.	.	.	.	.	.	.	.	A	0.030	-1.341478	0.01277	.	.	ENSG00000099399	ENST00000378988	T	0.02944	4.1	3.27	-0.618	0.11576	.	0.055399	0.64402	N	0.000001	T	0.00384	0.0012	N	0.00012	-2.95	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.43718	-0.9374	10	0.02654	T	1	.	3.1161	0.06375	0.4518:0.2229:0.3252:0.0	.	170	O15479	MAGB2_HUMAN	E	170	ENSP00000368273:K170E	ENSP00000368273:K170E	K	+	1	0	MAGEB2	30147126	0.230000	0.23740	0.004000	0.12327	0.017000	0.09413	0.365000	0.20348	-0.264000	0.09365	0.356000	0.21956	AAA		0.498	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	NM_002364	
NHSL2	340527	hgsc.bcm.edu	37	X	71358844	71358844	+	Silent	SNP	G	G	A	rs142783746	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chrX:71358844G>A	ENST00000373677.1	+	2	1610	c.348G>A	c.(346-348)tcG>tcA	p.S116S	NHSL2_ENST00000535692.1_Silent_p.S116S|NHSL2_ENST00000510661.1_Silent_p.S251S|NHSL2_ENST00000540800.1_Silent_p.S482S			Q5HYW2	NHSL2_HUMAN	NHS-like 2	116								p.S482S(1)|p.S113S(1)		NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					GTGGGACCTCGAGGCTGGAGA	0.607													G|||	35	0.00927152	0.0234	0.0058	3775	,	,		14203	0.0		0.0	False		,,,				2504	0.0				p.S482S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1446A	X						.	G		65,3764		0,56,9,1576,556	13.0	11.0	12.0		1446	-7.5	0.0	X	dbSNP_134	12	0,6718		0,0,0,2428,1862	no	coding-synonymous	NHSL2	NM_001013627.2		0,56,9,4004,2418	AA,AG,A,GG,G		0.0,1.6976,0.6163		482/1226	71358844	65,10482	2197	4290	6487	71275569	SO:0001819	synonymous_variant	340527	exon6					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.348G>A	X.37:g.71358844G>A		Somatic		Capture	SOLID	Phase_I	71275569	NM_001013627	B2RN94	Silent	SNP	ENST00000373677.1	37																																																																																					0.607	NHSL2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057170.1	NM_001013627	
KLHL4	56062	hgsc.bcm.edu	37	X	86887326	86887326	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chrX:86887326G>A	ENST00000373119.4	+	7	1586	c.1441G>A	c.(1441-1443)Gtg>Atg	p.V481M	KLHL4_ENST00000373114.4_Missense_Mutation_p.V481M	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	481						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.V481M(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						GCTCTATGTCGTGGGAGGAAG	0.428																																					p.V481M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1441A	X						.						122.0	103.0	110.0					X																	86887326		2203	4300	6503	86773982	SO:0001583	missense	56062	exon7			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1441G>A	X.37:g.86887326G>A	ENSP00000362211:p.Val481Met	Somatic		Capture	SOLID	Phase_I	86773982	NM_057162	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.430368	0.83776	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.80033	-1.33;-1.33	5.32	5.32	0.75619	Galactose oxidase, beta-propeller (1);	0.067011	0.64402	D	0.000015	D	0.88713	0.6511	M	0.67625	2.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.985	D	0.89973	0.4095	10	0.87932	D	0	.	16.9539	0.86253	0.0:0.0:1.0:0.0	.	481;481	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	M	481	ENSP00000362211:V481M;ENSP00000362206:V481M	ENSP00000362206:V481M	V	+	1	0	KLHL4	86773982	1.000000	0.71417	0.640000	0.29408	0.917000	0.54804	9.225000	0.95219	2.211000	0.71520	0.506000	0.49869	GTG		0.428	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
ABCD1	215	hgsc.bcm.edu	37	X	153002628	153002628	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chrX:153002628G>A	ENST00000218104.3	+	5	1810	c.1411G>A	c.(1411-1413)Gaa>Aaa	p.E471K	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	471					alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)	p.E471K(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGTGGATGTGGAACAGGGGAT	0.662																																					p.E471K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1411A	X						.						112.0	72.0	86.0					X																	153002628		2203	4300	6503	152655822	SO:0001583	missense	215	exon5			Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1411G>A	X.37:g.153002628G>A	ENSP00000218104:p.Glu471Lys	Somatic		Capture	SOLID	Phase_I	152655822	NM_000033	Q6GTZ2	Missense_Mutation	SNP	ENST00000218104.3	37	CCDS14728.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.59|19.59	3.856041|3.856041	0.71834|0.71834	.|.	.|.	ENSG00000101986|ENSG00000101986	ENST00000218104|ENST00000443684	D|.	0.94184|.	-3.37|.	4.0|4.0	4.0|4.0	0.46444|0.46444	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.56673|.	0.2001|.	L|L	0.37750|0.37750	1.13|1.13	0.80722|0.80722	D|D	1|1	B|.	0.28552|.	0.215|.	B|.	0.26614|.	0.071|.	T|.	0.54289|.	-0.8316|.	10|.	0.18276|.	T|.	0.48|.	-18.6211|-18.6211	14.3814|14.3814	0.66914|0.66914	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	471|.	P33897|.	ABCD1_HUMAN|.	K|X	471|138	ENSP00000218104:E471K|.	ENSP00000218104:E471K|.	E|W	+|+	1|3	0|0	ABCD1|ABCD1	152655822|152655822	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.920000|0.920000	0.55202|0.55202	6.758000|6.758000	0.74929|0.74929	1.974000|1.974000	0.57490|0.57490	0.384000|0.384000	0.25694|0.25694	GAA|TGG		0.662	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033	
NPAS2	4862	hgsc.bcm.edu	37	2	101549457	101549457	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:101549457G>A	ENST00000335681.5	+	4	552	c.267G>A	c.(265-267)atG>atA	p.M89I	NPAS2_ENST00000486017.1_3'UTR|NPAS2_ENST00000542504.1_Missense_Mutation_p.M154I	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	89	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.M89I(1)		cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCCAGCTGATGTTGGAGGTGA	0.413																																					p.M89I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G267A	2						.						85.0	76.0	79.0					2																	101549457		2203	4300	6503	100915889	SO:0001583	missense	4862	exon4			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.267G>A	2.37:g.101549457G>A	ENSP00000338283:p.Met89Ile	Somatic		Capture	SOLID	Phase_I	100915889	NM_002518	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	ENST00000335681.5	37	CCDS2048.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	9.367|9.367|9.367	1.069445|1.069445|1.069445	0.20147|0.20147|0.20147	.|.|.	.|.|.	ENSG00000170485|ENSG00000170485|ENSG00000170485	ENST00000427413|ENST00000335681;ENST00000542504;ENST00000451740|ENST00000448812	.|T;T|.	.|0.04654|.	.|3.58;3.59|.	5.67|5.67|5.67	5.67|5.67|5.67	0.87782|0.87782|0.87782	.|PAS (3);PAS fold (1);|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.66317|0.66317|0.66317	0.2777|0.2777|0.2777	L|L|L	0.37850|0.37850|0.37850	1.14|1.14|1.14	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D|.	.|0.69078|.	.|0.997;0.986|.	.|D;D|.	.|0.69307|.	.|0.963;0.952|.	T|T|T	0.60510|0.60510|0.60510	-0.7249|-0.7249|-0.7249	5|10|5	.|0.33940|.	.|T|.	.|0.23|.	.|.|.	19.7612|19.7612|19.7612	0.96319|0.96319|0.96319	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|154;89|.	.|F5H027;Q99743|.	.|.;NPAS2_HUMAN|.	Y|I|I	155|89;154;75|79	.|ENSP00000338283:M89I;ENSP00000438428:M154I|.	.|ENSP00000338283:M89I|.	C|M|V	+|+|+	2|3|1	0|0|0	NPAS2|NPAS2|NPAS2	100915889|100915889|100915889	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	9.329000|9.329000|9.329000	0.96413|0.96413|0.96413	2.646000|2.646000|2.646000	0.89796|0.89796|0.89796	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	TGT|ATG|GTT		0.413	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3		
