#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
REM1	28954	hgsc.bcm.edu	37	20	30070121	30070122	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:30070121_30070122insG	ENST00000201979.2	+	4	748_749	c.455_456insG	c.(454-459)caggggfs	p.QG152fs		NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	152					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)	p.Q152H(1)|p.S155fs*16(1)		kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TCATGCCTGCAGGGGGGCAGTG	0.604																																					p.Q152fs												REM1,pancreas,NS,Substitution - Missense,-1	.	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(1)|pancreas(1)	c.455_456insG	20						.																																			29533783	SO:0001589	frameshift_variant	28954	exon4			AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.461dupG	20.37:g.30070127_30070127dupG	ENSP00000201979:p.Gln152fs	Somatic		Capture	SOLID	Phase_I	29533782	NM_014012	E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Frame_Shift_Ins	INS	ENST00000201979.2	37	CCDS13181.1																																																																																				0.604	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078508.2	NM_014012	
C20orf85	128602	hgsc.bcm.edu	37	20	56735726	56735727	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:56735726_56735727insC	ENST00000371168.3	+	4	323_324	c.262_263insC	c.(262-264)tccfs	p.S88fs		NM_178456.2	NP_848551.1	Q9H1P6	CT085_HUMAN	chromosome 20 open reading frame 85	88										kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	13	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			GGTCTTTCCATCCCCCCCAGTC	0.579																																					p.S88fs												.	.	0			c.262_263insC	20						.			5,4259		0,5,2127						5.1	0.2		dbSNP_126	44	5,8249		0,5,4122	no	frameshift	C20orf85	NM_178456.2		0,10,6249	A1A1,A1R,RR		0.0606,0.1173,0.0799				10,12508				56169133	SO:0001589	frameshift_variant	128602	exon4			AL354776	CCDS13465.1	20q13.32	2012-10-29			ENSG00000124237	ENSG00000124237			16216	protein-coding gene	gene with protein product	"""Low in Lung Cancer 1"""						Standard	NM_178456		Approved	bA196N14.1, LLC1	uc002xyv.3	Q9H1P6	OTTHUMG00000032836	ENST00000371168.3:c.269dupC	20.37:g.56735733_56735733dupC	ENSP00000360210:p.Ser88fs	Somatic		Capture	SOLID	Phase_I	56169132	NM_178456		Frame_Shift_Ins	INS	ENST00000371168.3	37	CCDS13465.1																																																																																				0.579	C20orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079866.2	NM_178456	
EPN2	22905	hgsc.bcm.edu	37	17	19215444	19215445	+	Frame_Shift_Ins	INS	-	-	A	rs140735903	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:19215444_19215445insA	ENST00000314728.5	+	6	1443_1444	c.959_960insA	c.(958-963)ccaaaafs	p.PK320fs	EPN2_ENST00000347697.2_Frame_Shift_Ins_p.PK263fs|EPN2_ENST00000571254.1_Frame_Shift_Ins_p.PK263fs|EPN2_ENST00000395626.1_Frame_Shift_Ins_p.PK320fs|EPN2_ENST00000395620.2_Frame_Shift_Ins_p.PK263fs|EPN2_ENST00000395618.3_Frame_Shift_Ins_p.PK35fs|EPN2_ENST00000575595.1_Frame_Shift_Ins_p.PK35fs	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	320					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)	p.K323fs*39(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					GTTAAAATTCCAAAAAAGAAAG	0.505																																					p.P320fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.959_960insA	17						.																																			19156038	SO:0001589	frameshift_variant	22905	exon6			AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.965dupA	17.37:g.19215450_19215450dupA	ENSP00000320543:p.Pro320fs	Somatic		Capture	SOLID	Phase_I	19156037	NM_014964	A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Frame_Shift_Ins	INS	ENST00000314728.5	37	CCDS11203.1																																																																																				0.505	EPN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132283.3	NM_014964	
CA5A	763	hgsc.bcm.edu	37	16	87921800	87921801	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:87921800_87921801insA	ENST00000309893.2	-	7	917_918	c.852_853insT	c.(850-855)cttcaafs	p.Q285fs		NM_001739.1	NP_001730.1	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial	285					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.Q285fs*16(1)		large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(80;0.0513)	Brinzolamide(DB01194)|Zonisamide(DB00909)	ATCAAGGGTTGAAGTGGGCGAT	0.505																																					p.Q285fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.853_854insT	16						.																																			86479302	SO:0001589	frameshift_variant	763	exon7			L19297	CCDS10965.1	16q24.2	2012-08-21			ENSG00000174990	ENSG00000174990	4.2.1.1	"""Carbonic anhydrases"""	1377	protein-coding gene	gene with protein product		114761		CA5		8356065, 7490083	Standard	NM_001739		Approved	CAV, CAVA	uc002fkn.1	P35218	OTTHUMG00000137677	ENST00000309893.2:c.853dupT	16.37:g.87921802_87921802dupA	ENSP00000309649:p.Gln285fs	Somatic		Capture	SOLID	Phase_I	86479301	NM_001739	B2RPF2	Frame_Shift_Ins	INS	ENST00000309893.2	37	CCDS10965.1																																																																																				0.505	CA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269164.1	NM_001739	
FBXO40	51725	hgsc.bcm.edu	37	3	121345568	121345569	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:121345568_121345569insA	ENST00000338040.4	+	4	2355_2356	c.1941_1942insA	c.(1942-1944)aaafs	p.K648fs		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	648					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I649fs*7(1)		NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		GCCTCTTCTCCAAAATCAAGAG	0.441																																					p.S647fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1941_1942insA	3						.																																			122828259	SO:0001589	frameshift_variant	51725	exon4			AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.1945dupA	3.37:g.121345572_121345572dupA	ENSP00000337510:p.Lys648fs	Somatic		Capture	SOLID	Phase_I	122828258	NM_016298	B2RAX7|Q32M70|Q9ULM5	Frame_Shift_Ins	INS	ENST00000338040.4	37	CCDS33835.1																																																																																				0.441	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	NM_016298	
TFR2	7036	hgsc.bcm.edu	37	7	100225548	100225548	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:100225548A>G	ENST00000462107.1	-	14	1874	c.1587T>C	c.(1585-1587)atT>atC	p.I529I	TFR2_ENST00000223051.3_Silent_p.I529I|TFR2_ENST00000544242.1_Silent_p.I70I|TFR2_ENST00000431692.1_3'UTR			Q9UP52	TFR2_HUMAN	transferrin receptor 2	529					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)	p.I529I(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	GGACACTCTCAATGAGACTTG	0.602																																					p.I529I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1587C	7						.						105.0	100.0	102.0					7																	100225548		2203	4300	6503	100063484	SO:0001819	synonymous_variant	7036	exon13			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.1587T>C	7.37:g.100225548A>G		Somatic		Capture	SOLID	Phase_I	100063484	NM_003227	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Silent	SNP	ENST00000462107.1	37	CCDS34707.1																																																																																				0.602	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
PUS7	54517	hgsc.bcm.edu	37	7	105098353	105098353	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:105098353T>C	ENST00000356362.2	-	16	2084	c.1870A>G	c.(1870-1872)Aaa>Gaa	p.K624E	PUS7_ENST00000469408.1_Missense_Mutation_p.K624E	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	624					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.K624E(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						AAATCCATTTTCAGAGCCCTG	0.448																																					p.K624E	Colon(138;2387 3051 17860)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1870G	7						.						122.0	115.0	117.0					7																	105098353		2203	4300	6503	104885589	SO:0001583	missense	54517	exon16			AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.1870A>G	7.37:g.105098353T>C	ENSP00000348722:p.Lys624Glu	Somatic		Capture	SOLID	Phase_I	104885589	NM_019042	Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	CCDS34725.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.297097	0.81025	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.41400	1.0;1.0	5.86	5.86	0.93980	Pseudouridine synthase, catalytic domain (1);	0.044218	0.85682	D	0.000000	T	0.47358	0.1441	L	0.55213	1.73	0.50632	D	0.999882	P;D	0.59767	0.947;0.986	P;P	0.54100	0.577;0.742	T	0.44050	-0.9353	10	0.02654	T	1	-27.0681	15.7408	0.77894	0.0:0.0:0.0:1.0	.	624;624	B3KY42;Q96PZ0	.;PUS7_HUMAN	E	624	ENSP00000348722:K624E;ENSP00000417402:K624E	ENSP00000348722:K624E	K	-	1	0	PUS7	104885589	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.737000	0.55060	2.367000	0.80283	0.528000	0.53228	AAA		0.448	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042	
LRRN3	54674	hgsc.bcm.edu	37	7	110763029	110763029	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:110763029G>A	ENST00000422987.3	+	2	1032	c.201G>A	c.(199-201)ttG>ttA	p.L67L	LRRN3_ENST00000451085.1_Silent_p.L67L|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|LRRN3_ENST00000308478.5_Silent_p.L67L|IMMP2L_ENST00000331762.3_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	67	LRRNT.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L67L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		CAGCCAGATTGCCAGCTAACA	0.398																																					p.L67L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G201A	7						.						135.0	123.0	127.0					7																	110763029		2203	4300	6503	110550265	SO:0001819	synonymous_variant	54674	exon2			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.201G>A	7.37:g.110763029G>A		Somatic		Capture	SOLID	Phase_I	110550265	NM_018334	O43377|Q6I9V8|Q8IYQ6	Silent	SNP	ENST00000422987.3	37	CCDS5754.1																																																																																				0.398	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
LRRN3	54674	hgsc.bcm.edu	37	7	110764291	110764291	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:110764291C>T	ENST00000422987.3	+	2	2294	c.1463C>T	c.(1462-1464)cCc>cTc	p.P488L	LRRN3_ENST00000451085.1_Missense_Mutation_p.P488L|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.P488L|IMMP2L_ENST00000331762.3_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	488	Ig-like C2-type.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P488L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		GGCGTAACTCCCAAAGAAGGG	0.403																																					p.P488L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1463T	7						.						62.0	62.0	62.0					7																	110764291		2203	4300	6503	110551527	SO:0001583	missense	54674	exon2			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1463C>T	7.37:g.110764291C>T	ENSP00000412417:p.Pro488Leu	Somatic		Capture	SOLID	Phase_I	110551527	NM_018334	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	C	7.097	0.573397	0.13623	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	D;D;D	0.95788	-3.81;-3.81;-3.81	6.17	5.3	0.74995	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.464737	0.20228	N	0.096549	D	0.88066	0.6337	N	0.13043	0.29	0.40378	D	0.979418	B	0.02656	0.0	B	0.06405	0.002	T	0.81996	-0.0676	10	0.20519	T	0.43	.	6.5244	0.22293	0.1814:0.6722:0.0:0.1464	.	488	Q9H3W5	LRRN3_HUMAN	L	488	ENSP00000312001:P488L;ENSP00000397312:P488L;ENSP00000412417:P488L	ENSP00000312001:P488L	P	+	2	0	LRRN3	110551527	0.490000	0.26012	0.941000	0.38009	0.911000	0.54048	2.416000	0.44644	1.625000	0.50366	0.655000	0.94253	CCC		0.403	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
SPAM1	6677	hgsc.bcm.edu	37	7	123594537	123594537	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:123594537C>A	ENST00000439500.1	+	4	1526	c.913C>A	c.(913-915)Cgc>Agc	p.R305S	SPAM1_ENST00000460182.1_Missense_Mutation_p.R305S|SPAM1_ENST00000402183.2_Missense_Mutation_p.R305S|SPAM1_ENST00000223028.7_Missense_Mutation_p.R305S|SPAM1_ENST00000340011.5_Missense_Mutation_p.R305S	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	305					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.R305S(2)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TGCATATACCCGCATAGTTTT	0.388																																					p.R305S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C913A	7						.						36.0	36.0	36.0					7																	123594537		2203	4299	6502	123381773	SO:0001583	missense	6677	exon3			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.913C>A	7.37:g.123594537C>A	ENSP00000402123:p.Arg305Ser	Somatic		Capture	SOLID	Phase_I	123381773	NM_001174044	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	37	CCDS5791.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.474718	0.63737	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75	6.17	6.17	0.99709	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.105283	0.64402	D	0.000004	T	0.66655	0.2811	H	0.95504	3.68	0.53005	D	0.999966	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75283	-0.3372	9	.	.	.	-25.9732	19.8676	0.96824	0.0:1.0:0.0:0.0	.	305;305	Q8TC30;P38567	.;HYALP_HUMAN	S	305	ENSP00000386028:R305S;ENSP00000417934:R305S;ENSP00000345849:R305S;ENSP00000402123:R305S;ENSP00000223028:R305S	.	R	+	1	0	SPAM1	123381773	0.993000	0.37304	0.524000	0.27887	0.057000	0.15508	3.101000	0.50283	2.941000	0.99782	0.655000	0.94253	CGC		0.388	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1		
FSCN3	29999	hgsc.bcm.edu	37	7	127235723	127235723	+	Silent	SNP	C	C	T	rs371544770		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:127235723C>T	ENST00000265825.5	+	2	726	c.507C>T	c.(505-507)gaC>gaT	p.D169D	FSCN3_ENST00000420086.2_Silent_p.D35D|GCC1_ENST00000497650.1_5'Flank	NM_020369.2	NP_065102.1	Q9NQT6	FSCN3_HUMAN	fascin actin-bundling protein 3, testicular	169						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.D169D(1)		endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30						TCTGGGTGGACGCAGCAGTTC	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		16614	0.0		0.0	False		,,,				2504	0.001				p.D169D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C507T	7						.	C		1,4405	2.1+/-5.4	0,1,2202	143.0	114.0	124.0		507	-8.8	0.0	7		124	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FSCN3	NM_020369.2		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		169/499	127235723	2,13004	2203	4300	6503	127022959	SO:0001819	synonymous_variant	29999	exon2				CCDS34746.1	7q31.3	2014-02-03	2014-02-03		ENSG00000106328	ENSG00000106328		"""Fascins"""	3961	protein-coding gene	gene with protein product		615800	"""fascin (Strongylocentrotus purpuratus) homolog 3 (actin-bundling protein, testicular)"", ""fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)"""			11925108	Standard	NM_020369		Approved		uc003vmd.2	Q9NQT6	OTTHUMG00000022935	ENST00000265825.5:c.507C>T	7.37:g.127235723C>T		Somatic		Capture	SOLID	Phase_I	127022959	NM_020369	A4D0Z2|A6NLL7|B2RA62|B4DU68	Silent	SNP	ENST00000265825.5	37	CCDS34746.1																																																																																				0.612	FSCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059256.2	NM_020369	
ATP6V0A4	50617	hgsc.bcm.edu	37	7	138394386	138394386	+	Silent	SNP	G	G	A	rs372230422	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:138394386G>A	ENST00000310018.2	-	21	2694	c.2412C>T	c.(2410-2412)caC>caT	p.H804H	ATP6V0A4_ENST00000393054.1_Silent_p.H804H|ATP6V0A4_ENST00000353492.4_Silent_p.H804H	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	804					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)	p.H804H(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GTCGCAGGGCGTGCAGGAAAG	0.557													G|||	2	0.000399361	0.0	0.0	5008	,	,		14118	0.0		0.0	False		,,,				2504	0.002				p.H804H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2412T	7						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	177.0	174.0	175.0		2412,2412,2412	-9.0	0.3	7		175	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	ATP6V0A4	NM_020632.2,NM_130840.2,NM_130841.2	,,	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	,,	804/841,804/841,804/841	138394386	3,13003	2203	4300	6503	138044926	SO:0001819	synonymous_variant	50617	exon20			AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.2412C>T	7.37:g.138394386G>A		Somatic		Capture	SOLID	Phase_I	138044926	NM_130840	A4D1R4|A8KA80|Q32M47	Silent	SNP	ENST00000310018.2	37	CCDS5849.1																																																																																				0.557	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	NM_020632	
HEATR2	54919	hgsc.bcm.edu	37	7	819635	819635	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:819635C>T	ENST00000297440.6	+	12	2305	c.2285C>T	c.(2284-2286)gCa>gTa	p.A762V	HEATR2_ENST00000403952.3_Missense_Mutation_p.A187V|HEATR2_ENST00000313147.5_Missense_Mutation_p.A762V	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	762						cytoplasm (GO:0005737)		p.A762V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		GTGAGGATGGCAGCCGCCTCC	0.532																																					p.A762V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2285T	7						.						128.0	101.0	110.0					7																	819635		2203	4300	6503	786161	SO:0001583	missense	54919	exon12			AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.2285C>T	7.37:g.819635C>T	ENSP00000297440:p.Ala762Val	Somatic		Capture	SOLID	Phase_I	786161	NM_017802	Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	ENST00000297440.6	37	CCDS34580.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116740	0.77323	.	.	ENSG00000164818	ENST00000297440;ENST00000313147;ENST00000537862;ENST00000403952	T;T;T	0.67865	-0.29;-0.29;-0.29	4.22	4.22	0.49857	Armadillo-like helical (1);Armadillo-type fold (1);	0.236571	0.41605	D	0.000845	T	0.77082	0.4078	M	0.63843	1.955	0.40931	D	0.98439	P;D;P	0.67145	0.815;0.996;0.793	P;D;B	0.63283	0.531;0.913;0.362	T	0.77512	-0.2560	10	0.34782	T	0.22	-11.3063	16.5517	0.84474	0.0:1.0:0.0:0.0	.	762;187;508	Q86Y56;E9PGY2;F5H8D4	HEAT2_HUMAN;.;.	V	762;762;508;187	ENSP00000297440:A762V;ENSP00000321451:A762V;ENSP00000384884:A187V	ENSP00000297440:A762V	A	+	2	0	HEATR2	786161	0.995000	0.38212	0.015000	0.15790	0.179000	0.23085	5.171000	0.64996	2.049000	0.60858	0.550000	0.68814	GCA		0.532	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1	NM_017802	
CARD11	84433	hgsc.bcm.edu	37	7	2974209	2974209	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:2974209T>C	ENST00000396946.4	-	10	1799	c.1396A>G	c.(1396-1398)Agc>Ggc	p.S466G		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	466					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.S459G(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GTCCTGGGGCTGGCATCCCCA	0.577			Mis		DLBCL																																p.S466G			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1396G	7						.						100.0	86.0	90.0					7																	2974209		2203	4300	6503	2940735	SO:0001583	missense	84433	exon10			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1396A>G	7.37:g.2974209T>C	ENSP00000380150:p.Ser466Gly	Somatic		Capture	SOLID	Phase_I	2940735	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	T	3.895	-0.023139	0.07634	.	.	ENSG00000198286	ENST00000396946	T	0.51817	0.69	5.22	2.78	0.32641	.	0.430857	0.27544	N	0.018885	T	0.23289	0.0563	N	0.08118	0	0.34514	D	0.707417	B	0.06786	0.001	B	0.09377	0.004	T	0.19353	-1.0308	10	0.15066	T	0.55	-28.7646	8.9408	0.35729	0.0:0.227:0.0:0.773	.	466	Q9BXL7	CAR11_HUMAN	G	466	ENSP00000380150:S466G	ENSP00000380150:S466G	S	-	1	0	CARD11	2940735	0.595000	0.26857	0.956000	0.39512	0.739000	0.42172	0.474000	0.22148	0.300000	0.22699	0.459000	0.35465	AGC		0.577	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
RBAK	57786	hgsc.bcm.edu	37	7	5103891	5103891	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:5103891A>G	ENST00000353796.3	+	6	1128	c.804A>G	c.(802-804)aaA>aaG	p.K268K	RBAK_ENST00000396912.1_Silent_p.K268K|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	268					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.K268K(1)		NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		AATGTGGAAAATCCTTCTGTA	0.388																																					p.K268K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A804G	7						.						63.0	65.0	64.0					7																	5103891		2203	4300	6503	5070417	SO:0001819	synonymous_variant	57786	exon5			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.804A>G	7.37:g.5103891A>G		Somatic		Capture	SOLID	Phase_I	5070417	NM_021163	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Silent	SNP	ENST00000353796.3	37	CCDS5337.1																																																																																				0.388	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163	
SP4	6671	hgsc.bcm.edu	37	7	21469764	21469764	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:21469764T>C	ENST00000222584.3	+	3	1199	c.981T>C	c.(979-981)acT>acC	p.T327T		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	327					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.T327T(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GCACAACCACTGCTTCAACGT	0.488																																					p.T327T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T981C	7						.						147.0	99.0	116.0					7																	21469764		2203	4300	6503	21436289	SO:0001819	synonymous_variant	6671	exon3				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.981T>C	7.37:g.21469764T>C		Somatic		Capture	SOLID	Phase_I	21436289	NM_003112	O60402|Q32M52	Silent	SNP	ENST00000222584.3	37	CCDS5373.1																																																																																				0.488	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
EGFR	1956	hgsc.bcm.edu	37	7	55224280	55224280	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:55224280C>T	ENST00000275493.2	+	9	1238	c.1061C>T	c.(1060-1062)aCg>aTg	p.T354M	EGFR_ENST00000442591.1_Missense_Mutation_p.T354M|EGFR_ENST00000420316.2_Missense_Mutation_p.T354M|EGFR_ENST00000455089.1_Missense_Mutation_p.T309M|EGFR_ENST00000342916.3_Missense_Mutation_p.T354M|EGFR_ENST00000344576.2_Missense_Mutation_p.T354M|EGFR_ENST00000454757.2_Missense_Mutation_p.T301M	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	354					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.T354M(2)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	ATAAATGCTACGAATATTAAA	0.428		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.T354M		yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1061T	7						.						90.0	92.0	92.0					7																	55224280		2203	4300	6503	55191774	SO:0001583	missense	1956	exon9	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.1061C>T	7.37:g.55224280C>T	ENSP00000275493:p.Thr354Met	Somatic		Capture	SOLID	Phase_I	55191774	NM_201282	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522585	0.85600	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77	5.95	5.95	0.96441	.	0.045880	0.85682	D	0.000000	T	0.71600	0.3359	M	0.84683	2.71	0.58432	D	0.999998	D;D;D;D;P	0.89917	0.986;0.987;1.0;1.0;0.91	P;P;D;D;B	0.79108	0.649;0.46;0.992;0.972;0.19	T	0.75326	-0.3357	10	0.87932	D	0	.	14.5476	0.68044	0.0:0.8538:0.1462:0.0	.	309;354;354;354;354	Q504U8;P00533;P00533-3;P00533-4;P00533-2	.;EGFR_HUMAN;.;.;.	M	309;354;224;354;354;354;354;301;148	ENSP00000415559:T309M;ENSP00000342376:T354M;ENSP00000345973:T354M;ENSP00000413843:T354M;ENSP00000275493:T354M;ENSP00000410031:T354M;ENSP00000395243:T301M	ENSP00000275493:T354M	T	+	2	0	EGFR	55191774	0.987000	0.35691	0.988000	0.46212	0.865000	0.49528	3.609000	0.54117	2.825000	0.97269	0.655000	0.94253	ACG		0.428	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
SEMA3E	9723	hgsc.bcm.edu	37	7	82997078	82997078	+	Missense_Mutation	SNP	C	C	A	rs148649507		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:82997078C>A	ENST00000307792.3	-	17	2619	c.2152G>T	c.(2152-2154)Ggt>Tgt	p.G718C	SEMA3E_ENST00000427262.1_Missense_Mutation_p.G658C	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	718					axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.G718C(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				TTGCTATAACCGATCAGCTGC	0.473																																					p.G718C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2152T	7						.						163.0	152.0	156.0					7																	82997078		2203	4300	6503	82835014	SO:0001583	missense	9723	exon17			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.2152G>T	7.37:g.82997078C>A	ENSP00000303212:p.Gly718Cys	Somatic		Capture	SOLID	Phase_I	82835014	NM_012431	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	37	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277531	0.80580	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.79454	-1.27;-1.27	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.88976	0.6584	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89293	0.3620	10	0.72032	D	0.01	.	19.9343	0.97131	0.0:1.0:0.0:0.0	.	718	O15041	SEM3E_HUMAN	C	718;658;718	ENSP00000303212:G718C;ENSP00000405052:G658C	ENSP00000303212:G718C	G	-	1	0	SEMA3E	82835014	1.000000	0.71417	0.884000	0.34674	0.726000	0.41606	7.228000	0.78079	2.719000	0.93026	0.585000	0.79938	GGT		0.473	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
DMTF1	9988	hgsc.bcm.edu	37	7	86811625	86811625	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:86811625C>T	ENST00000394703.5	+	12	1355	c.792C>T	c.(790-792)tgC>tgT	p.C264C	DMTF1_ENST00000414194.2_5'UTR|DMTF1_ENST00000331242.7_Silent_p.C264C|DMTF1_ENST00000432937.2_Silent_p.C176C|DMTF1_ENST00000411766.2_3'UTR|DMTF1_ENST00000413276.2_Silent_p.C264C	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	264	Interaction with CCND1, CCND2 and CCND3. {ECO:0000250}.|Required for DNA-binding. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C264C(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					AAGATCGGTGCCGACTGATGA	0.493																																					p.C264C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C792T	7						.						159.0	142.0	148.0					7																	86811625		2203	4300	6503	86649561	SO:0001819	synonymous_variant	9988	exon10			AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.792C>T	7.37:g.86811625C>T		Somatic		Capture	SOLID	Phase_I	86649561	NM_001142327	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Silent	SNP	ENST00000394703.5	37	CCDS5601.1																																																																																				0.493	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334025.5	NM_021145	
ABCB4	5244	hgsc.bcm.edu	37	7	87038679	87038679	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:87038679A>G	ENST00000265723.4	-	24	3065	c.2954T>C	c.(2953-2955)gTg>gCg	p.V985A	ABCB4_ENST00000545634.1_Missense_Mutation_p.V985A|ABCB4_ENST00000453593.1_Missense_Mutation_p.V938A|ABCB4_ENST00000358400.3_Missense_Mutation_p.V938A|ABCB4_ENST00000359206.3_Missense_Mutation_p.V985A	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	985	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.V985A(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TCCTAGAGCCACTGCACCAAA	0.393																																					p.V985A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2954C	7						.						110.0	106.0	107.0					7																	87038679		2203	4300	6503	86876615	SO:0001583	missense	5244	exon24			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2954T>C	7.37:g.87038679A>G	ENSP00000265723:p.Val985Ala	Somatic		Capture	SOLID	Phase_I	86876615	NM_018849	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	A	15.86	2.957204	0.53293	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;T;D;T;D	0.89617	-2.54;-1.3;-2.54;-1.3;-2.54	5.58	4.43	0.53597	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.146217	0.64402	D	0.000011	T	0.77857	0.4193	N	0.04636	-0.2	0.38412	D	0.945947	B;B;B	0.19445	0.005;0.012;0.036	B;B;B	0.29353	0.004;0.061;0.101	T	0.77122	-0.2704	10	0.62326	D	0.03	-15.8142	11.2268	0.48888	0.9284:0.0:0.0716:0.0	.	938;985;985	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	A	985;938;985;938;985	ENSP00000352135:V985A;ENSP00000351172:V938A;ENSP00000265723:V985A;ENSP00000392983:V938A;ENSP00000437465:V985A	ENSP00000265723:V985A	V	-	2	0	ABCB4	86876615	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.199000	0.58426	2.255000	0.74692	0.533000	0.62120	GTG		0.393	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
ZSCAN25	221785	hgsc.bcm.edu	37	7	99227507	99227507	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:99227507G>A	ENST00000394152.2	+	8	1826	c.1499G>A	c.(1498-1500)cGg>cAg	p.R500Q	ZSCAN25_ENST00000466948.1_Intron|ZSCAN25_ENST00000262941.6_Missense_Mutation_p.R428Q|ZSCAN25_ENST00000334715.3_Missense_Mutation_p.R500Q	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	500					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R500Q(1)									AAAGGGGAGCGGCTGGTCCGA	0.622																																					p.R500Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1499A	7						.						68.0	54.0	59.0					7																	99227507		2203	4300	6503	99065443	SO:0001583	missense	221785	exon8			AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.1499G>A	7.37:g.99227507G>A	ENSP00000377708:p.Arg500Gln	Somatic		Capture	SOLID	Phase_I	99065443	NM_145115	A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Missense_Mutation	SNP	ENST00000394152.2	37	CCDS5671.2	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531682	0.64972	.	.	ENSG00000197037	ENST00000394152;ENST00000334715;ENST00000262941	T;T;T	0.60299	0.2;0.2;1.29	4.49	2.62	0.31277	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.210017	0.24128	N	0.041288	T	0.36220	0.0959	N	0.12663	0.25	0.30566	N	0.763977	D;P	0.62365	0.991;0.782	P;B	0.47981	0.563;0.148	T	0.26360	-1.0105	10	0.20519	T	0.43	-27.5702	3.8928	0.09127	0.1946:0.22:0.5854:0.0	.	428;500	Q6NSZ9-2;Q6NSZ9	.;ZN498_HUMAN	Q	500;500;428	ENSP00000377708:R500Q;ENSP00000334800:R500Q;ENSP00000262941:R428Q	ENSP00000262941:R428Q	R	+	2	0	ZNF498	99065443	0.000000	0.05858	0.999000	0.59377	0.998000	0.95712	-0.009000	0.12765	1.151000	0.42436	0.555000	0.69702	CGG		0.622	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157203.4	NM_145115	
VIPR2	7434	hgsc.bcm.edu	37	7	158896453	158896453	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr7:158896453T>C	ENST00000262178.2	-	4	537	c.352A>G	c.(352-354)Agc>Ggc	p.S118G	VIPR2_ENST00000402066.1_Missense_Mutation_p.S259G	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	118					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)	p.S118G(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		CCTACCTTGCTCTCATCCTCC	0.527																																					p.S118G	Pancreas(154;1876 1931 2329 17914 20079)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A352G	7						.						169.0	146.0	154.0					7																	158896453		2203	4300	6503	158589214	SO:0001583	missense	7434	exon4			CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.352A>G	7.37:g.158896453T>C	ENSP00000262178:p.Ser118Gly	Somatic		Capture	SOLID	Phase_I	158589214	NM_003382	Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Missense_Mutation	SNP	ENST00000262178.2	37	CCDS5950.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.848|2.848	-0.238953|-0.238953	0.05944|0.05944	.|.	.|.	ENSG00000106018|ENSG00000106018	ENST00000418475|ENST00000262178;ENST00000402066	.|T;T	.|0.46451	.|0.91;0.87	4.85|4.85	-1.8|-1.8	0.07907|0.07907	.|GPCR, family 2, extracellular hormone receptor domain (1);	.|0.628574	.|0.14669	.|N	.|0.305488	T|T	0.19725|0.19725	0.0474|0.0474	N|N	0.12746|0.12746	0.255|0.255	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.23119|0.23119	-1.0197|-1.0197	5|9	.|.	.|.	.|.	.|.	8.8536|8.8536	0.35214|0.35214	0.0:0.4749:0.0:0.5251|0.0:0.4749:0.0:0.5251	.|.	.|118	.|P41587	.|VIPR2_HUMAN	G|G	113|118;259	.|ENSP00000262178:S118G;ENSP00000384497:S259G	.|.	E|S	-|-	2|1	0|0	VIPR2|VIPR2	158589214|158589214	0.017000|0.017000	0.18338|0.18338	0.007000|0.007000	0.13788|0.13788	0.001000|0.001000	0.01503|0.01503	0.046000|0.046000	0.14035|0.14035	-0.260000|-0.260000	0.09418|0.09418	-0.371000|-0.371000	0.07208|0.07208	GAG|AGC		0.527	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322675.1	NM_003382	
SCP2D1	140856	hgsc.bcm.edu	37	20	18794792	18794792	+	Silent	SNP	G	G	A	rs368734818		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:18794792G>A	ENST00000377428.2	+	1	423	c.333G>A	c.(331-333)ccG>ccA	p.P111P	C20orf78_ENST00000278779.4_Intron|C20orf78_ENST00000463425.1_5'Flank	NM_178483.2	NP_848578.1	Q9UJQ7	SCP2D_HUMAN	SCP2 sterol-binding domain containing 1	111	SCP2.							p.P111P(1)									TTACAATCCCGGAGTCTGTCT	0.512													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17455	0.0		0.0	False		,,,				2504	0.0				p.P111P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G333A	20						.	G	,	2,4404	4.2+/-10.8	0,2,2201	57.0	62.0	60.0		,333	-12.2	0.1	20		60	0,8600		0,0,4300	no	intron,coding-synonymous	C20orf79,LOC100128496	NM_001242671.1,NM_178483.2	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	,111/157	18794792	2,13004	2203	4300	6503	18742792	SO:0001819	synonymous_variant	140856	exon1			AL035563	CCDS13139.1	20p11.23	2012-10-29	2012-10-29	2012-10-29	ENSG00000132631	ENSG00000132631			16211	protein-coding gene	gene with protein product	"""sterol carrier protein 2-like protein"""		"""chromosome 20 open reading frame 79"""	C20orf79		16501878	Standard	NM_178483		Approved	dJ1068E13.2, HSD22	uc002wrk.3	Q9UJQ7	OTTHUMG00000031983	ENST00000377428.2:c.333G>A	20.37:g.18794792G>A		Somatic		Capture	SOLID	Phase_I	18742792	NM_178483	Q548A4	Silent	SNP	ENST00000377428.2	37	CCDS13139.1																																																																																				0.512	SCP2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078193.1	NM_178483	
ZNF343	79175	hgsc.bcm.edu	37	20	2464938	2464938	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:2464938A>G	ENST00000278772.4	-	6	1156	c.669T>C	c.(667-669)ccT>ccC	p.P223P	RP4-734P14.4_ENST00000461548.1_Intron	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P223P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						CTAGCTGCACAGGGTTTGGTC	0.473																																					p.P223P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T669C	20						.						115.0	114.0	115.0					20																	2464938		2203	4300	6503	2412938	SO:0001819	synonymous_variant	79175	exon6			AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.669T>C	20.37:g.2464938A>G		Somatic		Capture	SOLID	Phase_I	2412938	NM_024325	Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Silent	SNP	ENST00000278772.4	37	CCDS13028.1																																																																																				0.473	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077617.1	NM_024325	
CST9	128822	hgsc.bcm.edu	37	20	23586352	23586352	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:23586352T>C	ENST00000376971.3	-	1	161	c.150A>G	c.(148-150)acA>acG	p.T50T		NM_001008693.2	NP_001008693.2	Q5W186	CST9_HUMAN	cystatin 9 (testatin)	50						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.T50T(1)		central_nervous_system(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Colorectal(13;0.0993)					CAAACTCCACTGTGGCGAGGA	0.502																																					p.T50T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A150G	20						.						278.0	230.0	246.0					20																	23586352		2203	4300	6503	23534352	SO:0001819	synonymous_variant	128822	exon1			AF494536	CCDS33450.1	20p11.21	2012-08-14			ENSG00000173335	ENSG00000173335			13261	protein-coding gene	gene with protein product						20565543	Standard	NM_001008693		Approved	CLM, CTES7A	uc002wtl.3	Q5W186	OTTHUMG00000032076	ENST00000376971.3:c.150A>G	20.37:g.23586352T>C		Somatic		Capture	SOLID	Phase_I	23534352	NM_001008693	B2RP76|Q8TD53	Silent	SNP	ENST00000376971.3	37	CCDS33450.1																																																																																				0.502	CST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078341.1	NM_001008693.1	
SRC	6714	hgsc.bcm.edu	37	20	36028676	36028676	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:36028676G>A	ENST00000373578.2	+	10	1367	c.1018G>A	c.(1018-1020)Gtc>Atc	p.V340I	SRC_ENST00000477066.1_3'UTR|SRC_ENST00000358208.4_Missense_Mutation_p.V340I|SRC_ENST00000373567.2_Missense_Mutation_p.V340I|SRC_ENST00000445403.1_Missense_Mutation_p.V340I|SRC_ENST00000373558.2_Missense_Mutation_p.V346I|SRC_ENST00000360723.4_Missense_Mutation_p.V346I	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	340	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)	p.V340I(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	CATTTACATCGTCACGGAGTA	0.597																																					p.V340I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1018A	20						.						86.0	76.0	80.0					20																	36028676		2203	4300	6503	35462090	SO:0001583	missense	6714	exon10			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.1018G>A	20.37:g.36028676G>A	ENSP00000362680:p.Val340Ile	Somatic		Capture	SOLID	Phase_I	35462090	NM_005417	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	37	CCDS13294.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139327	0.37728	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	D;D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84;-1.84	4.98	4.98	0.66077	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76695	0.4023	L	0.28458	0.855	0.80722	D	1	B	0.23735	0.09	B	0.16722	0.016	T	0.71210	-0.4660	10	0.16896	T	0.51	.	15.8004	0.78450	0.0:0.0:1.0:0.0	.	340	P12931	SRC_HUMAN	I	340;340;346;340;340;346	ENSP00000408503:V340I;ENSP00000362680:V340I;ENSP00000353950:V346I;ENSP00000350941:V340I;ENSP00000362668:V340I;ENSP00000362659:V346I	ENSP00000350941:V340I	V	+	1	0	SRC	35462090	1.000000	0.71417	0.961000	0.40146	0.657000	0.38888	9.657000	0.98554	2.584000	0.87258	0.561000	0.74099	GTC		0.597	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417	
R3HDML	140902	hgsc.bcm.edu	37	20	42979342	42979342	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:42979342G>A	ENST00000217043.2	+	5	844	c.672G>A	c.(670-672)ccG>ccA	p.P224P	RP5-881L22.5_ENST00000438702.1_RNA|RP5-881L22.5_ENST00000430481.2_RNA	NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	224						extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)	p.P224P(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			TGGGAAAGCCGTGCTCCTCCT	0.517																																					p.P224P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G672A	20						.						127.0	108.0	115.0					20																	42979342		2203	4300	6503	42412756	SO:0001819	synonymous_variant	140902	exon5			BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.672G>A	20.37:g.42979342G>A		Somatic		Capture	SOLID	Phase_I	42412756	NM_178491		Silent	SNP	ENST00000217043.2	37	CCDS13329.1																																																																																				0.517	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079344.1	NM_178491	
B4GALT5	9334	hgsc.bcm.edu	37	20	48260138	48260138	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:48260138A>G	ENST00000371711.4	-	4	601	c.414T>C	c.(412-414)caT>caC	p.H138H		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	138					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)	p.H138H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			AGAAGAGTTCATGAATGTAAT	0.458																																					p.H138H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T414C	20						.						200.0	178.0	185.0					20																	48260138		2203	4300	6503	47693545	SO:0001819	synonymous_variant	9334	exon4			AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.414T>C	20.37:g.48260138A>G		Somatic		Capture	SOLID	Phase_I	47693545	NM_004776	E1P625|Q2M394|Q9UJQ8	Silent	SNP	ENST00000371711.4	37	CCDS13420.1																																																																																				0.458	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3	NM_004776	
BCAS1	8537	hgsc.bcm.edu	37	20	52645359	52645359	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:52645359G>A	ENST00000395961.3	-	4	461	c.295C>T	c.(295-297)Ctc>Ttc	p.L99F	BCAS1_ENST00000411563.1_Missense_Mutation_p.L2F|BCAS1_ENST00000371440.3_Missense_Mutation_p.L99F|BCAS1_ENST00000371435.2_Missense_Mutation_p.L99F	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	99						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.L99F(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			GGCCGAGAGAGCATCAAGAAA	0.512																																					p.L99F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C295T	20						.						85.0	75.0	79.0					20																	52645359		2203	4300	6503	52078766	SO:0001583	missense	8537	exon4			AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.295C>T	20.37:g.52645359G>A	ENSP00000379290:p.Leu99Phe	Somatic		Capture	SOLID	Phase_I	52078766	NM_003657	A0AVG5|Q68CZ3	Missense_Mutation	SNP	ENST00000395961.3	37	CCDS13444.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816132	0.70912	.	.	ENSG00000064787	ENST00000371440;ENST00000395961;ENST00000371435;ENST00000411563	T;T;T;T	0.60548	2.08;2.08;2.08;0.18	4.97	4.02	0.46733	.	0.315469	0.30639	N	0.009183	T	0.48857	0.1523	L	0.52759	1.655	0.32040	N	0.598381	P;B;B;P;B;B	0.46912	0.733;0.215;0.215;0.886;0.412;0.412	B;B;B;B;B;B	0.41723	0.339;0.139;0.139;0.365;0.148;0.148	T	0.60707	-0.7210	10	0.48119	T	0.1	-7.4402	7.927	0.29880	0.1896:0.0:0.8104:0.0	.	2;99;99;99;99;99	B4E2C4;B2RCQ5;O75363-2;G3XAF7;A0AVG7;O75363	.;.;.;.;.;BCAS1_HUMAN	F	99;99;99;2	ENSP00000360495:L99F;ENSP00000379290:L99F;ENSP00000360490:L99F;ENSP00000397442:L2F	ENSP00000360490:L99F	L	-	1	0	BCAS1	52078766	0.996000	0.38824	0.876000	0.34364	0.988000	0.76386	2.829000	0.48128	1.219000	0.43474	0.462000	0.41574	CTC		0.512	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	NM_003657	
BMP2	650	hgsc.bcm.edu	37	20	6759343	6759343	+	Silent	SNP	T	T	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:6759343T>A	ENST00000378827.4	+	3	2017	c.798T>A	c.(796-798)acT>acA	p.T266T		NM_001200.2	NP_001191.1	P12643	BMP2_HUMAN	bone morphogenetic protein 2	266					activation of MAPK activity (GO:0000187)|atrioventricular valve morphogenesis (GO:0003181)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|bone mineralization (GO:0030282)|bone mineralization involved in bone maturation (GO:0035630)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiocyte differentiation (GO:0035051)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation (GO:0002062)|corticotropin hormone secreting cell differentiation (GO:0060128)|embryo development (GO:0009790)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchyme development (GO:0060485)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of calcium-independent cell-cell adhesion (GO:0051042)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|pericardium development (GO:0060039)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of odontogenesis (GO:0042482)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of Wnt signaling pathway by BMP signaling pathway (GO:0060804)|protein destabilization (GO:0031648)|protein phosphorylation (GO:0006468)|proteoglycan metabolic process (GO:0006029)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP receptor binding (GO:0070700)|phosphatase activator activity (GO:0019211)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)|retinol dehydrogenase activity (GO:0004745)|SMAD binding (GO:0046332)	p.T266T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	13						TGCTAGTAACTTTTGGCCATG	0.463																																					p.T266T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T798A	20						.						77.0	64.0	69.0					20																	6759343		2203	4300	6503	6707343	SO:0001819	synonymous_variant	650	exon3				CCDS13099.1	20p12	2014-01-30			ENSG00000125845	ENSG00000125845		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1069	protein-coding gene	gene with protein product		112261		BMP2A		2376592	Standard	NM_001200		Approved		uc002wmu.1	P12643	OTTHUMG00000031833	ENST00000378827.4:c.798T>A	20.37:g.6759343T>A		Somatic		Capture	SOLID	Phase_I	6707343	NM_001200		Silent	SNP	ENST00000378827.4	37	CCDS13099.1																																																																																				0.463	BMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077918.3		
PLCB1	23236	hgsc.bcm.edu	37	20	8745968	8745968	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:8745968G>T	ENST00000338037.6	+	26	2920	c.2893G>T	c.(2893-2895)Gct>Tct	p.A965S	PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Missense_Mutation_p.A965S|PLCB1_ENST00000378637.2_Missense_Mutation_p.A965S	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	965					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.A965S(1)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						AAGGAGAGCCGCTTTGGAAAA	0.358																																					p.A965S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2893T	20						.						60.0	66.0	64.0					20																	8745968		2203	4300	6503	8693968	SO:0001583	missense	23236	exon26			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2893G>T	20.37:g.8745968G>T	ENSP00000338185:p.Ala965Ser	Somatic		Capture	SOLID	Phase_I	8693968	NM_182734	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.245468	0.22796	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.17854	2.25;2.26;2.25	5.77	4.82	0.62117	.	0.112685	0.64402	D	0.000009	T	0.08492	0.0211	N	0.08118	0	0.37764	D	0.926417	B;B	0.18310	0.003;0.027	B;B	0.21546	0.004;0.035	T	0.22800	-1.0206	10	0.11485	T	0.65	.	11.0779	0.48043	0.1414:0.0:0.8586:0.0	.	965;965	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	S	965;965;965;885;885	ENSP00000367908:A965S;ENSP00000338185:A965S;ENSP00000367904:A965S	ENSP00000338185:A965S	A	+	1	0	PLCB1	8693968	1.000000	0.71417	0.965000	0.40720	0.910000	0.53928	6.416000	0.73332	1.583000	0.49898	0.650000	0.86243	GCT		0.358	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
ZBP1	81030	hgsc.bcm.edu	37	20	56188368	56188368	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr20:56188368G>A	ENST00000371173.3	-	5	698	c.521C>T	c.(520-522)gCa>gTa	p.A174V	ZBP1_ENST00000541799.1_Missense_Mutation_p.A174V|ZBP1_ENST00000538947.1_5'Flank|ZBP1_ENST00000343535.4_Missense_Mutation_p.A174V|ZBP1_ENST00000340462.4_Missense_Mutation_p.A151V|ZBP1_ENST00000395822.3_Missense_Mutation_p.A99V	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	174					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)	p.A174V(1)		large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			GGCTGACTTTGCTCTTCTTCC	0.453																																					p.A174V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C521T	20						.						184.0	168.0	173.0					20																	56188368		2203	4300	6503	55621774	SO:0001583	missense	81030	exon5			AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.521C>T	20.37:g.56188368G>A	ENSP00000360215:p.Ala174Val	Somatic		Capture	SOLID	Phase_I	55621774	NM_001160419	A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Missense_Mutation	SNP	ENST00000371173.3	37	CCDS13461.1	.	.	.	.	.	.	.	.	.	.	G	7.199	0.593091	0.13875	.	.	ENSG00000124256	ENST00000371173;ENST00000395822;ENST00000340462;ENST00000357677;ENST00000343535;ENST00000541799	T;T;T;T;T	0.12672	3.03;2.66;3.02;3.0;2.68	2.86	-2.76	0.05896	Winged helix-turn-helix transcription repressor DNA-binding (1);	1.717780	0.03516	N	0.220246	T	0.12390	0.0301	L	0.36672	1.1	0.09310	N	1	P;P;D;P	0.53619	0.764;0.802;0.961;0.891	B;B;P;B	0.45343	0.161;0.249;0.477;0.382	T	0.21965	-1.0230	10	0.38643	T	0.18	0.0011	4.529	0.11995	0.0:0.2535:0.4389:0.3076	.	174;174;99;174	F5GYT1;A2RRL9;A2A2F7;Q9H171	.;.;.;ZBP1_HUMAN	V	174;99;151;174;174;174	ENSP00000360215:A174V;ENSP00000379167:A99V;ENSP00000344954:A151V;ENSP00000340584:A174V;ENSP00000440552:A174V	ENSP00000344954:A151V	A	-	2	0	ZBP1	55621774	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.205000	0.09411	-0.628000	0.05582	0.462000	0.41574	GCA		0.453	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776	
TOX4	9878	hgsc.bcm.edu	37	14	21955761	21955761	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr14:21955761A>G	ENST00000405508.1	+	4	503	c.227A>G	c.(226-228)cAg>cGg	p.Q76R	TOX4_ENST00000494242.1_3'UTR|TOX4_ENST00000448790.2_Missense_Mutation_p.Q53R|TOX4_ENST00000262709.3_Missense_Mutation_p.Q76R			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	76						chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)	p.Q76R(1)		large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		TTTTCAGCCCAGTATGGGGTC	0.572																																					p.Q76R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A227G	14						.						118.0	109.0	112.0					14																	21955761		2203	4300	6503	21025601	SO:0001583	missense	9878	exon3			AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.227A>G	14.37:g.21955761A>G	ENSP00000385102:p.Gln76Arg	Somatic		Capture	SOLID	Phase_I	21025601	NM_014828	B4DPY8|B4DSM0|E7EV69	Missense_Mutation	SNP	ENST00000405508.1	37	CCDS32043.1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.603057	0.66445	.	.	ENSG00000092203	ENST00000416256;ENST00000405508;ENST00000262709;ENST00000457430;ENST00000448790	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	5.43	5.43	0.79202	.	0.263835	0.38837	N	0.001551	T	0.58163	0.2103	L	0.52573	1.65	0.35827	D	0.825029	P;D	0.57257	0.92;0.979	B;P	0.51487	0.346;0.671	T	0.69811	-0.5044	10	0.62326	D	0.03	.	14.7597	0.69596	1.0:0.0:0.0:0.0	.	53;76	B4DPY8;O94842	.;TOX4_HUMAN	R	105;76;76;53;53	ENSP00000402195:Q105R;ENSP00000385102:Q76R;ENSP00000262709:Q76R;ENSP00000406196:Q53R;ENSP00000393080:Q53R	ENSP00000262709:Q76R	Q	+	2	0	TOX4	21025601	0.999000	0.42202	0.991000	0.47740	0.995000	0.86356	3.729000	0.54999	2.175000	0.68902	0.533000	0.62120	CAG		0.572	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317287.2	NM_014828	
MMP14	4323	hgsc.bcm.edu	37	14	23313925	23313925	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr14:23313925G>A	ENST00000311852.6	+	8	1498	c.1237G>A	c.(1237-1239)Gac>Aac	p.D413N	MMP14_ENST00000548162.1_3'UTR	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	413					angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.D413N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	GCTGCCTACCGACAAGATTGA	0.557																																					p.D413N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1237A	14						.						114.0	117.0	116.0					14																	23313925		2203	4300	6503	22383765	SO:0001583	missense	4323	exon8				CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.1237G>A	14.37:g.23313925G>A	ENSP00000308208:p.Asp413Asn	Somatic		Capture	SOLID	Phase_I	22383765	NM_004995	A8K5L0|Q6GSF3|Q92678	Missense_Mutation	SNP	ENST00000311852.6	37	CCDS9577.1	.	.	.	.	.	.	.	.	.	.	G	34	5.310724	0.95629	.	.	ENSG00000157227	ENST00000311852	T	0.08282	3.11	5.51	5.51	0.81932	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.14527	0.0351	L	0.36672	1.1	0.80722	D	1	D	0.56035	0.974	P	0.51170	0.661	T	0.00615	-1.1643	10	0.46703	T	0.11	.	18.2078	0.89860	0.0:0.0:1.0:0.0	.	413	P50281	MMP14_HUMAN	N	413	ENSP00000308208:D413N	ENSP00000308208:D413N	D	+	1	0	MMP14	22383765	1.000000	0.71417	0.981000	0.43875	0.959000	0.62525	6.660000	0.74417	2.582000	0.87167	0.557000	0.71058	GAC		0.557	MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071660.3	NM_004995	
ACIN1	22985	hgsc.bcm.edu	37	14	23530642	23530642	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr14:23530642G>A	ENST00000262710.1	-	17	3790	c.3463C>T	c.(3463-3465)Cgg>Tgg	p.R1155W	ACIN1_ENST00000357481.2_Missense_Mutation_p.R397W|ACIN1_ENST00000557515.1_Missense_Mutation_p.R396W|ACIN1_ENST00000397341.3_Missense_Mutation_p.R397W|ACIN1_ENST00000457657.1_Missense_Mutation_p.R1115W|ACIN1_ENST00000338631.6_Missense_Mutation_p.R428W|ACIN1_ENST00000555053.1_Missense_Mutation_p.R1142W|ACIN1_ENST00000605057.1_Missense_Mutation_p.R1097W	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	1155	Arg/Asp/Glu/Lys-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R1155W(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CGCTCCCGCCGCTCCATTTCC	0.677																																					p.R428W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1282T	14						.						61.0	65.0	64.0					14																	23530642		2203	4300	6503	22600482	SO:0001583	missense	22985	exon10			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.3463C>T	14.37:g.23530642G>A	ENSP00000262710:p.Arg1155Trp	Somatic		Capture	SOLID	Phase_I	22600482	NM_001164816	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083561	0.76642	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053	T;T;T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13;2.13;2.13	4.79	3.89	0.44902	.	0.000000	0.36234	N	0.002717	T	0.14874	0.0359	L	0.42245	1.32	0.58432	D	0.999993	P;P;B;B;B	0.37233	0.588;0.453;0.225;0.045;0.045	B;B;B;B;B	0.29524	0.103;0.048;0.028;0.006;0.006	T	0.04607	-1.0939	10	0.87932	D	0	-8.9866	7.7062	0.28650	0.0853:0.0:0.7536:0.1611	.	1142;1155;1115;428;397	G3V3M7;Q9UKV3;E7EQT4;Q9UKV3-2;Q9UKV3-3	.;ACINU_HUMAN;.;.;.	W	396;428;397;1155;1115;397;1142	ENSP00000451138:R396W;ENSP00000345541:R428W;ENSP00000350073:R397W;ENSP00000262710:R1155W;ENSP00000405677:R1115W;ENSP00000380502:R397W;ENSP00000451328:R1142W	ENSP00000262710:R1155W	R	-	1	2	ACIN1	22600482	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.505000	0.53356	1.358000	0.45922	0.563000	0.77884	CGG		0.677	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
SCFD1	23256	hgsc.bcm.edu	37	14	31185146	31185146	+	Missense_Mutation	SNP	G	G	A	rs150891719		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr14:31185146G>A	ENST00000458591.2	+	20	1873	c.1646G>A	c.(1645-1647)cGt>cAt	p.R549H	SCFD1_ENST00000544052.2_Missense_Mutation_p.R482H|SCFD1_ENST00000541123.1_Missense_Mutation_p.R364H|SCFD1_ENST00000396629.2_Missense_Mutation_p.R457H|SCFD1_ENST00000421551.3_Missense_Mutation_p.R490H	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	549					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)	p.R549H(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		CCTGTTACTCGTATTTTGGAC	0.318																																					p.R482H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1445A	14						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	69.0	71.0	71.0		1646,1445	4.9	1.0	14	dbSNP_134	71	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SCFD1	NM_016106.2,NM_182835.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	549/643,482/576	31185146	1,13005	2203	4300	6503	30254897	SO:0001583	missense	23256	exon19			AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.1646G>A	14.37:g.31185146G>A	ENSP00000390783:p.Arg549His	Somatic		Capture	SOLID	Phase_I	30254897	NM_182835	A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	ENST00000458591.2	37	CCDS9639.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470685	0.84533	0.0	1.16E-4	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000541123;ENST00000396629	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.85	4.95	0.65309	.	0.118601	0.53938	D	0.000045	T	0.66117	0.2757	M	0.89095	3.005	0.53688	D	0.999977	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.973;0.991;0.991	T	0.74408	-0.3675	10	0.87932	D	0	3.0E-4	15.2269	0.73359	0.0:0.0:0.858:0.142	.	490;482;549	B7Z738;B7Z4U7;Q8WVM8	.;.;SCFD1_HUMAN	H	549;482;490;364;457	ENSP00000390783:R549H;ENSP00000443010:R482H;ENSP00000388078:R490H;ENSP00000443537:R364H;ENSP00000379870:R457H	ENSP00000309417:R557H	R	+	2	0	SCFD1	30254897	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.732000	0.84908	1.447000	0.47661	0.491000	0.48974	CGT		0.318	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276612.3	NM_182835	
