#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TSHZ3	57616	hgsc.bcm.edu	37	19	31770141	31770141	+	Silent	SNP	C	C	T	rs139408497	byFrequency	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr19:31770141C>T	ENST00000240587.4	-	2	885	c.558G>A	c.(556-558)ccG>ccA	p.P186P		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	186					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P3P(1)|p.P186P(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GGCTGGGCTCCGGGAGCATGC	0.632													C|||	9	0.00179712	0.0	0.0	5008	,	,		16593	0.0079		0.0	False		,,,				2504	0.001				p.P186P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G558A	19						.	C		0,4406		0,0,2203	42.0	41.0	41.0		558	-10.8	0.1	19	dbSNP_134	41	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TSHZ3	NM_020856.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		186/1082	31770141	1,13005	2203	4300	6503	36461981	SO:0001819	synonymous_variant	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.558G>A	19.37:g.31770141C>T		Somatic		Capture	SOLID	Phase_I	36461981	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																				0.632	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
ZNF382	84911	hgsc.bcm.edu	37	19	37100894	37100894	+	Silent	SNP	T	T	C			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr19:37100894T>C	ENST00000292928.2	+	3	191	c.78T>C	c.(76-78)ccT>ccC	p.P26P	ZNF382_ENST00000435416.1_Silent_p.P26P|ZNF382_ENST00000423582.1_Intron|ZNF382_ENST00000439428.1_Silent_p.P25P	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	26	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.|Mediates interaction with TRIM28. {ECO:0000250}.|Represses transcription. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P26P(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AACTAGACCCTGCTCAGAAGG	0.473																																					p.P26P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T78C	19						.						155.0	141.0	146.0					19																	37100894		2203	4300	6503	41792734	SO:0001819	synonymous_variant	84911	exon3			AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.78T>C	19.37:g.37100894T>C		Somatic		Capture	SOLID	Phase_I	41792734	NM_032825	A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Silent	SNP	ENST00000292928.2	37	CCDS33004.1																																																																																				0.473	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	NM_032825	
CYP2A13	1553	hgsc.bcm.edu	37	19	41599640	41599640	+	Missense_Mutation	SNP	G	G	A	rs566665410		TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr19:41599640G>A	ENST00000330436.3	+	6	937	c.937G>A	c.(937-939)Ggt>Agt	p.G313S		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	313					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.G313S(1)		breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CCTGCGCTACGGTTTCCTGCT	0.567													g|||	1	0.000199681	0.0	0.0	5008	,	,		19716	0.0		0.0	False		,,,				2504	0.001				p.G313S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G937A	19						.						92.0	79.0	83.0					19																	41599640		2203	4300	6503	46291480	SO:0001583	missense	1553	exon6			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.937G>A	19.37:g.41599640G>A	ENSP00000332679:p.Gly313Ser	Somatic		Capture	SOLID	Phase_I	46291480	NM_000766	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	37	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	14.88	2.666359	0.47677	.	.	ENSG00000197838	ENST00000330436	T	0.68903	-0.36	4.58	3.54	0.40534	.	0.140984	0.47093	D	0.000254	T	0.62792	0.2457	N	0.20845	0.615	0.30297	N	0.78982	D	0.64830	0.994	P	0.56088	0.791	T	0.64445	-0.6406	10	0.54805	T	0.06	.	11.8262	0.52269	0.0879:0.0:0.9121:0.0	.	313	Q16696	CP2AD_HUMAN	S	313	ENSP00000332679:G313S	ENSP00000332679:G313S	G	+	1	0	CYP2A13	46291480	1.000000	0.71417	0.981000	0.43875	0.040000	0.13550	4.913000	0.63341	1.170000	0.42753	0.485000	0.47835	GGT		0.567	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
PSG9	5678	hgsc.bcm.edu	37	19	43763039	43763039	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr19:43763039G>A	ENST00000270077.3	-	4	1054	c.958C>T	c.(958-960)Cgc>Tgc	p.R320C	PSG9_ENST00000443718.3_Missense_Mutation_p.R227C|PSG9_ENST00000418820.2_Missense_Mutation_p.R227C|PSG9_ENST00000593948.1_Intron|PSG9_ENST00000596730.1_Intron|PSG9_ENST00000291752.5_Intron|PSG9_ENST00000244293.7_Intron	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	320	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.R320C(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				GGGTTACTGCGGAGGCCACCA	0.488																																					p.R320C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C958T	19						.						109.0	111.0	110.0					19																	43763039		2137	4283	6420	48454879	SO:0001583	missense	5678	exon4			M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.958C>T	19.37:g.43763039G>A	ENSP00000270077:p.Arg320Cys	Somatic		Capture	SOLID	Phase_I	48454879	NM_002784	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000270077.3	37	CCDS12618.1	.	.	.	.	.	.	.	.	.	.	N	8.625	0.892402	0.17613	.	.	ENSG00000183668	ENST00000270077;ENST00000443718;ENST00000435220	T;T	0.12774	2.65;2.65	1.39	-2.77	0.05877	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.29976	0.0750	M	0.79926	2.475	0.09310	N	1	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.964	T	0.12993	-1.0526	9	0.62326	D	0.03	.	2.8093	0.05436	0.3164:0.0:0.4671:0.2165	.	227;320	E7EW65;Q00887	.;PSG9_HUMAN	C	320;227;281	ENSP00000270077:R320C;ENSP00000396753:R227C	ENSP00000270077:R320C	R	-	1	0	PSG9	48454879	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.652000	0.05366	-1.133000	0.02903	-1.050000	0.02344	CGC		0.488	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323065.1	NM_002784	
DHX34	9704	hgsc.bcm.edu	37	19	47858433	47858433	+	Silent	SNP	C	C	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr19:47858433C>A	ENST00000328771.4	+	3	1192	c.843C>A	c.(841-843)gtC>gtA	p.V281V		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	281	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.V281V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		TGGATGAAGTCCATGAGCGGC	0.597																																					p.V281V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C843A	19						.						114.0	94.0	101.0					19																	47858433		2203	4300	6503	52550273	SO:0001819	synonymous_variant	9704	exon3			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.843C>A	19.37:g.47858433C>A		Somatic		Capture	SOLID	Phase_I	52550273	NM_014681	B4DMY8	Silent	SNP	ENST00000328771.4	37	CCDS12700.1																																																																																				0.597	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
AURKC	6795	hgsc.bcm.edu	37	19	57743915	57743915	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr19:57743915C>A	ENST00000302804.7	+	4	488	c.302C>A	c.(301-303)cCc>cAc	p.P101H	AURKC_ENST00000598785.1_Missense_Mutation_p.P67H|AURKC_ENST00000415300.2_Missense_Mutation_p.P82H|AURKC_ENST00000448930.1_Missense_Mutation_p.P67H|AURKC_ENST00000599062.1_Missense_Mutation_p.P98H	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	101	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.P67H(1)|p.P101H(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		TTCAGACACCCCAATATCCTG	0.483																																					p.P67H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C200A	19						.						98.0	92.0	94.0					19																	57743915		2203	4300	6503	62435727	SO:0001583	missense	6795	exon4				CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.302C>A	19.37:g.57743915C>A	ENSP00000302898:p.Pro101His	Somatic		Capture	SOLID	Phase_I	62435727	NM_003160	O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	ENST00000302804.7	37	CCDS33128.1	.	.	.	.	.	.	.	.	.	.	C	17.84	3.487109	0.63962	.	.	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.12465	2.68;2.68;2.68	3.6	1.34	0.21922	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.115127	0.64402	N	0.000012	T	0.33177	0.0854	M	0.87827	2.91	0.53005	D	0.999967	D;D;P	0.61697	0.99;0.972;0.948	P;P;P	0.60789	0.879;0.786;0.809	T	0.13388	-1.0511	10	0.87932	D	0	-7.0262	8.2156	0.31509	0.1762:0.653:0.1708:0.0	.	98;101;82	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	H	82;67;101	ENSP00000407162:P82H;ENSP00000406798:P67H;ENSP00000302898:P101H	ENSP00000302898:P101H	P	+	2	0	AURKC	62435727	1.000000	0.71417	0.983000	0.44433	0.875000	0.50365	3.566000	0.53805	0.471000	0.27319	0.555000	0.69702	CCC		0.483	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465089.1	NM_003160	
NBPF15	284565	hgsc.bcm.edu	37	1	148753320	148753320	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr1:148753320C>T	ENST00000417839.1	+	12	1527	c.1337C>T	c.(1336-1338)aCt>aTt	p.T446I		NM_001102663.1	NP_001096133	Q5SXJ2	NBPFG_HUMAN		446	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.T446I(2)		breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4	all_hematologic(923;0.032)					TGTTATTCGACTCCTTCAGAT	0.473																																					p.T446I												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1337T	1						.						1.0	1.0	1.0					1																	148753320		548	611	1159	147019944	SO:0001583	missense	728936	exon12																														ENST00000417839.1:c.1337C>T	1.37:g.148753320C>T	ENSP00000395369:p.Thr446Ile	Somatic		Capture	SOLID	Phase_I	147019944	NM_001102663	A8MPT6	Missense_Mutation	SNP	ENST00000417839.1	37	CCDS41384.1	.	.	.	.	.	.	.	.	.	.	c	7.852	0.724198	0.15439	.	.	ENSG00000203827	ENST00000417839;ENST00000254372	T	0.18338	2.22	0.109	0.109	0.14578	DUF1220 (2);	.	.	.	.	T	0.27063	0.0663	M	0.87547	2.89	0.09310	N	1	D;B	0.69078	0.997;0.427	D;B	0.79108	0.992;0.344	T	0.03000	-1.1084	8	0.72032	D	0.01	.	.	.	.	.	446;256	Q5SXJ2;B4DRP3	NBPFG_HUMAN;.	I	446	ENSP00000395369:T446I	ENSP00000254372:T446I	T	+	2	0	NBPF16	147019944	0.047000	0.20315	0.019000	0.16419	0.019000	0.09904	0.962000	0.29280	0.181000	0.19994	0.184000	0.17185	ACT		0.473	NBPF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097693.1		
ARNT	405	hgsc.bcm.edu	37	1	150784514	150784514	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr1:150784514G>A	ENST00000358595.5	-	22	2553	c.2353C>T	c.(2353-2355)Ccc>Tcc	p.P785S	ARNT_ENST00000354396.2_Missense_Mutation_p.P783S|ARNT_ENST00000505755.1_Missense_Mutation_p.P770S|ARNT_ENST00000515192.1_Missense_Mutation_p.P771S|RNU6-1309P_ENST00000363305.1_RNA	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	785					cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.P785S(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			GAAAAGGGGGGAAACATAGTT	0.383			T	ETV6	AML																																p.P769S			Dom	yes		1	1q21	405	aryl hydrocarbon receptor nuclear translocator		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2305T	1						.						76.0	75.0	75.0					1																	150784514		2203	4300	6503	149051138	SO:0001583	missense	405	exon21			AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.2353C>T	1.37:g.150784514G>A	ENSP00000351407:p.Pro785Ser	Somatic		Capture	SOLID	Phase_I	149051138	NM_001197325	B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Missense_Mutation	SNP	ENST00000358595.5	37	CCDS970.1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.412348	0.62511	.	.	ENSG00000143437	ENST00000358595;ENST00000354396;ENST00000515192;ENST00000394700;ENST00000505755	T;T;T;T	0.08282	3.21;3.26;3.21;3.11	5.2	5.2	0.72013	.	0.128917	0.53938	D	0.000057	T	0.16041	0.0386	L	0.57536	1.79	0.49299	D	0.999778	P;D;D;D;P	0.65815	0.9;0.995;0.995;0.995;0.835	B;P;P;P;B	0.62014	0.334;0.897;0.897;0.897;0.291	T	0.01018	-1.1479	10	0.39692	T	0.17	.	18.7458	0.91792	0.0:0.0:1.0:0.0	.	769;783;771;770;785	A8K6P0;F8WAP6;P27540-3;P27540-2;P27540	.;.;.;.;ARNT_HUMAN	S	785;783;771;736;770	ENSP00000351407:P785S;ENSP00000346372:P783S;ENSP00000423851:P771S;ENSP00000427571:P770S	ENSP00000346372:P783S	P	-	1	0	ARNT	149051138	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.976000	0.63785	2.441000	0.82636	0.655000	0.94253	CCC		0.383	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084741.2		