EVX2	344191	hgsc.bcm.edu	37	2	176946936	176946936	+	Silent	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:176946936C>A	ENST00000308618.4	-	2	805	c.669G>T	c.(667-669)gcG>gcT	p.A223A		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	223					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A223A(1)		kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		GGTTGAGTGCCGCGGCCAGCT	0.622																																					p.A223A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G669T	2						.						26.0	21.0	23.0					2																	176946936		2186	4287	6473	176655182	SO:0001819	synonymous_variant	344191	exon2				CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.669G>T	2.37:g.176946936C>A		Somatic		Capture	SOLID	Phase_I	176655182	NM_001080458		Silent	SNP	ENST00000308618.4	37	CCDS33333.1																																																																																				0.622	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359252.1		
TTN	7273	hgsc.bcm.edu	37	2	179641465	179641465	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:179641465A>T	ENST00000591111.1	-	28	5350	c.5126T>A	c.(5125-5127)cTc>cAc	p.L1709H	TTN_ENST00000589042.1_Missense_Mutation_p.L1709H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.L1709H|TTN_ENST00000342175.6_Missense_Mutation_p.L1663H|TTN_ENST00000342992.6_Missense_Mutation_p.L1709H|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L1663H|TTN_ENST00000460472.2_Missense_Mutation_p.L1663H			Q8WZ42	TITIN_HUMAN	titin	12540	Ig-like 8.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L1663H(3)|p.L1709H(2)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAGGAAGTGAGTTTTTTCTT	0.473																																					p.L1709H												.	.	5	Substitution - Missense(5)	large_intestine(5)	c.T5126A	2						.						88.0	80.0	82.0					2																	179641465		2203	4300	6503	179349710	SO:0001583	missense	7273	exon28			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5126T>A	2.37:g.179641465A>T	ENSP00000465570:p.Leu1709His	Somatic		Capture	SOLID	Phase_I	179349710	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	10.85	1.467347	0.26335	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71	5.34	5.34	0.76211	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.88702	0.6508	H	0.95679	3.705	0.36637	D	0.876629	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.93949	0.7230	9	0.87932	D	0	.	15.3245	0.74150	1.0:0.0:0.0:0.0	.	1663;1663;1663;1709;1709	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	1709;1663;1663;1663;1663;1709	ENSP00000343764:L1709H;ENSP00000434586:L1663H;ENSP00000340554:L1663H;ENSP00000352154:L1663H;ENSP00000354117:L1709H	ENSP00000340554:L1663H	L	-	2	0	TTN	179349710	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.265000	0.95647	2.040000	0.60383	0.533000	0.62120	CTC		0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZNF804A	91752	hgsc.bcm.edu	37	2	185800789	185800789	+	Silent	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:185800789G>A	ENST00000302277.6	+	4	1260	c.666G>A	c.(664-666)gcG>gcA	p.A222A		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	222							metal ion binding (GO:0046872)	p.A222A(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CAAAGAAAGCGTCCGTGAAGC	0.433																																					p.A222A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G666A	2						.						69.0	70.0	70.0					2																	185800789		2203	4299	6502	185509034	SO:0001819	synonymous_variant	91752	exon4			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.666G>A	2.37:g.185800789G>A		Somatic		Capture	SOLID	Phase_I	185509034	NM_194250	A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	37	CCDS2291.1																																																																																				0.433	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
ZSWIM2	151112	hgsc.bcm.edu	37	2	187713825	187713825	+	Silent	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:187713825C>T	ENST00000295131.2	-	1	72	c.33G>A	c.(31-33)agG>agA	p.R11R		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	11					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R11R(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			AGTGTCTTCGCCTTTCAGAGG	0.642																																					p.R11R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G33A	2						.						40.0	38.0	39.0					2																	187713825		2203	4300	6503	187422070	SO:0001819	synonymous_variant	151112	exon1			AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.33G>A	2.37:g.187713825C>T		Somatic		Capture	SOLID	Phase_I	187422070	NM_182521	B3KXV6|Q53SI3|Q57ZY3	Silent	SNP	ENST00000295131.2	37	CCDS33348.1																																																																																				0.642	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521	
TMEM198	130612	hgsc.bcm.edu	37	2	220413910	220413910	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:220413910T>A	ENST00000344458.2	+	5	1364	c.779T>A	c.(778-780)aTg>aAg	p.M260K	TMEM198_ENST00000373883.3_Missense_Mutation_p.M260K|MIR3132_ENST00000581997.1_RNA|RP11-256I23.1_ENST00000596829.1_RNA			Q66K66	TM198_HUMAN	transmembrane protein 198	260	Arg-rich.				multicellular organismal development (GO:0007275)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	16		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GTGCAACTGATGCGGATTCGG	0.637																																					p.M260K												.	.	0			c.T779A	2						.						90.0	97.0	94.0					2																	220413910		2203	4300	6503	220122154	SO:0001583	missense	130612	exon4			BC068567	CCDS33385.1	2q35	2011-12-06			ENSG00000188760	ENSG00000188760			33704	protein-coding gene	gene with protein product							Standard	NM_001005209		Approved	MGC99813, TMEM198A	uc002vmf.3	Q66K66	OTTHUMG00000059156	ENST00000344458.2:c.779T>A	2.37:g.220413910T>A	ENSP00000343507:p.Met260Lys	None		Capture	SOLID	Phase_I	220122154	NM_001005209		Missense_Mutation	SNP	ENST00000344458.2	37	CCDS33385.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.709997	0.68730	.	.	ENSG00000188760	ENST00000344458;ENST00000373883	.	.	.	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.49695	0.1572	N	0.20986	0.625	0.47511	D	0.999449	D	0.54601	0.967	P	0.60789	0.879	T	0.43032	-0.9416	9	0.02654	T	1	-34.5403	14.0	0.64427	0.0:0.0:0.0:1.0	.	260	Q66K66	TM198_HUMAN	K	260	.	ENSP00000343507:M260K	M	+	2	0	TMEM198	220122154	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.833000	0.86765	2.039000	0.60335	0.459000	0.35465	ATG		0.637	TMEM198-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131063.1	NM_001005209	
