#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AKR1C4	1109	broad.mit.edu	37	10	5247730	5247730	+	Missense_Mutation	SNP	C	C	T	rs531165422	byFrequency	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr10:5247730C>T	ENST00000380448.1	+	6	633	c.380C>T	c.(379-381)aCg>aTg	p.T127M	AKR1C4_ENST00000263126.1_Missense_Mutation_p.T127M			P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	127					androgen metabolic process (GO:0008209)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|bile acid transmembrane transporter activity (GO:0015125)|chlordecone reductase activity (GO:0047743)|electron carrier activity (GO:0009055)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|retinal dehydrogenase activity (GO:0001758)	p.T127M(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	18						CCAGGTGAGACGCCACTACCA	0.443													C|||	2	0.000399361	0.0008	0.0	5008	,	,		19952	0.0		0.0	False		,,,				2504	0.001				p.T127M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C380T	10						.						120.0	100.0	107.0					10																	5247730		2203	4300	6503	5237730	SO:0001583	missense	1109	exon4			M33375	CCDS7064.1	10p15.1	2012-12-04	2012-12-04		ENSG00000198610	ENSG00000198610	1.1.1.225	"""Aldo-keto reductases"""	387	protein-coding gene	gene with protein product	"""chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4"""	600451	"""aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)"""	CHDR		7789999	Standard	NM_001818		Approved	DD4, HAKRA, C11, 3-alpha-HSD, CDR, MGC22581	uc001ihw.2	P17516	OTTHUMG00000017591	ENST00000380448.1:c.380C>T	10.37:g.5247730C>T	ENSP00000369814:p.Thr127Met	Somatic		Capture	Illumina HiSeq	Phase_I	5237730	NM_001818	Q5T6A3|Q8WW84|Q9NS54	Missense_Mutation	SNP	ENST00000380448.1	37	CCDS7064.1	.	.	.	.	.	.	.	.	.	.	c	9.936	1.216229	0.22373	.	.	ENSG00000198610	ENST00000380448;ENST00000263126	T;T	0.51071	0.72;0.72	2.9	-5.79	0.02354	NADP-dependent oxidoreductase domain (3);	1.137330	0.06647	N	0.762085	T	0.33789	0.0875	L	0.28400	0.85	0.09310	N	1	P	0.35774	0.519	B	0.40444	0.329	T	0.44205	-0.9343	10	0.87932	D	0	.	4.6262	0.12479	0.4332:0.2806:0.0:0.2862	.	127	P17516	AK1C4_HUMAN	M	127	ENSP00000369814:T127M;ENSP00000263126:T127M	ENSP00000263126:T127M	T	+	2	0	AKR1C4	5237730	0.930000	0.31532	0.000000	0.03702	0.001000	0.01503	1.805000	0.38883	-1.272000	0.02427	-1.734000	0.00692	ACG		0.443	AKR1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046543.2	NM_001818	
SLIT1	6585	broad.mit.edu	37	10	98808785	98808785	+	Silent	SNP	G	G	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr10:98808785G>T	ENST00000266058.4	-	14	1637	c.1392C>A	c.(1390-1392)gcC>gcA	p.A464A	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Silent_p.A464A	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	464	LRRCT 2.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.A464A(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		TGGCACAGCGGGCACCACTCG	0.622																																					p.A464A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1392A	10						.						93.0	83.0	87.0					10																	98808785		2203	4300	6503	98798775	SO:0001819	synonymous_variant	6585	exon14			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1392C>A	10.37:g.98808785G>T		Somatic		Capture	Illumina HiSeq	Phase_I	98798775	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Silent	SNP	ENST00000266058.4	37	CCDS7453.1																																																																																				0.622	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
UBTD1	80019	broad.mit.edu	37	10	99329960	99329960	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr10:99329960C>T	ENST00000370664.3	+	3	700	c.364C>T	c.(364-366)Ccg>Tcg	p.P122S	ANKRD2_ENST00000370655.1_5'Flank|ANKRD2_ENST00000455090.1_5'Flank|ANKRD2_ENST00000307518.5_5'Flank|ANKRD2_ENST00000298808.5_5'Flank	NM_024954.3	NP_079230.1	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1	122								p.P122S(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		CTGCCTGTCACCGCCGGTGAA	0.647																																					p.P122S	Pancreas(100;169 2668 32720)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C364T	10						.						64.0	74.0	70.0					10																	99329960		2203	4300	6503	99319950	SO:0001583	missense	80019	exon3			BC007331	CCDS7465.1	10q24.2	2005-09-22			ENSG00000165886	ENSG00000165886			25683	protein-coding gene	gene with protein product						12477932	Standard	NM_024954		Approved	FLJ11807	uc001knv.1	Q9HAC8	OTTHUMG00000018856	ENST00000370664.3:c.364C>T	10.37:g.99329960C>T	ENSP00000359698:p.Pro122Ser	Somatic		Capture	Illumina HiSeq	Phase_I	99319950	NM_024954	D3DR57|Q53HI3	Missense_Mutation	SNP	ENST00000370664.3	37	CCDS7465.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969364	0.34754	.	.	ENSG00000165886	ENST00000370664	T	0.41758	0.99	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.58032	0.2094	M	0.68952	2.095	0.80722	D	1	D	0.57571	0.98	P	0.58077	0.832	T	0.50242	-0.8851	10	0.20046	T	0.44	-14.8445	19.0508	0.93043	0.0:1.0:0.0:0.0	.	122	Q9HAC8	UBTD1_HUMAN	S	122	ENSP00000359698:P122S	ENSP00000359698:P122S	P	+	1	0	UBTD1	99319950	1.000000	0.71417	0.208000	0.23602	0.029000	0.11900	7.818000	0.86416	2.687000	0.91594	0.655000	0.94253	CCG		0.647	UBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049701.1	NM_024954	
IGSF9B	22997	broad.mit.edu	37	11	133807826	133807827	+	Frame_Shift_Ins	INS	-	-	G	rs567657119		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:133807826_133807827insG	ENST00000321016.8	-	4	669_670	c.439_440insC	c.(439-441)cagfs	p.Q147fs	IGSF9B_ENST00000533871.2_Frame_Shift_Ins_p.Q147fs			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	147	Ig-like 2.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CTCGATGTACTGGGGGGGTGTT	0.574																																					p.Q147fs												.	.	0			c.440_441insC	11						.																																			133313037	SO:0001589	frameshift_variant	22997	exon4			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.440dupC	11.37:g.133807833_133807833dupG	ENSP00000317980:p.Gln147fs	None		Capture	Illumina HiSeq	Phase_I	133313036	NM_014987	G5EA26	Frame_Shift_Ins	INS	ENST00000321016.8	37																																																																																					0.574	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
ZNF214	7761	broad.mit.edu	37	11	7022693	7022693	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:7022693C>T	ENST00000278314.4	-	3	536	c.221G>A	c.(220-222)gGc>gAc	p.G74D	ZNF214_ENST00000536068.1_Missense_Mutation_p.G74D|ZNF214_ENST00000531083.1_5'UTR	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	74	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G74D(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		CATCTGGGCGCCAGCATTCCA	0.418																																					p.G74D	Ovarian(22;251 657 736 21522 46864)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G221A	11						.						186.0	187.0	187.0					11																	7022693		2201	4295	6496	6979269	SO:0001583	missense	7761	exon3			AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.221G>A	11.37:g.7022693C>T	ENSP00000278314:p.Gly74Asp	Somatic		Capture	Illumina HiSeq	Phase_I	6979269	NM_013249	B2R8Q1	Missense_Mutation	SNP	ENST00000278314.4	37	CCDS31418.1	.	.	.	.	.	.	.	.	.	.	C	6.847	0.525462	0.13066	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.05382	3.45;3.45	4.14	-0.545	0.11843	Krueppel-associated box (1);	1.125910	0.06785	N	0.785987	T	0.02533	0.0077	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47289	-0.9129	10	0.12103	T	0.63	.	0.4616	0.00517	0.3196:0.3057:0.1566:0.218	.	74	Q9UL59	ZN214_HUMAN	D	74	ENSP00000278314:G74D;ENSP00000445373:G74D	ENSP00000278314:G74D	G	-	2	0	ZNF214	6979269	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.116000	0.15561	0.099000	0.17552	-0.345000	0.07892	GGC		0.418	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385349.1		
ABCC8	6833	broad.mit.edu	37	11	17483316	17483316	+	Silent	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:17483316G>A	ENST00000389817.3	-	5	704	c.636C>T	c.(634-636)gaC>gaT	p.D212D	ABCC8_ENST00000302539.4_Silent_p.D212D			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	212					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)	p.D212D(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GTACCCCCAGGTCTTGCAGGT	0.567																																					p.D212D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C636T	11						.						113.0	101.0	105.0					11																	17483316		2200	4293	6493	17439892	SO:0001819	synonymous_variant	6833	exon5			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.636C>T	11.37:g.17483316G>A		Somatic		Capture	Illumina HiSeq	Phase_I	17439892	NM_000352	A6NMX8|E3UYX6|O75948|Q16583	Silent	SNP	ENST00000389817.3	37	CCDS31437.1																																																																																				0.567	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
OR4A5	81318	broad.mit.edu	37	11	51411675	51411675	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:51411675T>A	ENST00000319760.6	-	1	773	c.721A>T	c.(721-723)Agt>Tgt	p.S241C		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S241C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				ACAACGGTACTGCCGGAGCTG	0.398																																					p.S241C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A721T	11						.						62.0	61.0	61.0					11																	51411675		2201	4295	6496	51268251	SO:0001583	missense	81318	exon1			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.721A>T	11.37:g.51411675T>A	ENSP00000367664:p.Ser241Cys	Somatic		Capture	Illumina HiSeq	Phase_I	51268251	NM_001005272	Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	1.868	-0.460993	0.04508	.	.	ENSG00000221840	ENST00000319760	T	0.37752	1.18	2.2	0.924	0.19418	GPCR, rhodopsin-like superfamily (1);	0.144004	0.31709	N	0.007190	T	0.13243	0.0321	N	0.02539	-0.55	0.09310	N	1	B	0.28820	0.224	B	0.29716	0.106	T	0.16689	-1.0394	10	0.87932	D	0	.	4.8879	0.13712	0.5093:0.0:0.0:0.4907	.	241	Q8NH83	OR4A5_HUMAN	C	241	ENSP00000367664:S241C	ENSP00000367664:S241C	S	-	1	0	OR4A5	51268251	0.000000	0.05858	0.023000	0.16930	0.003000	0.03518	-2.762000	0.00785	0.235000	0.21160	0.136000	0.15936	AGT		0.398	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
OR5M9	390162	broad.mit.edu	37	11	56230825	56230825	+	Missense_Mutation	SNP	C	C	T	rs377523071		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:56230825C>T	ENST00000279791.1	-	1	52	c.53G>A	c.(52-54)cGt>cAt	p.R18H		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R18H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					TAGCTCCTGACGACAGGTCAG	0.428																																					p.R18H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G53A	11						.	C	HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	35.0	36.0	35.0		53	-2.7	0.0	11		35	0,8592		0,0,4296	no	missense	OR5M9	NM_001004743.1	29	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	benign	18/311	56230825	1,12993	2201	4296	6497	55987401	SO:0001583	missense	390162	exon1			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.53G>A	11.37:g.56230825C>T	ENSP00000279791:p.Arg18His	Somatic		Capture	Illumina HiSeq	Phase_I	55987401	NM_001004743	Q6IEW5|Q96RB9	Missense_Mutation	SNP	ENST00000279791.1	37	CCDS31531.1	.	.	.	.	.	.	.	.	.	.	C	5.338	0.247742	0.10130	2.27E-4	0.0	ENSG00000150269	ENST00000279791	T	0.01084	5.36	4.79	-2.71	0.05986	.	0.000000	0.44688	D	0.000440	T	0.00666	0.0022	N	0.05280	-0.08	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.47674	-0.9099	10	0.30078	T	0.28	-0.7536	10.3265	0.43796	0.0:0.286:0.0:0.714	.	18	Q8NGP3	OR5M9_HUMAN	H	18	ENSP00000279791:R18H	ENSP00000279791:R18H	R	-	2	0	OR5M9	55987401	0.000000	0.05858	0.004000	0.12327	0.402000	0.30811	-3.137000	0.00588	-0.325000	0.08577	-0.980000	0.02579	CGT		0.428	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743	
MS4A10	341116	broad.mit.edu	37	11	60561504	60561504	+	Missense_Mutation	SNP	C	C	A	rs111688654		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:60561504C>A	ENST00000308287.1	+	5	516	c.420C>A	c.(418-420)ttC>ttA	p.F140L		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	140						integral component of membrane (GO:0016021)		p.F140L(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						CTGGCCTCTTCGTCATCTCCA	0.517																																					p.F140L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C420A	11						.						145.0	129.0	134.0					11																	60561504		2203	4299	6502	60318080	SO:0001583	missense	341116	exon5			AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.420C>A	11.37:g.60561504C>A	ENSP00000311862:p.Phe140Leu	Somatic		Capture	Illumina HiSeq	Phase_I	60318080	NM_206893	B2RP45|Q96PG3	Missense_Mutation	SNP	ENST00000308287.1	37	CCDS7992.1	.	.	.	.	.	.	.	.	.	.	C	3.744	-0.053022	0.07362	.	.	ENSG00000172689	ENST00000308287	T	0.02140	4.43	4.87	-9.75	0.00506	.	0.200816	0.25027	N	0.033707	T	0.02267	0.0070	L	0.55834	1.745	0.19775	N	0.999957	P	0.38565	0.637	B	0.43251	0.413	T	0.04053	-1.0981	10	0.19590	T	0.45	-15.0447	8.9067	0.35528	0.0:0.2639:0.1055:0.6306	.	140	Q96PG2	M4A10_HUMAN	L	140	ENSP00000311862:F140L	ENSP00000311862:F140L	F	+	3	2	MS4A10	60318080	0.002000	0.14202	0.010000	0.14722	0.022000	0.10575	-2.782000	0.00772	-2.305000	0.00654	-0.736000	0.03550	TTC		0.517	MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395619.1	NM_206893	
FADS2	9415	broad.mit.edu	37	11	61615706	61615706	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:61615706G>A	ENST00000278840.4	+	5	1324	c.694G>A	c.(694-696)Gat>Aat	p.D232N	FADS2_ENST00000522056.1_Missense_Mutation_p.D201N|FADS2_ENST00000257261.6_Missense_Mutation_p.D210N|FADS2_ENST00000521849.1_Missense_Mutation_p.D232N	NM_004265.2	NP_004256.1	O95864	FADS2_HUMAN	fatty acid desaturase 2	232					alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)	p.D232N(1)		breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	CAAGGATCCCGATGTGAACAT	0.562																																					p.D232N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G694A	11						.						211.0	161.0	178.0					11																	61615706		2202	4299	6501	61372282	SO:0001583	missense	9415	exon5			AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000278840.4:c.694G>A	11.37:g.61615706G>A	ENSP00000278840:p.Asp232Asn	Somatic		Capture	Illumina HiSeq	Phase_I	61372282	NM_004265	A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Missense_Mutation	SNP	ENST00000278840.4	37	CCDS8012.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960034	0.74016	.	.	ENSG00000134824	ENST00000257261;ENST00000522056;ENST00000278840;ENST00000521849	T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71	4.37	4.37	0.52481	Fatty acid desaturase, type 1 (1);	0.000000	0.53938	D	0.000056	D	0.86381	0.5919	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.89603	0.3836	10	0.87932	D	0	-5.6942	16.7157	0.85397	0.0:0.0:1.0:0.0	.	201;232;232;210	B7Z634;O95864;O95864-3;O95864-2	.;FADS2_HUMAN;.;.	N	210;201;232;232	ENSP00000257261:D210N;ENSP00000429500:D201N;ENSP00000278840:D232N;ENSP00000431091:D232N	ENSP00000257261:D210N	D	+	1	0	FADS2	61372282	1.000000	0.71417	0.459000	0.27081	0.069000	0.16628	8.624000	0.90961	2.244000	0.73946	0.557000	0.71058	GAT		0.562	FADS2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375586.2	NM_004265	
SYVN1	84447	broad.mit.edu	37	11	64898950	64898950	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:64898950G>C	ENST00000377190.3	-	7	743	c.649C>G	c.(649-651)Ctg>Gtg	p.L217V	SYVN1_ENST00000307289.6_Missense_Mutation_p.L166V|SYVN1_ENST00000526121.1_5'UTR|SYVN1_ENST00000526060.1_Missense_Mutation_p.L217V|SYVN1_ENST00000294256.8_Missense_Mutation_p.L217V	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	217					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CCTGTAAACAGCTCTGTGTAG	0.577																																					p.L217V												.	.	0			c.C649G	11						.						115.0	94.0	101.0					11																	64898950		2201	4297	6498	64655526	SO:0001583	missense	84447	exon7			AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.649C>G	11.37:g.64898950G>C	ENSP00000366395:p.Leu217Val	None		Capture	Illumina HiSeq	Phase_I	64655526	NM_032431	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Missense_Mutation	SNP	ENST00000377190.3	37	CCDS31605.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137794	0.56936	.	.	ENSG00000162298	ENST00000377190;ENST00000294256;ENST00000434219;ENST00000307289;ENST00000526060;ENST00000531018;ENST00000528487	T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0	4.49	3.49	0.39957	.	0.000000	0.64402	D	0.000001	T	0.49133	0.1539	M	0.81497	2.545	0.80722	D	1	P;P;P	0.45827	0.867;0.569;0.577	P;B;B	0.47573	0.55;0.269;0.194	T	0.51100	-0.8748	10	0.40728	T	0.16	-13.9117	9.2678	0.37652	0.1153:0.0:0.8847:0.0	.	166;217;217	Q86TM6-2;Q86TM6-3;Q86TM6	.;.;SYVN1_HUMAN	V	217;217;217;166;217;157;202	ENSP00000366395:L217V;ENSP00000294256:L217V;ENSP00000302035:L166V;ENSP00000436984:L217V;ENSP00000431215:L157V;ENSP00000431720:L202V	ENSP00000294256:L217V	L	-	1	2	SYVN1	64655526	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.123000	0.64703	2.321000	0.78463	0.563000	0.77884	CTG		0.577	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	
EHBP1L1	254102	broad.mit.edu	37	11	65357422	65357422	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:65357422C>A	ENST00000309295.4	+	14	4284	c.4019C>A	c.(4018-4020)tCg>tAg	p.S1340*	EHBP1L1_ENST00000533364.1_5'Flank	NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	1340	Pro-rich.					membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						AGTTCCCCCTCGGAGGAACCA	0.627																																					p.S1340X												.	.	0			c.C4019A	11						.						32.0	40.0	37.0					11																	65357422		2017	4149	6166	65113998	SO:0001587	stop_gained	254102	exon14			AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.4019C>A	11.37:g.65357422C>A	ENSP00000312671:p.Ser1340*	None		Capture	Illumina HiSeq	Phase_I	65113998	NM_001099409	Q8TB89|Q9H7M7	Nonsense_Mutation	SNP	ENST00000309295.4	37	CCDS44649.1	.	.	.	.	.	.	.	.	.	.	C	41	8.949605	0.99014	.	.	ENSG00000173442	ENST00000309295	.	.	.	3.73	-0.515	0.11954	.	2.196060	0.02224	N	0.064220	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.6596	0.05023	0.2358:0.3925:0.0:0.3716	.	.	.	.	X	1340	.	ENSP00000312671:S1340X	S	+	2	0	EHBP1L1	65113998	0.000000	0.05858	0.001000	0.08648	0.222000	0.24845	-1.623000	0.02040	0.021000	0.15133	0.563000	0.77884	TCG		0.627	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658	