TUFT1	7286	hgsc.bcm.edu	37	1	151542154	151542154	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr1:151542154G>T	ENST00000368849.3	+	7	564	c.502G>T	c.(502-504)Gat>Tat	p.D168Y	TUFT1_ENST00000538902.1_Missense_Mutation_p.D187Y|TUFT1_ENST00000353024.3_Missense_Mutation_p.D109Y|TUFT1_ENST00000392712.3_Missense_Mutation_p.D113Y|TUFT1_ENST00000368848.2_Missense_Mutation_p.D143Y	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	168					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)	p.D168Y(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TATAAATGAGGATGTTGAGAG	0.532																																					p.D168Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G502T	1						.						258.0	256.0	257.0					1																	151542154		2203	4300	6503	149808778	SO:0001583	missense	7286	exon7			AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.502G>T	1.37:g.151542154G>T	ENSP00000357842:p.Asp168Tyr	Somatic		Capture	SOLID	Phase_I	149808778	NM_020127	B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Missense_Mutation	SNP	ENST00000368849.3	37	CCDS1000.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102399	0.76983	.	.	ENSG00000143367	ENST00000368849;ENST00000392712;ENST00000353024;ENST00000368848;ENST00000538902;ENST00000507671	T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42	5.31	5.31	0.75309	.	0.054165	0.64402	D	0.000001	T	0.40979	0.1139	M	0.65975	2.015	0.35152	D	0.769878	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.74023	0.982;0.967;0.967	T	0.47169	-0.9138	10	0.66056	D	0.02	-9.5128	9.9941	0.41889	0.0919:0.0:0.9081:0.0	.	187;143;168	F5H607;Q9NNX1-2;Q9NNX1	.;.;TUFT1_HUMAN	Y	168;113;109;143;187;143	ENSP00000357842:D168Y;ENSP00000376476:D113Y;ENSP00000343781:D109Y;ENSP00000357841:D143Y;ENSP00000437997:D187Y	ENSP00000343781:D109Y	D	+	1	0	TUFT1	149808778	1.000000	0.71417	0.051000	0.19133	0.438000	0.31896	5.293000	0.65680	2.476000	0.83614	0.557000	0.71058	GAT		0.532	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035022.1	NM_020127	
E2F2	1870	hgsc.bcm.edu	37	1	23836582	23836582	+	Silent	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr1:23836582C>T	ENST00000361729.2	-	7	1530	c.1104G>A	c.(1102-1104)ttG>ttA	p.L368L		NM_004091.3	NP_004082.1	Q14209	E2F2_HUMAN	E2F transcription factor 2	368	Transactivation. {ECO:0000255}.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.L368L(1)		endometrium(4)|large_intestine(2)|lung(1)|ovary(3)|skin(2)|urinary_tract(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.52e-24)|Colorectal(126;6.25e-08)|COAD - Colon adenocarcinoma(152;3.42e-06)|GBM - Glioblastoma multiforme(114;8.98e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|KIRC - Kidney renal clear cell carcinoma(1967;0.00366)|STAD - Stomach adenocarcinoma(196;0.0132)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.0888)|LUSC - Lung squamous cell carcinoma(448;0.19)		CAGTAGCCTCCAAGGGGACCA	0.652																																					p.L368L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1104A	1						.						19.0	21.0	20.0					1																	23836582		2203	4300	6503	23709169	SO:0001819	synonymous_variant	1870	exon7			L22846	CCDS236.1	1p36	2008-02-05			ENSG00000007968	ENSG00000007968			3114	protein-coding gene	gene with protein product		600426				8246995, 8246996	Standard	NM_004091		Approved	E2F-2	uc001bhe.2	Q14209	OTTHUMG00000003223	ENST00000361729.2:c.1104G>A	1.37:g.23836582C>T		Somatic		Capture	SOLID	Phase_I	23709169	NM_004091	B2R9W1|Q7Z6H1	Silent	SNP	ENST00000361729.2	37	CCDS236.1																																																																																				0.652	E2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008885.1	NM_004091	
ARID1A	8289	hgsc.bcm.edu	37	1	27059269	27059269	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr1:27059269C>T	ENST00000324856.7	+	4	2277	c.1906C>T	c.(1906-1908)Ccc>Tcc	p.P636S	ARID1A_ENST00000374152.2_Missense_Mutation_p.P253S|ARID1A_ENST00000457599.2_Missense_Mutation_p.P636S	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	636				P -> T (in Ref. 9; AAK54505). {ECO:0000305}.	androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.P636S(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TCAGTCAAGACCCTCCAGCTT	0.483			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.P636S			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1906T	1						.						122.0	116.0	118.0					1																	27059269		2203	4300	6503	26931856	SO:0001583	missense	8289	exon4			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1906C>T	1.37:g.27059269C>T	ENSP00000320485:p.Pro636Ser	Somatic		Capture	SOLID	Phase_I	26931856	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.727921	0.89390	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.07800	3.61;3.16;3.38	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.29126	0.0724	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.996	T	0.00114	-1.2040	10	0.48119	T	0.1	-8.7269	19.8172	0.96573	0.0:1.0:0.0:0.0	.	636;636;290	O14497;O14497-2;Q4LE49	ARI1A_HUMAN;.;.	S	636;636;253	ENSP00000320485:P636S;ENSP00000387636:P636S;ENSP00000363267:P253S	ENSP00000320485:P636S	P	+	1	0	ARID1A	26931856	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.905000	0.75714	2.702000	0.92279	0.491000	0.48974	CCC		0.483	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
THEMIS2	9473	hgsc.bcm.edu	37	1	28211922	28211922	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr1:28211922G>T	ENST00000373921.3	+	5	1840	c.1836G>T	c.(1834-1836)agG>agT	p.R612S	THEMIS2_ENST00000373925.1_Nonsense_Mutation_p.E255*|THEMIS2_ENST00000492877.1_3'UTR|THEMIS2_ENST00000373927.3_Nonsense_Mutation_p.E118*|THEMIS2_ENST00000328928.7_Missense_Mutation_p.R483S	NM_001105556.1	NP_001099026.1	Q5TEJ8	THMS2_HUMAN	thymocyte selection associated family member 2	612					cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E255*(1)									CTGCCCACAGGAAGGGCCACA	0.597																																					p.E118X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G352T	1						.						56.0	52.0	53.0					1																	28211922		2203	4300	6503	28084509	SO:0001583	missense	9473	exon3			AF044896	CCDS30653.1, CCDS30654.1, CCDS41290.1, CCDS65461.1	1p35.2	2012-07-10	2012-07-10	2012-07-10	ENSG00000130775	ENSG00000130775			16839	protein-coding gene	gene with protein product	"""induced by contact to basement membrane 1"""		"""chromosome 1 open reading frame 38"""	C1orf38		16219472	Standard	XM_005246041		Approved	ICB-1, Icb-1	uc001bpc.4	Q5TEJ8	OTTHUMG00000003735	ENST00000373921.3:c.1836G>T	1.37:g.28211922G>T	ENSP00000363031:p.Arg612Ser	Somatic		Capture	SOLID	Phase_I	28084509	NM_001039477	A2RTZ3|B4DZT9|B4DZY3|O60560|Q5TEJ1|Q5TEJ9|Q5TEK1|Q68DP4|Q9BYB6|Q9NS90	Nonsense_Mutation	SNP	ENST00000373921.3	37	CCDS41290.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	8.188|8.188|8.188	0.795245|0.795245|0.795245	0.16327|0.16327|0.16327	.|.|.	.|.|.	ENSG00000130775|ENSG00000130775|ENSG00000130775	ENST00000373925;ENST00000373927|ENST00000456990|ENST00000328928;ENST00000373921	.|.|T;T	.|.|0.21543	.|.|2.0;2.0	3.4|3.4|3.4	3.4|3.4|3.4	0.38934|0.38934|0.38934	.|.|.	.|.|0.701361	.|.|0.12972	.|.|N	.|.|0.424100	.|T|T	.|0.16041|0.16041	.|0.0386|0.0386	.|.|.	.|.|.	.|.|.	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|.|B;B;B	.|.|0.25105	.|.|0.025;0.05;0.118	.|.|B;B;B	.|.|0.23574	.|.|0.016;0.047;0.026	.|T|T	.|0.10177|0.10177	.|-1.0641|-1.0641	.|4|9	0.87932|.|0.44086	D|.|T	0|.|0.13	-4.7642|-4.7642|-4.7642	10.6177|10.6177|10.6177	0.45460|0.45460|0.45460	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|483;416;612	.|.|Q5TEJ8-5;Q5TEJ8-6;Q5TEJ8	.|.|.;.;THMS2_HUMAN	X|V|S	255;118|360|483;612	.|.|ENSP00000329862:R483S;ENSP00000363031:R612S	ENSP00000363035:E255X|.|ENSP00000329862:R483S	E|G|R	+|+|+	1|2|3	0|0|2	C1orf38|C1orf38|C1orf38	28084509|28084509|28084509	0.005000|0.005000|0.005000	0.15991|0.15991|0.15991	0.049000|0.049000|0.049000	0.19019|0.19019|0.19019	0.010000|0.010000|0.010000	0.07245|0.07245|0.07245	1.020000|1.020000|1.020000	0.30027|0.30027|0.30027	2.206000|2.206000|2.206000	0.71126|0.71126|0.71126	0.305000|0.305000|0.305000	0.20034|0.20034|0.20034	GAA|GGA|AGG		0.597	THEMIS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011148.1	NM_004848	
LRRC7	57554	hgsc.bcm.edu	37	1	70541809	70541809	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr1:70541809G>A	ENST00000035383.5	+	22	4196	c.4166G>A	c.(4165-4167)cGc>cAc	p.R1389H	LRRC7_ENST00000415775.2_Missense_Mutation_p.R673H|LRRC7_ENST00000310961.5_Missense_Mutation_p.R1347H	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1389						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.R1389H(2)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CTTCAGCATCGCAGCCGGGAG	0.507																																					p.R1389H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4166A	1						.						63.0	59.0	61.0					1																	70541809		2203	4300	6503	70314397	SO:0001583	missense	57554	exon22				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.4166G>A	1.37:g.70541809G>A	ENSP00000035383:p.Arg1389His	Somatic		Capture	SOLID	Phase_I	70314397	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323222	0.60634	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.38240	1.15;1.24;2.34	5.86	5.86	0.93980	.	0.061993	0.64402	D	0.000007	T	0.26629	0.0651	L	0.27053	0.805	0.38717	D	0.953366	D;B;B	0.64830	0.994;0.119;0.035	P;B;B	0.52672	0.706;0.027;0.003	T	0.01413	-1.1361	10	0.15952	T	0.53	.	19.1705	0.93575	0.0:0.0:1.0:0.0	.	673;1342;1389	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	H	1347;1389;673;1165	ENSP00000309245:R1347H;ENSP00000035383:R1389H;ENSP00000394867:R673H	ENSP00000035383:R1389H	R	+	2	0	LRRC7	70314397	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.501000	0.81600	2.771000	0.95319	0.650000	0.86243	CGC		0.507	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
LPAR3	23566	hgsc.bcm.edu	37	1	85279732	85279732	+	Missense_Mutation	SNP	C	C	T	rs560059746		TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr1:85279732C>T	ENST00000440886.1	-	2	897	c.859G>A	c.(859-861)Gtc>Atc	p.V287I	LPAR3_ENST00000370611.3_Missense_Mutation_p.V287I|LPAR3_ENST00000491034.1_5'UTR			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	287					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)	p.V287I(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						GGGTTCACGACGGAGTTGAGC	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19381	0.0		0.0	False		,,,				2504	0.0				p.V287I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G859A	1						.						115.0	107.0	110.0					1																	85279732		2203	4300	6503	85052320	SO:0001583	missense	23566	exon3			AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.859G>A	1.37:g.85279732C>T	ENSP00000395389:p.Val287Ile	Somatic		Capture	SOLID	Phase_I	85052320	NM_012152	A0AVA3	Missense_Mutation	SNP	ENST00000440886.1	37	CCDS700.1	.	.	.	.	.	.	.	.	.	.	C	13.21	2.169634	0.38315	.	.	ENSG00000171517	ENST00000440886;ENST00000370611	T;T	0.37411	1.2;1.2	5.65	4.73	0.59995	GPCR, rhodopsin-like superfamily (1);	0.182462	0.48286	D	0.000194	T	0.08268	0.0206	N	0.20807	0.61	0.36883	D	0.889503	B	0.13594	0.008	B	0.09377	0.004	T	0.14671	-1.0464	10	0.11182	T	0.66	.	9.0724	0.36500	0.0:0.7568:0.1661:0.0771	.	287	Q9UBY5	LPAR3_HUMAN	I	287	ENSP00000395389:V287I;ENSP00000359643:V287I	ENSP00000359643:V287I	V	-	1	0	LPAR3	85052320	0.860000	0.29831	0.880000	0.34516	0.995000	0.86356	1.736000	0.38187	1.354000	0.45846	0.650000	0.86243	GTC		0.582	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027467.1	NM_012152	