SPHKAP	80309	hgsc.bcm.edu	37	2	228883418	228883418	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:228883418A>C	ENST00000392056.3	-	7	2198	c.2152T>G	c.(2152-2154)Tgc>Ggc	p.C718G	SPHKAP_ENST00000344657.5_Missense_Mutation_p.C718G	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	718						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AACGTGAAGCATATCACATCT	0.418																																					p.C718G												.	.	0			c.T2152G	2						.						200.0	180.0	187.0					2																	228883418		2203	4300	6503	228591662	SO:0001583	missense	80309	exon7				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2152T>G	2.37:g.228883418A>C	ENSP00000375909:p.Cys718Gly	None		Capture	SOLID	Phase_I	228591662	NM_001142644	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	A	9.688	1.151026	0.21371	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.50001	0.76;0.76	5.81	4.66	0.58398	.	0.290250	0.45606	D	0.000360	T	0.43964	0.1271	L	0.55481	1.735	0.39829	D	0.972946	P;P	0.49961	0.93;0.89	B;P	0.44990	0.383;0.466	T	0.38672	-0.9650	10	0.32370	T	0.25	.	8.5743	0.33590	0.8524:0.0:0.1476:0.0	.	718;718	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	G	718	ENSP00000375909:C718G;ENSP00000339886:C718G	ENSP00000339886:C718G	C	-	1	0	SPHKAP	228591662	0.990000	0.36364	0.843000	0.33291	0.907000	0.53573	3.631000	0.54280	1.132000	0.42129	0.533000	0.62120	TGC		0.418	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
SPHKAP	80309	hgsc.bcm.edu	37	2	228883420	228883420	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:228883420A>C	ENST00000392056.3	-	7	2196	c.2150T>G	c.(2149-2151)aTa>aGa	p.I717R	SPHKAP_ENST00000344657.5_Missense_Mutation_p.I717R	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	717						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CGTGAAGCATATCACATCTAA	0.418																																					p.I717R												.	.	0			c.T2150G	2						.						201.0	180.0	187.0					2																	228883420		2203	4300	6503	228591664	SO:0001583	missense	80309	exon7				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2150T>G	2.37:g.228883420A>C	ENSP00000375909:p.Ile717Arg	None		Capture	SOLID	Phase_I	228591664	NM_001142644	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.760902	0.69763	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.52057	0.68;0.68	5.81	5.81	0.92471	.	0.344891	0.37530	N	0.002046	T	0.58538	0.2129	L	0.58101	1.795	0.80722	D	1	P;P	0.52463	0.624;0.953	B;P	0.53360	0.347;0.724	T	0.62177	-0.6909	10	0.87932	D	0	.	15.6368	0.76961	1.0:0.0:0.0:0.0	.	717;717	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	R	717	ENSP00000375909:I717R;ENSP00000339886:I717R	ENSP00000339886:I717R	I	-	2	0	SPHKAP	228591664	1.000000	0.71417	0.905000	0.35620	0.839000	0.47603	8.553000	0.90686	2.343000	0.79666	0.533000	0.62120	ATA		0.418	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
NMUR1	10316	hgsc.bcm.edu	37	2	232389944	232389944	+	Missense_Mutation	SNP	C	C	T	rs375241123		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:232389944C>T	ENST00000305141.4	-	3	1224	c.1091G>A	c.(1090-1092)cGa>cAa	p.R364Q		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	364					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)	p.R364Q(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GAAGGTCTCTCGGAAGCGGCT	0.657													.|||	1	0.000199681	0.0	0.0	5008	,	,		16686	0.0		0.0	False		,,,				2504	0.001				p.R364Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1091A	2						.	C	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	48.0	53.0	51.0		1091	1.0	0.4	2		51	0,8600		0,0,4300	no	missense	NMUR1	NM_006056.4	43	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging	364/427	232389944	2,13004	2203	4300	6503	232098188	SO:0001583	missense	10316	exon3			AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.1091G>A	2.37:g.232389944C>T	ENSP00000305877:p.Arg364Gln	Somatic		Capture	SOLID	Phase_I	232098188	NM_006056	O43664|Q7LDP6|Q8NE20	Missense_Mutation	SNP	ENST00000305141.4	37	CCDS2486.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.423105	0.62733	4.54E-4	0.0	ENSG00000171596	ENST00000305141	T	0.57273	0.41	4.79	1.01	0.19927	.	0.123545	0.52532	N	0.000067	T	0.45418	0.1341	M	0.75264	2.295	0.42098	D	0.991325	P	0.41345	0.746	B	0.33890	0.172	T	0.42275	-0.9461	10	0.51188	T	0.08	-9.5656	9.168	0.37063	0.0:0.6986:0.0:0.3014	.	364	Q9HB89	NMUR1_HUMAN	Q	364	ENSP00000305877:R364Q	ENSP00000305877:R364Q	R	-	2	0	NMUR1	232098188	0.829000	0.29322	0.414000	0.26521	0.980000	0.70556	1.657000	0.37366	0.015000	0.14971	0.555000	0.69702	CGA		0.657	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
SH3BP4	23677	hgsc.bcm.edu	37	2	235943707	235943707	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:235943707G>C	ENST00000409212.1	+	3	568	c.61G>C	c.(61-63)Ggg>Cgg	p.G21R	SH3BP4_ENST00000392011.2_Missense_Mutation_p.G21R|SH3BP4_ENST00000344528.4_Missense_Mutation_p.G21R			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	21					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)	p.G21R(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CAAGTCAGAGGGGACCCTGAT	0.562																																					p.G21R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G61C	2						.						61.0	62.0	62.0					2																	235943707		2203	4300	6503	235608446	SO:0001583	missense	23677	exon3			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.61G>C	2.37:g.235943707G>C	ENSP00000386862:p.Gly21Arg	Somatic		Capture	SOLID	Phase_I	235608446	NM_014521	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	37	CCDS2513.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.846213	0.91277	.	.	ENSG00000130147	ENST00000392011;ENST00000420127;ENST00000416021;ENST00000409212;ENST00000344528;ENST00000444916;ENST00000446904;ENST00000454947	T;T;T;T;T	0.34072	2.61;1.38;2.61;2.61;1.49	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.47875	0.1469	L	0.34521	1.04	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.64506	0.926;0.926	T	0.50734	-0.8793	10	0.87932	D	0	-35.4239	15.6121	0.76733	0.0:0.0:1.0:0.0	.	21;21	A8K594;Q9P0V3	.;SH3B4_HUMAN	R	21	ENSP00000375867:G21R;ENSP00000403251:G21R;ENSP00000386862:G21R;ENSP00000340237:G21R;ENSP00000415391:G21R	ENSP00000340237:G21R	G	+	1	0	SH3BP4	235608446	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.939000	0.92951	2.275000	0.75901	0.655000	0.94253	GGG		0.562	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
CEP68	23177	hgsc.bcm.edu	37	2	65305046	65305046	+	Silent	SNP	T	T	C	rs143036273	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:65305046T>C	ENST00000377990.2	+	5	2255	c.2052T>C	c.(2050-2052)agT>agC	p.S684S	CEP68_ENST00000546106.1_Intron|CEP68_ENST00000260569.4_Silent_p.S547S|RAB1A_ENST00000494188.1_Intron	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	684					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.S684S(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						TGACGGAGAGTGTCTTACAGA	0.413																																					p.S684S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2052C	2						.						94.0	94.0	94.0					2																	65305046		2203	4300	6503	65158550	SO:0001819	synonymous_variant	23177	exon5			BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.2052T>C	2.37:g.65305046T>C		Somatic		Capture	SOLID	Phase_I	65158550	NM_015147	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Silent	SNP	ENST00000377990.2	37	CCDS1880.2																																																																																				0.413	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