CFL1	1072	broad.mit.edu	37	11	65623434	65623434	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:65623434T>G	ENST00000525451.2	-	3	998	c.283A>C	c.(283-285)Aag>Cag	p.K95Q	CFL1_ENST00000531407.1_Missense_Mutation_p.K78Q|CFL1_ENST00000308162.5_Missense_Mutation_p.K95Q|CFL1_ENST00000527344.1_Missense_Mutation_p.K78Q|CFL1_ENST00000531413.1_Missense_Mutation_p.K78Q|CFL1_ENST00000534769.1_Missense_Mutation_p.K133Q|CFL1_ENST00000524553.1_Missense_Mutation_p.K78Q			P23528	COF1_HUMAN	cofilin 1 (non-muscle)	95	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin cytoskeleton organization (GO:0030036)|actin filament depolymerization (GO:0030042)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytoskeleton organization (GO:0007010)|establishment of cell polarity (GO:0030010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|mitotic cytokinesis (GO:0000281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell size (GO:0045792)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of actin filament depolymerization (GO:0030836)|protein import into nucleus (GO:0006606)|protein phosphorylation (GO:0006468)|regulation of cell morphogenesis (GO:0022604)|response to amino acid (GO:0043200)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.K95Q(1)		breast(1)|kidney(1)|large_intestine(2)|lung(2)	6				READ - Rectum adenocarcinoma(159;0.169)		TCCTCCTTCTTGCTCTCCTTG	0.527																																					p.K95Q	Esophageal Squamous(90;820 1366 3932 32351 42291)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A283C	11						.						165.0	142.0	150.0					11																	65623434		2201	4297	6498	65380010	SO:0001583	missense	1072	exon2			X95404	CCDS8114.1	11q13.1	2010-12-03			ENSG00000172757	ENSG00000172757			1874	protein-coding gene	gene with protein product		601442		CFL		8800436	Standard	NM_005507		Approved		uc001ofs.3	P23528		ENST00000525451.2:c.283A>C	11.37:g.65623434T>G	ENSP00000432660:p.Lys95Gln	Somatic		Capture	Illumina HiSeq	Phase_I	65380010	NM_005507	B3KUQ1|Q53Y87|Q9UCA2	Missense_Mutation	SNP	ENST00000525451.2	37	CCDS8114.1	.	.	.	.	.	.	.	.	.	.	T	15.57	2.872252	0.51695	.	.	ENSG00000172757	ENST00000525451;ENST00000308162;ENST00000527344;ENST00000531407;ENST00000524553;ENST00000534769;ENST00000531413;ENST00000532134;ENST00000530413;ENST00000534784	T;T;T;T;T;T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15;1.15;1.15;1.15;1.15;1.15	4.28	4.28	0.50868	Actin-binding, cofilin/tropomyosin type (3);	0.000000	0.85682	D	0.000000	T	0.27559	0.0677	L	0.38692	1.165	0.80722	D	1	B	0.20459	0.045	B	0.26614	0.071	T	0.05484	-1.0882	10	0.12103	T	0.63	.	12.0253	0.53367	0.0:0.0:0.0:1.0	.	95	P23528	COF1_HUMAN	Q	95;95;78;78;78;133;78;95;78;78	ENSP00000432660:K95Q;ENSP00000309629:K95Q;ENSP00000432155:K78Q;ENSP00000433910:K78Q;ENSP00000432226:K78Q;ENSP00000431696:K133Q;ENSP00000433131:K78Q;ENSP00000436431:K95Q;ENSP00000436899:K78Q;ENSP00000433308:K78Q	ENSP00000309629:K95Q	K	-	1	0	CFL1	65380010	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.228000	0.72288	1.882000	0.54519	0.533000	0.62120	AAG		0.527	CFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390701.3	NM_005507	
NUMA1	4926	broad.mit.edu	37	11	71725532	71725532	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:71725532A>C	ENST00000393695.3	-	15	3348	c.3017T>G	c.(3016-3018)gTg>gGg	p.V1006G	NUMA1_ENST00000351960.6_Intron|NUMA1_ENST00000358965.6_Missense_Mutation_p.V1006G|RP11-849H4.4_ENST00000502284.1_RNA	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.V1006G(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						CAGCCGCGCCACCTCCCTTTC	0.687			T	RARA	APL																																p.V1006G			Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3017G	11						.						49.0	54.0	53.0					11																	71725532		2199	4291	6490	71403180	SO:0001583	missense	4926	exon15			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.3017T>G	11.37:g.71725532A>C	ENSP00000377298:p.Val1006Gly	Somatic		Capture	Illumina HiSeq	Phase_I	71403180	NM_006185		Missense_Mutation	SNP	ENST00000393695.3	37	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	A	15.08	2.726735	0.48833	.	.	ENSG00000137497	ENST00000358965;ENST00000393695;ENST00000359652	T;T	0.15256	2.44;2.45	5.6	3.18	0.36537	.	0.366532	0.23418	N	0.048389	T	0.16128	0.0388	L	0.44542	1.39	0.46774	D	0.999193	P;P;B;P	0.50617	0.937;0.467;0.255;0.937	P;B;B;P	0.46850	0.529;0.187;0.157;0.529	T	0.01096	-1.1453	9	.	.	.	.	6.5195	0.22266	0.6:0.3144:0.0855:0.0	.	1012;490;1006;1006	Q4LE64;Q59HB8;Q14980-2;Q14980	.;.;.;NUMA1_HUMAN	G	1006;1006;569	ENSP00000351851:V1006G;ENSP00000377298:V1006G	.	V	-	2	0	NUMA1	71403180	0.001000	0.12720	1.000000	0.80357	0.861000	0.49209	1.312000	0.33574	2.136000	0.66102	0.533000	0.62120	GTG		0.687	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		
SPCS2	9789	broad.mit.edu	37	11	74688088	74688088	+	Nonstop_Mutation	SNP	G	G	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:74688088G>T	ENST00000263672.6	+	5	720	c.681G>T	c.(679-681)taG>taT	p.*227Y	SPCS2_ENST00000526361.1_Nonstop_Mutation_p.*88Y|SPCS2_ENST00000530257.1_Nonstop_Mutation_p.*158Y|SPCS2_ENST00000528265.1_Intron	NM_014752.2	NP_055567.2	Q15005	SPCS2_HUMAN	signal peptidase complex subunit 2 homolog (S. cerevisiae)	0					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)	p.*227Y(1)		breast(1)	1						AAATAAAGTAGCCAATTCTAA	0.413																																					p.X227Y												.	.	1	Nonstop extension(1)	large_intestine(1)	c.G681T	11						.						5.0	5.0	5.0					11																	74688088		1710	3826	5536	74365736	SO:0001578	stop_lost	9789	exon5			D14658	CCDS44681.1	11q13.4	2008-02-05			ENSG00000118363	ENSG00000118363			28962	protein-coding gene	gene with protein product						7788527	Standard	NM_014752		Approved	KIAA0102	uc001ovu.2	Q15005	OTTHUMG00000165517	ENST00000263672.6:c.681G>T	11.37:g.74688088G>T	ENSP00000263672:p.*227Tyrext*27	Somatic		Capture	Illumina HiSeq	Phase_I	74365736	NM_014752	Q15507|Q3KQT0|Q641R4|Q6FG65|Q6IRX0|Q6P1P4|Q96HU9	Nonstop_Mutation	SNP	ENST00000263672.6	37	CCDS44681.1	.	.	.	.	.	.	.	.	.	.	.	7.465	0.645537	0.14451	.	.	ENSG00000118363	ENST00000263672;ENST00000530257;ENST00000526361;ENST00000532972	.	.	.	5.35	1.2	0.21068	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0114	0.30355	0.465:0.0:0.535:0.0	.	.	.	.	Y	227;158;88;258	.	.	X	+	3	2	SPCS2	74365736	0.986000	0.35501	0.847000	0.33407	0.223000	0.24884	1.521000	0.35910	0.293000	0.22520	-0.142000	0.14014	TAG		0.413	SPCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384587.1	NM_014752	
NCAM1	4684	broad.mit.edu	37	11	113105795	113105795	+	Silent	SNP	C	C	T	rs78645852		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr11:113105795C>T	ENST00000533760.1	+	13	1949	c.1350C>T	c.(1348-1350)ccC>ccT	p.P450P	NCAM1_ENST00000316851.7_Silent_p.P568P|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Silent_p.P577P	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	578	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.P577P(2)|p.P568P(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GCCTGAAGCCCGAAACAACGT	0.547																																					p.R569X												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C1705T	11						.						25.0	28.0	27.0					11																	113105795		1996	4155	6151	112611005	SO:0001819	synonymous_variant	4684	exon13				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1350C>T	11.37:g.113105795C>T		Somatic		Capture	Illumina HiSeq	Phase_I	112611005	NM_001076682	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Silent	SNP	ENST00000533760.1	37																																																																																					0.547	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
ALG10B	144245	broad.mit.edu	37	12	38714720	38714720	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr12:38714720C>A	ENST00000308742.4	+	3	1443	c.1127C>A	c.(1126-1128)gCc>gAc	p.A376D	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	376					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)	p.A376D(1)		breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				TTAGTTCCAGCCTATATATTT	0.308																																					p.A376D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1127A	12						.						72.0	77.0	75.0					12																	38714720		2197	4295	6492	37000987	SO:0001583	missense	144245	exon3			AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.1127C>A	12.37:g.38714720C>A	ENSP00000310120:p.Ala376Asp	Somatic		Capture	Illumina HiSeq	Phase_I	37000987	NM_001013620	B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	37	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	c	11.87	1.766303	0.31228	.	.	ENSG00000175548	ENST00000308742	T	0.57907	0.37	3.34	-3.72	0.04411	.	0.508601	0.20832	N	0.084878	T	0.49490	0.1560	M	0.73962	2.25	0.40985	D	0.984807	B	0.32324	0.364	B	0.41571	0.36	T	0.37572	-0.9700	10	0.35671	T	0.21	.	5.6039	0.17369	0.0:0.2106:0.4175:0.3719	.	376	Q5I7T1	AG10B_HUMAN	D	376	ENSP00000310120:A376D	ENSP00000310120:A376D	A	+	2	0	ALG10B	37000987	0.344000	0.24827	0.290000	0.24890	0.951000	0.60555	-0.072000	0.11486	-0.808000	0.04387	-1.074000	0.02243	GCC		0.308	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620	
VWF	7450	broad.mit.edu	37	12	6058290	6058290	+	Missense_Mutation	SNP	C	C	T	rs150577615		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr12:6058290C>T	ENST00000261405.5	-	52	8587	c.8333G>A	c.(8332-8334)cGg>cAg	p.R2778Q	ANO2_ENST00000327087.8_5'Flank|ANO2_ENST00000356134.5_5'Flank|ANO2_ENST00000546188.1_5'Flank	NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2778	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.R2778Q(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GGGCTCCGTCCGTGTCGGAGA	0.557																																					p.R2778Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8333A	12						.	C	GLN/ARG	0,4406		0,0,2203	103.0	83.0	90.0		8333	-2.5	0.0	12	dbSNP_134	90	2,8598	2.2+/-6.3	0,2,4298	no	missense	VWF	NM_000552.3	43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	2778/2814	6058290	2,13004	2203	4300	6503	5928551	SO:0001583	missense	7450	exon52				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.8333G>A	12.37:g.6058290C>T	ENSP00000261405:p.Arg2778Gln	Somatic		Capture	Illumina HiSeq	Phase_I	5928551	NM_000552	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.495331	0.26774	0.0	2.33E-4	ENSG00000110799	ENST00000261405	T	0.35789	1.29	4.89	-2.49	0.06403	Cystine knot, C-terminal (3);	0.899723	0.08996	N	0.863682	T	0.18173	0.0436	L	0.28458	0.855	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.29488	-1.0010	10	0.15066	T	0.55	.	1.4237	0.02318	0.152:0.2393:0.1493:0.4593	.	2778	P04275	VWF_HUMAN	Q	2778	ENSP00000261405:R2778Q	ENSP00000261405:R2778Q	R	-	2	0	VWF	5928551	0.000000	0.05858	0.002000	0.10522	0.783000	0.44284	-1.629000	0.02029	-0.111000	0.12001	0.555000	0.69702	CGG		0.557	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
PRICKLE1	144165	broad.mit.edu	37	12	42858278	42858278	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr12:42858278A>G	ENST00000455697.1	-	7	1843	c.1558T>C	c.(1558-1560)Tcc>Ccc	p.S520P	RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.S520P|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.S520P|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.S520P|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.S520P	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	520					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S520P(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		CACTCCAGGGAATCTTCATAC	0.478																																					p.S520P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1558C	12						.						119.0	115.0	117.0					12																	42858278		2203	4300	6503	41144545	SO:0001583	missense	144165	exon7			AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.1558T>C	12.37:g.42858278A>G	ENSP00000401060:p.Ser520Pro	Somatic		Capture	Illumina HiSeq	Phase_I	41144545	NM_001144882	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	37	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	A	16.15	3.040555	0.55003	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01	5.76	4.6	0.57074	.	0.050045	0.85682	D	0.000000	T	0.52075	0.1712	L	0.40543	1.245	0.80722	D	1	B	0.25667	0.131	B	0.23018	0.043	T	0.53092	-0.8487	10	0.46703	T	0.11	-6.867	12.3952	0.55380	0.9314:0.0:0.0686:0.0	.	520	Q96MT3	PRIC1_HUMAN	P	520	ENSP00000401060:S520P;ENSP00000398947:S520P;ENSP00000448359:S520P;ENSP00000345064:S520P;ENSP00000449819:S520P	ENSP00000345064:S520P	S	-	1	0	PRICKLE1	41144545	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.058000	0.76676	2.322000	0.78497	0.528000	0.53228	TCC		0.478	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
PTPRR	5801	broad.mit.edu	37	12	71286552	71286552	+	Silent	SNP	G	G	A	rs202082061		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr12:71286552G>A	ENST00000283228.2	-	2	716	c.264C>T	c.(262-264)ccC>ccT	p.P88P		NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	88					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.P88P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		GGTCATATGCGGGTCTAGGAA	0.448																																					p.P88P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C264T	12						.						212.0	210.0	211.0					12																	71286552		2203	4300	6503	69572819	SO:0001819	synonymous_variant	5801	exon2			D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.264C>T	12.37:g.71286552G>A		Somatic		Capture	Illumina HiSeq	Phase_I	69572819	NM_002849	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Silent	SNP	ENST00000283228.2	37	CCDS8998.1																																																																																				0.448	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849	
CYSLTR2	57105	broad.mit.edu	37	13	49281775	49281775	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr13:49281775G>C	ENST00000282018.3	+	1	825	c.822G>C	c.(820-822)tgG>tgC	p.W274C		NM_020377.2	NP_065110.1	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	274					immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell death (GO:0010942)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteinyl leukotriene receptor activity (GO:0001631)|leukotriene receptor activity (GO:0004974)	p.W274C(1)		endometrium(2)|large_intestine(4)|lung(12)|skin(2)	20		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	TGACGACATGGAAAGTGGGTT	0.478																																					p.W274C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G822C	13						.						158.0	138.0	144.0					13																	49281775		2203	4300	6503	48179776	SO:0001583	missense	57105	exon1			AB038269	CCDS9412.1	13q14.2	2012-08-10			ENSG00000152207	ENSG00000152207		"""GPCR / Class A : Leukotriene receptors"""	18274	protein-coding gene	gene with protein product		605666				10913337, 1085123	Standard	NM_020377		Approved	CysLT(2), CYSLT2R	uc001vck.2	Q9NS75	OTTHUMG00000016906	ENST00000282018.3:c.822G>C	13.37:g.49281775G>C	ENSP00000282018:p.Trp274Cys	Somatic		Capture	Illumina HiSeq	Phase_I	48179776	NM_020377	Q9HCQ2	Missense_Mutation	SNP	ENST00000282018.3	37	CCDS9412.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.343394	0.24339	.	.	ENSG00000152207	ENST00000282018	T	0.06768	3.26	5.51	5.51	0.81932	GPCR, rhodopsin-like superfamily (1);	0.121970	0.37761	N	0.001946	T	0.13500	0.0327	M	0.65975	2.015	0.53005	D	0.999962	B	0.30439	0.279	B	0.34301	0.179	T	0.01771	-1.1277	10	0.38643	T	0.18	.	13.9554	0.64144	0.0:0.0:0.8386:0.1614	.	274	Q9NS75	CLTR2_HUMAN	C	274	ENSP00000282018:W274C	ENSP00000282018:W274C	W	+	3	0	CYSLTR2	48179776	0.171000	0.23029	0.589000	0.28718	0.010000	0.07245	1.616000	0.36933	2.597000	0.87782	0.655000	0.94253	TGG		0.478	CYSLTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044894.1		
ALDH6A1	4329	broad.mit.edu	37	14	74533431	74533431	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr14:74533431G>C	ENST00000553458.1	-	9	1299	c.1201C>G	c.(1201-1203)Cca>Gca	p.P401A	AC005484.5_ENST00000492026.1_RNA|CCDC176_ENST00000553773.1_Intron|ALDH6A1_ENST00000555126.1_Missense_Mutation_p.P118A|ALDH6A1_ENST00000350259.4_Missense_Mutation_p.P388A	NM_001278593.1|NM_005589.2	NP_001265522.1|NP_005580.1	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6 family, member A1	401					branched-chain amino acid catabolic process (GO:0009083)|brown fat cell differentiation (GO:0050873)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|thymine metabolic process (GO:0019859)|valine catabolic process (GO:0006574)|valine metabolic process (GO:0006573)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fatty-acyl-CoA binding (GO:0000062)|malonate-semialdehyde dehydrogenase (acetylating) activity (GO:0018478)|methylmalonate-semialdehyde dehydrogenase (acylating) activity (GO:0004491)|poly(A) RNA binding (GO:0044822)	p.P401A(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(3)|skin(3)	21				BRCA - Breast invasive adenocarcinoma(234;0.00354)		ATGATGGTTGGTCCAACAAAG	0.388																																					p.P401A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1201G	14						.						149.0	139.0	142.0					14																	74533431		2203	4300	6503	73603184	SO:0001583	missense	4329	exon9			M93405	CCDS9826.1, CCDS61501.1	14q24.3	2014-02-03			ENSG00000119711	ENSG00000119711	1.2.1.27	"""Aldehyde dehydrogenases"""	7179	protein-coding gene	gene with protein product		603178		MMSDH		1527093	Standard	NM_005589		Approved		uc001xpo.3	Q02252	OTTHUMG00000171203	ENST00000553458.1:c.1201C>G	14.37:g.74533431G>C	ENSP00000450436:p.Pro401Ala	Somatic		Capture	Illumina HiSeq	Phase_I	73603184	NM_005589	B2R609|B4DFS8|J3KNU8|Q9UKM8	Missense_Mutation	SNP	ENST00000553458.1	37	CCDS9826.1	.	.	.	.	.	.	.	.	.	.	G	19.27	3.794784	0.70452	.	.	ENSG00000119711	ENST00000553458;ENST00000350259;ENST00000555126	D;D;D	0.97642	-4.47;-4.47;-4.47	5.53	4.64	0.57946	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.98391	0.9465	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98837	1.0753	10	0.54805	T	0.06	.	14.521	0.67851	0.0707:0.0:0.9293:0.0	.	388;401	B4DFS8;Q02252	.;MMSA_HUMAN	A	401;388;118	ENSP00000450436:P401A;ENSP00000342564:P388A;ENSP00000452081:P118A	ENSP00000342564:P401A	P	-	1	0	ALDH6A1	73603184	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	9.776000	0.99001	1.327000	0.45338	-0.291000	0.09656	CCA		0.388	ALDH6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412309.1		