ASTN1	460	hgsc.bcm.edu	37	1	176838060	176838060	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr1:176838060G>T	ENST00000367654.3	-	22	3802	c.3591C>A	c.(3589-3591)caC>caA	p.H1197Q	ASTN1_ENST00000361833.2_Missense_Mutation_p.H1189Q|ASTN1_ENST00000424564.2_Missense_Mutation_p.H1189Q|ASTN1_ENST00000367657.3_Missense_Mutation_p.H1189Q	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1197					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.H1189Q(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AGAGGACCCGGTGTAAGGTGG	0.493																																					p.H1189Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3567A	1						.						156.0	147.0	150.0					1																	176838060		2203	4300	6503	175104683	SO:0001583	missense	460	exon22			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3591C>A	1.37:g.176838060G>T	ENSP00000356626:p.His1197Gln	Somatic		Capture	SOLID	Phase_I	175104683	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	G	15.77	2.932811	0.52866	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.15603	2.41;2.82;2.82;2.41	5.7	-10.4	0.00318	.	0.042709	0.85682	N	0.000000	T	0.12518	0.0304	L	0.47716	1.5	0.58432	D	0.999993	B;B	0.06786	0.001;0.0	B;B	0.13407	0.009;0.006	T	0.12760	-1.0535	10	0.46703	T	0.11	-17.1324	16.9561	0.86260	0.2165:0.0913:0.6922:0.0	.	1189;1189	O14525-2;B1AJS1	.;.	Q	1189;1189;1197;1189;1189	ENSP00000356629:H1189Q;ENSP00000354536:H1189Q;ENSP00000356626:H1197Q;ENSP00000395041:H1189Q	ENSP00000354536:H1189Q	H	-	3	2	ASTN1	175104683	1.000000	0.71417	0.350000	0.25708	0.157000	0.22087	1.464000	0.35288	-1.861000	0.01153	-1.326000	0.01283	CAC		0.493	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
TRPC6	7225	hgsc.bcm.edu	37	11	101362321	101362321	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr11:101362321C>T	ENST00000344327.3	-	3	1518	c.1094G>A	c.(1093-1095)cGt>cAt	p.R365H	TRPC6_ENST00000532133.1_Missense_Mutation_p.R365H|TRPC6_ENST00000348423.4_Intron|TRPC6_ENST00000360497.4_Missense_Mutation_p.R365H	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	365					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.R365H(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		AAGTTTTAAACGGCTGAGATT	0.428																																					p.R365H	Colon(166;1315 1927 11094 12848 34731)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1094A	11						.						131.0	136.0	135.0					11																	101362321		2203	4299	6502	100867531	SO:0001583	missense	7225	exon3			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1094G>A	11.37:g.101362321C>T	ENSP00000340913:p.Arg365His	Somatic		Capture	SOLID	Phase_I	100867531	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	C	36	5.627346	0.96671	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000360497	T;T;T	0.74315	-0.83;-0.83;-0.83	6.14	6.14	0.99180	.	0.044133	0.85682	D	0.000000	D	0.90376	0.6988	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.91210	0.4998	10	0.87932	D	0	-1.6677	20.8597	0.99761	0.0:1.0:0.0:0.0	.	365;365	Q9Y210-3;Q9Y210	.;TRPC6_HUMAN	H	365	ENSP00000340913:R365H;ENSP00000435574:R365H;ENSP00000353687:R365H	ENSP00000340913:R365H	R	-	2	0	TRPC6	100867531	1.000000	0.71417	0.997000	0.53966	0.922000	0.55478	7.731000	0.84895	2.937000	0.99478	0.650000	0.86243	CGT		0.428	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
UBE4A	9354	hgsc.bcm.edu	37	11	118257211	118257211	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr11:118257211T>C	ENST00000431736.2	+	16	2564	c.2492T>C	c.(2491-2493)cTg>cCg	p.L831P	UBE4A_ENST00000545354.1_Missense_Mutation_p.L296P|UBE4A_ENST00000252108.3_Missense_Mutation_p.L824P					ubiquitination factor E4A									p.L831P(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		TGGGATAGTCTGACTCCAGAA	0.458																																					p.L831P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2492C	11						.						130.0	136.0	134.0					11																	118257211		2200	4296	6496	117762421	SO:0001583	missense	9354	exon16			D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.2492T>C	11.37:g.118257211T>C	ENSP00000387362:p.Leu831Pro	Somatic		Capture	SOLID	Phase_I	117762421	NM_004788		Missense_Mutation	SNP	ENST00000431736.2	37	CCDS8396.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.171328	0.78452	.	.	ENSG00000110344	ENST00000252108;ENST00000431736;ENST00000545354	T;T;T	0.46819	0.86;0.86;0.86	5.67	5.67	0.87782	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.69433	0.3110	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.992;0.999	T	0.70436	-0.4872	10	0.41790	T	0.15	-4.0998	15.9141	0.79496	0.0:0.0:0.0:1.0	.	824;831	Q14139;Q14139-2	UBE4A_HUMAN;.	P	824;831;296	ENSP00000252108:L824P;ENSP00000387362:L831P;ENSP00000438918:L296P	ENSP00000252108:L824P	L	+	2	0	UBE4A	117762421	1.000000	0.71417	0.936000	0.37596	0.998000	0.95712	6.105000	0.71505	2.154000	0.67381	0.533000	0.62120	CTG		0.458	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
ANO5	203859	hgsc.bcm.edu	37	11	22257787	22257787	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr11:22257787T>G	ENST00000324559.8	+	8	1044	c.727T>G	c.(727-729)Tct>Gct	p.S243A		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	243					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)	p.S243A(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACTGCTAAACTCTAACACTTA	0.393																																					p.S242A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T724G	11						.						184.0	158.0	167.0					11																	22257787		2203	4300	6503	22214363	SO:0001583	missense	203859	exon8			AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.727T>G	11.37:g.22257787T>G	ENSP00000315371:p.Ser243Ala	Somatic		Capture	SOLID	Phase_I	22214363	NM_001142649		Missense_Mutation	SNP	ENST00000324559.8	37	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	T	11.86	1.763450	0.31228	.	.	ENSG00000171714	ENST00000324559	T	0.69806	-0.43	5.64	2.95	0.34219	.	0.134612	0.64402	D	0.000003	T	0.63546	0.2520	M	0.75777	2.31	0.26623	N	0.972629	B	0.29552	0.248	B	0.29524	0.103	T	0.60924	-0.7166	10	0.56958	D	0.05	.	9.5076	0.39056	0.5372:0.0:0.0:0.4627	.	243	Q75V66	ANO5_HUMAN	A	243	ENSP00000315371:S243A	ENSP00000315371:S243A	S	+	1	0	ANO5	22214363	1.000000	0.71417	0.068000	0.19968	0.167000	0.22549	5.022000	0.64078	1.038000	0.40049	0.455000	0.32223	TCT		0.393	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599	
ZFP91	80829	hgsc.bcm.edu	37	11	58380290	58380290	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr11:58380290C>T	ENST00000316059.6	+	8	1135	c.964C>T	c.(964-966)Ctt>Ttt	p.L322F	ZFP91-CNTF_ENST00000389919.4_Missense_Mutation_p.L322F|AP001350.1_ENST00000601906.1_5'Flank	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	322					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)	p.L322F(2)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				TGGAACTGTCCTTGCCCATCC	0.388																																					p.L322F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C964T	11						.						171.0	157.0	162.0					11																	58380290		2201	4295	6496	58136866	SO:0001583	missense	80829	exon8			AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.964C>T	11.37:g.58380290C>T	ENSP00000339030:p.Leu322Phe	Somatic		Capture	SOLID	Phase_I	58136866	NM_053023	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Missense_Mutation	SNP	ENST00000316059.6	37	CCDS31553.1	.	.	.	.	.	.	.	.	.	.	C	16.06	3.014796	0.54468	.	.	ENSG00000186660	ENST00000316059;ENST00000389918	T	0.08008	3.14	5.87	5.87	0.94306	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.64402	D	0.000008	T	0.06600	0.0169	N	0.00453	-1.485	0.54753	D	0.999989	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.52230	-0.8603	10	0.02654	T	1	-10.0133	18.9764	0.92738	0.0:1.0:0.0:0.0	.	322;322	Q96JP5-2;Q96JP5	.;ZFP91_HUMAN	F	322	ENSP00000339030:L322F	ENSP00000374569:L322F	L	+	1	0	ZFP91	58136866	0.999000	0.42202	1.000000	0.80357	0.982000	0.71751	2.927000	0.48900	2.772000	0.95346	0.650000	0.86243	CTT		0.388	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268674.1	NM_053023	
OR6T1	219874	hgsc.bcm.edu	37	11	123813879	123813879	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr11:123813879C>A	ENST00000321252.2	-	1	701	c.667G>T	c.(667-669)Gcc>Tcc	p.A223S		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A223S(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		AGAACAGTGGCAAGAATGCAG	0.537																																					p.A223S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G667T	11						.						86.0	81.0	83.0					11																	123813879		2202	4299	6501	123319089	SO:0001583	missense	219874	exon1			AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.667G>T	11.37:g.123813879C>A	ENSP00000325203:p.Ala223Ser	Somatic		Capture	SOLID	Phase_I	123319089	NM_001005187	Q6IFE7	Missense_Mutation	SNP	ENST00000321252.2	37	CCDS31700.1	.	.	.	.	.	.	.	.	.	.	C	2.770	-0.255859	0.05829	.	.	ENSG00000181499	ENST00000321252	T	0.36699	1.24	3.7	0.481	0.16809	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.16385	0.0394	N	0.11000	0.08	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.20840	-1.0263	9	0.46703	T	0.11	-13.4277	1.7649	0.03000	0.3642:0.3464:0.1786:0.1108	.	223	Q8NGN1	OR6T1_HUMAN	S	223	ENSP00000325203:A223S	ENSP00000325203:A223S	A	-	1	0	OR6T1	123319089	0.000000	0.05858	0.039000	0.18376	0.603000	0.37013	-3.221000	0.00552	-0.097000	0.12307	0.563000	0.77884	GCC		0.537	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	NM_001005187	
TAP2	6891	hgsc.bcm.edu	37	6	32800523	32800523	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr6:32800523C>T	ENST00000452392.2	-	6	1197	c.1024G>A	c.(1024-1026)Gtt>Att	p.V342I	TAP2_ENST00000374897.2_Missense_Mutation_p.V342I|TAP2_ENST00000485701.1_5'Flank|TAP2_ENST00000374899.4_Missense_Mutation_p.V342I			Q9UDX4	S14L3_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	0	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.V342I(1)								Vitamin E(DB00163)	AAACTGCGAACGGTCTGCAGC	0.602																																					p.V342I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1024A	6	GRCh37	HI0701	TAP2	I		.						97.0	88.0	92.0					6																	32800523		1510	2709	4219	32908501	SO:0001583	missense	6891	exon6			M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267		"""ATP binding cassette transporters / subfamily B"""	44	protein-coding gene	gene with protein product		170261		ABCB3		1529427, 1946428, 16395595	Standard	NM_001290043		Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000452392.2:c.1024G>A	6.37:g.32800523C>T	ENSP00000391806:p.Val342Ile	Somatic		Capture	SOLID	Phase_I	32908501	NM_018833	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000452392.2	37		.	.	.	.	.	.	.	.	.	.	C	19.67	3.871847	0.72180	.	.	ENSG00000204267;ENSG00000204267;ENSG00000204267;ENSG00000250264	ENST00000556934;ENST00000374899;ENST00000374897;ENST00000452392	D;D;D	0.94092	-3.35;-3.35;-3.35	5.05	5.05	0.67936	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.284218	0.25411	N	0.030872	D	0.97084	0.9047	M	0.91300	3.195	0.36159	D	0.848013	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;P	0.73380	0.98;0.945;0.945;0.876	D	0.97712	1.0191	9	0.87932	D	0	-26.1794	15.9458	0.79792	0.0:1.0:0.0:0.0	.	342;343;342;342	E7ENX8;Q59H06;Q03519;Q9UP03	.;.;TAP2_HUMAN;.	I	342	ENSP00000364034:V342I;ENSP00000364032:V342I;ENSP00000391806:V342I	ENSP00000364032:V342I	V	-	1	0	XXbac-BPG246D15.9;TAP2	32908501	1.000000	0.71417	0.955000	0.39395	0.113000	0.19764	6.477000	0.73591	2.619000	0.88677	0.549000	0.68633	GTT		0.602	TAP2-001	NOVEL	mRNA_end_NF|cds_end_NF|basic|appris_principal|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000361828.1	NM_000544	
PRSS35	167681	hgsc.bcm.edu	37	6	84233714	84233714	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr6:84233714G>A	ENST00000369700.3	+	2	731	c.554G>A	c.(553-555)aGg>aAg	p.R185K	PRSS35_ENST00000536636.1_Missense_Mutation_p.R185K	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	185	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)	p.R185K(1)		breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		AAAAAGCTAAGGGTAGGGTTG	0.478																																					p.R185K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G554A	6						.						96.0	101.0	99.0					6																	84233714		2203	4300	6503	84290433	SO:0001583	missense	167681	exon3			BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.554G>A	6.37:g.84233714G>A	ENSP00000358714:p.Arg185Lys	Somatic		Capture	SOLID	Phase_I	84290433	NM_001170423	A8K7B3|Q9BQP6	Missense_Mutation	SNP	ENST00000369700.3	37	CCDS4999.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671705	0.67928	.	.	ENSG00000146250	ENST00000536636;ENST00000369700	D;D	0.89485	-2.52;-2.52	5.78	5.78	0.91487	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (2);	0.049390	0.85682	D	0.000000	D	0.91358	0.7274	L	0.47716	1.5	0.58432	D	0.999999	D	0.67145	0.996	D	0.65573	0.936	D	0.90391	0.4395	10	0.48119	T	0.1	-14.7795	19.9981	0.97395	0.0:0.0:1.0:0.0	.	185	Q8N3Z0	PRS35_HUMAN	K	185	ENSP00000440870:R185K;ENSP00000358714:R185K	ENSP00000358714:R185K	R	+	2	0	PRSS35	84290433	1.000000	0.71417	0.605000	0.28930	0.080000	0.17528	9.476000	0.97823	2.733000	0.93635	0.561000	0.74099	AGG		0.478	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041352.1	NM_153362	