MPHOSPH10	10199	hgsc.bcm.edu	37	2	71371651	71371651	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:71371651C>T	ENST00000244230.2	+	8	1892	c.1540C>T	c.(1540-1542)Cac>Tac	p.H514Y		NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	514					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)	p.H514Y(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						CTCAAACTTCCACTTTATCCC	0.393																																					p.H514Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1540T	2						.						106.0	95.0	98.0					2																	71371651		2203	4300	6503	71225159	SO:0001583	missense	10199	exon8			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1540C>T	2.37:g.71371651C>T	ENSP00000244230:p.His514Tyr	Somatic		Capture	SOLID	Phase_I	71225159	NM_005791	A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	37	CCDS1916.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.800509	0.90538	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.15834	2.39;2.39	5.58	5.58	0.84498	.	0.048451	0.85682	D	0.000000	T	0.40297	0.1111	M	0.76002	2.32	0.80722	D	1	P	0.51057	0.941	P	0.60068	0.868	T	0.03130	-1.1069	10	0.40728	T	0.16	.	17.4466	0.87579	0.0:1.0:0.0:0.0	.	514	O00566	MPP10_HUMAN	Y	514;374	ENSP00000244230:H514Y;ENSP00000393034:H374Y	ENSP00000244230:H514Y	H	+	1	0	MPHOSPH10	71225159	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.018000	0.76406	2.794000	0.96219	0.655000	0.94253	CAC		0.393	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791	
COL6A3	1293	hgsc.bcm.edu	37	2	238285852	238285852	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr2:238285852G>T	ENST00000295550.4	-	7	3085	c.2633C>A	c.(2632-2634)gCt>gAt	p.A878D	COL6A3_ENST00000409809.1_Missense_Mutation_p.A672D|COL6A3_ENST00000346358.4_Missense_Mutation_p.A678D|COL6A3_ENST00000353578.4_Missense_Mutation_p.A672D|COL6A3_ENST00000392003.2_Missense_Mutation_p.A471D|COL6A3_ENST00000472056.1_Missense_Mutation_p.A271D|COL6A3_ENST00000392004.3_Missense_Mutation_p.A672D|COL6A3_ENST00000347401.3_Missense_Mutation_p.A677D	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	878	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCTGTACTGAGCCACCGCAAT	0.502																																					p.A271D												.	.	0			c.C812A	2						.						100.0	99.0	99.0					2																	238285852		2203	4300	6503	237950591	SO:0001583	missense	1293	exon4			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.2633C>A	2.37:g.238285852G>T	ENSP00000295550:p.Ala878Asp	None		Capture	SOLID	Phase_I	237950591	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048089	0.75846	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003;ENST00000433762	D;D;D;D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	5.85	5.85	0.93711	von Willebrand factor, type A (3);	0.000000	0.52532	D	0.000061	D	0.91143	0.7211	M	0.84082	2.675	0.52501	D	0.999957	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.97110	0.99;0.999;0.997;1.0;1.0;0.985	D	0.91795	0.5447	10	0.87932	D	0	.	13.3656	0.60682	0.0717:0.0:0.9283:0.0	.	678;271;471;672;672;878	E9PCV6;E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;.;CO6A3_HUMAN	D	878;677;672;271;672;678;672;471;678	ENSP00000295550:A878D;ENSP00000315609:A677D;ENSP00000315873:A672D;ENSP00000418285:A271D;ENSP00000386844:A672D;ENSP00000295546:A678D;ENSP00000375861:A672D;ENSP00000375860:A471D;ENSP00000389539:A678D	ENSP00000295550:A878D	A	-	2	0	COL6A3	237950591	1.000000	0.71417	0.996000	0.52242	0.821000	0.46438	4.437000	0.59955	2.767000	0.95098	0.655000	0.94253	GCT		0.502	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
PRSS3	5646	hgsc.bcm.edu	37	9	33799155	33799155	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr9:33799155G>T	ENST00000361005.5	+	5	892	c.892G>T	c.(892-894)Gac>Tac	p.D298Y	PRSS3_ENST00000495682.1_3'UTR|PRSS3_ENST00000342836.4_Missense_Mutation_p.D255Y|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_Missense_Mutation_p.D241Y|PRSS3_ENST00000429677.3_Missense_Mutation_p.D234Y	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	298	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.D241Y(1)|p.D298Y(1)		large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			CTGGATTAAGGACACCATCGC	0.567																																					p.D241Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G721T	9						.						112.0	105.0	108.0					9																	33799155		2203	4300	6503	33789155	SO:0001583	missense	5646	exon5				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.892G>T	9.37:g.33799155G>T	ENSP00000354280:p.Asp298Tyr	Somatic		Capture	SOLID	Phase_I	33789155	NM_002771	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	G	8.491	0.861951	0.17178	.	.	ENSG00000010438	ENST00000361005;ENST00000342836;ENST00000429677;ENST00000379405	T;D;T;D	0.93488	0.17;-3.23;0.17;-3.23	3.45	-6.89	0.01660	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	1.451510	0.03486	N	0.215846	D	0.90625	0.7060	L	0.33339	1.005	0.09310	N	1	P;D;D	0.54601	0.667;0.967;0.965	P;P;P	0.51297	0.449;0.561;0.665	D	0.85445	0.1157	10	0.59425	D	0.04	.	8.3981	0.32570	0.0908:0.6466:0.1486:0.114	.	241;298;255	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	Y	298;255;234;241	ENSP00000354280:D298Y;ENSP00000340889:D255Y;ENSP00000401828:D234Y;ENSP00000368715:D241Y	ENSP00000340889:D255Y	D	+	1	0	PRSS3	33789155	0.000000	0.05858	0.003000	0.11579	0.022000	0.10575	-2.302000	0.01136	-1.214000	0.02614	0.306000	0.20318	GAC		0.567	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
PSAT1	29968	hgsc.bcm.edu	37	9	80916929	80916929	+	Missense_Mutation	SNP	C	C	T	rs150812587	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr9:80916929C>T	ENST00000376588.3	+	3	249	c.181C>T	c.(181-183)Cgg>Tgg	p.R61W	PSAT1_ENST00000347159.2_Missense_Mutation_p.R61W	NM_058179.2	NP_478059.1	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1	61					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-serine biosynthetic process (GO:0006564)|pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	O-phospho-L-serine:2-oxoglutarate aminotransferase activity (GO:0004648)|pyridoxal phosphate binding (GO:0030170)	p.R61W(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	20						GAATCTTGTGCGGGAATTGCT	0.328																																					p.R61W	Colon(34;187 791 10662 18313 37609)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C181T	9						.	C	TRP/ARG,TRP/ARG	1,4405	4.2+/-10.8	0,1,2202	113.0	112.0	112.0		181,181	4.5	1.0	9	dbSNP_134	112	0,8600		0,0,4300	no	missense,missense	PSAT1	NM_021154.3,NM_058179.2	101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	61/325,61/371	80916929	1,13005	2203	4300	6503	80106749	SO:0001583	missense	29968	exon3			BC004863	CCDS6659.1, CCDS6660.1	9q21.2	2008-08-11			ENSG00000135069	ENSG00000135069			19129	protein-coding gene	gene with protein product		610936				12633500, 3651428	Standard	NM_058179		Approved	PSA	uc004ala.3	Q9Y617	OTTHUMG00000020066	ENST00000376588.3:c.181C>T	9.37:g.80916929C>T	ENSP00000365773:p.Arg61Trp	Somatic		Capture	SOLID	Phase_I	80106749	NM_058179	Q5T7G5|Q5T7G6|Q96AW2|Q9BQ12	Missense_Mutation	SNP	ENST00000376588.3	37	CCDS6660.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845802	0.71603	2.27E-4	0.0	ENSG00000135069	ENST00000347159;ENST00000376588	D;D	0.88046	-2.33;-2.33	5.42	4.49	0.54785	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.95364	0.8495	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.96530	0.9392	10	0.87932	D	0	-17.3358	15.0479	0.71841	0.1473:0.8527:0.0:0.0	.	61;61	Q9Y617-2;Q9Y617	.;SERC_HUMAN	W	61	ENSP00000317606:R61W;ENSP00000365773:R61W	ENSP00000317606:R61W	R	+	1	2	PSAT1	80106749	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	3.218000	0.51192	1.222000	0.43521	0.655000	0.94253	CGG		0.328	PSAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052777.1	NM_021154	