RYR3	6263	broad.mit.edu	37	15	33954583	33954583	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr15:33954583G>A	ENST00000389232.4	+	35	4922	c.4852G>A	c.(4852-4854)Gcc>Acc	p.A1618T	RYR3_ENST00000415757.3_Missense_Mutation_p.A1618T	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1618	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.A1618T(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCTGGCCAGCGCCAAGGAGAG	0.552																																					p.A1618T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4852A	15						.						61.0	59.0	60.0					15																	33954583		2021	4170	6191	31741875	SO:0001583	missense	6263	exon35				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.4852G>A	15.37:g.33954583G>A	ENSP00000373884:p.Ala1618Thr	Somatic		Capture	Illumina HiSeq	Phase_I	31741875	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	10.07	1.249713	0.22880	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.76968	-1.06;-1.06	4.89	2.97	0.34412	.	0.130414	0.51477	N	0.000089	T	0.73048	0.3537	M	0.72118	2.19	0.25117	N	0.990672	D;P	0.52996	0.957;0.622	B;B	0.42188	0.379;0.107	T	0.65643	-0.6118	10	0.44086	T	0.13	.	8.0916	0.30803	0.0743:0.0:0.6447:0.281	.	1618;1618	Q15413-2;Q15413	.;RYR3_HUMAN	T	1618	ENSP00000373884:A1618T;ENSP00000399610:A1618T	ENSP00000354735:A1618T	A	+	1	0	RYR3	31741875	1.000000	0.71417	0.121000	0.21740	0.371000	0.29859	5.364000	0.66110	0.640000	0.30582	-0.145000	0.13849	GCC		0.552	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
LCTL	197021	broad.mit.edu	37	15	66853527	66853527	+	Silent	SNP	G	G	T	rs143302973	byFrequency	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr15:66853527G>T	ENST00000341509.5	-	5	738	c.607C>A	c.(607-609)Cgg>Agg	p.R203R	LCTL_ENST00000537670.1_Silent_p.R30R|LCTL_ENST00000563438.1_5'Flank	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	203					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.R203R(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CTGCTTACCCGAGGATCACTG	0.547																																					p.R203R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C607A	15						.						111.0	96.0	101.0					15																	66853527		2201	4299	6500	64640581	SO:0001819	synonymous_variant	197021	exon5			AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.607C>A	15.37:g.66853527G>T		Somatic		Capture	Illumina HiSeq	Phase_I	64640581	NM_207338	B3KQY0	Silent	SNP	ENST00000341509.5	37	CCDS10220.1																																																																																				0.547	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256921.2	NM_207338	
SRRM2	23524	broad.mit.edu	37	16	2816046	2816046	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr16:2816046A>C	ENST00000301740.8	+	11	6066	c.5517A>C	c.(5515-5517)agA>agC	p.R1839S		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1839	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.R1839S(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GACGCCGAAGAGGCCGCTCTC	0.642																																					p.R1839S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5517C	16						.						43.0	45.0	44.0					16																	2816046		2198	4300	6498	2756047	SO:0001583	missense	23524	exon11			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5517A>C	16.37:g.2816046A>C	ENSP00000301740:p.Arg1839Ser	Somatic		Capture	Illumina HiSeq	Phase_I	2756047	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	A	9.445	1.089074	0.20390	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.27104	1.69	5.46	3.14	0.36123	.	0.000000	0.64402	D	0.000006	T	0.20088	0.0483	N	0.08118	0	0.30794	N	0.740563	D	0.57899	0.981	D	0.69824	0.966	T	0.14364	-1.0475	10	0.07813	T	0.8	-13.1127	4.9017	0.13779	0.7163:0.0:0.2837:0.0	.	1839	Q9UQ35	SRRM2_HUMAN	S	1839;1839;1091	ENSP00000301740:R1839S	ENSP00000301740:R1839S	R	+	3	2	SRRM2	2756047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.205000	0.32308	0.905000	0.36596	0.528000	0.53228	AGA		0.642	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
DNAJA3	9093	broad.mit.edu	37	16	4491457	4491457	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr16:4491457C>A	ENST00000262375.6	+	4	588	c.511C>A	c.(511-513)Cat>Aat	p.H171N	DNAJA3_ENST00000431375.2_Intron|DNAJA3_ENST00000355296.4_Missense_Mutation_p.H171N|DNAJA3_ENST00000572139.1_3'UTR	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	171					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)	p.H171N(1)		NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						CGGCTCCCAGCATAGCTACTG	0.557																																					p.H171N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C511A	16						.						67.0	66.0	66.0					16																	4491457		2197	4300	6497	4431458	SO:0001583	missense	9093	exon4			AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.511C>A	16.37:g.4491457C>A	ENSP00000262375:p.His171Asn	Somatic		Capture	Illumina HiSeq	Phase_I	4431458	NM_001135110	B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Missense_Mutation	SNP	ENST00000262375.6	37	CCDS10515.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163186	0.38217	.	.	ENSG00000103423	ENST00000262375;ENST00000355296	T;T	0.64438	-0.1;-0.09	5.9	4.94	0.65067	Heat shock protein DnaJ, N-terminal (1);	0.127520	0.56097	D	0.000030	T	0.39759	0.1090	N	0.08118	0	0.80722	D	1	B;B	0.14438	0.0;0.01	B;B	0.15484	0.0;0.013	T	0.27606	-1.0069	10	0.10902	T	0.67	-2.8168	14.6381	0.68704	0.0:0.9292:0.0:0.0708	.	171;171	Q96EY1-2;Q96EY1	.;DNJA3_HUMAN	N	171	ENSP00000262375:H171N;ENSP00000347445:H171N	ENSP00000262375:H171N	H	+	1	0	DNAJA3	4431458	1.000000	0.71417	0.991000	0.47740	0.486000	0.33341	5.969000	0.70422	2.811000	0.96726	0.558000	0.71614	CAT		0.557	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251633.1		
HMOX2	3163	broad.mit.edu	37	16	4558052	4558052	+	Silent	SNP	G	G	T	rs200491627		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr16:4558052G>T	ENST00000570646.1	+	4	1148	c.543G>T	c.(541-543)ggG>ggT	p.G181G	HMOX2_ENST00000575120.1_Silent_p.G152G|HMOX2_ENST00000219700.6_Silent_p.G181G|HMOX2_ENST00000406590.2_Silent_p.G181G|HMOX2_ENST00000414777.1_Silent_p.G181G|HMOX2_ENST00000398595.3_Silent_p.G181G|HMOX2_ENST00000458134.3_Silent_p.G181G	NM_002134.3	NP_002125.3	P30519	HMOX2_HUMAN	heme oxygenase (decycling) 2	181					cellular iron ion homeostasis (GO:0006879)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|porphyrin-containing compound metabolic process (GO:0006778)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)	p.G181G(1)		endometrium(1)|large_intestine(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8						CCAGCACAGGGGAAGGGACCC	0.587																																					p.G181G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G543T	16						.						45.0	45.0	45.0					16																	4558052		2197	4300	6497	4498053	SO:0001819	synonymous_variant	3163	exon4				CCDS10517.1, CCDS66931.1, CCDS73818.1	16p13.3	2008-02-05			ENSG00000103415	ENSG00000103415	1.14.99.3		5014	protein-coding gene	gene with protein product		141251				1575508	Standard	NM_002134		Approved	HO-2	uc002cwq.4	P30519	OTTHUMG00000129473	ENST00000570646.1:c.543G>T	16.37:g.4558052G>T		Somatic		Capture	Illumina HiSeq	Phase_I	4498053	NM_002134	A8MT35|D3DUD5|I3L430|O60605	Silent	SNP	ENST00000570646.1	37	CCDS10517.1																																																																																				0.587	HMOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251636.2		
ZNF768	79724	broad.mit.edu	37	16	30536821	30536821	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr16:30536821G>T	ENST00000380412.5	-	2	815	c.640C>A	c.(640-642)Cca>Aca	p.P214T	ZNF768_ENST00000562803.1_Missense_Mutation_p.P183T	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	214					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.P214T(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						TCAAAAGGTGGCCCTATGGGC	0.587																																					p.P214T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C640A	16						.						71.0	78.0	76.0					16																	30536821		2197	4300	6497	30444322	SO:0001583	missense	79724	exon2			BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.640C>A	16.37:g.30536821G>T	ENSP00000369777:p.Pro214Thr	Somatic		Capture	Illumina HiSeq	Phase_I	30444322	NM_024671	Q569L7|Q96CX4	Missense_Mutation	SNP	ENST00000380412.5	37	CCDS10681.2	.	.	.	.	.	.	.	.	.	.	G	2.891	-0.229569	0.06022	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	T	0.07327	3.2	5.18	3.01	0.34805	.	0.155679	0.30602	N	0.009269	T	0.04272	0.0118	N	0.08118	0	0.26253	N	0.978696	B	0.12013	0.005	B	0.10450	0.005	T	0.30707	-0.9969	10	0.87932	D	0	-0.6668	7.2304	0.26038	0.0:0.1527:0.5865:0.2608	.	214	Q9H5H4	ZN768_HUMAN	T	214;183	ENSP00000369777:P214T	ENSP00000369777:P214T	P	-	1	0	ZNF768	30444322	0.697000	0.27767	0.983000	0.44433	0.075000	0.17131	0.815000	0.27253	1.361000	0.45981	0.561000	0.74099	CCA		0.587	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255522.2	NM_024671	
KIFC3	3801	broad.mit.edu	37	16	57805259	57805259	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr16:57805259G>T	ENST00000379655.4	-	6	873	c.616C>A	c.(616-618)Cag>Aag	p.Q206K	KIFC3_ENST00000566975.1_5'Flank|KIFC3_ENST00000543930.1_Missense_Mutation_p.Q67K|KIFC3_ENST00000562903.1_Missense_Mutation_p.Q67K|KIFC3_ENST00000465878.2_Missense_Mutation_p.Q67K|KIFC3_ENST00000541240.1_Missense_Mutation_p.Q228K|KIFC3_ENST00000539578.1_Missense_Mutation_p.Q148K|KIFC3_ENST00000540079.2_Missense_Mutation_p.Q104K|KIFC3_ENST00000421376.2_Missense_Mutation_p.Q67K|KIFC3_ENST00000445690.2_Missense_Mutation_p.Q206K	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	206					ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				GTCTTCTGCTGCACCTCTAGG	0.627																																					p.Q206K												.	.	0			c.C616A	16						.						120.0	111.0	114.0					16																	57805259		2198	4300	6498	56362760	SO:0001583	missense	3801	exon6			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.616C>A	16.37:g.57805259G>T	ENSP00000368976:p.Gln206Lys	None		Capture	Illumina HiSeq	Phase_I	56362760	NM_001130100	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Missense_Mutation	SNP	ENST00000379655.4	37	CCDS10789.2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.343075	0.82022	.	.	ENSG00000140859	ENST00000379655;ENST00000445690;ENST00000421376;ENST00000541240;ENST00000540079;ENST00000543930;ENST00000539578	T;T;T;T;T;T;T	0.74209	-0.76;-0.75;-0.74;-0.76;-0.75;-0.82;-0.75	5.35	5.35	0.76521	.	0.189397	0.46145	D	0.000320	T	0.72581	0.3478	L	0.53249	1.67	0.37301	D	0.908715	P;P;B;P;P;B	0.48089	0.717;0.814;0.391;0.905;0.717;0.335	B;B;B;B;B;B	0.42916	0.227;0.402;0.116;0.392;0.227;0.086	T	0.76451	-0.2954	10	0.35671	T	0.21	.	17.6558	0.88177	0.0:0.0:1.0:0.0	.	228;148;67;104;206;67	B7Z484;F5H4I9;B7Z896;F5H3M2;Q9BVG8;A8K6S2	.;.;.;.;KIFC3_HUMAN;.	K	206;206;67;228;104;67;148	ENSP00000368976:Q206K;ENSP00000401696:Q206K;ENSP00000396399:Q67K;ENSP00000442008:Q228K;ENSP00000438805:Q104K;ENSP00000444012:Q67K;ENSP00000444884:Q148K	ENSP00000368976:Q206K	Q	-	1	0	KIFC3	56362760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.721000	0.54941	2.529000	0.85273	0.655000	0.94253	CAG		0.627	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257329.2	NM_005550	
PHLPP2	23035	broad.mit.edu	37	16	71703183	71703183	+	Silent	SNP	G	G	A	rs186124960		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr16:71703183G>A	ENST00000568954.1	-	11	2001	c.1623C>T	c.(1621-1623)ccC>ccT	p.P541P	PHLPP2_ENST00000356272.3_Silent_p.P541P|PHLPP2_ENST00000567016.1_Silent_p.P576P|PHLPP2_ENST00000393524.2_Silent_p.P541P|PHLPP2_ENST00000360429.3_Silent_p.P541P			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	541					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.P541P(2)		central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						CATACCTCACGGGAACCTCTG	0.383																																					p.P541P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C1623T	16						.						89.0	92.0	91.0					16																	71703183		2198	4300	6498	70260684	SO:0001819	synonymous_variant	23035	exon10			BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.1623C>T	16.37:g.71703183G>A		Somatic		Capture	Illumina HiSeq	Phase_I	70260684	NM_015020	A1L374|Q9NV17|Q9Y2E3	Silent	SNP	ENST00000568954.1	37	CCDS32479.1																																																																																				0.383	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020	
CNTNAP4	85445	broad.mit.edu	37	16	76532520	76532520	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr16:76532520T>C	ENST00000476707.1	+	14	2442	c.2303T>C	c.(2302-2304)gTg>gCg	p.V768A	CNTNAP4_ENST00000478060.1_Missense_Mutation_p.V692A|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.V716A|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.V764A|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	765	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.V692A(1)|p.V764A(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						ACTAAGATCGTGATTACAGAC	0.398																																					p.X765R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2293C	16						.						78.0	74.0	75.0					16																	76532520		2029	4241	6270	75090021	SO:0001583	missense	85445	exon15			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.2303T>C	16.37:g.76532520T>C	ENSP00000417628:p.Val768Ala	Somatic		Capture	Illumina HiSeq	Phase_I	75090021	NM_033401	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	T	16.14	3.037479	0.54896	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	4.93	4.93	0.64822	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	0.000000	0.37623	N	0.002017	T	0.17746	0.0426	.	.	.	0.46149	D	0.998892	B;B;B	0.22746	0.038;0.021;0.074	B;B;B	0.28553	0.049;0.033;0.091	T	0.03193	-1.1062	9	0.42905	T	0.14	.	14.7099	0.69222	0.0:0.0:0.0:1.0	.	692;768;765	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	A	764;716;692;768	ENSP00000306893:V764A;ENSP00000439733:V716A;ENSP00000418741:V692A;ENSP00000417628:V768A	ENSP00000306893:V764A	V	+	2	0	CNTNAP4	75090021	1.000000	0.71417	0.991000	0.47740	0.986000	0.74619	7.806000	0.86020	2.199000	0.70637	0.528000	0.53228	GTG		0.398	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
DNAH9	1770	broad.mit.edu	37	17	11845721	11845721	+	Silent	SNP	T	T	C			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr17:11845721T>C	ENST00000262442.4	+	67	12830	c.12762T>C	c.(12760-12762)gtT>gtC	p.V4254V	DNAH9_ENST00000608377.1_Silent_p.V566V|DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000454412.2_Silent_p.V4178V	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	4254					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.V4254V(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ACATTGTAGTTGCCTTCCAGG	0.527																																					p.V566V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1698C	17						.						128.0	112.0	117.0					17																	11845721		2203	4300	6503	11786446	SO:0001819	synonymous_variant	1770	exon13			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.12762T>C	17.37:g.11845721T>C		Somatic		Capture	Illumina HiSeq	Phase_I	11786446	NM_004662	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																				0.527	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
CDRT1	374286	broad.mit.edu	37	17	15498128	15498128	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr17:15498128C>T	ENST00000395906.3	-	10	1780	c.1781G>A	c.(1780-1782)gGc>gAc	p.G594D	RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.G904D|CDRT1_ENST00000354433.3_Missense_Mutation_p.G94D|CDRT1_ENST00000583965.1_Intron	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	594								p.G94D(2)|p.G594D(2)		endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		CATGACCAGGCCATCAGTGCT	0.562																																					p.G594D												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G1781A	17						.						116.0	112.0	113.0					17																	15498128		2203	4300	6503	15438853	SO:0001583	missense	10626	exon10			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.1781G>A	17.37:g.15498128C>T	ENSP00000379242:p.Gly594Asp	Somatic		Capture	Illumina HiSeq	Phase_I	15438853	NM_006382	O43848|O95611	Missense_Mutation	SNP	ENST00000395906.3	37	CCDS45619.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.31|14.31	2.498678|2.498678	0.44455|0.44455	.|.	.|.	ENSG00000251537|ENSG00000241322;ENSG00000251537;ENSG00000251537	ENST00000455584|ENST00000354433;ENST00000261644;ENST00000395906	.|T;T	.|0.65732	.|-0.17;-0.17	4.99|4.99	4.99|4.99	0.66335|0.66335	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.509310	.|0.17958	.|N	.|0.156266	T|T	0.74764|0.74764	0.3759|0.3759	L|L	0.47016|0.47016	1.485|1.485	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|0.993;1.0	T|T	0.75637|0.75637	-0.3249|-0.3249	5|10	.|0.62326	.|D	.|0.03	.|.	17.201|17.201	0.86906|0.86906	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|594;918	.|O95170;Q59EB2	.|CDRT1_HUMAN;.	T|D	919|94;624;594	.|ENSP00000346416:G94D;ENSP00000379242:G594D	.|ENSP00000346416:G94D	A|G	-|-	1|2	0|0	RP11-385D13.1|CDRT1;RP11-385D13.1	15438853|15438853	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.641000|0.641000	0.38312|0.38312	6.368000|6.368000	0.73104|0.73104	2.595000|2.595000	0.87683|0.87683	0.585000|0.585000	0.79938|0.79938	GCC|GGC		0.562	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448127.1	NM_006382	