DTD2	112487	hgsc.bcm.edu	37	14	31917340	31917340	+	Missense_Mutation	SNP	A	A	G	rs145706913		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr14:31917340A>G	ENST00000310850.4	-	3	618	c.502T>C	c.(502-504)Ttt>Ctt	p.F168L	DTD2_ENST00000356180.4_Missense_Mutation_p.F168L|RP11-176H8.1_ENST00000547378.1_Intron|CTD-2213F21.2_ENST00000502430.2_RNA	NM_080664.2	NP_542395.1	Q96FN9	DTD2_HUMAN	D-tyrosyl-tRNA deacylase 2 (putative)	168					D-amino acid catabolic process (GO:0019478)	cytoplasm (GO:0005737)	hydrolase activity, acting on ester bonds (GO:0016788)	p.F168L(1)									CATTTTCAAAACTCAATTAAG	0.363																																					p.F168L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T502C	14						.						144.0	144.0	144.0					14																	31917340		2203	4300	6503	30987091	SO:0001583	missense	112487	exon3			BC010618	CCDS9643.1	14q12	2012-09-25	2012-09-25	2012-09-25	ENSG00000129480	ENSG00000129480			20277	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 126"""	C14orf126			Standard	NM_080664		Approved	MGC9912	uc001wrj.3	Q96FN9	OTTHUMG00000140205	ENST00000310850.4:c.502T>C	14.37:g.31917340A>G	ENSP00000312224:p.Phe168Leu	Somatic		Capture	SOLID	Phase_I	30987091	NM_080664	D3DS87	Missense_Mutation	SNP	ENST00000310850.4	37	CCDS9643.1	.	.	.	.	.	.	.	.	.	.	A	18.58	3.655518	0.67586	.	.	ENSG00000129480	ENST00000310850;ENST00000356180	T;T	0.56776	0.44;0.44	5.92	4.75	0.60458	D-Tyr tRNAtyr deacylase-like domain (2);	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	L	0.48362	1.52	0.53688	D	0.999978	B	0.26602	0.154	B	0.31869	0.137	T	0.37197	-0.9716	10	0.32370	T	0.25	-1.1325	13.2202	0.59883	0.8672:0.1328:0.0:0.0	.	168	Q96FN9	DTD2_HUMAN	L	168	ENSP00000312224:F168L;ENSP00000348503:F168L	ENSP00000312224:F168L	F	-	1	0	C14orf126	30987091	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.763000	0.74955	1.029000	0.39812	0.383000	0.25322	TTT		0.363	DTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276614.2	NM_080664	
MIPOL1	145282	hgsc.bcm.edu	37	14	37838760	37838760	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr14:37838760G>A	ENST00000327441.7	+	11	1333	c.867G>A	c.(865-867)gaG>gaA	p.E289E	MIPOL1_ENST00000545536.1_Silent_p.E258E|MIPOL1_ENST00000536774.1_Silent_p.E108E|MIPOL1_ENST00000539062.2_Silent_p.E258E|MIPOL1_ENST00000396294.2_Silent_p.E289E|MIPOL1_ENST00000556451.1_Silent_p.E258E|MIPOL1_ENST00000537471.1_Silent_p.E289E	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	289						nucleus (GO:0005634)		p.E289E(1)		breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		ATGTGAAAGAGCAGAACCAGA	0.433																																					p.E289E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G867A	14						.						130.0	120.0	123.0					14																	37838760		2203	4300	6503	36908511	SO:0001819	synonymous_variant	145282	exon12			AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.867G>A	14.37:g.37838760G>A		Somatic		Capture	SOLID	Phase_I	36908511	NM_001195297	D3DSA4|Q7Z3J0|Q8IV14	Silent	SNP	ENST00000327441.7	37	CCDS9664.1																																																																																				0.433	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276734.1	NM_138731	
MNAT1	4331	hgsc.bcm.edu	37	14	61262972	61262972	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr14:61262972G>A	ENST00000261245.4	+	2	228	c.127G>A	c.(127-129)Gct>Act	p.A43T	MNAT1_ENST00000539616.2_Missense_Mutation_p.A43T	NM_002431.3	NP_002422.1	P51948	MAT1_HUMAN	MNAT CDK-activating kinase assembly factor 1	43					7-methylguanosine mRNA capping (GO:0006370)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to calcium ion (GO:0051592)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|ventricular system development (GO:0021591)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|zinc ion binding (GO:0008270)	p.A43T(1)		NS(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.0174)		TGTGAGAGGAGCTGGAAACTG	0.408								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																													p.A43T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G127A	14						.						114.0	103.0	106.0					14																	61262972		2203	4300	6503	60332725	SO:0001583	missense	4331	exon2			X87843	CCDS9750.1, CCDS53899.1	14q23	2013-07-31	2013-07-31		ENSG00000020426	ENSG00000020426		"""RING-type (C3HC4) zinc fingers"", ""General transcription factor IIH complex subunits"""	7181	protein-coding gene	gene with protein product	"""CDK-activating kinase assembly factor"""	602659	"""menage a trois 1 (CAK assembly factor)"", ""menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)"""			9465303	Standard	NM_002431		Approved	MAT1, RNF66	uc001xfd.3	P51948	OTTHUMG00000152340	ENST00000261245.4:c.127G>A	14.37:g.61262972G>A	ENSP00000261245:p.Ala43Thr	Somatic		Capture	SOLID	Phase_I	60332725	NM_001177963	G3V1U8|Q15817|Q6ICQ7	Missense_Mutation	SNP	ENST00000261245.4	37	CCDS9750.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.056263	0.55325	.	.	ENSG00000020426	ENST00000261245;ENST00000539616	T;T	0.43294	0.95;0.96	5.63	3.82	0.43975	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.105606	0.64402	D	0.000003	T	0.18759	0.0450	N	0.08118	0	0.42035	D	0.991044	P;P	0.36990	0.51;0.577	B;B	0.33454	0.164;0.106	T	0.05649	-1.0872	10	0.23891	T	0.37	-16.842	7.4922	0.27469	0.1382:0.0:0.7276:0.1342	.	43;43	G3V1U8;P51948	.;MAT1_HUMAN	T	43	ENSP00000261245:A43T;ENSP00000446437:A43T	ENSP00000261245:A43T	A	+	1	0	MNAT1	60332725	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.519000	0.67074	0.855000	0.35359	-0.150000	0.13652	GCT		0.408	MNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276956.1	NM_002431	
RPS6KL1	83694	hgsc.bcm.edu	37	14	75373759	75373759	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr14:75373759A>G	ENST00000555647.1	-	12	1895	c.1608T>C	c.(1606-1608)caT>caC	p.H536H	RPS6KL1_ENST00000557413.1_Silent_p.H536H|RPS6KL1_ENST00000354625.2_Silent_p.H505H|RPS6KL1_ENST00000358328.4_Silent_p.H536H			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	536	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.H536H(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		TGAAAAAGGGATGGGACTTGA	0.612																																					p.H505H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1515C	14						.						211.0	208.0	209.0					14																	75373759		2203	4300	6503	74443512	SO:0001819	synonymous_variant	83694	exon10			BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.1608T>C	14.37:g.75373759A>G		Somatic		Capture	SOLID	Phase_I	74443512	NM_031464	A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Silent	SNP	ENST00000555647.1	37	CCDS9834.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.462|9.462	1.093417|1.093417	0.20471|0.20471	.|.	.|.	ENSG00000198208|ENSG00000198208	ENST00000555910|ENST00000553971	.|.	.|.	.|.	5.0|5.0	2.05|2.05	0.26809|0.26809	.|.	.|.	.|.	.|.	.|.	T|T	0.57533|0.57533	0.2060|0.2060	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.48779|0.48779	-0.9005|-0.9005	4|4	.|.	.|.	.|.	-19.5179|-19.5179	8.6988|8.6988	0.34312|0.34312	0.2501:0.0:0.7499:0.0|0.2501:0.0:0.7499:0.0	.|.	.|.	.|.	.|.	T|P	31|91	.|.	.|.	I|S	-|-	2|1	0|0	RPS6KL1|RPS6KL1	74443512|74443512	0.994000|0.994000	0.37717|0.37717	1.000000|1.000000	0.80357|0.80357	0.943000|0.943000	0.58893|0.58893	0.216000|0.216000	0.17585|0.17585	0.118000|0.118000	0.18165|0.18165	0.260000|0.260000	0.18958|0.18958	ATC|TCC		0.612	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413732.1		
ANGEL1	23357	hgsc.bcm.edu	37	14	77270146	77270146	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr14:77270146C>T	ENST00000251089.2	-	6	1602	c.1490G>A	c.(1489-1491)tGt>tAt	p.C497Y	ANGEL1_ENST00000557179.1_Missense_Mutation_p.C62Y	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	497								p.C497Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		CTTGGGGTGACAGGAGGTGAC	0.522																																					p.C497Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1490A	14						.						112.0	115.0	114.0					14																	77270146		2203	4300	6503	76339899	SO:0001583	missense	23357	exon6			AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.1490G>A	14.37:g.77270146C>T	ENSP00000251089:p.Cys497Tyr	Somatic		Capture	SOLID	Phase_I	76339899	NM_015305	B4DWL7|O94859|Q8NCS9	Missense_Mutation	SNP	ENST00000251089.2	37	CCDS9852.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371202	0.42003	.	.	ENSG00000013523	ENST00000251089;ENST00000557179	T;T	0.43688	1.89;0.94	5.75	5.75	0.90469	Endonuclease/exonuclease/phosphatase (2);	0.238996	0.45361	D	0.000377	T	0.47358	0.1441	L	0.48642	1.525	0.34232	D	0.676674	P	0.47910	0.902	P	0.55871	0.786	T	0.43458	-0.9390	10	0.02654	T	1	-2.4864	15.2548	0.73576	0.0:0.8608:0.1392:0.0	.	497	Q9UNK9	ANGE1_HUMAN	Y	497;62	ENSP00000251089:C497Y;ENSP00000451534:C62Y	ENSP00000251089:C497Y	C	-	2	0	ANGEL1	76339899	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.407000	0.44565	2.711000	0.92665	0.655000	0.94253	TGT		0.522	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413712.2	NM_015305	
ZC3H14	79882	hgsc.bcm.edu	37	14	89061337	89061337	+	Intron	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr14:89061337T>C	ENST00000251038.5	+	10	1504				ZC3H14_ENST00000393514.5_Intron|ZC3H14_ENST00000302216.8_Intron|ZC3H14_ENST00000555900.1_Silent_p.N89N|ZC3H14_ENST00000556945.1_Intron|ZC3H14_ENST00000359301.3_Intron|ZC3H14_ENST00000318308.6_Silent_p.N89N|ZC3H14_ENST00000557607.1_Intron|ZC3H14_ENST00000406216.3_Silent_p.N89N|ZC3H14_ENST00000336693.4_Intron|ZC3H14_ENST00000555755.1_Intron	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14							cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.N89N(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						TTAAAATGAATGAATATTCAA	0.328																																					p.N89N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T267C	14						.						51.0	51.0	51.0					14																	89061337		2203	4298	6501	88131090	SO:0001627	intron_variant	79882	exon1			AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.1280-1741T>C	14.37:g.89061337T>C		Somatic		Capture	SOLID	Phase_I	88131090	NM_207662	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Silent	SNP	ENST00000251038.5	37	CCDS32133.1																																																																																				0.328	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824	
MORC2	22880	hgsc.bcm.edu	37	22	31345789	31345789	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr22:31345789T>G	ENST00000397641.3	-	5	674	c.266A>C	c.(265-267)aAg>aCg	p.K89T	MORC2_ENST00000215862.4_Missense_Mutation_p.K27T			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	89						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.K27R(1)|p.K27T(1)		breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						AGGTGTTCGCTTGGCCGACTT	0.468																																					p.K27T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A80C	22						.						126.0	114.0	118.0					22																	31345789		2203	4300	6503	29675789	SO:0001583	missense	22880	exon6			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.266A>C	22.37:g.31345789T>G	ENSP00000380763:p.Lys89Thr	Somatic		Capture	SOLID	Phase_I	29675789	NM_014941	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	37		.	.	.	.	.	.	.	.	.	.	T	31	5.060167	0.93846	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.80653	-1.4;-1.4	5.62	5.62	0.85841	ATPase-like, ATP-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.89976	0.6871	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91349	0.5103	10	0.87932	D	0	.	15.8169	0.78608	0.0:0.0:0.0:1.0	.	89	Q9Y6X9	MORC2_HUMAN	T	89;27	ENSP00000380763:K89T;ENSP00000215862:K27T	ENSP00000215862:K27T	K	-	2	0	MORC2	29675789	1.000000	0.71417	0.997000	0.53966	0.965000	0.64279	7.698000	0.84413	2.151000	0.67156	0.482000	0.46254	AAG		0.468	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2	NM_014941	
EP300	2033	hgsc.bcm.edu	37	22	41564829	41564829	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr22:41564829A>G	ENST00000263253.7	+	25	5349	c.4130A>G	c.(4129-4131)cAt>cGt	p.H1377R	RNU6-375P_ENST00000517050.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1377	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.H1377R(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TTTGGCATGCATGTTCAAGAG	0.483			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.H1377R			Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4130G	22						.						207.0	182.0	190.0					22																	41564829		2203	4300	6503	39894775	SO:0001583	missense	2033	exon25	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4130A>G	22.37:g.41564829A>G	ENSP00000263253:p.His1377Arg	Somatic		Capture	SOLID	Phase_I	39894775	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.213584	0.79352	.	.	ENSG00000100393	ENST00000263253	D	0.93307	-3.2	5.95	5.95	0.96441	.	0.000000	0.49916	D	0.000123	D	0.97414	0.9154	M	0.91920	3.255	0.58432	D	0.999992	D	0.89917	1.0	D	0.87578	0.998	D	0.98249	1.0492	10	0.87932	D	0	-14.8387	16.4069	0.83677	1.0:0.0:0.0:0.0	.	1377	Q09472	EP300_HUMAN	R	1377	ENSP00000263253:H1377R	ENSP00000263253:H1377R	H	+	2	0	EP300	39894775	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.237000	0.95368	2.272000	0.75746	0.460000	0.39030	CAT		0.483	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
LPHN1	22859	hgsc.bcm.edu	37	19	14294372	14294372	+	Missense_Mutation	SNP	C	C	T	rs370477888		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:14294372C>T	ENST00000340736.6	-	2	340	c.43G>A	c.(43-45)Gcc>Acc	p.A15T	LPHN1_ENST00000361434.3_Missense_Mutation_p.A15T	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	15					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.A15T(1)		central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ACCAGGACGGCGGTGACACAC	0.677																																					p.A15T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G43A	19						.	C	THR/ALA,THR/ALA	1,4359		0,1,2179	27.0	23.0	24.0		43,43	3.0	0.8	19		24	0,8562		0,0,4281	no	missense,missense	LPHN1	NM_014921.4,NM_001008701.2	58,58	0,1,6460	TT,TC,CC		0.0,0.0229,0.0077	benign,benign	15/1470,15/1475	14294372	1,12921	2180	4281	6461	14155372	SO:0001583	missense	22859	exon2			AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.43G>A	19.37:g.14294372C>T	ENSP00000340688:p.Ala15Thr	Somatic		Capture	SOLID	Phase_I	14155372	NM_014921	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	C	7.743	0.701688	0.15172	2.29E-4	0.0	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.69806	-0.43;-0.43	4.07	3.02	0.34903	.	0.389003	0.22329	N	0.061491	T	0.42944	0.1225	N	0.22421	0.69	0.23594	N	0.997333	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.28073	-1.0055	10	0.02654	T	1	.	7.2369	0.26074	0.0:0.8684:0.0:0.1316	.	15;15	O94910-2;O94910	.;LPHN1_HUMAN	T	15	ENSP00000340688:A15T;ENSP00000355328:A15T	ENSP00000340688:A15T	A	-	1	0	LPHN1	14155372	0.124000	0.22315	0.809000	0.32408	0.983000	0.72400	0.622000	0.24433	0.800000	0.34041	0.491000	0.48974	GCC		0.677	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
CYP4F12	66002	hgsc.bcm.edu	37	19	15806837	15806837	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:15806837A>G	ENST00000550308.1	+	10	1587	c.1207A>G	c.(1207-1209)Acc>Gcc	p.T403A	CYP4F12_ENST00000324632.10_Missense_Mutation_p.T403A	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	403					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)	p.T403A(1)		NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	CCGATGCTGCACCCAGGACAT	0.607																																					p.T403A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1207G	19						.						91.0	89.0	90.0					19																	15806837		2203	4300	6503	15667837	SO:0001583	missense	66002	exon10			AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.1207A>G	19.37:g.15806837A>G	ENSP00000448998:p.Thr403Ala	Somatic		Capture	SOLID	Phase_I	15667837	NM_023944	E7ET51|O60389|Q5JPJ7|Q9HCS1	Missense_Mutation	SNP	ENST00000550308.1	37	CCDS42517.1	.	.	.	.	.	.	.	.	.	.	.	10.55	1.382282	0.24944	.	.	ENSG00000186204	ENST00000550308;ENST00000324632	T;T	0.69926	-0.44;-0.44	2.41	1.39	0.22231	.	0.259960	0.28624	U	0.014686	T	0.62024	0.2394	M	0.62266	1.93	0.38153	D	0.938805	B	0.20368	0.044	B	0.33799	0.17	T	0.58885	-0.7557	10	0.51188	T	0.08	.	5.9907	0.19460	0.8589:0.0:0.1411:0.0	.	403	Q9HCS2	CP4FC_HUMAN	A	403	ENSP00000448998:T403A;ENSP00000321821:T403A	ENSP00000321821:T403A	T	+	1	0	CYP4F12	15667837	0.005000	0.15991	0.108000	0.21378	0.024000	0.10985	0.687000	0.25407	0.346000	0.23899	-0.736000	0.03550	ACC		0.607	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378938.9		
GNA15	2769	hgsc.bcm.edu	37	19	3157856	3157856	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:3157856C>T	ENST00000262958.3	+	6	1133	c.875C>T	c.(874-876)gCt>gTt	p.A292V	AC005264.2_ENST00000587587.1_RNA	NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	292					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.A292V(1)		large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		TCCCACCTGGCTACCTATTTC	0.478																																					p.A292V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C875T	19						.						164.0	156.0	158.0					19																	3157856		2203	4300	6503	3108856	SO:0001583	missense	2769	exon6				CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.875C>T	19.37:g.3157856C>T	ENSP00000262958:p.Ala292Val	Somatic		Capture	SOLID	Phase_I	3108856	NM_002068	E9KL40|E9KL47|O75247|Q53XK2	Missense_Mutation	SNP	ENST00000262958.3	37	CCDS12104.1	.	.	.	.	.	.	.	.	.	.	C	9.387	1.074609	0.20227	.	.	ENSG00000060558	ENST00000262958	D	0.88586	-2.4	4.62	3.59	0.41128	.	0.180800	0.37393	N	0.002118	T	0.74935	0.3782	N	0.10664	0.02	0.36247	D	0.853671	B	0.02656	0.0	B	0.12837	0.008	T	0.68439	-0.5408	10	0.15066	T	0.55	.	10.415	0.44316	0.0:0.9033:0.0:0.0967	.	292	P30679	GNA15_HUMAN	V	292	ENSP00000262958:A292V	ENSP00000262958:A292V	A	+	2	0	GNA15	3108856	0.398000	0.25279	0.998000	0.56505	0.994000	0.84299	1.026000	0.30103	0.973000	0.38340	0.544000	0.68410	GCT		0.478	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452320.2	NM_002068	
ZNF506	440515	hgsc.bcm.edu	37	19	19917815	19917815	+	Silent	SNP	G	G	A	rs577132629		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:19917815G>A	ENST00000540806.2	-	2	154	c.66C>T	c.(64-66)gaC>gaT	p.D22D	ZNF506_ENST00000443905.2_Silent_p.D22D|ZNF506_ENST00000587461.1_Silent_p.D22D|ZNF506_ENST00000545006.1_Silent_p.D22D|CTC-559E9.4_ENST00000590274.1_lincRNA|ZNF506_ENST00000587452.1_Silent_p.D22D|CTC-559E9.6_ENST00000591884.1_RNA|ZNF506_ENST00000450683.2_Silent_p.D22D|CTC-559E9.6_ENST00000589657.1_RNA			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	22	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D22D(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						GCTGTGCAGCGTCCAGGCAAT	0.413													-|||	1	0.000199681	0.0	0.0	5008	,	,		16204	0.0		0.0	False		,,,				2504	0.001				p.D22D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C66T	19						.						108.0	115.0	112.0					19																	19917815		2203	4300	6503	19778815	SO:0001819	synonymous_variant	440515	exon2			AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.66C>T	19.37:g.19917815G>A		Somatic		Capture	SOLID	Phase_I	19778815	NM_001145404	B3KTH6	Silent	SNP	ENST00000540806.2	37	CCDS42531.1																																																																																				0.413	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460794.1	XM_036218	
GPATCH1	55094	hgsc.bcm.edu	37	19	33602645	33602645	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:33602645G>A	ENST00000170564.2	+	12	1915	c.1601G>A	c.(1600-1602)tGt>tAt	p.C534Y		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	534					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)	p.C534Y(1)		breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					CTGGAACGCTGTCTGGACCCC	0.577																																					p.C534Y	Pancreas(67;88 1713 4567 18227)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1601A	19						.						98.0	101.0	100.0					19																	33602645		2203	4300	6503	38294485	SO:0001583	missense	55094	exon12			AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.1601G>A	19.37:g.33602645G>A	ENSP00000170564:p.Cys534Tyr	Somatic		Capture	SOLID	Phase_I	38294485	NM_018025	Q8IZV6|Q8N3B7|Q9NW94	Missense_Mutation	SNP	ENST00000170564.2	37	CCDS12428.1	.	.	.	.	.	.	.	.	.	.	G	0.751	-0.772683	0.02951	.	.	ENSG00000076650	ENST00000170564	T	0.31247	1.5	5.73	4.67	0.58626	.	0.171029	0.64402	D	0.000004	T	0.18045	0.0433	L	0.37561	1.115	0.80722	D	1	B	0.15719	0.014	B	0.15052	0.012	T	0.08973	-1.0696	10	0.02654	T	1	-10.3218	6.314	0.21180	0.0729:0.1339:0.6543:0.1389	.	534	Q9BRR8	GPTC1_HUMAN	Y	534	ENSP00000170564:C534Y	ENSP00000170564:C534Y	C	+	2	0	GPATCH1	38294485	1.000000	0.71417	0.523000	0.27875	0.080000	0.17528	3.548000	0.53670	1.372000	0.46190	0.650000	0.86243	TGT		0.577	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450834.1	NM_018025	
FXYD5	53827	hgsc.bcm.edu	37	19	35660478	35660478	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:35660478G>A	ENST00000342879.3	+	8	1275	c.497G>A	c.(496-498)tGc>tAc	p.C166Y	FXYD5_ENST00000541435.2_Missense_Mutation_p.C166Y|FXYD5_ENST00000591716.2_3'UTR|FXYD5_ENST00000392219.2_Missense_Mutation_p.C166Y|FXYD5_ENST00000392217.3_Missense_Mutation_p.C95Y|FXYD5_ENST00000423817.3_Missense_Mutation_p.C166Y|FXYD5_ENST00000588699.1_3'UTR|FXYD5_ENST00000590686.1_Missense_Mutation_p.C166Y			Q96DB9	FXYD5_HUMAN	FXYD domain containing ion transport regulator 5	166					microvillus assembly (GO:0030033)|negative regulation of calcium-dependent cell-cell adhesion (GO:0046588)	integral component of membrane (GO:0016021)	actin binding (GO:0003779)|cadherin binding (GO:0045296)|ion channel activity (GO:0005216)	p.C166Y(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9	all_lung(56;9.4e-09)|Lung NSC(56;1.4e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.75e-22)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;7.07e-19)|LUSC - Lung squamous cell carcinoma(66;0.0221)			GGTGGCAAGTGCAGGCAGCTG	0.547																																					p.C166Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G497A	19						.						96.0	84.0	88.0					19																	35660478		2203	4300	6503	40352318	SO:0001583	missense	53827	exon9			AF161462	CCDS12447.1	19q13.12	2008-02-05	2002-01-14		ENSG00000089327	ENSG00000089327			4029	protein-coding gene	gene with protein product	"""dysadherin"""	606669	"""FXYD domain-containing ion transport regulator 5"""				Standard	NM_144779		Approved	OIT2	uc002nyg.2	Q96DB9	OTTHUMG00000048092	ENST00000342879.3:c.497G>A	19.37:g.35660478G>A	ENSP00000344254:p.Cys166Tyr	Somatic		Capture	SOLID	Phase_I	40352318	NM_001164605	B7WNZ8|Q6UW44|Q9HC34|Q9P039	Missense_Mutation	SNP	ENST00000342879.3	37	CCDS12447.1	.	.	.	.	.	.	.	.	.	.	G	2.712	-0.268631	0.05716	.	.	ENSG00000089327	ENST00000392219;ENST00000541435;ENST00000342879;ENST00000423817;ENST00000392217	T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54	4.22	3.18	0.36537	.	0.521764	0.19301	N	0.117650	T	0.74268	0.3694	M	0.83774	2.66	0.24347	N	0.994937	B;P	0.46020	0.385;0.871	B;P	0.46479	0.161;0.518	T	0.68640	-0.5355	10	0.72032	D	0.01	-3.1812	8.4095	0.32636	0.1059:0.0:0.8941:0.0	.	95;166	Q96DB9-2;Q96DB9	.;FXYD5_HUMAN	Y	166;166;166;166;95	ENSP00000376053:C166Y;ENSP00000443390:C166Y;ENSP00000344254:C166Y;ENSP00000393848:C166Y;ENSP00000376051:C95Y	ENSP00000344254:C166Y	C	+	2	0	FXYD5	40352318	0.996000	0.38824	0.427000	0.26684	0.013000	0.08279	2.359000	0.44142	1.364000	0.46038	0.563000	0.77884	TGC		0.547	FXYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109443.1	NM_014164	
AXL	558	hgsc.bcm.edu	37	19	41737137	41737137	+	Silent	SNP	G	G	A	rs142452494		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:41737137G>A	ENST00000301178.4	+	6	907	c.717G>A	c.(715-717)acG>acA	p.T239T	AXL_ENST00000359092.3_Silent_p.T239T|AXL_ENST00000593513.1_5'UTR	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	239	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T239T(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						GCCAACCCACGGAGCTGGAGG	0.612																																					p.T239T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G717A	19						.	G	,	0,4406		0,0,2203	62.0	59.0	60.0		717,717	-9.4	0.7	19	dbSNP_134	60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	AXL	NM_001699.4,NM_021913.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	239/886,239/895	41737137	1,13005	2203	4300	6503	46428977	SO:0001819	synonymous_variant	558	exon6			M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.717G>A	19.37:g.41737137G>A		Somatic		Capture	SOLID	Phase_I	46428977	NM_021913	Q8N5L2|Q9UD27	Silent	SNP	ENST00000301178.4	37	CCDS12575.1																																																																																				0.612	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2		
ATP1A3	478	hgsc.bcm.edu	37	19	42486196	42486196	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:42486196C>A	ENST00000302102.5	-	9	1206	c.1056G>T	c.(1054-1056)gaG>gaT	p.E352D	ATP1A3_ENST00000545399.1_Missense_Mutation_p.E365D|ATP1A3_ENST00000543770.1_Missense_Mutation_p.E363D|ATP1A3_ENST00000602133.1_Missense_Mutation_p.E322D	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	352					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.E352D(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						tttctacagcctccaggttct	0.582																																					p.E352D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1056T	19						.						161.0	143.0	149.0					19																	42486196		2203	4300	6503	47178036	SO:0001583	missense	478	exon9				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.1056G>T	19.37:g.42486196C>A	ENSP00000302397:p.Glu352Asp	Somatic		Capture	SOLID	Phase_I	47178036	NM_152296	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	37	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376819	0.61735	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41	4.21	3.17	0.36434	HAD-like domain (1);ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.86264	0.5891	M	0.62088	1.915	0.80722	D	1	P;D;D;D	0.71674	0.951;0.998;0.998;0.998	P;D;D;D	0.87578	0.782;0.997;0.998;0.998	D	0.86215	0.1627	10	0.66056	D	0.02	.	10.2227	0.43207	0.0:0.9007:0.0:0.0993	.	365;363;352;352	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	D	352;352;365;322;96;363	ENSP00000302397:E352D;ENSP00000411503:E352D;ENSP00000444688:E365D;ENSP00000437577:E363D	ENSP00000302397:E352D	E	-	3	2	ATP1A3	47178036	0.998000	0.40836	1.000000	0.80357	0.550000	0.35303	0.679000	0.25291	1.134000	0.42165	-0.291000	0.09656	GAG		0.582	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
ATP1A3	478	hgsc.bcm.edu	37	19	42492232	42492232	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:42492232C>T	ENST00000302102.5	-	4	363	c.213G>A	c.(211-213)acG>acA	p.T71T	ATP1A3_ENST00000468774.2_5'UTR|ATP1A3_ENST00000545399.1_Silent_p.T84T|ATP1A3_ENST00000543770.1_Silent_p.T82T|ATP1A3_ENST00000602133.1_Silent_p.T41T	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	71					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.T71T(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						TAGGCGGTGGCGTGAGTGCGT	0.627																																					p.T71T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G213A	19						.						109.0	113.0	112.0					19																	42492232		2203	4300	6503	47184072	SO:0001819	synonymous_variant	478	exon4				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.213G>A	19.37:g.42492232C>T		Somatic		Capture	SOLID	Phase_I	47184072	NM_152296	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Silent	SNP	ENST00000302102.5	37	CCDS12594.1																																																																																				0.627	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
EML2	24139	hgsc.bcm.edu	37	19	46116911	46116911	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:46116911G>A	ENST00000245925.3	-	18	1762	c.1712C>T	c.(1711-1713)gCg>gTg	p.A571V	EML2_ENST00000589876.1_Missense_Mutation_p.A571V|EML2_ENST00000536630.1_Missense_Mutation_p.A718V|EML2_ENST00000587152.1_Missense_Mutation_p.A772V	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	571	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.A571V(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		AGTGCCGTCCGCCCCCTCAGA	0.572																																					p.A718V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2153T	19						.						113.0	94.0	100.0					19																	46116911		2203	4300	6503	50808751	SO:0001583	missense	24139	exon21			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.1712C>T	19.37:g.46116911G>A	ENSP00000245925:p.Ala571Val	Somatic		Capture	SOLID	Phase_I	50808751	NM_001193269	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	ENST00000245925.3	37	CCDS12670.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.299646	0.23650	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055	T;T	0.29397	1.57;2.74	4.75	2.65	0.31530	WD40/YVTN repeat-like-containing domain (1);Soluble quinoprotein glucose/sorbosone dehydrogenase (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.26231	0.0640	M	0.66439	2.03	0.52501	D	0.999954	B;B;B	0.34255	0.206;0.445;0.03	B;B;B	0.24155	0.051;0.03;0.022	T	0.15694	-1.0428	10	0.54805	T	0.06	-19.9707	8.8426	0.35151	0.1883:0.0:0.8117:0.0	.	737;718;571	B7Z3Q9;B7Z3I2;O95834	.;.;EMAL2_HUMAN	V	718;571;729	ENSP00000442365:A718V;ENSP00000245925:A571V	ENSP00000245925:A571V	A	-	2	0	EML2	50808751	0.860000	0.29831	0.756000	0.31282	0.028000	0.11728	4.029000	0.57253	1.385000	0.46445	0.563000	0.77884	GCG		0.572	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459608.1	NM_012155	
HRC	3270	hgsc.bcm.edu	37	19	49657751	49657751	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:49657751A>G	ENST00000252825.4	-	1	930	c.744T>C	c.(742-744)gaT>gaC	p.D248D	HRC_ENST00000595625.1_Silent_p.D248D	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	248	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Asp-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)	p.D248D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		catcatcatcatcgtcatctt	0.507																																					p.D248D	Melanoma(37;75 1097 24567 25669 30645)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T744C	19						.						132.0	95.0	107.0					19																	49657751		2203	4300	6503	54349563	SO:0001819	synonymous_variant	3270	exon1				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.744T>C	19.37:g.49657751A>G		Somatic		Capture	SOLID	Phase_I	54349563	NM_002152	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																				0.507	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
FPR3	2359	hgsc.bcm.edu	37	19	52327899	52327899	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:52327899A>G	ENST00000339223.4	+	2	1077	c.898A>G	c.(898-900)Att>Gtt	p.I300V	FPR3_ENST00000595991.1_Missense_Mutation_p.I300V	NM_002030.3	NP_002021.3	P25089	FPR3_HUMAN	formyl peptide receptor 3	300					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)	p.I300V(1)		NS(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)	35						CCTCAACCCAATTCTCTACGT	0.458																																					p.I300V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A898G	19						.						152.0	149.0	150.0					19																	52327899		2203	4300	6503	57019711	SO:0001583	missense	2359	exon2				CCDS12841.1	19q13.3-q13.4	2012-08-08	2008-04-17	2008-04-17		ENSG00000187474		"""GPCR / Class A : Formyl peptide receptors"""	3828	protein-coding gene	gene with protein product		136539	"""formyl peptide receptor-like 2"""	FPRL2		1612600, 8198572	Standard	NM_002030		Approved	FPRH1, FMLPY, RMLP-R-I	uc002pxt.1	P25089		ENST00000339223.4:c.898A>G	19.37:g.52327899A>G	ENSP00000341821:p.Ile300Val	Somatic		Capture	SOLID	Phase_I	57019711	NM_002030		Missense_Mutation	SNP	ENST00000339223.4	37	CCDS12841.1	.	.	.	.	.	.	.	.	.	.	.	0.007	-2.004661	0.00431	.	.	ENSG00000187474	ENST00000339223	T	0.40756	1.02	2.35	-1.8	0.07907	GPCR, rhodopsin-like superfamily (1);	0.624103	0.15597	N	0.254123	T	0.26810	0.0656	L	0.42686	1.345	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.13019	-1.0525	10	0.38643	T	0.18	.	3.1801	0.06582	0.4829:0.0:0.2637:0.2534	.	300	P25089	FPR3_HUMAN	V	300	ENSP00000341821:I300V	ENSP00000341821:I300V	I	+	1	0	FPR3	57019711	0.000000	0.05858	0.678000	0.29963	0.048000	0.14542	-1.531000	0.02219	-0.675000	0.05246	-1.843000	0.00578	ATT		0.458	FPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466914.1	NM_002030	
PRKCG	5582	hgsc.bcm.edu	37	19	54407971	54407971	+	Missense_Mutation	SNP	G	G	A	rs41275818		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:54407971G>A	ENST00000263431.3	+	16	2021	c.1739G>A	c.(1738-1740)cGg>cAg	p.R580Q	PRKCG_ENST00000540413.1_Missense_Mutation_p.R580Q|PRKCG_ENST00000542049.1_Intron	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	580	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)	p.R580Q(1)		large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	TCGCTTTCCCGGGAAGCCGTG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18565	0.0		0.001	False		,,,				2504	0.0				p.R580Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1739A	19						.						82.0	62.0	69.0					19																	54407971		2203	4300	6503	59099783	SO:0001583	missense	5582	exon16			M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1739G>A	19.37:g.54407971G>A	ENSP00000263431:p.Arg580Gln	Somatic		Capture	SOLID	Phase_I	59099783	NM_002739	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	CCDS12867.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	26.2	4.716924	0.89205	.	.	ENSG00000126583	ENST00000540413;ENST00000263431	T;T	0.53423	0.62;0.62	4.63	4.63	0.57726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.39545	0.1082	N	0.16066	0.365	0.80722	D	1	P;P	0.49783	0.928;0.588	P;B	0.47744	0.556;0.066	T	0.38178	-0.9673	9	0.51188	T	0.08	.	15.3956	0.74790	0.0:0.0:1.0:0.0	rs41275818	580;580	F5H5C4;P05129	.;KPCG_HUMAN	Q	580	ENSP00000443493:R580Q;ENSP00000263431:R580Q	ENSP00000263431:R580Q	R	+	2	0	PRKCG	59099783	0.946000	0.32159	1.000000	0.80357	0.997000	0.91878	2.168000	0.42424	2.573000	0.86826	0.561000	0.74099	CGG		0.577	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
LILRA4	23547	hgsc.bcm.edu	37	19	54849273	54849273	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:54849273C>T	ENST00000291759.4	-	4	645	c.589G>A	c.(589-591)Ggc>Agc	p.G197S	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	197	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.G197S(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TTTTCATAGCCGTAGCATCTG	0.542																																					p.G197S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G589A	19						.						97.0	81.0	87.0					19																	54849273		2203	4300	6503	59541085	SO:0001583	missense	23547	exon4			AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.589G>A	19.37:g.54849273C>T	ENSP00000291759:p.Gly197Ser	Somatic		Capture	SOLID	Phase_I	59541085	NM_012276	Q32MC4	Missense_Mutation	SNP	ENST00000291759.4	37	CCDS12890.1	.	.	.	.	.	.	.	.	.	.	.	14.65	2.598708	0.46318	.	.	ENSG00000239961	ENST00000291759	T	0.03152	4.03	2.76	1.72	0.24424	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.791070	0.10909	N	0.620826	T	0.11067	0.0270	M	0.62016	1.91	0.09310	N	1	D	0.61697	0.99	D	0.63192	0.912	T	0.18871	-1.0323	10	0.54805	T	0.06	.	5.7138	0.17948	0.0:0.846:0.0:0.154	.	197	P59901	LIRA4_HUMAN	S	197	ENSP00000291759:G197S	ENSP00000291759:G197S	G	-	1	0	LILRA4	59541085	0.000000	0.05858	0.074000	0.20217	0.072000	0.16883	0.354000	0.20146	0.732000	0.32470	0.563000	0.77884	GGC		0.542	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276	
KIR3DL1	3811	hgsc.bcm.edu	37	19	55294941	55294941	+	Intron	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:55294941C>T	ENST00000538269.1	+	2	61				KIR2DL3_ENST00000434419.2_Missense_Mutation_p.A274V|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR2DL1_ENST00000336077.6_Missense_Mutation_p.A274V|KIR3DL1_ENST00000402254.2_Intron|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.A300V|CTB-61M7.1_ENST00000400864.3_RNA			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.A274V(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		TCTACAGATGCTGCGGTAATG	0.522																																					p.A274V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C821T	19						.						127.0	127.0	127.0					19																	55294941		2170	4189	6359	59986753	SO:0001627	intron_variant	3802	exon7			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-34048C>T	19.37:g.55294941C>T		Somatic		Capture	SOLID	Phase_I	59986753	NM_014218	O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	37		.	.	.	.	.	.	.	.	.	.	C	12.37	1.917280	0.33815	.	.	ENSG00000243772;ENSG00000125498;ENSG00000125498	ENST00000434419;ENST00000336077;ENST00000291633	T;T;T	0.00518	7.12;7.07;6.86	0.929	-0.315	0.12746	.	.	.	.	.	T	0.00906	0.0030	M	0.90252	3.1	0.09310	N	1	P;B;P;P	0.51791	0.745;0.235;0.697;0.948	B;B;B;P	0.46885	0.222;0.08;0.285;0.53	T	0.41662	-0.9496	9	0.87932	D	0	.	3.3319	0.07087	0.0:0.6772:0.0:0.3228	.	300;275;274;274	Q6IST4;E3NZD7;Q6H2H3;P43627	.;.;.;KI2L2_HUMAN	V	274;274;300	ENSP00000415758:A274V;ENSP00000336769:A274V;ENSP00000291633:A300V	ENSP00000291633:A300V	A	+	2	0	KIR2DL1;KIR2DL3	59986753	0.001000	0.12720	0.002000	0.10522	0.027000	0.11550	-0.463000	0.06696	-0.049000	0.13379	0.184000	0.17185	GCT		0.522	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289	
KIR3DL1	3811	hgsc.bcm.edu	37	19	55325333	55325333	+	Intron	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:55325333G>A	ENST00000538269.1	+	2	61				KIR2DL4_ENST00000346587.4_Missense_Mutation_p.A171T|KIR2DL4_ENST00000396284.2_Missense_Mutation_p.A321T|KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000357494.4_Missense_Mutation_p.A249T|KIR2DL4_ENST00000345540.5_Missense_Mutation_p.A266T|KIR3DL1_ENST00000391728.4_5'Flank|KIR2DL4_ENST00000396293.1_Missense_Mutation_p.A154T|KIR2DL4_ENST00000359085.4_3'UTR|KIR3DL1_ENST00000402254.2_Intron|KIR3DL1_ENST00000358178.4_5'Flank|KIR3DL1_ENST00000326542.7_5'Flank|KIR2DL4_ENST00000463062.1_3'UTR			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.A266T(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		GGTGACATACGCACAGTTGGA	0.473																																					p.A266T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G796A	19						.						23.0	36.0	32.0					19																	55325333		1836	3875	5711	60017145	SO:0001627	intron_variant	3805	exon7			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-3656G>A	19.37:g.55325333G>A		Somatic		Capture	SOLID	Phase_I	60017145	NM_001080770	O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	37		.	.	.	.	.	.	.	.	.	.	G	5.791	0.330264	0.10956	.	.	ENSG00000189013	ENST00000396284;ENST00000345540;ENST00000357494;ENST00000396293;ENST00000346587;ENST00000396289	T;T;T;T;T;T	0.00564	6.6;6.62;6.71;6.62;6.57;6.63	0.993	-0.113	0.13568	.	.	.	.	.	T	0.00328	0.0010	.	.	.	0.09310	N	1	B;B;B;B;B;B	0.31351	0.024;0.044;0.054;0.088;0.054;0.32	B;B;B;B;B;B	0.21708	0.009;0.029;0.032;0.036;0.032;0.036	T	0.42632	-0.9440	8	0.41790	T	0.15	.	3.1525	0.06493	0.3241:0.0:0.6759:0.0	.	301;321;249;171;266;154	Q99706;E7EST5;Q99706-4;Q8N736;Q99706-3;Q8N738	KI2L4_HUMAN;.;.;.;.;.	T	321;266;249;154;171;321	ENSP00000379580:A321T;ENSP00000339634:A266T;ENSP00000350088:A249T;ENSP00000379588:A154T;ENSP00000345331:A171T;ENSP00000379584:A321T	ENSP00000339634:A266T	A	+	1	0	KIR2DL4	60017145	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-2.077000	0.01371	0.001000	0.14605	0.184000	0.17185	GCA		0.473	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289	
ZNF426	79088	hgsc.bcm.edu	37	19	9643551	9643551	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:9643551A>G	ENST00000535489.1	-	4	631	c.295T>C	c.(295-297)Tca>Cca	p.S99P	ZNF426_ENST00000589289.1_Missense_Mutation_p.S99P|ZNF426_ENST00000253115.2_Missense_Mutation_p.S99P|ZNF426_ENST00000593003.1_Missense_Mutation_p.S61P			Q9BUY5	ZN426_HUMAN	zinc finger protein 426	99	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S99P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20						ACTGTCCTTGACTCTTCTTGT	0.398																																					p.S99P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T295C	19						.						143.0	121.0	129.0					19																	9643551		2203	4300	6503	9504551	SO:0001583	missense	79088	exon6			AK095759	CCDS12215.1, CCDS74279.1	19p13.2	2013-01-08				ENSG00000130818		"""Zinc fingers, C2H2-type"", ""-"""	20725	protein-coding gene	gene with protein product							Standard	NM_024106		Approved	MGC2663	uc002mlq.3	Q9BUY5		ENST00000535489.1:c.295T>C	19.37:g.9643551A>G	ENSP00000439017:p.Ser99Pro	Somatic		Capture	SOLID	Phase_I	9504551	NM_024106	B3KTL2	Missense_Mutation	SNP	ENST00000535489.1	37	CCDS12215.1	.	.	.	.	.	.	.	.	.	.	A	6.593	0.477765	0.12521	.	.	ENSG00000130818	ENST00000545189;ENST00000253115;ENST00000535489	T;T	0.05513	3.43;3.43	1.9	-3.81	0.04294	Krueppel-associated box (2);	.	.	.	.	T	0.01421	0.0046	N	0.01417	-0.88	0.09310	N	1	B;B	0.33266	0.404;0.404	B;B	0.17979	0.02;0.02	T	0.39522	-0.9610	9	0.35671	T	0.21	.	1.4443	0.02360	0.2321:0.1769:0.4156:0.1753	.	86;99	Q59EH4;Q9BUY5	.;ZN426_HUMAN	P	86;99;99	ENSP00000253115:S99P;ENSP00000439017:S99P	ENSP00000253115:S99P	S	-	1	0	ZNF426	9504551	0.000000	0.05858	0.000000	0.03702	0.601000	0.36947	-1.024000	0.03603	-2.071000	0.00880	0.260000	0.18958	TCA		0.398	ZNF426-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449905.1	NM_024106	
HSPBP1	23640	hgsc.bcm.edu	37	19	55773989	55773989	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr19:55773989C>T	ENST00000255631.5	-	9	1377	c.1067G>A	c.(1066-1068)aGc>aAc	p.S356N	HSPBP1_ENST00000587922.1_Missense_Mutation_p.S356N|HSPBP1_ENST00000376343.3_Missense_Mutation_p.S254N|HSPBP1_ENST00000433386.2_Missense_Mutation_p.S356N	NM_001130106.1|NM_012267.4	NP_001123578.1|NP_036399.3	Q9NZL4	HPBP1_HUMAN	HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1	359					negative regulation of catalytic activity (GO:0043086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)		enzyme inhibitor activity (GO:0004857)	p.S356N(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	8			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCGATCCATGCTGTCGTCCGC	0.622																																					p.S356N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1067A	19						.						76.0	58.0	64.0					19																	55773989		2203	4300	6503	60465801	SO:0001583	missense	23640	exon8				CCDS33111.1	19q13.42	2008-12-16			ENSG00000133265	ENSG00000133265			24989	protein-coding gene	gene with protein product	"""hsp70 interacting protein"", ""Hsp70 binding protein 1"""	612939				10786638, 9830037	Standard	NM_001130106		Approved	HspBP1, FES1	uc002qkd.3	Q9NZL4		ENST00000255631.5:c.1067G>A	19.37:g.55773989C>T	ENSP00000255631:p.Ser356Asn	Somatic		Capture	SOLID	Phase_I	60465801	NM_012267	B3KQP0|B4DG11|O95351|Q6ZNU5	Missense_Mutation	SNP	ENST00000255631.5	37	CCDS33111.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.778656	0.31502	.	.	ENSG00000133265	ENST00000433386;ENST00000255631;ENST00000376343	T;T	0.79845	-1.31;-1.31	4.51	4.51	0.55191	.	0.204081	0.50627	D	0.000103	T	0.79924	0.4530	L	0.46157	1.445	0.26804	N	0.969135	P;P	0.45827	0.867;0.867	P;P	0.47645	0.451;0.553	T	0.74985	-0.3477	10	0.49607	T	0.09	.	15.1048	0.72312	0.0:1.0:0.0:0.0	.	359;402	Q9NZL4;B4DG11	HPBP1_HUMAN;.	N	356;356;254	ENSP00000398244:S356N;ENSP00000255631:S356N	ENSP00000255631:S356N	S	-	2	0	HSPBP1	60465801	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	3.409000	0.52657	2.238000	0.73509	0.305000	0.20034	AGC		0.622	HSPBP1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452670.1	NM_012267	
UBR5	51366	hgsc.bcm.edu	37	8	103327018	103327018	+	Silent	SNP	C	C	T	rs375257842		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:103327018C>T	ENST00000520539.1	-	15	2454	c.1848G>A	c.(1846-1848)acG>acA	p.T616T	UBR5_ENST00000521922.1_Silent_p.T610T|UBR5_ENST00000220959.4_Silent_p.T616T	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	616					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.T616T(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CATCACTACACGTGGATGCTG	0.413																																					p.T616T	Ovarian(131;96 1741 5634 7352 27489)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1848A	8						.	C		0,4406		0,0,2203	143.0	115.0	125.0		1848	-10.5	0.0	8		125	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	UBR5	NM_015902.5		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		616/2800	103327018	2,13004	2203	4300	6503	103396194	SO:0001819	synonymous_variant	51366	exon15			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.1848G>A	8.37:g.103327018C>T		Somatic		Capture	SOLID	Phase_I	103396194	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Silent	SNP	ENST00000520539.1	37	CCDS34933.1																																																																																				0.413	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
FZD6	8323	hgsc.bcm.edu	37	8	104336822	104336822	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:104336822G>T	ENST00000358755.4	+	4	805	c.488G>T	c.(487-489)aGg>aTg	p.R163M	FZD6_ENST00000523739.1_Missense_Mutation_p.R131M|FZD6_ENST00000522566.1_Missense_Mutation_p.R163M|FZD6_ENST00000540287.1_Intron	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	163					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R163M(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			TGGTGTCCAAGGCATCTTAAG	0.428																																					p.R163M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G488T	8						.						79.0	87.0	84.0					8																	104336822		2203	4300	6503	104405998	SO:0001583	missense	8323	exon4			AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.488G>T	8.37:g.104336822G>T	ENSP00000351605:p.Arg163Met	Somatic		Capture	SOLID	Phase_I	104405998	NM_001164615	B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Missense_Mutation	SNP	ENST00000358755.4	37	CCDS6298.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.107381	0.37145	.	.	ENSG00000164930	ENST00000522566;ENST00000358755;ENST00000523739;ENST00000539487	T;T;T	0.77489	-1.07;-1.07;-1.1	5.8	4.92	0.64577	.	0.224693	0.48286	D	0.000200	T	0.74869	0.3773	M	0.68317	2.08	0.80722	D	1	B;P;B	0.39216	0.157;0.664;0.157	B;B;B	0.39185	0.103;0.293;0.103	T	0.74797	-0.3543	10	0.45353	T	0.12	.	10.236	0.43284	0.1521:0.0:0.8479:0.0	.	108;163;163	B4E236;B2R9H9;O60353	.;.;FZD6_HUMAN	M	163;163;131;108	ENSP00000429055:R163M;ENSP00000351605:R163M;ENSP00000429528:R131M	ENSP00000351605:R163M	R	+	2	0	FZD6	104405998	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.068000	0.57534	1.429000	0.47314	0.491000	0.48974	AGG		0.428	FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380560.1	NM_003506	
DCAF13	25879	hgsc.bcm.edu	37	8	104439448	104439448	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:104439448A>C	ENST00000297579.5	+	5	1325	c.1048A>C	c.(1048-1050)Agt>Cgt	p.S350R	DCAF13_ENST00000521971.1_Missense_Mutation_p.S158R|DCAF13_ENST00000519682.1_Missense_Mutation_p.S194R|DCAF13_ENST00000521999.1_3'UTR	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	198					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.S350R(1)		NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						GGGATTTGACAGTATAAGTAG	0.318																																					p.S350R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1048C	8						.						87.0	83.0	84.0					8																	104439448		2203	4300	6503	104508624	SO:0001583	missense	25879	exon5			AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.1048A>C	8.37:g.104439448A>C	ENSP00000297579:p.Ser350Arg	Somatic		Capture	SOLID	Phase_I	104508624	NM_015420	Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	ENST00000297579.5	37	CCDS34934.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.937966	0.92526	.	.	ENSG00000164934	ENST00000297579;ENST00000521971;ENST00000519682	T;T;T	0.01359	4.98;4.98;4.98	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.06917	0.0176	L	0.61387	1.9	0.80722	D	1	D;D	0.63046	0.99;0.992	P;D	0.64321	0.743;0.924	T	0.04320	-1.0960	10	0.72032	D	0.01	-20.0847	16.2405	0.82405	1.0:0.0:0.0:0.0	.	198;198	B3KME9;Q9NV06	.;DCA13_HUMAN	R	350;158;194	ENSP00000297579:S350R;ENSP00000430883:S158R;ENSP00000430411:S194R	ENSP00000297579:S350R	S	+	1	0	DCAF13	104508624	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.730000	0.91510	2.238000	0.73509	0.477000	0.44152	AGT		0.318	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380797.2	NM_015420	
COL14A1	7373	hgsc.bcm.edu	37	8	121302005	121302005	+	Splice_Site	SNP	G	G	A	rs146129118	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:121302005G>A	ENST00000297848.3	+	34	4506	c.4236G>A	c.(4234-4236)ccG>ccA	p.P1412P	COL14A1_ENST00000247781.3_Splice_Site_p.P1317P|COL14A1_ENST00000309791.4_Splice_Site_p.P1412P	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.P1412P(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			ACTCTGCACCGGTAAGTGAAT	0.408													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19198	0.0		0.0	False		,,,				2504	0.0				p.P1412P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4236A	8						.	G		2,4404	4.2+/-10.8	0,2,2201	108.0	100.0	103.0		4236	1.6	1.0	8	dbSNP_134	103	0,8600		0,0,4300	yes	coding-synonymous-near-splice	COL14A1	NM_021110.1		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		1412/1797	121302005	2,13004	2203	4300	6503	121371186	SO:0001630	splice_region_variant	7373	exon34				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4236+1G>A	8.37:g.121302005G>A		Somatic		Capture	SOLID	Phase_I	121371186	NM_021110		Silent	SNP	ENST00000297848.3	37	CCDS34938.1																																																																																				0.408	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	Silent
COL14A1	7373	hgsc.bcm.edu	37	8	121344382	121344382	+	Silent	SNP	C	C	A	rs115728758	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:121344382C>A	ENST00000297848.3	+	41	4932	c.4662C>A	c.(4660-4662)ggC>ggA	p.G1554G	COL14A1_ENST00000247781.3_Silent_p.G1459G|COL14A1_ENST00000309791.4_Silent_p.G1554G	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.G1554G(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TTCGCCAGGGCCTTCCGGGAA	0.483													C|||	2	0.000399361	0.0	0.0	5008	,	,		17267	0.0		0.002	False		,,,				2504	0.0				p.G1554G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4662A	8						.	C		0,4406		0,0,2203	79.0	78.0	78.0		4662	0.8	1.0	8	dbSNP_132	78	11,8589	8.4+/-32.0	0,11,4289	no	coding-synonymous	COL14A1	NM_021110.1		0,11,6492	AA,AC,CC		0.1279,0.0,0.0846		1554/1797	121344382	11,12995	2203	4300	6503	121413563	SO:0001819	synonymous_variant	7373	exon41				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4662C>A	8.37:g.121344382C>A		Somatic		Capture	SOLID	Phase_I	121413563	NM_021110		Silent	SNP	ENST00000297848.3	37	CCDS34938.1																																																																																				0.483	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
ZHX2	22882	hgsc.bcm.edu	37	8	123965245	123965245	+	Missense_Mutation	SNP	G	G	A	rs202088448		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:123965245G>A	ENST00000314393.4	+	3	2330	c.1495G>A	c.(1495-1497)Gtc>Atc	p.V499I		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	499					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.V499I(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			AAGGGGCATCGTCCACATCAC	0.587																																					p.V499I	Esophageal Squamous(94;1056 1388 11767 13799 49639)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1495A	8						.	G	ILE/VAL	0,4406		0,0,2203	83.0	68.0	73.0		1495	5.9	1.0	8		73	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZHX2	NM_014943.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	499/838	123965245	1,13005	2203	4300	6503	124034426	SO:0001583	missense	22882	exon3			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.1495G>A	8.37:g.123965245G>A	ENSP00000314709:p.Val499Ile	Somatic		Capture	SOLID	Phase_I	124034426	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.376377	0.42105	0.0	1.16E-4	ENSG00000178764	ENST00000314393	D	0.91631	-2.88	5.94	5.94	0.96194	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000006	D	0.93281	0.7859	L	0.27053	0.805	0.58432	D	0.999995	D	0.89917	1.0	D	0.76575	0.988	D	0.91105	0.4917	10	0.25106	T	0.35	-27.6591	20.3632	0.98871	0.0:0.0:1.0:0.0	.	499	Q9Y6X8	ZHX2_HUMAN	I	499	ENSP00000314709:V499I	ENSP00000314709:V499I	V	+	1	0	ZHX2	124034426	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	3.983000	0.56916	2.826000	0.97356	0.561000	0.74099	GTC		0.587	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
MTSS1	9788	hgsc.bcm.edu	37	8	125565659	125565659	+	Silent	SNP	G	G	A	rs200563029	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:125565659G>A	ENST00000518547.1	-	14	2315	c.1842C>T	c.(1840-1842)ccC>ccT	p.P614P	MTSS1_ENST00000378017.3_Silent_p.P589P|MTSS1_ENST00000431961.2_Silent_p.P332P|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000395508.2_Silent_p.P388P|MTSS1_ENST00000524090.1_Silent_p.P504P|MTSS1_ENST00000325064.5_Silent_p.P618P|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000354184.4_Silent_p.P332P	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	614	Pro-rich.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)	p.P614P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CAGGGATCACGGGTGTCTTGA	0.642													G|||	11	0.00219649	0.0	0.0014	5008	,	,		16927	0.0		0.0	False		,,,				2504	0.0102				p.P614P	Esophageal Squamous(160;622 1893 3862 8546 12509)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1842T	8						.						62.0	62.0	62.0					8																	125565659		2203	4300	6503	125634840	SO:0001819	synonymous_variant	9788	exon14			AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1842C>T	8.37:g.125565659G>A		Somatic		Capture	SOLID	Phase_I	125634840	NM_014751	J3KNK6|Q8TCA2|Q96RX2	Silent	SNP	ENST00000518547.1	37	CCDS6353.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	6.788	0.514441	0.12944	.	.	ENSG00000170873	ENST00000519168	.	.	.	5.8	-8.73	0.00841	.	.	.	.	.	T	0.43433	0.1247	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49588	-0.8924	4	.	.	.	-22.6584	5.5326	0.16993	0.6128:0.0997:0.1068:0.1807	.	.	.	.	C	402	.	.	R	-	1	0	MTSS1	125634840	0.000000	0.05858	0.367000	0.25926	0.958000	0.62258	-3.707000	0.00387	-1.337000	0.02236	-0.254000	0.11334	CGT		0.642	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	
MTSS1	9788	hgsc.bcm.edu	37	8	125565783	125565783	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:125565783A>G	ENST00000518547.1	-	14	2191	c.1718T>C	c.(1717-1719)cTc>cCc	p.L573P	MTSS1_ENST00000378017.3_Missense_Mutation_p.L548P|MTSS1_ENST00000431961.2_Missense_Mutation_p.L291P|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000395508.2_Missense_Mutation_p.L347P|MTSS1_ENST00000524090.1_Missense_Mutation_p.L463P|MTSS1_ENST00000325064.5_Missense_Mutation_p.L577P|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000354184.4_Missense_Mutation_p.L291P	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	573					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)	p.L573P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GGTGGTGGGGAGGCCAGCAGT	0.597																																					p.L573P	Esophageal Squamous(160;622 1893 3862 8546 12509)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1718C	8						.						77.0	55.0	63.0					8																	125565783		2203	4300	6503	125634964	SO:0001583	missense	9788	exon14			AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1718T>C	8.37:g.125565783A>G	ENSP00000429064:p.Leu573Pro	Somatic		Capture	SOLID	Phase_I	125634964	NM_014751	J3KNK6|Q8TCA2|Q96RX2	Missense_Mutation	SNP	ENST00000518547.1	37	CCDS6353.1	.	.	.	.	.	.	.	.	.	.	A	13.98	2.399214	0.42512	.	.	ENSG00000170873	ENST00000378017;ENST00000518547;ENST00000354184;ENST00000395508;ENST00000325064;ENST00000431961;ENST00000524090	T;T;T;T;T;T;T	0.53206	0.87;0.79;0.89;0.63;0.79;0.89;0.81	6.04	4.88	0.63580	.	0.065512	0.64402	N	0.000006	T	0.66458	0.2791	M	0.72118	2.19	0.80722	D	1	B;D;D;D;D;D;D	0.89917	0.011;1.0;1.0;1.0;1.0;1.0;1.0	B;D;D;D;D;D;D	0.97110	0.003;0.999;0.999;0.999;1.0;0.999;0.997	T	0.69015	-0.5257	10	0.72032	D	0.01	-23.6624	12.2481	0.54583	0.9339:0.0:0.0661:0.0	.	463;347;548;573;548;291;222	E7EWW5;B7Z3B6;A5YM41;O43312;O43312-4;O43312-2;Q6ZTG0	.;.;.;MTSS1_HUMAN;.;.;.	P	548;573;291;347;577;291;463	ENSP00000367256:L548P;ENSP00000429064:L573P;ENSP00000346119:L291P;ENSP00000378884:L347P;ENSP00000322804:L577P;ENSP00000393606:L291P;ENSP00000428319:L463P	ENSP00000322804:L577P	L	-	2	0	MTSS1	125634964	1.000000	0.71417	0.993000	0.49108	0.081000	0.17604	9.339000	0.96797	1.102000	0.41551	-0.441000	0.05720	CTC		0.597	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	