POSTN	10631	hgsc.bcm.edu	37	13	38154781	38154781	+	Silent	SNP	G	G	A	rs147888983		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr13:38154781G>A	ENST00000379747.4	-	11	1563	c.1446C>T	c.(1444-1446)aaC>aaT	p.N482N	POSTN_ENST00000541481.1_Silent_p.N482N|POSTN_ENST00000379743.4_Silent_p.N482N|POSTN_ENST00000541179.1_Silent_p.N482N|POSTN_ENST00000379742.4_Silent_p.N482N|POSTN_ENST00000379749.4_Silent_p.N482N	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	482	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)	p.N482N(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		GAATCGCACCGTTTCTCCCTT	0.433																																					p.N482N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1446T	13						.	G	,,,	1,4405	2.1+/-5.4	0,1,2202	281.0	258.0	266.0		1446,1446,1446,1446	-5.9	0.8	13	dbSNP_134	266	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	POSTN	NM_001135934.1,NM_001135935.1,NM_001135936.1,NM_006475.2	,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,	482/780,482/782,482/752,482/837	38154781	1,13005	2203	4300	6503	37052781	SO:0001819	synonymous_variant	10631	exon11			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1446C>T	13.37:g.38154781G>A		Somatic		Capture	SOLID	Phase_I	37052781	NM_001135934	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Silent	SNP	ENST00000379747.4	37	CCDS9364.1																																																																																				0.433	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
FREM2	341640	hgsc.bcm.edu	37	13	39263451	39263451	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr13:39263451A>G	ENST00000280481.7	+	1	2186	c.1970A>G	c.(1969-1971)cAc>cGc	p.H657R		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	657					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TTCTATAGACACTCTGGGCCC	0.537																																					p.H657R												.	.	0			c.A1970G	13						.						71.0	67.0	69.0					13																	39263451		2203	4300	6503	38161451	SO:0001583	missense	341640	exon1			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1970A>G	13.37:g.39263451A>G	ENSP00000280481:p.His657Arg	None		Capture	SOLID	Phase_I	38161451	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	A	16.37	3.103613	0.56291	.	.	ENSG00000150893	ENST00000280481	T	0.51817	0.69	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.73583	0.3605	M	0.88979	2.995	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	T	0.79470	-0.1790	10	0.87932	D	0	.	16.2045	0.82114	1.0:0.0:0.0:0.0	.	657	Q5SZK8	FREM2_HUMAN	R	657	ENSP00000280481:H657R	ENSP00000280481:H657R	H	+	2	0	FREM2	38161451	1.000000	0.71417	0.793000	0.32043	0.666000	0.39218	9.335000	0.96500	2.234000	0.73211	0.459000	0.35465	CAC		0.537	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FREM2	341640	hgsc.bcm.edu	37	13	39266575	39266575	+	Silent	SNP	T	T	C	rs369588914		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr13:39266575T>C	ENST00000280481.7	+	1	5310	c.5094T>C	c.(5092-5094)ttT>ttC	p.F1698F		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1698					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F1698F(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTCTTAGATTTATCGTGACAG	0.443																																					p.F1698F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T5094C	13						.	T		0,4406		0,0,2203	103.0	103.0	103.0		5094	-0.2	1.0	13		103	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FREM2	NM_207361.4		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		1698/3170	39266575	1,13005	2203	4300	6503	38164575	SO:0001819	synonymous_variant	341640	exon1			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5094T>C	13.37:g.39266575T>C		Somatic		Capture	SOLID	Phase_I	38164575	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																				0.443	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
GPALPP1	55425	hgsc.bcm.edu	37	13	45602034	45602034	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr13:45602034C>T	ENST00000379151.4	+	8	1022	c.919C>T	c.(919-921)Ctc>Ttc	p.L307F	RP11-321C24.1_ENST00000437748.2_lincRNA|GPALPP1_ENST00000361121.2_Missense_Mutation_p.L307F|GPALPP1_ENST00000357537.3_Missense_Mutation_p.L137F	NM_018559.2	NP_061029.2	Q8IXQ4	GPAM1_HUMAN	GPALPP motifs containing 1	307								p.L307F(1)									TGATAAAGATCTCAAGGTTAA	0.343																																					p.L307F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C919T	13						.						64.0	73.0	70.0					13																	45602034		2202	4300	6502	44500034	SO:0001583	missense	55425	exon8			AB051491	CCDS9394.1	13q14.12	2013-08-13	2013-08-12	2013-08-12	ENSG00000133114	ENSG00000133114			20298	protein-coding gene	gene with protein product			"""KIAA1704"""	KIAA1704		11214970	Standard	NM_018559		Approved	bA245H20.2, AD029, LSR7	uc001uzq.3	Q8IXQ4	OTTHUMG00000016841	ENST00000379151.4:c.919C>T	13.37:g.45602034C>T	ENSP00000368447:p.Leu307Phe	Somatic		Capture	SOLID	Phase_I	44500034	NM_018559	A8K8X8|Q05BX8|Q05D87|Q5T3Z3|Q5T3Z5|Q9C0F9|Q9H2R0|Q9P0W6	Missense_Mutation	SNP	ENST00000379151.4	37	CCDS9394.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686486	0.88639	.	.	ENSG00000133114	ENST00000379151;ENST00000361121;ENST00000357537	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.82737	0.5102	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.83160	-0.0099	9	0.54805	T	0.06	-0.6457	18.7849	0.91951	0.0:1.0:0.0:0.0	.	158;307	Q8IXQ4-2;Q8IXQ4	.;K1704_HUMAN	F	307;307;137	.	ENSP00000350145:L137F	L	+	1	0	KIAA1704	44500034	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.356000	0.79445	2.757000	0.94681	0.585000	0.79938	CTC		0.343	GPALPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044749.2	NM_018559	
COL4A1	1282	hgsc.bcm.edu	37	13	110845252	110845252	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr13:110845252C>T	ENST00000375820.4	-	23	1511	c.1390G>A	c.(1390-1392)Gga>Aga	p.G464R	COL4A1_ENST00000543140.1_Missense_Mutation_p.G464R	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	464	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CAACTCTCTCCTTTTTGACCT	0.502																																					p.G464R												.	.	0			c.G1390A	13						.						72.0	72.0	72.0					13																	110845252		2203	4300	6503	109643253	SO:0001583	missense	1282	exon23			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1390G>A	13.37:g.110845252C>T	ENSP00000364979:p.Gly464Arg	None		Capture	SOLID	Phase_I	109643253	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.230526	0.58777	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	D;D	0.99429	-4.76;-5.89	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	D	0.99701	0.9886	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97210	0.9870	10	0.87932	D	0	.	16.0588	0.80822	0.0:1.0:0.0:0.0	.	464	P02462	CO4A1_HUMAN	R	458;464;464;464	ENSP00000364979:G464R;ENSP00000443348:G464R	ENSP00000364973:G458R	G	-	1	0	COL4A1	109643253	1.000000	0.71417	0.998000	0.56505	0.904000	0.53231	5.261000	0.65496	2.283000	0.76528	0.563000	0.77884	GGA		0.502	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