COL1A1	1277	broad.mit.edu	37	17	48264043	48264043	+	Missense_Mutation	SNP	T	T	G	rs202131429	byFrequency	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr17:48264043T>G	ENST00000225964.5	-	48	3890	c.3772A>C	c.(3772-3774)Acc>Ccc	p.T1258P		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	1258	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	TCACGGCAGGTGCGGGCGGGG	0.642			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.T1258P			Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	.	0			c.A3772C	17						.																																			45619042	SO:0001583	missense	1277	exon48			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.3772A>C	17.37:g.48264043T>G	ENSP00000225964:p.Thr1258Pro	None		Capture	Illumina HiSeq	Phase_I	45619042	NM_000088	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	37	CCDS11561.1	.	.	.	.	.	.	.	.	.	.	T	16.71	3.197356	0.58126	.	.	ENSG00000108821	ENST00000225964	T	0.76578	-1.03	3.93	3.93	0.45458	Fibrillar collagen, C-terminal (3);	0.000000	0.85682	U	0.000000	D	0.90225	0.6944	H	0.98721	4.31	0.53005	D	0.99996	D	0.59767	0.986	P	0.54629	0.757	D	0.93106	0.6512	10	0.87932	D	0	.	11.885	0.52598	0.0:0.0:0.0:1.0	.	1258	P02452	CO1A1_HUMAN	P	1258	ENSP00000225964:T1258P	ENSP00000225964:T1258P	T	-	1	0	COL1A1	45619042	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.721000	0.84768	1.630000	0.50440	0.260000	0.18958	ACC		0.642	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
COG1	9382	broad.mit.edu	37	17	71202302	71202302	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr17:71202302A>C	ENST00000299886.4	+	11	2600	c.2520A>C	c.(2518-2520)aaA>aaC	p.K840N		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	840					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.K840N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			GAATTGAGAAAGTGACTGACC	0.433																																					p.K840N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2520C	17						.						110.0	99.0	103.0					17																	71202302		2203	4300	6503	68713897	SO:0001583	missense	9382	exon11				CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.2520A>C	17.37:g.71202302A>C	ENSP00000299886:p.Lys840Asn	Somatic		Capture	Illumina HiSeq	Phase_I	68713897	NM_018714	Q9NPV9|Q9P2G6	Missense_Mutation	SNP	ENST00000299886.4	37	CCDS11692.1	.	.	.	.	.	.	.	.	.	.	A	12.28	1.890675	0.33348	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.24538	1.85;1.85	5.4	-2.5	0.06384	.	0.141820	0.64402	N	0.000006	T	0.36441	0.0967	M	0.75264	2.295	0.44719	D	0.997719	P;D;P	0.67145	0.944;0.996;0.944	P;P;P	0.59546	0.587;0.859;0.587	T	0.17837	-1.0356	10	0.46703	T	0.11	-11.7959	6.3562	0.21402	0.3561:0.2515:0.3924:0.0	.	840;840;840	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	N	840	ENSP00000400111:K840N;ENSP00000299886:K840N	ENSP00000299886:K840N	K	+	3	2	COG1	68713897	0.997000	0.39634	0.866000	0.34008	0.876000	0.50452	0.439000	0.21575	-0.436000	0.07254	-0.313000	0.08912	AAA		0.433	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1		
TP53	7157	broad.mit.edu	37	17	7579390	7579393	+	Frame_Shift_Del	DEL	GGAA	GGAA	-			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	GGAA	GGAA	GGAA	-	GGAA	GGAA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr17:7579390_7579393delGGAA	ENST00000269305.4	-	4	483_486	c.294_297delTTCC	c.(292-297)ccttccfs	p.PS98fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.PS98fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.PS98fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.PS98fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.PS98fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.PS98fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	98	Interaction with WWOX.		P -> L (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.S99fs*48(3)|p.S99fs*23(3)|p.Q100fs*37(3)|p.G59fs*23(3)|p.S99F(2)|p.V73fs*9(1)|p.S99P(1)|p.W91fs*13(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.S99fs*24(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGTTTTCTGGGAAGGGACAGAAG	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.98_99del	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	28	Deletion - Frameshift(17)|Whole gene deletion(8)|Substitution - Missense(3)	upper_aerodigestive_tract(4)|ovary(4)|bone(4)|large_intestine(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|breast(2)|pancreas(2)|stomach(1)|liver(1)	c.294_297del	17						.																																			7520118	SO:0001589	frameshift_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.294_297delTTCC	17.37:g.7579390_7579393delGGAA	ENSP00000269305:p.Pro98fs	Somatic		Capture	Illumina HiSeq	Phase_I	7520115	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																				0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
RNF213	57674	broad.mit.edu	37	17	78320948	78320948	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr17:78320948C>T	ENST00000582970.1	+	29	8956	c.8813C>T	c.(8812-8814)gCc>gTc	p.A2938V	RNF213_ENST00000336301.6_Missense_Mutation_p.A1011V|RNF213_ENST00000508628.2_Missense_Mutation_p.A2987V	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2938					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TTTGCCAAAGCCTACGAAACG	0.527																																					p.A2987V												.	.	0			c.C8960T	17						.						57.0	46.0	50.0					17																	78320948		2203	4300	6503	75935543	SO:0001583	missense	57674	exon30			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.8813C>T	17.37:g.78320948C>T	ENSP00000464087:p.Ala2938Val	None		Capture	Illumina HiSeq	Phase_I	75935543	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.781755	0.31502	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.30182	1.54	5.82	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.51686	0.1689	M	0.78916	2.43	0.44261	D	0.997113	P	0.46859	0.885	P	0.55260	0.772	T	0.55373	-0.8151	10	0.66056	D	0.02	.	16.3949	0.83601	0.0:0.8684:0.1316:0.0	.	1011	Q63HN8	RN213_HUMAN	V	2938;2987;1011	ENSP00000338218:A1011V	ENSP00000338218:A1011V	A	+	2	0	RNF213	75935543	1.000000	0.71417	0.987000	0.45799	0.157000	0.22087	4.820000	0.62671	2.751000	0.94390	0.563000	0.77884	GCC		0.527	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
EMILIN2	84034	broad.mit.edu	37	18	2891866	2891866	+	Missense_Mutation	SNP	C	C	A	rs139273490	byFrequency	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr18:2891866C>A	ENST00000254528.3	+	4	1900	c.1741C>A	c.(1741-1743)Cac>Aac	p.H581N		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	581					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		CGACAGCCTGCACCTTTTGAA	0.463																																					p.H581N												.	.	0			c.C1741A	18						.						58.0	56.0	57.0					18																	2891866		2203	4300	6503	2881866	SO:0001583	missense	84034	exon4			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.1741C>A	18.37:g.2891866C>A	ENSP00000254528:p.His581Asn	None		Capture	Illumina HiSeq	Phase_I	2881866	NM_032048	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	C	6.673	0.492758	0.12702	.	.	ENSG00000132205	ENST00000254528	T	0.34472	1.36	5.48	-1.41	0.08941	.	1.694010	0.02247	N	0.066298	T	0.17577	0.0422	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.08576	-1.0715	10	0.17369	T	0.5	-1.8407	1.2905	0.02059	0.3261:0.3186:0.226:0.1293	.	581	Q9BXX0	EMIL2_HUMAN	N	581	ENSP00000254528:H581N	ENSP00000254528:H581N	H	+	1	0	EMILIN2	2881866	0.000000	0.05858	0.002000	0.10522	0.030000	0.12068	0.005000	0.13129	0.062000	0.16340	0.563000	0.77884	CAC		0.463	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
DSEL	92126	broad.mit.edu	37	18	65180277	65180277	+	Silent	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr18:65180277C>T	ENST00000310045.7	-	2	3072	c.1599G>A	c.(1597-1599)gcG>gcA	p.A533A	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	523					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.A533A(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TAAGCCACTGCGCACATTCTC	0.512																																					p.A533A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1599A	18						.						88.0	77.0	81.0					18																	65180277		2203	4300	6503	63331257	SO:0001819	synonymous_variant	92126	exon2			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1599G>A	18.37:g.65180277C>T		Somatic		Capture	Illumina HiSeq	Phase_I	63331257	NM_032160	Q17RH1|Q6P5Z3	Silent	SNP	ENST00000310045.7	37	CCDS11995.1																																																																																				0.512	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
ZNF407	55628	broad.mit.edu	37	18	72347442	72347442	+	Silent	SNP	C	C	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr18:72347442C>A	ENST00000299687.5	+	1	4467	c.4467C>A	c.(4465-4467)gtC>gtA	p.V1489V	ZNF407_ENST00000309902.6_Silent_p.V1489V|ZNF407_ENST00000582337.1_Silent_p.V1489V|ZNF407_ENST00000577538.1_Silent_p.V1489V	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V1489V(1)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TTAAATGTGTCAAGTGCACAG	0.473																																					p.V1489V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4467A	18						.						47.0	50.0	49.0					18																	72347442		1880	4121	6001	70476430	SO:0001819	synonymous_variant	55628	exon1			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.4467C>A	18.37:g.72347442C>A		Somatic		Capture	Illumina HiSeq	Phase_I	70476430	NM_001146190	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Silent	SNP	ENST00000299687.5	37	CCDS45885.1																																																																																				0.473	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
GPR32	2854	broad.mit.edu	37	19	51274669	51274669	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr19:51274669C>T	ENST00000270590.4	+	1	949	c.812C>T	c.(811-813)cCg>cTg	p.P271L		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	271					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.P271L(1)		breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		TTCTGGTCCCCGTTTAACGTG	0.597																																					p.P271L	Esophageal Squamous(113;152 1581 5732 15840 44398)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C812T	19						.						86.0	87.0	86.0					19																	51274669		2203	4300	6503	55966481	SO:0001583	missense	2854	exon1			AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.812C>T	19.37:g.51274669C>T	ENSP00000270590:p.Pro271Leu	Somatic		Capture	Illumina HiSeq	Phase_I	55966481	NM_001506	Q502U7|Q6NWS5	Missense_Mutation	SNP	ENST00000270590.4	37	CCDS12801.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898547	0.52227	.	.	ENSG00000142511	ENST00000270590	T	0.79845	-1.31	2.56	1.48	0.22813	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.89375	0.6697	M	0.91196	3.185	0.52501	D	0.999954	D	0.89917	1.0	D	0.72982	0.979	D	0.87618	0.2508	9	0.87932	D	0	.	7.6623	0.28410	0.0:0.8545:0.0:0.1455	.	271	O75388	GPR32_HUMAN	L	271	ENSP00000270590:P271L	ENSP00000270590:P271L	P	+	2	0	GPR32	55966481	0.994000	0.37717	0.374000	0.26016	0.650000	0.38633	3.309000	0.51903	0.352000	0.24053	0.313000	0.20887	CCG		0.597	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
SIGLEC14	100049587	broad.mit.edu	37	19	52149213	52149213	+	Silent	SNP	T	T	G			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr19:52149213T>G	ENST00000360844.6	-	3	563	c.522A>C	c.(520-522)ccA>ccC	p.P174P	SIGLEC5_ENST00000534261.2_5'Flank|SIGLEC5_ENST00000222107.4_Intron|SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000429354.3_Intron	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	174	Ig-like C2-type 1.				cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.P174P(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		ATGTGAGAGGTGGTCCCGCTT	0.652																																					p.P174P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A522C	19						.						5.0	6.0	6.0					19																	52149213		1874	3883	5757	56841025	SO:0001819	synonymous_variant	100049587	exon3			AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.522A>C	19.37:g.52149213T>G		Somatic		Capture	Illumina HiSeq	Phase_I	56841025	NM_001098612	Q6UXG0	Silent	SNP	ENST00000360844.6	37	CCDS42604.1																																																																																				0.652	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466899.2	NM_001098612	
OR7D2	162998	broad.mit.edu	37	19	9297386	9297386	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr19:9297386C>T	ENST00000344248.2	+	1	1108	c.929C>T	c.(928-930)tCt>tTt	p.S310F		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	310					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S310F(1)		breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						AGGGCAGCCTCTTGTTTGTGA	0.453																																					p.S310F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C929T	19						.						34.0	36.0	35.0					19																	9297386		2200	4298	6498	9158386	SO:0001583	missense	162998	exon1			AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.929C>T	19.37:g.9297386C>T	ENSP00000345563:p.Ser310Phe	Somatic		Capture	Illumina HiSeq	Phase_I	9158386	NM_175883	Q6IFJ7|Q8N133	Missense_Mutation	SNP	ENST00000344248.2	37	CCDS32900.1	.	.	.	.	.	.	.	.	.	.	C	4.216	0.038847	0.08148	.	.	ENSG00000188000	ENST00000344248	T	0.02197	4.4	1.73	0.666	0.17901	.	0.708972	0.11465	U	0.561322	T	0.01765	0.0056	N	0.24115	0.695	0.09310	N	1	B	0.12630	0.006	B	0.16289	0.015	T	0.45659	-0.9246	10	0.56958	D	0.05	.	4.2888	0.10867	0.0:0.7898:0.0:0.2102	.	310	Q96RA2	OR7D2_HUMAN	F	310	ENSP00000345563:S310F	ENSP00000345563:S310F	S	+	2	0	OR7D2	9158386	.	.	0.001000	0.08648	0.000000	0.00434	.	.	0.317000	0.23160	-0.422000	0.05995	TCT		0.453	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449002.1		
ZNF583	147949	broad.mit.edu	37	19	56935705	56935705	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr19:56935705C>A	ENST00000333201.9	+	5	1888	c.1678C>A	c.(1678-1680)Cag>Aag	p.Q560K	ZNF583_ENST00000291598.7_Missense_Mutation_p.Q560K|ZNF583_ENST00000585612.1_Intron	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	560					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q560K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		cacatcaaatcagttgccaag	0.423																																					p.Q560K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1678A	19						.						66.0	63.0	64.0					19																	56935705		2203	4300	6503	61627517	SO:0001583	missense	147949	exon5			AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.1678C>A	19.37:g.56935705C>A	ENSP00000388502:p.Gln560Lys	Somatic		Capture	Illumina HiSeq	Phase_I	61627517	NM_001159860	O14850|Q2NKK3	Missense_Mutation	SNP	ENST00000333201.9	37	CCDS12943.1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.186841	0.38609	.	.	ENSG00000198440	ENST00000291598;ENST00000333201	T;T	0.04603	3.59;3.59	4.64	3.61	0.41365	.	0.582086	0.14406	N	0.321546	T	0.02418	0.0074	N	0.08118	0	0.27588	N	0.949368	B	0.27823	0.19	B	0.19666	0.026	T	0.42050	-0.9474	9	.	.	.	.	8.0192	0.30400	0.0:0.8918:0.0:0.1082	.	560	Q96ND8	ZN583_HUMAN	K	560	ENSP00000291598:Q560K;ENSP00000388502:Q560K	.	Q	+	1	0	ZNF583	61627517	0.000000	0.05858	0.952000	0.39060	0.980000	0.70556	0.106000	0.15354	2.574000	0.86865	0.650000	0.86243	CAG		0.423	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478	
EXOSC10	5394	broad.mit.edu	37	1	11137497	11137497	+	Silent	SNP	A	A	G			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr1:11137497A>G	ENST00000376936.4	-	16	1853	c.1804T>C	c.(1804-1806)Ttg>Ctg	p.L602L	EXOSC10_ENST00000544779.1_Missense_Mutation_p.I654T|EXOSC10_ENST00000304457.7_Silent_p.L602L	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	602					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L602L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		ACATTCTCCAATCTCTGCATT	0.537																																					p.L602L	Colon(179;105 1987 14326 27364 29542)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1804C	1						.						77.0	78.0	78.0					1																	11137497		2203	4300	6503	11060084	SO:0001819	synonymous_variant	5394	exon16			BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.1804T>C	1.37:g.11137497A>G		Somatic		Capture	Illumina HiSeq	Phase_I	11060084	NM_001001998	B1AKQ0|B1AKQ1|Q15158	Silent	SNP	ENST00000376936.4	37	CCDS30584.1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.419699	0.42918	.	.	ENSG00000171824	ENST00000544779	.	.	.	5.44	-0.285	0.12866	.	.	.	.	.	T	0.14657	0.0354	.	.	.	0.19775	N	0.999956	.	.	.	.	.	.	T	0.29088	-1.0023	5	0.10636	T	0.68	-16.2948	4.2566	0.10721	0.3528:0.0:0.3755:0.2717	.	.	.	.	T	654	.	ENSP00000439473:I654T	I	-	2	0	EXOSC10	11060084	0.988000	0.35896	0.969000	0.41365	0.989000	0.77384	1.174000	0.31932	0.125000	0.18397	-0.250000	0.11733	ATT		0.537	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006078.1	NM_001001998	
KCNA2	3737	broad.mit.edu	37	1	111146932	111146932	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr1:111146932C>G	ENST00000485317.1	-	3	1146	c.473G>C	c.(472-474)aGc>aCc	p.S158T	KCNA2_ENST00000316361.4_Missense_Mutation_p.S158T|KCNA2_ENST00000369770.3_Missense_Mutation_p.S158T|KCNA2_ENST00000440270.1_Missense_Mutation_p.S158T|KCNA2_ENST00000525120.1_Intron			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	158					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.S158T(1)		endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	AGGCCCTGAGCTCTCTGGGTA	0.473																																					p.S158T	Pancreas(18;568 735 10587 23710 36357)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G473C	1						.						65.0	68.0	67.0					1																	111146932		2203	4300	6503	110948455	SO:0001583	missense	3737	exon2			L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.473G>C	1.37:g.111146932C>G	ENSP00000433109:p.Ser158Thr	Somatic		Capture	Illumina HiSeq	Phase_I	110948455	NM_004974	Q86XG6	Missense_Mutation	SNP	ENST00000485317.1	37	CCDS827.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452718	0.63290	.	.	ENSG00000177301	ENST00000369770;ENST00000485317;ENST00000440270;ENST00000316361	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.75845	0.3905	M	0.78916	2.43	0.80722	D	1	P;D	0.60160	0.502;0.987	B;D	0.71414	0.197;0.973	T	0.71321	-0.4628	10	0.32370	T	0.25	.	20.0697	0.97716	0.0:1.0:0.0:0.0	.	158;158	Q86XG6;P16389	.;KCNA2_HUMAN	T	158	ENSP00000358785:S158T;ENSP00000433109:S158T;ENSP00000415257:S158T;ENSP00000314520:S158T	ENSP00000314520:S158T	S	-	2	0	KCNA2	110948455	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.757000	0.85209	2.751000	0.94390	0.609000	0.83330	AGC		0.473	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128001.2	NM_004974	