KLHL32	114792	hgsc.bcm.edu	37	6	97533119	97533119	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr6:97533119A>C	ENST00000369261.4	+	6	892	c.529A>C	c.(529-531)Agc>Cgc	p.S177R	KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000536676.1_Missense_Mutation_p.S141R|KLHL32_ENST00000539200.1_Missense_Mutation_p.S108R	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	177								p.S177R(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		ACTCCTGAAGAGCCGCCCAGA	0.498																																					p.S177R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A529C	6						.						99.0	98.0	98.0					6																	97533119		2203	4300	6503	97639840	SO:0001583	missense	114792	exon6			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.529A>C	6.37:g.97533119A>C	ENSP00000358265:p.Ser177Arg	Somatic		Capture	SOLID	Phase_I	97639840	NM_052904	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.608171	0.87258	.	.	ENSG00000186231	ENST00000369255;ENST00000369261;ENST00000536676;ENST00000539200;ENST00000447886	T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44	6.17	6.17	0.99709	BTB/Kelch-associated (2);	0.123152	0.85682	D	0.000000	T	0.67306	0.2879	L	0.48642	1.525	0.80722	D	1	P;B;B;P	0.47106	0.89;0.324;0.175;0.549	P;B;B;B	0.54629	0.757;0.241;0.129;0.326	T	0.71307	-0.4632	10	0.72032	D	0.01	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	108;141;177;177	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	R	103;177;141;108;73	ENSP00000358265:S177R;ENSP00000440382:S141R;ENSP00000441527:S108R;ENSP00000389310:S73R	ENSP00000358259:S103R	S	+	1	0	KLHL32	97639840	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.841000	0.55850	2.371000	0.80710	0.533000	0.62120	AGC		0.498	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904	
SYNE1	23345	hgsc.bcm.edu	37	6	152716782	152716782	+	Silent	SNP	C	C	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr6:152716782C>A	ENST00000367255.5	-	51	8182	c.7581G>T	c.(7579-7581)ctG>ctT	p.L2527L	SYNE1_ENST00000423061.1_Silent_p.L2534L|SYNE1_ENST00000341594.5_Silent_p.L2566L|SYNE1_ENST00000448038.1_Silent_p.L2534L|SYNE1_ENST00000265368.4_Silent_p.L2527L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2527					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.L2527L(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCCATAAGTTCAGTTTTCTGT	0.348										HNSCC(10;0.0054)																											p.L2534L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G7602T	6						.						119.0	111.0	113.0					6																	152716782		2203	4300	6503	152758475	SO:0001819	synonymous_variant	23345	exon51			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.7581G>T	6.37:g.152716782C>A		Somatic		Capture	SOLID	Phase_I	152758475	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																				0.348	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
GAS2L2	246176	hgsc.bcm.edu	37	17	34073219	34073219	+	Missense_Mutation	SNP	C	C	A	rs115955572	byFrequency	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr17:34073219C>A	ENST00000254466.6	-	6	1324	c.1297G>T	c.(1297-1299)Ggg>Tgg	p.G433W	GAS2L2_ENST00000587565.1_Missense_Mutation_p.G417W	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	433					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)	p.G433W(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GTGGGGTTCCCGGCGTCGGTT	0.587																																					p.G433W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1297T	17						.						124.0	137.0	132.0					17																	34073219		2203	4300	6503	31097332	SO:0001583	missense	246176	exon6			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1297G>T	17.37:g.34073219C>A	ENSP00000254466:p.Gly433Trp	Somatic		Capture	SOLID	Phase_I	31097332	NM_139285	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	C	0.597	-0.830415	0.02734	.	.	ENSG00000132139	ENST00000254466	T	0.19394	2.15	5.19	0.519	0.17035	.	0.746929	0.12439	N	0.468842	T	0.08758	0.0217	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28776	-1.0033	10	0.62326	D	0.03	-6.7127	1.8585	0.03184	0.1315:0.1548:0.1366:0.5771	.	433	Q8NHY3	GA2L2_HUMAN	W	433	ENSP00000254466:G433W	ENSP00000254466:G433W	G	-	1	0	GAS2L2	31097332	0.000000	0.05858	0.008000	0.14137	0.002000	0.02628	-0.197000	0.09518	-0.246000	0.09611	-5.199000	0.00001	GGG		0.587	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
KRT37	8688	hgsc.bcm.edu	37	17	39578647	39578647	+	Missense_Mutation	SNP	G	G	A	rs372339722		TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr17:39578647G>A	ENST00000225550.3	-	4	771	c.772C>T	c.(772-774)Cgg>Tgg	p.R258W	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	258	Linker 12.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R258W(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				AGCTCGATCCGGAACTTCTCC	0.552																																					p.R258W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C772T	17						.	G	TRP/ARG	1,4405		0,1,2202	162.0	158.0	159.0		772	-1.0	0.0	17		159	1,8599		0,1,4299	no	missense	KRT37	NM_003770.4	101	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	258/450	39578647	2,13004	2203	4300	6503	36832173	SO:0001583	missense	8688	exon4			Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.772C>T	17.37:g.39578647G>A	ENSP00000225550:p.Arg258Trp	Somatic		Capture	SOLID	Phase_I	36832173	NM_003770		Missense_Mutation	SNP	ENST00000225550.3	37	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	.	11.97	1.797904	0.31777	2.27E-4	1.16E-4	ENSG00000108417	ENST00000225550	D	0.88975	-2.45	5.04	-1.05	0.10036	Filament (1);	0.616464	0.13535	N	0.380631	D	0.82907	0.5139	L	0.50333	1.59	0.09310	N	1	B	0.19817	0.039	B	0.14023	0.01	T	0.71794	-0.4485	10	0.87932	D	0	.	7.0894	0.25275	0.1192:0.0:0.4158:0.465	.	258	O76014	KRT37_HUMAN	W	258	ENSP00000225550:R258W	ENSP00000225550:R258W	R	-	1	2	KRT37	36832173	0.000000	0.05858	0.000000	0.03702	0.650000	0.38633	0.276000	0.18716	-0.411000	0.07530	0.655000	0.94253	CGG		0.552	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770	
TP53	7157	hgsc.bcm.edu	37	17	7577550	7577550	+	Missense_Mutation	SNP	C	C	T	rs397516437		TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr17:7577550C>T	ENST00000269305.4	-	7	920	c.731G>A	c.(730-732)gGc>gAc	p.G244D	TP53_ENST00000420246.2_Missense_Mutation_p.G244D|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G244D|TP53_ENST00000359597.4_Missense_Mutation_p.G244D|TP53_ENST00000445888.2_Missense_Mutation_p.G244D|TP53_ENST00000413465.2_Missense_Mutation_p.G244D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	244	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in sporadic cancers; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934572).|G -> E (in a sporadic cancer; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|MG -> IC (in a sporadic cancer; somatic mutation).|MG -> IS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G244D(47)|p.G244V(14)|p.G244A(9)|p.0?(8)|p.?(5)|p.G151D(4)|p.G244fs*4(3)|p.G244_M246>V(3)|p.G244fs*19(1)|p.G151_M153>V(1)|p.G244fs*17(1)|p.M243fs*18(1)|p.G244E(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.G244del(1)|p.G151fs*4(1)|p.C238_M246delCNSSCMGGM(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTCATGCCGCCCATGCAGGA	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.G244D	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,+2	.	104	Substitution - Missense(75)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Insertion - Frameshift(4)|Deletion - Frameshift(4)|Deletion - In frame(3)	large_intestine(21)|liver(16)|haematopoietic_and_lymphoid_tissue(9)|ovary(9)|stomach(7)|breast(7)|lung(7)|biliary_tract(6)|upper_aerodigestive_tract(4)|urinary_tract(4)|bone(4)|central_nervous_system(3)|oesophagus(2)|cervix(1)|vulva(1)|endometrium(1)|salivary_gland(1)|prostate(1)	c.G731A	17	GRCh37	CM056069|CM070298	TP53	M	rs28934572	.						148.0	111.0	124.0					17																	7577550		2203	4300	6503	7518275	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.731G>A	17.37:g.7577550C>T	ENSP00000269305:p.Gly244Asp	Somatic		Capture	SOLID	Phase_I	7518275	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.842901	0.91197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99894	0.9949	M	0.90759	3.145	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.997;1.0;1.0;1.0;1.0	D	0.96044	0.9026	10	0.87932	D	0	-29.0146	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934572	244;244;151;244;244;244	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	D	244;244;244;244;244;244;233;151;112;151	ENSP00000410739:G244D;ENSP00000352610:G244D;ENSP00000269305:G244D;ENSP00000398846:G244D;ENSP00000391127:G244D;ENSP00000391478:G244D;ENSP00000425104:G112D;ENSP00000423862:G151D	ENSP00000269305:G244D	G	-	2	0	TP53	7518275	1.000000	0.71417	0.965000	0.40720	0.979000	0.70002	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PSMC5	5705	hgsc.bcm.edu	37	17	61906877	61906877	+	Silent	SNP	A	A	G			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr17:61906877A>G	ENST00000310144.6	+	3	428	c.120A>G	c.(118-120)caA>caG	p.Q40Q	PSMC5_ENST00000375812.4_Silent_p.Q32Q|FTSJ3_ENST00000580295.1_Intron|FTSJ3_ENST00000427159.2_5'Flank|PSMC5_ENST00000580864.1_Silent_p.Q32Q|PSMC5_ENST00000581882.1_Silent_p.Q32Q	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5	40					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.Q40Q(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						ATAAGAGCCAAAACCTCCGGA	0.507																																					p.Q40Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A120G	17						.						70.0	67.0	68.0					17																	61906877		2184	4255	6439	59260609	SO:0001819	synonymous_variant	5705	exon3			L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195		ENST00000310144.6:c.120A>G	17.37:g.61906877A>G		Somatic		Capture	SOLID	Phase_I	59260609	NM_002805	A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Silent	SNP	ENST00000310144.6	37	CCDS11645.1																																																																																				0.507	PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444404.1	NM_002805	
UBN1	29855	hgsc.bcm.edu	37	16	4910693	4910693	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr16:4910693A>G	ENST00000396658.4	+	6	1403	c.700A>G	c.(700-702)Aag>Gag	p.K234E	UBN1_ENST00000262376.6_Missense_Mutation_p.K234E|UBN1_ENST00000590769.1_Missense_Mutation_p.K234E|UBN1_ENST00000545171.1_Missense_Mutation_p.K234E	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	234	Lys-rich.				chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K234E(1)		NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						CAGTAAGGAGAAGAAGAAGAA	0.453																																					p.K234E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A700G	16						.						134.0	148.0	143.0					16																	4910693		2197	4300	6497	4850694	SO:0001583	missense	29855	exon6			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.700A>G	16.37:g.4910693A>G	ENSP00000379894:p.Lys234Glu	Somatic		Capture	SOLID	Phase_I	4850694	NM_016936	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.023292	0.75390	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.61510	0.7;0.1;0.7	5.77	5.77	0.91146	.	0.049579	0.85682	D	0.000000	T	0.69842	0.3156	M	0.67397	2.05	0.47737	D	0.999508	D;D	0.76494	0.999;0.999	D;D	0.73380	0.98;0.955	T	0.66810	-0.5829	10	0.02654	T	1	-22.751	16.383	0.83481	1.0:0.0:0.0:0.0	.	234;234	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	E	234	ENSP00000262376:K234E;ENSP00000442379:K234E;ENSP00000379894:K234E	ENSP00000262376:K234E	K	+	1	0	UBN1	4850694	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.208000	0.65203	2.326000	0.78906	0.533000	0.62120	AAG		0.453	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936	