LPL	4023	hgsc.bcm.edu	37	8	19809369	19809369	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:19809369G>A	ENST00000311322.8	+	3	809	c.339G>A	c.(337-339)tgG>tgA	p.W113*		NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	113			W -> G (in LPL deficiency).|W -> R (in LPL deficiency). {ECO:0000269|PubMed:1479292, ECO:0000269|PubMed:1598907}.		chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)	p.W113*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	TGGTGGACTGGCTGTCACGGG	0.532																																					p.W113X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G339A	8						.						174.0	156.0	162.0					8																	19809369		2203	4300	6503	19853649	SO:0001587	stop_gained	4023	exon3				CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.339G>A	8.37:g.19809369G>A	ENSP00000309757:p.Trp113*	Somatic		Capture	SOLID	Phase_I	19853649	NM_000237	B2R5T9|Q16282|Q16283|Q96FC4	Nonsense_Mutation	SNP	ENST00000311322.8	37	CCDS6012.1	.	.	.	.	.	.	.	.	.	.	G	36	5.756416	0.96898	.	.	ENSG00000175445	ENST00000520959;ENST00000524029;ENST00000311322;ENST00000538071;ENST00000535763	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.3366	17.7894	0.88547	0.0:0.0:1.0:0.0	.	.	.	.	X	37;113;113;37;99	.	.	W	+	3	0	LPL	19853649	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.688000	0.98670	2.805000	0.96524	0.460000	0.39030	TGG		0.532	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089113.3		
RHOBTB2	23221	hgsc.bcm.edu	37	8	22862973	22862973	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:22862973G>A	ENST00000251822.6	+	3	818	c.281G>A	c.(280-282)cGc>cAc	p.R94H	RHOBTB2_ENST00000519685.1_Missense_Mutation_p.R116H|RP11-875O11.1_ENST00000502083.2_RNA|RP11-875O11.1_ENST00000523884.1_RNA|RHOBTB2_ENST00000522948.1_Missense_Mutation_p.R101H|RHOBTB2_ENST00000523918.1_3'UTR	NM_015178.2	NP_055993.2	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2	94	Rho-like.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.R94H(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	31		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		AAAGACCGTCGCTTTGCTTAT	0.577																																					p.R116H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G347A	8						.						88.0	82.0	84.0					8																	22862973		2203	4300	6503	22918918	SO:0001583	missense	23221	exon5			AF315385	CCDS6034.1, CCDS55210.1, CCDS55211.1	8p21.2	2013-01-08			ENSG00000008853	ENSG00000008853		"""BTB/POZ domain containing"""	18756	protein-coding gene	gene with protein product		607352				11222756	Standard	NM_001160036		Approved	KIAA0717, DBC2	uc011kzp.1	Q9BYZ6	OTTHUMG00000097827	ENST00000251822.6:c.281G>A	8.37:g.22862973G>A	ENSP00000251822:p.Arg94His	Somatic		Capture	SOLID	Phase_I	22918918	NM_001160036	A8K9Z8|D3DSR8|E9PBU2|E9PEI7|O94825|Q8N4A8|Q9BZK6	Missense_Mutation	SNP	ENST00000251822.6	37	CCDS6034.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526219	0.85600	.	.	ENSG00000008853	ENST00000519685;ENST00000524077;ENST00000522948;ENST00000251822	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	4.71	4.71	0.59529	.	0.054481	0.64402	D	0.000001	D	0.86188	0.5873	L	0.61218	1.895	0.49915	D	0.999837	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.991;0.991;0.991	D	0.87621	0.2510	10	0.72032	D	0.01	.	16.3995	0.83635	0.0:0.0:1.0:0.0	.	101;94;116	E9PEI7;Q9BYZ6;E9PBU2	.;RHBT2_HUMAN;.	H	116;116;101;94	ENSP00000427926:R116H;ENSP00000430785:R116H;ENSP00000429141:R101H;ENSP00000251822:R94H	ENSP00000251822:R94H	R	+	2	0	RHOBTB2	22918918	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.617000	0.98361	2.430000	0.82344	0.655000	0.94253	CGC		0.577	RHOBTB2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215101.2		
EXTL3	2137	hgsc.bcm.edu	37	8	28575255	28575255	+	Missense_Mutation	SNP	C	C	T	rs200494893		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:28575255C>T	ENST00000220562.4	+	3	2581	c.1679C>T	c.(1678-1680)gCg>gTg	p.A560V	EXTL3_ENST00000523149.1_Missense_Mutation_p.A176V|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	560					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.A560V(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		TCAGGCAAGGCGGCTGGAACT	0.617													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16582	0.0		0.0	False		,,,				2504	0.0				p.A560V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1679T	8						.	C	VAL/ALA	0,4406		0,0,2203	45.0	43.0	44.0		1679	5.9	1.0	8		44	2,8598	2.2+/-6.3	0,2,4298	yes	missense	EXTL3	NM_001440.2	64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	560/920	28575255	2,13004	2203	4300	6503	28631174	SO:0001583	missense	2137	exon3			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.1679C>T	8.37:g.28575255C>T	ENSP00000220562:p.Ala560Val	Somatic		Capture	SOLID	Phase_I	28631174	NM_001440	D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	37	CCDS6070.1	.	.	.	.	.	.	.	.	.	.	C	3.404	-0.121681	0.06838	0.0	2.33E-4	ENSG00000012232	ENST00000523149;ENST00000220562	D;D	0.95272	-3.27;-3.66	5.95	5.95	0.96441	.	0.187488	0.47455	D	0.000230	D	0.88905	0.6564	N	0.14661	0.345	0.48632	D	0.999686	B	0.28512	0.214	B	0.13407	0.009	D	0.84690	0.0722	10	0.27082	T	0.32	-23.8028	20.3748	0.98911	0.0:1.0:0.0:0.0	.	560	O43909	EXTL3_HUMAN	V	176;560	ENSP00000428691:A176V;ENSP00000220562:A560V	ENSP00000220562:A560V	A	+	2	0	EXTL3	28631174	1.000000	0.71417	0.973000	0.42090	0.583000	0.36354	4.950000	0.63603	2.817000	0.96982	0.563000	0.77884	GCG		0.617	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
SFRP1	6422	hgsc.bcm.edu	37	8	41122966	41122966	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:41122966T>A	ENST00000220772.3	-	3	1002	c.665A>T	c.(664-666)gAc>gTc	p.D222V	SFRP1_ENST00000379845.3_Missense_Mutation_p.D86V	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	222	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.K222M(1)|p.D222V(1)		breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			AATCTTCTTGTCGCCATTTTC	0.443																																					p.D222V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A665T	8						.						80.0	80.0	80.0					8																	41122966		2203	4300	6503	41242123	SO:0001583	missense	6422	exon3			AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.665A>T	8.37:g.41122966T>A	ENSP00000220772:p.Asp222Val	Somatic		Capture	SOLID	Phase_I	41242123	NM_003012	O00546|O14779	Missense_Mutation	SNP	ENST00000220772.3	37	CCDS34886.1	.	.	.	.	.	.	.	.	.	.	T	15.50	2.852849	0.51270	.	.	ENSG00000104332	ENST00000220772;ENST00000379845;ENST00000535263	T;T	0.31769	1.48;1.48	4.4	3.2	0.36748	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.054098	0.64402	D	0.000001	T	0.50377	0.1612	M	0.81341	2.54	0.80722	D	1	P	0.47604	0.898	P	0.59221	0.854	T	0.52268	-0.8598	10	0.72032	D	0.01	.	9.6138	0.39679	0.0:0.085:0.0:0.915	.	222	Q8N474	SFRP1_HUMAN	V	222;86;222	ENSP00000220772:D222V;ENSP00000369174:D86V	ENSP00000220772:D222V	D	-	2	0	SFRP1	41242123	1.000000	0.71417	0.938000	0.37757	0.393000	0.30537	6.090000	0.71397	0.790000	0.33803	0.460000	0.39030	GAC		0.443	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377132.1	NM_003012	
ST18	9705	hgsc.bcm.edu	37	8	53044591	53044591	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:53044591C>A	ENST00000276480.7	-	22	3276	c.2593G>T	c.(2593-2595)Gag>Tag	p.E865*		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	865					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E865*(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGTGGTAGCTCTTGTTTGTTC	0.493																																					p.E865X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2593T	8						.						154.0	136.0	142.0					8																	53044591		2203	4300	6503	53207144	SO:0001587	stop_gained	9705	exon22			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2593G>T	8.37:g.53044591C>A	ENSP00000276480:p.Glu865*	Somatic		Capture	SOLID	Phase_I	53207144	NM_014682	Q17RY1	Nonsense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	C	48	14.003974	0.99774	.	.	ENSG00000147488	ENST00000276480	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-23.234	19.469	0.94954	0.0:1.0:0.0:0.0	.	.	.	.	X	865	.	ENSP00000276480:E865X	E	-	1	0	ST18	53207144	1.000000	0.71417	0.942000	0.38095	0.947000	0.59692	7.776000	0.85560	2.649000	0.89929	0.655000	0.94253	GAG		0.493	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
RP1	6101	hgsc.bcm.edu	37	8	55538689	55538689	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:55538689C>T	ENST00000220676.1	+	4	2395	c.2247C>T	c.(2245-2247)ctC>ctT	p.L749L		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	749					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.L749L(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAAGTAATCTCAATTCCACGA	0.318																																					p.L749L	Colon(91;1014 1389 7634 14542 40420)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2247T	8						.						26.0	27.0	27.0					8																	55538689		2202	4296	6498	55701242	SO:0001819	synonymous_variant	6101	exon4			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2247C>T	8.37:g.55538689C>T		Somatic		Capture	SOLID	Phase_I	55701242	NM_006269		Silent	SNP	ENST00000220676.1	37	CCDS6160.1																																																																																				0.318	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
C8orf34	116328	hgsc.bcm.edu	37	8	69699762	69699762	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:69699762C>T	ENST00000539993.1	+	12	1831	c.1282C>T	c.(1282-1284)Caa>Taa	p.Q428*	C8orf34_ENST00000337103.4_Nonsense_Mutation_p.Q403*|C8orf34_ENST00000325233.3_Nonsense_Mutation_p.Q172*|C8orf34_ENST00000518698.1_Nonsense_Mutation_p.Q514*			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	428								p.Q403*(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			GGAAGCAGAACAAGAGAAACG	0.363																																					p.Q514X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1540T	8						.						108.0	97.0	101.0					8																	69699762		2203	4300	6503	69862316	SO:0001587	stop_gained	116328	exon12			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.1282C>T	8.37:g.69699762C>T	ENSP00000438159:p.Gln428*	Somatic		Capture	SOLID	Phase_I	69862316	NM_052958	A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Nonsense_Mutation	SNP	ENST00000539993.1	37		.	.	.	.	.	.	.	.	.	.	C	41	8.684875	0.98914	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000337103;ENST00000325233	.	.	.	5.36	5.36	0.76844	.	0.540252	0.18718	N	0.133119	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.6991	16.3753	0.83383	0.0:1.0:0.0:0.0	.	.	.	.	X	514;428;403;172	.	.	Q	+	1	0	C8orf34	69862316	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.644000	0.61397	2.657000	0.90304	0.655000	0.94253	CAA		0.363	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_052958	
KIAA1429	25962	hgsc.bcm.edu	37	8	95531233	95531233	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:95531233G>A	ENST00000297591.5	-	9	2568	c.2493C>T	c.(2491-2493)taC>taT	p.Y831Y	KIAA1429_ENST00000437199.1_Silent_p.Y831Y|KIAA1429_ENST00000421249.2_Silent_p.Y831Y	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	831					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.Y831Y(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CTTTGGAATAGTACTCCATTA	0.328																																					p.Y831Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2493T	8						.						50.0	56.0	54.0					8																	95531233		2199	4299	6498	95600409	SO:0001819	synonymous_variant	25962	exon9			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.2493C>T	8.37:g.95531233G>A		Somatic		Capture	SOLID	Phase_I	95600409	NM_015496	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Silent	SNP	ENST00000297591.5	37	CCDS34923.1																																																																																				0.328	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
SLC45A4	57210	hgsc.bcm.edu	37	8	142231819	142231819	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr8:142231819A>G	ENST00000024061.3	-	2	441	c.134T>C	c.(133-135)aTc>aCc	p.I45T	SLC45A4_ENST00000433583.2_Missense_Mutation_p.I38T|SLC45A4_ENST00000519067.1_Missense_Mutation_p.I45T|SLC45A4_ENST00000517878.1_Missense_Mutation_p.I96T	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)		p.I45T(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GAGGCCAAGGATGGGGCTCAG	0.667																																					p.I45T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T134C	8						.						102.0	88.0	93.0					8																	142231819		2203	4300	6503	142301001	SO:0001583	missense	57210	exon2			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.134T>C	8.37:g.142231819A>G	ENSP00000024061:p.Ile45Thr	Somatic		Capture	SOLID	Phase_I	142301001	NM_001080431	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	ENST00000024061.3	37	CCDS34948.1	.	.	.	.	.	.	.	.	.	.	A	19.78	3.890826	0.72524	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061;ENST00000519986	D;D;D;D;D	0.93488	-2.79;-2.79;-2.79;-2.79;-3.23	5.49	5.49	0.81192	.	0.277859	0.41396	D	0.000881	D	0.95648	0.8585	M	0.66939	2.045	0.41931	D	0.99056	D;D;B	0.65815	0.962;0.995;0.106	P;P;B	0.62014	0.828;0.897;0.098	D	0.96285	0.9209	10	0.87932	D	0	-30.7226	15.5837	0.76465	1.0:0.0:0.0:0.0	.	96;45;45	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	T	45;96;38;45;27	ENSP00000429059:I45T;ENSP00000428137:I96T;ENSP00000400799:I38T;ENSP00000024061:I45T;ENSP00000429974:I27T	ENSP00000024061:I45T	I	-	2	0	SLC45A4	142301001	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	9.090000	0.94144	2.089000	0.63090	0.334000	0.21626	ATC		0.667	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
SLC25A24	29957	hgsc.bcm.edu	37	1	108681767	108681767	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:108681767A>G	ENST00000565488.1	-	9	1381	c.1162T>C	c.(1162-1164)Ttg>Ctg	p.L388L	SLC25A24_ENST00000370041.4_Silent_p.L369L	NM_013386.4	NP_037518.3	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24	388					ATP transport (GO:0015867)|cellular response to calcium ion (GO:0071277)|cellular response to oxidative stress (GO:0034599)|mitochondrial transport (GO:0006839)|regulation of cell death (GO:0010941)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP transmembrane transporter activity (GO:0005347)|calcium ion binding (GO:0005509)	p.L369L(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		CATCCCAGCAACACCATGACT	0.453																																					p.L388L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1162C	1						.						80.0	83.0	82.0					1																	108681767		2203	4300	6503	108483290	SO:0001819	synonymous_variant	29957	exon9			AJ619961	CCDS786.1, CCDS41361.1	1p13.2	2013-05-22			ENSG00000085491	ENSG00000085491		"""Solute carriers"", ""EF-hand domain containing"""	20662	protein-coding gene	gene with protein product		608744				15123600	Standard	NM_013386		Approved	DKFZp586G0123, APC1	uc001dvn.5	Q6NUK1	OTTHUMG00000011013	ENST00000565488.1:c.1162T>C	1.37:g.108681767A>G		Somatic		Capture	SOLID	Phase_I	108483290	NM_013386	B7ZAI9|Q5T331|Q5T485|Q6PJJ9|Q705K4|Q9P129	Silent	SNP	ENST00000565488.1	37	CCDS41361.1																																																																																				0.453	SLC25A24-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030280.2	NM_013386	
SSU72	29101	hgsc.bcm.edu	37	1	1500252	1500252	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:1500252A>G	ENST00000291386.3	-	2	436	c.125T>C	c.(124-126)gTg>gCg	p.V42A	SSU72_ENST00000359060.4_Missense_Mutation_p.V42A	NM_014188.2	NP_054907.1	Q9NP77	SSU72_HUMAN	SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)	42					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|mRNA polyadenylation (GO:0006378)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)	p.V42A(1)		large_intestine(2)|lung(5)	7	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		TGGAAGCTTCACGTGAGTCCC	0.433																																					p.V42A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T125C	1						.						133.0	129.0	130.0					1																	1500252		2203	4300	6503	1490115	SO:0001583	missense	29101	exon2			AJ276409	CCDS32.1	1p36	2010-03-24	2006-04-04		ENSG00000160075	ENSG00000160075			25016	protein-coding gene	gene with protein product			"""Ssu72 RNA polymerase II CTD phosphatase homolog (yeast)"""			15125841, 15659578	Standard	NM_014188		Approved	HSPC182	uc001agd.3	Q9NP77	OTTHUMG00000000576	ENST00000291386.3:c.125T>C	1.37:g.1500252A>G	ENSP00000291386:p.Val42Ala	Somatic		Capture	SOLID	Phase_I	1490115	NM_014188	Q9BZS6|Q9H933	Missense_Mutation	SNP	ENST00000291386.3	37	CCDS32.1	.	.	.	.	.	.	.	.	.	.	A	29.6	5.019620	0.93462	.	.	ENSG00000160075	ENST00000291386;ENST00000378725;ENST00000359060	T;T	0.58652	0.32;0.32	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000001	T	0.82181	0.4981	H	0.94462	3.54	0.80722	D	1	D;D;D	0.69078	0.997;0.996;0.99	D;D;D	0.76575	0.988;0.94;0.938	D	0.87274	0.2288	10	0.87932	D	0	-33.3861	14.6234	0.68602	1.0:0.0:0.0:0.0	.	42;42;42	B4DMK6;Q9NP77-2;Q9NP77	.;.;SSU72_HUMAN	A	42	ENSP00000291386:V42A;ENSP00000351955:V42A	ENSP00000291386:V42A	V	-	2	0	SSU72	1490115	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	8.988000	0.93501	2.133000	0.65898	0.460000	0.39030	GTG		0.433	SSU72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001366.1	NM_014188	
CLCC1	23155	hgsc.bcm.edu	37	1	109484066	109484066	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:109484066C>T	ENST00000369971.2	-	7	886	c.757G>A	c.(757-759)Gtg>Atg	p.V253M	CLCC1_ENST00000482889.1_5'UTR|CLCC1_ENST00000356970.2_Missense_Mutation_p.V253M|CLCC1_ENST00000369976.1_Intron|CLCC1_ENST00000302500.4_Missense_Mutation_p.V132M|CLCC1_ENST00000369968.2_Intron|CLCC1_ENST00000369969.2_Missense_Mutation_p.V132M|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000348264.2_Intron|CLCC1_ENST00000369970.3_Missense_Mutation_p.V203M|CLCC1_ENST00000415331.1_Missense_Mutation_p.V203M	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	253						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)	p.V203M(1)		autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		TTGGCACACACATTGTTTAAT	0.448																																					p.V253M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G757A	1						.						220.0	196.0	204.0					1																	109484066		2203	4300	6503	109285589	SO:0001583	missense	23155	exon7			AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.757G>A	1.37:g.109484066C>T	ENSP00000358988:p.Val253Met	Somatic		Capture	SOLID	Phase_I	109285589	NM_001048210	O94861|Q8WYP8|Q8WYP9|Q9BU25	Missense_Mutation	SNP	ENST00000369971.2	37	CCDS41362.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156961	0.57259	.	.	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369969;ENST00000369970;ENST00000302500	T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59	5.9	2.95	0.34219	.	0.635241	0.16936	N	0.193464	T	0.45074	0.1324	M	0.67953	2.075	0.09310	N	1	D;D;D	0.65815	0.995;0.977;0.986	P;P;P	0.60117	0.841;0.803;0.869	T	0.31668	-0.9935	10	0.41790	T	0.15	-0.8455	4.5894	0.12299	0.1261:0.6169:0.1219:0.1352	.	132;203;253	Q96S66-3;Q96S66-2;Q96S66	.;.;CLCC1_HUMAN	M	253;253;203;132;203;132	ENSP00000349456:V253M;ENSP00000358988:V253M;ENSP00000411591:V203M;ENSP00000358986:V132M;ENSP00000358987:V203M;ENSP00000306552:V132M	ENSP00000306552:V132M	V	-	1	0	CLCC1	109285589	0.000000	0.05858	0.001000	0.08648	0.823000	0.46562	0.237000	0.17985	0.364000	0.24374	0.591000	0.81541	GTG		0.448	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032405.1	NM_015127	
FLG	2312	hgsc.bcm.edu	37	1	152280032	152280032	+	Missense_Mutation	SNP	T	T	C	rs71625200	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:152280032T>C	ENST00000368799.1	-	3	7365	c.7330A>G	c.(7330-7332)Aag>Gag	p.K2444E	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2444	Ser-rich.			K -> Q (in Ref. 3; AAA52454). {ECO:0000305}.	establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTGCCTGCTTGTGGTGGGAT	0.592									Ichthyosis				C|||	1718	0.343051	0.1218	0.4222	5008	,	,		21032	0.6071		0.171	False		,,,				2504	0.4908				p.K2444E												.	.	0			c.A7330G	1						.	C	GLU/LYS	599,3807	766.7+/-413.5	43,513,1647	304.0	277.0	286.0		7330	2.1	0.0	1	dbSNP_130	286	1407,7191	749.4+/-407.4	123,1161,3015	no	missense	FLG	NM_002016.1	56	166,1674,4662	CC,CT,TT		16.3643,13.5951,15.426	benign	2444/4062	152280032	2006,10998	2203	4299	6502	150546656	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7330A>G	1.37:g.152280032T>C	ENSP00000357789:p.Lys2444Glu	Somatic		Capture	SOLID	Phase_I	150546656	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	586	0.2683150183150183	51	0.10365853658536585	107	0.2955801104972376	319	0.5576923076923077	109	0.1437994722955145	C	7.499	0.652241	0.14580	0.135951	0.163643	ENSG00000143631	ENST00000368799	T	0.01647	4.71	4.1	2.1	0.27182	.	.	.	.	.	T	0.00109	0.0003	N	0.00036	-2.535	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.26710	-1.0095	8	0.02654	T	1	.	3.9847	0.09511	0.0:0.5744:0.1996:0.226	.	2444	P20930	FILA_HUMAN	E	2444	ENSP00000357789:K2444E	ENSP00000357789:K2444E	K	-	1	0	FLG	150546656	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	-0.889000	0.04144	0.313000	0.23062	-0.330000	0.08379	AAG		0.592	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
SLC27A3	11000	hgsc.bcm.edu	37	1	153751868	153751868	+	Silent	SNP	C	C	T	rs202242885		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:153751868C>T	ENST00000368661.3	+	9	2000	c.1935C>T	c.(1933-1935)caC>caT	p.H645H	SLC27A3_ENST00000271857.2_Silent_p.H726H|SLC27A3_ENST00000484014.1_3'UTR	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	645					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)	p.H645H(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GTCCCCCCCACGCTTTGGACC	0.617																																					p.H645H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1935T	1						.			0,4406		0,0,2203	123.0	107.0	112.0		1935	1.5	0.1	1		112	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	SLC27A3	NM_024330.1		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		645/731	153751868	2,13004	2203	4300	6503	152018492	SO:0001819	synonymous_variant	11000	exon9			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.1935C>T	1.37:g.153751868C>T		Somatic		Capture	SOLID	Phase_I	152018492	NM_024330	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Silent	SNP	ENST00000368661.3	37	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	C	1.412	-0.575219	0.03882	0.0	2.33E-4	ENSG00000143554	ENST00000458027	.	.	.	4.58	1.55	0.23275	.	.	.	.	.	T	0.09555	0.0235	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	T	0.33574	-0.9863	4	.	.	.	-11.1804	3.5328	0.07784	0.1579:0.4209:0.329:0.0923	.	.	.	.	M	350	.	.	T	+	2	0	SLC27A3	152018492	0.017000	0.18338	0.130000	0.21974	0.480000	0.33159	0.576000	0.23744	0.227000	0.20999	0.591000	0.81541	ACG		0.617	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
GATAD2B	57459	hgsc.bcm.edu	37	1	153785767	153785767	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:153785767G>A	ENST00000368655.4	-	8	1621	c.1378C>T	c.(1378-1380)Cgg>Tgg	p.R460W		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	460	CR2; histone tail-binding.				ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R460W(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTTTTCAGCCGGTTGGTGTGT	0.458																																					p.R460W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1378T	1						.						211.0	188.0	196.0					1																	153785767		2203	4300	6503	152052391	SO:0001583	missense	57459	exon8			AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.1378C>T	1.37:g.153785767G>A	ENSP00000357644:p.Arg460Trp	Somatic		Capture	SOLID	Phase_I	152052391	NM_020699	D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	ENST00000368655.4	37	CCDS1054.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.136016	0.77662	.	.	ENSG00000143614	ENST00000368655	T	0.40756	1.02	5.04	5.04	0.67666	.	0.054132	0.64402	D	0.000001	T	0.55737	0.1939	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.58538	-0.7619	10	0.72032	D	0.01	-2.3014	17.33	0.87259	0.0:0.0:1.0:0.0	.	460	Q8WXI9	P66B_HUMAN	W	460	ENSP00000357644:R460W	ENSP00000357644:R460W	R	-	1	2	GATAD2B	152052391	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	2.229000	0.42990	2.622000	0.88805	0.655000	0.94253	CGG		0.458	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090305.1	NM_020699	
DCST2	127579	hgsc.bcm.edu	37	1	155003662	155003662	+	Missense_Mutation	SNP	C	C	T	rs371287152		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:155003662C>T	ENST00000368424.3	-	5	846	c.788G>A	c.(787-789)cGc>cAc	p.R263H	DCST2_ENST00000295536.5_Missense_Mutation_p.R263H|DCST1_ENST00000423025.2_5'Flank|DCST1_ENST00000368419.2_5'Flank|DCST1_ENST00000392480.1_5'Flank|DCST1_ENST00000295542.1_5'Flank	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	263						integral component of membrane (GO:0016021)		p.R263H(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GATGGTCTGGCGCAAGAAGGG	0.637																																					p.R263H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G788A	1						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	91.0	74.0	80.0		788	1.2	0.8	1		80	0,8600		0,0,4300	no	missense	DCST2	NM_144622.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	263/774	155003662	1,13005	2203	4300	6503	153270286	SO:0001583	missense	127579	exon5			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.788G>A	1.37:g.155003662C>T	ENSP00000357409:p.Arg263His	Somatic		Capture	SOLID	Phase_I	153270286	NM_144622	Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	ENST00000368424.3	37	CCDS1082.2	.	.	.	.	.	.	.	.	.	.	C	11.53	1.666829	0.29604	2.27E-4	0.0	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.23754	1.89;1.93	5.19	1.19	0.21007	.	0.070349	0.50627	D	0.000102	T	0.05777	0.0151	L	0.32530	0.975	0.19775	N	0.999954	B	0.25486	0.127	B	0.18263	0.021	T	0.34950	-0.9808	10	0.27785	T	0.31	-18.4455	8.3131	0.32084	0.0:0.6684:0.0:0.3316	.	263	Q5T1A1	DCST2_HUMAN	H	263	ENSP00000357409:R263H;ENSP00000295536:R263H	ENSP00000295536:R263H	R	-	2	0	DCST2	153270286	0.002000	0.14202	0.769000	0.31535	0.890000	0.51754	-0.029000	0.12329	0.591000	0.29711	0.561000	0.74099	CGC		0.637	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090953.3	NM_144622	
IQGAP3	128239	hgsc.bcm.edu	37	1	156509304	156509304	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:156509304A>G	ENST00000361170.2	-	25	2928	c.2918T>C	c.(2917-2919)cTg>cCg	p.L973P	IQGAP3_ENST00000498755.1_5'Flank	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	973					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.L973P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTGAAAGATCAGCTTGGCCAG	0.517																																					p.L973P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2918C	1						.						90.0	82.0	85.0					1																	156509304		2203	4300	6503	154775928	SO:0001583	missense	128239	exon25			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.2918T>C	1.37:g.156509304A>G	ENSP00000354451:p.Leu973Pro	Somatic		Capture	SOLID	Phase_I	154775928	NM_178229	Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	37	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.306541	0.81247	.	.	ENSG00000183856	ENST00000361170	D	0.84516	-1.86	4.8	4.8	0.61643	Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000003	D	0.92459	0.7606	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94015	0.7287	10	0.87932	D	0	-12.2845	13.3075	0.60362	1.0:0.0:0.0:0.0	.	973	Q86VI3	IQGA3_HUMAN	P	973	ENSP00000354451:L973P	ENSP00000354451:L973P	L	-	2	0	IQGAP3	154775928	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.135000	0.94478	2.008000	0.58898	0.533000	0.62120	CTG		0.517	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
ARHGAP30	257106	hgsc.bcm.edu	37	1	161023120	161023120	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:161023120G>A	ENST00000368013.3	-	6	912	c.592C>T	c.(592-594)Cgg>Tgg	p.R198W	ARHGAP30_ENST00000368015.1_Missense_Mutation_p.R21W|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.R198W	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	198	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)	p.R198W(2)		breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GATTGTACCCGCACCTCCATG	0.557																																					p.R198W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C592T	1						.						150.0	110.0	123.0					1																	161023120		2203	4300	6503	159289744	SO:0001583	missense	257106	exon6			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.592C>T	1.37:g.161023120G>A	ENSP00000356992:p.Arg198Trp	Somatic		Capture	SOLID	Phase_I	159289744	NM_181720	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	37	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277395	0.80580	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368017;ENST00000368015	T;T;T	0.56776	2.71;2.71;0.44	5.54	4.55	0.56014	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.74619	0.3740	M	0.92507	3.315	0.45554	D	0.9985	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.80721	-0.1256	10	0.87932	D	0	.	14.7564	0.69567	0.0:0.0:0.8456:0.1544	.	198;198	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	W	198;198;50;21	ENSP00000356995:R198W;ENSP00000356992:R198W;ENSP00000356994:R21W	ENSP00000356992:R198W	R	-	1	2	ARHGAP30	159289744	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	3.000000	0.49481	2.619000	0.88677	0.650000	0.86243	CGG		0.557	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
ASTN1	460	hgsc.bcm.edu	37	1	177001978	177001978	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:177001978A>G	ENST00000367654.3	-	3	690	c.479T>C	c.(478-480)aTg>aCg	p.M160T	ASTN1_ENST00000424564.2_Missense_Mutation_p.M160T|ASTN1_ENST00000361833.2_Missense_Mutation_p.M160T|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Missense_Mutation_p.M160T	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	160					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.M160T(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CAGAGCGATCATGCCACCCTA	0.577																																					p.M160T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T479C	1						.						49.0	44.0	46.0					1																	177001978		2202	4299	6501	175268601	SO:0001583	missense	460	exon3			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.479T>C	1.37:g.177001978A>G	ENSP00000356626:p.Met160Thr	Somatic		Capture	SOLID	Phase_I	175268601	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	A	16.02	3.004732	0.54254	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.15017	2.46;2.87;2.87;2.46	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.26122	0.0637	L	0.40543	1.245	0.80722	D	1	D;P;P	0.62365	0.991;0.892;0.892	P;P;P	0.53401	0.725;0.542;0.542	T	0.01202	-1.1420	10	0.87932	D	0	-25.516	15.12	0.72434	1.0:0.0:0.0:0.0	.	160;160;160	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	T	160	ENSP00000356629:M160T;ENSP00000354536:M160T;ENSP00000356626:M160T;ENSP00000395041:M160T	ENSP00000354536:M160T	M	-	2	0	ASTN1	175268601	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.166000	0.94766	2.030000	0.59900	0.533000	0.62120	ATG		0.577	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
EMC1	23065	hgsc.bcm.edu	37	1	19561645	19561645	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:19561645C>A	ENST00000477853.1	-	13	1453	c.1411G>T	c.(1411-1413)Gga>Tga	p.G471*	EMC1_ENST00000375208.3_Nonsense_Mutation_p.G449*|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375199.3_Nonsense_Mutation_p.G470*	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	471						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)		p.G471*(1)									CCAAATTCTCCTTCCAGCTCG	0.567																																					p.G471X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1411T	1						.						99.0	87.0	91.0					1																	19561645		2203	4300	6503	19434232	SO:0001587	stop_gained	23065	exon13				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.1411G>T	1.37:g.19561645C>A	ENSP00000420608:p.Gly471*	Somatic		Capture	SOLID	Phase_I	19434232	NM_015047	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Nonsense_Mutation	SNP	ENST00000477853.1	37	CCDS190.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.884927|6.884927	0.97908|0.97908	.|.	.|.	ENSG00000127463|ENSG00000127463	ENST00000477853;ENST00000375199;ENST00000375208|ENST00000375197	.|.	.|.	.|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.75110	.|0.3805	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72232	.|-0.4353	.|4	0.16896|.	T|.	0.51|.	-15.7884|-15.7884	18.8623|18.8623	0.92278|0.92278	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|M	471;470;449|204	.|.	ENSP00000364345:G470X|.	G|R	-|-	1|2	0|0	KIAA0090|KIAA0090	19434232|19434232	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.280000|7.280000	0.78610|0.78610	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GGA|AGG		0.567	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047	
RGL1	23179	hgsc.bcm.edu	37	1	183857698	183857698	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:183857698G>A	ENST00000360851.3	+	8	1220	c.1042G>A	c.(1042-1044)Gct>Act	p.A348T	RGL1_ENST00000539189.1_Missense_Mutation_p.A348T|RGL1_ENST00000304685.4_Missense_Mutation_p.A383T|RGL1_ENST00000536277.1_Missense_Mutation_p.A346T			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	348	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.A383T(1)		breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						AAAGACTTGGGCTGCCGTCCC	0.473																																					p.A383T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1147A	1						.						104.0	107.0	106.0					1																	183857698		2203	4299	6502	182124321	SO:0001583	missense	23179	exon9			AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.1042G>A	1.37:g.183857698G>A	ENSP00000354097:p.Ala348Thr	Somatic		Capture	SOLID	Phase_I	182124321	NM_015149	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	ENST00000360851.3	37		.	.	.	.	.	.	.	.	.	.	G	21.8	4.197654	0.79015	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000543395;ENST00000360851;ENST00000539189	T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48	5.07	5.07	0.68467	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.117745	0.56097	D	0.000021	T	0.29882	0.0747	L	0.49640	1.575	0.80722	D	1	P;P;P;P;P	0.41748	0.557;0.761;0.511;0.611;0.761	B;B;B;B;B	0.40165	0.215;0.321;0.281;0.321;0.321	T	0.03651	-1.1016	10	0.30854	T	0.27	.	13.7857	0.63108	0.0762:0.0:0.9238:0.0	.	348;346;153;348;383	F5H6U6;B7Z2W5;F5H3C3;Q9NZL6;Q5SXQ6	.;.;.;RGL1_HUMAN;.	T	383;383;346;153;348;348	ENSP00000303192:A383T;ENSP00000356501:A383T;ENSP00000438662:A346T;ENSP00000354097:A348T;ENSP00000437355:A348T	ENSP00000303192:A383T	A	+	1	0	RGL1	182124321	1.000000	0.71417	0.927000	0.36925	0.937000	0.57800	4.538000	0.60650	2.341000	0.79615	0.655000	0.94253	GCT		0.473	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149	
KIF21B	23046	hgsc.bcm.edu	37	1	200956019	200956019	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:200956019C>T	ENST00000422435.2	-	26	3958	c.3642G>A	c.(3640-3642)acG>acA	p.T1214T	KIF21B_ENST00000461742.2_Silent_p.T1214T|KIF21B_ENST00000332129.2_Silent_p.T1214T|KIF21B_ENST00000360529.5_Silent_p.T1214T	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1214					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T1214T(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						TCAGCGGGGACGTCTCTGTGG	0.562																																					p.T1214T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3642A	1						.						132.0	104.0	113.0					1																	200956019		2203	4300	6503	199222642	SO:0001819	synonymous_variant	23046	exon26			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.3642G>A	1.37:g.200956019C>T		Somatic		Capture	SOLID	Phase_I	199222642	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	ENST00000422435.2	37	CCDS58056.1																																																																																				0.562	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
PPP1R15B	84919	hgsc.bcm.edu	37	1	204380041	204380041	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:204380041A>G	ENST00000367188.4	-	1	878	c.499T>C	c.(499-501)Ttg>Ctg	p.L167L	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	167					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)	p.L167L(1)		breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			GCAGGGTCCAAAGCACTTCCC	0.562																																					p.L167L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T499C	1						.						91.0	93.0	92.0					1																	204380041		2203	4300	6503	202646664	SO:0001819	synonymous_variant	84919	exon1			AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.499T>C	1.37:g.204380041A>G		Somatic		Capture	SOLID	Phase_I	202646664	NM_032833	Q53GQ4|Q658M2|Q6P156|Q96SN1	Silent	SNP	ENST00000367188.4	37	CCDS1445.1																																																																																				0.562	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833	
IL19	29949	hgsc.bcm.edu	37	1	207014413	207014413	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:207014413A>T	ENST00000270218.6	+	6	1367	c.428A>T	c.(427-429)aAc>aTc	p.N143I	IL19_ENST00000340758.2_Missense_Mutation_p.N181I	NM_013371.3	NP_037503.2	Q9UHD0	IL19_HUMAN	interleukin 19	143					apoptotic process (GO:0006915)|immune response (GO:0006955)|interleukin-6 biosynthetic process (GO:0042226)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|reactive oxygen species metabolic process (GO:0072593)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)	p.N143I(1)		central_nervous_system(2)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7			BRCA - Breast invasive adenocarcinoma(75;0.211)			ATCCATGACAACTATGATCAG	0.512																																					p.N143I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A428T	1						.						116.0	89.0	98.0					1																	207014413		2203	4300	6503	205081036	SO:0001583	missense	29949	exon6			AF192498	CCDS1468.1, CCDS1469.1	1q32.2	2008-07-18			ENSG00000142224	ENSG00000142224		"""Interleukins and interleukin receptors"""	5990	protein-coding gene	gene with protein product	"""melanoma differentiation associated protein-like protein"""	605687				11196675	Standard	NM_153758		Approved	IL-19, MDA1, ZMDA1, IL-10C, NG.1	uc001heo.3	Q9UHD0	OTTHUMG00000036387	ENST00000270218.6:c.428A>T	1.37:g.207014413A>T	ENSP00000270218:p.Asn143Ile	Somatic		Capture	SOLID	Phase_I	205081036	NM_013371	B6VEV9|Q5VUT3|Q96QR4|Q9NUA0	Missense_Mutation	SNP	ENST00000270218.6	37	CCDS1469.1	.	.	.	.	.	.	.	.	.	.	A	17.09	3.300176	0.60195	.	.	ENSG00000142224	ENST00000340758;ENST00000270218	T;T	0.17528	2.27;2.27	5.71	4.57	0.56435	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.211905	0.49916	N	0.000136	T	0.30324	0.0761	M	0.73598	2.24	0.44162	D	0.996968	P;P	0.50710	0.551;0.938	P;P	0.52343	0.566;0.696	T	0.02909	-1.1095	10	0.54805	T	0.06	.	8.979	0.35953	0.835:0.0:0.0:0.165	.	143;181	Q9UHD0;Q5VUT3	IL19_HUMAN;.	I	181;143	ENSP00000343000:N181I;ENSP00000270218:N143I	ENSP00000270218:N143I	N	+	2	0	IL19	205081036	1.000000	0.71417	0.996000	0.52242	0.581000	0.36288	3.176000	0.50863	0.969000	0.38237	0.482000	0.46254	AAC		0.512	IL19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088567.2	NM_153758	
CENPF	1063	hgsc.bcm.edu	37	1	214830702	214830702	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:214830702C>T	ENST00000366955.3	+	18	9080	c.8912C>T	c.(8911-8913)aCg>aTg	p.T2971M		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	3067	Sufficient for centromere localization.|Sufficient for nuclear localization.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.T2971M(2)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GCAGAAGACACGGAAGGTACT	0.403																																					p.T2971M	Colon(80;575 1284 11000 14801 43496)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C8912T	1						.						55.0	52.0	53.0					1																	214830702		2203	4300	6503	212897325	SO:0001583	missense	1063	exon18			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.8912C>T	1.37:g.214830702C>T	ENSP00000355922:p.Thr2971Met	Somatic		Capture	SOLID	Phase_I	212897325	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	c	10.79	1.449356	0.26074	.	.	ENSG00000117724	ENST00000366955	T	0.03272	3.99	5.33	-3.27	0.05048	Centromere protein Cenp-F, Rb protein-binding domain (1);	0.987596	0.08206	N	0.981474	T	0.01835	0.0058	N	0.08118	0	0.09310	N	1	P	0.52577	0.954	B	0.43360	0.417	T	0.39333	-0.9619	10	0.32370	T	0.25	.	1.996	0.03456	0.466:0.1604:0.0805:0.2932	.	3067	P49454	CENPF_HUMAN	M	2971	ENSP00000355922:T2971M	ENSP00000355922:T2971M	T	+	2	0	CENPF	212897325	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.293000	0.08320	-0.213000	0.10094	-0.119000	0.15052	ACG		0.403	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
USH2A	7399	hgsc.bcm.edu	37	1	216348629	216348629	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:216348629G>A	ENST00000307340.3	-	21	4978	c.4592C>T	c.(4591-4593)cCc>cTc	p.P1531L	USH2A_ENST00000366942.3_Missense_Mutation_p.P1531L|USH2A_ENST00000366943.2_Missense_Mutation_p.P1531L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1531	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.P1531L(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGTGGAGCTGGGAAATTTACA	0.403										HNSCC(13;0.011)																											p.P1531L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4592T	1						.						85.0	64.0	71.0					1																	216348629		2203	4300	6503	214415252	SO:0001583	missense	7399	exon21			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4592C>T	1.37:g.216348629G>A	ENSP00000305941:p.Pro1531Leu	Somatic		Capture	SOLID	Phase_I	214415252	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	35	5.500604	0.96371	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.80653	-1.4;-1.4;2.08	5.89	5.89	0.94794	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (1);	0.165183	0.28760	N	0.014222	D	0.87888	0.6291	M	0.71581	2.175	0.80722	D	1	D;D	0.69078	0.993;0.997	P;P	0.62089	0.898;0.826	D	0.83385	0.0014	10	0.18276	T	0.48	.	20.2453	0.98397	0.0:0.0:1.0:0.0	.	1531;1531	O75445-2;O75445	.;USH2A_HUMAN	L	1531	ENSP00000305941:P1531L;ENSP00000355910:P1531L;ENSP00000355909:P1531L	ENSP00000305941:P1531L	P	-	2	0	USH2A	214415252	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.359000	0.90093	2.777000	0.95525	0.637000	0.83480	CCC		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
KDM1A	23028	hgsc.bcm.edu	37	1	23382469	23382469	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:23382469G>T	ENST00000356634.3	+	6	1017	c.868G>T	c.(868-870)Ggc>Tgc	p.G290C	RP1-184J9.2_ENST00000427154.1_RNA|KDM1A_ENST00000400181.4_Missense_Mutation_p.G310C|KDM1A_ENST00000542151.1_Missense_Mutation_p.G310C|MIR4419A_ENST00000583845.1_RNA	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	290					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.G310C(1)		breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						TGGGGTCTCAGGCTTGGCAGC	0.353																																					p.G310C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G928T	1						.						110.0	117.0	115.0					1																	23382469		2203	4300	6503	23255056	SO:0001583	missense	23028	exon7			AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.868G>T	1.37:g.23382469G>T	ENSP00000349049:p.Gly290Cys	Somatic		Capture	SOLID	Phase_I	23255056	NM_001009999	A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Missense_Mutation	SNP	ENST00000356634.3	37	CCDS30627.1	.	.	.	.	.	.	.	.	.	.	G	32	5.134809	0.94517	.	.	ENSG00000004487	ENST00000356634;ENST00000400181;ENST00000542151	D;D;D	0.99981	-10.35;-10.35;-10.35	6.02	6.02	0.97574	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.99984	0.9995	H	0.96430	3.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98609	1.0662	10	0.87932	D	0	-18.7744	19.5289	0.95219	0.0:0.0:1.0:0.0	.	310;290	O60341-2;O60341	.;KDM1A_HUMAN	C	290;310;310	ENSP00000349049:G290C;ENSP00000383042:G310C;ENSP00000439072:G310C	ENSP00000349049:G290C	G	+	1	0	KDM1A	23255056	1.000000	0.71417	0.993000	0.49108	0.999000	0.98932	9.617000	0.98361	2.865000	0.98341	0.655000	0.94253	GGC		0.353	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008880.3	NM_015013	
CNIH3	149111	hgsc.bcm.edu	37	1	224804931	224804931	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:224804931G>A	ENST00000272133.3	+	1	937	c.55G>A	c.(55-57)Gcg>Acg	p.A19T	RP11-100E13.1_ENST00000437416.1_RNA	NM_152495.1	NP_689708.1	Q8TBE1	CNIH3_HUMAN	cornichon family AMPA receptor auxiliary protein 3	19					intracellular signal transduction (GO:0035556)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|postsynaptic membrane (GO:0045211)	channel regulator activity (GO:0016247)	p.A19T(1)		large_intestine(5)|lung(4)	9	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		GCTGTGCGCTGCGCTCATCTT	0.557																																					p.A19T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G55A	1						.						318.0	303.0	308.0					1																	224804931		2203	4300	6503	222871554	SO:0001583	missense	149111	exon1			AF070524	CCDS1544.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143786	ENSG00000143786			26802	protein-coding gene	gene with protein product			"""cornichon homolog 3 (Drosophila)"""			8619474, 9110174	Standard	NM_152495		Approved	FLJ38993, CNIH-3	uc001hos.1	Q8TBE1	OTTHUMG00000037634	ENST00000272133.3:c.55G>A	1.37:g.224804931G>A	ENSP00000272133:p.Ala19Thr	Somatic		Capture	SOLID	Phase_I	222871554	NM_152495		Missense_Mutation	SNP	ENST00000272133.3	37	CCDS1544.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.829362	0.50845	.	.	ENSG00000143786	ENST00000272133	T	0.46819	0.86	4.85	2.95	0.34219	.	0.054356	0.64402	D	0.000001	T	0.39118	0.1066	L	0.49126	1.545	0.44214	D	0.997048	B	0.18461	0.028	B	0.17722	0.019	T	0.16600	-1.0397	10	0.41790	T	0.15	-23.147	8.568	0.33552	0.0819:0.0:0.7657:0.1524	.	19	Q8TBE1	CNIH3_HUMAN	T	19	ENSP00000272133:A19T	ENSP00000272133:A19T	A	+	1	0	CNIH3	222871554	1.000000	0.71417	0.880000	0.34516	0.793000	0.44817	5.805000	0.69143	0.454000	0.26884	-0.136000	0.14681	GCG		0.557	CNIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091752.2	NM_152495	
ARID1A	8289	hgsc.bcm.edu	37	1	27106719	27106719	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:27106719C>T	ENST00000324856.7	+	20	6701	c.6330C>T	c.(6328-6330)gcC>gcT	p.A2110A	ARID1A_ENST00000540690.1_Silent_p.A438A|ARID1A_ENST00000457599.2_Silent_p.A1893A|ARID1A_ENST00000374152.2_Silent_p.A1727A	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2110					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.A2110A(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCCCAATGCCGTCCTTTCCC	0.602			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.A2110A			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6330T	1						.						95.0	92.0	93.0					1																	27106719		2203	4300	6503	26979306	SO:0001819	synonymous_variant	8289	exon20			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6330C>T	1.37:g.27106719C>T		Somatic		Capture	SOLID	Phase_I	26979306	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Silent	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	1.453	-0.564440	0.03939	.	.	ENSG00000117713	ENST00000430799	.	.	.	4.97	3.09	0.35607	.	.	.	.	.	T	0.47764	0.1463	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35425	-0.9789	4	.	.	.	-7.8703	4.5561	0.12136	0.0:0.4216:0.2857:0.2927	.	.	.	.	C	1007	.	.	R	+	1	0	ARID1A	26979306	0.985000	0.35326	1.000000	0.80357	0.991000	0.79684	0.118000	0.15605	0.815000	0.34398	0.585000	0.79938	CGT		0.602	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
CSMD2	114784	hgsc.bcm.edu	37	1	34070949	34070949	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:34070949G>A	ENST00000373380.1	-	21	3304	c.3084C>T	c.(3082-3084)ggC>ggT	p.G1028G	CSMD2_ENST00000373381.4_Silent_p.G2155G|CSMD2_ENST00000489419.1_5'Flank|CSMD2_ENST00000373377.1_Silent_p.G254G|CSMD2_ENST00000373388.2_Silent_p.G254G			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2157	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G2157G(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGACAGGGTGGCCAGTCAATT	0.587																																					p.G2157G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6471T	1						.						110.0	96.0	101.0					1																	34070949		2203	4300	6503	33843536	SO:0001819	synonymous_variant	114784	exon43			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.3084C>T	1.37:g.34070949G>A		Somatic		Capture	SOLID	Phase_I	33843536	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373380.1	37																																																																																					0.587	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
CSMD2	114784	hgsc.bcm.edu	37	1	34080170	34080170	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:34080170C>T	ENST00000373380.1	-	19	2906	c.2686G>A	c.(2686-2688)Ggc>Agc	p.G896S	CSMD2_ENST00000373381.4_Missense_Mutation_p.G2023S|CSMD2_ENST00000373377.1_Missense_Mutation_p.G122S|CSMD2_ENST00000373388.2_Missense_Mutation_p.G122S			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1983	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G1983S(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCTGGGAAGCCGGGGCTCAGG	0.572																																					p.G1983S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5947A	1						.						90.0	83.0	85.0					1																	34080170		2203	4300	6503	33852757	SO:0001583	missense	114784	exon40			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2686G>A	1.37:g.34080170C>T	ENSP00000362478:p.Gly896Ser	Somatic		Capture	SOLID	Phase_I	33852757	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37		.	.	.	.	.	.	.	.	.	.	C	36	5.648271	0.96714	.	.	ENSG00000121904	ENST00000373381;ENST00000373380;ENST00000373377;ENST00000373388	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.47	5.47	0.80525	CUB (5);	0.000000	0.85682	D	0.000000	T	0.58308	0.2113	M	0.76727	2.345	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.61242	-0.7102	10	0.72032	D	0.01	.	18.323	0.90244	0.0:1.0:0.0:0.0	.	896;1983;2023	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	S	2023;896;122;122	ENSP00000362479:G2023S;ENSP00000362478:G896S;ENSP00000362475:G122S;ENSP00000362486:G122S	ENSP00000241312:G1983S	G	-	1	0	CSMD2	33852757	1.000000	0.71417	0.930000	0.37139	0.992000	0.81027	7.818000	0.86416	2.570000	0.86706	0.655000	0.94253	GGC		0.572	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
SH3D21	79729	hgsc.bcm.edu	37	1	36786276	36786276	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:36786276C>T	ENST00000426732.2	+	13	1949	c.1664C>T	c.(1663-1665)gCg>gTg	p.A555V	SH3D21_ENST00000453908.2_Missense_Mutation_p.A671V|SH3D21_ENST00000474766.1_3'UTR|SH3D21_ENST00000312808.4_Missense_Mutation_p.A317V|EVA1B_ENST00000490466.1_5'Flank|SH3D21_ENST00000505871.1_Missense_Mutation_p.A560V			A4FU49	SH321_HUMAN	SH3 domain containing 21	555						extracellular vesicular exosome (GO:0070062)		p.A671V(1)|p.A317V(1)		endometrium(1)|large_intestine(6)|lung(4)|pancreas(1)	12						GAGACGCTCGCGCTCCCCTCG	0.567																																					p.A560V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1679T	1						.						47.0	51.0	50.0					1																	36786276		2201	4296	6497	36558863	SO:0001583	missense	79729	exon11			AK056459	CCDS30674.1, CCDS30674.2	1p34.3	2011-02-21	2011-02-21	2011-02-21	ENSG00000214193	ENSG00000214193			26236	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 113"""	C1orf113		12477932	Standard	NM_024676		Approved	FLJ22938	uc010oia.1	A4FU49	OTTHUMG00000007868	ENST00000426732.2:c.1664C>T	1.37:g.36786276C>T	ENSP00000408613:p.Ala555Val	Somatic		Capture	SOLID	Phase_I	36558863	NM_024676	B4DLI6|D3DPS6|J3KQM5|Q5VTK7|Q86XZ6|Q8N445|Q96DN4|Q9H5W5	Missense_Mutation	SNP	ENST00000426732.2	37		.	.	.	.	.	.	.	.	.	.	C	15.53	2.860590	0.51482	.	.	ENSG00000214193	ENST00000453908;ENST00000426732;ENST00000312808;ENST00000505871	T;T;T;T	0.47869	1.31;1.72;0.83;1.74	3.6	2.67	0.31697	.	.	.	.	.	T	0.29620	0.0739	N	0.14661	0.345	0.09310	N	1	B;B	0.26400	0.148;0.091	B;B	0.22386	0.039;0.017	T	0.20974	-1.0259	9	0.56958	D	0.05	.	9.0843	0.36572	0.0:0.7751:0.2249:0.0	.	560;555	A4FU49-3;A4FU49	.;SH321_HUMAN	V	671;555;317;560	ENSP00000403476:A671V;ENSP00000408613:A555V;ENSP00000321936:A317V;ENSP00000421294:A560V	ENSP00000321936:A317V	A	+	2	0	SH3D21	36558863	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.018000	0.13422	1.074000	0.40909	0.462000	0.41574	GCG		0.567	SH3D21-202	KNOWN	basic	protein_coding	protein_coding		NM_024676	
MACF1	23499	hgsc.bcm.edu	37	1	39801259	39801259	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:39801259A>G	ENST00000372915.3	+	36	9101	c.9014A>G	c.(9013-9015)tAt>tGt	p.Y3005C	MACF1_ENST00000476350.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000289893.4_Missense_Mutation_p.Y1440C|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000564288.1_Missense_Mutation_p.Y3000C|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.Y3037C			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3005					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.Y1440C(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAAAAGTTGTATCAGGAAACT	0.403																																					p.Y1440C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4319G	1						.						69.0	72.0	71.0					1																	39801259		2203	4300	6503	39573846	SO:0001583	missense	23499	exon1			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.9014A>G	1.37:g.39801259A>G	ENSP00000362006:p.Tyr3005Cys	Somatic		Capture	SOLID	Phase_I	39573846	NM_033044	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	A	8.444	0.851525	0.17034	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.61040	0.14;1.23	5.0	2.57	0.30868	.	1.266200	0.05367	N	0.534720	T	0.43809	0.1264	N	0.14661	0.345	0.50039	D	0.999841	B	0.32396	0.369	B	0.34038	0.174	T	0.20538	-1.0272	10	0.62326	D	0.03	.	8.7521	0.34622	0.5871:0.4129:0.0:0.0	.	3005	Q9UPN3	MACF1_HUMAN	C	3005;1440	ENSP00000362006:Y3005C;ENSP00000289893:Y1440C	ENSP00000289893:Y1440C	Y	+	2	0	MACF1	39573846	0.016000	0.18221	0.933000	0.37362	0.938000	0.57974	1.542000	0.36137	0.894000	0.36317	0.383000	0.25322	TAT		0.403	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