ATP1A4	480	broad.mit.edu	37	1	160143412	160143412	+	Silent	SNP	C	C	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr1:160143412C>A	ENST00000368081.4	+	13	2367	c.1896C>A	c.(1894-1896)gcC>gcA	p.A632A	ATP1A4_ENST00000418334.1_3'UTR	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	632					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.A632A(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CAGCTAAGGCCATTGCCAAGG	0.542																																					p.A632A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1896A	1						.						155.0	129.0	138.0					1																	160143412		2203	4300	6503	158410036	SO:0001819	synonymous_variant	480	exon13			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1896C>A	1.37:g.160143412C>A		Somatic		Capture	Illumina HiSeq	Phase_I	158410036	NM_144699	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	ENST00000368081.4	37	CCDS1197.1																																																																																				0.542	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
ITLN2	142683	broad.mit.edu	37	1	160914939	160914939	+	Silent	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr1:160914939G>A	ENST00000368029.3	-	8	1026	c.969C>T	c.(967-969)ttC>ttT	p.F323F	RP11-544M22.1_ENST00000356006.3_RNA|ITLN2_ENST00000494442.1_5'UTR	NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	323						extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.F323F(1)		endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CTCATCTATAGAACAAGAGTA	0.527																																					p.F323F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C969T	1						.						60.0	54.0	56.0					1																	160914939		2203	4300	6503	159181563	SO:0001819	synonymous_variant	142683	exon8			AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.969C>T	1.37:g.160914939G>A		Somatic		Capture	Illumina HiSeq	Phase_I	159181563	NM_080878	Q17RR2|Q5VYI0	Silent	SNP	ENST00000368029.3	37	CCDS1212.1																																																																																				0.527	ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071465.1	NM_080878	
TNN	63923	broad.mit.edu	37	1	175087943	175087943	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr1:175087943A>G	ENST00000239462.4	+	11	2746	c.2633A>G	c.(2632-2634)gAc>gGc	p.D878G		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	878	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.D878G(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		AAGAAGGCTGACACCAAGGCC	0.562																																					p.D878G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2633G	1						.						62.0	54.0	57.0					1																	175087943		2203	4300	6503	173354566	SO:0001583	missense	63923	exon11			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2633A>G	1.37:g.175087943A>G	ENSP00000239462:p.Asp878Gly	Somatic		Capture	Illumina HiSeq	Phase_I	173354566	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	A	7.447	0.641813	0.14451	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.26223	1.75	5.01	5.01	0.66863	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.719385	0.14372	N	0.323719	T	0.26702	0.0653	M	0.65677	2.01	0.24664	N	0.993455	B	0.25563	0.129	B	0.29524	0.103	T	0.19128	-1.0315	10	0.31617	T	0.26	.	6.0043	0.19537	0.7838:0.0:0.2162:0.0	.	878	Q9UQP3	TENN_HUMAN	G	878;701	ENSP00000239462:D878G	ENSP00000239462:D878G	D	+	2	0	TNN	173354566	0.384000	0.25164	0.998000	0.56505	0.805000	0.45488	1.867000	0.39499	2.001000	0.58596	0.260000	0.18958	GAC		0.562	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
SRSF4	6429	broad.mit.edu	37	1	29475721	29475721	+	Missense_Mutation	SNP	C	C	T	rs539657602		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr1:29475721C>T	ENST00000373795.4	-	6	920	c.686G>A	c.(685-687)cGg>cAg	p.R229Q	SRSF4_ENST00000466448.1_5'UTR|RP11-242O24.3_ENST00000413004.1_lincRNA|SRSF4_ENST00000546138.1_Silent_p.P127P	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	229	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R229Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						gctcTTGCTCCGGGAGCGGGA	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		15164	0.0		0.001	False		,,,				2504	0.0				p.R229Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G686A	1						.						23.0	31.0	28.0					1																	29475721		2167	4217	6384	29348308	SO:0001583	missense	6429	exon6			BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.686G>A	1.37:g.29475721C>T	ENSP00000362900:p.Arg229Gln	Somatic		Capture	Illumina HiSeq	Phase_I	29348308	NM_005626	Q5VXP1|Q9BUA4|Q9UEB5	Missense_Mutation	SNP	ENST00000373795.4	37	CCDS333.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.890863	0.52014	.	.	ENSG00000116350	ENST00000373795;ENST00000434636	T	0.61510	0.1	5.77	4.83	0.62350	.	0.414254	0.24638	N	0.036823	T	0.52386	0.1731	L	0.54323	1.7	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.50083	-0.8869	10	0.48119	T	0.1	.	11.9483	0.52940	0.0:0.9118:0.0:0.0882	.	229	Q08170	SRSF4_HUMAN	Q	229	ENSP00000362900:R229Q	ENSP00000362900:R229Q	R	-	2	0	SRSF4	29348308	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.094000	0.41719	1.343000	0.45638	0.655000	0.94253	CGG		0.567	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626	
HECTD3	79654	broad.mit.edu	37	1	45473240	45473240	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr1:45473240G>A	ENST00000372172.4	-	10	1419	c.1348C>T	c.(1348-1350)Cgc>Tgc	p.R450C	HECTD3_ENST00000372168.3_Missense_Mutation_p.R60C|HECTD3_ENST00000486132.1_5'Flank	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3	450					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R60C(1)|p.R450C(1)|p.R166C(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					GGCCGCTGGCGGGACAGCAGT	0.612																																					p.R450C												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C1348T	1						.						47.0	50.0	49.0					1																	45473240		2098	4223	6321	45245827	SO:0001583	missense	79654	exon10			BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.1348C>T	1.37:g.45473240G>A	ENSP00000361245:p.Arg450Cys	Somatic		Capture	Illumina HiSeq	Phase_I	45245827	NM_024602	B3KPV7|B3KRH4|Q5T448|Q9H783	Missense_Mutation	SNP	ENST00000372172.4	37	CCDS41318.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449956	0.84101	.	.	ENSG00000126107	ENST00000372172;ENST00000372168	T;T	0.60299	0.2;0.47	5.19	5.19	0.71726	.	0.359655	0.31554	N	0.007458	T	0.50667	0.1629	N	0.19112	0.55	0.53688	D	0.999979	D;D	0.65815	0.993;0.995	P;P	0.50708	0.548;0.648	T	0.55095	-0.8194	10	0.72032	D	0.01	.	11.6624	0.51354	0.0:0.0:0.7026:0.2974	.	450;60	Q5T447;Q5T447-2	HECD3_HUMAN;.	C	450;60	ENSP00000361245:R450C;ENSP00000361241:R60C	ENSP00000361241:R60C	R	-	1	0	HECTD3	45245827	1.000000	0.71417	0.996000	0.52242	0.936000	0.57629	5.165000	0.64959	2.686000	0.91538	0.655000	0.94253	CGC		0.612	HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023734.1	NM_024602	
ST6GALNAC5	81849	broad.mit.edu	37	1	77509953	77509953	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr1:77509953G>A	ENST00000477717.1	+	3	561	c.326G>A	c.(325-327)cGg>cAg	p.R109Q		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	109					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)	p.R109Q(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						CTGCACAGTCGGCAAGGCTCC	0.622																																					p.R109Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G326A	1						.						55.0	49.0	51.0					1																	77509953		2203	4300	6503	77282541	SO:0001583	missense	81849	exon3				CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.326G>A	1.37:g.77509953G>A	ENSP00000417583:p.Arg109Gln	Somatic		Capture	Illumina HiSeq	Phase_I	77282541	NM_030965	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	37	CCDS673.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.456995	0.26161	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.29142	1.58	5.72	-3.59	0.04583	.	0.928775	0.09228	N	0.830926	T	0.05502	0.0145	L	0.31371	0.925	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.41413	-0.9510	10	0.15066	T	0.55	-20.3949	5.7534	0.18160	0.5328:0.0:0.2542:0.2131	.	109	Q9BVH7	SIA7E_HUMAN	Q	109;19	ENSP00000417583:R109Q	ENSP00000436263:R109Q	R	+	2	0	ST6GALNAC5	77282541	0.000000	0.05858	0.655000	0.29622	0.694000	0.40290	0.578000	0.23773	-0.194000	0.10399	-0.345000	0.07892	CGG		0.622	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
CRB1	23418	broad.mit.edu	37	1	197313588	197313588	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr1:197313588G>T	ENST00000367400.3	+	3	965	c.830G>T	c.(829-831)tGt>tTt	p.C277F	CRB1_ENST00000543483.1_5'UTR|CRB1_ENST00000367399.2_Intron|CRB1_ENST00000535699.1_Missense_Mutation_p.C208F|CRB1_ENST00000538660.1_Missense_Mutation_p.C277F	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	277	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GGAGGGCTGTGTGTGGATGGA	0.498																																					p.C277F												.	.	0			c.G830T	1						.						205.0	181.0	189.0					1																	197313588		2203	4300	6503	195580211	SO:0001583	missense	23418	exon3				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.830G>T	1.37:g.197313588G>T	ENSP00000356370:p.Cys277Phe	None		Capture	Illumina HiSeq	Phase_I	195580211	NM_201253	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600999	0.66332	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400	T;T;T	0.65549	-0.16;-0.16;-0.16	5.25	5.25	0.73442	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.88716	0.6512	H	0.99312	4.51	0.80722	D	1	D;D;D;D	0.89917	0.999;0.994;0.999;1.0	D;D;D;D	0.97110	0.997;0.916;0.996;1.0	D	0.93648	0.6970	9	0.87932	D	0	.	18.8316	0.92143	0.0:0.0:1.0:0.0	.	277;208;277;302	B7Z5T2;F5H0L2;P82279;Q59H36	.;.;CRUM1_HUMAN;.	F	208;277;277	ENSP00000438786:C208F;ENSP00000438091:C277F;ENSP00000356370:C277F	ENSP00000356370:C277F	C	+	2	0	CRB1	195580211	1.000000	0.71417	0.698000	0.30274	0.658000	0.38924	9.174000	0.94824	2.434000	0.82447	0.650000	0.86243	TGT		0.498	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
SAMHD1	25939	broad.mit.edu	37	20	35575184	35575184	+	Silent	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr20:35575184G>A	ENST00000262878.4	-	2	431	c.232C>T	c.(232-234)Ctg>Ttg	p.L78L	SAMHD1_ENST00000373694.5_5'UTR	NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	78	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.L78L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				AGACAAGGCAGTAATGCGCCT	0.318																																					p.L78L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C232T	20						.						81.0	79.0	80.0					20																	35575184		2203	4300	6503	35008598	SO:0001819	synonymous_variant	25939	exon2			AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.232C>T	20.37:g.35575184G>A		Somatic		Capture	Illumina HiSeq	Phase_I	35008598	NM_015474	B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Silent	SNP	ENST00000262878.4	37	CCDS13288.1																																																																																				0.318	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079062.2	NM_015474	
R3HDML	140902	broad.mit.edu	37	20	42972129	42972129	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr20:42972129A>G	ENST00000217043.2	+	3	665	c.493A>G	c.(493-495)Acc>Gcc	p.T165A	Y_RNA_ENST00000364493.1_RNA	NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	165	SCP.					extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)	p.T165A(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			CGATGGCCCCACCTGCTCCCA	0.567																																					p.T165A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A493G	20						.						83.0	63.0	70.0					20																	42972129		2203	4300	6503	42405543	SO:0001583	missense	140902	exon3			BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.493A>G	20.37:g.42972129A>G	ENSP00000217043:p.Thr165Ala	Somatic		Capture	Illumina HiSeq	Phase_I	42405543	NM_178491		Missense_Mutation	SNP	ENST00000217043.2	37	CCDS13329.1	.	.	.	.	.	.	.	.	.	.	A	9.063	0.994892	0.19043	.	.	ENSG00000101074	ENST00000217043	T	0.07567	3.18	5.09	4.13	0.48395	CAP domain (3);	0.221447	0.36444	N	0.002585	T	0.04907	0.0132	N	0.04705	-0.18	0.25742	N	0.985158	B	0.02656	0.0	B	0.04013	0.001	T	0.32981	-0.9886	10	0.51188	T	0.08	.	12.7813	0.57479	0.0822:0.0:0.9177:0.0	.	165	Q9H3Y0	CRSPL_HUMAN	A	165	ENSP00000217043:T165A	ENSP00000217043:T165A	T	+	1	0	R3HDML	42405543	0.490000	0.26012	0.522000	0.27862	0.001000	0.01503	0.998000	0.29744	1.240000	0.43803	-0.248000	0.11899	ACC		0.567	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079344.1	NM_178491	
NCOA3	8202	broad.mit.edu	37	20	46268698	46268698	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr20:46268698G>A	ENST00000371998.3	+	16	3174	c.2983G>A	c.(2983-2985)Gct>Act	p.A995T	NCOA3_ENST00000371997.3_Missense_Mutation_p.A990T|NCOA3_ENST00000341724.6_Missense_Mutation_p.A925T|NCOA3_ENST00000372004.3_Missense_Mutation_p.A995T			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	995					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.A995T(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GGGAATGGGGGCTAATCCCTA	0.463																																					p.A995T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2983A	20						.						88.0	78.0	81.0					20																	46268698		2203	4300	6503	45702105	SO:0001583	missense	8202	exon16			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.2983G>A	20.37:g.46268698G>A	ENSP00000361066:p.Ala995Thr	Somatic		Capture	Illumina HiSeq	Phase_I	45702105	NM_001174087	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	37	CCDS13407.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.096898	0.37048	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.02015	4.5;4.68;4.68;4.5	5.9	3.98	0.46160	.	0.508675	0.19326	N	0.117006	T	0.01421	0.0046	N	0.08118	0	0.18873	N	0.999988	B;B;B;B;B;B	0.18968	0.019;0.005;0.019;0.019;0.032;0.019	B;B;B;B;B;B	0.22152	0.017;0.007;0.028;0.017;0.038;0.017	T	0.49790	-0.8902	10	0.17832	T	0.49	-5.367	7.9077	0.29771	0.1216:0.0:0.7467:0.1317	.	995;990;999;995;995;995	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	T	995;925;995;995;990	ENSP00000342123:A925T;ENSP00000361073:A995T;ENSP00000361066:A995T;ENSP00000361065:A990T	ENSP00000345671:A995T	A	+	1	0	NCOA3	45702105	1.000000	0.71417	0.861000	0.33841	0.795000	0.44927	3.647000	0.54403	0.847000	0.35167	-0.471000	0.05019	GCT		0.463	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
LTN1	26046	broad.mit.edu	37	21	30313616	30313616	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr21:30313616C>A	ENST00000361371.5	-	25	4487	c.4408G>T	c.(4408-4410)Gac>Tac	p.D1470Y	LTN1_ENST00000389194.2_Missense_Mutation_p.D1516Y			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	1470					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.D1470Y(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TAACAGAAGTCTTCACTCAGT	0.363																																					p.D1516Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4546T	21						.						139.0	136.0	137.0					21																	30313616		2203	4300	6503	29235487	SO:0001583	missense	26046	exon25			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.4408G>T	21.37:g.30313616C>A	ENSP00000354977:p.Asp1470Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	29235487	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	37		.	.	.	.	.	.	.	.	.	.	C	19.15	3.771072	0.69992	.	.	ENSG00000198862	ENST00000389194;ENST00000361371	T;T	0.19532	2.14;2.15	5.25	5.25	0.73442	.	0.096901	0.64402	D	0.000001	T	0.14141	0.0342	N	0.08118	0	0.80722	D	1	P	0.51653	0.947	B	0.41374	0.355	T	0.08513	-1.0718	10	0.62326	D	0.03	.	19.0339	0.92970	0.0:1.0:0.0:0.0	.	1470	O94822	LTN1_HUMAN	Y	1516;1470	ENSP00000373846:D1516Y;ENSP00000354977:D1470Y	ENSP00000354977:D1470Y	D	-	1	0	LTN1	29235487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.794000	0.75135	2.724000	0.93272	0.655000	0.94253	GAC		0.363	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
C22orf42	150297	broad.mit.edu	37	22	32546332	32546332	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr22:32546332G>A	ENST00000382097.3	-	7	700	c.628C>T	c.(628-630)Ctt>Ttt	p.L210F	C22orf42_ENST00000490640.1_5'Flank	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	210								p.L210F(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						AGGTCTTCAAGAGAGACAGAT	0.413																																					p.L210F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C628T	22						.						135.0	126.0	129.0					22																	32546332		2203	4300	6503	30876332	SO:0001583	missense	150297	exon7			BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.628C>T	22.37:g.32546332G>A	ENSP00000371529:p.Leu210Phe	Somatic		Capture	Illumina HiSeq	Phase_I	30876332	NM_001010859	A4QPH5	Missense_Mutation	SNP	ENST00000382097.3	37	CCDS33639.1	.	.	.	.	.	.	.	.	.	.	g	5.845	0.340110	0.11069	.	.	ENSG00000205856	ENST00000382097	T	0.47528	0.84	0.401	0.401	0.16338	.	.	.	.	.	T	0.38054	0.1026	N	0.08118	0	0.09310	N	1	P	0.47106	0.89	P	0.54965	0.765	T	0.27673	-1.0067	8	0.87932	D	0	.	.	.	.	.	210	Q6IC83	CV042_HUMAN	F	210	ENSP00000371529:L210F	ENSP00000371529:L210F	L	-	1	0	C22orf42	30876332	0.001000	0.12720	0.005000	0.12908	0.066000	0.16364	-0.434000	0.06939	0.474000	0.27392	0.173000	0.16961	CTT		0.413	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075268.2	NM_001010859	