GRIN2A	2903	hgsc.bcm.edu	37	16	9857679	9857679	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr16:9857679C>T	ENST00000396573.2	-	14	4031	c.3722G>A	c.(3721-3723)cGg>cAg	p.R1241Q	GRIN2A_ENST00000404927.2_Missense_Mutation_p.R1241Q|GRIN2A_ENST00000330684.3_Missense_Mutation_p.R1241Q|GRIN2A_ENST00000562109.1_Missense_Mutation_p.R1241Q|GRIN2A_ENST00000396575.2_Missense_Mutation_p.R1241Q|GRIN2A_ENST00000535259.1_Missense_Mutation_p.R1084Q	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1241					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.R1241Q(2)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTTCCCCATCCGCAGGCAGGC	0.582																																					p.R1241Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G3722A	16						.						128.0	123.0	125.0					16																	9857679		2197	4300	6497	9765180	SO:0001583	missense	2903	exon13				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3722G>A	16.37:g.9857679C>T	ENSP00000379818:p.Arg1241Gln	Somatic		Capture	SOLID	Phase_I	9765180	NM_001134408	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166868	0.57476	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.12039	2.89;2.72;2.72;2.89;2.89	5.11	5.11	0.69529	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.056599	0.64402	D	0.000001	T	0.17577	0.0422	L	0.47716	1.5	0.28839	N	0.896734	P;P;D	0.53151	0.873;0.896;0.958	B;P;P	0.48627	0.348;0.584;0.532	T	0.04870	-1.0921	9	.	.	.	.	11.0693	0.47993	0.0:0.9155:0.0:0.0845	.	1084;1241;1241	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	Q	1241;1241;1084;1241;1241	ENSP00000379818:R1241Q;ENSP00000385872:R1241Q;ENSP00000441572:R1084Q;ENSP00000332549:R1241Q;ENSP00000379820:R1241Q	.	R	-	2	0	GRIN2A	9765180	0.838000	0.29461	1.000000	0.80357	0.992000	0.81027	3.599000	0.54045	2.365000	0.80145	0.655000	0.94253	CGG		0.582	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
ZPLD1	131368	hgsc.bcm.edu	37	3	102187857	102187857	+	Missense_Mutation	SNP	C	C	T	rs147459423		TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr3:102187857C>T	ENST00000491959.1	+	15	1693	c.811C>T	c.(811-813)Cgg>Tgg	p.R271W	ZPLD1_ENST00000466937.1_Missense_Mutation_p.R271W|ZPLD1_ENST00000306176.1_Missense_Mutation_p.R287W			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	271	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)		p.R287W(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						CCGAAGCCAGCGGGGCCGGTT	0.473																																					p.R287W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C859T	3						.						74.0	75.0	75.0					3																	102187857		2203	4300	6503	103670547	SO:0001583	missense	131368	exon8			AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.811C>T	3.37:g.102187857C>T	ENSP00000420265:p.Arg271Trp	Somatic		Capture	SOLID	Phase_I	103670547	NM_175056	Q49AS1|Q8WU36	Missense_Mutation	SNP	ENST00000491959.1	37		.	.	.	.	.	.	.	.	.	.	C	20.7	4.040659	0.75732	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	D;D;D	0.82893	-1.66;-1.66;-1.66	5.47	4.59	0.56863	Zona pellucida sperm-binding protein (3);	0.401538	0.28828	N	0.014011	T	0.78824	0.4344	L	0.38175	1.15	0.31381	N	0.679055	P;D	0.53619	0.924;0.961	B;P	0.49301	0.34;0.606	T	0.79427	-0.1808	10	0.49607	T	0.09	-11.9781	7.7632	0.28965	0.2651:0.6531:0.0:0.0818	.	287;271	Q8TCW7-2;Q8TCW7	.;ZPLD1_HUMAN	W	271;287;271	ENSP00000420265:R271W;ENSP00000307801:R287W;ENSP00000418253:R271W	ENSP00000307801:R287W	R	+	1	2	ZPLD1	103670547	1.000000	0.71417	0.863000	0.33907	0.961000	0.63080	4.658000	0.61497	1.313000	0.45069	0.462000	0.41574	CGG		0.473	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056	
ITGA9	3680	hgsc.bcm.edu	37	3	37567542	37567542	+	Silent	SNP	C	C	T	rs200417361		TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr3:37567542C>T	ENST00000264741.5	+	13	1609	c.1353C>T	c.(1351-1353)tcC>tcT	p.S451S	ITGA9_ENST00000422441.1_Silent_p.S451S	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	451					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.S451S(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		CCTTCATGTCCGACAGCGTGG	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		20134	0.0		0.001	False		,,,				2504	0.0				p.S451S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1353T	3						.	C		0,4406		0,0,2203	168.0	138.0	148.0		1353	-11.8	0.0	3		148	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ITGA9	NM_002207.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		451/1036	37567542	2,13004	2203	4300	6503	37542546	SO:0001819	synonymous_variant	3680	exon13			L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.1353C>T	3.37:g.37567542C>T		Somatic		Capture	SOLID	Phase_I	37542546	NM_002207	Q14638	Silent	SNP	ENST00000264741.5	37	CCDS2669.1																																																																																				0.522	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
LRTM1	57408	hgsc.bcm.edu	37	3	54958685	54958685	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr3:54958685G>A	ENST00000273286.5	-	2	727	c.565C>T	c.(565-567)Ctc>Ttc	p.L189F	CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000490478.1_Intron|LRTM1_ENST00000493075.1_Missense_Mutation_p.L113F	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	189	LRRCT.					integral component of membrane (GO:0016021)		p.L189F(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		TTAAGACCGAGCAAGTGGCAA	0.473																																					p.L189F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C565T	3						.						91.0	97.0	95.0					3																	54958685		2203	4300	6503	54933725	SO:0001583	missense	57408	exon2			AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.565C>T	3.37:g.54958685G>A	ENSP00000273286:p.Leu189Phe	Somatic		Capture	SOLID	Phase_I	54933725	NM_020678	Q8IUU2	Missense_Mutation	SNP	ENST00000273286.5	37	CCDS2876.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690974	0.30052	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	T;D	0.90788	4.09;-2.73	5.96	4.17	0.49024	Cysteine-rich flanking region, C-terminal (1);	0.232964	0.42548	D	0.000690	D	0.86814	0.6023	L	0.56280	1.765	0.33214	D	0.553773	B	0.13145	0.007	B	0.12837	0.008	D	0.86345	0.1707	10	0.41790	T	0.15	.	9.8958	0.41318	0.246:0.0:0.754:0.0	.	189	Q9HBL6	LRTM1_HUMAN	F	189;113	ENSP00000273286:L189F;ENSP00000419772:L113F	ENSP00000273286:L189F	L	-	1	0	LRTM1	54933725	1.000000	0.71417	0.967000	0.41034	0.744000	0.42396	2.402000	0.44521	1.536000	0.49237	0.655000	0.94253	CTC		0.473	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351399.1	NM_020678	
TRIM42	287015	hgsc.bcm.edu	37	3	140401765	140401765	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr3:140401765C>T	ENST00000286349.3	+	2	994	c.803C>T	c.(802-804)tCg>tTg	p.S268L		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	268						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.S268L(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCCTTCCACTCGGATGTGGCC	0.597																																					p.S268L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C803T	3						.						117.0	104.0	108.0					3																	140401765		2203	4300	6503	141884455	SO:0001583	missense	287015	exon2			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.803C>T	3.37:g.140401765C>T	ENSP00000286349:p.Ser268Leu	Somatic		Capture	SOLID	Phase_I	141884455	NM_152616	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	37	CCDS3113.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.986617	0.53934	.	.	ENSG00000155890	ENST00000286349	T	0.38887	1.11	5.41	4.52	0.55395	.	0.588445	0.15101	N	0.280534	T	0.27278	0.0669	L	0.39898	1.24	0.32689	N	0.514476	P	0.45011	0.848	B	0.26969	0.075	T	0.48969	-0.8987	10	0.62326	D	0.03	-20.1333	10.4343	0.44426	0.0:0.9074:0.0:0.0926	.	268	Q8IWZ5	TRI42_HUMAN	L	268	ENSP00000286349:S268L	ENSP00000286349:S268L	S	+	2	0	TRIM42	141884455	0.231000	0.23751	1.000000	0.80357	0.986000	0.74619	0.546000	0.23284	2.546000	0.85860	0.561000	0.74099	TCG		0.597	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
GHSR	2693	hgsc.bcm.edu	37	3	172166128	172166128	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr3:172166128C>T	ENST00000241256.2	-	1	118	c.76G>A	c.(76-78)Ggc>Agc	p.G26S	GHSR_ENST00000427970.1_Missense_Mutation_p.G26S	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	26					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)	p.G26S(2)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			GAGTCGTTGCCGGGGGAAGCA	0.687																																					p.G26S	Esophageal Squamous(93;641 1401 20883 29581 34638)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G76A	3						.						25.0	26.0	26.0					3																	172166128		2202	4300	6502	173648822	SO:0001583	missense	2693	exon1			AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.76G>A	3.37:g.172166128C>T	ENSP00000241256:p.Gly26Ser	Somatic		Capture	SOLID	Phase_I	173648822	NM_198407	Q14D12|Q6ISR8|Q92848|Q96RJ7	Missense_Mutation	SNP	ENST00000241256.2	37	CCDS3218.1	.	.	.	.	.	.	.	.	.	.	C	2.210	-0.380931	0.05000	.	.	ENSG00000121853	ENST00000241256;ENST00000427970	T;T	0.67171	-0.25;0.07	4.48	0.26	0.15588	.	1.407040	0.04209	N	0.331382	T	0.39860	0.1094	N	0.08118	0	0.09310	N	1	B;B	0.18461	0.009;0.028	B;B	0.15870	0.002;0.014	T	0.26258	-1.0108	10	0.07482	T	0.82	-0.7914	3.4586	0.07524	0.1899:0.4037:0.0:0.4064	.	26;26	Q92847-2;Q92847	.;GHSR_HUMAN	S	26	ENSP00000241256:G26S;ENSP00000395344:G26S	ENSP00000241256:G26S	G	-	1	0	GHSR	173648822	0.620000	0.27068	0.008000	0.14137	0.545000	0.35147	-0.056000	0.11787	0.162000	0.19483	0.462000	0.41574	GGC		0.687	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346728.1	NM_004122	
GDF3	9573	hgsc.bcm.edu	37	12	7848078	7848078	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr12:7848078G>C	ENST00000329913.3	-	1	294	c.247C>G	c.(247-249)Ctt>Gtt	p.L83V		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	83					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)	p.L83V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						AGAAAGCGAAGTACATTCCCG	0.483																																					p.L83V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C247G	12						.						73.0	75.0	74.0					12																	7848078		2203	4300	6503	7739345	SO:0001583	missense	9573	exon1			AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.247C>G	12.37:g.7848078G>C	ENSP00000331745:p.Leu83Val	Somatic		Capture	SOLID	Phase_I	7739345	NM_020634	Q8NEJ4	Missense_Mutation	SNP	ENST00000329913.3	37	CCDS8581.1	.	.	.	.	.	.	.	.	.	.	G	4.315	0.057846	0.08339	.	.	ENSG00000184344	ENST00000329913	T	0.50813	0.73	3.98	0.844	0.18943	Transforming growth factor-beta, N-terminal (1);	0.179734	0.47455	D	0.000226	T	0.24275	0.0588	L	0.34521	1.04	0.21147	N	0.999777	B	0.27013	0.166	B	0.28991	0.097	T	0.16808	-1.0390	10	0.02654	T	1	.	1.8261	0.03121	0.1227:0.2007:0.4708:0.2057	.	83	Q9NR23	GDF3_HUMAN	V	83	ENSP00000331745:L83V	ENSP00000331745:L83V	L	-	1	0	GDF3	7739345	0.962000	0.33011	0.030000	0.17652	0.963000	0.63663	1.201000	0.32259	0.795000	0.33922	0.313000	0.20887	CTT		0.483	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399717.1		
RASSF8	11228	hgsc.bcm.edu	37	12	26217949	26217949	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr12:26217949C>T	ENST00000405154.2	+	3	821	c.622C>T	c.(622-624)Cgt>Tgt	p.R208C	RASSF8_ENST00000282884.9_Missense_Mutation_p.R208C|RASSF8_ENST00000542865.1_Missense_Mutation_p.R208C|RASSF8_ENST00000381352.3_Missense_Mutation_p.R208C|RASSF8_ENST00000541490.1_Missense_Mutation_p.R208C	NM_001164748.1	NP_001158220.1	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 8	208	Glu-rich.				signal transduction (GO:0007165)			p.R208C(1)		cervix(2)|endometrium(1)|large_intestine(6)|lung(15)|urinary_tract(1)	25	Colorectal(261;0.0847)					GGAAATTGTCCGTCTAGAGCA	0.343																																					p.R208C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C622T	12						.						55.0	59.0	58.0					12																	26217949		2203	4300	6503	26109216	SO:0001583	missense	11228	exon4			U82396	CCDS8705.1, CCDS53765.1	12p12.3	2013-05-30	2008-02-22	2005-09-14	ENSG00000123094	ENSG00000123094			13232	protein-coding gene	gene with protein product		608231	"""chromosome 12 open reading frame 2"""	C12orf2			Standard	NM_007211		Approved	HoJ-1	uc001rgx.3	Q8NHQ8	OTTHUMG00000169087	ENST00000405154.2:c.622C>T	12.37:g.26217949C>T	ENSP00000384491:p.Arg208Cys	Somatic		Capture	SOLID	Phase_I	26109216	NM_007211	A8K1Z0|O95647|Q5SCI2|Q76KB6	Missense_Mutation	SNP	ENST00000405154.2	37	CCDS53765.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437511	0.43224	.	.	ENSG00000123094	ENST00000381352;ENST00000405154;ENST00000542865;ENST00000541490;ENST00000542004;ENST00000541218;ENST00000282884	D;D;D;D;T;T;D	0.93307	-3.2;-3.2;-3.2;-3.2;0.83;0.72;-3.2	5.0	5.0	0.66597	.	0.450029	0.24052	N	0.041984	D	0.91751	0.7391	L	0.46157	1.445	0.40330	D	0.978914	D;D	0.60575	0.987;0.988	P;B	0.46825	0.528;0.412	D	0.92705	0.6178	10	0.72032	D	0.01	-22.7365	13.342	0.60551	0.168:0.832:0.0:0.0	.	208;208	Q8NHQ8-2;Q8NHQ8	.;RASF8_HUMAN	C	208	ENSP00000370756:R208C;ENSP00000384491:R208C;ENSP00000439839:R208C;ENSP00000443096:R208C;ENSP00000442485:R208C;ENSP00000445970:R208C;ENSP00000282884:R208C	ENSP00000282884:R208C	R	+	1	0	RASSF8	26109216	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	3.695000	0.54749	2.498000	0.84270	0.563000	0.77884	CGT		0.343	RASSF8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402209.2	NM_007211	