TRIT1	54802	hgsc.bcm.edu	37	1	40313724	40313724	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:40313724G>A	ENST00000316891.5	-	6	763	c.749C>T	c.(748-750)gCt>gTt	p.A250V	TRIT1_ENST00000537440.1_5'UTR|TRIT1_ENST00000537223.1_5'UTR|TRIT1_ENST00000441669.2_Missense_Mutation_p.A168V|TRIT1_ENST00000491865.1_Intron|TRIT1_ENST00000372818.1_Missense_Mutation_p.A250V|TRIT1_ENST00000541099.1_Intron|TRIT1_ENST00000545233.1_Missense_Mutation_p.A4V	NM_017646.4	NP_060116.2	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1	250	Interaction with isopentenylpyrophosphate transferase. {ECO:0000250}.				tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|tRNA dimethylallyltransferase activity (GO:0052381)	p.A250V(1)		breast(1)|large_intestine(5)|liver(1)|lung(3)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(1)	15	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CAAGAGCCCAGCAGCAAGCAT	0.428																																					p.A250V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C749T	1						.						146.0	138.0	141.0					1																	40313724		2203	4300	6503	40086311	SO:0001583	missense	54802	exon6			AF074918	CCDS30681.1	1p34.2	2012-10-05			ENSG00000043514	ENSG00000043514	2.5.1.8		20286	protein-coding gene	gene with protein product						11111046, 15870694	Standard	NM_017646		Approved	FLJ20061, IPT	uc021olz.1	Q9H3H1	OTTHUMG00000009245	ENST00000316891.5:c.749C>T	1.37:g.40313724G>A	ENSP00000321810:p.Ala250Val	Somatic		Capture	SOLID	Phase_I	40086311	NM_017646	A1A4X7|Q3T7B5|Q5QPK5|Q5QPK6|Q6IAC9|Q96FJ3|Q96L45|Q9NXT7	Missense_Mutation	SNP	ENST00000316891.5	37	CCDS30681.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.594396	0.66219	.	.	ENSG00000043514	ENST00000046894;ENST00000372825;ENST00000441669;ENST00000316891;ENST00000372818;ENST00000534869;ENST00000545233	T;T;T	0.45276	0.9;0.9;0.9	5.97	5.01	0.66863	.	0.310486	0.40222	N	0.001151	T	0.41627	0.1167	L	0.59967	1.855	0.80722	D	1	P;P;P	0.46457	0.831;0.534;0.878	P;B;B	0.45610	0.487;0.283;0.441	T	0.11817	-1.0572	10	0.30078	T	0.28	-9.628	9.4295	0.38601	0.0707:0.0:0.785:0.1443	.	250;250;168	Q9H3H1;Q9H3H1-4;Q9H3H1-5	MOD5_HUMAN;.;.	V	250;168;162;250;250;143;4	ENSP00000321810:A250V;ENSP00000361905:A250V;ENSP00000439596:A4V	ENSP00000046894:A250V	A	-	2	0	TRIT1	40086311	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.588000	0.60999	2.836000	0.97738	0.655000	0.94253	GCT		0.428	TRIT1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025627.2	NM_017646	
HIVEP3	59269	hgsc.bcm.edu	37	1	42048335	42048335	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:42048335G>A	ENST00000372583.1	-	4	3019	c.2134C>T	c.(2134-2136)Ctg>Ttg	p.L712L	HIVEP3_ENST00000429157.2_Silent_p.L712L|HIVEP3_ENST00000372584.1_Silent_p.L712L|HIVEP3_ENST00000247584.5_Silent_p.L712L|HIVEP3_ENST00000460604.1_5'Flank	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	712	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L712L(1)		NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CTCTTCCTCAGTGGAGTGAGT	0.532																																					p.L712L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2134T	1						.						113.0	98.0	103.0					1																	42048335		2203	4300	6503	41820922	SO:0001819	synonymous_variant	59269	exon4			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.2134C>T	1.37:g.42048335G>A		Somatic		Capture	SOLID	Phase_I	41820922	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	CCDS463.1																																																																																				0.532	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
CDC20	991	hgsc.bcm.edu	37	1	43825929	43825929	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:43825929C>A	ENST00000372462.1	+	5	825	c.622C>A	c.(622-624)Ctg>Atg	p.L208M	CDC20_ENST00000310955.6_Missense_Mutation_p.L208M|CDC20_ENST00000478882.1_3'UTR|RP1-92O14.3_ENST00000424948.1_RNA			Q12834	CDC20_HUMAN	cell division cycle 20	208					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)	p.L208M(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CAGTGTGTACCTGTGGAGTGC	0.512																																					p.L208M	Esophageal Squamous(137;1154 1759 10362 10401 46925)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C622A	1						.						149.0	141.0	144.0					1																	43825929		2203	4300	6503	43598516	SO:0001583	missense	991	exon6			U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.622C>A	1.37:g.43825929C>A	ENSP00000361540:p.Leu208Met	Somatic		Capture	SOLID	Phase_I	43598516	NM_001255	B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Missense_Mutation	SNP	ENST00000372462.1	37	CCDS484.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.293394	0.60086	.	.	ENSG00000117399	ENST00000437896;ENST00000310955;ENST00000372462	T;T	0.35789	1.29;1.29	5.85	-0.684	0.11331	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.57975	0.2090	M	0.84948	2.725	0.54753	D	0.999987	D	0.89917	1.0	D	0.80764	0.994	T	0.62291	-0.6885	10	0.66056	D	0.02	-13.0355	10.8764	0.46913	0.0:0.6233:0.0:0.3767	.	208	Q12834	CDC20_HUMAN	M	184;208;208	ENSP00000308450:L208M;ENSP00000361540:L208M	ENSP00000308450:L208M	L	+	1	2	CDC20	43598516	0.998000	0.40836	0.998000	0.56505	0.987000	0.75469	0.911000	0.28584	0.073000	0.16731	-0.345000	0.07892	CTG		0.512	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019488.1	NM_001255	
STIL	6491	hgsc.bcm.edu	37	1	47717356	47717356	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:47717356C>A	ENST00000360380.3	-	18	3679	c.3316G>T	c.(3316-3318)Ggg>Tgg	p.G1106W	STIL_ENST00000396221.2_Missense_Mutation_p.G1089W|STIL_ENST00000337817.5_Missense_Mutation_p.G1106W|STIL_ENST00000371877.3_Missense_Mutation_p.G1107W|STIL_ENST00000243182.6_Missense_Mutation_p.G1106W	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	1106					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.G1106W(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				AAACTAAGCCCCACTGTGCTT	0.373																																					p.G1107W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3319T	1						.						161.0	165.0	164.0					1																	47717356		2203	4300	6503	47489943	SO:0001583	missense	6491	exon17			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.3316G>T	1.37:g.47717356C>A	ENSP00000353544:p.Gly1106Trp	Somatic		Capture	SOLID	Phase_I	47489943	NM_001048166	Q5T0C5|Q68CN9	Missense_Mutation	SNP	ENST00000360380.3	37	CCDS548.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.147172	0.77888	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182	T;T;T;T;T	0.28454	1.62;1.62;1.61;1.83;1.62	5.48	5.48	0.80851	.	0.210092	0.44285	D	0.000469	T	0.54967	0.1891	L	0.60455	1.87	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.56007	-0.8050	10	0.87932	D	0	-9.4573	19.3553	0.94410	0.0:1.0:0.0:0.0	.	1089;1107;1106	E9PSF2;Q15468-2;Q15468	.;.;STIL_HUMAN	W	1106;1106;1107;1089;1106	ENSP00000353544:G1106W;ENSP00000337367:G1106W;ENSP00000360944:G1107W;ENSP00000379523:G1089W;ENSP00000243182:G1106W	ENSP00000243182:G1106W	G	-	1	0	STIL	47489943	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.453000	0.60061	2.575000	0.86900	0.460000	0.39030	GGG		0.373	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035	
LRP8	7804	hgsc.bcm.edu	37	1	53729868	53729868	+	Missense_Mutation	SNP	C	C	T	rs202186923		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:53729868C>T	ENST00000306052.6	-	10	1729	c.1628G>A	c.(1627-1629)cGg>cAg	p.R543Q	LRP8_ENST00000347547.2_Missense_Mutation_p.R373Q|LRP8_ENST00000465675.1_Missense_Mutation_p.R96Q|LRP8_ENST00000354412.3_Missense_Mutation_p.R414Q|LRP8_ENST00000460214.1_5'Flank|LRP8_ENST00000371454.2_Missense_Mutation_p.R543Q	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	543					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.R543Q(1)|p.R543P(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						AGCGATGGCCCGGGGTTCACT	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		19457	0.0		0.001	False		,,,				2504	0.0				p.R414Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1241A	1						.						65.0	64.0	64.0					1																	53729868		2203	4300	6503	53502456	SO:0001583	missense	7804	exon9			D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.1628G>A	1.37:g.53729868C>T	ENSP00000303634:p.Arg543Gln	Somatic		Capture	SOLID	Phase_I	53502456	NM_017522	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	CCDS578.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	C|C	36|36	5.969237|5.969237	0.97156|0.97156	.|.	.|.	ENSG00000157193|ENSG00000157193	ENST00000475501|ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	.|D;D;D;D;D	.|0.96491	.|-4.03;-4.03;-4.03;-4.03;-4.03	5.02|5.02	5.02|5.02	0.67125|0.67125	.|Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	.|.	.|.	.|.	.|.	D|D	0.98403|0.98403	0.9469|0.9469	M|M	0.88704|0.88704	2.975|2.975	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|1.0;0.995;0.999;0.952;0.991;1.0	D|D	0.99399|0.99399	1.0927|1.0927	5|9	.|0.87932	.|D	.|0	.|.	18.5321|18.5321	0.90996|0.90996	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|96;414;373;543;543;96	.|B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.|.;.;.;.;LRP8_HUMAN;.	R|Q	232|543;543;96;414;373	.|ENSP00000303634:R543Q;ENSP00000360509:R543Q;ENSP00000437009:R96Q;ENSP00000346391:R414Q;ENSP00000334522:R373Q	.|ENSP00000303634:R543Q	G|R	-|-	1|2	0|0	LRP8|LRP8	53502456|53502456	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	5.925000|5.925000	0.70062|0.70062	2.597000|2.597000	0.87782|0.87782	0.655000|0.655000	0.94253|0.94253	GGG|CGG		0.572	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
C1orf177	163747	hgsc.bcm.edu	37	1	55272739	55272739	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:55272739C>T	ENST00000371273.3	+	2	190	c.175C>T	c.(175-177)Cgt>Tgt	p.R59C	C1orf177_ENST00000358193.3_Missense_Mutation_p.R59C	NM_001110533.1	NP_001104003	Q3ZCV2	CA177_HUMAN	chromosome 1 open reading frame 177	59								p.R59C(1)		breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(6)|prostate(2)	17						ATACTCCACGCGTTATTCTAC	0.572																																					p.R59C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C175T	1						.						213.0	194.0	200.0					1																	55272739		2203	4300	6503	55045327	SO:0001583	missense	163747	exon2			AK097520	CCDS599.1, CCDS44153.1	1p32.3	2012-07-25			ENSG00000162398	ENSG00000162398			26854	protein-coding gene	gene with protein product							Standard	NM_152607		Approved	FLJ40201	uc001cyb.4	Q3ZCV2	OTTHUMG00000009986	ENST00000371273.3:c.175C>T	1.37:g.55272739C>T	ENSP00000360320:p.Arg59Cys	Somatic		Capture	SOLID	Phase_I	55045327	NM_001110533	B7WPL2|Q8N7Y9	Missense_Mutation	SNP	ENST00000371273.3	37	CCDS44153.1	.	.	.	.	.	.	.	.	.	.	C	10.60	1.396851	0.25205	.	.	ENSG00000162398	ENST00000358193;ENST00000371273	T;T	0.25414	1.8;1.8	3.72	0.579	0.17397	.	1.922710	0.02825	N	0.126025	T	0.18425	0.0442	N	0.14661	0.345	0.09310	N	1	D;D	0.56521	0.976;0.976	P;P	0.44696	0.458;0.458	T	0.17137	-1.0379	10	0.39692	T	0.17	.	6.4121	0.21696	0.4918:0.3224:0.1858:0.0	.	59;59	Q3ZCV2;Q3ZCV2-2	CA177_HUMAN;.	C	59	ENSP00000350924:R59C;ENSP00000360320:R59C	ENSP00000350924:R59C	R	+	1	0	C1orf177	55045327	0.004000	0.15560	0.000000	0.03702	0.010000	0.07245	0.242000	0.18087	0.137000	0.18759	0.462000	0.41574	CGT		0.572	C1orf177-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027674.1	NM_152607	
LEPR	3953	hgsc.bcm.edu	37	1	66101977	66101977	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:66101977C>T	ENST00000349533.6	+	20	2962	c.2777C>T	c.(2776-2778)aCa>aTa	p.T926I	LEPR_ENST00000406510.3_5'UTR	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)	p.T926I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AGTGTTGATACATCATGGAAA	0.378																																					p.T926I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2777T	1						.						153.0	155.0	154.0					1																	66101977		2203	4300	6503	65874565	SO:0001583	missense	3953	exon20			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2777C>T	1.37:g.66101977C>T	ENSP00000330393:p.Thr926Ile	Somatic		Capture	SOLID	Phase_I	65874565	NM_002303	Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	C	9.336	1.061780	0.19987	.	.	ENSG00000116678	ENST00000349533	T	0.55760	0.5	5.78	2.83	0.33086	.	0.424874	0.28940	N	0.013651	T	0.18257	0.0438	L	0.44542	1.39	0.23120	N	0.998264	B	0.06786	0.001	B	0.06405	0.002	T	0.17623	-1.0363	10	0.56958	D	0.05	-1.7564	0.9198	0.01312	0.1727:0.4094:0.1621:0.2558	.	926	P48357	LEPR_HUMAN	I	926	ENSP00000330393:T926I	ENSP00000330393:T926I	T	+	2	0	LEPR	65874565	0.023000	0.18921	0.232000	0.24009	0.567000	0.35839	0.716000	0.25836	0.794000	0.33899	0.650000	0.86243	ACA		0.378	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
PDE4B	5142	hgsc.bcm.edu	37	1	66833736	66833736	+	Silent	SNP	C	C	T	rs373028719		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:66833736C>T	ENST00000329654.4	+	15	1837	c.1650C>T	c.(1648-1650)acC>acT	p.T550T	PDE4B_ENST00000423207.2_Silent_p.T535T|PDE4B_ENST00000371049.3_Silent_p.T550T|PDE4B_ENST00000480109.2_Silent_p.T317T|PDE4B_ENST00000371045.5_Silent_p.T378T	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	550					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.T550T(1)|p.T535T(1)|p.T378T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	ACAACTATACCGATCGCATTC	0.368																																					p.T550T												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C1650T	1						.						81.0	80.0	80.0					1																	66833736		2203	4300	6503	66606324	SO:0001819	synonymous_variant	5142	exon15			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.1650C>T	1.37:g.66833736C>T		Somatic		Capture	SOLID	Phase_I	66606324	NM_002600	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Silent	SNP	ENST00000329654.4	37	CCDS632.1																																																																																				0.368	PDE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025188.3	NM_002600	
FPGT	8790	hgsc.bcm.edu	37	1	74670892	74670892	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:74670892T>C	ENST00000609362.1	+	4	1198	c.1161T>C	c.(1159-1161)agT>agC	p.S387S	FPGT_ENST00000524915.1_Intron|TNNI3K_ENST00000370891.2_Intron|FPGT-TNNI3K_ENST00000533006.1_Intron|FPGT-TNNI3K_ENST00000370895.1_Intron|FPGT_ENST00000370894.5_Splice_Site_p.V115A|FPGT-TNNI3K_ENST00000557284.2_Intron|FPGT-TNNI3K_ENST00000370899.3_Intron|FPGT_ENST00000534056.1_Intron|FPGT_ENST00000370898.3_Silent_p.S400S|FPGT-TNNI3K_ENST00000370893.1_Intron	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	387					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)	p.S387S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						TAACTTTTAGTATCTTTCCAG	0.383																																					p.V115A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T344C	1						.						60.0	62.0	61.0					1																	74670892		2203	4299	6502	74443480	SO:0001819	synonymous_variant	8790	exon4			AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.1161T>C	1.37:g.74670892T>C		Somatic		Capture	SOLID	Phase_I	74443480	NM_001199329	A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Silent	SNP	ENST00000609362.1	37	CCDS663.1	.	.	.	.	.	.	.	.	.	.	T	0.046	-1.265360	0.01433	.	.	ENSG00000254685	ENST00000370894	.	.	.	5.91	4.02	0.46733	.	.	.	.	.	T	0.63838	0.2545	M	0.83603	2.65	0.80722	D	1	.	.	.	.	.	.	T	0.66432	-0.5925	5	.	.	.	.	8.7363	0.34530	0.0:0.7659:0.0:0.2341	.	.	.	.	A	115	.	.	V	+	2	0	TNNI3K	74443480	1.000000	0.71417	0.984000	0.44739	0.454000	0.32378	0.896000	0.28377	0.794000	0.33899	-0.242000	0.12053	GTA		0.383	FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
FPGT-TNNI3K	100526835	hgsc.bcm.edu	37	1	74832996	74832996	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:74832996C>T	ENST00000370899.3	+	14	1574	c.1537C>T	c.(1537-1539)Ccc>Tcc	p.P513S	TNNI3K_ENST00000370891.2_Missense_Mutation_p.P513S|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.P513S|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.P526S|TNNI3K_ENST00000326637.3_Missense_Mutation_p.P412S|RP11-439H8.4_ENST00000415549.2_RNA	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough									p.P412S(1)									AGATGAATTGCCCTGTAATGA	0.358																																					p.P513S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1537T	1						.						144.0	154.0	150.0					1																	74832996		2203	4299	6502	74605584	SO:0001583	missense	51086	exon14					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1537C>T	1.37:g.74832996C>T	ENSP00000359936:p.Pro513Ser	Somatic		Capture	SOLID	Phase_I	74605584	NM_001199327		Missense_Mutation	SNP	ENST00000370899.3	37		.	.	.	.	.	.	.	.	.	.	C	13.33	2.205059	0.39003	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000534632;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.74209	-0.82;-0.53;-0.82;-0.82;-0.82	5.62	5.62	0.85841	Ankyrin repeat-containing domain (1);	0.112005	0.64402	D	0.000007	T	0.43055	0.1230	N	0.14661	0.345	0.51482	D	0.999923	B;B;B;B	0.16396	0.0;0.004;0.008;0.017	B;B;B;B	0.14578	0.0;0.002;0.007;0.011	T	0.50381	-0.8835	10	0.07990	T	0.79	.	19.6717	0.95914	0.0:1.0:0.0:0.0	.	412;513;513;513	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	S	513;513;134;513;513;412	ENSP00000359936:P513S;ENSP00000359932:P513S;ENSP00000450895:P513S;ENSP00000359928:P513S;ENSP00000322251:P412S	ENSP00000322251:P412S	P	+	1	0	RP11-653A5.2;AC093158.1	74605584	1.000000	0.71417	0.989000	0.46669	0.216000	0.24613	3.657000	0.54474	2.649000	0.89929	0.555000	0.69702	CCC		0.358	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
WDR63	126820	hgsc.bcm.edu	37	1	85560133	85560133	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:85560133A>G	ENST00000294664.6	+	10	1248	c.1068A>G	c.(1066-1068)gtA>gtG	p.V356V	WDR63_ENST00000326813.8_Silent_p.V317V|WDR63_ENST00000370596.1_Silent_p.V317V	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	356								p.V356V(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		CTGTGTCGGTAGCCGTGCGAC	0.413																																					p.V356V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1068G	1						.						238.0	238.0	238.0					1																	85560133		2203	4300	6503	85332721	SO:0001819	synonymous_variant	126820	exon10				CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.1068A>G	1.37:g.85560133A>G		Somatic		Capture	SOLID	Phase_I	85332721	NM_145172	A8K988|Q96L72|Q96NU4	Silent	SNP	ENST00000294664.6	37	CCDS702.1																																																																																				0.413	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027565.2	NM_145172	
SH3GLB1	51100	hgsc.bcm.edu	37	1	87185236	87185236	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:87185236T>C	ENST00000370558.4	+	3	585	c.261T>C	c.(259-261)gcT>gcC	p.A87A	SH3GLB1_ENST00000535010.1_5'UTR|SH3GLB1_ENST00000482504.1_Silent_p.A87A	NM_001206651.1|NM_001206653.1|NM_016009.4	NP_001193580.1|NP_001193582.1|NP_057093.1	Q9Y371	SHLB1_HUMAN	SH3-domain GRB2-like endophilin B1	87	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				'de novo' posttranslational protein folding (GO:0051084)|apoptotic process (GO:0006915)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	fatty acid binding (GO:0005504)|identical protein binding (GO:0042802)|lysophosphatidic acid acyltransferase activity (GO:0042171)|protein homodimerization activity (GO:0042803)	p.A87A(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|stomach(1)	11		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		ATAGAAAAGCTCCAAGTCGTA	0.353																																					p.A87A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T261C	1						.						70.0	74.0	72.0					1																	87185236		2203	4300	6503	86957824	SO:0001819	synonymous_variant	51100	exon3			AF263293	CCDS710.1, CCDS55612.1, CCDS55613.1, CCDS72819.1	1p22.3	2012-04-17	2001-12-04		ENSG00000097033	ENSG00000097033		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	10833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 70"""	609287	"""SH3-domain, GRB2-like, endophilin B1"""			11161816, 11259440	Standard	NM_016009		Approved	CGI-61, KIAA0491, Bif-1, PPP1R70	uc001dly.3	Q9Y371	OTTHUMG00000010257	ENST00000370558.4:c.261T>C	1.37:g.87185236T>C		Somatic		Capture	SOLID	Phase_I	86957824	NM_016009	B4E182|Q5H8U5|Q9H3Z0|Q9NR47|Q9NYA9	Silent	SNP	ENST00000370558.4	37	CCDS710.1																																																																																				0.353	SH3GLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028287.2	NM_016009	
OR6F1	343169	hgsc.bcm.edu	37	1	247875329	247875329	+	Silent	SNP	C	C	T	rs150409826		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr1:247875329C>T	ENST00000302084.2	-	1	776	c.729G>A	c.(727-729)tcG>tcA	p.S243S	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S243S(1)		breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CGGTGAGATGCGAGGAGCACG	0.537																																					p.S243S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G729A	1						.	C		1,4405	2.1+/-5.4	0,1,2202	114.0	104.0	107.0		729	-7.4	0.0	1	dbSNP_134	107	0,8600		0,0,4300	no	coding-synonymous	OR6F1	NM_001005286.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		243/309	247875329	1,13005	2203	4300	6503	245941952	SO:0001819	synonymous_variant	343169	exon1			BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.729G>A	1.37:g.247875329C>T		Somatic		Capture	SOLID	Phase_I	245941952	NM_001005286	B2RNV6|Q6IF02|Q96R39	Silent	SNP	ENST00000302084.2	37	CCDS31095.1																																																																																				0.537	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286	
NNMT	4837	hgsc.bcm.edu	37	11	114183143	114183143	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:114183143G>A	ENST00000535401.1	+	5	1003	c.739G>A	c.(739-741)Gcc>Acc	p.A247T	NNMT_ENST00000542647.1_Missense_Mutation_p.A52T|NNMT_ENST00000545255.1_Missense_Mutation_p.A52T|NNMT_ENST00000299964.3_Missense_Mutation_p.A247T|NNMT_ENST00000541754.1_Missense_Mutation_p.A52T|RP11-64D24.2_ENST00000544925.1_RNA			P40261	NNMT_HUMAN	nicotinamide N-methyltransferase	247					methylation (GO:0032259)|organ regeneration (GO:0031100)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	nicotinamide N-methyltransferase activity (GO:0008112)	p.A247T(1)		kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;4.83e-16)|all_epithelial(67;7.28e-09)|all_hematologic(158;0.000135)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.79e-06)|Epithelial(105;1.32e-05)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.128)	Niacin(DB00627)	TTCCACCATGGCCAACAACGA	0.532																																					p.A247T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G739A	11						.						112.0	106.0	108.0					11																	114183143		2201	4296	6497	113688353	SO:0001583	missense	4837	exon3			U08021	CCDS8368.1	11q23.1	2007-08-15					2.1.1.1		7861	protein-coding gene	gene with protein product		600008				8575745	Standard	NM_006169		Approved		uc001pos.1	P40261		ENST00000535401.1:c.739G>A	11.37:g.114183143G>A	ENSP00000441434:p.Ala247Thr	Somatic		Capture	SOLID	Phase_I	113688353	NM_006169		Missense_Mutation	SNP	ENST00000535401.1	37	CCDS8368.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.406767	0.42715	.	.	ENSG00000166741	ENST00000535401;ENST00000299964;ENST00000541754;ENST00000542647;ENST00000545255	T;T;T;T;T	0.09911	2.93;2.93;2.93;2.93;2.93	4.93	-1.12	0.09808	.	0.872729	0.09893	N	0.742071	T	0.06826	0.0174	N	0.20530	0.585	0.09310	N	1	B	0.27625	0.183	B	0.31101	0.124	T	0.47005	-0.9150	10	0.16896	T	0.51	-5.5205	8.9637	0.35863	0.0796:0.0:0.2374:0.683	.	247	P40261	NNMT_HUMAN	T	247;247;52;52;52	ENSP00000441434:A247T;ENSP00000299964:A247T;ENSP00000445680:A52T;ENSP00000445994:A52T;ENSP00000445248:A52T	ENSP00000299964:A247T	A	+	1	0	NNMT	113688353	0.000000	0.05858	0.000000	0.03702	0.954000	0.61252	0.203000	0.17315	-0.576000	0.05974	0.563000	0.77884	GCC		0.532	NNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398951.1	NM_006169	
SIDT2	51092	hgsc.bcm.edu	37	11	117060713	117060713	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:117060713C>A	ENST00000324225.4	+	16	1996	c.1465C>A	c.(1465-1467)Ctc>Atc	p.L489I	SIDT2_ENST00000431081.2_Missense_Mutation_p.L486I|SIDT2_ENST00000532062.1_5'Flank	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	489					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)	p.L489I(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		CTACAACTTCCTCTGCGCCCA	0.607																																					p.L489I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1465A	11						.						110.0	91.0	98.0					11																	117060713		2201	4296	6497	116565923	SO:0001583	missense	51092	exon16			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1465C>A	11.37:g.117060713C>A	ENSP00000314023:p.Leu489Ile	Somatic		Capture	SOLID	Phase_I	116565923	NM_001040455	Q8NBY7|Q9Y357	Missense_Mutation	SNP	ENST00000324225.4	37	CCDS31682.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.797908	0.90538	.	.	ENSG00000149577	ENST00000324225;ENST00000278951;ENST00000431081	T;T;T	0.25250	1.81;1.81;1.81	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.48259	0.1490	M	0.79475	2.455	0.58432	D	0.999996	D;P;P;D	0.55385	0.964;0.944;0.925;0.971	P;P;P;P	0.62435	0.841;0.572;0.85;0.902	T	0.47586	-0.9106	10	0.56958	D	0.05	-29.4352	12.9313	0.58288	0.0:0.9197:0.0:0.0803	.	510;486;489;510	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	I	489;510;486	ENSP00000314023:L489I;ENSP00000278951:L510I;ENSP00000399635:L486I	ENSP00000278951:L510I	L	+	1	0	SIDT2	116565923	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.897000	0.69831	2.639000	0.89480	0.491000	0.48974	CTC		0.607	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	NM_015996	
SIDT2	51092	hgsc.bcm.edu	37	11	117062651	117062651	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:117062651G>A	ENST00000324225.4	+	19	2324	c.1793G>A	c.(1792-1794)cGg>cAg	p.R598Q	SIDT2_ENST00000431081.2_Missense_Mutation_p.R595Q|SIDT2_ENST00000532062.1_5'Flank	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	598					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)	p.R598Q(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		TACCAGAAGCGGCACCCGGAC	0.587																																					p.R598Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1793A	11						.						203.0	180.0	188.0					11																	117062651		2201	4296	6497	116567861	SO:0001583	missense	51092	exon19			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1793G>A	11.37:g.117062651G>A	ENSP00000314023:p.Arg598Gln	Somatic		Capture	SOLID	Phase_I	116567861	NM_001040455	Q8NBY7|Q9Y357	Missense_Mutation	SNP	ENST00000324225.4	37	CCDS31682.1	.	.	.	.	.	.	.	.	.	.	G	36	5.817156	0.96982	.	.	ENSG00000149577	ENST00000324225;ENST00000278951;ENST00000431081	T;T;T	0.50548	0.74;0.74;0.74	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.74741	0.3756	M	0.90870	3.155	0.80722	D	1	D;D;D;D	0.69078	0.997;0.966;0.994;0.993	P;P;D;D	0.65443	0.891;0.542;0.934;0.935	T	0.81678	-0.0824	10	0.87932	D	0	-25.182	18.2914	0.90131	0.0:0.0:1.0:0.0	.	619;595;598;619	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	Q	598;619;595	ENSP00000314023:R598Q;ENSP00000278951:R619Q;ENSP00000399635:R595Q	ENSP00000278951:R619Q	R	+	2	0	SIDT2	116567861	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.546000	0.98097	2.573000	0.86826	0.655000	0.94253	CGG		0.587	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	NM_015996	
MPZL2	10205	hgsc.bcm.edu	37	11	118133281	118133281	+	Missense_Mutation	SNP	C	C	T	rs200854123		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:118133281C>T	ENST00000278937.2	-	3	436	c.308G>A	c.(307-309)cGg>cAg	p.R103Q	MPZL2_ENST00000438295.2_Missense_Mutation_p.R103Q|MPZL2_ENST00000525647.1_5'Flank	NM_005797.3	NP_005788.1	O60487	MPZL2_HUMAN	myelin protein zero-like 2	103	Ig-like V-type.				anatomical structure morphogenesis (GO:0009653)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)|T cell differentiation in thymus (GO:0033077)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R103Q(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|skin(1)	11	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		GGCATCGTACCGCTCAGGATT	0.532																																					p.R103Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G308A	11						.						132.0	101.0	111.0					11																	118133281		2200	4296	6496	117638491	SO:0001583	missense	10205	exon3			AF275945	CCDS8393.1	11q24	2013-01-11	2007-08-01	2007-08-01		ENSG00000149573		"""Immunoglobulin superfamily / V-set domain containing"""	3496	protein-coding gene	gene with protein product		604873	"""epithelial V-like antigen 1"""	EVA1		9585423	Standard	NM_005797		Approved	EVA	uc001psn.3	O60487		ENST00000278937.2:c.308G>A	11.37:g.118133281C>T	ENSP00000278937:p.Arg103Gln	Somatic		Capture	SOLID	Phase_I	117638491	NM_144765	A8K2R1	Missense_Mutation	SNP	ENST00000278937.2	37	CCDS8393.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.706221	0.68615	.	.	ENSG00000149573	ENST00000278937;ENST00000438295	T;T	0.65549	-0.16;-0.16	5.98	5.98	0.97165	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.222293	0.47852	D	0.000213	T	0.61615	0.2361	L	0.54323	1.7	0.52501	D	0.999956	D	0.56035	0.974	P	0.47299	0.543	T	0.56559	-0.7959	10	0.18710	T	0.47	.	14.5856	0.68322	0.0:0.9309:0.0:0.0691	.	103	O60487	MPZL2_HUMAN	Q	103	ENSP00000278937:R103Q;ENSP00000408362:R103Q	ENSP00000278937:R103Q	R	-	2	0	MPZL2	117638491	0.035000	0.19736	0.728000	0.30774	0.116000	0.19942	2.444000	0.44890	2.835000	0.97688	0.650000	0.86243	CGG		0.532	MPZL2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392113.1	NM_005797	
HINFP	25988	hgsc.bcm.edu	37	11	119003374	119003374	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:119003374A>G	ENST00000350777.2	+	7	821	c.758A>G	c.(757-759)aAt>aGt	p.N253S	HINFP_ENST00000527410.1_Missense_Mutation_p.N253S	NM_001243259.1|NM_015517.4|NM_198971.2	NP_001230188.1|NP_056332.2|NP_945322.1	Q9BQA5	HINFP_HUMAN	histone H4 transcription factor	253					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|establishment of protein localization (GO:0045184)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|myoblast differentiation (GO:0045445)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.N253S(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CTCTCAGTGAATCACTATAAG	0.577																																					p.N253S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A758G	11						.						163.0	150.0	154.0					11																	119003374		2200	4295	6495	118508584	SO:0001583	missense	25988	exon8			AL080201	CCDS8414.1, CCDS58188.1	11q23.3	2013-01-08	2009-01-22	2009-01-22	ENSG00000172273	ENSG00000172273		"""Zinc fingers, C2H2-type"""	17850	protein-coding gene	gene with protein product	"""histone nuclear factor P"""	607099	"""MBD2-interacting zinc finger 1"", ""MBD2-interacting zinc finger"""	MIZF		11553631	Standard	NM_015517		Approved	DKFZP434F162, HiNF-P, ZNF743	uc001pvq.3	Q9BQA5	OTTHUMG00000166168	ENST00000350777.2:c.758A>G	11.37:g.119003374A>G	ENSP00000318085:p.Asn253Ser	Somatic		Capture	SOLID	Phase_I	118508584	NM_015517	B3KPH6|B4DWB4|E9PQF4|Q96E65|Q9Y4M7	Missense_Mutation	SNP	ENST00000350777.2	37	CCDS8414.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506874	0.44558	.	.	ENSG00000172273	ENST00000350777;ENST00000527410	T;T	0.08807	3.05;3.06	5.53	5.53	0.82687	Zinc finger, C2H2 (1);	0.041889	0.85682	D	0.000000	T	0.09202	0.0227	L	0.48877	1.53	0.51767	D	0.999939	P	0.42296	0.775	B	0.39660	0.306	T	0.28839	-1.0031	10	0.11485	T	0.65	-18.1337	14.8412	0.70226	1.0:0.0:0.0:0.0	.	253	Q9BQA5	HINFP_HUMAN	S	253	ENSP00000318085:N253S;ENSP00000436815:N253S	ENSP00000318085:N253S	N	+	2	0	HINFP	118508584	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.766000	0.74970	2.108000	0.64289	0.533000	0.62120	AAT		0.577	HINFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388201.2	NM_015517	
OR8B4	283162	hgsc.bcm.edu	37	11	124294011	124294011	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:124294011A>G	ENST00000356130.3	-	1	778	c.757T>C	c.(757-759)Tca>Cca	p.S253P		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S253P(1)		endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AATGTCCCTGACCCAAAAAAC	0.463																																					p.S253P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T757C	11						.						90.0	89.0	89.0					11																	124294011		2201	4299	6500	123799221	SO:0001583	missense	283162	exon1			AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.757T>C	11.37:g.124294011A>G	ENSP00000348449:p.Ser253Pro	Somatic		Capture	SOLID	Phase_I	123799221	NM_001005196	B2RNF8|Q6IFQ7	Missense_Mutation	SNP	ENST00000356130.3	37	CCDS31710.1	.	.	.	.	.	.	.	.	.	.	a	13.46	2.245278	0.39697	.	.	ENSG00000198657	ENST00000356130	T	0.00051	8.81	4.14	4.14	0.48551	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43416	D	0.000564	T	0.00271	0.0008	L	0.43646	1.37	0.31986	N	0.605214	D	0.61697	0.99	D	0.67725	0.953	T	0.61153	-0.7120	10	0.87932	D	0	.	7.5094	0.27564	0.6781:0.0:0.0:0.3219	.	253	Q96RC9	OR8B4_HUMAN	P	253	ENSP00000348449:S253P	ENSP00000348449:S253P	S	-	1	0	OR8B4	123799221	0.000000	0.05858	0.999000	0.59377	0.317000	0.28152	-0.779000	0.04659	2.109000	0.64355	0.533000	0.62120	TCA		0.463	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387055.1	NM_001005196	
DCPS	28960	hgsc.bcm.edu	37	11	126213236	126213236	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:126213236G>A	ENST00000263579.4	+	5	1000	c.671G>A	c.(670-672)cGc>cAc	p.R224H	DCPS_ENST00000530860.1_3'UTR	NM_014026.3	NP_054745.1	Q96C86	DCPS_HUMAN	decapping enzyme, scavenger	224					cellular response to menadione (GO:0036245)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA metabolic process (GO:0016071)|negative regulation of programmed cell death (GO:0043069)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	m7G(5')pppN diphosphatase activity (GO:0050072)|RNA 7-methylguanosine cap binding (GO:0000340)	p.R224H(1)		endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		ATCTGCCATCGCCGGGGCATC	0.612																																					p.R224H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G671A	11						.						83.0	60.0	68.0					11																	126213236		2201	4298	6499	125718446	SO:0001583	missense	28960	exon5			AF077201	CCDS8473.1	11q24	2008-02-05			ENSG00000110063	ENSG00000110063			29812	protein-coding gene	gene with protein product		610534				12198172, 14523240	Standard	NM_014026		Approved	HSPC015, HINT-5, HSL1	uc001qdp.3	Q96C86	OTTHUMG00000165829	ENST00000263579.4:c.671G>A	11.37:g.126213236G>A	ENSP00000263579:p.Arg224His	Somatic		Capture	SOLID	Phase_I	125718446	NM_014026	Q8NHL8|Q9Y2S5	Missense_Mutation	SNP	ENST00000263579.4	37	CCDS8473.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192456	0.78902	.	.	ENSG00000110063	ENST00000263579	D	0.96265	-3.96	5.31	4.4	0.53042	Histidine triad-like motif (1);	0.112759	0.64402	D	0.000010	D	0.96842	0.8969	M	0.65975	2.015	0.53005	D	0.999964	D	0.76494	0.999	P	0.60541	0.876	D	0.96569	0.9421	10	0.62326	D	0.03	-26.7074	10.2429	0.43324	0.1493:0.0:0.8507:0.0	.	224	Q96C86	DCPS_HUMAN	H	224	ENSP00000263579:R224H	ENSP00000263579:R224H	R	+	2	0	DCPS	125718446	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	5.734000	0.68580	1.497000	0.48584	-0.136000	0.14681	CGC		0.612	DCPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386455.1	NM_014026	
HBD	3045	hgsc.bcm.edu	37	11	5255332	5255332	+	Silent	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:5255332C>A	ENST00000380299.3	-	2	418	c.204G>T	c.(202-204)gtG>gtT	p.V68V	HBD_ENST00000292901.3_Silent_p.V68V	NM_000519.3	NP_000510.1	P02042	HBD_HUMAN	hemoglobin, delta	68					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)	p.V68V(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	16		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGCACCTAGCACCTTCTTGC	0.537																																					p.V68V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G204T	11						.						163.0	139.0	147.0					11																	5255332		2201	4298	6499	5211908	SO:0001819	synonymous_variant	3045	exon2			AY034468	CCDS31376.1	11p15.5	2012-10-02			ENSG00000223609	ENSG00000223609			4829	protein-coding gene	gene with protein product		142000				2649166	Standard	NM_000519		Approved		uc001maf.1	P02042	OTTHUMG00000066674	ENST00000380299.3:c.204G>T	11.37:g.5255332C>A		Somatic		Capture	SOLID	Phase_I	5211908	NM_000519	Q3Y5H3|Q8WXT7	Silent	SNP	ENST00000380299.3	37	CCDS31376.1																																																																																				0.537	HBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142970.1	NM_000519	
APBB1	322	hgsc.bcm.edu	37	11	6425007	6425007	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:6425007G>A	ENST00000609360.1	-	3	866	c.767C>T	c.(766-768)cCg>cTg	p.P256L	APBB1_ENST00000529519.1_Intron|APBB1_ENST00000608704.1_5'UTR|APBB1_ENST00000389906.2_Missense_Mutation_p.P256L|APBB1_ENST00000608655.1_Missense_Mutation_p.P36L|APBB1_ENST00000609331.1_Missense_Mutation_p.P21L|APBB1_ENST00000299402.6_Missense_Mutation_p.P256L|APBB1_ENST00000608645.1_5'UTR|APBB1_ENST00000530885.1_Missense_Mutation_p.P36L|APBB1_ENST00000311051.3_Missense_Mutation_p.P256L|APBB1_ENST00000608394.1_5'UTR	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	256	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)	p.P256L(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CCATCCAGCCGGCAGGTCGGA	0.632																																					p.P256L	GBM(147;1810 2556 5672 39622)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C767T	11						.						77.0	73.0	75.0					11																	6425007		2201	4296	6497	6381583	SO:0001583	missense	322	exon3			L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213		ENST00000609360.1:c.767C>T	11.37:g.6425007G>A	ENSP00000477213:p.Pro256Leu	Somatic		Capture	SOLID	Phase_I	6381583	NM_001164	A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Missense_Mutation	SNP	ENST00000609360.1	37		.	.	.	.	.	.	.	.	.	.	G	27.8	4.859926	0.91433	.	.	ENSG00000166313	ENST00000299402;ENST00000311051;ENST00000389906;ENST00000539758;ENST00000544288;ENST00000530885	D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22	4.67	4.67	0.58626	.	0.000000	0.64402	D	0.000001	D	0.92541	0.7631	M	0.71871	2.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	D	0.93319	0.6691	10	0.87932	D	0	-17.4835	15.0946	0.72223	0.0:0.0:1.0:0.0	.	21;36;256	F5H1C5;B7Z2Y0;O00213-2	.;.;.	L	256;256;256;105;21;36	ENSP00000299402:P256L;ENSP00000311912:P256L;ENSP00000374556:P256L;ENSP00000433338:P36L	ENSP00000299402:P256L	P	-	2	0	APBB1	6381583	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.507000	0.97996	2.425000	0.82216	0.313000	0.20887	CCG		0.632	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471831.1	NM_001164	
PPFIBP2	8495	hgsc.bcm.edu	37	11	7663547	7663547	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:7663547A>G	ENST00000299492.4	+	17	1924	c.1536A>G	c.(1534-1536)tcA>tcG	p.S512S	PPFIBP2_ENST00000530181.1_Silent_p.S369S|PPFIBP2_ENST00000528883.1_Silent_p.S400S|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000533792.1_Silent_p.S354S	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	512					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)	p.S512S(1)		breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GAACTCAGTCAGGAAATTTCT	0.537																																					p.S512S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1536G	11						.						69.0	64.0	66.0					11																	7663547		2201	4296	6497	7620123	SO:0001819	synonymous_variant	8495	exon17			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1536A>G	11.37:g.7663547A>G		Somatic		Capture	SOLID	Phase_I	7620123	NM_003621	B7Z433|E9PK77|O75337|Q8WW26	Silent	SNP	ENST00000299492.4	37	CCDS31419.1	.	.	.	.	.	.	.	.	.	.	A	9.860	1.196046	0.22037	.	.	ENSG00000166387	ENST00000534409	.	.	.	5.9	-0.745	0.11098	.	.	.	.	.	T	0.39253	0.1071	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25813	-1.0121	4	.	.	.	-11.1618	0.4605	0.00515	0.3444:0.2594:0.1453:0.2509	.	.	.	.	G	203	.	.	R	+	1	2	PPFIBP2	7620123	0.984000	0.35163	0.997000	0.53966	0.903000	0.53119	0.245000	0.18142	-0.142000	0.11354	-0.280000	0.10049	AGG		0.537	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621	
SWAP70	23075	hgsc.bcm.edu	37	11	9770699	9770699	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:9770699T>G	ENST00000318950.6	+	11	1723	c.1620T>G	c.(1618-1620)caT>caG	p.H540Q	SWAP70_ENST00000447399.2_Missense_Mutation_p.H482Q	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	540					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)	p.H540Q(1)		NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		AAGTGGCCCATCATGAAGGAT	0.318																																					p.H540Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1620G	11						.						83.0	86.0	85.0					11																	9770699		2201	4294	6495	9727275	SO:0001583	missense	23075	exon11			AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.1620T>G	11.37:g.9770699T>G	ENSP00000315630:p.His540Gln	Somatic		Capture	SOLID	Phase_I	9727275	NM_015055	D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Missense_Mutation	SNP	ENST00000318950.6	37	CCDS31426.1	.	.	.	.	.	.	.	.	.	.	T	11.83	1.755245	0.31046	.	.	ENSG00000133789	ENST00000447399;ENST00000318950	T;T	0.04970	3.52;3.52	5.53	-2.77	0.05877	.	0.367969	0.30989	N	0.008475	T	0.02012	0.0063	N	0.04880	-0.145	0.33997	D	0.649835	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.39941	-0.9589	10	0.27785	T	0.31	-5.278	1.1888	0.01860	0.2783:0.0991:0.3071:0.3155	.	482;540	E7EMB1;Q9UH65	.;SWP70_HUMAN	Q	482;540	ENSP00000399056:H482Q;ENSP00000315630:H540Q	ENSP00000315630:H540Q	H	+	3	2	SWAP70	9727275	0.420000	0.25457	0.988000	0.46212	0.966000	0.64601	-0.347000	0.07750	-0.457000	0.07033	0.533000	0.62120	CAT		0.318	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386766.2	NM_015055	
NAV2	89797	hgsc.bcm.edu	37	11	19954819	19954819	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:19954819T>C	ENST00000396087.3	+	8	1197	c.1098T>C	c.(1096-1098)agT>agC	p.S366S	NAV2_ENST00000349880.4_Silent_p.S343S|NAV2_ENST00000540292.1_Silent_p.S297S|NAV2_ENST00000396085.1_Silent_p.S343S|NAV2_ENST00000527559.2_Silent_p.S295S|NAV2_ENST00000360655.4_Silent_p.S279S	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	366					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)	p.S366S(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CTAATTGCAGTACCTCCTCGG	0.607																																					p.S279S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T837C	11						.						131.0	133.0	133.0					11																	19954819		2199	4293	6492	19911395	SO:0001819	synonymous_variant	89797	exon7			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.1098T>C	11.37:g.19954819T>C		Somatic		Capture	SOLID	Phase_I	19911395	NM_001111018	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	CCDS58126.1																																																																																				0.607	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
PAX6	5080	hgsc.bcm.edu	37	11	31812281	31812281	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:31812281C>T	ENST00000379132.3	-	11	1440	c.1160G>A	c.(1159-1161)gGc>gAc	p.G387D	PAX6_ENST00000379129.2_Missense_Mutation_p.G401D|PAX6_ENST00000379123.5_Missense_Mutation_p.G387D|PAX6_ENST00000379107.2_Missense_Mutation_p.G401D|PAX6_ENST00000419022.1_Missense_Mutation_p.G401D|PAX6_ENST00000379111.2_Missense_Mutation_p.G387D|PAX6_ENST00000379115.4_Missense_Mutation_p.G401D|PAX6_ENST00000241001.8_Missense_Mutation_p.G387D			P26367	PAX6_HUMAN	paired box 6	387	Pro/Ser/Thr-rich.		G -> D. {ECO:0000269|PubMed:10737978}.		astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)	p.G401D(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					GCCCGAGGTGCCCATTGGCTG	0.542									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																												p.G387D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1160A	11						.						117.0	104.0	108.0					11																	31812281		2202	4299	6501	31768857	SO:0001583	missense	5080	exon12	Familial Cancer Database	WAGR syndrome	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.1160G>A	11.37:g.31812281C>T	ENSP00000368427:p.Gly387Asp	Somatic		Capture	SOLID	Phase_I	31768857	NM_001127612	Q6N006|Q99413	Missense_Mutation	SNP	ENST00000379132.3	37	CCDS31451.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306927	0.60305	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000379107;ENST00000464174;ENST00000241001;ENST00000379115;ENST00000474783;ENST00000379111;ENST00000379123;ENST00000494377;ENST00000470027;ENST00000379109;ENST00000533333	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.93859	-3.3;-3.29;-3.3;-3.3;-2.93;-3.29;-3.3;-2.23;-3.29;-3.29;-2.74;-2.74;-3.29;-3.03	6.11	6.11	0.99139	.	0.135147	0.64402	D	0.000002	D	0.91968	0.7456	L	0.47716	1.5	0.45307	D	0.998309	B;B	0.28552	0.215;0.058	B;B	0.31495	0.131;0.03	D	0.87914	0.2699	10	0.35671	T	0.21	.	20.7342	0.99715	0.0:1.0:0.0:0.0	.	401;387	F1T0F8;P26367	.;PAX6_HUMAN	D	401;387;401;401;186;387;401;77;387;387;251;251;387;342	ENSP00000404100:G401D;ENSP00000368427:G387D;ENSP00000368424:G401D;ENSP00000368401:G401D;ENSP00000431961:G186D;ENSP00000241001:G387D;ENSP00000368410:G401D;ENSP00000450579:G77D;ENSP00000368406:G387D;ENSP00000368418:G387D;ENSP00000451901:G251D;ENSP00000450775:G251D;ENSP00000368403:G387D;ENSP00000451372:G342D	ENSP00000241001:G387D	G	-	2	0	PAX6	31768857	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.967000	0.70403	2.906000	0.99361	0.655000	0.94253	GGC		0.542	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	NM_001604	
TTC17	55761	hgsc.bcm.edu	37	11	43471697	43471697	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:43471697G>A	ENST00000039989.4	+	20	2866	c.2852G>A	c.(2851-2853)gGc>gAc	p.G951D		NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	951					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.G951D(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CTTTGCAATGGCAATCTCCCC	0.498																																					p.G951D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2852A	11						.						132.0	116.0	121.0					11																	43471697		2203	4300	6503	43428273	SO:0001583	missense	55761	exon20			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.2852G>A	11.37:g.43471697G>A	ENSP00000039989:p.Gly951Asp	Somatic		Capture	SOLID	Phase_I	43428273	NM_018259	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933152	0.34096	.	.	ENSG00000052841	ENST00000039989	T	0.29142	1.58	5.98	5.06	0.68205	.	0.248864	0.40469	N	0.001092	T	0.17534	0.0421	N	0.08118	0	0.31070	N	0.713143	B	0.31125	0.309	B	0.25140	0.058	T	0.06162	-1.0842	10	0.38643	T	0.18	-10.7891	16.1325	0.81454	0.0:0.3118:0.6882:0.0	.	951	Q96AE7	TTC17_HUMAN	D	951	ENSP00000039989:G951D	ENSP00000039989:G951D	G	+	2	0	TTC17	43428273	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.344000	0.65981	1.498000	0.48600	0.591000	0.81541	GGC		0.498	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
TSPAN18	90139	hgsc.bcm.edu	37	11	44941388	44941388	+	Silent	SNP	C	C	T	rs369513260		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:44941388C>T	ENST00000520358.2	+	8	868	c.453C>T	c.(451-453)aaC>aaT	p.N151N	TSPAN18_ENST00000340160.3_Silent_p.N151N			Q96SJ8	TSN18_HUMAN	tetraspanin 18	151						integral component of membrane (GO:0016021)		p.N151N(1)		endometrium(1)|large_intestine(6)|lung(3)	10						GCGGGGTCAACGGGCCTGAAG	0.592																																					p.N151N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C453T	11						.	C		0,4406		0,0,2203	145.0	149.0	147.0		453	-0.4	1.0	11		147	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	TSPAN18	NM_130783.4		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		151/249	44941388	1,13003	2203	4299	6502	44897964	SO:0001819	synonymous_variant	90139	exon7			AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.453C>T	11.37:g.44941388C>T		Somatic		Capture	SOLID	Phase_I	44897964	NM_130783	Q6UY44|Q8NBI9	Silent	SNP	ENST00000520358.2	37	CCDS7910.1	.	.	.	.	.	.	.	.	.	.	C	8.292	0.817920	0.16607	0.0	1.16E-4	ENSG00000157570	ENST00000518429	.	.	.	5.27	-0.443	0.12249	.	.	.	.	.	T	0.54255	0.1847	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47535	-0.9110	4	.	.	.	.	8.313	0.32082	0.0:0.3331:0.0:0.6669	.	.	.	.	W	155	.	.	R	+	1	2	TSPAN18	44897964	0.552000	0.26505	0.999000	0.59377	0.790000	0.44656	-0.254000	0.08781	0.063000	0.16370	-0.258000	0.10820	CGG		0.592	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376197.3	NM_130783	
PHF21A	51317	hgsc.bcm.edu	37	11	45992799	45992799	+	Silent	SNP	G	G	A	rs148927461		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:45992799G>A	ENST00000418153.2	-	7	679	c.480C>T	c.(478-480)acC>acT	p.T160T	PHF21A_ENST00000323180.6_Silent_p.T160T|PHF21A_ENST00000257821.4_Silent_p.T160T			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	160					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.T160T(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						TGTTGATGGCGGTCACCATAG	0.547																																					p.T160T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C480T	11						.	G	,	1,4403	2.1+/-5.4	0,1,2201	142.0	127.0	132.0		480,480	4.7	1.0	11	dbSNP_134	132	2,8596	2.2+/-6.3	0,2,4297	no	coding-synonymous,coding-synonymous	PHF21A	NM_001101802.1,NM_016621.3	,	0,3,6498	AA,AG,GG		0.0233,0.0227,0.0231	,	160/681,160/635	45992799	3,12999	2202	4299	6501	45949375	SO:0001819	synonymous_variant	51317	exon7			AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.480C>T	11.37:g.45992799G>A		Somatic		Capture	SOLID	Phase_I	45949375	NM_001101802	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Silent	SNP	ENST00000418153.2	37	CCDS44578.1																																																																																				0.547	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392583.1	NM_016621	
NR1H3	10062	hgsc.bcm.edu	37	11	47282948	47282948	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:47282948C>T	ENST00000467728.1	+	4	1894	c.656C>T	c.(655-657)gCt>gTt	p.A219V	NR1H3_ENST00000441012.2_Missense_Mutation_p.A219V|NR1H3_ENST00000395397.3_Missense_Mutation_p.A174V|NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000405853.3_Missense_Mutation_p.A219V|NR1H3_ENST00000405576.1_Missense_Mutation_p.A174V|NR1H3_ENST00000527949.1_Missense_Mutation_p.A128V|NR1H3_ENST00000407404.1_Missense_Mutation_p.A219V|NR1H3_ENST00000481889.2_Missense_Mutation_p.A174V			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	219	Ligand-binding. {ECO:0000255}.				apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.A219V(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						AAGCTCGTCGCTGCCCAGCAA	0.632																																					p.A174V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C521T	11						.						59.0	56.0	57.0					11																	47282948		2201	4298	6499	47239524	SO:0001583	missense	10062	exon4			U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.656C>T	11.37:g.47282948C>T	ENSP00000420656:p.Ala219Val	Somatic		Capture	SOLID	Phase_I	47239524	NM_001130102	A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	ENST00000467728.1	37	CCDS7929.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.548172	0.45383	.	.	ENSG00000025434	ENST00000395397;ENST00000405576;ENST00000481889;ENST00000531660;ENST00000407404;ENST00000441012;ENST00000467728;ENST00000405853;ENST00000527949	D;D;D;T;D;D;D;D;D	0.95205	-3.64;-3.22;-3.07;0.27;-3.27;-3.64;-3.64;-3.27;-3.42	5.24	5.24	0.73138	Nuclear hormone receptor, ligand-binding (2);	0.152140	0.64402	D	0.000013	D	0.96488	0.8854	M	0.69823	2.125	0.28954	N	0.890259	B;P;P;P;D	0.61697	0.107;0.773;0.737;0.945;0.99	B;P;B;P;D	0.66497	0.014;0.597;0.171;0.468;0.944	D	0.91645	0.5330	10	0.17832	T	0.49	.	19.7033	0.96063	0.0:1.0:0.0:0.0	.	225;174;219;174;219	B4DXU5;B5MBY7;Q13133;E9PLL4;Q13133-2	.;.;NR1H3_HUMAN;.;.	V	174;174;174;85;219;219;219;219;128	ENSP00000378793:A174V;ENSP00000385073:A174V;ENSP00000433271:A174V;ENSP00000434650:A85V;ENSP00000385801:A219V;ENSP00000387946:A219V;ENSP00000420656:A219V;ENSP00000384745:A219V;ENSP00000432073:A128V	ENSP00000378793:A174V	A	+	2	0	NR1H3	47239524	1.000000	0.71417	0.813000	0.32504	0.485000	0.33311	7.411000	0.80078	2.814000	0.96858	0.655000	0.94253	GCT		0.632	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3		
PSMC3	5702	hgsc.bcm.edu	37	11	47444453	47444453	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:47444453T>C	ENST00000298852.3	-	7	820	c.663A>G	c.(661-663)aaA>aaG	p.K221K	PSMC3_ENST00000530912.1_Silent_p.K179K|PSMC3_ENST00000602866.1_Silent_p.K205K	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	221					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.K221K(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TCAGCACCCCTTTTGGAGGTT	0.597																																					p.K221K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A663G	11						.						115.0	117.0	116.0					11																	47444453		2201	4298	6499	47401029	SO:0001819	synonymous_variant	5702	exon7			M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.663A>G	11.37:g.47444453T>C		Somatic		Capture	SOLID	Phase_I	47401029	NM_002804	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Silent	SNP	ENST00000298852.3	37	CCDS7935.1																																																																																				0.597	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395660.2	NM_002804	
OR10W1	81341	hgsc.bcm.edu	37	11	58034613	58034613	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:58034613G>C	ENST00000395079.2	-	1	1119	c.718C>G	c.(718-720)Ctg>Gtg	p.L240V		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L240V(1)		kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				TACTGCAGCAGCACCACAGTG	0.582																																					p.L240V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C718G	11						.						82.0	79.0	80.0					11																	58034613		2201	4295	6496	57791189	SO:0001583	missense	81341	exon1			AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.718C>G	11.37:g.58034613G>C	ENSP00000378516:p.Leu240Val	Somatic		Capture	SOLID	Phase_I	57791189	NM_207374	A2RUD2|A8MTE1|Q6UXQ2	Missense_Mutation	SNP	ENST00000395079.2	37	CCDS7968.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.874736	0.33069	.	.	ENSG00000172772	ENST00000395079	T	0.33654	1.4	5.8	0.148	0.14843	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39020	N	0.001485	T	0.13927	0.0337	N	0.11284	0.12	0.09310	N	1	B	0.18968	0.032	B	0.20767	0.031	T	0.34229	-0.9837	10	0.05351	T	0.99	.	8.1369	0.31061	0.1962:0.4285:0.3753:0.0	.	240	Q8NGF6	O10W1_HUMAN	V	240	ENSP00000378516:L240V	ENSP00000378516:L240V	L	-	1	2	OR10W1	57791189	0.000000	0.05858	0.813000	0.32504	0.394000	0.30568	-1.295000	0.02764	0.321000	0.23259	0.655000	0.94253	CTG		0.582	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394704.1	NM_207374	
OR5B12	390191	hgsc.bcm.edu	37	11	58207485	58207485	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:58207485A>G	ENST00000302572.2	-	1	161	c.140T>C	c.(139-141)aTt>aCt	p.I47T		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I47T(1)		large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GTCCAGTAGAATCAATTCAAT	0.488																																					p.I47T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T140C	11						.						73.0	81.0	79.0					11																	58207485		2201	4295	6496	57964061	SO:0001583	missense	390191	exon1			AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.140T>C	11.37:g.58207485A>G	ENSP00000306657:p.Ile47Thr	Somatic		Capture	SOLID	Phase_I	57964061	NM_001004733	B2RNL2|Q6IEV5	Missense_Mutation	SNP	ENST00000302572.2	37	CCDS31551.1	.	.	.	.	.	.	.	.	.	.	A	8.738	0.918202	0.17982	.	.	ENSG00000172362	ENST00000302572	T	0.08458	3.09	4.74	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	D	0.000463	T	0.13884	0.0336	M	0.69358	2.11	0.28983	N	0.888543	P	0.50369	0.934	P	0.44696	0.458	T	0.05566	-1.0877	10	0.72032	D	0.01	-9.0239	12.4804	0.55839	1.0:0.0:0.0:0.0	.	47	Q96R08	OR5BC_HUMAN	T	47	ENSP00000306657:I47T	ENSP00000306657:I47T	I	-	2	0	OR5B12	57964061	0.651000	0.27340	0.181000	0.23098	0.069000	0.16628	4.997000	0.63921	2.118000	0.64928	0.459000	0.35465	ATT		0.488	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394987.1	NM_001004733	