BEND7	222389	hgsc.bcm.edu	37	10	13481174	13481175	+	Stop_Codon_Del	DEL	AG	AG	-	rs10590401	byFrequency	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	AG	AG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr10:13481174_13481175delAG	ENST00000396900.2	-	0	1556_1557				BEND7_ENST00000341083.3_Stop_Codon_Del|BEND7_ENST00000486542.1_5'UTR			Q8N7W2	BEND7_HUMAN	BEN domain containing 7							extracellular vesicular exosome (GO:0070062)		p.*469fs?(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						agataatttcagagagagaggc	0.47														227	0.0453275	0.1634	0.0144	5008	,	,		24326	0.0		0.001	False		,,,				2504	0.0				p.468_469del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1404_1405del	10						.			589,3675		45,499,1588						0.8	0.0		dbSNP_119	108	6,8248		0,6,4121	no	frameshift	BEND7	NM_152751.2		45,505,5709	A1A1,A1R,RR		0.0727,13.8133,4.7532				595,11923				13521181	SO:0001567	stop_retained_variant	222389	exon9			BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	Exception_encountered	10.37:g.13481182_13481183delAG	Exception_encountered	Somatic		Capture	SOLID	Phase_I	13521180	NM_152751	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Frame_Shift_Del	DEL	ENST00000396900.2	37																																																																																					0.470	BEND7-202	KNOWN	basic	protein_coding	protein_coding		NM_152751	
CUBN	8029	hgsc.bcm.edu	37	10	16960774	16960774	+	Missense_Mutation	SNP	G	G	A	rs150117913		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr10:16960774G>A	ENST00000377833.4	-	45	6912	c.6847C>T	c.(6847-6849)Cgg>Tgg	p.R2283W		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2283	CUB 16. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.R2283W(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACTCCATCCCGCAACTCAAGG	0.403													G|||	1	0.000199681	0.0	0.0	5008	,	,		16777	0.0		0.001	False		,,,				2504	0.0				p.R2283W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6847T	10						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	65.0	55.0	59.0		6847	2.3	1.0	10	dbSNP_134	59	0,8600		0,0,4300	no	missense	CUBN	NM_001081.3	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	2283/3624	16960774	1,13005	2203	4300	6503	17000780	SO:0001583	missense	8029	exon45			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6847C>T	10.37:g.16960774G>A	ENSP00000367064:p.Arg2283Trp	Somatic		Capture	SOLID	Phase_I	17000780	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	16.32	3.090227	0.55968	2.27E-4	0.0	ENSG00000107611	ENST00000377833	T	0.36157	1.27	5.6	2.26	0.28386	CUB (5);	0.000000	0.39834	N	0.001255	T	0.60038	0.2238	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.67534	-0.5646	10	0.66056	D	0.02	.	15.7204	0.77705	0.0:0.0:0.6334:0.3666	.	2283	O60494	CUBN_HUMAN	W	2283	ENSP00000367064:R2283W	ENSP00000367064:R2283W	R	-	1	2	CUBN	17000780	1.000000	0.71417	0.998000	0.56505	0.331000	0.28603	4.147000	0.58078	0.659000	0.30945	0.650000	0.86243	CGG		0.403	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
VIM	7431	hgsc.bcm.edu	37	10	17272654	17272654	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr10:17272654A>T	ENST00000224237.5	+	2	714	c.569A>T	c.(568-570)cAg>cTg	p.Q190L	RP11-124N14.3_ENST00000456355.1_RNA|VIM_ENST00000544301.1_Missense_Mutation_p.Q190L|VIM_ENST00000485947.1_3'UTR|VIM-AS1_ENST00000605833.1_RNA			P08670	VIME_HUMAN	vimentin	190	Coil 1B.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)	p.Q190L(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TTCAGATTGCAGGAGGAGATG	0.572											OREG0020050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q190L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A569T	10						.						127.0	138.0	134.0					10																	17272654		2203	4300	6503	17312660	SO:0001583	missense	7431	exon3			M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.569A>T	10.37:g.17272654A>T	ENSP00000224237:p.Gln190Leu	Somatic	716	Capture	SOLID	Phase_I	17312660	NM_003380	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	ENST00000224237.5	37	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.899266	0.91962	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533;ENST00000421459	D;D;D	0.89123	-2.47;-2.47;-2.47	5.4	5.4	0.78164	Filament (1);	0.000000	0.42821	U	0.000648	D	0.92185	0.7522	M	0.84433	2.695	0.80722	D	1	P;B;P;P;P	0.47604	0.796;0.148;0.775;0.898;0.647	P;B;P;P;P	0.48598	0.464;0.234;0.583;0.583;0.464	D	0.93435	0.6789	10	0.87932	D	0	.	15.0861	0.72155	1.0:0.0:0.0:0.0	.	190;177;177;190;190	Q53HU8;F5H288;B3KRK8;B0YJC4;P08670	.;.;.;.;VIME_HUMAN	L	190;190;177;16	ENSP00000446007:Q190L;ENSP00000224237:Q190L;ENSP00000391842:Q16L	ENSP00000224237:Q190L	Q	+	2	0	VIM	17312660	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.487000	0.81328	2.048000	0.60808	0.519000	0.50382	CAG		0.572	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
PRKG1	5592	hgsc.bcm.edu	37	10	53822303	53822303	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr10:53822303G>A	ENST00000401604.2	+	7	996	c.802G>A	c.(802-804)Gtc>Atc	p.V268I	PRKG1_ENST00000373980.4_Missense_Mutation_p.V283I|PRKG1_ENST00000373985.1_Missense_Mutation_p.V256I|PRKG1_ENST00000373975.2_5'UTR			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	268	cGMP-binding, low affinity.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)	p.V283I(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		GCAGGTAAATGTCACTCGTGA	0.403																																					p.V283I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G847A	10						.						65.0	64.0	64.0					10																	53822303		2203	4300	6503	53492309	SO:0001583	missense	5592	exon7				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.802G>A	10.37:g.53822303G>A	ENSP00000384200:p.Val268Ile	Somatic		Capture	SOLID	Phase_I	53492309	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	37	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831832	0.71258	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000373976	D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26	5.76	5.76	0.90799	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.136717	0.48286	D	0.000182	D	0.92344	0.7571	L	0.43554	1.36	0.80722	D	1	B;B	0.26445	0.149;0.025	B;B	0.37346	0.238;0.247	D	0.89427	0.3714	10	0.41790	T	0.15	-21.1759	17.4751	0.87657	0.0:0.0:1.0:0.0	.	283;268	Q13976-2;Q13976	.;KGP1_HUMAN	I	268;256;283;141	ENSP00000384200:V268I;ENSP00000363097:V256I;ENSP00000363092:V283I;ENSP00000363087:V141I	ENSP00000363087:V141I	V	+	1	0	PRKG1	53492309	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.296000	0.96104	2.726000	0.93360	0.655000	0.94253	GTC		0.403	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ANAPC16	119504	hgsc.bcm.edu	37	10	73992773	73992773	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr10:73992773C>T	ENST00000299381.4	+	4	350	c.232C>T	c.(232-234)Cgg>Tgg	p.R78W	ANAPC16_ENST00000470481.2_3'UTR	NM_001242546.1|NM_001242547.1|NM_001242548.1|NM_173473.3	NP_001229475.1|NP_001229476.1|NP_001229477.1|NP_775744.1	Q96DE5	APC16_HUMAN	anaphase promoting complex subunit 16	78					mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	anaphase-promoting complex (GO:0005680)|cytoplasm (GO:0005737)		p.R78W(1)		large_intestine(1)|ovary(1)	2						GCAAGTTGCTCGGATGGAAAA	0.488																																					p.R78W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C232T	10						.						