CORO2B	10391	hgsc.bcm.edu	37	15	68987577	68987577	+	Silent	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr15:68987577G>A	ENST00000566799.1	+	3	344	c.315G>A	c.(313-315)tcG>tcA	p.S105S	CORO2B_ENST00000543950.1_Silent_p.S100S|CORO2B_ENST00000540068.1_Silent_p.S100S|CORO2B_ENST00000261861.5_Silent_p.S100S			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	105					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)	p.S105S(1)		kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						TCATTGCCTCGTGCTCGGAGG	0.607																																					p.S105S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G315A	15						.						118.0	100.0	106.0					15																	68987577		2200	4298	6498	66774631	SO:0001819	synonymous_variant	10391	exon3			AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.315G>A	15.37:g.68987577G>A		Somatic		Capture	SOLID	Phase_I	66774631	NM_006091	A8K0W3|O94767|Q8TAN1	Silent	SNP	ENST00000566799.1	37	CCDS10229.2																																																																																				0.607	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006091	
ARHGAP36	158763	hgsc.bcm.edu	37	X	130219684	130219684	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chrX:130219684G>T	ENST00000276211.5	+	8	1423	c.1078G>T	c.(1078-1080)Gac>Tac	p.D360Y	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.D348Y|ARHGAP36_ENST00000370921.1_Missense_Mutation_p.D224Y	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	360	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.D360Y(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GAACTGCGAGGACTCAATTGG	0.493																																					p.D360Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1078T	X						.						163.0	158.0	160.0					X																	130219684		2203	4300	6503	130047365	SO:0001583	missense	158763	exon8				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1078G>T	X.37:g.130219684G>T	ENSP00000276211:p.Asp360Tyr	Somatic		Capture	SOLID	Phase_I	130047365	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738418	0.49045	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	4.88	4.88	0.63580	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.48767	D	0.000164	T	0.49253	0.1546	M	0.85777	2.775	0.52099	D	0.999949	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.994;0.994;0.997	T	0.55761	-0.8090	10	0.87932	D	0	.	12.1001	0.53778	0.0:0.0:1.0:0.0	.	329;348;360	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	Y	360;348;329;224	ENSP00000276211:D360Y;ENSP00000359960:D348Y;ENSP00000408515:D329Y;ENSP00000359959:D224Y	ENSP00000276211:D360Y	D	+	1	0	ARHGAP36	130047365	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	3.731000	0.55013	2.243000	0.73865	0.600000	0.82982	GAC		0.493	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
LRP2	4036	hgsc.bcm.edu	37	2	170044681	170044681	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr2:170044681G>A	ENST00000263816.3	-	49	9412	c.9127C>T	c.(9127-9129)Cgc>Tgc	p.R3043C		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3043	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R3043C(2)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CTAATGCAGCGCCCGTTCTGA	0.517																																					p.R3043C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C9127T	2						.						140.0	134.0	136.0					2																	170044681		2203	4300	6503	169752927	SO:0001583	missense	4036	exon49				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9127C>T	2.37:g.170044681G>A	ENSP00000263816:p.Arg3043Cys	Somatic		Capture	SOLID	Phase_I	169752927	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.042203	0.75732	.	.	ENSG00000081479	ENST00000263816	D	0.96136	-3.92	5.68	2.66	0.31614	.	0.436137	0.26159	N	0.025985	D	0.96571	0.8881	M	0.74647	2.275	0.80722	D	1	D	0.76494	0.999	P	0.62382	0.901	D	0.95853	0.8876	10	0.66056	D	0.02	.	11.194	0.48703	0.0:0.1242:0.618:0.2577	.	3043	P98164	LRP2_HUMAN	C	3043	ENSP00000263816:R3043C	ENSP00000263816:R3043C	R	-	1	0	LRP2	169752927	0.999000	0.42202	0.322000	0.25334	0.878000	0.50629	2.841000	0.48223	0.707000	0.31934	0.650000	0.86243	CGC		0.517	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
NRBP1	29959	hgsc.bcm.edu	37	2	27664588	27664588	+	Missense_Mutation	SNP	G	G	A	rs141700147	byFrequency	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr2:27664588G>A	ENST00000233557.3	+	19	2349	c.1517G>A	c.(1516-1518)cGg>cAg	p.R506Q	KRTCAP3_ENST00000407293.1_5'Flank|KRTCAP3_ENST00000543753.1_5'Flank|KRTCAP3_ENST00000288873.3_5'Flank|NRBP1_ENST00000379863.3_Missense_Mutation_p.R514Q|NRBP1_ENST00000379852.3_Missense_Mutation_p.R506Q			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	506					ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)	p.R506Q(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					GACCAGAGCCGGTTGACTTCT	0.547													G|||	6	0.00119808	0.0045	0.0	5008	,	,		18142	0.0		0.0	False		,,,				2504	0.0				p.R506Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1517A	2						.	G	GLN/ARG	4,4402	9.9+/-24.2	0,4,2199	179.0	183.0	182.0		1517	5.7	1.0	2	dbSNP_134	182	1,8599	1.2+/-3.3	0,1,4299	yes	missense	NRBP1	NM_013392.2	43	0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384	possibly-damaging	506/536	27664588	5,13001	2203	4300	6503	27518092	SO:0001583	missense	29959	exon18			AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.1517G>A	2.37:g.27664588G>A	ENSP00000233557:p.Arg506Gln	Somatic		Capture	SOLID	Phase_I	27518092	NM_013392	B3KV40|D6W558|Q53FZ5|Q96SU3	Missense_Mutation	SNP	ENST00000233557.3	37	CCDS1753.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.944186	0.73672	9.08E-4	1.16E-4	ENSG00000115216	ENST00000233557;ENST00000421823;ENST00000379852;ENST00000379863	T;T;T	0.14022	2.84;2.84;2.54	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.14399	0.0348	L	0.43152	1.355	0.58432	D	0.999999	B;B;B	0.32302	0.363;0.239;0.154	B;B;B	0.24701	0.022;0.055;0.025	T	0.02093	-1.1215	10	0.45353	T	0.12	-8.6676	18.2912	0.90131	0.0:0.0:1.0:0.0	.	486;514;506	B4DW31;F8W6G1;Q9UHY1	.;.;NRBP_HUMAN	Q	506;486;506;514	ENSP00000233557:R506Q;ENSP00000369181:R506Q;ENSP00000369192:R514Q	ENSP00000233557:R506Q	R	+	2	0	NRBP1	27518092	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	6.787000	0.75099	2.662000	0.90505	0.561000	0.74099	CGG		0.547	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215033.1	NM_013392	
ASTL	431705	hgsc.bcm.edu	37	2	96789670	96789670	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr2:96789670C>A	ENST00000342380.2	-	9	1214	c.1215G>T	c.(1213-1215)caG>caT	p.Q405H		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)									p.Q405H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						CAGGGACTGGCTGGATTCCTG	0.602																																					p.Q405H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1215T	2						.						73.0	80.0	77.0					2																	96789670		2203	4300	6503	96153397	SO:0001583	missense	431705	exon9			AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.1215G>T	2.37:g.96789670C>A	ENSP00000343674:p.Gln405His	Somatic		Capture	SOLID	Phase_I	96153397	NM_001002036		Missense_Mutation	SNP	ENST00000342380.2	37	CCDS33249.1	.	.	.	.	.	.	.	.	.	.	C	4.831	0.154568	0.09236	.	.	ENSG00000188886	ENST00000342380	T	0.65549	-0.16	3.43	0.387	0.16259	.	0.723303	0.11938	N	0.515031	T	0.42017	0.1184	N	0.24115	0.695	0.09310	N	1	P	0.44578	0.838	B	0.38562	0.276	T	0.27123	-1.0083	10	0.56958	D	0.05	-1.778	5.6292	0.17501	0.0:0.5876:0.0:0.4124	.	405	Q6HA08	ASTL_HUMAN	H	405	ENSP00000343674:Q405H	ENSP00000343674:Q405H	Q	-	3	2	ASTL	96153397	0.000000	0.05858	0.002000	0.10522	0.086000	0.17979	-0.104000	0.10923	0.073000	0.16731	-0.377000	0.06932	CAG		0.602	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1		
SNRNP200	23020	hgsc.bcm.edu	37	2	96953273	96953273	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr2:96953273G>A	ENST00000323853.5	-	26	3465	c.3388C>T	c.(3388-3390)Cgc>Tgc	p.R1130C	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1130	SEC63 1.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.R1130C(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CGGAACTGGCGCAGAGGACAC	0.493																																					p.R1130C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3388T	2						.						112.0	109.0	110.0					2																	96953273		2203	4300	6503	96317000	SO:0001583	missense	23020	exon26			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.3388C>T	2.37:g.96953273G>A	ENSP00000317123:p.Arg1130Cys	Somatic		Capture	SOLID	Phase_I	96317000	NM_014014	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667082	0.88251	.	.	ENSG00000144028	ENST00000323853	T	0.63744	-0.06	5.08	5.08	0.68730	Sec63 domain (3);	0.058257	0.64402	D	0.000001	T	0.80808	0.4694	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	D	0.83703	0.0183	10	0.87932	D	0	-6.7624	17.3825	0.87408	0.0:0.0:1.0:0.0	.	1130	O75643	U520_HUMAN	C	1130	ENSP00000317123:R1130C	ENSP00000317123:R1130C	R	-	1	0	SNRNP200	96317000	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.632000	0.83247	2.630000	0.89119	0.462000	0.41574	CGC		0.493	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
COL6A3	1293	hgsc.bcm.edu	37	2	238275437	238275437	+	Missense_Mutation	SNP	C	C	T	rs371441617		TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr2:238275437C>T	ENST00000295550.4	-	11	5845	c.5393G>A	c.(5392-5394)cGc>cAc	p.R1798H	COL6A3_ENST00000472056.1_Missense_Mutation_p.R1191H|COL6A3_ENST00000346358.4_Missense_Mutation_p.R1598H|COL6A3_ENST00000409809.1_Missense_Mutation_p.R1592H|COL6A3_ENST00000347401.3_Missense_Mutation_p.R1597H|COL6A3_ENST00000353578.4_Missense_Mutation_p.R1592H	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1798	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R1798H(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GTTGCCCACGCGGAACGCTGT	0.547																																					p.R1191H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3572A	2						.						97.0	89.0	92.0					2																	238275437		2203	4300	6503	237940176	SO:0001583	missense	1293	exon8			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5393G>A	2.37:g.238275437C>T	ENSP00000295550:p.Arg1798His	Somatic		Capture	SOLID	Phase_I	237940176	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	11.30	1.597341	0.28445	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.51	3.69	0.42338	von Willebrand factor, type A (3);	0.000000	0.48286	D	0.000191	D	0.86351	0.5912	N	0.26130	0.795	0.43088	D	0.994755	D;D;D	0.89917	1.0;1.0;0.996	D;D;P	0.97110	1.0;0.999;0.845	T	0.83021	-0.0167	10	0.23302	T	0.38	.	14.8057	0.69952	0.263:0.737:0.0:0.0	.	1191;1592;1798	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	H	1798;1597;1592;1191;1592;1598	ENSP00000295550:R1798H;ENSP00000315609:R1597H;ENSP00000315873:R1592H;ENSP00000418285:R1191H;ENSP00000386844:R1592H;ENSP00000295546:R1598H	ENSP00000295550:R1798H	R	-	2	0	COL6A3	237940176	1.000000	0.71417	0.506000	0.27664	0.147000	0.21601	4.669000	0.61575	0.663000	0.31027	0.650000	0.86243	CGC		0.547	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