MS4A1	931	hgsc.bcm.edu	37	11	60235860	60235860	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:60235860A>G	ENST00000534668.1	+	7	1102	c.813A>G	c.(811-813)gaA>gaG	p.E271E	MS4A1_ENST00000532073.1_Silent_p.E258E|MS4A1_ENST00000528313.1_Silent_p.E104E|MS4A1_ENST00000345732.4_Silent_p.E271E|MS4A1_ENST00000389939.2_Silent_p.E271E	NM_152866.2	NP_690605.1	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member 1	271					B cell proliferation (GO:0042100)|humoral immune response (GO:0006959)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	MHC class II protein complex binding (GO:0023026)	p.E271E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)	AAGAAGAGGAAGAAGAAGAAA	0.378																																					p.E271E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A813G	11						.						96.0	94.0	95.0					11																	60235860		2203	4300	6503	59992436	SO:0001819	synonymous_variant	931	exon7			M27394	CCDS31570.1	11q12-q13.1	2014-09-17				ENSG00000156738		"""CD molecules"""	7315	protein-coding gene	gene with protein product		112210		CD20		2448768	Standard	NM_152866		Approved	B1, Bp35, MS4A2	uc001npq.3	P11836		ENST00000534668.1:c.813A>G	11.37:g.60235860A>G		Somatic		Capture	SOLID	Phase_I	59992436	NM_021950	A6NMS4|B4DT24|P08984|Q13963	Silent	SNP	ENST00000534668.1	37	CCDS31570.1																																																																																				0.378	MS4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395402.1		
AHNAK	79026	hgsc.bcm.edu	37	11	62284496	62284496	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:62284496G>A	ENST00000378024.4	-	5	17667	c.17393C>T	c.(17392-17394)aCg>aTg	p.T5798M	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'UTR	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5798					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.T5798M(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AAACTCCAGCGTCCCCGTCGG	0.483																																					p.T5798M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C17393T	11						.						88.0	92.0	91.0					11																	62284496		2202	4299	6501	62041072	SO:0001583	missense	79026	exon5			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17393C>T	11.37:g.62284496G>A	ENSP00000367263:p.Thr5798Met	Somatic		Capture	SOLID	Phase_I	62041072	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010400	0.54361	.	.	ENSG00000124942	ENST00000378024	T	0.00659	5.94	4.99	4.99	0.66335	.	.	.	.	.	T	0.03520	0.0101	L	0.51422	1.61	0.28842	N	0.896522	D	0.89917	1.0	D	0.83275	0.996	T	0.31138	-0.9954	9	0.52906	T	0.07	.	17.8825	0.88844	0.0:0.0:1.0:0.0	.	5798	Q09666	AHNK_HUMAN	M	5798	ENSP00000367263:T5798M	ENSP00000367263:T5798M	T	-	2	0	AHNAK	62041072	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.186000	0.50942	2.312000	0.78011	0.549000	0.68633	ACG		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
CHRM1	1128	hgsc.bcm.edu	37	11	62677284	62677284	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:62677284C>T	ENST00000306960.3	-	2	1830	c.1289G>A	c.(1288-1290)cGc>cAc	p.R430H	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	430					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.R430H(1)		large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	CAGCAGCAGGCGAAAGGTGTC	0.622																																					p.R430H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1289A	11						.						153.0	151.0	152.0					11																	62677284		2201	4298	6499	62433860	SO:0001583	missense	1128	exon2			Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.1289G>A	11.37:g.62677284C>T	ENSP00000306490:p.Arg430His	Somatic		Capture	SOLID	Phase_I	62433860	NM_000738	Q96RH1	Missense_Mutation	SNP	ENST00000306960.3	37	CCDS8040.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.432241	0.43122	.	.	ENSG00000168539	ENST00000306960;ENST00000543973	T;T	0.40476	1.03;1.03	3.98	3.98	0.46160	.	0.743953	0.11194	N	0.589538	T	0.39064	0.1064	N	0.19112	0.55	0.33595	D	0.601547	D	0.71674	0.998	P	0.54346	0.749	T	0.49707	-0.8911	10	0.66056	D	0.02	-12.5732	7.4349	0.27150	0.0:0.8835:0.0:0.1165	.	430	P11229	ACM1_HUMAN	H	430	ENSP00000306490:R430H;ENSP00000441188:R430H	ENSP00000306490:R430H	R	-	2	0	CHRM1	62433860	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.935000	0.28924	2.028000	0.59812	0.561000	0.74099	CGC		0.622	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396178.1	NM_000738	
LRP5	4041	hgsc.bcm.edu	37	11	68157388	68157388	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:68157388C>T	ENST00000294304.7	+	7	1558	c.1452C>T	c.(1450-1452)atC>atT	p.I484I		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	484	Beta-propeller 2.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.I484I(1)		autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACCCTAAAATCGAGTGTGCCA	0.602																																					p.I484I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1452T	11						.						131.0	119.0	123.0					11																	68157388		2200	4294	6494	67913964	SO:0001819	synonymous_variant	4041	exon7			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.1452C>T	11.37:g.68157388C>T		Somatic		Capture	SOLID	Phase_I	67913964	NM_002335	Q96TD6|Q9UES7|Q9UP66	Silent	SNP	ENST00000294304.7	37	CCDS8181.1																																																																																				0.602	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
SYTL2	54843	hgsc.bcm.edu	37	11	85456815	85456815	+	Splice_Site	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:85456815G>T	ENST00000528231.1	-	3	531	c.254C>A	c.(253-255)gCt>gAt	p.A85D	SYTL2_ENST00000524452.1_Splice_Site_p.A85D|SYTL2_ENST00000316356.4_Splice_Site_p.A85D|SYTL2_ENST00000389960.4_Splice_Site_p.A85D|SYTL2_ENST00000527523.1_Splice_Site_p.A37D	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	85					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.A85D(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		ACTCTGCTCAGCTGAAACAGG	0.453																																					p.A85D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C254A	11						.						155.0	140.0	145.0					11																	85456815		2203	4299	6502	85134463	SO:0001630	splice_region_variant	54843	exon4			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.254-1C>A	11.37:g.85456815G>T		Somatic		Capture	SOLID	Phase_I	85134463	NM_032943	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	37	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758518	0.31137	.	.	ENSG00000137501	ENST00000389960;ENST00000316356;ENST00000528231;ENST00000527523;ENST00000524452	T;T;T;T;T	0.27890	1.69;1.73;1.74;1.64;1.69	5.88	2.93	0.34026	.	.	.	.	.	T	0.20047	0.0482	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.26318	0.146;0.04;0.024;0.04	B;B;B;B	0.27715	0.082;0.028;0.013;0.028	T	0.04650	-1.0936	8	.	.	.	.	8.2618	0.31790	0.0734:0.0:0.6531:0.2735	.	37;85;85;85	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13	.;.;SYTL2_HUMAN;.	D	85;85;85;37;85	ENSP00000374610:A85D;ENSP00000318803:A85D;ENSP00000431701:A85D;ENSP00000434010:A37D;ENSP00000435238:A85D	.	A	-	2	0	SYTL2	85134463	0.987000	0.35691	1.000000	0.80357	0.943000	0.58893	1.489000	0.35562	0.785000	0.33685	0.655000	0.94253	GCT		0.453	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927	Missense_Mutation
APLP2	334	hgsc.bcm.edu	37	11	130013269	130013269	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr11:130013269C>T	ENST00000263574.5	+	18	2290	c.2218C>T	c.(2218-2220)Cgt>Tgt	p.R740C	APLP2_ENST00000345598.5_Missense_Mutation_p.R499C|APLP2_ENST00000338167.5_Missense_Mutation_p.R728C|APLP2_ENST00000543137.1_Missense_Mutation_p.R635C|APLP2_ENST00000528499.1_Missense_Mutation_p.R672C|APLP2_ENST00000539648.1_Missense_Mutation_p.R528C|APLP2_ENST00000278756.7_Missense_Mutation_p.R738C	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	740					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)	p.R740C(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		CCCAGAAGAGCGTCACCTGAA	0.557																																					p.R740C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2218T	11						.						150.0	129.0	136.0					11																	130013269		2201	4297	6498	129518479	SO:0001583	missense	334	exon18			L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.2218C>T	11.37:g.130013269C>T	ENSP00000263574:p.Arg740Cys	Somatic		Capture	SOLID	Phase_I	129518479	NM_001642	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	ENST00000263574.5	37	CCDS8486.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.900991	0.92035	.	.	ENSG00000084234	ENST00000528499;ENST00000539648;ENST00000263574;ENST00000345598;ENST00000338167;ENST00000278756;ENST00000543137	D;D;D;D;D;D;D	0.96885	-4.16;-4.16;-4.16;-4.16;-4.16;-4.16;-4.16	5.65	5.65	0.86999	Beta-amyloid precursor protein C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97857	0.9296	M	0.69523	2.12	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;1.0;0.997;0.999;1.0;0.997;0.998	D	0.97700	1.0184	9	.	.	.	-13.3597	18.7125	0.91662	0.0:1.0:0.0:0.0	.	528;740;684;499;666;672;728	F5H845;Q06481;Q06481-2;Q06481-5;B4E3I5;Q06481-4;Q06481-3	.;APLP2_HUMAN;.;.;.;.;.	C	672;528;740;499;728;738;635	ENSP00000435914:R672C;ENSP00000443728:R528C;ENSP00000263574:R740C;ENSP00000263575:R499C;ENSP00000345444:R728C;ENSP00000278756:R738C;ENSP00000444122:R635C	.	R	+	1	0	APLP2	129518479	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.679000	0.68160	2.659000	0.90383	0.655000	0.94253	CGT		0.557	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386109.1	NM_001642	
TFAP2A	7020	hgsc.bcm.edu	37	6	10400740	10400740	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:10400740G>A	ENST00000482890.1	-	7	1318	c.966C>T	c.(964-966)aaC>aaT	p.N322N	TFAP2A_ENST00000497266.1_5'UTR|TFAP2A_ENST00000379613.3_Silent_p.N324N|TFAP2A_ENST00000319516.4_Silent_p.N318N|TFAP2A_ENST00000379608.3_Silent_p.N316N|TFAP2A_ENST00000379604.2_Silent_p.N322N			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	322	H-S-H (helix-span-helix), dimerization.				anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.N322N(1)|p.N316N(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				AATGTTGTCGGTTGAGAAATT	0.498																																					p.N322N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C966T	6						.						164.0	146.0	152.0					6																	10400740		2203	4300	6503	10508726	SO:0001819	synonymous_variant	7020	exon6			X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.966C>T	6.37:g.10400740G>A		Somatic		Capture	SOLID	Phase_I	10508726	NM_003220	Q13777|Q5TAV5|Q8N1C6	Silent	SNP	ENST00000482890.1	37	CCDS4510.1																																																																																				0.498	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353619.2	NM_003220	
SEC63	11231	hgsc.bcm.edu	37	6	108234626	108234626	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:108234626G>A	ENST00000369002.4	-	5	637	c.458C>T	c.(457-459)aCg>aTg	p.T153M		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	153	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.T153M(1)		endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		CTCTTCATCCGTTAAACTAGC	0.358																																					p.T153M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C458T	6						.						117.0	124.0	122.0					6																	108234626		2203	4300	6503	108341319	SO:0001583	missense	11231	exon5			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.458C>T	6.37:g.108234626G>A	ENSP00000357998:p.Thr153Met	Somatic		Capture	SOLID	Phase_I	108341319	NM_007214	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Missense_Mutation	SNP	ENST00000369002.4	37	CCDS5061.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669755	0.88348	.	.	ENSG00000025796	ENST00000369002;ENST00000423697;ENST00000429168	T;T	0.32272	1.46;1.46	5.61	5.61	0.85477	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.44850	0.1313	L	0.48935	1.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.40213	-0.9575	10	0.87932	D	0	-13.809	19.6401	0.95754	0.0:0.0:1.0:0.0	.	153;153	Q9UGP8;B3KQF0	SEC63_HUMAN;.	M	153;13;97	ENSP00000357998:T153M;ENSP00000403144:T97M	ENSP00000357998:T153M	T	-	2	0	SEC63	108341319	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.072000	0.93986	2.643000	0.89663	0.555000	0.69702	ACG		0.358	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	
SLC22A16	85413	hgsc.bcm.edu	37	6	110746228	110746228	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:110746228G>T	ENST00000368919.3	-	8	1648	c.1582C>A	c.(1582-1584)Ctt>Att	p.L528I	SLC22A16_ENST00000330550.4_Missense_Mutation_p.L494I	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	528					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)	p.L528I(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	CGTTTCCCAAGGGTTTCTGGA	0.413																																					p.L528I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1582A	6						.						95.0	94.0	94.0					6																	110746228		2203	4300	6503	110852921	SO:0001583	missense	85413	exon8				CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.1582C>A	6.37:g.110746228G>T	ENSP00000357915:p.Leu528Ile	Somatic		Capture	SOLID	Phase_I	110852921	NM_033125	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	ENST00000368919.3	37	CCDS5084.1	.	.	.	.	.	.	.	.	.	.	G	19.70	3.875612	0.72180	.	.	ENSG00000004809	ENST00000368919;ENST00000330550	T;T	0.74315	-0.83;-0.83	4.92	-0.238	0.13055	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.	.	.	.	T	0.60418	0.2267	M	0.81682	2.555	0.09310	N	1	P;P	0.43578	0.811;0.775	P;B	0.48270	0.572;0.436	T	0.55321	-0.8159	9	0.39692	T	0.17	.	1.7215	0.02912	0.1623:0.1371:0.4187:0.2819	.	528;494	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	I	528;494	ENSP00000357915:L528I;ENSP00000328583:L494I	ENSP00000328583:L494I	L	-	1	0	SLC22A16	110852921	0.534000	0.26362	0.002000	0.10522	0.968000	0.65278	1.060000	0.30530	-0.293000	0.08986	0.591000	0.81541	CTT		0.413	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125	
LAMA4	3910	hgsc.bcm.edu	37	6	112462050	112462050	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:112462050T>C	ENST00000230538.7	-	22	3285	c.2888A>G	c.(2887-2889)aAg>aGg	p.K963R	LAMA4_ENST00000389463.4_Missense_Mutation_p.K956R|LAMA4_ENST00000424408.2_Missense_Mutation_p.K956R|LAMA4_ENST00000522006.1_Missense_Mutation_p.K956R	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	963	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.K956R(1)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AAATTCCCCCTTTTTAATGAA	0.438																																					p.K956R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2867G	6						.						105.0	101.0	102.0					6																	112462050		2203	4300	6503	112568743	SO:0001583	missense	3910	exon22				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.2888A>G	6.37:g.112462050T>C	ENSP00000230538:p.Lys963Arg	Somatic		Capture	SOLID	Phase_I	112568743	NM_001105207	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.581515	0.65992	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.81	5.81	0.92471	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.095466	0.64402	D	0.000002	T	0.40145	0.1105	L	0.34521	1.04	0.80722	D	1	D;D	0.64830	0.994;0.993	D;P	0.64506	0.926;0.879	T	0.35649	-0.9780	10	0.46703	T	0.11	.	12.5282	0.56098	0.0:0.0:0.1386:0.8614	.	963;956	Q16363;Q16363-2	LAMA4_HUMAN;.	R	963;956;956;956	ENSP00000230538:K963R;ENSP00000429488:K956R;ENSP00000374114:K956R;ENSP00000416470:K956R	ENSP00000230538:K963R	K	-	2	0	LAMA4	112568743	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	4.575000	0.60908	2.224000	0.72417	0.528000	0.53228	AAG		0.438	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
RNF217	154214	hgsc.bcm.edu	37	6	125397989	125397989	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:125397989C>T	ENST00000521654.2	+	4	1468	c.1468C>T	c.(1468-1470)Cga>Tga	p.R490*	RNF217_ENST00000560949.1_Nonsense_Mutation_p.R255*|RNF217_ENST00000368414.2_Nonsense_Mutation_p.R52*|RNF217_ENST00000275184.6_Nonsense_Mutation_p.R134*|RNF217_ENST00000359704.2_Nonsense_Mutation_p.R198*			Q8TC41	RN217_HUMAN	ring finger protein 217	490					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R198*(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		GAGATTAGTGCGAGGGTCAGT	0.448																																					p.R198X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C592T	6						.						147.0	140.0	142.0					6																	125397989		2203	4300	6503	125439688	SO:0001587	stop_gained	154214	exon6			BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.1468C>T	6.37:g.125397989C>T	ENSP00000428698:p.Arg490*	Somatic		Capture	SOLID	Phase_I	125439688	NM_152553	H7C5V4|Q5TCA4|Q9BX48	Nonsense_Mutation	SNP	ENST00000521654.2	37		.	.	.	.	.	.	.	.	.	.	C	29.9	5.046280	0.93740	.	.	ENSG00000146373	ENST00000521654;ENST00000368414;ENST00000359704;ENST00000275184	.	.	.	5.34	3.5	0.40072	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.026	0.64586	0.394:0.606:0.0:0.0	.	.	.	.	X	255;52;198;134	.	ENSP00000275184:R134X	R	+	1	2	RNF217	125439688	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.740000	0.38228	0.688000	0.31529	0.650000	0.86243	CGA		0.448	RNF217-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000042063.3	NM_152553	
VNN2	8875	hgsc.bcm.edu	37	6	133077014	133077014	+	Missense_Mutation	SNP	T	T	C	rs563034797		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:133077014T>C	ENST00000326499.6	-	3	629	c.505A>G	c.(505-507)Aca>Gca	p.T169A	RP1-55C23.7_ENST00000430895.1_RNA|VNN2_ENST00000525270.1_Missense_Mutation_p.T116A|VNN2_ENST00000526192.1_5'UTR|VNN2_ENST00000525289.1_Missense_Mutation_p.T169A	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	169	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)	p.T169A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		TTTCCTTCTGTATTATACACC	0.438																																					p.T169A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A505G	6						.						160.0	131.0	141.0					6																	133077014		2203	4300	6503	133118707	SO:0001583	missense	8875	exon3			AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.505A>G	6.37:g.133077014T>C	ENSP00000322276:p.Thr169Ala	Somatic		Capture	SOLID	Phase_I	133118707	NM_004665	A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Missense_Mutation	SNP	ENST00000326499.6	37	CCDS5161.1	.	.	.	.	.	.	.	.	.	.	T	0.879	-0.729506	0.03135	.	.	ENSG00000112303	ENST00000326499;ENST00000525270;ENST00000525289	D;D;D	0.84589	-1.87;-1.87;-1.87	5.03	-10.1	0.00402	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	1.458410	0.04767	N	0.427479	T	0.25005	0.0607	N	0.00750	-1.22	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.42682	-0.9437	10	0.25106	T	0.35	0.921	4.9049	0.13793	0.4387:0.3484:0.0543:0.1586	.	169;169	O95498-2;O95498	.;VNN2_HUMAN	A	169;116;169	ENSP00000322276:T169A;ENSP00000436822:T116A;ENSP00000436935:T169A	ENSP00000322276:T169A	T	-	1	0	VNN2	133118707	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-4.186000	0.00278	-5.041000	0.00023	-1.760000	0.00671	ACA		0.438	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042264.2		
MTFR2	113115	hgsc.bcm.edu	37	6	136560934	136560934	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:136560934C>T	ENST00000420702.1	-	6	928	c.539G>A	c.(538-540)cGc>cAc	p.R180H	MTFR2_ENST00000451457.2_Missense_Mutation_p.R180H	NM_001099286.1	NP_001092756.1	Q6P444	MTFR2_HUMAN	mitochondrial fission regulator 2	180					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	mitochondrion (GO:0005739)		p.R180H(1)									CAAACTAATGCGCTCGTCACT	0.438																																					p.R180H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G539A	6						.						47.0	40.0	42.0					6																	136560934		2203	4300	6503	136602627	SO:0001583	missense	113115	exon6			BC011716	CCDS5176.1	6q23.2	2012-11-30	2012-11-29	2012-11-29	ENSG00000146410	ENSG00000146410			21115	protein-coding gene	gene with protein product			"""DUF729 domain containing 1"", ""family with sequence similarity 54, member A"""	DUFD1, FAM54A			Standard	NM_138419		Approved		uc003qgt.1	Q6P444	OTTHUMG00000015643	ENST00000420702.1:c.539G>A	6.37:g.136560934C>T	ENSP00000395232:p.Arg180His	Somatic		Capture	SOLID	Phase_I	136602627	NM_138419	A8K8D8|E1P585|Q5JWR7|Q6ZUE8|Q7L3U6|Q9BZ39	Missense_Mutation	SNP	ENST00000420702.1	37	CCDS5176.1	.	.	.	.	.	.	.	.	.	.	c	6.438	0.448962	0.12223	.	.	ENSG00000146410	ENST00000451457;ENST00000420702;ENST00000418509	T;T;T	0.44083	0.93;0.93;0.93	5.41	3.6	0.41247	.	1.009780	0.07940	N	0.979068	T	0.09291	0.0229	N	0.08118	0	0.09310	N	1	B	0.25351	0.124	B	0.14578	0.011	T	0.35176	-0.9799	10	0.45353	T	0.12	-4.7266	9.2073	0.37298	0.0:0.3006:0.5435:0.1559	.	180	Q6P444	FA54A_HUMAN	H	180;180;137	ENSP00000407010:R180H;ENSP00000395232:R180H;ENSP00000410861:R137H	ENSP00000410861:R137H	R	-	2	0	FAM54A	136602627	0.356000	0.24930	0.001000	0.08648	0.001000	0.01503	1.408000	0.34668	0.263000	0.21812	-0.941000	0.02677	CGC		0.438	MTFR2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042378.2	NM_138419	
UST	10090	hgsc.bcm.edu	37	6	149395153	149395153	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:149395153G>A	ENST00000367463.4	+	8	1225	c.1122G>A	c.(1120-1122)agG>agA	p.R374R	UST_ENST00000466695.1_3'UTR	NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	374					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.R374R(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		CCCCCCTGAGGCCACACTTCT	0.478																																					p.R374R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1122A	6						.						104.0	103.0	103.0					6																	149395153		2203	4300	6503	149436846	SO:0001819	synonymous_variant	10090	exon8			AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.1122G>A	6.37:g.149395153G>A		Somatic		Capture	SOLID	Phase_I	149436846	NM_005715	B2RCX6	Silent	SNP	ENST00000367463.4	37	CCDS5213.1																																																																																				0.478	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715	
JARID2	3720	hgsc.bcm.edu	37	6	15520308	15520308	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:15520308T>G	ENST00000341776.2	+	18	3811	c.3567T>G	c.(3565-3567)atT>atG	p.I1189M	JARID2_ENST00000397311.3_Missense_Mutation_p.I1017M	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	1189					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.I1189M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AGGAACAGATTATCAGTCTGG	0.483																																					p.I1189M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3567G	6						.						72.0	63.0	66.0					6																	15520308		2203	4300	6503	15628287	SO:0001583	missense	3720	exon18			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.3567T>G	6.37:g.15520308T>G	ENSP00000341280:p.Ile1189Met	Somatic		Capture	SOLID	Phase_I	15628287	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	T	13.99	2.401405	0.42613	.	.	ENSG00000008083	ENST00000341776;ENST00000397311	D;D	0.88431	-2.38;-2.38	5.71	-5.44	0.02624	Zinc finger, C5HC2-type (1);	0.000000	0.85682	D	0.000000	D	0.82513	0.5053	N	0.24115	0.695	0.58432	D	0.999999	D	0.76494	0.999	D	0.87578	0.998	T	0.82602	-0.0376	10	0.72032	D	0.01	-12.6924	9.9818	0.41817	0.2233:0.5752:0.0:0.2015	.	1189	Q92833	JARD2_HUMAN	M	1189;1017	ENSP00000341280:I1189M;ENSP00000380478:I1017M	ENSP00000341280:I1189M	I	+	3	3	JARID2	15628287	0.447000	0.25673	0.770000	0.31555	0.994000	0.84299	-0.283000	0.08433	-1.035000	0.03291	0.533000	0.62120	ATT		0.483	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
TIAM2	26230	hgsc.bcm.edu	37	6	155450636	155450636	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:155450636G>A	ENST00000461783.3	+	6	1552	c.279G>A	c.(277-279)acG>acA	p.T93T	TIAM2_ENST00000529824.2_Silent_p.T93T|TIAM2_ENST00000318981.5_Silent_p.T93T|TIAM2_ENST00000456144.1_Silent_p.T93T|TIAM2_ENST00000360366.4_Silent_p.T93T|TIAM2_ENST00000367174.2_5'UTR			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	93					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T93T(2)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CCTACTCCACGCACAGGACAA	0.552																																					p.T93T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G279A	6						.						70.0	64.0	66.0					6																	155450636		2203	4300	6503	155492328	SO:0001819	synonymous_variant	26230	exon3				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.279G>A	6.37:g.155450636G>A		Somatic		Capture	SOLID	Phase_I	155492328	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Silent	SNP	ENST00000461783.3	37	CCDS34558.1																																																																																				0.552	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
WRNIP1	56897	hgsc.bcm.edu	37	6	2770357	2770357	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:2770357A>G	ENST00000380773.4	+	3	1227	c.1018A>G	c.(1018-1020)Act>Gct	p.T340A	WRNIP1_ENST00000380771.4_Intron|WRNIP1_ENST00000380769.4_Missense_Mutation_p.T120A|WRNIP1_ENST00000380764.1_5'UTR	NM_020135.2	NP_064520.2			Werner helicase interacting protein 1									p.T340A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				TGATTAGGACACTTTCCTTCC	0.488																																					p.T340A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1018G	6						.						129.0	110.0	116.0					6																	2770357		2203	4300	6503	2715356	SO:0001583	missense	56897	exon3			AB056152	CCDS4475.1, CCDS4476.1	6p25.2	2010-04-21			ENSG00000124535	ENSG00000124535		"""ATPases / AAA-type"""	20876	protein-coding gene	gene with protein product		608196				11301316	Standard	NM_020135		Approved	WHIP, FLJ22526, bA420G6.2	uc003mtz.3	Q96S55	OTTHUMG00000014126	ENST00000380773.4:c.1018A>G	6.37:g.2770357A>G	ENSP00000370150:p.Thr340Ala	Somatic		Capture	SOLID	Phase_I	2715356	NM_020135		Missense_Mutation	SNP	ENST00000380773.4	37	CCDS4475.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.480011	0.44044	.	.	ENSG00000124535	ENST00000380773;ENST00000380769	D;D	0.92545	-3.06;-3.06	6.06	6.06	0.98353	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.043683	0.85682	D	0.000000	T	0.68072	0.2961	N	0.02865	-0.47	0.80722	D	1	B	0.18013	0.025	B	0.24701	0.055	T	0.67906	-0.5549	10	0.02654	T	1	-7.4909	15.7938	0.78394	1.0:0.0:0.0:0.0	.	340	Q96S55	WRIP1_HUMAN	A	340;120	ENSP00000370150:T340A;ENSP00000370146:T120A	ENSP00000370146:T120A	T	+	1	0	WRNIP1	2715356	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.125000	0.94402	2.322000	0.78497	0.528000	0.53228	ACT		0.488	WRNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039641.1	NM_130395	
KDM1B	221656	hgsc.bcm.edu	37	6	18160180	18160180	+	Silent	SNP	G	G	A	rs201798497	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:18160180G>A	ENST00000297792.5	+	3	231	c.54G>A	c.(52-54)ccG>ccA	p.P18P	KDM1B_ENST00000388870.2_Silent_p.P18P|KDM1B_ENST00000397244.1_Silent_p.P18P|KDM1B_ENST00000546309.2_Intron			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	18					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)	p.P18P(1)		breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						ATCATTCTCCGGATAGCCTTC	0.398													G|||	2	0.000399361	0.0	0.0	5008	,	,		18972	0.0		0.002	False		,,,				2504	0.0				p.P18P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G54A	6						.	G		0,4406		0,0,2203	75.0	68.0	70.0		54	-9.4	0.9	6		70	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	KDM1B	NM_153042.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		18/591	18160180	2,13004	2203	4300	6503	18268159	SO:0001819	synonymous_variant	221656	exon3			AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.54G>A	6.37:g.18160180G>A		Somatic		Capture	SOLID	Phase_I	18268159	NM_153042	A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Silent	SNP	ENST00000297792.5	37	CCDS34343.1																																																																																				0.398	KDM1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277080.1	NM_153042	
RNF144B	255488	hgsc.bcm.edu	37	6	18457497	18457497	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:18457497G>A	ENST00000259939.3	+	5	760	c.443G>A	c.(442-444)tGc>tAc	p.C148Y	RNF144B_ENST00000429054.2_Missense_Mutation_p.C59Y	NM_182757.3	NP_877434.2	Q7Z419	R144B_HUMAN	ring finger protein 144B	148					apoptotic process (GO:0006915)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.C148Y(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(7)	11	Ovarian(93;0.00365)|Breast(50;0.0145)	all_hematologic(90;0.0536)	OV - Ovarian serous cystadenocarcinoma(7;0.00165)|all cancers(50;0.0102)|Epithelial(50;0.0105)			TGCCCTTCTTGCCACCTGAAA	0.552																																					p.C148Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G443A	6						.						316.0	276.0	289.0					6																	18457497		2203	4300	6503	18565476	SO:0001583	missense	255488	exon5			AK096832	CCDS34345.1	6p22.3	2011-05-23	2009-01-05	2007-08-20	ENSG00000137393	ENSG00000137393		"""RING-type (C3HC4) zinc fingers"""	21578	protein-coding gene	gene with protein product			"""IBR domain containing 2"""	IBRDC2			Standard	NM_182757		Approved	bA528A10.3	uc003ncs.3	Q7Z419	OTTHUMG00000014322	ENST00000259939.3:c.443G>A	6.37:g.18457497G>A	ENSP00000259939:p.Cys148Tyr	Somatic		Capture	SOLID	Phase_I	18565476	NM_182757	B3KUA8|B4DZI2|Q5TB85|Q6P4Q0|Q8N3R7|Q9BX38	Missense_Mutation	SNP	ENST00000259939.3	37	CCDS34345.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499857	0.85176	.	.	ENSG00000137393	ENST00000429054;ENST00000259939	D;D	0.98958	-5.27;-5.27	5.12	5.12	0.69794	Zinc finger, C6HC-type (2);	0.000000	0.85682	D	0.000000	D	0.99515	0.9827	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.98183	1.0458	9	.	.	.	.	18.9517	0.92643	0.0:0.0:1.0:0.0	.	148	Q7Z419	R144B_HUMAN	Y	59;148	ENSP00000411270:C59Y;ENSP00000259939:C148Y	.	C	+	2	0	RNF144B	18565476	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.361000	0.97122	2.530000	0.85305	0.609000	0.83330	TGC		0.552	RNF144B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039965.2	XM_172581	
SLC17A2	10246	hgsc.bcm.edu	37	6	25924123	25924123	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:25924123A>C	ENST00000265425.3	-	2	60	c.40T>G	c.(40-42)Tgt>Ggt	p.C14G	SLC17A2_ENST00000377850.3_Missense_Mutation_p.C14G|SLC17A2_ENST00000360488.3_Missense_Mutation_p.C14G			O00624	NPT3_HUMAN	solute carrier family 17, member 2	14					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.C14G(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						CGTAATGAACAGAAATCTGGA	0.453																																					p.C14G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T40G	6						.						134.0	127.0	129.0					6																	25924123		2203	4300	6503	26032102	SO:0001583	missense	10246	exon3			U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.40T>G	6.37:g.25924123A>C	ENSP00000265425:p.Cys14Gly	Somatic		Capture	SOLID	Phase_I	26032102	NM_005835	A6NK81|A6NLD6|Q5TB84|Q76P85	Missense_Mutation	SNP	ENST00000265425.3	37		.	.	.	.	.	.	.	.	.	.	A	19.78	3.891446	0.72524	.	.	ENSG00000112337	ENST00000360488;ENST00000377850;ENST00000265425	T;T;T	0.56776	0.44;0.44;0.44	5.11	5.11	0.69529	Major facilitator superfamily domain, general substrate transporter (1);	0.094606	0.47852	D	0.000205	T	0.59280	0.2182	L	0.60455	1.87	0.46478	D	0.999067	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.986;0.98;0.996	T	0.62680	-0.6803	10	0.54805	T	0.06	.	11.4964	0.50410	1.0:0.0:0.0:0.0	.	14;14;14	O00624;A6NK81;O00624-2	NPT3_HUMAN;.;.	G	14	ENSP00000353677:C14G;ENSP00000367081:C14G;ENSP00000265425:C14G	ENSP00000265425:C14G	C	-	1	0	SLC17A2	26032102	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	6.095000	0.71439	2.275000	0.75901	0.533000	0.62120	TGT		0.453	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040075.1		
BTN2A2	10385	hgsc.bcm.edu	37	6	26392754	26392754	+	Silent	SNP	C	C	T	rs375971811		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:26392754C>T	ENST00000356709.4	+	8	1242	c.1131C>T	c.(1129-1131)ttC>ttT	p.F377F	BTN2A2_ENST00000482536.1_Silent_p.F167F|BTN2A2_ENST00000416795.2_Silent_p.F377F|BTN2A2_ENST00000469230.1_Intron|BTN2A2_ENST00000352867.2_Silent_p.F261F|BTN2A2_ENST00000432533.2_3'UTR	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	377	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.F377F(1)		breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						GGGAGAGCTTCGCCTCAGGGA	0.587																																					p.F377F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1131T	6						.						135.0	125.0	128.0					6																	26392754		2203	4300	6503	26500733	SO:0001819	synonymous_variant	10385	exon8			U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.1131C>T	6.37:g.26392754C>T		Somatic		Capture	SOLID	Phase_I	26500733	NM_006995	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Silent	SNP	ENST00000356709.4	37	CCDS4606.1																																																																																				0.587	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040117.1		
ZKSCAN3	80317	hgsc.bcm.edu	37	6	28331522	28331522	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:28331522G>T	ENST00000377255.3	+	6	984	c.687G>T	c.(685-687)caG>caT	p.Q229H	ZKSCAN3_ENST00000252211.2_Missense_Mutation_p.Q229H|ZKSCAN3_ENST00000341464.5_Missense_Mutation_p.Q81H	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	229	KRAB.				autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q229H(1)		kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						AATGGACACAGCAGGATTCAT	0.473																																					p.Q229H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G687T	6						.						86.0	81.0	83.0					6																	28331522		2203	4300	6503	28439501	SO:0001583	missense	80317	exon5			U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.687G>T	6.37:g.28331522G>T	ENSP00000366465:p.Gln229His	Somatic		Capture	SOLID	Phase_I	28439501	NM_024493	B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Missense_Mutation	SNP	ENST00000377255.3	37	CCDS4650.1	.	.	.	.	.	.	.	.	.	.	.	8.845	0.943185	0.18281	.	.	ENSG00000189298	ENST00000252211;ENST00000341464;ENST00000377255	T;T;T	0.01933	4.55;4.55;4.55	2.98	1.6	0.23607	Krueppel-associated box (3);	.	.	.	.	T	0.01254	0.0041	L	0.31804	0.96	0.09310	N	1	P	0.50819	0.939	P	0.52267	0.694	T	0.53570	-0.8420	9	0.38643	T	0.18	.	7.9333	0.29914	0.1927:0.0:0.8073:0.0	.	229	Q9BRR0	ZKSC3_HUMAN	H	229;81;229	ENSP00000252211:Q229H;ENSP00000341883:Q81H;ENSP00000366465:Q229H	ENSP00000252211:Q229H	Q	+	3	2	ZKSCAN3	28439501	0.951000	0.32395	0.015000	0.15790	0.947000	0.59692	1.296000	0.33389	0.458000	0.26988	0.563000	0.77884	CAG		0.473	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040189.3	NM_024493	
TRIM26	7726	hgsc.bcm.edu	37	6	30166679	30166679	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:30166679C>T	ENST00000454678.2	-	4	638	c.202G>A	c.(202-204)Gtg>Atg	p.V68M	TRIM26_ENST00000487829.1_5'UTR|TRIM26_ENST00000453195.1_Missense_Mutation_p.V68M|TRIM26_ENST00000437089.1_Missense_Mutation_p.V68M	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	68					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.V68M(1)		lung(1)|ovary(2)	3						AGTTGCCACACGGGTCGGATG	0.622																																					p.V68M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G202A	6						.						73.0	70.0	71.0					6																	30166679		1509	2708	4217	30274658	SO:0001583	missense	7726	exon4			AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.202G>A	6.37:g.30166679C>T	ENSP00000410446:p.Val68Met	Somatic		Capture	SOLID	Phase_I	30274658	NM_003449	A6NG96|Q5SRL2	Missense_Mutation	SNP	ENST00000454678.2	37	CCDS4678.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951814	0.53186	.	.	ENSG00000234127	ENST00000453195;ENST00000454678;ENST00000437089;ENST00000416596;ENST00000420345;ENST00000418026;ENST00000434785	D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.26	5.26	0.73747	Zinc finger, RING/FYVE/PHD-type (1);	0.179052	0.27586	N	0.018705	T	0.80385	0.4613	N	0.08118	0	0.29629	N	0.845609	D	0.89917	1.0	D	0.79108	0.992	T	0.80801	-0.1220	10	0.87932	D	0	.	16.3887	0.83524	0.0:1.0:0.0:0.0	.	68	Q12899	TRI26_HUMAN	M	68	ENSP00000391879:V68M;ENSP00000410446:V68M;ENSP00000395491:V68M;ENSP00000413673:V68M;ENSP00000387530:V68M;ENSP00000400920:V68M	ENSP00000413673:V68M	V	-	1	0	TRIM26	30274658	0.968000	0.33430	0.981000	0.43875	0.344000	0.29017	1.973000	0.40550	2.457000	0.83068	0.643000	0.83706	GTG		0.622	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253442.1	NM_003449	
PPP1R10	5514	hgsc.bcm.edu	37	6	30572487	30572487	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:30572487C>T	ENST00000376511.2	-	12	1532	c.980G>A	c.(979-981)aGc>aAc	p.S327N		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	327	Interaction with TOX4. {ECO:0000250}.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)	p.S327N(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						TGGTTCTGTGCTCGTTTTCCC	0.537																																					p.S327N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G980A	6						.						302.0	294.0	297.0					6																	30572487		1511	2709	4220	30680466	SO:0001583	missense	5514	exon12			Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.980G>A	6.37:g.30572487C>T	ENSP00000365694:p.Ser327Asn	Somatic		Capture	SOLID	Phase_I	30680466	NM_002714	O00405	Missense_Mutation	SNP	ENST00000376511.2	37	CCDS4681.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.761592	0.31228	.	.	ENSG00000204569	ENST00000376511	T	0.46819	0.86	5.46	5.46	0.80206	.	0.499688	0.23801	N	0.044422	T	0.12263	0.0298	N	0.08118	0	0.33411	D	0.578596	P	0.37466	0.596	B	0.32211	0.142	T	0.07635	-1.0762	10	0.40728	T	0.16	-14.4655	9.5136	0.39091	0.1586:0.6881:0.1533:0.0	.	327	Q96QC0	PP1RA_HUMAN	N	327	ENSP00000365694:S327N	ENSP00000365694:S327N	S	-	2	0	PPP1R10	30680466	0.979000	0.34478	1.000000	0.80357	0.997000	0.91878	1.480000	0.35464	2.561000	0.86390	0.655000	0.94253	AGC		0.537	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2	NM_002714	
BAG6	7917	hgsc.bcm.edu	37	6	31610801	31610801	+	Silent	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:31610801G>T	ENST00000375964.6	-	14	2071	c.1758C>A	c.(1756-1758)ccC>ccA	p.P586P	BAG6_ENST00000470875.1_5'UTR|BAG6_ENST00000404765.2_Silent_p.P616P|BAG6_ENST00000362049.6_Silent_p.P580P|BAG6_ENST00000375976.4_Silent_p.P580P|BAG6_ENST00000439687.2_Intron|BAG6_ENST00000211379.5_Silent_p.P580P	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	586	4 X 29 AA approximate repeats.|Pro-rich.				brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)	p.P580P(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						CCCCAGGAGCGGGGCCAGCTG	0.652																																					p.P580P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1740A	6						.						18.0	21.0	20.0					6																	31610801		2195	4289	6484	31718780	SO:0001819	synonymous_variant	7917	exon14			M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.1758C>A	6.37:g.31610801G>T		Somatic		Capture	SOLID	Phase_I	31718780	NM_001098534	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Silent	SNP	ENST00000375964.6	37	CCDS47403.1																																																																																				0.652	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703	
C6orf10	10665	hgsc.bcm.edu	37	6	32337730	32337730	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:32337730A>G	ENST00000447241.2	-	2	216	c.44T>C	c.(43-45)cTg>cCg	p.L15P	C6orf10_ENST00000375007.4_Missense_Mutation_p.L15P|C6orf10_ENST00000527965.1_Missense_Mutation_p.L15P|C6orf10_ENST00000533191.1_Missense_Mutation_p.L15P|C6orf10_ENST00000442822.2_Missense_Mutation_p.L15P|C6orf10_ENST00000375015.4_Missense_Mutation_p.L15P	NM_006781.3	NP_006772.3	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10	15						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.L15P(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	25						GGCAAGTCCCAGTAGAGTCAG	0.383																																					p.L15P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T44C	6						.						171.0	181.0	177.0					6																	32337730		1510	2709	4219	32445708	SO:0001583	missense	10665	exon2			U60665	CCDS34422.1, CCDS69082.1, CCDS75430.1	6p21.32	2012-11-20			ENSG00000204296	ENSG00000204296			13922	protein-coding gene	gene with protein product	"""testis specific basic protein"""					10803852	Standard	XM_005248810		Approved	TSBP	uc021yvs.1	Q5SRN2	OTTHUMG00000031107	ENST00000447241.2:c.44T>C	6.37:g.32337730A>G	ENSP00000415517:p.Leu15Pro	Somatic		Capture	SOLID	Phase_I	32445708	NM_006781	A2BET1|A2BET2|A6NME2|B0S7R2|B0S7R3|E9PMB1|Q5SPI9|Q5SPJ0|Q5SPK9|Q5SPL0|Q5SRN3|Q5TG25|Q5TG26|Q8N4B6	Missense_Mutation	SNP	ENST00000447241.2	37	CCDS34422.1	.	.	.	.	.	.	.	.	.	.	A	15.98	2.992478	0.54041	.	.	ENSG00000204296	ENST00000442822;ENST00000447241;ENST00000375015;ENST00000533191;ENST00000527965;ENST00000375007;ENST00000375002;ENST00000305725;ENST00000532023;ENST00000534588	T;T;T;T;T;T;T;T	0.06068	3.35;3.35;3.35;3.35;3.35;3.35;3.35;3.35	4.57	4.57	0.56435	.	.	.	.	.	T	0.12092	0.0294	L	0.58101	1.795	0.52099	D	0.999945	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00456	-1.1728	9	0.87932	D	0	-9.7531	10.502	0.44810	1.0:0.0:0.0:0.0	.	15;15	E9PMB1;Q5SRN2	.;CF010_HUMAN	P	15;15;15;15;15;15;15;14;15;15	ENSP00000411164:L15P;ENSP00000415517:L15P;ENSP00000364155:L15P;ENSP00000431199:L15P;ENSP00000435103:L15P;ENSP00000364146:L15P;ENSP00000432814:L15P;ENSP00000432566:L15P	ENSP00000303292:L14P	L	-	2	0	C6orf10	32445708	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	3.611000	0.54132	2.022000	0.59522	0.523000	0.50628	CTG		0.383	C6orf10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076178.4	NM_006781	
TAP2	6891	hgsc.bcm.edu	37	6	32805412	32805412	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:32805412A>G	ENST00000452392.2	-	3	683	c.510T>C	c.(508-510)ccT>ccC	p.P170P	TAP2_ENST00000374897.2_Silent_p.P170P|TAP2_ENST00000374899.4_Silent_p.P170P			Q9UDX4	S14L3_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.P170P(1)								Vitamin E(DB00163)	CAGAATAGTGAGGGATTAATG	0.493																																					p.P170P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T510C	6						.						85.0	75.0	78.0					6																	32805412		2203	4300	6503	32913390	SO:0001819	synonymous_variant	6891	exon3			M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267		"""ATP binding cassette transporters / subfamily B"""	44	protein-coding gene	gene with protein product		170261		ABCB3		1529427, 1946428, 16395595	Standard	NM_001290043		Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000452392.2:c.510T>C	6.37:g.32805412A>G		Somatic		Capture	SOLID	Phase_I	32913390	NM_018833	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Silent	SNP	ENST00000452392.2	37																																																																																					0.493	TAP2-001	NOVEL	mRNA_end_NF|cds_end_NF|basic|appris_principal|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000361828.1	NM_000544	
ITPR3	3710	hgsc.bcm.edu	37	6	33638205	33638205	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:33638205G>A	ENST00000374316.5	+	20	3353	c.2293G>A	c.(2293-2295)Gca>Aca	p.A765T	ITPR3_ENST00000605930.1_Missense_Mutation_p.A765T			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	765					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.A765T(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CCTGTGCATGGCAGACGAGAT	0.622																																					p.A765T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2293A	6						.						141.0	125.0	130.0					6																	33638205		2203	4300	6503	33746183	SO:0001583	missense	3710	exon19			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.2293G>A	6.37:g.33638205G>A	ENSP00000363435:p.Ala765Thr	Somatic		Capture	SOLID	Phase_I	33746183	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639612	0.67244	.	.	ENSG00000096433	ENST00000374316	D	0.91843	-2.92	4.81	4.81	0.61882	.	0.110679	0.64402	D	0.000009	D	0.86669	0.5988	L	0.61218	1.895	0.43485	D	0.995716	B	0.34241	0.444	B	0.33454	0.164	D	0.88419	0.3027	10	0.56958	D	0.05	-16.5436	12.9153	0.58203	0.0:0.0:0.8376:0.1624	.	765	Q14573	ITPR3_HUMAN	T	765	ENSP00000363435:A765T	ENSP00000363435:A765T	A	+	1	0	ITPR3	33746183	1.000000	0.71417	0.994000	0.49952	0.966000	0.64601	4.150000	0.58098	2.209000	0.71365	0.563000	0.77884	GCA		0.622	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
SCUBE3	222663	hgsc.bcm.edu	37	6	35200998	35200998	+	Missense_Mutation	SNP	C	C	T	rs369592922		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:35200998C>T	ENST00000274938.7	+	6	632	c.632C>T	c.(631-633)aCg>aTg	p.T211M	SCUBE3_ENST00000394681.1_Missense_Mutation_p.T211M	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3									p.T211M(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						TGCCAGCACACGTGTGATGAC	0.582																																					p.T211M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C632T	6						.		MET/THR	0,4406		0,0,2203	47.0	41.0	43.0		632	5.2	1.0	6		43	4,8596	3.7+/-12.6	0,4,4296	no	missense	SCUBE3	NM_152753.2	81	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	probably-damaging	211/994	35200998	4,13002	2203	4300	6503	35308976	SO:0001583	missense	222663	exon6			AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.632C>T	6.37:g.35200998C>T	ENSP00000274938:p.Thr211Met	Somatic		Capture	SOLID	Phase_I	35308976	NM_152753		Missense_Mutation	SNP	ENST00000274938.7	37	CCDS4800.1	.	.	.	.	.	.	.	.	.	.	c	19.05	3.752385	0.69533	0.0	4.65E-4	ENSG00000146197	ENST00000394681;ENST00000274938	T;D	0.95821	1.53;-3.82	5.25	5.25	0.73442	Epidermal growth factor-like (1);	0.059824	0.64402	D	0.000002	D	0.96306	0.8795	M	0.80028	2.48	0.44595	D	0.997566	D;D	0.59357	0.985;0.974	P;P	0.52309	0.695;0.499	D	0.96010	0.9001	10	0.52906	T	0.07	.	18.8459	0.92205	0.0:1.0:0.0:0.0	.	211;211	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	M	211	ENSP00000378174:T211M;ENSP00000274938:T211M	ENSP00000274938:T211M	T	+	2	0	SCUBE3	35308976	1.000000	0.71417	0.962000	0.40283	0.594000	0.36715	4.781000	0.62389	2.448000	0.82819	0.543000	0.68304	ACG		0.582	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
DEF6	50619	hgsc.bcm.edu	37	6	35287674	35287674	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:35287674G>A	ENST00000316637.5	+	9	1466	c.1461G>A	c.(1459-1461)gcG>gcA	p.A487A	DEF6_ENST00000542066.1_Silent_p.A232A	NM_022047.3	NP_071330.3	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog (mouse)	487	Glu-rich.					cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A487A(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	15						TCGAACGGGCGCAGCAGGAGA	0.617																																					p.A487A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1461A	6						.						30.0	28.0	29.0					6																	35287674		2193	4293	6486	35395652	SO:0001819	synonymous_variant	50619	exon9			AJ276095	CCDS4802.1	6p21.33-p21.1	2013-01-10	2001-11-28		ENSG00000023892	ENSG00000023892		"""Pleckstrin homology (PH) domain containing"""	2760	protein-coding gene	gene with protein product	"""SWAP-70-like adaptor protein of T cells"""	610094	"""differentially expressed in FDCP (mouse homolog) 6"""			19251698	Standard	NM_022047		Approved	IBP, SLAT, SWAP70L	uc003okk.3	Q9H4E7	OTTHUMG00000014563	ENST00000316637.5:c.1461G>A	6.37:g.35287674G>A		Somatic		Capture	SOLID	Phase_I	35395652	NM_022047	Q86VF4	Silent	SNP	ENST00000316637.5	37	CCDS4802.1																																																																																				0.617	DEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040276.1	NM_022047	
CPNE5	57699	hgsc.bcm.edu	37	6	36759847	36759847	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:36759847G>A	ENST00000244751.2	-	8	1115	c.491C>T	c.(490-492)aCc>aTc	p.T164I		NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	164	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)		p.T164I(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						CAGGATGATGGTGCCACATTT	0.552																																					p.T164I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C491T	6						.						139.0	111.0	121.0					6																	36759847		2203	4300	6503	36867825	SO:0001583	missense	57699	exon8			H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.491C>T	6.37:g.36759847G>A	ENSP00000244751:p.Thr164Ile	Somatic		Capture	SOLID	Phase_I	36867825	NM_020939	Q7Z6C8	Missense_Mutation	SNP	ENST00000244751.2	37	CCDS4825.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598784	0.46318	.	.	ENSG00000124772	ENST00000244751	T	0.41065	1.01	5.16	5.16	0.70880	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.113154	0.64402	D	0.000015	T	0.25457	0.0619	L	0.58810	1.83	0.80722	D	1	B	0.12630	0.006	B	0.15484	0.013	T	0.19943	-1.0290	10	0.62326	D	0.03	.	10.0232	0.42055	0.0929:0.0:0.9071:0.0	.	164	Q9HCH3	CPNE5_HUMAN	I	164	ENSP00000244751:T164I	ENSP00000244751:T164I	T	-	2	0	CPNE5	36867825	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.644000	0.54381	2.551000	0.86045	0.561000	0.74099	ACC		0.552	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	NM_020939	
POLH	5429	hgsc.bcm.edu	37	6	43565581	43565581	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:43565581A>G	ENST00000372236.4	+	5	934	c.639A>G	c.(637-639)tcA>tcG	p.S213S	POLH_ENST00000535400.1_Silent_p.S151S|POLH_ENST00000372226.1_Silent_p.S213S	NM_006502.2	NP_006493.1	O75417	DPOLQ_HUMAN	polymerase (DNA directed), eta	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.S213S(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			TTCAGTGTTCAGCTGGAATTT	0.438								DNA polymerases (catalytic subunits)	Xeroderma Pigmentosum																												p.S213S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A639G	6						.						113.0	120.0	117.0					6																	43565581		2203	4300	6503	43673559	SO:0001819	synonymous_variant	5429	exon5	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AB024313	CCDS4902.1	6p21	2014-09-17			ENSG00000170734	ENSG00000170734			9181	protein-coding gene	gene with protein product		603968				10385124, 10398605	Standard	NM_006502		Approved	RAD30A, XP-V	uc003ovq.4	Q9Y253	OTTHUMG00000014743	ENST00000372236.4:c.639A>G	6.37:g.43565581A>G		Somatic		Capture	SOLID	Phase_I	43673559	NM_006502	O95160|Q6VMB5	Silent	SNP	ENST00000372236.4	37	CCDS4902.1																																																																																				0.438	POLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040666.1	NM_006502	
SPATS1	221409	hgsc.bcm.edu	37	6	44344776	44344776	+	Silent	SNP	T	T	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:44344776T>A	ENST00000288390.2	+	8	1226	c.879T>A	c.(877-879)gcT>gcA	p.A293A	RP11-444E17.6_ENST00000505802.1_3'UTR|SPATS1_ENST00000323108.8_Silent_p.A293A			Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1	293								p.A293A(1)		NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(5)|skin(1)|urinary_tract(1)	14	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCACAGGTGCTTTGGACTTTC	0.438																																					p.A293A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T879A	6						.						142.0	130.0	134.0					6																	44344776		2203	4300	6503	44452754	SO:0001819	synonymous_variant	221409	exon9			AK058171	CCDS4911.1	6p21.1	2003-08-08			ENSG00000249481	ENSG00000249481			22957	protein-coding gene	gene with protein product							Standard	NM_145026		Approved	SPATA8, FLJ25442, SRSP1	uc021yzz.1	Q496A3	OTTHUMG00000014764	ENST00000288390.2:c.879T>A	6.37:g.44344776T>A		Somatic		Capture	SOLID	Phase_I	44452754	NM_145026	Q496A2|Q496A5|Q96LJ0	Silent	SNP	ENST00000288390.2	37	CCDS4911.1																																																																																				0.438	SPATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040738.2	NM_145026	
TDRD6	221400	hgsc.bcm.edu	37	6	46658677	46658677	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:46658677G>T	ENST00000316081.6	+	1	2812	c.2812G>T	c.(2812-2814)Gtg>Ttg	p.V938L	RP11-446F17.3_ENST00000434329.2_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.V938L	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	938					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)		p.V938L(1)		NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GTTTAACATTGTGGATTTGCT	0.353																																					p.V938L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2812T	6						.						77.0	84.0	82.0					6																	46658677		2203	4300	6503	46766636	SO:0001583	missense	221400	exon1			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2812G>T	6.37:g.46658677G>T	ENSP00000346065:p.Val938Leu	Somatic		Capture	SOLID	Phase_I	46766636	NM_001010870	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604315	0.66445	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.21031	2.03;2.15	5.74	5.74	0.90152	.	0.115346	0.64402	D	0.000015	T	0.47488	0.1448	M	0.86178	2.8	0.58432	D	0.99999	D;D	0.76494	0.999;0.999	D;D	0.91635	0.991;0.999	T	0.49523	-0.8931	10	0.54805	T	0.06	-14.5625	19.918	0.97070	0.0:0.0:1.0:0.0	.	938;938	F5H5M3;O60522	.;TDRD6_HUMAN	L	938	ENSP00000443299:V938L;ENSP00000346065:V938L	ENSP00000346065:V938L	V	+	1	0	TDRD6	46766636	1.000000	0.71417	0.962000	0.40283	0.417000	0.31264	9.434000	0.97515	2.706000	0.92434	0.650000	0.86243	GTG		0.353	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
MYO6	4646	hgsc.bcm.edu	37	6	76596598	76596598	+	Nonsense_Mutation	SNP	C	C	T	rs121912561		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:76596598C>T	ENST00000369977.3	+	25	2684	c.2545C>T	c.(2545-2547)Cga>Tga	p.R849*	MYO6_ENST00000369985.4_Nonsense_Mutation_p.R849*|MYO6_ENST00000369975.1_Nonsense_Mutation_p.R849*|MYO6_ENST00000369981.3_Nonsense_Mutation_p.R849*	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	849					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)	p.R849*(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		ACTGAAAAAACGACTTGATAA	0.328																																					p.R849X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2545T	6	GRCh37	CM081348	MYO6	M	rs121912561	.						85.0	90.0	88.0					6																	76596598		2203	4300	6503	76653318	SO:0001587	stop_gained	4646	exon25			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2545C>T	6.37:g.76596598C>T	ENSP00000358994:p.Arg849*	Somatic		Capture	SOLID	Phase_I	76653318	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Nonsense_Mutation	SNP	ENST00000369977.3	37	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	C	39	7.810118	0.98501	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	.	.	.	5.93	3.97	0.46021	.	0.055156	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	13.9327	0.64006	0.4184:0.5816:0.0:0.0	.	.	.	.	X	849	.	ENSP00000358992:R849X	R	+	1	2	MYO6	76653318	1.000000	0.71417	0.995000	0.50966	0.398000	0.30690	1.497000	0.35649	1.491000	0.48482	0.655000	0.94253	CGA		0.328	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
PSMB1	5689	hgsc.bcm.edu	37	6	170858120	170858120	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr6:170858120C>T	ENST00000262193.6	-	2	293	c.195G>A	c.(193-195)acG>acA	p.T65T	PSMB1_ENST00000462957.1_5'UTR	NM_002793.3	NP_002784.1	P20618	PSB1_HUMAN	proteasome (prosome, macropain) subunit, beta type, 1	65					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)	p.T65T(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	Bortezomib(DB00188)|Carfilzomib(DB08889)	GGCTATCCCGCGTATGAATTG	0.338																																					p.T65T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G195A	6						.						77.0	77.0	77.0					6																	170858120		2203	4300	6503	170700045	SO:0001819	synonymous_variant	5689	exon2			D00761	CCDS34577.1	6q27	2008-02-05			ENSG00000008018	ENSG00000008018		"""Proteasome (prosome, macropain) subunits"""	9537	protein-coding gene	gene with protein product		602017				2025653	Standard	NM_002793		Approved	PMSB1, HC5	uc011ehe.2	P20618	OTTHUMG00000016087	ENST00000262193.6:c.195G>A	6.37:g.170858120C>T		Somatic		Capture	SOLID	Phase_I	170700045	NM_002793	B5BU76|Q9BWA8	Silent	SNP	ENST00000262193.6	37	CCDS34577.1																																																																																				0.338	PSMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043278.2	NM_002793	