PKDREJ	10343	broad.mit.edu	37	22	46653548	46653548	+	Missense_Mutation	SNP	C	C	A	rs140054875		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr22:46653548C>A	ENST00000253255.5	-	1	5671	c.5672G>T	c.(5671-5673)cGg>cTg	p.R1891L		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1891					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		GGAATTAAACCGCTGCTGTTC	0.403																																					p.R1891L												.	.	0			c.G5672T	22						.						107.0	113.0	111.0					22																	46653548		2203	4300	6503	45032212	SO:0001583	missense	10343	exon1			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.5672G>T	22.37:g.46653548C>A	ENSP00000253255:p.Arg1891Leu	None		Capture	Illumina HiSeq	Phase_I	45032212	NM_006071	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	C	3.029	-0.199993	0.06219	.	.	ENSG00000130943	ENST00000253255	T	0.69806	-0.43	5.55	-0.663	0.11410	Polycystin cation channel, PKD1/PKD2 (1);	0.932158	0.09015	N	0.860941	T	0.48314	0.1493	L	0.29908	0.895	0.09310	N	0.999997	B	0.02656	0.0	B	0.06405	0.002	T	0.30446	-0.9978	10	0.38643	T	0.18	-4.2806	3.8289	0.08865	0.2658:0.3027:0.0:0.4315	.	1891	Q9NTG1	PKDRE_HUMAN	L	1891	ENSP00000253255:R1891L	ENSP00000253255:R1891L	R	-	2	0	PKDREJ	45032212	0.005000	0.15991	0.993000	0.49108	0.013000	0.08279	-1.187000	0.03067	-0.194000	0.10399	-1.632000	0.00781	CGG		0.403	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
DPP10	57628	broad.mit.edu	37	2	116101455	116101455	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr2:116101455G>T	ENST00000410059.1	+	3	718	c.238G>T	c.(238-240)Gtg>Ttg	p.V80L	DPP10_ENST00000310323.8_Missense_Mutation_p.V73L|DPP10_ENST00000393147.2_Missense_Mutation_p.V84L|DPP10_ENST00000409163.1_Missense_Mutation_p.V30L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	80						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.V73L(1)|p.V80L(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GAAAGACTTTGTGCTTCACGA	0.328																																					p.V30L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G88T	2						.						91.0	93.0	92.0					2																	116101455		2203	4300	6503	115817925	SO:0001583	missense	57628	exon4			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.238G>T	2.37:g.116101455G>T	ENSP00000386565:p.Val80Leu	Somatic		Capture	Illumina HiSeq	Phase_I	115817925	NM_001178036	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.836296	0.32421	.	.	ENSG00000175497	ENST00000436732;ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000419287;ENST00000476155	T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01	5.97	4.14	0.48551	.	0.678579	0.14556	N	0.312347	T	0.17959	0.0431	N	0.01874	-0.695	0.27503	N	0.951924	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.08055	0.003;0.001;0.001;0.001	T	0.13791	-1.0496	10	0.41790	T	0.15	-30.0935	8.0602	0.30629	0.0839:0.1598:0.7563:0.0	.	73;84;76;80	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	L	30;80;30;76;84;73;30;30	ENSP00000391092:V30L;ENSP00000386565:V80L;ENSP00000387038:V30L;ENSP00000376854:V76L;ENSP00000376855:V84L;ENSP00000309066:V73L;ENSP00000402499:V30L	ENSP00000309066:V73L	V	+	1	0	DPP10	115817925	0.987000	0.35691	0.994000	0.49952	0.988000	0.76386	0.711000	0.25764	0.835000	0.34877	0.585000	0.79938	GTG		0.328	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
LRP2	4036	broad.mit.edu	37	2	170031768	170031768	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr2:170031768G>A	ENST00000263816.3	-	55	10988	c.10703C>T	c.(10702-10704)cCg>cTg	p.P3568L	LRP2_ENST00000461418.1_5'Flank	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3568	LDL-receptor class A 27. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.P3568L(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TAAAGTCTGCGGGCTGGTGCA	0.532																																					p.P3568L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C10703T	2						.						76.0	77.0	77.0					2																	170031768		2203	4300	6503	169740014	SO:0001583	missense	4036	exon55				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10703C>T	2.37:g.170031768G>A	ENSP00000263816:p.Pro3568Leu	Somatic		Capture	Illumina HiSeq	Phase_I	169740014	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.309920	0.81247	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.95238	-3.65	5.71	5.71	0.89125	.	0.432079	0.26955	N	0.021654	D	0.94798	0.8320	N	0.25485	0.75	0.80722	D	1	D	0.71674	0.998	P	0.60789	0.879	D	0.95158	0.8279	10	0.59425	D	0.04	.	19.8706	0.96849	0.0:0.0:1.0:0.0	.	3568	P98164	LRP2_HUMAN	L	3568;263	ENSP00000263816:P3568L	ENSP00000263816:P3568L	P	-	2	0	LRP2	169740014	1.000000	0.71417	0.304000	0.25085	0.207000	0.24258	9.869000	0.99810	2.691000	0.91804	0.563000	0.77884	CCG		0.532	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TTN	7273	broad.mit.edu	37	2	179408003	179408003	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr2:179408003G>A	ENST00000591111.1	-	297	91998	c.91774C>T	c.(91774-91776)Cga>Tga	p.R30592*	RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.R23360*|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.R32233*|TTN_ENST00000342992.6_Nonsense_Mutation_p.R29665*|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.R23293*|TTN_ENST00000460472.2_Nonsense_Mutation_p.R23168*|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30592	Fibronectin type-III 123. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R23293*(1)|p.R23360*(1)|p.R29663*(1)|p.R23168*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAGTGAGTCGGCTACCACCA	0.502																																					p.A23167A												.	.	4	Substitution - Nonsense(4)	large_intestine(4)	c.C69501T	2						.						159.0	149.0	152.0					2																	179408003		1938	4144	6082	179116249	SO:0001587	stop_gained	7273	exon175			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.91774C>T	2.37:g.179408003G>A	ENSP00000465570:p.Arg30592*	Somatic		Capture	Illumina HiSeq	Phase_I	179116249	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	68	105.744346	0.99998	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.5273	0.50586	0.0:0.0:0.6246:0.3754	.	.	.	.	X	29665;23168;23360;23293;23165	.	ENSP00000340554:R23360X	R	-	1	2	TTN	179116249	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.724000	0.61972	2.793000	0.96121	0.655000	0.94253	CGA		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SF3B1	23451	broad.mit.edu	37	2	198281474	198281474	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr2:198281474A>T	ENST00000335508.6	-	6	748	c.657T>A	c.(655-657)gaT>gaA	p.D219E		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	219	U2AF homology region; mediates interaction with RMB39.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.D219E(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CCTCTGCCTGATCCCAACTTG	0.418			Mis		myelodysplastic syndrome																																p.D219E			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T657A	2						.						122.0	122.0	122.0					2																	198281474		2203	4300	6503	197989719	SO:0001583	missense	23451	exon6			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.657T>A	2.37:g.198281474A>T	ENSP00000335321:p.Asp219Glu	Somatic		Capture	Illumina HiSeq	Phase_I	197989719	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	A	13.64	2.297782	0.40694	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.26	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.50735	0.1633	L	0.45422	1.42	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.40739	-0.9547	9	0.21540	T	0.41	.	10.8562	0.46800	0.9266:0.0:0.0734:0.0	.	219	O75533	SF3B1_HUMAN	E	219	.	ENSP00000335321:D219E	D	-	3	2	SF3B1	197989719	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	3.230000	0.51286	1.032000	0.39892	0.472000	0.43445	GAT		0.418	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
XRCC5	7520	broad.mit.edu	37	2	216983871	216983871	+	Silent	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr2:216983871C>T	ENST00000392133.3	+	7	935	c.474C>T	c.(472-474)gaC>gaT	p.D158D	XRCC5_ENST00000392132.2_Silent_p.D158D			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	158	Leucine-zipper.				brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.D158D(1)		endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		AGAAATGTGACATCTCCCTGC	0.373								Non-homologous end-joining																													p.D158D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C474T	2						.						70.0	71.0	71.0					2																	216983871		2203	4300	6503	216692116	SO:0001819	synonymous_variant	7520	exon5			AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.474C>T	2.37:g.216983871C>T		Somatic		Capture	Illumina HiSeq	Phase_I	216692116	NM_021141	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Silent	SNP	ENST00000392133.3	37	CCDS2402.1																																																																																				0.373	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141	
LHCGR	3973	broad.mit.edu	37	2	48936111	48936111	+	Missense_Mutation	SNP	C	C	T	rs182707541		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr2:48936111C>T	ENST00000294954.7	-	8	677	c.656G>A	c.(655-657)cGt>cAt	p.R219H	STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000405626.1_Missense_Mutation_p.R219H|LHCGR_ENST00000403273.1_Missense_Mutation_p.R219H|LHCGR_ENST00000401907.1_Missense_Mutation_p.R219H|LHCGR_ENST00000344775.3_Missense_Mutation_p.R219H	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	219					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)	p.R219H(2)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TGTGGCCCCACGGAAGGCTCC	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		20047	0.001		0.0	False		,,,				2504	0.0				p.R219H												.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.G656A	2						.						228.0	197.0	208.0					2																	48936111		2203	4300	6503	48789615	SO:0001583	missense	3973	exon8				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.656G>A	2.37:g.48936111C>T	ENSP00000294954:p.Arg219His	Somatic		Capture	Illumina HiSeq	Phase_I	48789615	NM_000233	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	CCDS1842.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	13.95	2.391394	0.42410	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626;ENST00000403273;ENST00000401907	T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34	5.04	-8.09	0.01090	.	0.669200	0.15951	N	0.236731	T	0.62708	0.2450	L	0.41573	1.285	0.09310	N	1	B	0.15930	0.015	B	0.12156	0.007	T	0.41662	-0.9496	9	.	.	.	.	7.0296	0.24960	0.21:0.2068:0.0:0.5831	.	219	P22888	LSHR_HUMAN	H	219	ENSP00000344301:R219H;ENSP00000294954:R219H;ENSP00000386033:R219H;ENSP00000385847:R219H;ENSP00000385406:R219H	.	R	-	2	0	LHCGR	48789615	0.000000	0.05858	0.019000	0.16419	0.954000	0.61252	-2.232000	0.01205	-2.354000	0.00614	-0.150000	0.13652	CGT		0.542	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
SPTBN1	6711	broad.mit.edu	37	2	54874371	54874371	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr2:54874371C>A	ENST00000356805.4	+	24	5251	c.4970C>A	c.(4969-4971)gCc>gAc	p.A1657D	SPTBN1_ENST00000333896.5_Missense_Mutation_p.A1644D	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1657	Interaction with ANK2.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			ACCAGCCGGGCCCTGGTGGCC	0.567																																					p.A1657D												.	.	0			c.C4970A	2						.						82.0	82.0	82.0					2																	54874371		2203	4300	6503	54727875	SO:0001583	missense	6711	exon24				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.4970C>A	2.37:g.54874371C>A	ENSP00000349259:p.Ala1657Asp	None		Capture	Illumina HiSeq	Phase_I	54727875	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.414180	0.25465	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.52057	0.68;0.68	5.93	5.04	0.67666	.	0.229257	0.45606	D	0.000357	T	0.34395	0.0896	L	0.33753	1.03	0.35726	D	0.817526	B;B	0.10296	0.002;0.003	B;B	0.12837	0.008;0.005	T	0.34254	-0.9836	10	0.11794	T	0.64	.	12.0067	0.53263	0.1368:0.7318:0.1314:0.0	.	1644;1657	Q01082-3;Q01082	.;SPTB2_HUMAN	D	1657;1644	ENSP00000349259:A1657D;ENSP00000334156:A1644D	ENSP00000334156:A1644D	A	+	2	0	SPTBN1	54727875	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	3.084000	0.50143	1.491000	0.48482	0.591000	0.81541	GCC		0.567	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
TRIP12	9320	broad.mit.edu	37	2	230668351	230668351	+	Silent	SNP	A	A	C	rs202128964	byFrequency	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr2:230668351A>C	ENST00000283943.5	-	19	2887	c.2709T>G	c.(2707-2709)ctT>ctG	p.L903L	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389045.3_Silent_p.L633L|TRIP12_ENST00000389044.4_Silent_p.L951L	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	903					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.L903L(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CTGCCATCTGAAGTGCTCCCA	0.333													A|||	2	0.000399361	0.0	0.0	5008	,	,		16227	0.002		0.0	False		,,,				2504	0.0				p.L903L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2709G	2						.						72.0	72.0	72.0					2																	230668351		2202	4300	6502	230376595	SO:0001819	synonymous_variant	9320	exon19			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.2709T>G	2.37:g.230668351A>C		Somatic		Capture	Illumina HiSeq	Phase_I	230376595	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	37	CCDS33391.1																																																																																				0.333	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
TOMM70A	9868	broad.mit.edu	37	3	100091564	100091564	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr3:100091564G>T	ENST00000284320.5	-	9	1786	c.1338C>A	c.(1336-1338)taC>taA	p.Y446*		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	446					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)	p.Y446*(9)		endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						ATGCCTGGCGGTACTATAAAA	0.353																																					p.Y446X												.	.	9	Substitution - Nonsense(9)	endometrium(8)|large_intestine(1)	c.C1338A	3						.						77.0	74.0	75.0					3																	100091564		2203	4300	6503	101574254	SO:0001587	stop_gained	9868	exon9			AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.1338C>A	3.37:g.100091564G>T	ENSP00000284320:p.Tyr446*	Somatic		Capture	Illumina HiSeq	Phase_I	101574254	NM_014820	D3DN48	Nonsense_Mutation	SNP	ENST00000284320.5	37	CCDS33807.1	.	.	.	.	.	.	.	.	.	.	G	39	7.748431	0.98468	.	.	ENSG00000154174	ENST00000284320;ENST00000544924	.	.	.	4.89	2.5	0.30297	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7544	7.7528	0.28907	0.6612:0.0:0.3388:0.0	.	.	.	.	X	446;339	.	ENSP00000284320:Y446X	Y	-	3	2	TOMM70A	101574254	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	2.408000	0.44574	0.307000	0.22880	-0.302000	0.09304	TAC		0.353	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353141.2		
CBLB	868	broad.mit.edu	37	3	105412419	105412419	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr3:105412419C>G	ENST00000264122.4	-	13	2294	c.1973G>C	c.(1972-1974)gGt>gCt	p.G658A	CBLB_ENST00000394027.3_Missense_Mutation_p.G680A|CBLB_ENST00000405772.1_Missense_Mutation_p.G658A|CBLB_ENST00000403724.1_Missense_Mutation_p.G658A	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	658	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G658A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						TCCAAGGTGACCATTGGAAAA	0.413			Mis S		AML																																p.G658A	GBM(93;588 1337 9788 29341 43499)		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1973C	3						.						106.0	100.0	102.0					3																	105412419		2203	4300	6503	106895109	SO:0001583	missense	868	exon13			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1973G>C	3.37:g.105412419C>G	ENSP00000264122:p.Gly658Ala	Somatic		Capture	Illumina HiSeq	Phase_I	106895109	NM_170662	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	37	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.393858	0.83011	.	.	ENSG00000114423	ENST00000394030;ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D;D	0.83914	-1.51;-1.76;-1.76;-1.77;-1.78	5.63	5.63	0.86233	.	0.203351	0.51477	D	0.000082	D	0.90789	0.7108	M	0.65498	2.005	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.995;0.998;0.996	D	0.91134	0.4940	10	0.87932	D	0	-18.5725	19.6768	0.95939	0.0:1.0:0.0:0.0	.	680;658;658	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	A	41;658;680;658;658	ENSP00000377598:G41A;ENSP00000264122:G658A;ENSP00000377595:G680A;ENSP00000384816:G658A;ENSP00000384938:G658A	ENSP00000264122:G658A	G	-	2	0	CBLB	106895109	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.741000	0.68638	2.665000	0.90641	0.591000	0.81541	GGT		0.413	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	
CADPS	8618	broad.mit.edu	37	3	62503858	62503858	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr3:62503858G>A	ENST00000383710.4	-	14	2708	c.2359C>T	c.(2359-2361)Cga>Tga	p.R787*	CADPS_ENST00000357948.3_Nonsense_Mutation_p.R770*|CADPS_ENST00000283269.9_Nonsense_Mutation_p.R787*	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	787					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.R787*(2)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		AGCAGAACTCGGAGCCTCTCT	0.418																																					p.R770X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2308T	3						.						111.0	109.0	110.0					3																	62503858		2203	4300	6503	62478898	SO:0001587	stop_gained	8618	exon14			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2359C>T	3.37:g.62503858G>A	ENSP00000373215:p.Arg787*	Somatic		Capture	Illumina HiSeq	Phase_I	62478898	NM_183393	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Nonsense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.312583|10.312583	0.99381|0.99381	.|.	.|.	ENSG00000163618|ENSG00000163618	ENST00000491424|ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269	.|.	.|.	.|.	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.48447|.	0.1500|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37361|.	-0.9709|.	4|.	.|0.02654	.|T	.|1	.|.	20.1708|20.1708	0.98159|0.98159	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	93|787;787;770;787	.|.	.|ENSP00000283269:R787X	P|R	-|-	2|1	0|2	CADPS|CADPS	62478898|62478898	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.945000|0.945000	0.59286|0.59286	8.009000|8.009000	0.88606|0.88606	2.761000|2.761000	0.94854|0.94854	0.655000|0.655000	0.94253|0.94253	CCG|CGA		0.418	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