AQP3	360	hgsc.bcm.edu	37	9	33442939	33442939	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr9:33442939G>T	ENST00000297991.4	-	4	483	c.403C>A	c.(403-405)Ctt>Att	p.L135I	AQP3_ENST00000493581.1_5'UTR	NM_004925.4	NP_004916.1	Q92482	AQP3_HUMAN	aquaporin 3 (Gill blood group)	135					excretion (GO:0007588)|odontogenesis (GO:0042476)|positive regulation of immune system process (GO:0002684)|regulation of keratinocyte differentiation (GO:0045616)|renal water absorption (GO:0070295)|response to calcium ion (GO:0051592)|response to retinoic acid (GO:0032526)|response to vitamin D (GO:0033280)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urea transport (GO:0015840)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|transporter activity (GO:0005215)|water channel activity (GO:0015250)	p.L135I(1)		endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		GAAACAAAAAGCTGGTTGTCG	0.557																																					p.L135I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C403A	9						.						102.0	107.0	105.0					9																	33442939		2203	4300	6503	33432939	SO:0001583	missense	360	exon4				CCDS6542.1	9p13	2014-07-18	2006-02-23		ENSG00000165272	ENSG00000165272		"""Ion channels / Aquaporins"", ""Blood group antigens"""	636	protein-coding gene	gene with protein product	"""Gill blood group"""	600170	"""aquaporin 3"", ""aquaporin 3 (GIL blood group)"""			7558005	Standard	NM_004925		Approved	GIL	uc003zsx.3	Q92482	OTTHUMG00000019769	ENST00000297991.4:c.403C>A	9.37:g.33442939G>T	ENSP00000297991:p.Leu135Ile	Somatic		Capture	SOLID	Phase_I	33432939	NM_004925	A8K843|B2RE16|D3DRL3|O00108|Q6FGT2|Q6FGW6	Missense_Mutation	SNP	ENST00000297991.4	37	CCDS6542.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.241220	0.22711	.	.	ENSG00000165272	ENST00000297991;ENST00000343952	T	0.11821	2.74	5.81	2.9	0.33743	Aquaporin-like (2);	0.378286	0.29814	N	0.011128	T	0.31104	0.0786	M	0.72118	2.19	0.31978	N	0.606279	D;P	0.58620	0.983;0.587	D;P	0.63597	0.916;0.458	T	0.35943	-0.9768	10	0.62326	D	0.03	-0.0223	10.5013	0.44806	0.2185:0.0:0.7815:0.0	.	135;135	C9JAH5;Q92482	.;AQP3_HUMAN	I	135	ENSP00000297991:L135I	ENSP00000297991:L135I	L	-	1	0	AQP3	33432939	0.911000	0.30947	0.025000	0.17156	0.097000	0.18754	1.490000	0.35573	0.328000	0.23435	0.655000	0.94253	CTT		0.557	AQP3-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052055.1	NM_004925	
CDC14B	8555	hgsc.bcm.edu	37	9	99285665	99285665	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr9:99285665G>A	ENST00000375241.1	-	11	1574	c.1123C>T	c.(1123-1125)Cgt>Tgt	p.R375C	CDC14B_ENST00000463569.1_Missense_Mutation_p.R375C|CDC14B_ENST00000265659.2_Missense_Mutation_p.R375C|CDC14B_ENST00000375242.3_Missense_Mutation_p.R338C|CDC14B_ENST00000481149.1_5'Flank|CDC14B_ENST00000375240.3_Missense_Mutation_p.R375C|CDC14B_ENST00000375236.1_Missense_Mutation_p.R375C	NM_003671.3|NM_033331.2	NP_003662.1|NP_201588.1	O60729	CC14B_HUMAN	cell division cycle 14B	375	B.				activation of anaphase-promoting complex activity (GO:0051488)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R375C(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	15		Acute lymphoblastic leukemia(62;0.0559)				AACTTCTGACGAAAATAGTCC	0.428																																					p.R338C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1012T	9						.						99.0	106.0	104.0					9																	99285665		2203	4300	6503	98325486	SO:0001583	missense	8555	exon11			AF023158	CCDS6721.1, CCDS6722.1, CCDS43853.1	9q22.3	2013-01-17	2013-01-17		ENSG00000081377	ENSG00000081377		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1719	protein-coding gene	gene with protein product		603505	"""CDC14 (cell division cycle 14, S. cerevisiae) homolog B"", ""CDC14 cell division cycle 14 homolog B (S. cerevisiae)"""			9367992	Standard	NM_003671		Approved	Cdc14B1, Cdc14B2, CDC14B3, hCDC14B	uc004awj.3	O60729	OTTHUMG00000020300	ENST00000375241.1:c.1123C>T	9.37:g.99285665G>A	ENSP00000364389:p.Arg375Cys	Somatic		Capture	SOLID	Phase_I	98325486	NM_001077181	A6N5X8|A8MQ20|B1AL31|B1AL32|O43183|O60730|Q5JU08	Missense_Mutation	SNP	ENST00000375241.1	37	CCDS6722.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606194	0.66445	.	.	ENSG00000081377	ENST00000265659;ENST00000375241;ENST00000375240;ENST00000375242;ENST00000463569;ENST00000375236	T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88	5.29	5.29	0.74685	.	0.152605	0.64402	D	0.000015	T	0.52645	0.1747	M	0.77486	2.375	0.80722	D	1	B;D;P	0.89917	0.112;1.0;0.86	B;D;B	0.63488	0.022;0.915;0.199	T	0.55724	-0.8096	10	0.72032	D	0.01	-4.3923	19.137	0.93431	0.0:0.0:1.0:0.0	.	375;375;338	O60729-2;O60729;A8MQ20	.;CC14B_HUMAN;.	C	375;375;375;338;375;375	ENSP00000265659:R375C;ENSP00000364389:R375C;ENSP00000364388:R375C;ENSP00000364390:R338C;ENSP00000420572:R375C;ENSP00000364384:R375C	ENSP00000265659:R375C	R	-	1	0	CDC14B	98325486	1.000000	0.71417	0.995000	0.50966	0.785000	0.44390	5.389000	0.66255	2.759000	0.94783	0.555000	0.69702	CGT		0.428	CDC14B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053278.2	NM_033331	
C9orf156	51531	hgsc.bcm.edu	37	9	100672378	100672378	+	Silent	SNP	A	A	C			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr9:100672378A>C	ENST00000375119.3	-	4	1006	c.930T>G	c.(928-930)ccT>ccG	p.P310P	C9orf156_ENST00000478126.1_5'UTR	NM_016481.3	NP_057565.3	Q9BU70	NAP1_HUMAN	chromosome 9 open reading frame 156	310					viral process (GO:0016032)		hydrolase activity (GO:0016787)	p.P310P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)	13		Acute lymphoblastic leukemia(62;0.158)				CAGGGCAGTGAGGGGCCATGG	0.567																																					p.P310P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T930G	9						.						87.0	78.0	81.0					9																	100672378		2203	4300	6503	99712199	SO:0001819	synonymous_variant	51531	exon4			AK023069	CCDS6730.1	9q31.1	2011-03-02			ENSG00000136932	ENSG00000136932			30967	protein-coding gene	gene with protein product	"""Nef (lentivirus myristoylated factor) associated protein 1"""						Standard	NM_016481		Approved	HSPC219, NAP1	uc004axv.1	Q9BU70	OTTHUMG00000021007	ENST00000375119.3:c.930T>G	9.37:g.100672378A>C		Somatic		Capture	SOLID	Phase_I	99712199	NM_016481	Q5T113|Q86SK0|Q9NXJ7|Q9P0Q7	Silent	SNP	ENST00000375119.3	37	CCDS6730.1																																																																																				0.567	C9orf156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055401.1	NM_016481	
NIPSNAP3B	55335	hgsc.bcm.edu	37	9	107528664	107528664	+	Missense_Mutation	SNP	G	G	A	rs145226608	byFrequency	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr9:107528664G>A	ENST00000374762.3	+	2	190	c.119G>A	c.(118-120)cGt>cAt	p.R40H	NIPSNAP3B_ENST00000461177.1_Intron	NM_018376.2	NP_060846.2	Q9BS92	NPS3B_HUMAN	nipsnap homolog 3B (C. elegans)	40								p.R40H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	11						TATGAATTTCGTACTTATTAC	0.378													.|||	2	0.000399361	0.0	0.0	5008	,	,		19758	0.0		0.0	False		,,,				2504	0.002				p.R40H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G119A	9						.																																			106568485	SO:0001583	missense	55335	exon2			BC017914	CCDS6761.1	9q31.3	2003-11-27			ENSG00000165028	ENSG00000165028			23641	protein-coding gene	gene with protein product		608872				12477932	Standard	NM_018376		Approved	FLJ11275	uc004bci.3	Q9BS92	OTTHUMG00000020414	ENST00000374762.3:c.119G>A	9.37:g.107528664G>A	ENSP00000363894:p.Arg40His	Somatic		Capture	SOLID	Phase_I	106568485	NM_018376	Q5VX30|Q9NUM2	Missense_Mutation	SNP	ENST00000374762.3	37	CCDS6761.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.288017	0.40494	.	.	ENSG00000165028	ENST00000374762	T	0.63255	-0.03	3.93	2.06	0.26882	Dimeric alpha-beta barrel (1);	0.054961	0.64402	N	0.000001	T	0.63838	0.2545	M	0.88310	2.945	0.44345	D	0.997238	P	0.36282	0.546	B	0.35859	0.212	T	0.62831	-0.6771	10	0.42905	T	0.14	-21.8126	9.1985	0.37242	0.1876:0.0:0.8124:0.0	.	40	Q9BS92	NPS3B_HUMAN	H	40	ENSP00000363894:R40H	ENSP00000363894:R40H	R	+	2	0	NIPSNAP3B	106568485	1.000000	0.71417	0.349000	0.25694	0.192000	0.23643	7.021000	0.76425	0.418000	0.25898	0.655000	0.94253	CGT		0.378	NIPSNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053486.1	NM_018376	
FREM2	341640	hgsc.bcm.edu	37	13	39265234	39265234	+	Missense_Mutation	SNP	C	C	A	rs78099370	byFrequency	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr13:39265234C>A	ENST00000280481.7	+	1	3969	c.3753C>A	c.(3751-3753)agC>agA	p.S1251R		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1251					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S1251R(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGGTCGAAAGCTTCACCTTGG	0.423																																					p.S1251R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3753A	13						.						215.0	209.0	211.0					13																	39265234		2203	4300	6503	38163234	SO:0001583	missense	341640	exon1			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.3753C>A	13.37:g.39265234C>A	ENSP00000280481:p.Ser1251Arg	Somatic		Capture	SOLID	Phase_I	38163234	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183164	0.38511	.	.	ENSG00000150893	ENST00000280481	T	0.32515	1.45	6.01	3.27	0.37495	Cadherin (1);	0.081491	0.85682	D	0.000000	T	0.37625	0.1010	M	0.76838	2.35	0.46521	D	0.999087	P	0.44659	0.84	P	0.45343	0.477	T	0.11470	-1.0586	10	0.46703	T	0.11	.	8.3128	0.32082	0.0:0.6083:0.0:0.3917	.	1251	Q5SZK8	FREM2_HUMAN	R	1251	ENSP00000280481:S1251R	ENSP00000280481:S1251R	S	+	3	2	FREM2	38163234	0.205000	0.23458	1.000000	0.80357	0.998000	0.95712	-0.410000	0.07151	0.381000	0.24851	0.655000	0.94253	AGC		0.423	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
ZNF239	8187	hgsc.bcm.edu	37	10	44052592	44052592	+	Silent	SNP	G	G	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr10:44052592G>T	ENST00000306006.6	-	2	1588	c.936C>A	c.(934-936)gtC>gtA	p.V312V	ZNF239_ENST00000535642.1_Silent_p.V312V|ZNF239_ENST00000426961.1_Silent_p.V312V|ZNF239_ENST00000374446.2_Silent_p.V312V|ZNF239_ENST00000491188.1_5'Flank	NM_005674.2	NP_005665.2	Q16600	ZN239_HUMAN	zinc finger protein 239	312					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V312V(1)		endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						CTCCAGTGTGGACTCGCTGGT	0.517																																					p.V312V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C936A	10						.						102.0	107.0	105.0					10																	44052592		2201	4300	6501	43372598	SO:0001819	synonymous_variant	8187	exon2			X82125	CCDS41502.1	10q11.22-q11.23	2013-01-08			ENSG00000196793	ENSG00000196793		"""Zinc fingers, C2H2-type"""	13031	protein-coding gene	gene with protein product		601069				8903737, 8587123	Standard	NM_005674		Approved	MOK2, HOK-2	uc009xmk.3	Q16600	OTTHUMG00000018033	ENST00000306006.6:c.936C>A	10.37:g.44052592G>T		Somatic		Capture	SOLID	Phase_I	43372598	NM_001099283	Q5T1G9|Q8TAS5	Silent	SNP	ENST00000306006.6	37	CCDS41502.1																																																																																				0.517	ZNF239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047710.1		
ANXA8L1	728113	hgsc.bcm.edu	37	10	47167115	47167115	+	Silent	SNP	G	G	A	rs2271517		TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr10:47167115G>A	ENST00000359178.4	-	4	397	c.276C>T	c.(274-276)taC>taT	p.Y92Y	ANXA8L1_ENST00000545298.1_Silent_p.Y92Y|ANXA8L1_ENST00000358140.4_Silent_p.Y130Y|ANXA8L1_ENST00000414655.2_Silent_p.Y30Y	NM_001098845.1	NP_001092315	Q5T2P8	AXA81_HUMAN	annexin A8-like 1	92							calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.Y92Y(1)		large_intestine(1)|lung(1)	2						TGTATGGCGGGTACATAAGGG	0.542																																					p.Y92Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C276T	10						.						1.0	1.0	1.0					10																	47167115		2	9	11	46587121	SO:0001819	synonymous_variant	728113	exon4				CCDS73097.1, CCDS73098.1, CCDS73099.1	10q11.22	2014-06-19			ENSG00000150165			"""Annexins"""	23334	protein-coding gene	gene with protein product			"""annexin A8-like 2"""	ANXA8L2			Standard	NM_001098845		Approved	bA301J7.3, bA145E20.2		Q5T2P8	OTTHUMG00000018114	ENST00000359178.4:c.276C>T	10.37:g.47167115G>A		Somatic		Capture	SOLID	Phase_I	46587121	NM_001040084	A6NDE6|B4DKI1	Silent	SNP	ENST00000359178.4	37	CCDS41511.1																																																																																				0.542	ANXA8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047843.1		