DNAH9	1770	hgsc.bcm.edu	37	17	11809112	11809112	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:11809112A>G	ENST00000262442.4	+	61	11803	c.11735A>G	c.(11734-11736)gAt>gGt	p.D3912G	DNAH9_ENST00000454412.2_Missense_Mutation_p.D3912G|DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000608377.1_Missense_Mutation_p.D224G	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3912	AAA 6. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.D3912G(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CCACTGAAGGATGTAGAAAGT	0.493																																					p.D224G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A671G	17						.						63.0	60.0	61.0					17																	11809112		2203	4300	6503	11749837	SO:0001583	missense	1770	exon7			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11735A>G	17.37:g.11809112A>G	ENSP00000262442:p.Asp3912Gly	Somatic		Capture	SOLID	Phase_I	11749837	NM_004662	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.168334	0.78339	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001;ENST00000361801	T;T;T	0.09163	3.01;3.01;3.01	4.81	4.81	0.61882	Dynein heavy chain (1);	0.243643	0.48286	D	0.000190	T	0.34745	0.0908	M	0.81112	2.525	0.80722	D	1	D;D	0.69078	0.993;0.997	D;D	0.73708	0.94;0.981	T	0.20174	-1.0283	10	0.87932	D	0	.	14.8087	0.69977	1.0:0.0:0.0:0.0	.	265;3912	B7Z7H0;Q9NYC9	.;DYH9_HUMAN	G	3912;3912;2494;224;265	ENSP00000262442:D3912G;ENSP00000414874:D3912G;ENSP00000379323:D224G	ENSP00000262442:D3912G	D	+	2	0	DNAH9	11749837	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	9.087000	0.94110	2.153000	0.67306	0.533000	0.62120	GAT		0.493	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
SPECC1	92521	hgsc.bcm.edu	37	17	20109083	20109083	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:20109083C>T	ENST00000261503.5	+	4	1772	c.1721C>T	c.(1720-1722)aCg>aTg	p.T574M	SPECC1_ENST00000395522.2_Missense_Mutation_p.T493M|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000395527.4_Missense_Mutation_p.T574M|SPECC1_ENST00000395529.3_Missense_Mutation_p.T574M|SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395530.2_Missense_Mutation_p.T493M|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395525.3_Missense_Mutation_p.T493M|SPECC1_ENST00000472876.1_Intron	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	574					cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.T574M(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		GTGGAGCAGACGGCAGAGAGC	0.463																																					p.T493M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1478T	17						.						69.0	71.0	70.0					17																	20109083		2203	4300	6503	20049675	SO:0001583	missense	92521	exon2			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.1721C>T	17.37:g.20109083C>T	ENSP00000261503:p.Thr574Met	Somatic		Capture	SOLID	Phase_I	20049675	NM_001033555	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	c	1.324	-0.598736	0.03744	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.63744	-0.06;2.94;2.94;2.94	5.59	-11.2	0.00127	.	0.776014	0.13105	N	0.413497	T	0.29749	0.0743	N	0.13043	0.29	0.09310	N	1	B;B;B;B;B	0.19583	0.002;0.037;0.015;0.004;0.017	B;B;B;B;B	0.12837	0.001;0.008;0.005;0.002;0.004	T	0.05115	-1.0905	10	0.33940	T	0.23	-0.2262	4.4285	0.11515	0.0921:0.2221:0.1665:0.5192	.	574;493;493;574;574	A8MV89;Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;.;CYTSB_HUMAN	M	574;574;574;493;493;493	ENSP00000261503:T574M;ENSP00000378900:T574M;ENSP00000378893:T493M;ENSP00000378896:T493M	ENSP00000261503:T574M	T	+	2	0	SPECC1	20049675	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.249000	0.08842	-2.450000	0.00543	-2.933000	0.00087	ACG		0.463	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
RNF135	84282	hgsc.bcm.edu	37	17	29315123	29315123	+	Splice_Site	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:29315123G>T	ENST00000328381.5	+	3	1551	c.678G>T	c.(676-678)caG>caT	p.Q226H	RNF135_ENST00000535306.2_Splice_Site_p.Q226H|RNF135_ENST00000324689.4_Intron|RNF135_ENST00000443677.2_Intron	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135	226					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q226H(1)|p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				CACAAATGCAGGGTGAGCTGA	0.448																																					p.Q226H												.	.	2	Substitution - Missense(1)|Unknown(1)	large_intestine(1)|central_nervous_system(1)	c.G678T	17						.						40.0	38.0	39.0					17																	29315123		2203	4300	6503	26339249	SO:0001630	splice_region_variant	84282	exon3			AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.679+1G>T	17.37:g.29315123G>T		Somatic		Capture	SOLID	Phase_I	26339249	NM_001184992	A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	Missense_Mutation	SNP	ENST00000328381.5	37	CCDS11262.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.15|15.15	2.748593|2.748593	0.49257|0.49257	.|.	.|.	ENSG00000181481|ENSG00000181481	ENST00000328381;ENST00000535306;ENST00000535605|ENST00000434242	T;T|.	0.58060|.	0.36;2.42|.	4.26|4.26	1.02|1.02	0.19986|0.19986	.|.	0.889113|.	0.09418|.	N|.	0.804867|.	T|T	0.35682|0.35682	0.0940|0.0940	L|L	0.47716|0.47716	1.5|1.5	0.23227|0.23227	N|N	0.998082|0.998082	D;D|.	0.64830|.	0.994;0.991|.	P;P|.	0.61874|.	0.895;0.753|.	T|T	0.26710|0.26710	-1.0095|-1.0095	10|5	0.48119|.	T|.	0.1|.	-2.2396|-2.2396	4.7073|4.7073	0.12856|0.12856	0.1037:0.0:0.5098:0.3866|0.1037:0.0:0.5098:0.3866	.|.	226;226|.	F5GX60;Q8IUD6|.	.;RN135_HUMAN|.	H|M	226;226;45|10	ENSP00000328340:Q226H;ENSP00000440470:Q226H|.	ENSP00000328340:Q226H|.	Q|R	+|+	3|2	2|0	RNF135|RNF135	26339249|26339249	0.890000|0.890000	0.30428|0.30428	0.345000|0.345000	0.25642|0.25642	0.089000|0.089000	0.18198|0.18198	1.144000|1.144000	0.31565|0.31565	0.277000|0.277000	0.22141|0.22141	0.655000|0.655000	0.94253|0.94253	CAG|AGG		0.448	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256342.3	NM_032322	Missense_Mutation
CCL15	6359	hgsc.bcm.edu	37	17	34324848	34324848	+	Silent	SNP	C	C	A	rs375475844		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:34324848C>A	ENST00000354059.4	-	4	849	c.297G>T	c.(295-297)ccG>ccT	p.P99P	CCL14_ENST00000536149.1_5'UTR|CCL15-CCL14_ENST00000481427.2_Silent_p.P99P	NM_032965.4	NP_116741.1	Q16663	CCL15_HUMAN	chemokine (C-C motif) ligand 15	99					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive chemotaxis (GO:0050918)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.P99P(1)		large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCTGAACTCCCGGACCACTGG	0.498																																					p.P99P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G297T	17						.						72.0	70.0	71.0					17																	34324848		2203	4300	6503	31348961	SO:0001819	synonymous_variant	6359	exon4			AF031587	CCDS11304.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000267596	ENSG00000275718		"""Chemokine ligands"", ""Endogenous ligands"""	10613	protein-coding gene	gene with protein product	"""leukotactin 1"", ""CC chemokine 3"", ""macrophage inflammatory protein 5"", ""chemokine CC-2"", ""MIP-1 delta"""	601393	"""small inducible cytokine subfamily A (Cys-Cys), member 15"""	SCYA15		8661057	Standard	NM_032965		Approved	HCC-2, NCC-3, SCYL3, MIP-5, Lkn-1, MIP-1d, HMRP-2B	uc010wcu.2	Q16663	OTTHUMG00000188406	ENST00000354059.4:c.297G>T	17.37:g.34324848C>A		Somatic		Capture	SOLID	Phase_I	31348961	NM_032965	B2RU34|E1P651|Q9UM74	Silent	SNP	ENST00000354059.4	37	CCDS11304.1	.	.	.	.	.	.	.	.	.	.	C	3.635	-0.074660	0.07184	.	.	ENSG00000161574	ENST00000394506	.	.	.	4.72	-6.59	0.01830	.	.	.	.	.	T	0.15089	0.0364	.	.	.	0.20307	N	0.999918	.	.	.	.	.	.	T	0.27297	-1.0078	4	.	.	.	.	0.1036	0.00050	0.2569:0.1906:0.2276:0.3249	.	.	.	.	L	47	.	.	R	-	2	0	CCL15	31348961	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.491000	0.02302	-0.901000	0.03891	-0.964000	0.02622	CGG		0.498	CCL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256584.2	NM_004167	
CDK12	51755	hgsc.bcm.edu	37	17	37650932	37650932	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:37650932T>G	ENST00000447079.4	+	5	2437	c.2404T>G	c.(2404-2406)Ttc>Gtc	p.F802V	CDK12_ENST00000430627.2_Missense_Mutation_p.F802V	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	802	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.F802V(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						tgcactggatttcaagaagGA	0.348			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																											p.F802V			Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2404G	17						.						44.0	38.0	40.0					17																	37650932		2203	4297	6500	34904458	SO:0001583	missense	51755	exon5			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.2404T>G	17.37:g.37650932T>G	ENSP00000398880:p.Phe802Val	Somatic		Capture	SOLID	Phase_I	34904458	NM_016507	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	T	19.11	3.764063	0.69878	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.73363	-0.74;-0.74	4.69	4.69	0.59074	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.142024	0.33732	N	0.004608	T	0.80226	0.4584	L	0.38733	1.17	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.997;0.997;0.994	T	0.82619	-0.0368	10	0.87932	D	0	-9.0901	14.1124	0.65129	0.0:0.0:0.0:1.0	.	801;802;802	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	V	802	ENSP00000407720:F802V;ENSP00000398880:F802V	ENSP00000407720:F802V	F	+	1	0	CDK12	34904458	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.962000	0.87912	1.869000	0.54173	0.459000	0.35465	TTC		0.348	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
ERBB2	2064	hgsc.bcm.edu	37	17	37883787	37883787	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:37883787C>T	ENST00000269571.5	+	26	3558	c.3399C>T	c.(3397-3399)tgC>tgT	p.C1133C	ERBB2_ENST00000584601.1_Silent_p.C1103C|ERBB2_ENST00000406381.2_Silent_p.C1103C|ERBB2_ENST00000540147.1_Silent_p.C1103C|ERBB2_ENST00000541774.1_Silent_p.C1118C|MIEN1_ENST00000474210.1_5'Flank|ERBB2_ENST00000584450.1_Intron|ERBB2_ENST00000445658.2_Silent_p.C857C|MIR4728_ENST00000580969.1_RNA			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	1133					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.C1133C(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CCCTGACCTGCAGCCCCCAGC	0.642		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.C1103C			Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3309T	17						.						58.0	58.0	58.0					17																	37883787		2203	4300	6503	35137313	SO:0001819	synonymous_variant	2064	exon29			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.3399C>T	17.37:g.37883787C>T		Somatic		Capture	SOLID	Phase_I	35137313	NM_001005862	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Silent	SNP	ENST00000269571.5	37	CCDS32642.1																																																																																				0.642	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
IKZF3	22806	hgsc.bcm.edu	37	17	37947749	37947749	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:37947749T>C	ENST00000346872.3	-	5	573	c.512A>G	c.(511-513)gAa>gGa	p.E171G	IKZF3_ENST00000377952.2_Intron|IKZF3_ENST00000467757.1_Intron|IKZF3_ENST00000377958.2_Missense_Mutation_p.E84G|IKZF3_ENST00000350532.3_Missense_Mutation_p.E171G|IKZF3_ENST00000535189.1_Missense_Mutation_p.E137G|IKZF3_ENST00000377945.3_Intron|IKZF3_ENST00000439016.2_Intron|IKZF3_ENST00000377944.3_Intron|IKZF3_ENST00000394189.2_Intron|IKZF3_ENST00000439167.2_Missense_Mutation_p.E137G|IKZF3_ENST00000346243.3_Missense_Mutation_p.E171G|IKZF3_ENST00000351680.3_Missense_Mutation_p.E171G	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	171					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E171G(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			AAAAGGTTTTTCCCCTGTGTG	0.463																																					p.E171G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A512G	17						.						188.0	175.0	180.0					17																	37947749		2203	4300	6503	35201275	SO:0001583	missense	22806	exon5			AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.512A>G	17.37:g.37947749T>C	ENSP00000344544:p.Glu171Gly	Somatic		Capture	SOLID	Phase_I	35201275	NM_183230	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Missense_Mutation	SNP	ENST00000346872.3	37	CCDS11346.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.9|24.9	4.578311|4.578311	0.86645|0.86645	.|.	.|.	ENSG00000161405|ENSG00000161405	ENST00000488188;ENST00000377958;ENST00000535189;ENST00000351680;ENST00000346243;ENST00000350532|ENST00000439167;ENST00000439016	T;T;T;T;T|.	0.27557|.	1.66;1.66;1.66;1.66;1.66|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.64402|.	D|.	0.000018|.	T|T	0.79221|0.79221	0.4409|0.4409	M|M	0.84773|0.84773	2.715|2.715	0.80722|0.80722	D|D	1|1	P;D;D;D;D;D;D|.	0.89917|.	0.837;1.0;1.0;1.0;1.0;1.0;1.0|.	P;D;D;D;D;D;D|.	0.97110|.	0.547;1.0;0.997;1.0;0.999;0.994;1.0|.	T|T	0.81553|0.81553	-0.0880|-0.0880	10|5	0.59425|.	D|.	0.04|.	-18.4138|-18.4138	16.1617|16.1617	0.81721|0.81721	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	84;137;171;171;171;137;171|.	Q9UKT9-9;Q9UKT9-7;Q9UKT9-6;Q9UKT9-4;Q9UKT9-3;Q9UKT9-8;Q9UKT9|.	.;.;.;.;.;.;IKZF3_HUMAN|.	G|E	171;84;137;171;171;171|125	ENSP00000367194:E84G;ENSP00000438972:E137G;ENSP00000345622:E171G;ENSP00000341977:E171G;ENSP00000344471:E171G|.	ENSP00000341977:E171G|.	E|K	-|-	2|1	0|0	IKZF3|IKZF3	35201275|35201275	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.997000|7.997000	0.88414|0.88414	2.275000|2.275000	0.75901|0.75901	0.528000|0.528000	0.53228|0.53228	GAA|AAA		0.463	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2	NM_012481	
CNTNAP1	8506	hgsc.bcm.edu	37	17	40845501	40845501	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:40845501A>G	ENST00000264638.4	+	18	3156	c.2939A>G	c.(2938-2940)tAc>tGc	p.Y980C	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	980	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.Y980C(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CGCTATAGCTACTACACGTGT	0.587																																					p.Y980C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2939G	17						.						113.0	106.0	109.0					17																	40845501		2203	4300	6503	38099027	SO:0001583	missense	8506	exon18			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.2939A>G	17.37:g.40845501A>G	ENSP00000264638:p.Tyr980Cys	Somatic		Capture	SOLID	Phase_I	38099027	NM_003632		Missense_Mutation	SNP	ENST00000264638.4	37	CCDS11436.1	.	.	.	.	.	.	.	.	.	.	A	15.92	2.975896	0.53720	.	.	ENSG00000108797	ENST00000264638	T	0.76186	-1.0	5.69	5.69	0.88448	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like, type 3 (1);	0.094387	0.45606	D	0.000345	T	0.71039	0.3293	N	0.14661	0.345	0.33771	D	0.623113	P	0.49358	0.923	P	0.53146	0.719	T	0.81088	-0.1091	10	0.66056	D	0.02	.	15.9478	0.79806	1.0:0.0:0.0:0.0	.	980	P78357	CNTP1_HUMAN	C	980	ENSP00000264638:Y980C	ENSP00000264638:Y980C	Y	+	2	0	CNTNAP1	38099027	0.901000	0.30685	1.000000	0.80357	0.994000	0.84299	2.699000	0.47077	2.165000	0.68154	0.459000	0.35465	TAC		0.587	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632	
VPS25	84313	hgsc.bcm.edu	37	17	40925794	40925794	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:40925794T>C	ENST00000253794.2	+	2	137	c.97T>C	c.(97-99)Tgg>Cgg	p.W33R		NM_032353.2	NP_115729.1	Q9BRG1	VPS25_HUMAN	vacuolar protein sorting 25 homolog (S. cerevisiae)	33					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.W33R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)	5		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		GCTGGCCGCCTGGTGCTCGCT	0.612																																					p.W33R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T97C	17						.						76.0	80.0	79.0					17																	40925794		2203	4300	6503	38179320	SO:0001583	missense	84313	exon2			AB014763	CCDS11438.1	17q21.31	2014-02-12	2006-04-04		ENSG00000131475	ENSG00000131475			28122	protein-coding gene	gene with protein product		610907	"""vacuolar protein sorting 25 (yeast)"""			15511219	Standard	NM_032353		Approved	MGC10540, EAP20, DERP9	uc002ibi.3	Q9BRG1		ENST00000253794.2:c.97T>C	17.37:g.40925794T>C	ENSP00000253794:p.Trp33Arg	Somatic		Capture	SOLID	Phase_I	38179320	NM_032353	B2R581	Missense_Mutation	SNP	ENST00000253794.2	37	CCDS11438.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.985729	0.93044	.	.	ENSG00000131475	ENST00000253794	D	0.82344	-1.6	5.5	5.5	0.81552	ESCRT-II complex, Vps25 subunit, N-terminal winged helix (1);	0.000000	0.85682	D	0.000000	D	0.93700	0.7987	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95437	0.8522	10	0.87932	D	0	-9.3185	15.253	0.73561	0.0:0.0:0.0:1.0	.	33	Q9BRG1	VPS25_HUMAN	R	33	ENSP00000253794:W33R	ENSP00000253794:W33R	W	+	1	0	VPS25	38179320	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.405000	0.80007	2.088000	0.63022	0.533000	0.62120	TGG		0.612	VPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452383.1	NM_032353	
WNK4	65266	hgsc.bcm.edu	37	17	40934802	40934802	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:40934802G>A	ENST00000246914.5	+	2	666	c.645G>A	c.(643-645)cgG>cgA	p.R215R		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	215	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)	p.R215R(1)|p.R203R(1)		NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		GAGCTGAGCGGCAGCGCTTCT	0.602																																					p.R215R	Esophageal Squamous(6;201 374 4964 23855 42828)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G645A	17						.						68.0	59.0	62.0					17																	40934802		2203	4300	6503	38188328	SO:0001819	synonymous_variant	65266	exon2			AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.645G>A	17.37:g.40934802G>A		Somatic		Capture	SOLID	Phase_I	38188328	NM_032387	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Silent	SNP	ENST00000246914.5	37	CCDS11439.1																																																																																				0.602	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1		
G6PC3	92579	hgsc.bcm.edu	37	17	42151630	42151630	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:42151630T>C	ENST00000269097.4	+	2	552	c.321T>C	c.(319-321)ggT>ggC	p.G107G		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	107					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)	p.G107G(1)		endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GTGAGACTGGTCCAGGTGGGA	0.527																																					p.G107G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T321C	17						.						151.0	144.0	146.0					17																	42151630		2203	4300	6503	39507156	SO:0001819	synonymous_variant	92579	exon2			BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.321T>C	17.37:g.42151630T>C		Somatic		Capture	SOLID	Phase_I	39507156	NM_138387	Q8WU15	Silent	SNP	ENST00000269097.4	37	CCDS11476.1																																																																																				0.527	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457675.1	NM_138387	
FMNL1	752	hgsc.bcm.edu	37	17	43317920	43317920	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:43317920G>A	ENST00000331495.3	+	12	1494	c.1158G>A	c.(1156-1158)gcG>gcA	p.A386A	FMNL1_ENST00000587489.1_5'Flank|FMNL1_ENST00000328118.3_Silent_p.A386A|CTD-2020K17.3_ENST00000587534.1_RNA|CTD-2020K17.3_ENST00000393507.2_RNA	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	386	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)	p.A386A(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						ATGTGGGGGCGCTGCTGGAGG	0.597																																					p.A386A	GBM(164;1247 1997 8702 11086 51972)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1158A	17						.						92.0	82.0	86.0					17																	43317920		2203	4300	6503	40673703	SO:0001819	synonymous_variant	752	exon12			AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.1158G>A	17.37:g.43317920G>A		Somatic		Capture	SOLID	Phase_I	40673703	NM_005892	D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Silent	SNP	ENST00000331495.3	37	CCDS11497.1																																																																																				0.597	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450198.1	NM_005892	
LRRC59	55379	hgsc.bcm.edu	37	17	48469823	48469823	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:48469823G>T	ENST00000225972.7	-	4	600	c.365C>A	c.(364-366)cCt>cAt	p.P122H		NM_018509.3	NP_060979.2	Q96AG4	LRC59_HUMAN	leucine rich repeat containing 59	122						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P122H(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			GGCCAGGACAGGATCCAGGGG	0.527																																					p.P122H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C365A	17						.						127.0	114.0	118.0					17																	48469823		2203	4300	6503	45824822	SO:0001583	missense	55379	exon4			AK025328	CCDS11566.1	17q21.33	2014-02-12	2006-01-12		ENSG00000108829	ENSG00000108829			28817	protein-coding gene	gene with protein product		614854				12477932	Standard	NM_018509		Approved	PRO1855, FLJ21675	uc002iqt.3	Q96AG4	OTTHUMG00000162079	ENST00000225972.7:c.365C>A	17.37:g.48469823G>T	ENSP00000225972:p.Pro122His	Somatic		Capture	SOLID	Phase_I	45824822	NM_018509	B2RE83|D3DTX8|Q9P189	Missense_Mutation	SNP	ENST00000225972.7	37	CCDS11566.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976675	0.92982	.	.	ENSG00000108829	ENST00000225972	T	0.02345	4.33	5.26	5.26	0.73747	.	0.046962	0.85682	D	0.000000	T	0.15349	0.0370	M	0.81341	2.54	0.80722	D	1	D	0.71674	0.998	P	0.61132	0.884	T	0.00186	-1.1942	10	0.59425	D	0.04	.	19.2078	0.93739	0.0:0.0:1.0:0.0	.	122	Q96AG4	LRC59_HUMAN	H	122	ENSP00000225972:P122H	ENSP00000225972:P122H	P	-	2	0	LRRC59	45824822	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.567000	0.73983	2.615000	0.88500	0.491000	0.48974	CCT		0.527	LRRC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367117.2	NM_018509	
SLC25A11	8402	hgsc.bcm.edu	37	17	4841169	4841169	+	Missense_Mutation	SNP	C	C	T	rs149333609		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:4841169C>T	ENST00000225665.7	-	8	1152	c.812G>A	c.(811-813)cGc>cAc	p.R271H	RNF167_ENST00000572430.1_5'Flank|RNF167_ENST00000575111.1_5'Flank|RNF167_ENST00000576229.1_5'Flank|SLC25A11_ENST00000544061.2_Missense_Mutation_p.R220H|RNF167_ENST00000571816.1_5'Flank|RNF167_ENST00000262482.6_5'Flank	NM_001165417.1|NM_003562.4	NP_001158889.1|NP_003553.2	Q02978	M2OM_HUMAN	solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11	271					alpha-ketoglutarate transport (GO:0015742)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxoglutarate:malate antiporter activity (GO:0015367)|poly(A) RNA binding (GO:0044822)	p.R271H(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	10						GCCCTCGTAGCGGACAACTTT	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		16603	0.0		0.001	False		,,,				2504	0.0				p.R271H	Esophageal Squamous(144;1178 2388 18010 48797)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G812A	17						.						78.0	86.0	83.0					17																	4841169		2203	4300	6503	4781914	SO:0001583	missense	8402	exon8			X66114	CCDS11059.1, CCDS54069.1	17p13.3	2013-05-22			ENSG00000108528	ENSG00000108528		"""Solute carriers"""	10981	protein-coding gene	gene with protein product		604165		SLC20A4		10072597, 1457818	Standard	NM_003562		Approved	OGC	uc002fzo.2	Q02978	OTTHUMG00000099395	ENST00000225665.7:c.812G>A	17.37:g.4841169C>T	ENSP00000225665:p.Arg271His	Somatic		Capture	SOLID	Phase_I	4781914	NM_003562	F5GY65|O75537|Q969P7	Missense_Mutation	SNP	ENST00000225665.7	37	CCDS11059.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	19.26	3.793661	0.70452	.	.	ENSG00000108528	ENST00000225665;ENST00000544061	T;T	0.80214	-1.35;-1.35	5.16	4.17	0.49024	Mitochondrial carrier domain (2);	0.058042	0.64402	D	0.000004	D	0.88651	0.6494	M	0.89904	3.07	0.45354	D	0.998347	D;D	0.76494	0.999;0.999	D;D	0.65140	0.932;0.932	D	0.88993	0.3416	10	0.87932	D	0	-29.822	6.8589	0.24056	0.1737:0.7363:0.0:0.09	.	271;271	Q6IBH0;Q02978	.;M2OM_HUMAN	H	271;220	ENSP00000225665:R271H;ENSP00000440804:R220H	ENSP00000225665:R271H	R	-	2	0	SLC25A11	4781914	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.269000	0.65542	2.679000	0.91253	0.655000	0.94253	CGC		0.602	SLC25A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216852.4	NM_003562	
ABCC3	8714	hgsc.bcm.edu	37	17	48745344	48745344	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:48745344C>T	ENST00000285238.8	+	13	1836	c.1756C>T	c.(1756-1758)Ccc>Tcc	p.P586S		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	586	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.P586S(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CAACATGCTGCCCCAGTTAAT	0.532																																					p.P586S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1756T	17						.						154.0	133.0	140.0					17																	48745344		2203	4300	6503	46100343	SO:0001583	missense	8714	exon13			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1756C>T	17.37:g.48745344C>T	ENSP00000285238:p.Pro586Ser	Somatic		Capture	SOLID	Phase_I	46100343	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473925	0.84640	.	.	ENSG00000108846	ENST00000285238	T	0.54479	0.57	4.32	3.21	0.36854	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	T	0.59307	0.2184	M	0.89968	3.075	0.80722	D	1	P	0.36162	0.54	B	0.35182	0.197	T	0.67821	-0.5571	10	0.87932	D	0	-21.3117	12.1787	0.54199	0.0:0.9096:0.0:0.0904	.	586	O15438	MRP3_HUMAN	S	586	ENSP00000285238:P586S	ENSP00000285238:P586S	P	+	1	0	ABCC3	46100343	1.000000	0.71417	0.807000	0.32361	0.883000	0.51084	3.956000	0.56722	1.014000	0.39417	0.591000	0.81541	CCC		0.532	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
MRC2	9902	hgsc.bcm.edu	37	17	60743497	60743497	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:60743497C>T	ENST00000303375.5	+	3	965	c.563C>T	c.(562-564)aCc>aTc	p.T188I		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	188	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00479}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.T188I(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						AAGCCGTGCACCATCCCCTTC	0.622																																					p.T188I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C563T	17						.						78.0	56.0	63.0					17																	60743497		2202	4299	6501	58097229	SO:0001583	missense	9902	exon3			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.563C>T	17.37:g.60743497C>T	ENSP00000307513:p.Thr188Ile	Somatic		Capture	SOLID	Phase_I	58097229	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042406	0.55003	.	.	ENSG00000011028	ENST00000303375	T	0.48201	0.82	4.67	4.67	0.58626	Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);	0.263977	0.39020	N	0.001494	T	0.42017	0.1184	N	0.08118	0	0.80722	D	1	D	0.54601	0.967	P	0.55785	0.784	T	0.35025	-0.9805	10	0.20519	T	0.43	-29.6554	17.7644	0.88473	0.0:1.0:0.0:0.0	.	188	Q9UBG0	MRC2_HUMAN	I	188	ENSP00000307513:T188I	ENSP00000307513:T188I	T	+	2	0	MRC2	58097229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.772000	0.62324	2.428000	0.82296	0.561000	0.74099	ACC		0.622	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
MARCH10	162333	hgsc.bcm.edu	37	17	60879011	60879011	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:60879011T>C	ENST00000311269.5	-	2	360	c.86A>G	c.(85-87)tAt>tGt	p.Y29C	MARCH10_ENST00000544856.2_Missense_Mutation_p.Y29C|MARCH10_ENST00000456609.2_Missense_Mutation_p.Y29C|MARCH10_ENST00000583600.1_Missense_Mutation_p.Y29C	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	29					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.Y29C(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						AATTACCTGATACTCAGAGTC	0.433																																					p.Y29C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A86G	17						.						179.0	137.0	151.0					17																	60879011		2203	4300	6503	58232743	SO:0001583	missense	162333	exon2			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.86A>G	17.37:g.60879011T>C	ENSP00000311496:p.Tyr29Cys	Somatic		Capture	SOLID	Phase_I	58232743	NM_001100875	D3DU09|Q8IYS7|Q8N7Z7	Missense_Mutation	SNP	ENST00000311269.5	37	CCDS11635.1	.	.	.	.	.	.	.	.	.	.	T	11.24	1.581475	0.28180	.	.	ENSG00000173838	ENST00000456609;ENST00000311269;ENST00000544856	T;T;T	0.23348	1.91;1.91;1.91	5.59	5.59	0.84812	.	0.000000	0.37715	N	0.001967	T	0.49338	0.1551	M	0.71581	2.175	0.43300	D	0.995298	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.52185	-0.8609	10	0.87932	D	0	-14.0944	12.1663	0.54131	0.0:0.0:0.0:1.0	.	29;29;29	B3KVK0;G3V1Q5;Q8NA82	.;.;MARHA_HUMAN	C	29	ENSP00000416177:Y29C;ENSP00000311496:Y29C;ENSP00000443746:Y29C	ENSP00000311496:Y29C	Y	-	2	0	MARCH10	58232743	1.000000	0.71417	0.973000	0.42090	0.826000	0.46750	4.051000	0.57412	2.120000	0.65058	0.459000	0.35465	TAT		0.433	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1	NM_152598	
PSMC5	5705	hgsc.bcm.edu	37	17	61908464	61908464	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:61908464G>A	ENST00000310144.6	+	8	1056	c.748G>A	c.(748-750)Gaa>Aaa	p.E250K	PSMC5_ENST00000580864.1_Missense_Mutation_p.E242K|PSMC5_ENST00000581882.1_Missense_Mutation_p.E242K|PSMC5_ENST00000375812.4_Missense_Mutation_p.E242K|FTSJ3_ENST00000580295.1_5'Flank	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5	250	May mediate interaction with PRPF9. {ECO:0000250|UniProtKB:P62196}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.E250K(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						CTTCATGGACGAAATCGACTC	0.587																																					p.E250K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G748A	17						.						91.0	90.0	90.0					17																	61908464		2203	4300	6503	59262196	SO:0001583	missense	5705	exon8			L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195		ENST00000310144.6:c.748G>A	17.37:g.61908464G>A	ENSP00000310572:p.Glu250Lys	Somatic		Capture	SOLID	Phase_I	59262196	NM_002805	A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Missense_Mutation	SNP	ENST00000310144.6	37	CCDS11645.1	.	.	.	.	.	.	.	.	.	.	G	33	5.198450	0.94997	.	.	ENSG00000087191	ENST00000310144;ENST00000375812	D;D	0.90732	-2.72;-2.72	5.64	5.64	0.86602	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97213	0.9089	H	0.97265	3.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98005	1.0362	10	0.87932	D	0	.	17.243	0.87019	0.0:0.0:1.0:0.0	.	242;250	A8K3Z3;P62195	.;PRS8_HUMAN	K	250;242	ENSP00000310572:E250K;ENSP00000364970:E242K	ENSP00000310572:E250K	E	+	1	0	PSMC5	59262196	1.000000	0.71417	0.923000	0.36655	0.935000	0.57460	9.592000	0.98245	2.937000	0.99478	0.650000	0.86243	GAA		0.587	PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444404.1	NM_002805	
ABCA9	10350	hgsc.bcm.edu	37	17	66987079	66987079	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:66987079C>T	ENST00000340001.4	-	29	3947	c.3736G>A	c.(3736-3738)Gct>Act	p.A1246T	ABCA9_ENST00000482072.1_5'Flank|ABCA9_ENST00000453985.2_Missense_Mutation_p.A1208T|ABCA9_ENST00000370732.2_Missense_Mutation_p.A1246T	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1246					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A1246T(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GGAAAAATAGCGTTGCTTCTT	0.368																																					p.A1246T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3736A	17						.						151.0	131.0	138.0					17																	66987079		2202	4300	6502	64498674	SO:0001583	missense	10350	exon29			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.3736G>A	17.37:g.66987079C>T	ENSP00000342216:p.Ala1246Thr	Somatic		Capture	SOLID	Phase_I	64498674	NM_080283	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	C	5.600	0.295440	0.10622	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732	D;D	0.87029	-2.09;-2.2	5.33	-3.94	0.04130	.	2.609730	0.01272	N	0.009466	T	0.74137	0.3677	N	0.12569	0.235	0.09310	N	1	B;B	0.23591	0.088;0.002	B;B	0.26094	0.066;0.003	T	0.64127	-0.6480	10	0.14252	T	0.57	.	7.5994	0.28067	0.0:0.25:0.1333:0.6167	.	1246;1246	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	T	1246;1191;1246	ENSP00000342216:A1246T;ENSP00000359767:A1246T	ENSP00000342216:A1246T	A	-	1	0	ABCA9	64498674	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.848000	0.04326	-0.739000	0.04809	0.609000	0.83330	GCT		0.368	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
DNAH2	146754	hgsc.bcm.edu	37	17	7699970	7699970	+	Splice_Site	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:7699970G>T	ENST00000572933.1	+	50	9323	c.7863G>T	c.(7861-7863)aaG>aaT	p.K2621N	DNAH2_ENST00000389173.2_Splice_Site_p.K2621N			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2621	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K2621N(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				ACATCTCCAAGGTGACTCGCG	0.567																																					p.K2621N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7863T	17						.						140.0	115.0	124.0					17																	7699970		2203	4300	6503	7640695	SO:0001630	splice_region_variant	146754	exon49			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.7863+1G>T	17.37:g.7699970G>T		Somatic		Capture	SOLID	Phase_I	7640695	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	32	5.117848	0.94385	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.26518	1.73	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.50086	0.1595	M	0.67569	2.06	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.26573	-1.0099	10	0.32370	T	0.25	.	18.1044	0.89516	0.0:0.0:1.0:0.0	.	2621	Q9P225	DYH2_HUMAN	N	2621	ENSP00000373825:K2621N	ENSP00000353818:K2621N	K	+	3	2	DNAH2	7640695	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.819000	0.75262	2.805000	0.96524	0.609000	0.83330	AAG		0.567	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	Missense_Mutation
ST6GALNAC1	55808	hgsc.bcm.edu	37	17	74623595	74623595	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:74623595A>T	ENST00000156626.7	-	3	1101	c.902T>A	c.(901-903)cTc>cAc	p.L301H	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	301					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)	p.L301H(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						GAAGAGAGTGAGGTTGGGCAG	0.527																																					p.L301H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T902A	17						.						122.0	113.0	116.0					17																	74623595		2203	4300	6503	72135190	SO:0001583	missense	55808	exon3			Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.902T>A	17.37:g.74623595A>T	ENSP00000156626:p.Leu301His	Somatic		Capture	SOLID	Phase_I	72135190	NM_018414	Q6UW90|Q9NSC6	Missense_Mutation	SNP	ENST00000156626.7	37	CCDS11748.1	.	.	.	.	.	.	.	.	.	.	A	17.66	3.445195	0.63178	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.27402	1.7;1.67	5.1	4.02	0.46733	.	0.224693	0.35378	N	0.003249	T	0.49236	0.1545	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.48364	-0.9042	10	0.87932	D	0	-16.0057	10.8341	0.46677	0.9252:0.0:0.0748:0.0	.	301	Q9NSC7	SIA7A_HUMAN	H	301	ENSP00000156626:L301H;ENSP00000351991:L301H	ENSP00000156626:L301H	L	-	2	0	ST6GALNAC1	72135190	1.000000	0.71417	0.998000	0.56505	0.593000	0.36681	6.001000	0.70685	0.889000	0.36185	0.460000	0.39030	CTC		0.527	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450974.1	NM_018414	
CCDC42	146849	hgsc.bcm.edu	37	17	8647864	8647864	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:8647864G>A	ENST00000293845.3	-	1	290	c.64C>T	c.(64-66)Cgg>Tgg	p.R22W	CCDC42_ENST00000539522.2_Missense_Mutation_p.R22W	NM_144681.2	NP_653282.2	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42	22								p.R22W(1)		kidney(1)|large_intestine(4)|lung(3)|ovary(1)	9						TGCAGCAGCCGCTCCCCATAC	0.612																																					p.R22W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C64T	17						.						89.0	82.0	84.0					17																	8647864		2203	4300	6503	8588589	SO:0001583	missense	146849	exon1			AK057296	CCDS11145.1, CCDS54088.1	17p13.1	2012-05-28			ENSG00000161973	ENSG00000161973			26528	protein-coding gene	gene with protein product							Standard	NM_144681		Approved	FLJ32734, CCDC42A	uc002gln.3	Q96M95		ENST00000293845.3:c.64C>T	17.37:g.8647864G>A	ENSP00000293845:p.Arg22Trp	Somatic		Capture	SOLID	Phase_I	8588589	NM_001158261	Q8N6Q0	Missense_Mutation	SNP	ENST00000293845.3	37	CCDS11145.1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342508	0.41498	.	.	ENSG00000161973	ENST00000293845;ENST00000539522	T;T	0.25912	1.77;1.79	5.44	3.43	0.39272	.	0.225800	0.31381	N	0.007758	T	0.24044	0.0582	N	0.24115	0.695	0.33602	D	0.60243	D	0.69078	0.997	P	0.49637	0.617	T	0.36553	-0.9743	10	0.87932	D	0	-42.4506	11.9052	0.52708	0.0:0.0:0.5445:0.4555	.	22	Q96M95	CCD42_HUMAN	W	22	ENSP00000293845:R22W;ENSP00000444359:R22W	ENSP00000293845:R22W	R	-	1	2	CCDC42	8588589	0.984000	0.35163	1.000000	0.80357	0.099000	0.18886	1.479000	0.35453	0.652000	0.30806	0.561000	0.74099	CGG		0.612	CCDC42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442491.1	NM_144681	
CSNK1D	1453	hgsc.bcm.edu	37	17	80210963	80210963	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr17:80210963A>G	ENST00000314028.6	-	4	843	c.494T>C	c.(493-495)aTc>aCc	p.I165T	CSNK1D_ENST00000578904.1_5'UTR|CSNK1D_ENST00000392334.2_Missense_Mutation_p.I165T|CSNK1D_ENST00000398519.5_Missense_Mutation_p.I165T	NM_001893.4	NP_001884.2	P48730	KC1D_HUMAN	casein kinase 1, delta	165	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle (GO:0005819)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.I165T(1)		breast(2)|large_intestine(2)|lung(7)	11	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)			ACGATAGGGGATGTGCTGGTG	0.602																																					p.I165T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T494C	17						.						293.0	212.0	239.0					17																	80210963		2203	4300	6503	77804252	SO:0001583	missense	1453	exon4				CCDS11805.1, CCDS11806.1	17q25	2013-01-17				ENSG00000141551			2452	protein-coding gene	gene with protein product		600864				7797465	Standard	NM_001893		Approved	HCKID, CKID, CKIdelta	uc002kej.3	P48730		ENST00000314028.6:c.494T>C	17.37:g.80210963A>G	ENSP00000324464:p.Ile165Thr	Somatic		Capture	SOLID	Phase_I	77804252	NM_139062	A2I2P2|Q96KZ6|Q9BTN5	Missense_Mutation	SNP	ENST00000314028.6	37	CCDS11805.1	.	.	.	.	.	.	.	.	.	.	A	15.44	2.835198	0.50951	.	.	ENSG00000141551	ENST00000314028;ENST00000392334;ENST00000398519;ENST00000269361	T;T	0.06371	3.31;3.31	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.36276	0.0961	H	0.94847	3.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	T	0.51244	-0.8730	10	0.87932	D	0	.	15.0541	0.71897	1.0:0.0:0.0:0.0	.	165;165;108	P48730;P48730-2;B4E0G1	KC1D_HUMAN;.;.	T	165;165;108;57	ENSP00000324464:I165T;ENSP00000376146:I165T	ENSP00000269361:I57T	I	-	2	0	CSNK1D	77804252	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.262000	0.95591	2.155000	0.67459	0.533000	0.62120	ATC		0.602	CSNK1D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442632.1	NM_139062	
KRTAP15-1	254950	hgsc.bcm.edu	37	21	31812658	31812658	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr21:31812658T>C	ENST00000334067.3	+	1	62	c.13T>C	c.(13-15)Tgc>Cgc	p.C5R		NM_181623.1	NP_853654.1	Q3LI76	KR151_HUMAN	keratin associated protein 15-1	5						intermediate filament (GO:0005882)		p.C5R(1)		kidney(1)|large_intestine(3)|lung(6)|skin(1)	11						GTCTTACAACTGCAGCTCTGG	0.443																																					p.C5R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T13C	21						.						94.0	88.0	90.0					21																	31812658		2203	4300	6503	30734529	SO:0001583	missense	254950	exon1			AP001708	CCDS13593.1	21q22.1	2008-05-21			ENSG00000186970	ENSG00000186970		"""Keratin associated proteins"""	18927	protein-coding gene	gene with protein product						12359730	Standard	NM_181623		Approved	KAP15.1	uc002yod.3	Q3LI76	OTTHUMG00000057784	ENST00000334067.3:c.13T>C	21.37:g.31812658T>C	ENSP00000334866:p.Cys5Arg	Somatic		Capture	SOLID	Phase_I	30734529	NM_181623	Q2M3F4	Missense_Mutation	SNP	ENST00000334067.3	37	CCDS13593.1	.	.	.	.	.	.	.	.	.	.	T	6.267	0.417450	0.11870	.	.	ENSG00000186970	ENST00000334067	T	0.04119	3.7	4.79	-0.307	0.12777	.	1.280270	0.05370	N	0.535249	T	0.09202	0.0227	M	0.82323	2.585	0.20403	N	0.99991	B	0.15719	0.014	B	0.13407	0.009	T	0.42565	-0.9444	10	0.87932	D	0	-1.2626	4.1814	0.10378	0.0:0.2714:0.1708:0.5578	.	5	Q3LI76	KR151_HUMAN	R	5	ENSP00000334866:C5R	ENSP00000334866:C5R	C	+	1	0	KRTAP15-1	30734529	0.040000	0.19996	0.030000	0.17652	0.059000	0.15707	0.283000	0.18846	-0.039000	0.13602	0.533000	0.62120	TGC		0.443	KRTAP15-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128236.1		
KRTAP19-4	337971	hgsc.bcm.edu	37	21	31869181	31869181	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr21:31869181T>C	ENST00000334058.2	-	1	270	c.248A>G	c.(247-249)aAa>aGa	p.K83R		NM_181610.1	NP_853641.1	Q3LI73	KR194_HUMAN	keratin associated protein 19-4	83						intermediate filament (GO:0005882)		p.K83R(1)		central_nervous_system(1)|large_intestine(2)|lung(1)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GACTCAATATTTGGTTAAATT	0.353																																					p.K83R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A248G	21						.						169.0	168.0	168.0					21																	31869181		2203	4300	6503	30791052	SO:0001583	missense	337971	exon1			AP001708	CCDS33534.1	21q22.1	2011-02-10			ENSG00000186967	ENSG00000186967		"""Keratin associated proteins"""	18939	protein-coding gene	gene with protein product						12359730	Standard	NM_181610		Approved	KAP19.4	uc011acz.2	Q3LI73	OTTHUMG00000057767	ENST00000334058.2:c.248A>G	21.37:g.31869181T>C	ENSP00000335567:p.Lys83Arg	Somatic		Capture	SOLID	Phase_I	30791052	NM_181610	Q17RT4|Q17RT6	Missense_Mutation	SNP	ENST00000334058.2	37	CCDS33534.1	.	.	.	.	.	.	.	.	.	.	T	5.769	0.326258	0.10900	.	.	ENSG00000186967	ENST00000334058	T	0.20332	2.08	3.35	0.766	0.18476	.	.	.	.	.	T	0.14270	0.0345	.	.	.	0.09310	N	1	P	0.44241	0.829	B	0.38378	0.272	T	0.17107	-1.0380	8	0.87932	D	0	.	3.8377	0.08902	0.218:0.0:0.226:0.556	.	83	Q3LI73	KR194_HUMAN	R	83	ENSP00000335567:K83R	ENSP00000335567:K83R	K	-	2	0	KRTAP19-4	30791052	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.978000	0.03778	0.145000	0.18977	0.383000	0.25322	AAA		0.353	KRTAP19-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128219.2		
ERG	2078	hgsc.bcm.edu	37	21	39775628	39775628	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr21:39775628G>T	ENST00000417133.2	-	6	598	c.413C>A	c.(412-414)cCt>cAt	p.P138H	ERG_ENST00000398907.1_Missense_Mutation_p.P131H|ERG_ENST00000398910.1_Missense_Mutation_p.P138H|ERG_ENST00000288319.7_Missense_Mutation_p.P131H|ERG_ENST00000398905.1_Missense_Mutation_p.P131H|ERG_ENST00000398911.1_Missense_Mutation_p.P138H|ERG_ENST00000398919.2_Missense_Mutation_p.P138H|ERG_ENST00000442448.1_Missense_Mutation_p.P138H|ERG_ENST00000453032.2_Missense_Mutation_p.P39H|ERG_ENST00000398897.1_Missense_Mutation_p.P39H|ERG_ENST00000429727.2_Intron	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.P138H(1)	EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CCATAGCGTAGGATCTGAAAG	0.512			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																p.P138H	Esophageal Squamous(130;336 1700 3010 3083 40589)		Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C413A	21						.						74.0	65.0	68.0					21																	39775628		2203	4300	6503	38697498	SO:0001583	missense	2078	exon6				CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.413C>A	21.37:g.39775628G>T	ENSP00000414150:p.Pro138His	Somatic		Capture	SOLID	Phase_I	38697498	NM_001136154	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000417133.2	37	CCDS46648.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.167801	0.78339	.	.	ENSG00000157554	ENST00000398905;ENST00000398907;ENST00000288319;ENST00000398897;ENST00000398911;ENST00000417133;ENST00000398910;ENST00000442448;ENST00000453032;ENST00000398919	T;T;T;T;T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	4.73	4.73	0.59995	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.000000	0.85682	D	0.000000	D	0.87861	0.6284	H	0.95850	3.73	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.998;1.0;0.999;1.0	D	0.92095	0.5683	10	0.87932	D	0	.	18.1071	0.89524	0.0:0.0:1.0:0.0	.	138;131;138;138;131	P11308;B5MDW0;P11308-6;P11308-1;P11308-4	ERG_HUMAN;.;.;.;.	H	131;131;131;39;138;138;138;138;39;138	ENSP00000381877:P131H;ENSP00000381879:P131H;ENSP00000288319:P131H;ENSP00000381871:P39H;ENSP00000381882:P138H;ENSP00000414150:P138H;ENSP00000381881:P138H;ENSP00000394694:P138H;ENSP00000396268:P39H;ENSP00000381891:P138H	ENSP00000288319:P131H	P	-	2	0	ERG	38697498	1.000000	0.71417	0.357000	0.25798	0.587000	0.36485	9.766000	0.98957	2.345000	0.79718	0.655000	0.94253	CCT		0.512	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207532.2	NM_182918	
IGSF5	150084	hgsc.bcm.edu	37	21	41137773	41137773	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr21:41137773G>A	ENST00000380588.4	+	3	515	c.412G>A	c.(412-414)Gtc>Atc	p.V138I	IGSF5_ENST00000479378.1_3'UTR	NM_001080444.1	NP_001073913.1	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily, member 5	138	Ig-like V-type 1.				single organismal cell-cell adhesion (GO:0016337)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.V138I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(7)|skin(2)|stomach(1)	23		Prostate(19;5.35e-06)				TTACCTTACCGTCCAAGGTGT	0.522																																					p.V138I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G412A	21						.						75.0	67.0	70.0					21																	41137773		2203	4300	6503	40059643	SO:0001583	missense	150084	exon3				CCDS33562.1	21q22.2	2013-01-29			ENSG00000183067	ENSG00000183067		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5952	protein-coding gene	gene with protein product	"""junctional adhesion molecule 4"""	610638					Standard	NM_001080444		Approved	JAM4	uc002yyo.3	Q9NSI5	OTTHUMG00000086724	ENST00000380588.4:c.412G>A	21.37:g.41137773G>A	ENSP00000369962:p.Val138Ile	Somatic		Capture	SOLID	Phase_I	40059643	NM_001080444		Missense_Mutation	SNP	ENST00000380588.4	37	CCDS33562.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491490	0.44249	.	.	ENSG00000183067	ENST00000380588	T	0.30448	1.53	3.85	3.85	0.44370	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.063874	0.64402	D	0.000009	T	0.53384	0.1793	M	0.72894	2.215	0.44966	D	0.997986	D	0.76494	0.999	D	0.79784	0.993	T	0.58075	-0.7700	10	0.54805	T	0.06	-22.0952	14.843	0.70240	0.0:0.0:1.0:0.0	.	138	Q9NSI5	IGSF5_HUMAN	I	138	ENSP00000369962:V138I	ENSP00000369962:V138I	V	+	1	0	IGSF5	40059643	0.997000	0.39634	0.454000	0.27019	0.210000	0.24377	5.320000	0.65841	2.097000	0.63578	0.557000	0.71058	GTC		0.522	IGSF5-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195005.1		
PWP2	5822	hgsc.bcm.edu	37	21	45545959	45545959	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr21:45545959A>G	ENST00000291576.7	+	16	2160	c.2033A>G	c.(2032-2034)cAg>cGg	p.Q678R	PWP2_ENST00000494310.1_3'UTR	NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	678					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)	p.Q678R(1)		cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		GATGCTGGGCAGGAGGATGGA	0.542																																					p.Q678R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2033G	21						.						137.0	113.0	121.0					21																	45545959		2203	4300	6503	44370387	SO:0001583	missense	5822	exon16				CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.2033A>G	21.37:g.45545959A>G	ENSP00000291576:p.Gln678Arg	Somatic		Capture	SOLID	Phase_I	44370387	NM_005049	B2RAG8|Q96A77	Missense_Mutation	SNP	ENST00000291576.7	37	CCDS33579.1	.	.	.	.	.	.	.	.	.	.	A	5.748	0.322451	0.10900	.	.	ENSG00000241945	ENST00000291576	T	0.57595	0.39	4.55	1.89	0.25635	.	0.377355	0.29760	N	0.011264	T	0.28001	0.0690	N	0.14661	0.345	0.25634	N	0.986271	B	0.15719	0.014	B	0.16289	0.015	T	0.15896	-1.0421	10	0.12103	T	0.63	-14.6772	7.1801	0.25768	0.7035:0.1514:0.0:0.1451	.	678	Q15269	PWP2_HUMAN	R	678	ENSP00000291576:Q678R	ENSP00000291576:Q678R	Q	+	2	0	PWP2	44370387	0.998000	0.40836	0.543000	0.28128	0.182000	0.23217	1.676000	0.37565	0.676000	0.31285	0.482000	0.46254	CAG		0.542	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195736.3	NM_005049	
MYH11	4629	hgsc.bcm.edu	37	16	15841526	15841526	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:15841526C>T	ENST00000300036.5	-	19	2421	c.2312G>A	c.(2311-2313)cGa>cAa	p.R771Q	MYH11_ENST00000396324.3_Missense_Mutation_p.R778Q|MYH11_ENST00000452625.2_Missense_Mutation_p.R778Q|MYH11_ENST00000576790.2_Missense_Mutation_p.R771Q	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	771	Actin-binding. {ECO:0000250}.|Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.R771Q(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GACGCCAGTTCGGAAGAAGAT	0.512			T	CBFB	AML																																p.R778Q			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2333A	16						.						98.0	93.0	95.0					16																	15841526		2197	4300	6497	15749027	SO:0001583	missense	4629	exon20			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2312G>A	16.37:g.15841526C>T	ENSP00000300036:p.Arg771Gln	Somatic		Capture	SOLID	Phase_I	15749027	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	C	34	5.410584	0.96072	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	5.46	5.46	0.80206	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.89598	0.6761	H	0.96398	3.815	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.92575	0.6069	10	0.72032	D	0.01	.	18.3008	0.90163	0.0:1.0:0.0:0.0	.	778;771;778;771;778	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	Q	771;771;778;778;778	ENSP00000300036:R771Q;ENSP00000345136:R771Q;ENSP00000379616:R778Q;ENSP00000407821:R778Q	ENSP00000300036:R771Q	R	-	2	0	MYH11	15749027	1.000000	0.71417	0.964000	0.40570	0.811000	0.45836	7.818000	0.86416	2.565000	0.86533	0.561000	0.74099	CGA		0.512	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
UMOD	7369	hgsc.bcm.edu	37	16	20355392	20355392	+	Missense_Mutation	SNP	G	G	T	rs536996703		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:20355392G>T	ENST00000570689.1	-	6	1431	c.1285C>A	c.(1285-1287)Ctg>Atg	p.L429M	UMOD_ENST00000302509.4_Missense_Mutation_p.L429M|UMOD_ENST00000424589.1_Missense_Mutation_p.L462M|UMOD_ENST00000570331.1_5'Flank|UMOD_ENST00000396134.2_Missense_Mutation_p.L462M|UMOD_ENST00000396138.4_Missense_Mutation_p.L478M|UMOD_ENST00000396142.2_Missense_Mutation_p.L429M			P07911	UROM_HUMAN	uromodulin	429	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)	p.L429M(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TTCATGTCCAGGGGGTAGGAG	0.532																																					p.L429M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1285A	16						.						142.0	119.0	127.0					16																	20355392		2203	4300	6503	20262893	SO:0001583	missense	7369	exon6			M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1285C>A	16.37:g.20355392G>T	ENSP00000460548:p.Leu429Met	Somatic		Capture	SOLID	Phase_I	20262893	NM_003361	B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Missense_Mutation	SNP	ENST00000570689.1	37	CCDS10583.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440721	0.63067	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7	5.66	4.71	0.59529	Zona pellucida sperm-binding protein (3);	0.000000	0.39544	N	0.001323	D	0.90242	0.6949	M	0.86651	2.83	0.29636	N	0.845054	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85718	0.1323	10	0.56958	D	0.05	-15.0009	7.2865	0.26342	0.0882:0.1719:0.7398:0.0	.	462;429	E9PEA4;P07911	.;UROM_HUMAN	M	429;462;462;429;407;429	ENSP00000379438:L462M;ENSP00000416346:L462M;ENSP00000306279:L429M;ENSP00000379446:L429M	ENSP00000306279:L429M	L	-	1	2	UMOD	20262893	0.951000	0.32395	0.987000	0.45799	0.987000	0.75469	1.471000	0.35365	2.667000	0.90743	0.655000	0.94253	CTG		0.532	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1		
TMEM159	57146	hgsc.bcm.edu	37	16	21185398	21185398	+	Silent	SNP	C	C	T	rs533371685	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:21185398C>T	ENST00000233047.4	+	4	801	c.333C>T	c.(331-333)ctC>ctT	p.L111L	TMEM159_ENST00000572258.1_Intron|TMEM159_ENST00000261388.3_Silent_p.L111L|TMEM159_ENST00000451578.2_Silent_p.L135L|TMEM159_ENST00000572599.1_Silent_p.L111L			Q96B96	TM159_HUMAN	transmembrane protein 159	111						integral component of membrane (GO:0016021)		p.L111L(1)		large_intestine(3)|lung(2)|ovary(1)	6				GBM - Glioblastoma multiforme(48;0.0972)		TCGTATCACTCGCCATGTCGG	0.478																																					p.L111L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C333T	16						.						225.0	166.0	186.0					16																	21185398		2200	4300	6500	21092899	SO:0001819	synonymous_variant	57146	exon4			AF070596	CCDS10595.1	16p12.2	2008-02-05			ENSG00000011638	ENSG00000011638			30136	protein-coding gene	gene with protein product		611304				8619474, 9110174, 15589683	Standard	NM_020422		Approved	promethin	uc002dif.4	Q96B96	OTTHUMG00000131559	ENST00000233047.4:c.333C>T	16.37:g.21185398C>T		Somatic		Capture	SOLID	Phase_I	21092899	NM_020422	A6NMA9|B4DEC1|O00323	Silent	SNP	ENST00000233047.4	37	CCDS10595.1																																																																																				0.478	TMEM159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254421.1	NM_020422	
IL32	9235	hgsc.bcm.edu	37	16	3117408	3117408	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:3117408G>A	ENST00000534507.1	+	3	257	c.46G>A	c.(46-48)Gcc>Acc	p.A16T	IL32_ENST00000552356.1_Missense_Mutation_p.A16T|IL32_ENST00000382213.3_Missense_Mutation_p.A16T|IL32_ENST00000548652.1_Missense_Mutation_p.A16T|IL32_ENST00000529699.1_Missense_Mutation_p.A16T|IL32_ENST00000528163.2_Missense_Mutation_p.A16T|IL32_ENST00000444393.3_Missense_Mutation_p.A16T|IL32_ENST00000552936.1_Intron|IL32_ENST00000396887.3_Missense_Mutation_p.A16T|IL32_ENST00000548246.1_Missense_Mutation_p.A16T|IL32_ENST00000551513.1_Missense_Mutation_p.A16T|IL32_ENST00000525643.2_Missense_Mutation_p.A16T|IL32_ENST00000552664.1_Missense_Mutation_p.A16T|IL32_ENST00000531965.1_Missense_Mutation_p.A6T|IL32_ENST00000530890.1_Missense_Mutation_p.A16T|IL32_ENST00000549213.1_Missense_Mutation_p.A16T|IL32_ENST00000008180.9_Missense_Mutation_p.A16T|IL32_ENST00000530538.2_Missense_Mutation_p.A16T|IL32_ENST00000533097.2_Missense_Mutation_p.A16T|IL32_ENST00000325568.5_Missense_Mutation_p.A16T|IL32_ENST00000529550.1_Missense_Mutation_p.A16T|RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000551122.1_Missense_Mutation_p.A16T|IL32_ENST00000440815.3_Missense_Mutation_p.A16T|IL32_ENST00000548476.1_Missense_Mutation_p.A16T|IL32_ENST00000396890.2_Missense_Mutation_p.A16T|IL32_ENST00000526464.2_Missense_Mutation_p.A16T			P24001	IL32_HUMAN	interleukin 32	16					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)		p.A16T(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						GAAGCTGAAGGCCCGAATGGT	0.537																																					p.A16T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G46A	16						.						147.0	129.0	135.0					16																	3117408		2197	4300	6497	3057409	SO:0001583	missense	9235	exon3			M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	ENST00000534507.1:c.46G>A	16.37:g.3117408G>A	ENSP00000431775:p.Ala16Thr	Somatic		Capture	SOLID	Phase_I	3057409	NM_004221	A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Missense_Mutation	SNP	ENST00000534507.1	37		.	.	.	.	.	.	.	.	.	.	G	13.78	2.338301	0.41398	.	.	ENSG00000008517	ENST00000325568;ENST00000534507;ENST00000531965;ENST00000396887;ENST00000529699;ENST00000526464;ENST00000440815;ENST00000529550;ENST00000551122;ENST00000525643;ENST00000548807;ENST00000528163;ENST00000530890;ENST00000444393;ENST00000533097;ENST00000008180;ENST00000396890;ENST00000525228;ENST00000548652;ENST00000525377;ENST00000530538;ENST00000549213;ENST00000548476;ENST00000552664;ENST00000552356;ENST00000551513;ENST00000382213;ENST00000548246	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.74209	-0.75;0.56;0.72;0.54;0.55;-0.75;-0.75;-0.75;0.54;-0.75;0.56;-0.75;0.56;-0.75;-0.75;0.56;0.56;-0.8;-0.82;0.56;-0.75;0.54;0.56;-0.75;0.56;0.56;-0.82;0.55	2.13	-4.26	0.03755	.	.	.	.	.	T	0.46151	0.1378	N	0.08118	0	0.09310	N	1	P;P;P;P;P;P;P;P;P	0.44344	0.689;0.833;0.689;0.833;0.689;0.689;0.689;0.689;0.689	B;B;B;B;B;B;B;B;B	0.42030	0.096;0.373;0.096;0.373;0.096;0.096;0.281;0.096;0.136	T	0.45673	-0.9245	9	0.19590	T	0.45	.	3.0353	0.06119	0.4456:0.0:0.2849:0.2695	.	16;16;16;16;16;16;16;16;16	B8Q191;F8VSD2;C6GKH1;E9PIV2;A6NNM0;A8MPX0;P24001;P24001-2;P24001-4	.;.;.;.;.;.;IL32_HUMAN;.;.	T	16;16;6;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16;16	ENSP00000324742:A16T;ENSP00000431775:A16T;ENSP00000433177:A6T;ENSP00000380096:A16T;ENSP00000436937:A16T;ENSP00000450364:A16T;ENSP00000405063:A16T;ENSP00000437020:A16T;ENSP00000447496:A16T;ENSP00000432218:A16T;ENSP00000448354:A16T;ENSP00000432850:A16T;ENSP00000433747:A16T;ENSP00000411958:A16T;ENSP00000432917:A16T;ENSP00000008180:A16T;ENSP00000380099:A16T;ENSP00000431740:A16T;ENSP00000446624:A16T;ENSP00000433866:A16T;ENSP00000436929:A16T;ENSP00000447812:A16T;ENSP00000449483:A16T;ENSP00000448683:A16T;ENSP00000446978:A16T;ENSP00000449147:A16T;ENSP00000371648:A16T;ENSP00000447979:A16T	ENSP00000008180:A16T	A	+	1	0	IL32	3057409	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.895000	0.00707	-1.436000	0.01970	0.551000	0.68910	GCC		0.537	IL32-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000394812.2	NM_004221	