89.0	83.0	85.0					10																	73992773		2203	4300	6503	73662779	SO:0001583	missense	119504	exon4			BC009530	CCDS7314.1, CCDS73147.1	10q22.2	2011-08-12	2010-04-06	2010-04-06	ENSG00000166295	ENSG00000166295		"""Anaphase promoting complex subunits"""	26976	protein-coding gene	gene with protein product	"""centromere protein 27"""	613427	"""chromosome 10 open reading frame 104"""	C10orf104		14702039, 20360068	Standard	NM_001242546		Approved	bA570G20.3, FLJ33728, APC16, CENP-27	uc021psp.1	Q96DE5	OTTHUMG00000018433	ENST00000299381.4:c.232C>T	10.37:g.73992773C>T	ENSP00000299381:p.Arg78Trp	Somatic		Capture	SOLID	Phase_I	73662779	NM_173473		Missense_Mutation	SNP	ENST00000299381.4	37	CCDS7314.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.807166	0.50421	.	.	ENSG00000166295	ENST00000299381	.	.	.	6.03	3.12	0.35913	.	0.051235	0.85682	N	0.000000	T	0.36386	0.0965	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14811	-1.0459	9	0.87932	D	0	.	11.214	0.48815	0.0:0.6948:0.2402:0.065	.	78	Q96DE5	APC16_HUMAN	W	78	.	ENSP00000299381:R78W	R	+	1	2	ANAPC16	73662779	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.422000	0.52749	0.406000	0.25560	-0.175000	0.13238	CGG		0.488	ANAPC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048565.2	NM_173473	
KIF11	3832	hgsc.bcm.edu	37	10	94368932	94368932	+	Silent	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr10:94368932A>G	ENST00000260731.3	+	5	633	c.543A>G	c.(541-543)agA>agG	p.R181R		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	181	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)	p.R181R(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTTCTGAGAGACTACAGATGT	0.363																																					p.R181R	Colon(47;212 1003 2764 4062 8431)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A543G	10						.						92.0	94.0	93.0					10																	94368932		2203	4300	6503	94358912	SO:0001819	synonymous_variant	3832	exon5			X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.543A>G	10.37:g.94368932A>G		Somatic		Capture	SOLID	Phase_I	94358912	NM_004523	A0AV49|B2RMV3|Q15716|Q5VWX0	Silent	SNP	ENST00000260731.3	37	CCDS7422.1																																																																																				0.363	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049401.1	NM_004523	
NOC3L	64318	hgsc.bcm.edu	37	10	96112675	96112675	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr10:96112675G>A	ENST00000371361.3	-	7	936	c.836C>T	c.(835-837)aCa>aTa	p.T279I	NOC3L_ENST00000371350.1_Missense_Mutation_p.T279I|NOC3L_ENST00000543788.1_Missense_Mutation_p.T17I|NOC3L_ENST00000463649.1_5'UTR	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	279					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.T279I(1)		endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				TTCTGCTTCTGTGAGGGGCCG	0.333																																					p.T279I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C836T	10						.						81.0	84.0	83.0					10																	96112675		2203	4300	6503	96102665	SO:0001583	missense	64318	exon7			AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.836C>T	10.37:g.96112675G>A	ENSP00000360412:p.Thr279Ile	Somatic		Capture	SOLID	Phase_I	96102665	NM_022451	Q9H5M6|Q9H9D8	Missense_Mutation	SNP	ENST00000371361.3	37	CCDS7433.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602799	0.87157	.	.	ENSG00000173145	ENST00000543788;ENST00000371361;ENST00000371350	T;T;T	0.19250	2.16;2.33;2.33	4.88	4.88	0.63580	Nucleolar complex-associated (1);	0.000000	0.85682	D	0.000000	T	0.51278	0.1665	M	0.83692	2.655	0.58432	D	0.999998	D	0.89917	1.0	D	0.81914	0.995	T	0.58047	-0.7705	10	0.56958	D	0.05	-6.8824	18.0559	0.89364	0.0:0.0:1.0:0.0	.	279	Q8WTT2	NOC3L_HUMAN	I	17;279;279	ENSP00000437838:T17I;ENSP00000360412:T279I;ENSP00000360401:T279I	ENSP00000360401:T279I	T	-	2	0	NOC3L	96102665	1.000000	0.71417	0.984000	0.44739	0.946000	0.59487	9.476000	0.97823	2.247000	0.74100	0.585000	0.79938	ACA		0.333	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451	
TCF7L2	6934	hgsc.bcm.edu	37	10	114911545	114911545	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr10:114911545A>G	ENST00000355995.4	+	10	1570	c.1063A>G	c.(1063-1065)Aat>Gat	p.N355D	TCF7L2_ENST00000538897.1_Missense_Mutation_p.N355D|TCF7L2_ENST00000543371.1_Missense_Mutation_p.N355D|TCF7L2_ENST00000352065.5_Missense_Mutation_p.N332D|TCF7L2_ENST00000534894.1_Missense_Mutation_p.N355D|TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000369397.4_Missense_Mutation_p.N332D|TCF7L2_ENST00000536810.1_Missense_Mutation_p.N355D|TCF7L2_ENST00000545257.1_Missense_Mutation_p.N355D|TCF7L2_ENST00000355717.4_Missense_Mutation_p.N379D|TCF7L2_ENST00000542695.1_Missense_Mutation_p.N71D|TCF7L2_ENST00000369386.1_5'UTR|TCF7L2_ENST00000369389.1_Missense_Mutation_p.N66D			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	355	Mediates interaction with MAD2L2.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.N332D(1)|p.N355D(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		GAAACCTCTTAATGCATTCAT	0.448			T	VTI1A	colorectal																																p.N328D			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A982G	10						.						68.0	69.0	69.0					10																	114911545		2203	4300	6503	114901535	SO:0001583	missense	6934	exon9			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1063A>G	10.37:g.114911545A>G	ENSP00000348274:p.Asn355Asp	Somatic		Capture	SOLID	Phase_I	114901535	NM_001146284	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	a	25.4	4.629875	0.87660	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000352065;ENST00000542695;ENST00000369389;ENST00000277945	D;D;D;D;D;D;D;D;D;D;D;D	0.98493	-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96	5.24	5.24	0.73138	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.164524	0.52532	D	0.000068	D	0.99348	0.9771	H	0.97564	4.03	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.994;0.971;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;0.998;1.0;0.999;1.0;1.0;1.0;1.0;0.998;0.992;0.985;1.0;1.0;0.999	D	0.98519	1.0622	10	0.87932	D	0	-9.9586	15.1346	0.72552	1.0:0.0:0.0:0.0	.	212;172;254;355;226;270;328;332;332;298;355;332;332;337;379;332;355;328;332	B4DJZ2;B7Z9Z6;B4DWD5;Q9NQB0;C6ZRK4;C6ZRJ6;C6ZRJ9;F8W742;B4DRJ8;C6ZRK2;B9X074;C6ZRJ8;C6ZRK1;C6ZRJ7;F8W7T5;C6ZRK5;Q9NQB0-7;Q9NQB0-10;Q6FHW4	.;.;.;TF7L2_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	D	355;355;355;355;379;355;355;332;332;71;66;72	ENSP00000348274:N355D;ENSP00000440547:N355D;ENSP00000444972:N355D;ENSP00000446238:N355D;ENSP00000347949:N379D;ENSP00000446172:N355D;ENSP00000443626:N355D;ENSP00000358404:N332D;ENSP00000344823:N332D;ENSP00000443883:N71D;ENSP00000358396:N66D;ENSP00000277945:N72D	ENSP00000277945:N72D	N	+	1	0	TCF7L2	114901535	1.000000	0.71417	0.998000	0.56505	0.761000	0.43186	9.335000	0.96500	1.982000	0.57802	0.533000	0.62120	AAT		0.448	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