TET1	80312	hgsc.bcm.edu	37	10	70406004	70406004	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr10:70406004G>A	ENST00000373644.4	+	4	3727	c.3518G>A	c.(3517-3519)cGg>cAg	p.R1173Q		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1173					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.R1173Q(2)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GAAAATGATCGGCAGAAGTGG	0.383																																					p.R1173Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3518A	10						.						72.0	74.0	74.0					10																	70406004		2203	4300	6503	70076010	SO:0001583	missense	80312	exon4			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.3518G>A	10.37:g.70406004G>A	ENSP00000362748:p.Arg1173Gln	Somatic		Capture	SOLID	Phase_I	70076010	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.596129	0.00125	.	.	ENSG00000138336	ENST00000373644	T	0.05717	3.4	4.96	-2.38	0.06622	.	0.428387	0.19529	N	0.112081	T	0.01454	0.0047	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41998	-0.9477	10	0.06494	T	0.89	.	5.5713	0.17198	0.4428:0.2526:0.3046:0.0	.	1173	Q8NFU7	TET1_HUMAN	Q	1173	ENSP00000362748:R1173Q	ENSP00000362748:R1173Q	R	+	2	0	TET1	70076010	0.001000	0.12720	0.002000	0.10522	0.011000	0.07611	-0.173000	0.09854	-0.672000	0.05266	-1.388000	0.01159	CGG		0.383	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
MLLT10	8028	hgsc.bcm.edu	37	10	21962771	21962774	+	Frame_Shift_Del	DEL	GTCT	GTCT	-	rs111613862		TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	GTCT	GTCT	GTCT	-	GTCT	GTCT	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr10:21962771_21962774delGTCT	ENST00000307729.7	+	11	1722_1725	c.1544_1547delGTCT	c.(1543-1548)agtctgfs	p.SL515fs	MLLT10_ENST00000377059.3_Frame_Shift_Del_p.SL515fs|MLLT10_ENST00000446906.2_Frame_Shift_Del_p.SL515fs|MLLT10_ENST00000377072.3_Frame_Shift_Del_p.SL515fs			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	515	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.L516fs*45(1)		NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						ACAAGCTCTAGTCTGCAGAAATCT	0.412			T	"""MLL, PICALM, CDK6"""	AL																																p.515_516del			Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1544_1547del	10						.																																			22002780	SO:0001589	frameshift_variant	8028	exon10			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.1544_1547delGTCT	10.37:g.21962771_21962774delGTCT	ENSP00000307411:p.Ser515fs	Somatic		Capture	SOLID	Phase_I	22002777	NM_001195626	B1ANA8|Q5JT37|Q5VX90|Q66K63	Frame_Shift_Del	DEL	ENST00000307729.7	37	CCDS55708.1																																																																																				0.412	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047136.1		
KCNMA1	3778	hgsc.bcm.edu	37	10	78868321	78868321	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr10:78868321C>T	ENST00000286628.8	-	9	1140	c.1141G>A	c.(1141-1143)Gcc>Acc	p.A381T	KCNMA1_ENST00000286627.5_Missense_Mutation_p.A381T|KCNMA1_ENST00000404771.3_Missense_Mutation_p.A381T|KCNMA1_ENST00000372440.1_Missense_Mutation_p.A381T|KCNMA1_ENST00000404857.1_Missense_Mutation_p.A381T|KCNMA1_ENST00000372443.1_Missense_Mutation_p.A381T|KCNMA1_ENST00000354353.5_Missense_Mutation_p.A381T|KCNMA1_ENST00000406533.3_Missense_Mutation_p.A381T	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	381					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.A381T(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	ACGTAGCTGGCAAACATGGCC	0.473																																					p.A381T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1141A	10						.						86.0	86.0	86.0					10																	78868321		2203	4300	6503	78538327	SO:0001583	missense	3778	exon9			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.1141G>A	10.37:g.78868321C>T	ENSP00000286628:p.Ala381Thr	Somatic		Capture	SOLID	Phase_I	78538327	NM_001161353	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.185090|5.185090	0.94885|0.94885	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372421;ENST00000434208	D;D;D;D;D;D;D;D;D|.	0.98822|.	-5.16;-5.16;-5.16;-5.16;-5.16;-5.16;-5.16;-5.16;-5.16|.	5.92|5.92	5.92|5.92	0.95590|0.95590	Ion transport (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.66877|0.66877	0.2834|0.2834	L|L	0.37897|0.37897	1.145|1.145	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	0.999;0.987;0.984;1.0;0.984;0.997;0.987|.	D;D;D;D;D;D;D|.	0.97110|.	0.998;0.976;0.959;1.0;0.959;0.993;0.976|.	T|T	0.59695|0.59695	-0.7406|-0.7406	10|5	0.87932|.	D|.	0|.	-13.2211|-13.2211	20.3248|20.3248	0.98698|0.98698	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	381;381;381;381;381;163;381|.	Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;Q5SVJ7|.	.;.;.;KCMA1_HUMAN;.;.;.|.	T|Y	381;318;316;355;318;381;381;355;381;381;381;163|369;59	ENSP00000361517:A381T;ENSP00000361485:A318T;ENSP00000361514:A316T;ENSP00000396608:A355T;ENSP00000361520:A381T;ENSP00000286627:A381T;ENSP00000385552:A381T;ENSP00000346321:A381T;ENSP00000385806:A381T|.	ENSP00000286627:A381T|.	A|C	-|-	1|2	0|0	KCNMA1|KCNMA1	78538327|78538327	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.463000|7.463000	0.80869|0.80869	2.818000|2.818000	0.97014|0.97014	0.655000|0.655000	0.94253|0.94253	GCC|TGC		0.473	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
MRPS30	10884	hgsc.bcm.edu	37	5	44815139	44815139	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr5:44815139A>C	ENST00000507110.1	+	5	1193	c.1155A>C	c.(1153-1155)caA>caC	p.Q385H		NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	385					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.Q385H(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					AAGCTGATCAAAATAACCCTC	0.373																																					p.Q385H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1155C	5						.						99.0	102.0	101.0					5																	44815139		2203	4300	6503	44850896	SO:0001583	missense	10884	exon5			AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.1155A>C	5.37:g.44815139A>C	ENSP00000424328:p.Gln385His	Somatic		Capture	SOLID	Phase_I	44850896	NM_016640	Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Missense_Mutation	SNP	ENST00000507110.1	37	CCDS3951.1	.	.	.	.	.	.	.	.	.	.	A	17.52	3.411263	0.62399	.	.	ENSG00000112996	ENST00000507110	T	0.18960	2.18	5.86	0.345	0.16011	.	0.508561	0.23171	N	0.051133	T	0.33411	0.0862	L	0.60455	1.87	0.30862	N	0.733388	D	0.62365	0.991	P	0.59115	0.852	T	0.35001	-0.9806	10	0.54805	T	0.06	-12.435	11.4767	0.50302	0.6081:0.0:0.3919:0.0	.	385	Q9NP92	RT30_HUMAN	H	385	ENSP00000424328:Q385H	ENSP00000424328:Q385H	Q	+	3	2	MRPS30	44850896	0.060000	0.20803	1.000000	0.80357	0.996000	0.88848	0.275000	0.18698	0.081000	0.16988	0.528000	0.53228	CAA		0.373	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214033.2	NM_016640	
IQGAP2	10788	hgsc.bcm.edu	37	5	75967723	75967723	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr5:75967723G>A	ENST00000274364.6	+	24	3280	c.2983G>A	c.(2983-2985)Gac>Aac	p.D995N	IQGAP2_ENST00000396234.3_Missense_Mutation_p.D491N|IQGAP2_ENST00000379730.3_Missense_Mutation_p.D497N|IQGAP2_ENST00000502745.1_Missense_Mutation_p.D491N	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	995	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.D995N(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GATCATCGACGACAAGTCGCT	0.507																																					p.D995N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2983A	5						.						66.0	66.0	66.0					5																	75967723		2203	4300	6503	76003479	SO:0001583	missense	10788	exon24			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.2983G>A	5.37:g.75967723G>A	ENSP00000274364:p.Asp995Asn	Somatic		Capture	SOLID	Phase_I	76003479	NM_006633	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.538895	0.85917	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000396234;ENST00000502745	T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3	5.81	5.81	0.92471	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	T	0.80171	0.4574	L	0.55481	1.735	0.80722	D	1	P;P;P;P	0.45474	0.638;0.859;0.638;0.688	B;B;B;B	0.42798	0.192;0.398;0.192;0.29	T	0.77792	-0.2455	10	0.30078	T	0.28	-35.8676	20.0557	0.97650	0.0:0.0:1.0:0.0	.	497;945;491;995	F5H7S7;E7EWC2;Q13576-2;Q13576	.;.;.;IQGA2_HUMAN	N	995;497;945;491;491	ENSP00000274364:D995N;ENSP00000442313:D497N;ENSP00000421097:D945N;ENSP00000379535:D491N;ENSP00000426027:D491N	ENSP00000274364:D995N	D	+	1	0	IQGAP2	76003479	1.000000	0.71417	0.841000	0.33234	0.482000	0.33219	9.869000	0.99810	2.741000	0.93983	0.591000	0.81541	GAC		0.507	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
WDR41	55255	hgsc.bcm.edu	37	5	76758982	76758982	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr5:76758982A>C	ENST00000296679.4	-	4	661	c.286T>G	c.(286-288)Ttg>Gtg	p.L96V	WDR41_ENST00000507029.1_Missense_Mutation_p.L41V|WDR41_ENST00000414719.2_5'UTR	NM_018268.2	NP_060738.2	Q9HAD4	WDR41_HUMAN	WD repeat domain 41	96						lysosomal membrane (GO:0005765)		p.L96V(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)	14		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)		CAAGATTCCAAGGAAGGAAAT	0.343																																					p.L96V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T286G	5						.						120.0	122.0	121.0					5																	76758982		2203	4300	6503	76794738	SO:0001583	missense	55255	exon4			AF115511	CCDS4038.1	5q14	2013-01-09			ENSG00000164253	ENSG00000164253		"""WD repeat domain containing"""	25601	protein-coding gene	gene with protein product						12477932	Standard	NM_018268		Approved	FLJ10904	uc003kff.1	Q9HAD4	OTTHUMG00000102169	ENST00000296679.4:c.286T>G	5.37:g.76758982A>C	ENSP00000296679:p.Leu96Val	Somatic		Capture	SOLID	Phase_I	76794738	NM_018268	B4DT55|Q7Z792|Q8IWG3|Q8IXA9|Q8NDA7|Q9NV62	Missense_Mutation	SNP	ENST00000296679.4	37	CCDS4038.1	.	.	.	.	.	.	.	.	.	.	A	12.87	2.068022	0.36470	.	.	ENSG00000164253	ENST00000296679;ENST00000515253;ENST00000507029;ENST00000514559;ENST00000511036;ENST00000504895;ENST00000509971	T;T;T;T;T;T;T	0.65364	0.52;0.6;1.93;0.31;0.34;-0.15;0.04	5.81	1.97	0.26223	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.801298	0.12071	N	0.502252	T	0.45054	0.1323	L	0.34521	1.04	0.21604	N	0.999622	P;B	0.40578	0.722;0.109	B;B	0.38225	0.268;0.069	T	0.18967	-1.0320	10	0.21014	T	0.42	-2.3739	5.6915	0.17833	0.7315:0.0:0.1426:0.1259	.	41;96	B4DT55;Q9HAD4	.;WDR41_HUMAN	V	96;89;41;96;91;88;93	ENSP00000296679:L96V;ENSP00000426499:L89V;ENSP00000424287:L41V;ENSP00000426937:L96V;ENSP00000422510:L91V;ENSP00000426141:L88V;ENSP00000422922:L93V	ENSP00000296679:L96V	L	-	1	2	WDR41	76794738	0.414000	0.25408	0.008000	0.14137	0.889000	0.51656	0.488000	0.22371	0.098000	0.17522	0.528000	0.53228	TTG		0.343	WDR41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220014.2	NM_018268	
APC	324	hgsc.bcm.edu	37	5	112174631	112174631	+	Nonsense_Mutation	SNP	C	C	T	rs121913331		TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00L-01A-01W-A005-10	TCGA-AA-A00L-10A-01W-A005-10	g.chr5:112174631C>T	ENST00000457016.1	+	16	3720	c.3340C>T	c.(3340-3342)Cga>Tga	p.R1114*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.R1114*|APC_ENST00000257430.4_Nonsense_Mutation_p.R1114*			P25054	APC_HUMAN	adenomatous polyposis coli	1114	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1114*(30)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGAAACAAATCGAGTGGGTTC	0.403	R1114*(LOVO_LARGE_INTESTINE)|R1114*(SW948_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1096X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	31	Substitution - Nonsense(30)|Unknown(1)	large_intestine(29)|ovary(1)|skin(1)	c.C3286T	5	GRCh37	CM920048	APC	M	rs121913331	.						90.0	82.0	85.0					5																	112174631		2202	4300	6502	112202530	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3340C>T	5.37:g.112174631C>T	ENSP00000413133:p.Arg1114*	Somatic		Capture	SOLID	Phase_I	112202530	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	6.950292	0.97956	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.76	4.88	0.63580	.	0.190581	0.42172	D	0.000759	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7869	14.0911	0.64990	0.3279:0.6721:0.0:0.0	.	.	.	.	X	1114;1096;1114;1114;1114	.	ENSP00000257430:R1114X	R	+	1	2	APC	112202530	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.208000	0.42797	1.423000	0.47198	0.655000	0.94253	CGA		0.403	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