PLK1	5347	hgsc.bcm.edu	37	16	23692355	23692355	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:23692355A>G	ENST00000300093.4	+	3	809	c.698A>G	c.(697-699)gAt>gGt	p.D233G	PLK1_ENST00000564202.1_3'UTR	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	233	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.D233G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		TTCGAGGTGGATGTGTGGTCC	0.517																																					p.D233G	Colon(12;240 564 27038 33155)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A698G	16						.						237.0	210.0	219.0					16																	23692355		2197	4300	6497	23599856	SO:0001583	missense	5347	exon3				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.698A>G	16.37:g.23692355A>G	ENSP00000300093:p.Asp233Gly	Somatic		Capture	SOLID	Phase_I	23599856	NM_005030	Q15153|Q99746	Missense_Mutation	SNP	ENST00000300093.4	37	CCDS10616.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.812966	0.90707	.	.	ENSG00000166851	ENST00000300093;ENST00000425844	T	0.75589	-0.95	5.27	5.27	0.74061	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91791	0.7403	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94581	0.7779	10	0.87932	D	0	-17.7663	13.1379	0.59419	1.0:0.0:0.0:0.0	.	233	P53350	PLK1_HUMAN	G	233;136	ENSP00000300093:D233G	ENSP00000300093:D233G	D	+	2	0	PLK1	23599856	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	8.905000	0.92613	1.985000	0.57927	0.459000	0.35465	GAT		0.517	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030	
SIAH1	6477	hgsc.bcm.edu	37	16	48395627	48395627	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:48395627G>A	ENST00000380006.2	-	1	2166	c.713C>T	c.(712-714)gCg>gTg	p.A238V	LONP2_ENST00000564259.1_3'UTR|SIAH1_ENST00000394725.2_Missense_Mutation_p.A238V|SIAH1_ENST00000356721.3_Missense_Mutation_p.A269V			Q8IUQ4	SIAH1_HUMAN	siah E3 ubiquitin protein ligase 1	238	SBD.				anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell cycle (GO:0007049)|nervous system development (GO:0007399)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein catabolic process (GO:0030163)|protein destabilization (GO:0031648)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A238V(1)		endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|stomach(1)	7		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				TCGAGGAGTCGCTTCCCAAGT	0.443																																					p.A238V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C713T	16						.						99.0	84.0	89.0					16																	48395627		2200	4300	6500	46953128	SO:0001583	missense	6477	exon2			U76247	CCDS10735.1, CCDS32444.1	16q12.1	2013-06-03	2012-02-23		ENSG00000196470	ENSG00000196470			10857	protein-coding gene	gene with protein product		602212	"""seven in absentia homolog 1 (Drosophila)"""			9403064, 9334332	Standard	NM_001006610		Approved	hSIAH1	uc002efo.1	Q8IUQ4	OTTHUMG00000175417	ENST00000380006.2:c.713C>T	16.37:g.48395627G>A	ENSP00000369343:p.Ala238Val	Somatic		Capture	SOLID	Phase_I	46953128	NM_003031	A0FKF3|O43269|Q49A58|Q92880	Missense_Mutation	SNP	ENST00000380006.2	37	CCDS10735.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.549337	0.65311	.	.	ENSG00000196470	ENST00000356721;ENST00000394725;ENST00000380006	T;T	0.25579	1.79;1.79	5.55	5.55	0.83447	TRAF-type (1);Seven-in-absentia protein, TRAF-like domain (1);TRAF-like (1);	0.000000	0.85682	U	0.000000	T	0.60170	0.2248	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73380	0.968;0.98	T	0.66396	-0.5934	10	0.72032	D	0.01	-14.821	19.8667	0.96806	0.0:0.0:1.0:0.0	.	238;269	Q8IUQ4;Q8IUQ4-2	SIAH1_HUMAN;.	V	269;238;254	ENSP00000349156:A269V;ENSP00000378214:A238V	ENSP00000349156:A269V	A	-	2	0	SIAH1	46953128	1.000000	0.71417	0.994000	0.49952	0.271000	0.26615	9.813000	0.99286	2.773000	0.95371	0.655000	0.94253	GCG		0.443	SIAH1-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256842.12		
ADCY7	113	hgsc.bcm.edu	37	16	50348254	50348254	+	Missense_Mutation	SNP	G	G	A	rs371865539		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:50348254G>A	ENST00000394697.2	+	24	3248	c.2908G>A	c.(2908-2910)Gcc>Acc	p.A970T	ADCY7_ENST00000254235.3_Missense_Mutation_p.A970T			P51828	ADCY7_HUMAN	adenylate cyclase 7	970	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.A970T(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		GTTCAGCATCGCCCTGATGAG	0.637																																					p.A970T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2908A	16						.	G	THR/ALA	1,4395	2.1+/-5.4	0,1,2197	110.0	80.0	90.0		2908	5.1	1.0	16		90	0,8600		0,0,4300	no	missense	ADCY7	NM_001114.3	58	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	970/1081	50348254	1,12995	2198	4300	6498	48905755	SO:0001583	missense	113	exon23			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.2908G>A	16.37:g.50348254G>A	ENSP00000378187:p.Ala970Thr	Somatic		Capture	SOLID	Phase_I	48905755	NM_001114	A0AVA6	Missense_Mutation	SNP	ENST00000394697.2	37	CCDS10741.1	.	.	.	.	.	.	.	.	.	.	G	36	5.783517	0.96937	2.27E-4	0.0	ENSG00000121281	ENST00000394697;ENST00000254235	T;T	0.33654	1.4;1.4	5.12	5.12	0.69794	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.44097	U	0.000489	T	0.65165	0.2665	M	0.85099	2.735	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65327	-0.6195	10	0.35671	T	0.21	.	18.7502	0.91810	0.0:0.0:1.0:0.0	.	970	P51828	ADCY7_HUMAN	T	970	ENSP00000378187:A970T;ENSP00000254235:A970T	ENSP00000254235:A970T	A	+	1	0	ADCY7	48905755	1.000000	0.71417	0.989000	0.46669	0.985000	0.73830	9.578000	0.98200	2.664000	0.90586	0.655000	0.94253	GCC		0.637	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256877.3		
CETP	1071	hgsc.bcm.edu	37	16	57003551	57003551	+	Missense_Mutation	SNP	G	G	A	rs150236668		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:57003551G>A	ENST00000566128.1	+	4	469	c.202G>A	c.(202-204)Gag>Aag	p.E68K	CETP_ENST00000569082.1_3'UTR|CETP_ENST00000379780.2_Missense_Mutation_p.E133K|CETP_ENST00000200676.3_Missense_Mutation_p.E133K					cholesteryl ester transfer protein, plasma									p.E133K(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(4)|skin(3)	23						CATTGACTTCGAGATCGACTC	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		21591	0.0		0.0	False		,,,				2504	0.001				p.E133K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G397A	16						.	G	LYS/GLU	0,4396		0,0,2198	154.0	124.0	134.0		397	4.1	0.0	16	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	missense	CETP	NM_000078.2	56	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	133/494	57003551	1,12995	2198	4300	6498	55561052	SO:0001583	missense	1071	exon4			M30185	CCDS10772.1, CCDS67032.1	16q13	2012-10-02			ENSG00000087237	ENSG00000087237		"""BPI fold containing"""	1869	protein-coding gene	gene with protein product	"""BPI fold containing family F"""	118470				3600759, 2334701	Standard	NM_000078		Approved	BPIFF	uc002eki.2	P11597	OTTHUMG00000133279	ENST00000566128.1:c.202G>A	16.37:g.57003551G>A	ENSP00000456276:p.Glu68Lys	Somatic		Capture	SOLID	Phase_I	55561052	NM_000078		Missense_Mutation	SNP	ENST00000566128.1	37		.	.	.	.	.	.	.	.	.	.	G	19.86	3.905586	0.72868	0.0	1.16E-4	ENSG00000087237	ENST00000200676;ENST00000379780	T;T	0.05513	3.43;3.43	4.08	4.08	0.47627	Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.000000	0.85682	U	0.000000	T	0.14227	0.0344	L	0.36672	1.1	0.30028	N	0.813695	D;D	0.76494	0.999;0.986	D;P	0.74023	0.982;0.859	T	0.02789	-1.1110	10	0.27082	T	0.32	-13.097	13.0048	0.58699	0.0:0.0:1.0:0.0	.	133;133	P11597-2;P11597	.;CETP_HUMAN	K	133	ENSP00000200676:E133K;ENSP00000369106:E133K	ENSP00000200676:E133K	E	+	1	0	CETP	55561052	1.000000	0.71417	0.034000	0.17996	0.003000	0.03518	5.968000	0.70413	1.805000	0.52779	0.655000	0.94253	GAG		0.582	CETP-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000432305.1	NM_000078	
CETP	1071	hgsc.bcm.edu	37	16	57007363	57007363	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:57007363G>A	ENST00000566128.1	+	9	943	c.676G>A	c.(676-678)Gcc>Acc	p.A226T	CETP_ENST00000379780.2_Intron|CETP_ENST00000200676.3_Missense_Mutation_p.A291T					cholesteryl ester transfer protein, plasma									p.A291T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(4)|skin(3)	23						CCACTCGCTGGCCAAGGTAGC	0.617																																					p.A291T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G871A	16						.						78.0	71.0	74.0					16																	57007363		2198	4300	6498	55564864	SO:0001583	missense	1071	exon9			M30185	CCDS10772.1, CCDS67032.1	16q13	2012-10-02			ENSG00000087237	ENSG00000087237		"""BPI fold containing"""	1869	protein-coding gene	gene with protein product	"""BPI fold containing family F"""	118470				3600759, 2334701	Standard	NM_000078		Approved	BPIFF	uc002eki.2	P11597	OTTHUMG00000133279	ENST00000566128.1:c.676G>A	16.37:g.57007363G>A	ENSP00000456276:p.Ala226Thr	Somatic		Capture	SOLID	Phase_I	55564864	NM_000078		Missense_Mutation	SNP	ENST00000566128.1	37		.	.	.	.	.	.	.	.	.	.	G	15.87	2.961824	0.53400	.	.	ENSG00000087237	ENST00000200676	T	0.07114	3.22	3.8	3.8	0.43715	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.333020	0.29515	N	0.011932	T	0.15782	0.0380	L	0.34521	1.04	0.27078	N	0.963168	D	0.58268	0.982	P	0.62885	0.908	T	0.01853	-1.1260	10	0.49607	T	0.09	-2.559	12.373	0.55265	0.0:0.0:1.0:0.0	.	291	P11597	CETP_HUMAN	T	291	ENSP00000200676:A291T	ENSP00000200676:A291T	A	+	1	0	CETP	55564864	1.000000	0.71417	0.977000	0.42913	0.206000	0.24218	2.357000	0.44125	1.664000	0.50801	0.313000	0.20887	GCC		0.617	CETP-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000432305.1	NM_000078	
RSPRY1	89970	hgsc.bcm.edu	37	16	57265222	57265222	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:57265222T>G	ENST00000537866.1	+	13	2393	c.1520T>G	c.(1519-1521)aTt>aGt	p.I507S	RSPRY1_ENST00000394420.4_Missense_Mutation_p.I507S|RSPRY1_ENST00000563073.1_3'UTR			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	507						extracellular region (GO:0005576)	zinc ion binding (GO:0008270)	p.I507S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						GAAAAAATCATTTTGCCAAGG	0.333																																					p.I507S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1520G	16						.						90.0	86.0	87.0					16																	57265222		2198	4300	6498	55822723	SO:0001583	missense	89970	exon13			AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.1520T>G	16.37:g.57265222T>G	ENSP00000443176:p.Ile507Ser	Somatic		Capture	SOLID	Phase_I	55822723	NM_133368	Q6UX21|Q8ND53	Missense_Mutation	SNP	ENST00000537866.1	37	CCDS10775.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.630804	0.87660	.	.	ENSG00000159579	ENST00000394420;ENST00000537866	D;D	0.87179	-2.22;-2.22	5.78	5.78	0.91487	.	0.076574	0.85682	D	0.000000	D	0.92740	0.7692	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.92815	0.6267	10	0.51188	T	0.08	.	16.1167	0.81309	0.0:0.0:0.0:1.0	.	507	Q96DX4	RSPRY_HUMAN	S	507	ENSP00000377942:I507S;ENSP00000443176:I507S	ENSP00000377942:I507S	I	+	2	0	RSPRY1	55822723	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.673000	0.83973	2.204000	0.70986	0.528000	0.53228	ATT		0.333	RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432953.1	NM_133368	
CDH8	1006	hgsc.bcm.edu	37	16	61689413	61689413	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:61689413C>T	ENST00000577390.1	-	11	2821	c.1867G>A	c.(1867-1869)Gcc>Acc	p.A623T	CDH8_ENST00000577730.1_Missense_Mutation_p.A623T|CDH8_ENST00000299345.6_Missense_Mutation_p.A623T	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	623					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.A623T(2)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GCAATTAAGGCGCCCATACTG	0.443																																					p.A623T												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G1867A	16						.						108.0	90.0	96.0					16																	61689413		2203	4300	6503	60246914	SO:0001583	missense	1006	exon11			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1867G>A	16.37:g.61689413C>T	ENSP00000462701:p.Ala623Thr	Somatic		Capture	SOLID	Phase_I	60246914	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	36	5.767623	0.96914	.	.	ENSG00000150394	ENST00000299345	T	0.59502	0.26	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.82001	0.4942	M	0.92880	3.355	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.85800	0.1373	10	0.62326	D	0.03	.	18.4201	0.90587	0.0:1.0:0.0:0.0	.	623	P55286	CADH8_HUMAN	T	623	ENSP00000299345:A623T	ENSP00000299345:A623T	A	-	1	0	CDH8	60246914	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.440000	0.80464	2.599000	0.87857	0.561000	0.74099	GCC		0.443	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
CDH8	1006	hgsc.bcm.edu	37	16	61854974	61854974	+	Silent	SNP	A	A	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:61854974A>C	ENST00000577390.1	-	6	1833	c.879T>G	c.(877-879)acT>acG	p.T293T	CDH8_ENST00000577730.1_Silent_p.T293T|CDH8_ENST00000299345.6_Silent_p.T293T|CDH8_ENST00000584337.1_Silent_p.T293T	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	293	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.T293T(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TTCCTATTGCAGTGCCAAGAA	0.403																																					p.T293T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T879G	16						.						129.0	97.0	108.0					16																	61854974		2203	4300	6503	60412475	SO:0001819	synonymous_variant	1006	exon6			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.879T>G	16.37:g.61854974A>C		Somatic		Capture	SOLID	Phase_I	60412475	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	ENST00000577390.1	37	CCDS10802.1																																																																																				0.403	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
FHOD1	29109	hgsc.bcm.edu	37	16	67271603	67271603	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:67271603T>C	ENST00000258201.4	-	7	958	c.711A>G	c.(709-711)gcA>gcG	p.A237A		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	237	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.A237A(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		TGAACAGCGGTGCGTTGTTTT	0.567																																					p.A237A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A711G	16						.						109.0	95.0	100.0					16																	67271603		2198	4300	6498	65829104	SO:0001819	synonymous_variant	29109	exon7			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.711A>G	16.37:g.67271603T>C		Somatic		Capture	SOLID	Phase_I	65829104	NM_013241	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	ENST00000258201.4	37	CCDS10834.1																																																																																				0.567	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
TAT	6898	hgsc.bcm.edu	37	16	71610174	71610174	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:71610174C>T	ENST00000355962.4	-	2	278	c.145G>A	c.(145-147)Gcc>Acc	p.A49T	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	49					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)	p.A49T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	GTTTTCTTGGCCATGTCTGAG	0.498																																					p.A49T	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G145A	16						.						147.0	126.0	133.0					16																	71610174		2198	4300	6498	70167675	SO:0001583	missense	6898	exon2				CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.145G>A	16.37:g.71610174C>T	ENSP00000348234:p.Ala49Thr	Somatic		Capture	SOLID	Phase_I	70167675	NM_000353	B2R8I1|D3DWS2	Missense_Mutation	SNP	ENST00000355962.4	37	CCDS10903.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.211539	0.58343	.	.	ENSG00000198650	ENST00000355962	D	0.88586	-2.4	6.01	-0.645	0.11475	Tyrosine aminotransferase (1);Tyrosine/nicotianamine aminotransferase (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.254921	0.47093	D	0.000251	D	0.84383	0.5460	L	0.57536	1.79	0.38598	D	0.950594	P;B;B	0.39282	0.666;0.175;0.245	B;B;B	0.33339	0.162;0.136;0.16	T	0.79383	-0.1826	10	0.32370	T	0.25	-9.3032	17.2853	0.87139	0.3955:0.6045:0.0:0.0	.	49;49;49	Q8WW92;A1L4G7;P17735	.;.;ATTY_HUMAN	T	49	ENSP00000348234:A49T	ENSP00000348234:A49T	A	-	1	0	TAT	70167675	1.000000	0.71417	0.991000	0.47740	0.970000	0.65996	1.525000	0.35953	-0.400000	0.07656	-0.262000	0.10625	GCC		0.498	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1		
PHLPP2	23035	hgsc.bcm.edu	37	16	71689261	71689261	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:71689261G>A	ENST00000568954.1	-	17	2845	c.2467C>T	c.(2467-2469)Cga>Tga	p.R823*	RP11-432I5.6_ENST00000567077.1_RNA|PHLPP2_ENST00000567016.1_Nonsense_Mutation_p.R858*|PHLPP2_ENST00000356272.3_Nonsense_Mutation_p.R823*|PHLPP2_ENST00000393524.2_Nonsense_Mutation_p.R756*|PHLPP2_ENST00000360429.3_Nonsense_Mutation_p.R823*|PHLPP2_ENST00000540628.1_Nonsense_Mutation_p.R33*			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	823	PP2C-like.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.R823R(1)|p.R823*(1)		central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						TCCTCATTTCGGTCTCCATCA	0.478																																					p.R823X												.	.	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C2467T	16						.						189.0	175.0	180.0					16																	71689261		2198	4300	6498	70246762	SO:0001587	stop_gained	23035	exon16			BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.2467C>T	16.37:g.71689261G>A	ENSP00000457991:p.Arg823*	Somatic		Capture	SOLID	Phase_I	70246762	NM_015020	A1L374|Q9NV17|Q9Y2E3	Nonsense_Mutation	SNP	ENST00000568954.1	37	CCDS32479.1	.	.	.	.	.	.	.	.	.	.	G	39	7.874564	0.98537	.	.	ENSG00000040199	ENST00000540628;ENST00000299971;ENST00000360429;ENST00000356272;ENST00000393524	.	.	.	5.68	2.53	0.30540	.	0.121201	0.52532	D	0.000067	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5965	14.5922	0.68373	0.0:0.0:0.3673:0.6327	.	.	.	.	X	33;630;823;823;756	.	ENSP00000299971:R630X	R	-	1	2	PHLPP2	70246762	1.000000	0.71417	0.914000	0.36105	0.980000	0.70556	2.555000	0.45854	0.287000	0.22375	-0.182000	0.12963	CGA		0.478	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020	
MVP	9961	hgsc.bcm.edu	37	16	29848187	29848187	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:29848187A>G	ENST00000357402.5	+	7	955	c.817A>G	c.(817-819)Atc>Gtc	p.I273V	MVP_ENST00000452209.2_Missense_Mutation_p.H87R|MVP_ENST00000395353.1_Missense_Mutation_p.I273V	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	273					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)	p.I273V(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						GGTTGTGCCCATCACCACCCT	0.642																																					p.I273V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A817G	16						.						74.0	59.0	64.0					16																	29848187		2197	4300	6497	29755688	SO:0001583	missense	9961	exon7			X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.817A>G	16.37:g.29848187A>G	ENSP00000349977:p.Ile273Val	Somatic		Capture	SOLID	Phase_I	29755688	NM_017458	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	ENST00000357402.5	37	CCDS10656.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.41|14.41	2.527078|2.527078	0.44969|0.44969	.|.	.|.	ENSG00000013364|ENSG00000013364	ENST00000452209|ENST00000357402;ENST00000395353	T|T;T	0.63255|0.29142	-0.03|1.58;1.58	5.58|5.58	3.37|3.37	0.38596|0.38596	.|.	.|0.267740	.|0.38605	.|N	.|0.001629	T|T	0.14527|0.14527	0.0351|0.0351	N|N	0.17674|0.17674	0.51|0.51	0.23568|0.23568	N|N	0.997393|0.997393	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.32508|0.32508	-0.9904|-0.9904	7|10	0.87932|0.02654	D|T	0|1	-21.589|-21.589	7.8785|7.8785	0.29608|0.29608	0.8311:0.0:0.1689:0.0|0.8311:0.0:0.1689:0.0	.|.	.|273	.|Q14764	.|MVP_HUMAN	R|V	87|273	ENSP00000387916:H87R|ENSP00000349977:I273V;ENSP00000378760:I273V	ENSP00000387916:H87R|ENSP00000349977:I273V	H|I	+|+	2|1	0|0	MVP|MVP	29755688|29755688	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	2.964000|2.964000	0.49192|0.49192	0.946000|0.946000	0.37632|0.37632	0.379000|0.379000	0.24179|0.24179	CAT|ATC		0.642	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3	NM_005115	
TERF2IP	54386	hgsc.bcm.edu	37	16	75690391	75690391	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr16:75690391T>C	ENST00000300086.4	+	3	1179	c.1082T>C	c.(1081-1083)aTt>aCt	p.I361T		NM_018975.3	NP_061848.2	Q9NYB0	TE2IP_HUMAN	telomeric repeat binding factor 2, interacting protein	361					negative regulation of DNA recombination at telomere (GO:0048239)|negative regulation of telomere maintenance (GO:0032205)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of transcription, DNA-templated (GO:0006355)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear chromosome (GO:0000228)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.I361T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5						GGATATCCCATTTGGTCCCGA	0.448																																					p.I361T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1082C	16						.						149.0	153.0	151.0					16																	75690391		2198	4300	6498	74247892	SO:0001583	missense	54386	exon3			AK000669	CCDS32491.1	16q23.1	2012-10-03			ENSG00000166848	ENSG00000166848			19246	protein-coding gene	gene with protein product		605061				10850490	Standard	NM_018975		Approved	RAP1	uc002fet.2	Q9NYB0	OTTHUMG00000177136	ENST00000300086.4:c.1082T>C	16.37:g.75690391T>C	ENSP00000300086:p.Ile361Thr	Somatic		Capture	SOLID	Phase_I	74247892	NM_018975	B4DQN4|Q4W4Y2|Q8WYZ3|Q9NWR2	Missense_Mutation	SNP	ENST00000300086.4	37	CCDS32491.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175285	0.78564	.	.	ENSG00000166848	ENST00000300086	T	0.56103	0.48	5.84	5.84	0.93424	.	0.373438	0.30028	N	0.010582	T	0.59348	0.2187	L	0.29908	0.895	0.41676	D	0.989268	D	0.69078	0.997	P	0.61397	0.888	T	0.63906	-0.6531	10	0.87932	D	0	-10.8461	15.051	0.71867	0.0:0.0:0.0:1.0	.	361	Q9NYB0	TE2IP_HUMAN	T	361	ENSP00000300086:I361T	ENSP00000300086:I361T	I	+	2	0	TERF2IP	74247892	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.381000	0.66208	2.228000	0.72767	0.482000	0.46254	ATT		0.448	TERF2IP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000435519.1	NM_018975	
METTL4	64863	hgsc.bcm.edu	37	18	2544201	2544201	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr18:2544201C>T	ENST00000574538.1	-	8	2041	c.1266G>A	c.(1264-1266)ccG>ccA	p.P422P	METTL4_ENST00000319888.6_Intron	NM_022840.3	NP_073751.3	Q8N3J2	METL4_HUMAN	methyltransferase like 4	422					nucleobase-containing compound metabolic process (GO:0006139)		methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)	p.P422P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						TACCAGCAAGCGGTGGCTTAT	0.358																																					p.P422P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1266A	18						.						51.0	52.0	51.0					18																	2544201		2203	4300	6503	2534201	SO:0001819	synonymous_variant	64863	exon8				CCDS11826.1	18p11.31	2008-02-05			ENSG00000101574	ENSG00000101574			24726	protein-coding gene	gene with protein product						12477932	Standard	NM_022840		Approved	FLJ23017, HsT661	uc002klh.4	Q8N3J2	OTTHUMG00000131482	ENST00000574538.1:c.1266G>A	18.37:g.2544201C>T		Somatic		Capture	SOLID	Phase_I	2534201	NM_022840	B2RNA1|Q2TAA7|Q9H5U9	Silent	SNP	ENST00000574538.1	37	CCDS11826.1																																																																																				0.358	METTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254326.3	NM_022840	
DSC3	1825	hgsc.bcm.edu	37	18	28586945	28586945	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr18:28586945C>T	ENST00000360428.4	-	12	1896	c.1816G>A	c.(1816-1818)Gct>Act	p.A606T	DSC3_ENST00000434452.1_Missense_Mutation_p.A606T	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	606	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.A606T(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TAAAATGGAGCTCCATGGACA	0.348																																					p.A606T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1816A	18						.						97.0	97.0	97.0					18																	28586945		2203	4300	6503	26840943	SO:0001583	missense	1825	exon12			X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.1816G>A	18.37:g.28586945C>T	ENSP00000353608:p.Ala606Thr	Somatic		Capture	SOLID	Phase_I	26840943	NM_001941	A6NN35|Q14200|Q9HAZ9	Missense_Mutation	SNP	ENST00000360428.4	37	CCDS32810.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.973357	0.34848	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.60797	0.16;0.16	5.11	2.29	0.28610	Cadherin (2);Cadherin-like (1);	0.566788	0.13349	N	0.394533	T	0.57873	0.2083	L	0.60455	1.87	0.24240	N	0.99537	B;B	0.23249	0.024;0.082	B;B	0.28232	0.018;0.087	T	0.53173	-0.8476	10	0.48119	T	0.1	.	16.5526	0.84476	0.0:0.5389:0.4611:0.0	.	606;606	Q14574;Q14574-2	DSC3_HUMAN;.	T	606	ENSP00000353608:A606T;ENSP00000392068:A606T	ENSP00000353608:A606T	A	-	1	0	DSC3	26840943	0.637000	0.27216	0.544000	0.28141	0.912000	0.54170	0.794000	0.26958	0.291000	0.22468	0.563000	0.77884	GCT		0.348	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423	
MOCOS	55034	hgsc.bcm.edu	37	18	33831198	33831198	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr18:33831198A>G	ENST00000261326.5	+	11	2137	c.2116A>G	c.(2116-2118)Aaa>Gaa	p.K706E		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase									p.K706E(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TCATTTGATCAAACAAAGTTC	0.378																																					p.K706E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2116G	18						.						114.0	104.0	108.0					18																	33831198		2203	4300	6503	32085196	SO:0001583	missense	55034	exon11			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.2116A>G	18.37:g.33831198A>G	ENSP00000261326:p.Lys706Glu	Somatic		Capture	SOLID	Phase_I	32085196	NM_017947		Missense_Mutation	SNP	ENST00000261326.5	37	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	A	16.01	3.001361	0.54254	.	.	ENSG00000075643	ENST00000261326	T	0.17691	2.26	5.52	5.52	0.82312	Pyruvate kinase-like, insert domain (1);Molybdenum cofactor sulfurase, C-terminal (1);	0.146835	0.64402	D	0.000008	T	0.23965	0.0580	M	0.72894	2.215	0.30109	N	0.806771	P	0.48230	0.907	B	0.43478	0.421	T	0.30937	-0.9961	10	0.59425	D	0.04	-6.1156	12.0482	0.53491	1.0:0.0:0.0:0.0	.	706	Q96EN8	MOCOS_HUMAN	E	706	ENSP00000261326:K706E	ENSP00000261326:K706E	K	+	1	0	MOCOS	32085196	1.000000	0.71417	0.990000	0.47175	0.424000	0.31475	6.042000	0.70996	2.100000	0.63781	0.533000	0.62120	AAA		0.378	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
HDHD2	84064	hgsc.bcm.edu	37	18	44660877	44660877	+	Silent	SNP	A	A	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr18:44660877A>T	ENST00000300605.6	-	3	452	c.300T>A	c.(298-300)ccT>ccA	p.P100P	HDHD2_ENST00000587841.1_Intron	NM_032124.4	NP_115500.1	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain containing 2	100						extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)	p.P100P(1)		kidney(2)|large_intestine(2)|lung(1)|skin(1)	6						CTTTGAAATCAGGTAGTGCCC	0.358																																					p.P100P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T300A	18						.						66.0	64.0	65.0					18																	44660877		2203	4300	6503	42914875	SO:0001819	synonymous_variant	84064	exon3			AL136681	CCDS32829.1	18q21.1	2008-02-05				ENSG00000167220			25364	protein-coding gene	gene with protein product						11230166	Standard	NM_032124		Approved	DKFZP564D1378	uc002lcs.3	Q9H0R4		ENST00000300605.6:c.300T>A	18.37:g.44660877A>T		Somatic		Capture	SOLID	Phase_I	42914875	NM_032124	A8K7T3|Q96NV4	Silent	SNP	ENST00000300605.6	37	CCDS32829.1																																																																																				0.358	HDHD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450668.2	NM_032124	
MC4R	4160	hgsc.bcm.edu	37	18	58038875	58038875	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr18:58038875G>A	ENST00000299766.3	-	1	1126	c.708C>T	c.(706-708)cgC>cgT	p.R236R		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	236					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)	p.R236R(1)		endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				TGGCACCTTGGCGGATGGCAC	0.517																																					p.R236R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C708T	18						.						71.0	66.0	68.0					18																	58038875		2203	4300	6503	56189855	SO:0001819	synonymous_variant	4160	exon1			AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.708C>T	18.37:g.58038875G>A		Somatic		Capture	SOLID	Phase_I	56189855	NM_005912	B2RAC3|Q16317|Q3MIJ6	Silent	SNP	ENST00000299766.3	37	CCDS11976.1																																																																																				0.517	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256139.1	NM_005912	
SOCS6	9306	hgsc.bcm.edu	37	18	67992415	67992415	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr18:67992415G>A	ENST00000397942.3	+	2	827	c.511G>A	c.(511-513)Gtc>Atc	p.V171I	SOCS6_ENST00000582322.1_Missense_Mutation_p.V171I	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	171					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)		p.V171I(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				CCTGAATGGCGTCCGGAAGGA	0.567																																					p.V171I	Melanoma(84;1024 1361 24382 36583 42651)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G511A	18						.						62.0	54.0	57.0					18																	67992415		2203	4300	6503	66143395	SO:0001583	missense	9306	exon2			AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.511G>A	18.37:g.67992415G>A	ENSP00000381034:p.Val171Ile	Somatic		Capture	SOLID	Phase_I	66143395	NM_004232	Q8WUM3	Missense_Mutation	SNP	ENST00000397942.3	37	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	G	8.963	0.971131	0.18659	.	.	ENSG00000170677	ENST00000397942	T	0.28895	1.59	5.12	5.12	0.69794	.	0.220919	0.36893	N	0.002352	T	0.24509	0.0594	L	0.34521	1.04	0.51012	D	0.999901	B	0.31968	0.349	B	0.17722	0.019	T	0.03175	-1.1064	10	0.38643	T	0.18	-11.8366	18.5771	0.91159	0.0:0.0:1.0:0.0	.	171	O14544	SOCS6_HUMAN	I	171	ENSP00000381034:V171I	ENSP00000381034:V171I	V	+	1	0	SOCS6	66143395	1.000000	0.71417	0.041000	0.18516	0.005000	0.04900	4.990000	0.63876	2.371000	0.80710	0.561000	0.74099	GTC		0.567	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
CNDP2	55748	hgsc.bcm.edu	37	18	72179721	72179721	+	Silent	SNP	C	C	T	rs201331505		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr18:72179721C>T	ENST00000324262.4	+	7	1012	c.696C>T	c.(694-696)taC>taT	p.Y232Y	CNDP2_ENST00000579847.1_Silent_p.Y232Y|CNDP2_ENST00000324301.8_Silent_p.Y148Y	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	232					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.Y232Y(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		CTGGGGTGTACGGGGGCTCGG	0.542																																					p.Y232Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C696T	18						.	C	,	0,4406		0,0,2203	212.0	168.0	183.0		444,696	-4.6	0.5	18		183	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	CNDP2	NM_001168499.1,NM_018235.2	,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,	148/392,232/476	72179721	2,13004	2203	4300	6503	70330701	SO:0001819	synonymous_variant	55748	exon7			AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.696C>T	18.37:g.72179721C>T		Somatic		Capture	SOLID	Phase_I	70330701	NM_018235	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Silent	SNP	ENST00000324262.4	37	CCDS12006.1																																																																																				0.542	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
SEC13	6396	hgsc.bcm.edu	37	3	10357076	10357076	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:10357076G>A	ENST00000350697.3	-	3	218	c.93C>T	c.(91-93)tgC>tgT	p.C31C	SEC13_ENST00000397109.3_Silent_p.C17C|SEC13_ENST00000383801.2_Silent_p.C77C|SEC13_ENST00000337354.4_Silent_p.C34C|SEC13_ENST00000397117.1_Silent_p.C17C	NM_183352.1	NP_899195.1	P55735	SEC13_HUMAN	SEC13 homolog (S. cerevisiae)	31					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.C31C(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17						TGTCTGATGAGCAGGTTGCCA	0.622																																					p.C17C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C51T	3						.						68.0	62.0	64.0					3																	10357076		2203	4300	6503	10332076	SO:0001819	synonymous_variant	6396	exon3				CCDS2599.1, CCDS46751.1, CCDS63540.1	3p25-p24	2013-01-10	2006-11-07	2006-11-07	ENSG00000157020	ENSG00000157020		"""WD repeat domain containing"""	10697	protein-coding gene	gene with protein product		600152	"""SEC13 (S. cerevisiae)-like 1"", ""SEC13-like 1 (S. cerevisiae)"""	D3S1231E, SEC13L1		7987303	Standard	NM_183352		Approved	SEC13R, npp-20	uc003bvn.3	P55735	OTTHUMG00000128671	ENST00000350697.3:c.93C>T	3.37:g.10357076G>A		Somatic		Capture	SOLID	Phase_I	10332076	NM_001136232	A8MV37|B4DXJ1|Q5BJF0|Q9BRM6|Q9BUG7	Silent	SNP	ENST00000350697.3	37	CCDS2599.1																																																																																				0.622	SEC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250563.3		
SLC6A11	6538	hgsc.bcm.edu	37	3	10861169	10861169	+	Silent	SNP	C	C	T	rs376760918		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:10861169C>T	ENST00000254488.2	+	2	342	c.276C>T	c.(274-276)taC>taT	p.Y92Y	SLC6A11_ENST00000454147.1_Silent_p.Y92Y	NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	92					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)	p.Y92Y(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	TGATTCCCTACGTGGTGTTTT	0.428																																					p.Y92Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C276T	3						.	C		1,4405	2.1+/-5.4	0,1,2202	207.0	199.0	202.0		276	-2.3	1.0	3		202	0,8600		0,0,4300	no	coding-synonymous	SLC6A11	NM_014229.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		92/633	10861169	1,13005	2203	4300	6503	10836169	SO:0001819	synonymous_variant	6538	exon2			S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.276C>T	3.37:g.10861169C>T		Somatic		Capture	SOLID	Phase_I	10836169	NM_014229	B2R6U6|Q8IYC9	Silent	SNP	ENST00000254488.2	37	CCDS2602.1																																																																																				0.428	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229	
FBXO40	51725	hgsc.bcm.edu	37	3	121345749	121345749	+	Missense_Mutation	SNP	G	G	A	rs377351705		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:121345749G>A	ENST00000338040.4	+	4	2536	c.2122G>A	c.(2122-2124)Gtc>Atc	p.V708I		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	708					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V708I(1)		NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		AGGAAGATACGTCTCCTAAAA	0.493																																					p.V708I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2122A	3						.	G	ILE/VAL	0,4406		0,0,2203	61.0	62.0	61.0		2122	-7.6	0.0	3		61	2,8598	2.2+/-6.3	0,2,4298	no	missense	FBXO40	NM_016298.3	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	708/710	121345749	2,13004	2203	4300	6503	122828439	SO:0001583	missense	51725	exon4			AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.2122G>A	3.37:g.121345749G>A	ENSP00000337510:p.Val708Ile	Somatic		Capture	SOLID	Phase_I	122828439	NM_016298	B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	37	CCDS33835.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.709765	0.30322	0.0	2.33E-4	ENSG00000163833	ENST00000338040	T	0.30714	1.52	5.16	-7.6	0.01303	.	2.416860	0.01233	N	0.008418	T	0.10723	0.0262	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.20472	-1.0274	10	0.22706	T	0.39	7.8735	8.2191	0.31530	0.1654:0.118:0.61:0.1067	.	708	Q9UH90	FBX40_HUMAN	I	708	ENSP00000337510:V708I	ENSP00000337510:V708I	V	+	1	0	FBXO40	122828439	0.000000	0.05858	0.000000	0.03702	0.255000	0.26057	-1.462000	0.02364	-0.957000	0.03627	-0.793000	0.03317	GTC		0.493	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	NM_016298	
TMEM40	55287	hgsc.bcm.edu	37	3	12779235	12779235	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:12779235T>C	ENST00000314124.7	-	8	799	c.443A>G	c.(442-444)cAg>cGg	p.Q148R	TMEM40_ENST00000264728.8_Missense_Mutation_p.Q148R|TMEM40_ENST00000435218.2_Missense_Mutation_p.Q118R|TMEM40_ENST00000431022.2_Missense_Mutation_p.Q164R|TMEM40_ENST00000435575.1_Missense_Mutation_p.Q72R|TMEM40_ENST00000476331.1_5'UTR	NM_001284406.1|NM_018306.2	NP_001271335.1|NP_060776.2	Q8WWA1	TMM40_HUMAN	transmembrane protein 40	148						integral component of membrane (GO:0016021)		p.Q148R(1)		breast(1)|large_intestine(3)|lung(5)|urinary_tract(1)	10						TCTTCTTAACTGAGAGGCCTC	0.428																																					p.Q148R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A443G	3						.						134.0	129.0	131.0					3																	12779235		2203	4300	6503	12754235	SO:0001583	missense	55287	exon8			BC020658	CCDS2613.1, CCDS68347.1, CCDS68348.1	3p25.2	2005-01-10			ENSG00000088726	ENSG00000088726			25620	protein-coding gene	gene with protein product						12477932	Standard	NM_018306		Approved	FLJ11036	uc003bxg.1	Q8WWA1	OTTHUMG00000129801	ENST00000314124.7:c.443A>G	3.37:g.12779235T>C	ENSP00000322837:p.Gln148Arg	Somatic		Capture	SOLID	Phase_I	12754235	NM_018306	C9JID5|Q8NAL4|Q9NUZ4	Missense_Mutation	SNP	ENST00000314124.7	37	CCDS2613.1	.	.	.	.	.	.	.	.	.	.	T	10.23	1.292104	0.23564	.	.	ENSG00000088726	ENST00000314124;ENST00000435575;ENST00000435218;ENST00000264728;ENST00000431022	.	.	.	5.37	1.54	0.23209	.	0.922165	0.09112	N	0.846945	T	0.40719	0.1128	L	0.53249	1.67	0.09310	N	1	B;B;B;B	0.14438	0.004;0.0;0.01;0.002	B;B;B;B	0.12156	0.007;0.003;0.005;0.005	T	0.40327	-0.9569	9	0.62326	D	0.03	.	4.9845	0.14183	0.0:0.1791:0.1707:0.6502	.	164;72;118;148	B4DXI0;C9JID5;Q8WWA1-2;Q8WWA1	.;.;.;TMM40_HUMAN	R	148;72;118;148;164	.	ENSP00000264728:Q148R	Q	-	2	0	TMEM40	12754235	0.700000	0.27796	0.148000	0.22405	0.827000	0.46813	0.413000	0.21148	0.403000	0.25479	0.533000	0.62120	CAG		0.428	TMEM40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252029.2	NM_018306	
ZNF148	7707	hgsc.bcm.edu	37	3	124953099	124953099	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:124953099T>C	ENST00000360647.4	-	8	1227	c.742A>G	c.(742-744)Act>Gct	p.T248A	ZNF148_ENST00000497929.1_5'UTR|ZNF148_ENST00000544464.1_Intron|ZNF148_ENST00000468369.1_Intron|ZNF148_ENST00000485866.1_Missense_Mutation_p.T248A|ZNF148_ENST00000492394.1_Missense_Mutation_p.T248A|ZNF148_ENST00000484491.1_Missense_Mutation_p.T248A|SLC12A8_ENST00000423114.2_Intron	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	248					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.T248A(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						CCACTATGAGTTCTCTTATGC	0.303																																					p.T248A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A742G	3						.						114.0	116.0	115.0					3																	124953099		2203	4295	6498	126435789	SO:0001583	missense	7707	exon8			U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.742A>G	3.37:g.124953099T>C	ENSP00000353863:p.Thr248Ala	Somatic		Capture	SOLID	Phase_I	126435789	NM_021964	D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Missense_Mutation	SNP	ENST00000360647.4	37	CCDS3031.1	.	.	.	.	.	.	.	.	.	.	T	15.69	2.908441	0.52333	.	.	ENSG00000163848	ENST00000360647;ENST00000484491;ENST00000492394;ENST00000485866;ENST00000543574	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	5.32	5.32	0.75619	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.23649	0.0572	L	0.52905	1.665	0.80722	D	1	P	0.47677	0.899	B	0.39971	0.315	T	0.03555	-1.1025	10	0.66056	D	0.02	-0.4646	15.4436	0.75208	0.0:0.0:0.0:1.0	.	248	Q9UQR1	ZN148_HUMAN	A	248	ENSP00000353863:T248A;ENSP00000420335:T248A;ENSP00000419322:T248A;ENSP00000420448:T248A	ENSP00000353863:T248A	T	-	1	0	ZNF148	126435789	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.868000	0.87116	2.230000	0.72887	0.528000	0.53228	ACT		0.303	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355452.4	NM_021964	
CNTN6	27255	hgsc.bcm.edu	37	3	1337440	1337440	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:1337440C>G	ENST00000446702.2	+	6	1237	c.610C>G	c.(610-612)Cag>Gag	p.Q204E	CNTN6_ENST00000350110.2_Missense_Mutation_p.Q204E|CNTN6_ENST00000539053.1_Missense_Mutation_p.Q132E			Q9UQ52	CNTN6_HUMAN	contactin 6	204	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.Q204E(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CAAAGAGGCCCAGAGAAGTGT	0.438																																					p.Q204E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C610G	3						.						79.0	73.0	75.0					3																	1337440		2203	4300	6503	1312440	SO:0001583	missense	27255	exon6			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.610C>G	3.37:g.1337440C>G	ENSP00000407822:p.Gln204Glu	Somatic		Capture	SOLID	Phase_I	1312440	NM_014461	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	37	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.924631	0.34002	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.64991	-0.13;-0.13;-0.13	5.95	5.06	0.68205	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.774617	0.11552	N	0.552639	T	0.46229	0.1382	N	0.13043	0.29	0.09310	N	1	B;B	0.20164	0.029;0.042	B;B	0.24006	0.05;0.024	T	0.36261	-0.9755	10	0.36615	T	0.2	.	9.8788	0.41220	0.3707:0.5065:0.1228:0.0	.	132;204	B4DGV0;Q9UQ52	.;CNTN6_HUMAN	E	204;132;204	ENSP00000407822:Q204E;ENSP00000442791:Q132E;ENSP00000341882:Q204E	ENSP00000341882:Q204E	Q	+	1	0	CNTN6	1312440	0.000000	0.05858	0.927000	0.36925	0.989000	0.77384	0.417000	0.21214	1.483000	0.48342	0.655000	0.94253	CAG		0.438	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
IFT122	55764	hgsc.bcm.edu	37	3	129238001	129238001	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:129238001A>G	ENST00000348417.2	+	28	3520	c.3443A>G	c.(3442-3444)gAc>gGc	p.D1148G	IFT122_ENST00000296266.3_Missense_Mutation_p.D1199G|IFT122_ENST00000440957.2_Missense_Mutation_p.D939G|IFT122_ENST00000349441.2_Missense_Mutation_p.D1038G|IFT122_ENST00000507564.1_Missense_Mutation_p.D1141G|IFT122_ENST00000347300.2_Missense_Mutation_p.D1089G|IFT122_ENST00000431818.2_Missense_Mutation_p.D998G|IFT122_ENST00000504021.1_Missense_Mutation_p.D1025G	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	1148					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)		p.D1199G(1)		breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						GGAGATGAGGACCCGTTCACA	0.582																																					p.D1038G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3113G	3						.						121.0	112.0	115.0					3																	129238001		2203	4300	6503	130720691	SO:0001583	missense	55764	exon25			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.3443A>G	3.37:g.129238001A>G	ENSP00000324005:p.Asp1148Gly	Somatic		Capture	SOLID	Phase_I	130720691	NM_052990	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	ENST00000348417.2	37	CCDS3061.1	.	.	.	.	.	.	.	.	.	.	A	19.62	3.862222	0.71949	.	.	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957	T;T;T;T;T;T;T;T	0.67345	0.37;-0.26;-0.13;-0.06;0.52;0.52;0.39;-0.06	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.75635	0.3876	L	0.38175	1.15	0.80722	D	1	P;D;D;D;D;D;D;D;P;D	0.89917	0.925;1.0;0.997;1.0;1.0;1.0;1.0;1.0;0.935;0.961	P;D;D;D;D;D;D;D;B;P	0.97110	0.616;1.0;0.98;0.994;0.996;0.992;0.988;0.995;0.411;0.616	T	0.78237	-0.2282	10	0.87932	D	0	-32.6036	16.1864	0.81955	1.0:0.0:0.0:0.0	.	939;474;1141;536;1025;990;1038;1089;1148;1199	E9PDG2;B3KUD1;E7EQF4;B3KT43;B4DEY9;B4DPW7;Q9BTY4;Q9HBG6-3;Q9HBG6;G3XAB1	.;.;.;.;.;.;.;.;IF122_HUMAN;.	G	1089;1199;1141;998;1025;1038;1148;990;939	ENSP00000323973:D1089G;ENSP00000296266:D1199G;ENSP00000425536:D1141G;ENSP00000410946:D998G;ENSP00000422179:D1025G;ENSP00000324165:D1038G;ENSP00000324005:D1148G;ENSP00000401569:D939G	ENSP00000296266:D1199G	D	+	2	0	IFT122	130720691	1.000000	0.71417	0.996000	0.52242	0.315000	0.28087	8.334000	0.90028	2.225000	0.72522	0.533000	0.62120	GAC		0.582	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262	
ACKR4	51554	hgsc.bcm.edu	37	3	132319406	132319406	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:132319406A>G	ENST00000249887.2	+	2	261	c.165A>G	c.(163-165)ggA>ggG	p.G55G	ACAD11_ENST00000545291.1_Intron|ACAD11_ENST00000355458.3_Intron|ACAD11_ENST00000264990.6_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	55					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.G55G(1)									TCGTCATTGGACTTGCAGGCA	0.378																																					p.G55G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A165G	3						.						74.0	72.0	72.0					3																	132319406		2203	4299	6502	133802096	SO:0001819	synonymous_variant	51554	exon1			AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.165A>G	3.37:g.132319406A>G		Somatic		Capture	SOLID	Phase_I	133802096	NM_178445	B2R9U7	Silent	SNP	ENST00000249887.2	37	CCDS3075.1																																																																																				0.378	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357238.2	NM_016557	
SOX2	6657	hgsc.bcm.edu	37	3	181430445	181430445	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:181430445G>A	ENST00000325404.1	+	1	724	c.297G>A	c.(295-297)gcG>gcA	p.A99A	SOX2_ENST00000431565.2_Silent_p.A99A	NM_003106.3	NP_003097.1	P48431	SOX2_HUMAN	SRY (sex determining region Y)-box 2	99					adenohypophysis development (GO:0021984)|cell cycle arrest (GO:0007050)|cerebral cortex development (GO:0021987)|chromatin organization (GO:0006325)|detection of mechanical stimulus involved in equilibrioception (GO:0050973)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|diencephalon morphogenesis (GO:0048852)|endodermal cell fate specification (GO:0001714)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|eye development (GO:0001654)|forebrain development (GO:0030900)|forebrain neuron differentiation (GO:0021879)|glial cell fate commitment (GO:0021781)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|male genitalia development (GO:0030539)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|osteoblast differentiation (GO:0001649)|pigment biosynthetic process (GO:0046148)|pituitary gland development (GO:0021983)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to growth factor (GO:0070848)|response to retinoic acid (GO:0032526)|response to wounding (GO:0009611)|retina morphogenesis in camera-type eye (GO:0060042)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.A99A(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	10	all_cancers(143;1.22e-16)|Ovarian(172;0.0283)		all cancers(12;1.82e-48)|Epithelial(37;9.85e-40)|OV - Ovarian serous cystadenocarcinoma(80;7.37e-23)|Lung(8;2.01e-21)|GBM - Glioblastoma multiforme(1;2.13e-08)			GGCTGCGAGCGCTGCACATGA	0.602			A		"""NSCLC, oesophageal squamous carcinoma"""		MICROPHTHALMIA AND ESOPHAGEAL ATRESIA SYNDROME																														p.A99A			Dom	yes		3	3q26.3-q27	6657	SRY (sex determining region Y)-box 2	yes	E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G297A	3						.						30.0	35.0	33.0					3																	181430445		2203	4300	6503	182913139	SO:0001819	synonymous_variant	6657	exon1			BC013923	CCDS3239.1	3q26.3-q27	2014-09-17						"""SRY (sex determining region Y)-boxes"""	11195	protein-coding gene	gene with protein product		184429				7849401	Standard	NM_003106		Approved		uc003fkx.3	P48431		ENST00000325404.1:c.297G>A	3.37:g.181430445G>A		Somatic		Capture	SOLID	Phase_I	182913139	NM_003106	Q14537	Silent	SNP	ENST00000325404.1	37	CCDS3239.1																																																																																				0.602	SOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350419.1	NM_003106	
KCNH8	131096	hgsc.bcm.edu	37	3	19295253	19295253	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:19295253C>A	ENST00000328405.2	+	2	450	c.184C>A	c.(184-186)Cag>Aag	p.Q62K		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	62	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.Q62K(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TGAAGTCATGCAGAAGAGTTG	0.463																																					p.Q62K	NSCLC(124;1625 1765 8018 24930 42026)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C184A	3						.						170.0	178.0	175.0					3																	19295253		2203	4300	6503	19270257	SO:0001583	missense	131096	exon2			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.184C>A	3.37:g.19295253C>A	ENSP00000328813:p.Gln62Lys	Somatic		Capture	SOLID	Phase_I	19270257	NM_144633	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	C	31	5.065466	0.93898	.	.	ENSG00000183960	ENST00000328405	D	0.99519	-6.07	5.48	5.48	0.80851	PAS fold-3 (1);PAS (1);	0.000000	0.30630	U	0.009206	D	0.99501	0.9822	M	0.85041	2.73	0.80722	D	1	B;D	0.54207	0.151;0.965	B;P	0.61722	0.344;0.893	D	0.98750	1.0720	9	.	.	.	.	19.3515	0.94389	0.0:1.0:0.0:0.0	.	62;62	B7Z398;Q96L42	.;KCNH8_HUMAN	K	62	ENSP00000328813:Q62K	.	Q	+	1	0	KCNH8	19270257	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.743000	0.85020	2.554000	0.86153	0.655000	0.94253	CAG		0.463	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
DNAJB11	51726	hgsc.bcm.edu	37	3	186288750	186288750	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:186288750G>A	ENST00000439351.1	+	2	993	c.64G>A	c.(64-66)Gcc>Acc	p.A22T	DNAJB11_ENST00000265028.3_Missense_Mutation_p.A22T|TBCCD1_ENST00000446782.1_5'Flank|TBCCD1_ENST00000424280.1_5'Flank			Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	22					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|mRNA modification (GO:0016556)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A22T(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|urinary_tract(2)	15	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		GGCGGTGATTGCCGGGTGAGG	0.622																																					p.A22T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G64A	3						.						85.0	66.0	73.0					3																	186288750		2201	4300	6501	187771444	SO:0001583	missense	51726	exon1			AB028859	CCDS3277.1	3q27	2011-09-02			ENSG00000090520	ENSG00000090520		"""Heat shock proteins / DNAJ (HSP40)"""	14889	protein-coding gene	gene with protein product		611341				10827079, 11147971	Standard	NM_016306		Approved	EDJ, HEDJ, ERdj3	uc003fqi.3	Q9UBS4	OTTHUMG00000156614	ENST00000439351.1:c.64G>A	3.37:g.186288750G>A	ENSP00000414398:p.Ala22Thr	Somatic		Capture	SOLID	Phase_I	187771444	NM_016306	Q542Y5|Q542Y9|Q6IAQ8|Q96JC6	Missense_Mutation	SNP	ENST00000439351.1	37	CCDS3277.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112666	0.77210	.	.	ENSG00000090520	ENST00000439351;ENST00000265028	T;T	0.69685	-0.42;-0.42	5.44	5.44	0.79542	Heat shock protein DnaJ, N-terminal (2);	0.233794	0.42294	D	0.000736	T	0.55386	0.1917	N	0.20881	0.62	0.80722	D	1	B	0.22346	0.068	B	0.25291	0.059	T	0.55598	-0.8116	10	0.87932	D	0	-3.3077	14.6293	0.68645	0.0:0.0:1.0:0.0	.	22	Q9UBS4	DJB11_HUMAN	T	22	ENSP00000414398:A22T;ENSP00000265028:A22T	ENSP00000265028:A22T	A	+	1	0	DNAJB11	187771444	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.361000	0.73070	2.825000	0.97269	0.655000	0.94253	GCC		0.622	DNAJB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344779.1		
MB21D2	151963	hgsc.bcm.edu	37	3	192516448	192516448	+	Silent	SNP	G	G	T	rs372993931		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:192516448G>T	ENST00000392452.2	-	2	1523	c.1203C>A	c.(1201-1203)tcC>tcA	p.S401S		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	401							protein complex binding (GO:0032403)	p.S399S(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						AGCGCACAGAGGACAGCTTCC	0.572																																					p.S401S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1203A	3						.						51.0	45.0	47.0					3																	192516448		2203	4300	6503	193999142	SO:0001819	synonymous_variant	151963	exon2			AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.1203C>A	3.37:g.192516448G>T		Somatic		Capture	SOLID	Phase_I	193999142	NM_178496	Q86VD8	Silent	SNP	ENST00000392452.2	37	CCDS3302.2																																																																																				0.572	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341543.1	NM_178496	
GP5	2814	hgsc.bcm.edu	37	3	194118538	194118538	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:194118538G>A	ENST00000401815.1	-	1	545	c.474C>T	c.(472-474)ctC>ctT	p.L158L	GP5_ENST00000323007.3_Silent_p.L158L			P40197	GPV_HUMAN	glycoprotein V (platelet)	158					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|negative regulation of platelet activation (GO:0010544)|platelet activation (GO:0030168)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.L158L(1)		breast(3)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(14)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	35	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		GAAGGAAATCGAGCTGATTCT	0.493																																					p.L158L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C474T	3						.						70.0	73.0	72.0					3																	194118538		2203	4300	6503	195599827	SO:0001819	synonymous_variant	2814	exon2			L11238	CCDS3307.1	3q29	2008-02-01			ENSG00000178732	ENSG00000178732		"""CD molecules"""	4443	protein-coding gene	gene with protein product		173511				7690959	Standard	NM_004488		Approved	CD42d	uc003ftv.1	P40197	OTTHUMG00000150345	ENST00000401815.1:c.474C>T	3.37:g.194118538G>A		Somatic		Capture	SOLID	Phase_I	195599827	NM_004488	D1MER9	Silent	SNP	ENST00000401815.1	37	CCDS3307.1																																																																																				0.493	GP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317710.1	NM_004488	