TP63	8626	broad.mit.edu	37	3	189612255	189612256	+	Missense_Mutation	DNP	CA	CA	AT			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr3:189612255_189612256CA>AT	ENST00000264731.3	+	14	2096_2097	c.2007_2008CA>AT	c.(2005-2010)cgCAat>cgATat	p.N670Y	TP63_ENST00000320472.5_3'UTR|TP63_ENST00000449992.1_Missense_Mutation_p.N491Y|TP63_ENST00000440651.2_Missense_Mutation_p.N666Y|TP63_ENST00000382063.4_Missense_Mutation_p.N585Y|TP63_ENST00000456148.1_Missense_Mutation_p.N572Y|TP63_ENST00000354600.5_Missense_Mutation_p.N576Y	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	670	Transactivation inhibition.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)	p.R669>?(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		ATGCTCGCCGCAATAAGCAACA	0.535										HNSCC(45;0.13)																											.												.	.	1	Complex(1)	large_intestine(1)	c.1725_1726AT	3						.																																			191094950	SO:0001583	missense	8626	exon12			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	Exception_encountered	3.37:g.189612255_189612256delinsAT	ENSP00000264731:p.Asn670Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	191094949	NM_001114980	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	DNP	ENST00000264731.3	37	CCDS3293.1																																																																																				0.535	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
FAT4	79633	broad.mit.edu	37	4	126241071	126241071	+	Missense_Mutation	SNP	C	C	T	rs190175933		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr4:126241071C>T	ENST00000394329.3	+	1	3518	c.3505C>T	c.(3505-3507)Cgg>Tgg	p.R1169W		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1169	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R1169W(4)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCTTATGAGGCGGAGAGGGAC	0.453													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18404	0.0		0.0	False		,,,				2504	0.0				p.R1169W												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.C3505T	4						.	C	TRP/ARG	0,3888		0,0,1944	119.0	121.0	120.0		3505	3.3	0.8	4		120	1,8291		0,1,4145	yes	missense	FAT4	NM_024582.4	101	0,1,6089	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging	1169/4982	126241071	1,12179	1944	4146	6090	126460521	SO:0001583	missense	79633	exon1			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3505C>T	4.37:g.126241071C>T	ENSP00000377862:p.Arg1169Trp	Somatic		Capture	Illumina HiSeq	Phase_I	126460521	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	16.90	3.249055	0.59103	0.0	1.21E-4	ENSG00000196159	ENST00000394329	T	0.74632	-0.86	5.1	3.3	0.37823	Cadherin (4);Cadherin-like (1);	0.905027	0.08809	U	0.890645	T	0.76856	0.4046	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	P	0.56788	0.806	T	0.70655	-0.4812	10	0.66056	D	0.02	.	13.7862	0.63110	0.2885:0.7115:0.0:0.0	.	1169	Q6V0I7	FAT4_HUMAN	W	1169	ENSP00000377862:R1169W	ENSP00000377862:R1169W	R	+	1	2	FAT4	126460521	1.000000	0.71417	0.764000	0.31436	0.955000	0.61496	4.708000	0.61859	0.674000	0.31244	0.491000	0.48974	CGG		0.453	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
RNF175	285533	broad.mit.edu	37	4	154649422	154649422	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr4:154649422G>T	ENST00000347063.4	-	4	710	c.338C>A	c.(337-339)tCc>tAc	p.S113Y	RNF175_ENST00000274068.4_Intron|RP11-153M7.5_ENST00000505051.1_RNA|RNF175_ENST00000506505.1_Intron	NM_173662.2	NP_775933	Q8N4F7	RN175_HUMAN	ring finger protein 175	113						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.S113Y(2)		breast(1)|endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	13	all_hematologic(180;0.093)	Renal(120;0.118)				GGTAATAACGGAGAACATCCC	0.483																																					p.S113Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C338A	4						.						119.0	118.0	118.0					4																	154649422		1875	4102	5977	154868872	SO:0001583	missense	285533	exon4			BC034385	CCDS47149.1	4q31.3	2008-02-05			ENSG00000145428	ENSG00000145428		"""RING-type (C3HC4) zinc fingers"""	27735	protein-coding gene	gene with protein product							Standard	NM_173662		Approved	FLJ34190	uc003int.3	Q8N4F7	OTTHUMG00000161557	ENST00000347063.4:c.338C>A	4.37:g.154649422G>T	ENSP00000340979:p.Ser113Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	154868872	NM_173662	C9JL66|Q8NB61	Missense_Mutation	SNP	ENST00000347063.4	37	CCDS47149.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127314	0.56721	.	.	ENSG00000145428	ENST00000347063;ENST00000508248	T;T	0.80393	-1.37;-1.37	4.69	4.69	0.59074	.	0.075202	0.53938	D	0.000043	D	0.89805	0.6821	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.90798	0.4692	10	0.87932	D	0	-10.6344	15.9332	0.79683	0.0:0.0:1.0:0.0	.	113	Q8N4F7	RN175_HUMAN	Y	113;53	ENSP00000340979:S113Y;ENSP00000427472:S53Y	ENSP00000340979:S113Y	S	-	2	0	RNF175	154868872	1.000000	0.71417	0.964000	0.40570	0.903000	0.53119	3.695000	0.54749	2.885000	0.99019	0.655000	0.94253	TCC		0.483	RNF175-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365286.1	NM_173662	
UGT3A1	133688	broad.mit.edu	37	5	35955952	35955952	+	Missense_Mutation	SNP	G	G	A	rs554821154		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr5:35955952G>A	ENST00000274278.3	-	6	1447	c.1090C>T	c.(1090-1092)Cgt>Tgt	p.R364C	UGT3A1_ENST00000507113.1_Missense_Mutation_p.R330C|UGT3A1_ENST00000503189.1_Missense_Mutation_p.R364C|UGT3A1_ENST00000513233.1_5'UTR	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	364						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.R364C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACAAAAAGACGGATGCTGGGG	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		21840	0.0		0.0	False		,,,				2504	0.001				p.R364C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1090T	5						.						79.0	75.0	76.0					5																	35955952		2203	4300	6503	35991709	SO:0001583	missense	133688	exon6				CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.1090C>T	5.37:g.35955952G>A	ENSP00000274278:p.Arg364Cys	Somatic		Capture	Illumina HiSeq	Phase_I	35991709	NM_152404	G5E961|Q8IYS9|Q8NAW4|Q96DM6	Missense_Mutation	SNP	ENST00000274278.3	37	CCDS3913.1	.	.	.	.	.	.	.	.	.	.	.	16.29	3.082536	0.55861	.	.	ENSG00000145626	ENST00000274278;ENST00000503189;ENST00000507113	T;T;T	0.62941	-0.01;-0.01;-0.01	4.12	-1.32	0.09201	.	0.188237	0.32624	N	0.005845	T	0.69967	0.3170	M	0.93197	3.39	0.09310	N	1	P;P;P	0.50528	0.75;0.936;0.899	B;P;P	0.47673	0.212;0.554;0.511	T	0.66368	-0.5941	10	0.87932	D	0	.	7.8602	0.29506	0.0863:0.0:0.4724:0.4413	.	330;364;364	E9PD17;B7Z8Q8;Q6NUS8	.;.;UD3A1_HUMAN	C	364;364;330	ENSP00000274278:R364C;ENSP00000427079:R364C;ENSP00000426100:R330C	ENSP00000274278:R364C	R	-	1	0	UGT3A1	35991709	0.000000	0.05858	0.000000	0.03702	0.540000	0.34992	-0.422000	0.07043	-0.028000	0.13850	-0.363000	0.07495	CGT		0.473	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253770.2	NM_152404	
APC	324	broad.mit.edu	37	5	112175390	112175390	+	Nonsense_Mutation	SNP	C	C	T	rs121913328		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr5:112175390C>T	ENST00000457016.1	+	16	4479	c.4099C>T	c.(4099-4101)Cag>Tag	p.Q1367*	APC_ENST00000508376.2_Nonsense_Mutation_p.Q1367*|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1367*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1367	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1367*(26)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGTGGTGCTCAGACACCCAA	0.453	Q1367*(C2BBE1_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1349X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	28	Substitution - Nonsense(26)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(26)|soft_tissue(1)|skin(1)	c.C4045T	5	GRCh37	CM940072	APC	M	rs121913328	.						75.0	73.0	74.0					5																	112175390		2202	4300	6502	112203289	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4099C>T	5.37:g.112175390C>T	ENSP00000413133:p.Gln1367*	Somatic		Capture	Illumina HiSeq	Phase_I	112203289	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.623019	0.98890	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	5.3	0.74995	.	0.166931	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.8965	17.2482	0.87034	0.0:0.8741:0.1259:0.0	.	.	.	.	X	1367	.	.	Q	+	1	0	APC	112203289	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.223000	0.72257	1.603000	0.50134	0.655000	0.94253	CAG		0.453	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ZKSCAN8	7745	broad.mit.edu	37	6	28121580	28121580	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr6:28121580C>A	ENST00000330236.6	+	6	1706	c.1522C>A	c.(1522-1524)Cat>Aat	p.H508N	ZKSCAN8_ENST00000457389.2_Missense_Mutation_p.H508N	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	508					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H508N(1)									CCTTATTGAACATCAGAGAAT	0.453																																					p.H508N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1522A	6						.						50.0	51.0	51.0					6																	28121580		2203	4300	6503	28229559	SO:0001583	missense	7745	exon6				CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.1522C>A	6.37:g.28121580C>A	ENSP00000332750:p.His508Asn	Somatic		Capture	Illumina HiSeq	Phase_I	28229559	NM_006298	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Missense_Mutation	SNP	ENST00000330236.6	37	CCDS4645.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321873	0.81580	.	.	ENSG00000198315	ENST00000330236;ENST00000457389	D;D	0.86865	-2.18;-2.18	5.99	5.99	0.97316	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000011	D	0.96191	0.8758	H	0.97491	4.015	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.96943	0.9689	10	0.87932	D	0	.	19.2504	0.93923	0.0:1.0:0.0:0.0	.	508	Q15776	ZN192_HUMAN	N	508	ENSP00000332750:H508N;ENSP00000402948:H508N	ENSP00000332750:H508N	H	+	1	0	ZNF192	28229559	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.776000	0.68924	2.853000	0.98044	0.655000	0.94253	CAT		0.453	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040178.2		
ZKSCAN3	80317	broad.mit.edu	37	6	28327687	28327687	+	Silent	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr6:28327687G>A	ENST00000377255.3	+	3	621	c.324G>A	c.(322-324)gaG>gaA	p.E108E	ZKSCAN3_ENST00000341464.5_Intron|ZKSCAN3_ENST00000252211.2_Silent_p.E108E	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	108	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E108E(1)		kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						GGGTGCGGGAGCAGCATCCAG	0.592																																					p.E108E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G324A	6						.						25.0	28.0	27.0					6																	28327687		2201	4279	6480	28435666	SO:0001819	synonymous_variant	80317	exon2			U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.324G>A	6.37:g.28327687G>A		Somatic		Capture	Illumina HiSeq	Phase_I	28435666	NM_024493	B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Silent	SNP	ENST00000377255.3	37	CCDS4650.1																																																																																				0.592	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040189.3	NM_024493	
ABCC10	89845	broad.mit.edu	37	6	43400712	43400712	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr6:43400712G>A	ENST00000372530.4	+	3	1209	c.994G>A	c.(994-996)Ggt>Agt	p.G332S	ABCC10_ENST00000443426.2_Intron|ABCC10_ENST00000244533.3_Missense_Mutation_p.G289S	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	332	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.G289S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GGGGCTAGCCGGTGGGGCTGT	0.592																																					p.G332S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G994A	6						.						55.0	55.0	55.0					6																	43400712		2203	4300	6503	43508690	SO:0001583	missense	89845	exon3			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.994G>A	6.37:g.43400712G>A	ENSP00000361608:p.Gly332Ser	Somatic		Capture	Illumina HiSeq	Phase_I	43508690	NM_001198934	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	G	0.127	-1.118262	0.01785	.	.	ENSG00000124574	ENST00000372530;ENST00000244533	D;D	0.90676	-2.71;-2.71	5.44	0.231	0.15377	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.949081	0.08895	N	0.878041	T	0.66376	0.2783	N	0.16368	0.405	0.09310	N	1	B;B	0.11235	0.003;0.004	B;B	0.13407	0.009;0.005	T	0.54316	-0.8312	10	0.35671	T	0.21	0.0028	7.1269	0.25477	0.3402:0.0:0.553:0.1068	.	289;332	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	S	332;289	ENSP00000361608:G332S;ENSP00000244533:G289S	ENSP00000244533:G289S	G	+	1	0	ABCC10	43508690	0.000000	0.05858	0.000000	0.03702	0.092000	0.18411	0.298000	0.19120	-0.536000	0.06298	-1.134000	0.01955	GGT		0.592	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
HYAL4	23553	broad.mit.edu	37	7	123508775	123508775	+	Nonsense_Mutation	SNP	C	C	T	rs144025222		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr7:123508775C>T	ENST00000223026.4	+	3	1086	c.448C>T	c.(448-450)Cga>Tga	p.R150*	HYAL4_ENST00000476325.1_Nonsense_Mutation_p.R150*	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	150					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)	p.R150*(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						GGAATATTGGCGACCACAGTG	0.393																																					p.R150X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C448T	7						.	C	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	78.0	84.0	82.0		448	0.1	0.9	7	dbSNP_134	82	0,8600		0,0,4300	no	stop-gained	HYAL4	NM_012269.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		150/482	123508775	1,13005	2203	4300	6503	123296011	SO:0001587	stop_gained	23553	exon3			AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.448C>T	7.37:g.123508775C>T	ENSP00000223026:p.Arg150*	Somatic		Capture	Illumina HiSeq	Phase_I	123296011	NM_012269	D0VXG1|Q9UL99|Q9Y6T9	Nonsense_Mutation	SNP	ENST00000223026.4	37	CCDS5789.1	.	.	.	.	.	.	.	.	.	.	C	9.956	1.221355	0.22457	2.27E-4	0.0	ENSG00000106302	ENST00000223026;ENST00000476325	.	.	.	5.73	0.0593	0.14331	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.2876	10.8842	0.46957	0.6207:0.3052:0.0:0.074	.	.	.	.	X	150	.	.	R	+	1	2	HYAL4	123296011	1.000000	0.71417	0.944000	0.38274	0.002000	0.02628	0.933000	0.28897	-0.213000	0.10094	-0.894000	0.02916	CGA		0.393	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348545.1	NM_012269	
OSBPL3	26031	broad.mit.edu	37	7	24849562	24849562	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr7:24849562delG	ENST00000313367.2	-	20	2632	c.2181delC	c.(2179-2181)tacfs	p.Y727fs	OSBPL3_ENST00000353930.1_Frame_Shift_Del_p.Y691fs|OSBPL3_ENST00000396431.1_Frame_Shift_Del_p.Y696fs|OSBPL3_ENST00000352860.1_Frame_Shift_Del_p.Y696fs|OSBPL3_ENST00000487020.1_5'UTR|OSBPL3_ENST00000431825.2_Frame_Shift_Del_p.Y660fs|OSBPL3_ENST00000409069.1_Frame_Shift_Del_p.Y660fs|OSBPL3_ENST00000396429.1_Frame_Shift_Del_p.Y691fs	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	727					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)	p.W728fs*65(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						TAGTGCTCCAGTATTTTGCCT	0.413																																					p.Y691fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2073delC	7						.						205.0	183.0	191.0					7																	24849562		2203	4300	6503	24816087	SO:0001589	frameshift_variant	26031	exon19			AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.2181delC	7.37:g.24849562delG	ENSP00000315410:p.Tyr727fs	Somatic		Capture	Illumina HiSeq	Phase_I	24816087	NM_145321	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Frame_Shift_Del	DEL	ENST00000313367.2	37	CCDS5390.1																																																																																				0.413	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2		
VSTM2A	222008	broad.mit.edu	37	7	54636705	54636705	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr7:54636705C>T	ENST00000407838.3	+	5	1044	c.638C>T	c.(637-639)gCg>gTg	p.A213V	VSTM2A_ENST00000498834.1_Intron|VSTM2A_ENST00000402613.3_Intron|GS1-18A18.1_ENST00000456049.1_RNA|VSTM2A_ENST00000404951.1_Intron	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	213						extracellular region (GO:0005576)		p.A213V(1)		endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			TCCGCAGGTGCGAGGATAGCT	0.368																																					p.A213V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C638T	7						.						166.0	155.0	158.0					7																	54636705		1878	4102	5980	54604199	SO:0001583	missense	222008	exon5			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.638C>T	7.37:g.54636705C>T	ENSP00000384967:p.Ala213Val	Somatic		Capture	Illumina HiSeq	Phase_I	54604199	NM_182546	A4D2E9|B5MC94	Missense_Mutation	SNP	ENST00000407838.3	37	CCDS5512.2	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791485	0.50102	.	.	ENSG00000170419	ENST00000407838	T	0.46819	0.86	6.09	6.09	0.99107	.	.	.	.	.	T	0.55433	0.1920	N	0.22421	0.69	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	T	0.56950	-0.7894	9	0.66056	D	0.02	.	16.195	0.82021	0.0:1.0:0.0:0.0	.	213	Q8TAG5	VTM2A_HUMAN	V	213	ENSP00000384967:A213V	ENSP00000384967:A213V	A	+	2	0	VSTM2A	54604199	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.588000	0.67517	2.899000	0.99337	0.655000	0.94253	GCG		0.368	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318694.1	NM_182546	
SEMA3D	223117	broad.mit.edu	37	7	84628871	84628871	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr7:84628871C>T	ENST00000284136.6	-	17	2262	c.2219G>A	c.(2218-2220)cGg>cAg	p.R740Q	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	740	Arg/Lys-rich (basic).				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.R740Q(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TCTCTGTCTCCGCTTCTCCCT	0.502																																					p.R740Q	Ovarian(63;442 1191 17318 29975 31528)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2219A	7						.						168.0	142.0	151.0					7																	84628871		2203	4300	6503	84466807	SO:0001583	missense	223117	exon17			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.2219G>A	7.37:g.84628871C>T	ENSP00000284136:p.Arg740Gln	Somatic		Capture	Illumina HiSeq	Phase_I	84466807	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	C	14.50	2.553881	0.45487	.	.	ENSG00000153993	ENST00000284136	T	0.29655	1.56	5.93	5.93	0.95920	.	0.193537	0.49305	D	0.000157	T	0.20861	0.0502	L	0.34521	1.04	0.80722	D	1	B	0.30709	0.291	B	0.13407	0.009	T	0.03443	-1.1036	10	0.36615	T	0.2	.	10.661	0.45702	0.0:0.8586:0.0:0.1414	.	740	O95025	SEM3D_HUMAN	Q	740	ENSP00000284136:R740Q	ENSP00000284136:R740Q	R	-	2	0	SEMA3D	84466807	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.681000	0.46926	2.814000	0.96858	0.655000	0.94253	CGG		0.502	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