APC	324	hgsc.bcm.edu	37	5	112175390	112175390	+	Nonsense_Mutation	SNP	C	C	T	rs121913328		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr5:112175390C>T	ENST00000457016.1	+	16	4479	c.4099C>T	c.(4099-4101)Cag>Tag	p.Q1367*	APC_ENST00000508376.2_Nonsense_Mutation_p.Q1367*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1367*			P25054	APC_HUMAN	adenomatous polyposis coli	1367	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1367*(26)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGTGGTGCTCAGACACCCAA	0.453	Q1367*(C2BBE1_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1349X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	28	Substitution - Nonsense(26)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(26)|soft_tissue(1)|skin(1)	c.C4045T	5	GRCh37	CM940072	APC	M	rs121913328	.						75.0	73.0	74.0					5																	112175390		2202	4300	6502	112203289	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4099C>T	5.37:g.112175390C>T	ENSP00000413133:p.Gln1367*	Somatic		Capture	SOLID	Phase_I	112203289	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.623019	0.98890	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	5.3	0.74995	.	0.166931	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.8965	17.2482	0.87034	0.0:0.8741:0.1259:0.0	.	.	.	.	X	1367	.	.	Q	+	1	0	APC	112203289	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.223000	0.72257	1.603000	0.50134	0.655000	0.94253	CAG		0.453	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ANKHD1	54882	hgsc.bcm.edu	37	5	139876699	139876699	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr5:139876699A>C	ENST00000360839.2	+	15	2994	c.2840A>C	c.(2839-2841)aAt>aCt	p.N947T	ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.N947T|ANKHD1_ENST00000462121.1_3'UTR|ANKHD1_ENST00000297183.6_Missense_Mutation_p.N947T	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	947						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATGGGACAAATTCTCTTGAA	0.433																																					p.N947T												.	.	0			c.A2840C	5						.						130.0	131.0	130.0					5																	139876699		2203	4300	6503	139856883	SO:0001583	missense	404734	exon15			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.2840A>C	5.37:g.139876699A>C	ENSP00000354085:p.Asn947Thr	None		Capture	SOLID	Phase_I	139856883	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	A	13.32	2.203003	0.38905	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000421134;ENST00000532219	T;T;T;T	0.65549	-0.12;-0.16;-0.1;-0.16	5.77	4.61	0.57282	Ankyrin repeat-containing domain (1);	0.240281	0.40385	N	0.001114	T	0.46171	0.1379	L	0.29908	0.895	0.31361	N	0.681408	B;B;B	0.19331	0.013;0.035;0.02	B;B;B	0.19391	0.025;0.018;0.018	T	0.43410	-0.9393	10	0.08599	T	0.76	.	11.8221	0.52245	0.9313:0.0:0.0687:0.0	.	947;947;947	Q8IWZ3-4;Q8IWZ2;Q8IWZ3	.;.;ANKH1_HUMAN	T	947;980;947;947;481;966;947	ENSP00000354085:N947T;ENSP00000297183:N947T;ENSP00000394489:N966T;ENSP00000432016:N947T	ENSP00000432016:N947T	N	+	2	0	ANKHD1-EIF4EBP3;ANKHD1	139856883	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.750000	0.55157	0.999000	0.39023	0.482000	0.46254	AAT		0.433	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
PCDHA7	56141	hgsc.bcm.edu	37	5	140215170	140215170	+	Missense_Mutation	SNP	T	T	G	rs149764673		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr5:140215170T>G	ENST00000525929.1	+	1	1202	c.1202T>G	c.(1201-1203)tTc>tGc	p.F401C	PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.F401C|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	401	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGTCCACCTTCAAGAATTAC	0.562																																					p.F401C	NSCLC(160;258 2013 5070 22440 28951)											.	.	0			c.T1202G	5						.						128.0	128.0	128.0					5																	140215170		2203	4299	6502	140195354	SO:0001583	missense	56141	exon1			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1202T>G	5.37:g.140215170T>G	ENSP00000436426:p.Phe401Cys	None		Capture	SOLID	Phase_I	140195354	NM_018910	O75282	Missense_Mutation	SNP	ENST00000525929.1	37	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	T	10.15	1.270339	0.23221	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.59083	0.29;0.29	4.04	4.04	0.47022	Cadherin (4);Cadherin-like (1);	0.000000	0.33438	U	0.004918	T	0.77532	0.4144	M	0.90483	3.12	0.24446	N	0.994504	D;D	0.71674	0.998;0.998	D;D	0.80764	0.973;0.994	T	0.70204	-0.4936	10	0.87932	D	0	.	9.9163	0.41436	0.1521:0.0:0.0:0.8479	.	401;401	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	C	401	ENSP00000436426:F401C;ENSP00000367365:F401C	ENSP00000367365:F401C	F	+	2	0	PCDHA7	140195354	0.000000	0.05858	0.996000	0.52242	0.166000	0.22503	-0.771000	0.04699	1.592000	0.50018	0.254000	0.18369	TTC		0.562	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCDHGC5	56097	hgsc.bcm.edu	37	5	140870955	140870955	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr5:140870955C>A	ENST00000252087.1	+	1	2148	c.2148C>A	c.(2146-2148)tgC>tgA	p.C716*	PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	716					homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.C716*(2)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCGAAGTGCCTTCAGGGAA	0.592																																					p.C716X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2148A	5						.						105.0	108.0	107.0					5																	140870955		2203	4300	6503	140851139	SO:0001587	stop_gained	56097	exon1			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.2148C>A	5.37:g.140870955C>A	ENSP00000252087:p.Cys716*	Somatic		Capture	SOLID	Phase_I	140851139	NM_018929	Q9Y5C2	Nonsense_Mutation	SNP	ENST00000252087.1	37	CCDS4263.1	.	.	.	.	.	.	.	.	.	.	C	37	6.326929	0.97476	.	.	ENSG00000240764	ENST00000252087	.	.	.	4.93	3.11	0.35812	.	0.000000	0.49916	D	0.000132	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	8.1154	0.30940	0.0:0.7053:0.0:0.2947	.	.	.	.	X	716	.	ENSP00000252087:C716X	C	+	3	2	PCDHGC5	140851139	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	1.211000	0.32382	1.289000	0.44618	0.561000	0.74099	TGC		0.592	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929	
DOCK2	1794	hgsc.bcm.edu	37	5	169507235	169507235	+	Silent	SNP	G	G	A	rs201601393		TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00K-01A-02W-A005-10	TCGA-AA-A00K-10A-01W-A005-10	g.chr5:169507235G>A	ENST00000256935.8	+	50	5315	c.5235G>A	c.(5233-5235)gcG>gcA	p.A1745A	DOCK2_ENST00000540750.1_Silent_p.A806A|DOCK2_ENST00000520908.1_Silent_p.A1237A|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1745					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.A1745A(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCCTCAAGGCGTCTGTCCTCT	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		18211	0.001		0.0	False		,,,				2504	0.0				p.A1745A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5235A	5						.	G		0,4406		0,0,2203	134.0	109.0	117.0		5235	-9.2	0.0	5		117	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DOCK2	NM_004946.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1745/1831	169507235	1,13005	2203	4300	6503	169439813	SO:0001819	synonymous_variant	1794	exon50			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5235G>A	5.37:g.169507235G>A		Somatic		Capture	SOLID	Phase_I	169439813	NM_004946	Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	CCDS4371.1																																																																																				0.562	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