AGAP3	116988	broad.mit.edu	37	7	150839612	150839612	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr7:150839612T>A	ENST00000463381.1	+	14	1667	c.1171T>A	c.(1171-1173)Tgg>Agg	p.W391R	AGAP3_ENST00000397238.2_Missense_Mutation_p.W722R	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	686	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)	p.W722R(1)		central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						CCTCGATGACTGGCCGCCTGA	0.652																																					p.W722R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2164A	7						.						49.0	55.0	53.0					7																	150839612		2090	4227	6317	150470545	SO:0001583	missense	116988	exon16			AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.1171T>A	7.37:g.150839612T>A	ENSP00000418016:p.Trp391Arg	Somatic		Capture	Illumina HiSeq	Phase_I	150470545	NM_031946	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000463381.1	37		.	.	.	.	.	.	.	.	.	.	T	17.09	3.299641	0.60195	.	.	ENSG00000133612	ENST00000463381;ENST00000397232;ENST00000397238;ENST00000335355	T;T	0.55413	0.52;0.52	5.37	5.37	0.77165	.	0.208526	0.45126	D	0.000382	D	0.85353	0.5677	H	0.99834	4.825	0.80722	D	1	D;D;D;D	0.76494	0.962;0.995;0.998;0.999	D;D;D;D	0.87578	0.949;0.971;0.97;0.998	D	0.91960	0.5578	10	0.87932	D	0	.	14.5489	0.68052	0.0:0.0:0.0:1.0	.	686;221;722;391	Q96P47;E7ETI2;Q96P47-4;B3KNZ8	AGAP3_HUMAN;.;.;.	R	391;221;722;686	ENSP00000418016:W391R;ENSP00000380413:W722R	ENSP00000334157:W686R	W	+	1	0	AGAP3	150470545	1.000000	0.71417	0.998000	0.56505	0.108000	0.19459	7.908000	0.87438	2.034000	0.60081	0.533000	0.62120	TGG		0.652	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000351909.2	NM_031946	
DLC1	10395	broad.mit.edu	37	8	13356836	13356836	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr8:13356836T>G	ENST00000276297.4	-	2	1154	c.745A>C	c.(745-747)Acc>Ccc	p.T249P	DLC1_ENST00000511869.1_Missense_Mutation_p.T249P|DLC1_ENST00000316609.5_Missense_Mutation_p.T249P	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	249					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.T249P(2)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						ACATTGCAGGTGCTTCTTTCA	0.423																																					p.T249P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A745C	8						.						157.0	160.0	159.0					8																	13356836		2203	4300	6503	13401207	SO:0001583	missense	10395	exon2			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.745A>C	8.37:g.13356836T>G	ENSP00000276297:p.Thr249Pro	Somatic		Capture	Illumina HiSeq	Phase_I	13401207	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	T	5.953	0.359790	0.11296	.	.	ENSG00000164741	ENST00000276297;ENST00000316609;ENST00000511869	T;T;T	0.13089	3.53;2.62;2.63	4.84	0.873	0.19118	.	0.878070	0.09431	N	0.803119	T	0.12902	0.0313	L	0.42245	1.32	0.09310	N	1	B;D;B	0.53745	0.023;0.962;0.0	B;B;B	0.43867	0.015;0.434;0.001	T	0.28618	-1.0038	10	0.29301	T	0.29	.	8.3658	0.32385	0.0:0.1002:0.6308:0.269	.	249;249;249	E9PF76;Q96QB1-3;Q96QB1	.;.;RHG07_HUMAN	P	249	ENSP00000276297:T249P;ENSP00000321034:T249P;ENSP00000425878:T249P	ENSP00000276297:T249P	T	-	1	0	DLC1	13401207	0.002000	0.14202	0.001000	0.08648	0.051000	0.14879	0.352000	0.20113	0.057000	0.16193	0.533000	0.62120	ACC		0.423	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
CLU	1191	broad.mit.edu	37	8	27462577	27462577	+	Silent	SNP	G	G	C	rs1804560		TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr8:27462577G>C	ENST00000316403.10	-	5	1098	c.693C>G	c.(691-693)ccC>ccG	p.P231P	CLU_ENST00000560366.1_Silent_p.P283P|CLU_ENST00000405140.3_Silent_p.P231P|CLU_ENST00000546343.1_Silent_p.P242P|CLU_ENST00000523500.1_Silent_p.P231P			P10909	CLUS_HUMAN	clusterin	231					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)	p.P283P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		ACGGAGAGAAGGGCATCAAGC	0.597																																					p.P242P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C726G	8						.						123.0	117.0	119.0					8																	27462577		2203	4300	6503	27518494	SO:0001819	synonymous_variant	1191	exon5			M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.693C>G	8.37:g.27462577G>C		Somatic		Capture	Illumina HiSeq	Phase_I	27518494	NM_001171138	B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Silent	SNP	ENST00000316403.10	37	CCDS47832.1	.	.	.	.	.	.	.	.	.	.	G	3.098	-0.185380	0.06340	.	.	ENSG00000120885	ENST00000522098	.	.	.	4.51	0.652	0.17823	.	.	.	.	.	T	0.23611	0.0571	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.24548	-1.0157	4	.	.	.	-3.1635	3.7543	0.08579	0.5956:0.1884:0.2159:0.0	.	.	.	.	V	94	.	.	L	-	1	0	CLU	27518494	0.997000	0.39634	0.004000	0.12327	0.004000	0.04260	0.462000	0.21956	-0.063000	0.13065	-1.087000	0.02190	CTT		0.597	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219953.3	NM_001831	
SCARA5	286133	broad.mit.edu	37	8	27737202	27737202	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr8:27737202C>T	ENST00000354914.3	-	8	1720	c.1235G>A	c.(1234-1236)cGg>cAg	p.R412Q	SCARA5_ENST00000380385.2_Missense_Mutation_p.R187Q	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	412	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)	p.R412Q(1)		central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		GCCCCAACGCCGGTCGTGGTA	0.667																																					p.R412Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1235A	8						.						101.0	83.0	89.0					8																	27737202		2203	4300	6503	27793121	SO:0001583	missense	286133	exon8			AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.1235G>A	8.37:g.27737202C>T	ENSP00000346990:p.Arg412Gln	Somatic		Capture	Illumina HiSeq	Phase_I	27793121	NM_173833	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	37	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.856037	0.51376	.	.	ENSG00000168079	ENST00000354914;ENST00000380385	T;T	0.28069	1.63;1.63	4.87	3.99	0.46301	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.077234	0.52532	D	0.000068	T	0.19366	0.0465	L	0.31845	0.965	0.80722	D	1	B;P	0.34800	0.04;0.469	B;B	0.30782	0.014;0.12	T	0.04915	-1.0918	10	0.30854	T	0.27	.	7.6251	0.28208	0.0:0.804:0.0:0.196	.	187;412	Q6ZMJ2-4;Q6ZMJ2	.;SCAR5_HUMAN	Q	412;187	ENSP00000346990:R412Q;ENSP00000369746:R187Q	ENSP00000346990:R412Q	R	-	2	0	SCARA5	27793121	0.028000	0.19301	0.906000	0.35671	0.982000	0.71751	0.935000	0.28924	1.165000	0.42670	0.591000	0.81541	CGG		0.667	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833	
PXDNL	137902	broad.mit.edu	37	8	52321443	52321443	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr8:52321443G>A	ENST00000356297.4	-	17	2841	c.2741C>T	c.(2740-2742)tCg>tTg	p.S914L	PXDNL_ENST00000543296.1_Missense_Mutation_p.S914L	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	914					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.S914L(1)|p.S113L(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CCGAGGCACCGAAGGGTCTCT	0.597																																					p.S914L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2741T	8						.						33.0	37.0	36.0					8																	52321443		1948	4133	6081	52483996	SO:0001583	missense	137902	exon17				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2741C>T	8.37:g.52321443G>A	ENSP00000348645:p.Ser914Leu	Somatic		Capture	Illumina HiSeq	Phase_I	52483996	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.883|7.883	0.730744|0.730744	0.15507|0.15507	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000522933|ENST00000356297;ENST00000543296	.|T;T	.|0.74209	.|-0.82;-0.82	4.01|4.01	3.13|3.13	0.36017|0.36017	.|.	.|0.768028	.|0.10827	.|N	.|0.629831	T|T	0.69735|0.69735	0.3144|0.3144	L|L	0.55481|0.55481	1.735|1.735	0.09310|0.09310	N|N	1|1	.|B	.|0.22414	.|0.069	.|B	.|0.23574	.|0.047	T|T	0.61922|0.61922	-0.6963|-0.6963	5|10	.|0.72032	.|D	.|0.01	.|.	9.356|9.356	0.38166|0.38166	0.1106:0.0:0.8894:0.0|0.1106:0.0:0.8894:0.0	.|.	.|914	.|A1KZ92	.|PXDNL_HUMAN	W|L	33|914	.|ENSP00000348645:S914L;ENSP00000444865:S914L	.|ENSP00000348645:S914L	R|S	-|-	1|2	2|0	PXDNL|PXDNL	52483996|52483996	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.882000|0.882000	0.28186|0.28186	0.668000|0.668000	0.31126|0.31126	-0.136000|-0.136000	0.14681|0.14681	CGG|TCG		0.597	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
FBXO43	286151	broad.mit.edu	37	8	101153576	101153576	+	Silent	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr8:101153576C>T	ENST00000428847.2	-	2	1222	c.906G>A	c.(904-906)ccG>ccA	p.P302P		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	302					meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.P268P(2)|p.P302P(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			GATTACTTATCGGAGTCACAA	0.423																																					p.P302P												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G906A	8						.						54.0	51.0	52.0					8																	101153576		1909	4129	6038	101222752	SO:0001819	synonymous_variant	286151	exon2			BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.906G>A	8.37:g.101153576C>T		Somatic		Capture	Illumina HiSeq	Phase_I	101222752	NM_001029860		Silent	SNP	ENST00000428847.2	37	CCDS47904.1																																																																																				0.423	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380380.1	XM_209918	
FOCAD	54914	broad.mit.edu	37	9	20758144	20758144	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr9:20758144G>A	ENST00000380249.1	+	8	812	c.448G>A	c.(448-450)Gtg>Atg	p.V150M	FOCAD_ENST00000338382.6_Missense_Mutation_p.V150M	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	150						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.V150M(1)									TTGCTGGCCAGTGTTTTTGCA	0.413																																					p.V150M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G448A	9						.						105.0	94.0	97.0					9																	20758144		2203	4300	6503	20748144	SO:0001583	missense	54914	exon8			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.448G>A	9.37:g.20758144G>A	ENSP00000369599:p.Val150Met	Somatic		Capture	Illumina HiSeq	Phase_I	20748144	NM_017794	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041469	0.55003	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.22539	1.95;1.95	5.37	2.33	0.28932	Domain of unknown function DUF3730 (1);	0.257891	0.38005	N	0.001851	T	0.16342	0.0393	L	0.27053	0.805	0.26490	N	0.974962	P	0.43542	0.81	P	0.48030	0.564	T	0.06570	-1.0819	10	0.62326	D	0.03	-8.3075	2.913	0.05743	0.1601:0.1473:0.5499:0.1427	.	150	Q5VW36	K1797_HUMAN	M	150	ENSP00000369599:V150M;ENSP00000344307:V150M	ENSP00000344307:V150M	V	+	1	0	KIAA1797	20748144	0.987000	0.35691	0.897000	0.35233	0.803000	0.45373	0.877000	0.28106	0.606000	0.29965	0.555000	0.69702	GTG		0.413	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
AGTPBP1	23287	broad.mit.edu	37	9	88247596	88247596	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr9:88247596T>A	ENST00000357081.3	-	14	2140	c.1996A>T	c.(1996-1998)Agg>Tgg	p.R666W	AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000432218.1_Missense_Mutation_p.R504W|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.R626W|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.R678W			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	666					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						CCATAAGGCCTTTCTAAAATA	0.383																																					p.R626W												.	.	0			c.A1876T	9						.						54.0	54.0	54.0					9																	88247596		2203	4300	6503	87437416	SO:0001583	missense	23287	exon14			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.1996A>T	9.37:g.88247596T>A	ENSP00000349592:p.Arg666Trp	None		Capture	Illumina HiSeq	Phase_I	87437416	NM_015239	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	37		.	.	.	.	.	.	.	.	.	.	T	21.8	4.205714	0.79127	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218	T;T;T;T	0.52983	2.03;2.03;2.01;0.64	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.69851	0.3157	M	0.75777	2.31	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.988;0.998;1.0;0.988	T	0.73209	-0.4055	10	0.87932	D	0	-18.7736	16.5582	0.84512	0.0:0.0:0.0:1.0	.	678;666;504;626	Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.;CBPC1_HUMAN;.;.	W	666;626;678;504	ENSP00000349592:R666W;ENSP00000365251:R626W;ENSP00000365277:R678W;ENSP00000402804:R504W	ENSP00000349592:R666W	R	-	1	2	AGTPBP1	87437416	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	7.374000	0.79633	2.308000	0.77769	0.533000	0.62120	AGG		0.383	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
CCDC180	100499483	broad.mit.edu	37	9	100082484	100082484	+	Silent	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chr9:100082484C>T	ENST00000357054.1	+	25	2640	c.1705C>T	c.(1705-1707)Cta>Tta	p.L569L	CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000411667.2_Silent_p.L427L|CCDC180_ENST00000375202.2_Silent_p.L430L|CCDC180_ENST00000529487.1_Silent_p.L430L|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000395220.1_Silent_p.L529L			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	569						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.L569L(1)									GAACAAGGAGCTAGGTGAGTG	0.522																																					p.L430L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1288T	9						.						200.0	183.0	189.0					9																	100082484		2203	4300	6503	99122305	SO:0001819	synonymous_variant	57653	exon11			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1705C>T	9.37:g.100082484C>T		Somatic		Capture	Illumina HiSeq	Phase_I	99122305	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	ENST00000357054.1	37																																																																																					0.522	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
ZNF645	158506	broad.mit.edu	37	X	22292061	22292061	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chrX:22292061C>T	ENST00000323684.1	+	1	997	c.953C>T	c.(952-954)aCg>aTg	p.T318M		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	318	Pro-rich.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.T318M(1)		cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						GCTCTAACCACGACCTACGAT	0.458																																					p.T318M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C953T	X						.						136.0	108.0	118.0					X																	22292061		2203	4300	6503	22201982	SO:0001583	missense	158506	exon1			AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.953C>T	X.37:g.22292061C>T	ENSP00000323348:p.Thr318Met	Somatic		Capture	Illumina HiSeq	Phase_I	22201982	NM_152577	A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	ENST00000323684.1	37	CCDS14205.1	.	.	.	.	.	.	.	.	.	.	C	4.644	0.119736	0.08881	.	.	ENSG00000175809	ENST00000323684	T	0.34275	1.37	2.36	-1.54	0.08584	.	0.261204	0.35179	N	0.003394	T	0.14700	0.0355	N	0.08118	0	0.09310	N	1	B	0.23735	0.09	B	0.16289	0.015	T	0.10086	-1.0645	10	0.52906	T	0.07	.	6.575	0.22560	0.0:0.4417:0.0:0.5583	.	318	Q8N7E2	ZN645_HUMAN	M	318	ENSP00000323348:T318M	ENSP00000323348:T318M	T	+	2	0	ZNF645	22201982	0.093000	0.21703	0.000000	0.03702	0.001000	0.01503	-0.297000	0.08276	-0.485000	0.06754	-0.912000	0.02778	ACG		0.458	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	NM_152577	
CXorf36	79742	broad.mit.edu	37	X	45010954	45010954	+	Silent	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chrX:45010954C>T	ENST00000398000.2	-	5	1319	c.1245G>A	c.(1243-1245)acG>acA	p.T415T	CXorf36_ENST00000477281.1_5'UTR	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	415						extracellular region (GO:0005576)		p.T415T(1)		endometrium(1)|large_intestine(2)|lung(4)	7						TGGAGTCACACGTTCTCAGGG	0.542																																					p.T415T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1245A	X						.						115.0	100.0	104.0					X																	45010954		1568	3582	5150	44895898	SO:0001819	synonymous_variant	79742	exon5			AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.1245G>A	X.37:g.45010954C>T		Somatic		Capture	Illumina HiSeq	Phase_I	44895898	NM_176819	A8MUU5|B2RPN7|Q6UWJ5	Silent	SNP	ENST00000398000.2	37	CCDS48096.1																																																																																				0.542	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056333.2	NM_024689	
IL1RAPL2	26280	broad.mit.edu	37	X	104984675	104984675	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A00O-01A-02W-A00E-09	TCGA-AA-A00O-10A-01W-A00E-09	g.chrX:104984675C>T	ENST00000372582.1	+	8	1795	c.1039C>T	c.(1039-1041)Cgt>Tgt	p.R347C	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.R347C|IL1RAPL2_ENST00000485671.1_3'UTR	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	347	Ig-like C2-type 3.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.R347C(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TGTTTTGCTGCGTAAAAAGGG	0.368																																					p.R347C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1039T	X						.						62.0	52.0	56.0					X																	104984675		2203	4300	6503	104871331	SO:0001583	missense	26280	exon8			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1039C>T	X.37:g.104984675C>T	ENSP00000361663:p.Arg347Cys	Somatic		Capture	Illumina HiSeq	Phase_I	104871331	NM_017416	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	ENST00000372582.1	37	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	C	18.45	3.627219	0.66901	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	T;T	0.78126	-1.15;-1.15	5.61	5.61	0.85477	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	D	0.82783	0.5112	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	P	0.60117	0.869	T	0.81731	-0.0799	10	0.37606	T	0.19	.	17.5047	0.87741	0.0:1.0:0.0:0.0	.	347	Q9NP60	IRPL2_HUMAN	C	347	ENSP00000361663:R347C;ENSP00000344976:R347C	ENSP00000344976:R347C	R	+	1	0	IL1RAPL2	104871331	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	2.396000	0.44468	2.348000	0.79779	0.600000	0.82982	CGT		0.368	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