UBE2E1	7324	hgsc.bcm.edu	37	3	23930692	23930692	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:23930692A>G	ENST00000306627.3	+	5	645	c.426A>G	c.(424-426)gcA>gcG	p.A142A	UBE2E1_ENST00000424381.1_Silent_p.A109A|UBE2E1_ENST00000475680.1_3'UTR|UBE2E1_ENST00000346855.3_Silent_p.A125A|UBE2E1_ENST00000467766.1_Silent_p.A109A	NM_003341.4	NP_003332.1	P51965	UB2E1_HUMAN	ubiquitin-conjugating enzyme E2E 1	142					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cytokine-mediated signaling pathway (GO:0019221)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ISG15-protein conjugation (GO:0032020)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)	p.A142A(1)		breast(1)|endometrium(2)|large_intestine(4)	7						GGAGTCCAGCACTAACCATTT	0.338																																					p.A125A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A375G	3						.						159.0	150.0	153.0					3																	23930692		2203	4298	6501	23905696	SO:0001819	synonymous_variant	7324	exon4			X92963	CCDS2638.1, CCDS2639.1, CCDS56244.1	3p24.2	2011-05-19	2011-05-19		ENSG00000170142	ENSG00000170142		"""Ubiquitin-conjugating enzymes E2"""	12477	protein-coding gene	gene with protein product		602916	"""ubiquitin-conjugating enzyme E2E 1 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast)"""			8576257	Standard	NM_003341		Approved	UbcH6	uc003cch.3	P51965	OTTHUMG00000130483	ENST00000306627.3:c.426A>G	3.37:g.23930692A>G		Somatic		Capture	SOLID	Phase_I	23905696	NM_182666	B2RBX4|C9J8K2|K4DI90	Silent	SNP	ENST00000306627.3	37	CCDS2638.1																																																																																				0.338	UBE2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252882.2	NM_003341	
SLC4A7	9497	hgsc.bcm.edu	37	3	27427503	27427503	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:27427503T>C	ENST00000295736.5	-	23	3415	c.3345A>G	c.(3343-3345)ttA>ttG	p.L1115L	SLC4A7_ENST00000435667.2_Silent_p.L1000L|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000446700.1_Silent_p.L1107L|SLC4A7_ENST00000440156.1_Silent_p.L1111L|SLC4A7_ENST00000445684.1_Silent_p.L1111L|SLC4A7_ENST00000428386.1_Silent_p.L991L|SLC4A7_ENST00000455077.1_Silent_p.L996L|SLC4A7_ENST00000388777.4_Silent_p.L665L|SLC4A7_ENST00000454389.1_Silent_p.L1124L|SLC4A7_ENST00000437179.1_Silent_p.L996L	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	1115					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.L1115L(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	GCACAAACACTAATGCAAGAA	0.328																																					p.L1115L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3345G	3						.						112.0	121.0	118.0					3																	27427503		2203	4300	6503	27402507	SO:0001819	synonymous_variant	9497	exon23			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.3345A>G	3.37:g.27427503T>C		Somatic		Capture	SOLID	Phase_I	27402507	NM_003615	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Silent	SNP	ENST00000295736.5	37	CCDS33721.1																																																																																				0.328	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615	
POMGNT2	84892	hgsc.bcm.edu	37	3	43122062	43122062	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:43122062A>G	ENST00000344697.2	-	2	1207	c.862T>C	c.(862-864)Tac>Cac	p.Y288H	POMGNT2_ENST00000441964.1_Missense_Mutation_p.Y288H	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	288					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)	p.Y288H(1)									ACCAGAATGTACTCCTCGCCT	0.542																																					p.Y288H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T862C	3						.						87.0	87.0	87.0					3																	43122062		2203	4300	6503	43097066	SO:0001583	missense	84892	exon2			AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.862T>C	3.37:g.43122062A>G	ENSP00000344125:p.Tyr288His	Somatic		Capture	SOLID	Phase_I	43097066	NM_032806	B3KWC3|Q96SY3	Missense_Mutation	SNP	ENST00000344697.2	37	CCDS2709.1	.	.	.	.	.	.	.	.	.	.	A	16.47	3.131964	0.56828	.	.	ENSG00000144647	ENST00000441964;ENST00000344697	T;T	0.77358	-1.09;-1.09	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.87160	0.6108	M	0.81942	2.565	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	D	0.85642	0.1277	10	0.23891	T	0.37	-17.1629	14.8297	0.70139	1.0:0.0:0.0:0.0	.	288	Q8NAT1	AGO61_HUMAN	H	288	ENSP00000408992:Y288H;ENSP00000344125:Y288H	ENSP00000344125:Y288H	Y	-	1	0	C3orf39	43097066	1.000000	0.71417	0.983000	0.44433	0.912000	0.54170	7.576000	0.82467	2.091000	0.63221	0.533000	0.62120	TAC		0.542	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256643.1	NM_032806	
PRSS50	29122	hgsc.bcm.edu	37	3	46759004	46759004	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:46759004G>A	ENST00000460241.1	-	7	1900	c.230C>T	c.(229-231)cCg>cTg	p.P77L	PRSS50_ENST00000315170.7_Missense_Mutation_p.P77L			Q9UI38	TSP50_HUMAN	protease, serine, 50	77					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)	p.P77L(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						CTGGGTGGTCGGGGTCTGCCA	0.637																																					p.P77L	Pancreas(41;915 1239 11561 17469)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C230T	3						.						139.0	124.0	129.0					3																	46759004		2203	4300	6503	46734008	SO:0001583	missense	29122	exon2			AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.230C>T	3.37:g.46759004G>A	ENSP00000418875:p.Pro77Leu	Somatic		Capture	SOLID	Phase_I	46734008	NM_013270		Missense_Mutation	SNP	ENST00000460241.1	37	CCDS2745.1	.	.	.	.	.	.	.	.	.	.	G	7.642	0.680987	0.14907	.	.	ENSG00000206549	ENST00000315170;ENST00000460241	D;D	0.89050	-2.46;-2.46	3.01	-4.93	0.03066	.	26.935300	0.00481	N	0.000126	T	0.78426	0.4281	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.63871	-0.6539	10	0.44086	T	0.13	.	3.597	0.08010	0.426:0.0:0.2125:0.3615	.	77	Q9UI38	TSP50_HUMAN	L	77	ENSP00000326598:P77L;ENSP00000418875:P77L	ENSP00000326598:P77L	P	-	2	0	PRSS50	46734008	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.530000	0.06179	-1.317000	0.02292	-1.010000	0.02471	CCG		0.637	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1		
QRICH1	54870	hgsc.bcm.edu	37	3	49114313	49114313	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:49114313C>T	ENST00000395443.2	-	2	610	c.138G>A	c.(136-138)caG>caA	p.Q46Q	QRICH1_ENST00000357496.2_Silent_p.Q46Q|QRICH1_ENST00000424300.1_Silent_p.Q46Q	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	46	CARD.					nucleus (GO:0005634)		p.Q46Q(2)		breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TGGCTGTCTGCTGGAACTCCT	0.537																																					p.Q46Q												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.G138A	3						.						130.0	118.0	122.0					3																	49114313		2203	4300	6503	49089317	SO:0001819	synonymous_variant	54870	exon2				CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.138G>A	3.37:g.49114313C>T		Somatic		Capture	SOLID	Phase_I	49089317	NM_198880	Q4G0F7|Q7L621|Q8TEA5	Silent	SNP	ENST00000395443.2	37	CCDS2787.1																																																																																				0.537	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
IP6K1	9807	hgsc.bcm.edu	37	3	49775750	49775750	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:49775750C>T	ENST00000321599.4	-	3	630	c.329G>A	c.(328-330)cGg>cAg	p.R110Q	IP6K1_ENST00000395238.1_5'UTR|IP6K1_ENST00000460540.1_5'UTR|IP6K1_ENST00000468463.1_Missense_Mutation_p.R110Q	NM_001242829.1|NM_153273.3	NP_001229758.1|NP_695005.1	Q92551	IP6K1_HUMAN	inositol hexakisphosphate kinase 1	110					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.R110Q(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	15						AGGTTGCTCCCGTTCTGTTGT	0.547																																					p.R110Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G329A	3						.						160.0	128.0	138.0					3																	49775750		2203	4300	6503	49750754	SO:0001583	missense	9807	exon3			D87452	CCDS33760.1, CCDS43092.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000176095	ENSG00000176095			18360	protein-coding gene	gene with protein product		606991	"""inositol hexaphosphate kinase 1"""	IHPK1			Standard	NM_001242829		Approved	KIAA0263	uc003cxm.1	Q92551	OTTHUMG00000158197	ENST00000321599.4:c.329G>A	3.37:g.49775750C>T	ENSP00000323780:p.Arg110Gln	Somatic		Capture	SOLID	Phase_I	49750754	NM_153273	A8K157|A8MUX4|Q7L3I7|Q96E38	Missense_Mutation	SNP	ENST00000321599.4	37	CCDS33760.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.710069	0.68730	.	.	ENSG00000176095	ENST00000321599;ENST00000468463	T;T	0.59083	0.29;0.29	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.52677	0.1749	M	0.63428	1.95	0.80722	D	1	P;P	0.43662	0.814;0.667	B;B	0.33960	0.084;0.173	T	0.53521	-0.8427	10	0.13853	T	0.58	-15.9162	20.3363	0.98740	0.0:1.0:0.0:0.0	.	110;110	C9JNA8;Q92551	.;IP6K1_HUMAN	Q	110	ENSP00000323780:R110Q;ENSP00000420467:R110Q	ENSP00000323780:R110Q	R	-	2	0	IP6K1	49750754	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.148000	0.77389	2.814000	0.96858	0.563000	0.77884	CGG		0.547	IP6K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350380.1	NM_153273	
ADAMTS9	56999	hgsc.bcm.edu	37	3	64619430	64619430	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:64619430T>C	ENST00000498707.1	-	13	2324	c.1982A>G	c.(1981-1983)cAt>cGt	p.H661R	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.H633R	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	661	Cys-rich.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.H661R(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		GATGTTAAAATGCTTCCCGTC	0.502																																					p.H661R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1982G	3						.						215.0	198.0	204.0					3																	64619430		2203	4300	6503	64594470	SO:0001583	missense	56999	exon13			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.1982A>G	3.37:g.64619430T>C	ENSP00000418735:p.His661Arg	Somatic		Capture	SOLID	Phase_I	64594470	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	T	17.74	3.463084	0.63513	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.03441	3.93;3.93	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.11324	0.0276	L	0.33137	0.985	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.87578	0.98;0.996;0.998;0.943	T	0.11036	-1.0604	10	0.45353	T	0.12	.	15.6399	0.76989	0.0:0.0:0.0:1.0	.	633;661;661;661	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	R	633;661	ENSP00000295903:H633R;ENSP00000418735:H661R	ENSP00000295903:H633R	H	-	2	0	ADAMTS9	64594470	1.000000	0.71417	0.991000	0.47740	0.885000	0.51271	7.698000	0.84413	2.103000	0.63969	0.533000	0.62120	CAT		0.502	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
ST3GAL6	10402	hgsc.bcm.edu	37	3	98491686	98491686	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:98491686C>T	ENST00000483910.1	+	4	486	c.197C>T	c.(196-198)gCg>gTg	p.A66V	ST3GAL6_ENST00000468553.1_Missense_Mutation_p.A66V|ST3GAL6_ENST00000265261.6_5'UTR|ST3GAL6_ENST00000394162.1_Missense_Mutation_p.A66V|ST3GAL6_ENST00000462152.1_3'UTR	NM_001271146.1	NP_001258075.1	Q9Y274	SIA10_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 6	66					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|cellular response to interleukin-6 (GO:0071354)|glycolipid metabolic process (GO:0006664)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,3-sialyltransferase activity (GO:0052798)	p.A66V(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(1)	19						TTTCTGTGTGCGGCTGATTTT	0.368																																					p.A66V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C197T	3						.						212.0	193.0	199.0					3																	98491686		2203	4300	6503	99974376	SO:0001583	missense	10402	exon5			AF119391	CCDS2933.1, CCDS59452.1, CCDS74968.1	3q12.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000064225	ENSG00000064225		"""Sialyltransferases"""	18080	protein-coding gene	gene with protein product		607156	"""sialyltransferase 10 (alpha-2,3-sialyltransferase VI)"""	SIAT10		10206952	Standard	NM_006100		Approved	ST3GALVI	uc010hpd.4	Q9Y274	OTTHUMG00000159047	ENST00000483910.1:c.197C>T	3.37:g.98491686C>T	ENSP00000417376:p.Ala66Val	Somatic		Capture	SOLID	Phase_I	99974376	NM_006100	B2RCH2|B3KMI1|D3DN39|F8W6U0	Missense_Mutation	SNP	ENST00000483910.1	37	CCDS2933.1	.	.	.	.	.	.	.	.	.	.	C	9.361	1.068045	0.20067	.	.	ENSG00000064225	ENST00000483910;ENST00000460774;ENST00000497008;ENST00000486334;ENST00000394162;ENST00000468553;ENST00000485391;ENST00000492254;ENST00000477574	T;T;T;T	0.45668	0.92;0.91;0.92;0.89	5.85	3.08	0.35506	.	0.946978	0.08914	N	0.875390	T	0.31979	0.0814	L	0.50333	1.59	0.19945	N	0.999942	P;P	0.42248	0.774;0.574	B;B	0.35655	0.207;0.086	T	0.15809	-1.0424	10	0.29301	T	0.29	-12.0771	4.6801	0.12731	0.1558:0.6124:0.1502:0.0817	.	89;66	C9J480;Q9Y274	.;SIA10_HUMAN	V	66;66;66;66;66;66;66;89;31	ENSP00000417376:A66V;ENSP00000418896:A66V;ENSP00000377717:A66V;ENSP00000417201:A89V	ENSP00000377717:A66V	A	+	2	0	ST3GAL6	99974376	0.041000	0.20044	0.136000	0.22124	0.307000	0.27823	0.155000	0.16362	0.379000	0.24794	0.650000	0.86243	GCG		0.368	ST3GAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353013.2	NM_006100	
MUC4	4585	hgsc.bcm.edu	37	3	195479275	195479275	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr3:195479275T>C	ENST00000346145.4	-	20	2882	c.2843A>G	c.(2842-2844)gAa>gGa	p.E948G	MUC4_ENST00000475231.1_Missense_Mutation_p.E5132G|MUC4_ENST00000349607.4_Missense_Mutation_p.E897G|MUC4_ENST00000463781.3_Missense_Mutation_p.E5184G	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1941	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.E948G(1)|p.E5184G(1)|p.E5056G(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGAGGCATTTTCCTCTTCACT	0.572																																					p.E897G												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A2690G	3						.						95.0	92.0	93.0					3																	195479275		2203	4300	6503	196964946	SO:0001583	missense	4585	exon19			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.2843A>G	3.37:g.195479275T>C	ENSP00000304207:p.Glu948Gly	Somatic		Capture	SOLID	Phase_I	196964946	NM_138297	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000346145.4	37	CCDS3310.1	.	.	.	.	.	.	.	.	.	.	.	12.83	2.055848	0.36277	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.41065	1.01;1.37;1.27;1.31	4.95	4.95	0.65309	.	0.244366	0.28595	N	0.014789	T	0.54549	0.1865	M	0.63843	1.955	0.09310	N	1	D;P;P;D;D;P	0.69078	0.997;0.886;0.886;0.964;0.964;0.89	P;P;P;P;P;P	0.60068	0.868;0.462;0.462;0.637;0.637;0.493	T	0.48768	-0.9006	10	0.36615	T	0.2	-10.8761	11.3092	0.49353	0.0:0.0:0.0:1.0	.	5056;897;948;5184;5132;1889	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	G	897;948;5184;5132;1684	ENSP00000338109:E897G;ENSP00000304207:E948G;ENSP00000417498:E5184G;ENSP00000420243:E5132G	ENSP00000304207:E948G	E	-	2	0	MUC4	196964946	0.328000	0.24687	0.314000	0.25224	0.130000	0.20726	3.636000	0.54317	1.975000	0.57531	0.459000	0.35465	GAA		0.572	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1	NM_018406	
PRDM4	11108	hgsc.bcm.edu	37	12	108128021	108128021	+	Missense_Mutation	SNP	T	T	C	rs374756784		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:108128021T>C	ENST00000228437.5	-	12	2831	c.2372A>G	c.(2371-2373)tAt>tGt	p.Y791C	RP11-864J10.4_ENST00000546829.1_RNA|RP11-864J10.4_ENST00000546714.1_RNA	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	791					cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)	p.Y791C(1)		biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						ATCCGCTGAATACACAGCACT	0.403																																					p.Y791C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2372G	12						.						151.0	144.0	146.0					12																	108128021		2203	4300	6503	106652151	SO:0001583	missense	11108	exon12			AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.2372A>G	12.37:g.108128021T>C	ENSP00000228437:p.Tyr791Cys	Somatic		Capture	SOLID	Phase_I	106652151	NM_012406	Q9UFA6	Missense_Mutation	SNP	ENST00000228437.5	37	CCDS9115.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.416090	0.42817	.	.	ENSG00000110851	ENST00000228437	T	0.13089	2.62	6.03	4.87	0.63330	.	0.167662	0.56097	D	0.000039	T	0.21103	0.0508	L	0.27053	0.805	0.50467	D	0.999876	D	0.76494	0.999	P	0.62813	0.907	T	0.01420	-1.1359	10	0.87932	D	0	-7.9971	10.6432	0.45604	0.1428:0.0:0.0:0.8572	.	791	Q9UKN5	PRDM4_HUMAN	C	791	ENSP00000228437:Y791C	ENSP00000228437:Y791C	Y	-	2	0	PRDM4	106652151	0.999000	0.42202	0.039000	0.18376	0.828000	0.46876	3.337000	0.52120	1.079000	0.41038	0.454000	0.30748	TAT		0.403	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406546.1	NM_012406	
ATP2A2	488	hgsc.bcm.edu	37	12	110734528	110734528	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:110734528T>A	ENST00000539276.2	+	5	558	c.449T>A	c.(448-450)aTt>aAt	p.I150N	ATP2A2_ENST00000550248.2_3'UTR|ATP2A2_ENST00000395494.2_Missense_Mutation_p.I150N|ATP2A2_ENST00000308664.6_Missense_Mutation_p.I150N			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	150					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)	p.I150N(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						CCTGGTGATATTGTAGAAATT	0.358																																					p.I150N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T449A	12						.						144.0	135.0	138.0					12																	110734528		2203	4300	6503	109218911	SO:0001583	missense	488	exon5				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.449T>A	12.37:g.110734528T>A	ENSP00000440045:p.Ile150Asn	Somatic		Capture	SOLID	Phase_I	109218911	NM_170665	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	37	CCDS9144.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.3|25.3	4.621994|4.621994	0.87460|0.87460	.|.	.|.	ENSG00000174437|ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276;ENST00000550248|ENST00000548169	D;D;D|.	0.92495|.	-3.05;-3.05;-3.05|.	5.45|5.45	5.45|5.45	0.79879|0.79879	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.86669|.	0.5988|.	H|H	0.94886|0.94886	3.595|3.595	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.996;1.0;1.0|.	D;D;D|.	0.91635|.	0.913;0.996;0.999|.	D|.	0.90520|.	0.4488|.	9|.	.|.	.|.	.|.	.|.	15.4965|15.4965	0.75658|0.75658	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	150;150;150|.	P16615-4;P16615-2;P16615|.	.;.;AT2A2_HUMAN|.	N|X	150;150;150;25|67	ENSP00000311186:I150N;ENSP00000378872:I150N;ENSP00000440045:I150N|.	.|.	I|Y	+|+	2|3	0|2	ATP2A2|ATP2A2	109218911|109218911	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.690000|7.690000	0.84178|0.84178	2.062000|2.062000	0.61559|0.61559	0.472000|0.472000	0.43445|0.43445	ATT|TAT		0.358	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
BRAP	8315	hgsc.bcm.edu	37	12	112093423	112093423	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:112093423G>A	ENST00000327551.6	-	10	1308	c.1168C>T	c.(1168-1170)Cga>Tga	p.R390*	BRAP_ENST00000419234.4_Nonsense_Mutation_p.R420*|BRAP_ENST00000539060.1_Nonsense_Mutation_p.R241*			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R420*(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						CAGTAGATTCGCTGAGATTCC	0.413																																					p.R420X	Pancreas(146;846 1904 7830 25130 26065)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1258T	12						.						174.0	147.0	156.0					12																	112093423		2203	4300	6503	110577806	SO:0001587	stop_gained	8315	exon10			AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.1168C>T	12.37:g.112093423G>A	ENSP00000330813:p.Arg390*	Somatic		Capture	SOLID	Phase_I	110577806	NM_006768	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Nonsense_Mutation	SNP	ENST00000327551.6	37		.	.	.	.	.	.	.	.	.	.	G	29.8	5.034876	0.93575	.	.	ENSG00000089234	ENST00000419234;ENST00000539060;ENST00000327551;ENST00000547043	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5139	14.4931	0.67665	0.0:0.0:0.8439:0.1561	.	.	.	.	X	420;241;390;202	.	ENSP00000330813:R390X	R	-	1	2	BRAP	110577806	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.139000	0.50577	2.415000	0.81967	0.561000	0.74099	CGA		0.413	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2		
ETV6	2120	hgsc.bcm.edu	37	12	11905443	11905443	+	Silent	SNP	G	G	A	rs201801905		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:11905443G>A	ENST00000396373.4	+	2	367	c.93G>A	c.(91-93)acG>acA	p.T31T	ETV6_ENST00000544715.1_3'UTR	NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	31					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T31T(1)	ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				CTTCCTCGACGCCACTTCATG	0.572			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																p.T31T			Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G93A	12						.	G		1,4405	2.1+/-5.4	0,1,2202	82.0	74.0	76.0		93	-3.7	0.9	12		76	0,8600		0,0,4300	no	coding-synonymous	ETV6	NM_001987.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		31/453	11905443	1,13005	2203	4300	6503	11796710	SO:0001819	synonymous_variant	2120	exon2			BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.93G>A	12.37:g.11905443G>A		Somatic		Capture	SOLID	Phase_I	11796710	NM_001987	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Silent	SNP	ENST00000396373.4	37	CCDS8643.1																																																																																				0.572	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400130.2	NM_001987	
MED13L	23389	hgsc.bcm.edu	37	12	116429227	116429227	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:116429227G>A	ENST00000281928.3	-	17	3738	c.3532C>T	c.(3532-3534)Ctc>Ttc	p.L1178F		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1178						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.L1178F(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TCAAGGAAGAGTCCTGAATTG	0.468																																					p.L1178F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3532T	12						.						77.0	70.0	72.0					12																	116429227		2203	4300	6503	114913610	SO:0001583	missense	23389	exon17			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.3532C>T	12.37:g.116429227G>A	ENSP00000281928:p.Leu1178Phe	Somatic		Capture	SOLID	Phase_I	114913610	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.712751	0.68730	.	.	ENSG00000123066	ENST00000281928	D	0.88664	-2.41	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.94241	0.8151	M	0.69523	2.12	0.80722	D	1	D	0.71674	0.998	D	0.83275	0.996	D	0.94376	0.7600	10	0.87932	D	0	.	19.2467	0.93905	0.0:0.0:1.0:0.0	.	1178	Q71F56	MD13L_HUMAN	F	1178	ENSP00000281928:L1178F	ENSP00000281928:L1178F	L	-	1	0	MED13L	114913610	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.263000	0.95617	2.784000	0.95788	0.585000	0.79938	CTC		0.468	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
TMEM132D	121256	hgsc.bcm.edu	37	12	129569153	129569153	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:129569153C>T	ENST00000422113.2	-	6	1864	c.1538G>A	c.(1537-1539)aGc>aAc	p.S513N	TMEM132D_ENST00000389441.4_Missense_Mutation_p.S51N	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	513					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.S513N(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTCCAGGGGGCTGCTCAGGTG	0.552																																					p.S513N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1538A	12						.						116.0	86.0	96.0					12																	129569153		2203	4300	6503	128135106	SO:0001583	missense	121256	exon6			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1538G>A	12.37:g.129569153C>T	ENSP00000408581:p.Ser513Asn	Somatic		Capture	SOLID	Phase_I	128135106	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	c	14.99	2.699170	0.48307	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.48201	0.82;0.82	4.78	-0.974	0.10293	.	0.596486	0.16379	N	0.216989	T	0.49270	0.1547	L	0.58101	1.795	0.09310	N	1	P;B	0.35272	0.493;0.27	B;B	0.39465	0.3;0.222	T	0.50303	-0.8844	9	.	.	.	-6.3977	20.8743	0.99795	0.0:0.2031:0.7969:0.0	.	513;51	Q14C87;Q14C87-2	T132D_HUMAN;.	N	51;513	ENSP00000374092:S51N;ENSP00000408581:S513N	.	S	-	2	0	TMEM132D	128135106	0.998000	0.40836	0.000000	0.03702	0.666000	0.39218	3.615000	0.54167	-0.174000	0.10743	-0.313000	0.08912	AGC		0.552	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
PARP11	57097	hgsc.bcm.edu	37	12	3921504	3921504	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:3921504G>A	ENST00000228820.4	-	8	946	c.802C>T	c.(802-804)Cgg>Tgg	p.R268W	PARP11_ENST00000447133.3_Missense_Mutation_p.R187W|PARP11_ENST00000476985.1_Intron|PARP11_ENST00000397096.2_Intron|PARP11_ENST00000427057.2_Missense_Mutation_p.R187W	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	261	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.R261W(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			AACAGATGCCGCTGTTGCAAG	0.403																																					p.R268W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C802T	12						.						109.0	99.0	102.0					12																	3921504		2203	4300	6503	3791765	SO:0001583	missense	57097	exon8			AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.802C>T	12.37:g.3921504G>A	ENSP00000228820:p.Arg268Trp	Somatic		Capture	SOLID	Phase_I	3791765	NM_020367	B4DRQ0|Q68DS1|Q8N5Y9	Missense_Mutation	SNP	ENST00000228820.4	37	CCDS8523.2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.155319	0.78114	.	.	ENSG00000111224	ENST00000427057;ENST00000228820;ENST00000447133	T;T;T	0.19532	2.14;2.63;2.14	5.95	5.95	0.96441	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.127747	0.53938	D	0.000043	T	0.23171	0.0560	N	0.24115	0.695	0.36897	D	0.890199	D;P;P	0.67145	0.996;0.894;0.913	P;B;B	0.53549	0.729;0.219;0.326	T	0.04333	-1.0959	10	0.49607	T	0.09	.	11.1947	0.48707	0.0824:0.0:0.9176:0.0	.	187;268;261	Q9NR21-2;Q9NR21-4;Q9NR21	.;.;PAR11_HUMAN	W	187;268;187	ENSP00000397058:R187W;ENSP00000228820:R268W;ENSP00000405385:R187W	ENSP00000228820:R268W	R	-	1	2	PARP11	3791765	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.219000	0.65262	2.827000	0.97445	0.650000	0.86243	CGG		0.403	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344213.1		
C12orf4	57102	hgsc.bcm.edu	37	12	4645267	4645267	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:4645267G>A	ENST00000261250.3	-	2	181	c.94C>T	c.(94-96)Ctc>Ttc	p.L32F	RAD51AP1_ENST00000352618.4_5'Flank|RAD51AP1_ENST00000544927.1_5'Flank|RAD51AP1_ENST00000543041.1_5'Flank|RAD51AP1_ENST00000321524.7_5'Flank|C12orf4_ENST00000545746.1_Missense_Mutation_p.L32F|RAD51AP1_ENST00000228843.9_5'Flank	NM_020374.2	NP_065107.1	Q9NQ89	CL004_HUMAN	chromosome 12 open reading frame 4	32								p.L32F(1)		NS(1)|endometrium(1)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)		GGAAATTTGAGTGGCACTCTC	0.368																																					p.L32F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C94T	12						.						124.0	116.0	119.0					12																	4645267		2203	4300	6503	4515528	SO:0001583	missense	57102	exon2			AJ272205	CCDS8528.1	12p13.3	2012-08-10			ENSG00000047621	ENSG00000047621			1184	protein-coding gene	gene with protein product							Standard	NM_020374		Approved		uc001qms.3	Q9NQ89	OTTHUMG00000168258	ENST00000261250.3:c.94C>T	12.37:g.4645267G>A	ENSP00000261250:p.Leu32Phe	Somatic		Capture	SOLID	Phase_I	4515528	NM_020374	D3DUQ8|Q6MZH5	Missense_Mutation	SNP	ENST00000261250.3	37	CCDS8528.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153456	0.57259	.	.	ENSG00000047621	ENST00000261250;ENST00000545746	.	.	.	5.91	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.75642	0.3877	L	0.60455	1.87	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.78272	-0.2268	9	0.72032	D	0.01	.	14.8601	0.70376	0.0682:0.0:0.9318:0.0	.	32	Q9NQ89	CL004_HUMAN	F	32	.	ENSP00000261250:L32F	L	-	1	0	C12orf4	4515528	1.000000	0.71417	0.179000	0.23059	0.944000	0.59088	5.322000	0.65852	1.504000	0.48704	0.655000	0.94253	CTC		0.368	C12orf4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398992.1	NM_020374	
VWF	7450	hgsc.bcm.edu	37	12	6091078	6091078	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:6091078C>T	ENST00000261405.5	-	42	7415	c.7161G>A	c.(7159-7161)caG>caA	p.Q2387Q		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2387					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.Q2387Q(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CATCACAGCACTGGGTCTTCC	0.587																																					p.Q2387Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G7161A	12						.						121.0	97.0	105.0					12																	6091078		2203	4300	6503	5961339	SO:0001819	synonymous_variant	7450	exon42				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7161G>A	12.37:g.6091078C>T		Somatic		Capture	SOLID	Phase_I	5961339	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	CCDS8539.1																																																																																				0.587	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
USP5	8078	hgsc.bcm.edu	37	12	6970156	6970156	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:6970156C>T	ENST00000229268.8	+	12	1436	c.1384C>T	c.(1384-1386)Cgc>Tgc	p.R462C	USP5_ENST00000541969.1_3'UTR|USP5_ENST00000389231.5_Missense_Mutation_p.R462C	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	462	USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)	p.R462S(2)|p.R462C(1)		breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						TGAAGTGTTCCGCTTCTTGGT	0.537																																					p.R462C												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.C1384T	12						.						194.0	197.0	196.0					12																	6970156		2203	4300	6503	6840417	SO:0001583	missense	8078	exon12			U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.1384C>T	12.37:g.6970156C>T	ENSP00000229268:p.Arg462Cys	Somatic		Capture	SOLID	Phase_I	6840417	NM_003481	D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	ENST00000229268.8	37	CCDS41743.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155996	0.78114	.	.	ENSG00000111667	ENST00000229268;ENST00000389231	T;T	0.32988	1.43;1.43	5.14	5.14	0.70334	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.65790	0.2725	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.954	T	0.73672	-0.3909	10	0.66056	D	0.02	-5.2531	18.7977	0.92001	0.0:1.0:0.0:0.0	.	462;462	P45974;P45974-2	UBP5_HUMAN;.	C	462	ENSP00000229268:R462C;ENSP00000373883:R462C	ENSP00000229268:R462C	R	+	1	0	USP5	6840417	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.746000	0.55127	2.666000	0.90696	0.561000	0.74099	CGC		0.537	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1		
PTPRO	5800	hgsc.bcm.edu	37	12	15654580	15654580	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:15654580G>A	ENST00000281171.4	+	5	1018	c.688G>A	c.(688-690)Gtt>Att	p.V230I	PTPRO_ENST00000348962.2_Missense_Mutation_p.V230I|PTPRO_ENST00000543886.1_Missense_Mutation_p.V230I	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	230					axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)	p.V230I(1)		NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				AAATATTTCCGTTCGTATCGT	0.328																																					p.V230I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G688A	12						.						47.0	49.0	48.0					12																	15654580		2202	4299	6501	15545847	SO:0001583	missense	5800	exon5			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.688G>A	12.37:g.15654580G>A	ENSP00000281171:p.Val230Ile	Somatic		Capture	SOLID	Phase_I	15545847	NM_002848	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	37	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.037518	0.54896	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T	0.03951	3.76;3.75	4.71	4.71	0.59529	.	0.000000	0.42548	D	0.000689	T	0.09774	0.0240	L	0.27053	0.805	0.80722	D	1	P;P;D	0.69078	0.915;0.861;0.997	B;B;D	0.68621	0.204;0.101;0.959	T	0.11842	-1.0571	10	0.02654	T	1	.	17.9243	0.88977	0.0:0.0:1.0:0.0	.	230;230;230	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	I	230	ENSP00000281171:V230I;ENSP00000343434:V230I	ENSP00000281171:V230I	V	+	1	0	PTPRO	15545847	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.138000	0.50570	2.448000	0.82819	0.585000	0.79938	GTT		0.328	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1		
ARNTL2	56938	hgsc.bcm.edu	37	12	27521311	27521311	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:27521311C>T	ENST00000266503.5	+	2	166	c.148C>T	c.(148-150)Cga>Tga	p.R50*	ARNTL2_ENST00000546179.1_Nonsense_Mutation_p.R61*|ARNTL2_ENST00000261178.5_Nonsense_Mutation_p.R50*|ARNTL2_ENST00000311001.5_Nonsense_Mutation_p.R50*|ARNTL2_ENST00000544915.1_Nonsense_Mutation_p.R50*|ARNTL2_ENST00000542388.1_Nonsense_Mutation_p.R13*|ARNTL2_ENST00000539558.1_3'UTR|ARNTL2_ENST00000395901.2_Nonsense_Mutation_p.R61*			Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear translocator-like 2	50	Interaction with PER2. {ECO:0000250|UniProtKB:Q2VPD4}.				circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.R50*(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	21	Colorectal(261;0.0847)|Lung SC(9;0.184)					AGAGTTTCCACGAAAACGCAA	0.483																																					p.R50X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C148T	12						.						138.0	114.0	122.0					12																	27521311		2203	4300	6503	27412578	SO:0001587	stop_gained	56938	exon2			AF246961	CCDS8712.1, CCDS58219.1, CCDS58220.1, CCDS58221.1, CCDS58222.1	12p12.2-p11.2	2013-05-21			ENSG00000029153	ENSG00000029153		"""Basic helix-loop-helix proteins"""	18984	protein-coding gene	gene with protein product		614517				10864977, 10964693	Standard	NM_020183		Approved	BMAL2, MOP9, CLIF, PASD9, bHLHe6	uc001rht.2	Q8WYA1	OTTHUMG00000169257	ENST00000266503.5:c.148C>T	12.37:g.27521311C>T	ENSP00000266503:p.Arg50*	Somatic		Capture	SOLID	Phase_I	27412578	NM_020183	B7Z429|F5H402|Q8WYA2|Q8WYA3|Q8WYA4|Q96J63|Q9H2M4|Q9NS70|Q9NYQ4|Q9NYQ5	Nonsense_Mutation	SNP	ENST00000266503.5	37	CCDS8712.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562626	0.86335	.	.	ENSG00000029153	ENST00000544915;ENST00000395901;ENST00000546179;ENST00000311001;ENST00000261178;ENST00000266503;ENST00000542388	.	.	.	3.39	2.25	0.28309	.	0.748438	0.12247	N	0.485988	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0312	0.30465	0.7789:0.2211:0.0:0.0	.	.	.	.	X	50;61;61;50;50;50;13	.	ENSP00000261178:R50X	R	+	1	2	ARNTL2	27412578	0.995000	0.38212	0.984000	0.44739	0.664000	0.39144	0.628000	0.24522	0.691000	0.31592	-0.500000	0.04577	CGA		0.483	ARNTL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403162.1	NM_020183	
TMTC1	83857	hgsc.bcm.edu	37	12	29911676	29911676	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:29911676G>A	ENST00000539277.1	-	3	573	c.515C>T	c.(514-516)gCg>gTg	p.A172V	TMTC1_ENST00000552618.1_Missense_Mutation_p.A172V|TMTC1_ENST00000381224.2_Missense_Mutation_p.A64V|TMTC1_ENST00000256062.5_Missense_Mutation_p.A64V|TMTC1_ENST00000551659.1_Missense_Mutation_p.A172V	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	172						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.A64V(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					CAGCAGACACGCTAACACGTC	0.428																																					p.A172V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C515T	12						.						127.0	91.0	103.0					12																	29911676		2203	4300	6503	29802943	SO:0001583	missense	83857	exon3				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.515C>T	12.37:g.29911676G>A	ENSP00000442046:p.Ala172Val	Somatic		Capture	SOLID	Phase_I	29802943	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	G	34	5.368205	0.95900	.	.	ENSG00000133687	ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;D;D;D;T	0.94457	-0.64;-3.43;-3.43;-3.43;1.2	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.96494	0.8856	M	0.64676	1.99	0.49798	D	0.999828	D;D	0.89917	1.0;0.997	D;P	0.68765	0.96;0.736	D	0.95856	0.8879	9	.	.	.	-20.4561	18.1463	0.89656	0.0:0.0:1.0:0.0	.	64;172	Q8IUR5-3;Q8IUR5	.;TMTC1_HUMAN	V	64;172;172;172;64	ENSP00000256062:A64V;ENSP00000448112:A172V;ENSP00000449043:A172V;ENSP00000442046:A172V;ENSP00000370622:A64V	.	A	-	2	0	TMTC1	29802943	1.000000	0.71417	0.957000	0.39632	0.997000	0.91878	8.382000	0.90154	2.624000	0.88883	0.655000	0.94253	GCG		0.428	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
PUS7L	83448	hgsc.bcm.edu	37	12	44130334	44130334	+	Silent	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:44130334G>T	ENST00000416848.2	-	7	2063	c.1575C>A	c.(1573-1575)tcC>tcA	p.S525S	PUS7L_ENST00000431332.3_Silent_p.S212S|PUS7L_ENST00000551923.1_Silent_p.S525S|PUS7L_ENST00000344862.5_Silent_p.S525S	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	525	TRUD. {ECO:0000255|PROSITE- ProRule:PRU00342}.				pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.S525S(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		ATATGCGCATGGAATGGGGTA	0.458																																					p.S525S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1575A	12						.						178.0	145.0	156.0					12																	44130334		2203	4300	6503	42416601	SO:0001819	synonymous_variant	83448	exon7			BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.1575C>A	12.37:g.44130334G>T		Somatic		Capture	SOLID	Phase_I	42416601	NM_001098615	B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Silent	SNP	ENST00000416848.2	37	CCDS8743.1																																																																																				0.458	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	NM_031292	
DDX23	9416	hgsc.bcm.edu	37	12	49231785	49231785	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:49231785T>C	ENST00000308025.3	-	6	638	c.559A>G	c.(559-561)Atg>Gtg	p.M187V	DDX23_ENST00000553182.1_5'UTR	NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	187	Glu-rich.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)	p.M187V(1)		NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						TCTTCAAGCATCCTCTGCCGC	0.493																																					p.M187V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A559G	12						.						210.0	186.0	194.0					12																	49231785		2203	4300	6503	47518052	SO:0001583	missense	9416	exon6			AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.559A>G	12.37:g.49231785T>C	ENSP00000310723:p.Met187Val	Somatic		Capture	SOLID	Phase_I	47518052	NM_004818	B2R600|B4DH15|O43188	Missense_Mutation	SNP	ENST00000308025.3	37	CCDS8770.1	.	.	.	.	.	.	.	.	.	.	T	7.738	0.700618	0.15106	.	.	ENSG00000174243	ENST00000550834;ENST00000308025	T	0.20069	2.1	5.15	1.31	0.21738	.	0.513490	0.21793	N	0.069032	T	0.07413	0.0187	N	0.08118	0	0.21064	N	0.999798	B	0.13145	0.007	B	0.09377	0.004	T	0.22695	-1.0209	10	0.26408	T	0.33	-11.8829	1.168	0.01820	0.1297:0.1824:0.2111:0.4767	.	187	Q9BUQ8	DDX23_HUMAN	V	31;187	ENSP00000310723:M187V	ENSP00000310723:M187V	M	-	1	0	DDX23	47518052	0.075000	0.21258	0.981000	0.43875	0.992000	0.81027	0.106000	0.15354	0.401000	0.25424	0.460000	0.39030	ATG		0.493	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408897.2	NM_004818	
CSRNP2	81566	hgsc.bcm.edu	37	12	51467782	51467782	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:51467782G>A	ENST00000228515.1	-	3	532	c.235C>T	c.(235-237)Cgc>Tgc	p.R79C	CSRNP2_ENST00000550461.1_5'Flank	NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	79					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R79C(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						AAACCTTGGCGCCGGGCAAAG	0.562																																					p.R79C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C235T	12						.						86.0	91.0	90.0					12																	51467782		2203	4300	6503	49754049	SO:0001583	missense	81566	exon3			AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.235C>T	12.37:g.51467782G>A	ENSP00000228515:p.Arg79Cys	Somatic		Capture	SOLID	Phase_I	49754049	NM_030809		Missense_Mutation	SNP	ENST00000228515.1	37	CCDS8807.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947474	0.53186	.	.	ENSG00000110925	ENST00000228515;ENST00000548981;ENST00000552899	T;T	0.16457	2.34;2.34	5.11	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.14485	0.0350	L	0.31926	0.97	0.80722	D	1	B	0.21452	0.056	B	0.20384	0.029	T	0.04216	-1.0968	10	0.46703	T	0.11	-16.964	13.0536	0.58967	0.0794:0.0:0.9206:0.0	.	79	Q9H175	CSRN2_HUMAN	C	79	ENSP00000228515:R79C;ENSP00000447657:R79C	ENSP00000228515:R79C	R	-	1	0	CSRNP2	49754049	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.888000	0.48594	1.525000	0.49052	0.655000	0.94253	CGC		0.562	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404893.1		
PRR13	54458	hgsc.bcm.edu	37	12	53837540	53837540	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:53837540T>C	ENST00000429243.2	+	3	593	c.385T>C	c.(385-387)Tac>Cac	p.Y129H	PRR13_ENST00000551003.1_Missense_Mutation_p.Y97H|PRR13_ENST00000547368.1_Missense_Mutation_p.Y143H|PRR13_ENST00000379786.4_Missense_Mutation_p.Y79H|PRR13_ENST00000549135.1_Missense_Mutation_p.Y129H|RP11-793H13.8_ENST00000547717.1_RNA|PRR13_ENST00000549924.1_Missense_Mutation_p.Y129H|PRR13_ENST00000549740.1_Missense_Mutation_p.Y129H|PRR13_ENST00000549068.1_3'UTR|PCBP2_ENST00000541275.1_5'UTR|PRR13_ENST00000546581.1_Missense_Mutation_p.Y33H|PRR13_ENST00000549581.1_Missense_Mutation_p.Y79H	NM_001005354.2|NM_018457.3	NP_001005354.1|NP_060927.1	Q9NZ81	PRR13_HUMAN	proline rich 13	129	His-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.Y79H(1)		haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(1)|urinary_tract(1)	6						gcaccacaagtaccacaagca	0.512																																					p.Y129H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T385C	12						.						48.0	38.0	42.0					12																	53837540		2203	4300	6503	52123807	SO:0001583	missense	54458	exon3			AF217517	CCDS31811.1, CCDS44899.1	12q13.13	2014-05-28			ENSG00000205352	ENSG00000205352			24528	protein-coding gene	gene with protein product		610459				11230166	Standard	NM_018457		Approved	FLJ23818, DKFZP564J157	uc001scz.4	Q9NZ81	OTTHUMG00000170049	ENST00000429243.2:c.385T>C	12.37:g.53837540T>C	ENSP00000412064:p.Tyr129His	Somatic		Capture	SOLID	Phase_I	52123807	NM_018457	Q0V8U0|Q6FIG7|Q6MZP8|Q6NXQ6|Q6PKF9	Missense_Mutation	SNP	ENST00000429243.2	37	CCDS44899.1	.	.	.	.	.	.	.	.	.	.	T	9.655	1.142472	0.21205	.	.	ENSG00000205352	ENST00000429243;ENST00000549924;ENST00000551003;ENST00000549740;ENST00000546581;ENST00000549581;ENST00000547368;ENST00000379786;ENST00000549135	.	.	.	4.2	3.31	0.37934	.	.	.	.	.	T	0.25306	0.0615	N	0.02247	-0.625	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.05178	-1.0901	8	0.42905	T	0.14	.	8.3745	0.32434	0.0:0.892:0.0:0.108	.	129;79	Q9NZ81;Q9NZ81-2	PRR13_HUMAN;.	H	129;129;97;129;33;79;143;79;129	.	ENSP00000369112:Y79H	Y	+	1	0	PRR13	52123807	0.782000	0.28689	0.992000	0.48379	0.436000	0.31835	0.725000	0.25970	1.122000	0.41944	-0.146000	0.13790	TAC		0.512	PRR13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407055.1	NM_018457	
ITGA5	3678	hgsc.bcm.edu	37	12	54792481	54792481	+	Splice_Site	SNP	C	C	T	rs370125974		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:54792481C>T	ENST00000293379.4	-	28	3104	c.2843G>A	c.(2842-2844)cGg>cAg	p.R948Q	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	948					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.R948Q(1)|p.R948L(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						CTGGTGCTCCCGCTGTGGGTA	0.552																																					p.R948Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G2843A	12						.	C	GLN/ARG	0,4406		0,0,2203	79.0	70.0	73.0		2843	-0.5	0.0	12		73	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice	ITGA5	NM_002205.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	948/1050	54792481	1,13005	2203	4300	6503	53078748	SO:0001630	splice_region_variant	3678	exon28				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.2842-1G>A	12.37:g.54792481C>T		Somatic		Capture	SOLID	Phase_I	53078748	NM_002205	Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	37	CCDS8880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.125|9.125	1.009893|1.009893	0.19277|0.19277	0.0|0.0	1.16E-4|1.16E-4	ENSG00000161638|ENSG00000161638	ENST00000547197|ENST00000293379	.|T	.|0.50813	.|0.73	5.25|5.25	-0.516|-0.516	0.11950|0.11950	.|.	.|0.656381	.|0.14482	.|N	.|0.316913	T|T	0.38983|0.38983	0.1061|0.1061	M|M	0.61703|0.61703	1.905|1.905	0.09310|0.09310	N|N	1|1	.|B	.|0.18013	.|0.025	.|B	.|0.12156	.|0.007	T|T	0.36311|0.36311	-0.9753|-0.9753	5|10	.|0.66056	.|D	.|0.02	.|.	4.7958|4.7958	0.13272|0.13272	0.1412:0.4074:0.0:0.4515|0.1412:0.4074:0.0:0.4515	.|.	.|948	.|P08648	.|ITA5_HUMAN	R|Q	18|948	.|ENSP00000293379:R948Q	.|ENSP00000293379:R948Q	G|R	-|-	1|2	0|0	ITGA5|ITGA5	53078748|53078748	0.002000|0.002000	0.14202|0.14202	0.003000|0.003000	0.11579|0.11579	0.011000|0.011000	0.07611|0.07611	-0.034000|-0.034000	0.12225|0.12225	-0.310000|-0.310000	0.08766|0.08766	-0.345000|-0.345000	0.07892|0.07892	GGG|CGG		0.552	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		Missense_Mutation
ERBB3	2065	hgsc.bcm.edu	37	12	56478854	56478854	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:56478854G>A	ENST00000267101.3	+	3	750	c.310G>A	c.(310-312)Gtg>Atg	p.V104M	ERBB3_ENST00000411731.2_Missense_Mutation_p.V104M|ERBB3_ENST00000415288.2_Missense_Mutation_p.V45M|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	104			V -> M (in an ovarian mucinous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.V104M(7)|p.V104L(2)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CAACCTCCGCGTGGTGCGAGG	0.517																																					p.V104M												ERBB3,ovary,NS,Substitution - Missense,0	.	9	Substitution - Missense(9)	large_intestine(5)|endometrium(2)|ovary(1)|NS(1)	c.G310A	12						.						186.0	159.0	168.0					12																	56478854		2203	4300	6503	54765121	SO:0001583	missense	2065	exon3			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.310G>A	12.37:g.56478854G>A	ENSP00000267101:p.Val104Met	Somatic		Capture	SOLID	Phase_I	54765121	NM_001005915	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103691	0.56291	.	.	ENSG00000065361	ENST00000549282;ENST00000549061;ENST00000267101;ENST00000394099;ENST00000411731;ENST00000549672;ENST00000415288	T;T;T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48;-1.48;-1.48	5.82	4.93	0.64822	EGF receptor, L domain (1);	0.096412	0.43416	D	0.000573	D	0.87438	0.6177	M	0.82823	2.61	0.80722	D	1	D;D	0.76494	0.998;0.999	P;P	0.59221	0.698;0.854	D	0.88227	0.2901	10	0.59425	D	0.04	.	10.6531	0.45659	0.1547:0.0:0.8453:0.0	.	104;104	P21860;P21860-2	ERBB3_HUMAN;.	M	104;45;104;104;104;45;45	ENSP00000448636:V104M;ENSP00000449138:V45M;ENSP00000267101:V104M;ENSP00000415753:V104M;ENSP00000449713:V45M;ENSP00000408340:V45M	ENSP00000267101:V104M	V	+	1	0	ERBB3	54765121	1.000000	0.71417	0.892000	0.35008	0.052000	0.14988	4.300000	0.59079	1.450000	0.47717	0.655000	0.94253	GTG		0.517	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
STAT2	6773	hgsc.bcm.edu	37	12	56744927	56744927	+	Missense_Mutation	SNP	C	C	T	rs149666262		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:56744927C>T	ENST00000314128.4	-	10	1012	c.989G>A	c.(988-990)cGa>cAa	p.R330Q	STAT2_ENST00000556539.1_5'Flank|RNU7-40P_ENST00000516397.1_RNA|STAT2_ENST00000418572.2_Missense_Mutation_p.R326Q|STAT2_ENST00000557235.1_Missense_Mutation_p.R326Q			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	330					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.R330Q(3)		NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						GATGAGGGGTCGATGGGGAGT	0.507																																					p.R326Q												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G977A	12						.	C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	122.0	120.0	120.0		989,977	4.4	1.0	12	dbSNP_134	120	0,8600		0,0,4300	no	missense,missense	STAT2	NM_005419.3,NM_198332.1	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	330/852,326/848	56744927	1,13005	2203	4300	6503	55031194	SO:0001583	missense	6773	exon10			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.989G>A	12.37:g.56744927C>T	ENSP00000315768:p.Arg330Gln	Somatic		Capture	SOLID	Phase_I	55031194	NM_198332	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	ENST00000314128.4	37	CCDS8917.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807407	0.90623	2.27E-4	0.0	ENSG00000170581	ENST00000314128;ENST00000557235;ENST00000418572	D;D;D	0.91631	-2.88;-2.88;-2.88	4.4	4.4	0.53042	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.070425	0.56097	D	0.000023	D	0.95934	0.8676	M	0.79805	2.47	0.37811	D	0.928053	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.977;0.992;0.998	D	0.97472	1.0041	10	0.72032	D	0.01	-9.5184	16.2841	0.82710	0.0:1.0:0.0:0.0	.	326;326;330	B4DLC8;G3V2M6;P52630	.;.;STAT2_HUMAN	Q	330;326;326	ENSP00000315768:R330Q;ENSP00000450751:R326Q;ENSP00000387354:R326Q	ENSP00000315768:R330Q	R	-	2	0	STAT2	55031194	0.989000	0.36119	0.998000	0.56505	0.997000	0.91878	2.754000	0.47532	2.464000	0.83262	0.467000	0.42956	CGA		0.507	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410277.1	NM_005419	
TIMELESS	8914	hgsc.bcm.edu	37	12	56826204	56826204	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:56826204C>T	ENST00000553532.1	-	7	786	c.636G>A	c.(634-636)gaG>gaA	p.E212E	TIMELESS_ENST00000554616.1_Silent_p.E212E|TIMELESS_ENST00000229201.4_Silent_p.E211E					timeless circadian clock									p.E212E(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						GGCTCCATTGCTCCTCAGCAG	0.567																																					p.E212E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G636A	12						.						116.0	99.0	105.0					12																	56826204		2203	4300	6503	55112471	SO:0001819	synonymous_variant	8914	exon7			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.636G>A	12.37:g.56826204C>T		Somatic		Capture	SOLID	Phase_I	55112471	NM_003920		Silent	SNP	ENST00000553532.1	37	CCDS8918.1																																																																																				0.567	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
SLC26A10	65012	hgsc.bcm.edu	37	12	58016590	58016590	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:58016590C>A	ENST00000320442.4	+	6	1123	c.812C>A	c.(811-813)cCc>cAc	p.P271H	SLC26A10_ENST00000379218.2_Missense_Mutation_p.P271H	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	271						integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)	p.P271H(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					CCCCTCCTCCCCAACCTGGCT	0.582																																					p.P271H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C812A	12						.						92.0	77.0	82.0					12																	58016590		2203	4300	6503	56302857	SO:0001583	missense	65012	exon6				CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.812C>A	12.37:g.58016590C>A	ENSP00000320217:p.Pro271His	Somatic		Capture	SOLID	Phase_I	56302857	NM_133489	A6NMJ2|B6ZDQ3|Q6ZWI7	Missense_Mutation	SNP	ENST00000320442.4	37	CCDS8949.2	.	.	.	.	.	.	.	.	.	.	.	21.6	4.172969	0.78452	.	.	ENSG00000135502	ENST00000320442;ENST00000379218	D;D	0.94576	-3.46;-3.46	3.78	3.78	0.43462	Sulphate transporter (1);	.	.	.	.	D	0.97723	0.9253	M	0.93763	3.455	0.50467	D	0.99987	D	0.89917	1.0	D	0.97110	1.0	D	0.98194	1.0464	9	0.72032	D	0.01	.	13.9676	0.64218	0.0:1.0:0.0:0.0	.	271	Q8NG04	S2610_HUMAN	H	271	ENSP00000320217:P271H;ENSP00000368520:P271H	ENSP00000320217:P271H	P	+	2	0	SLC26A10	56302857	0.988000	0.35896	0.994000	0.49952	0.797000	0.45037	3.602000	0.54066	2.403000	0.81681	0.655000	0.94253	CCC		0.582	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2		
XPOT	11260	hgsc.bcm.edu	37	12	64825505	64825505	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:64825505T>A	ENST00000332707.5	+	18	2693	c.2164T>A	c.(2164-2166)Ttc>Atc	p.F722I		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	722	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.F722I(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		AGTTCTTCCGTTCATTCCATC	0.428																																					p.F722I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2164A	12						.						87.0	79.0	82.0					12																	64825505		2203	4300	6503	63111772	SO:0001583	missense	11260	exon18			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.2164T>A	12.37:g.64825505T>A	ENSP00000327821:p.Phe722Ile	Somatic		Capture	SOLID	Phase_I	63111772	NM_007235	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.191063	0.78902	.	.	ENSG00000184575	ENST00000332707	T	0.68025	-0.3	4.87	4.87	0.63330	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.57213	0.2038	L	0.56769	1.78	0.80722	D	1	P	0.44195	0.828	B	0.30401	0.115	T	0.62163	-0.6912	9	.	.	.	-16.9745	14.8421	0.70233	0.0:0.0:0.0:1.0	.	722	O43592	XPOT_HUMAN	I	722	ENSP00000327821:F722I	.	F	+	1	0	XPOT	63111772	1.000000	0.71417	0.959000	0.39883	0.985000	0.73830	7.870000	0.87175	1.984000	0.57885	0.449000	0.29647	TTC		0.428	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
PLXNC1	10154	hgsc.bcm.edu	37	12	94563057	94563057	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:94563057C>T	ENST00000258526.4	+	2	1440	c.1191C>T	c.(1189-1191)ggC>ggT	p.G397G	RP11-74K11.2_ENST00000550759.1_RNA|RP11-74K11.2_ENST00000551029.1_RNA	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	397	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)	p.G397G(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CTGGAGATGGCCAGTTACTTA	0.378																																					p.G397G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1191T	12						.						200.0	174.0	183.0					12																	94563057		2203	4300	6503	93087188	SO:0001819	synonymous_variant	10154	exon2			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.1191C>T	12.37:g.94563057C>T		Somatic		Capture	SOLID	Phase_I	93087188	NM_005761	Q59H25	Silent	SNP	ENST00000258526.4	37	CCDS9049.1																																																																																				0.378	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
POLE	5426	hgsc.bcm.edu	37	12	133244146	133244146	+	Silent	SNP	G	G	A	rs145337550		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr12:133244146G>A	ENST00000320574.5	-	20	2305	c.2262C>T	c.(2260-2262)taC>taT	p.Y754Y	POLE_ENST00000535270.1_Silent_p.Y727Y	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	754					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.Y754Y(1)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CGGTGTCCACGTAGAAGGAGT	0.572								DNA polymerases (catalytic subunits)																													p.Y754Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2262T	12						.	G		1,4405	2.1+/-5.4	0,1,2202	285.0	243.0	257.0		2262	-7.6	0.6	12	dbSNP_134	257	0,8600		0,0,4300	no	coding-synonymous	POLE	NM_006231.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		754/2287	133244146	1,13005	2203	4300	6503	131754219	SO:0001819	synonymous_variant	5426	exon20				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.2262C>T	12.37:g.133244146G>A		Somatic		Capture	SOLID	Phase_I	131754219	NM_006231	Q13533|Q86VH9	Silent	SNP	ENST00000320574.5	37	CCDS9278.1																																																																																				0.572	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
WDR72	256764	hgsc.bcm.edu	37	15	54006632	54006632	+	Splice_Site	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:54006632T>C	ENST00000396328.1	-	6	829	c.590A>G	c.(589-591)cAg>cGg	p.Q197R	WDR72_ENST00000360509.5_Splice_Site_p.Q197R|WDR72_ENST00000559418.1_Splice_Site_p.Q197R|WDR72_ENST00000557913.1_Splice_Site_p.Q196R	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	197								p.Q197R(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		CAAGCCAACCTGAATGCTGTT	0.333																																					p.Q197R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A590G	15						.						91.0	87.0	89.0					15																	54006632		2194	4293	6487	51793924	SO:0001630	splice_region_variant	256764	exon6			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.591+1A>G	15.37:g.54006632T>C		Somatic		Capture	SOLID	Phase_I	51793924	NM_182758	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	ENST00000396328.1	37	CCDS10151.1	.	.	.	.	.	.	.	.	.	.	T	18.03	3.532266	0.64972	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.47869	0.83;0.83	5.87	4.75	0.60458	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.078734	0.53938	N	0.000047	T	0.62684	0.2448	L	0.58669	1.825	0.37236	D	0.905905	D	0.76494	0.999	D	0.80764	0.994	T	0.68318	-0.5440	10	0.59425	D	0.04	.	11.2268	0.48888	0.0:0.0714:0.0:0.9286	.	197	Q3MJ13	WDR72_HUMAN	R	197	ENSP00000379619:Q197R;ENSP00000353699:Q197R	ENSP00000353699:Q197R	Q	-	2	0	WDR72	51793924	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	6.170000	0.71920	1.050000	0.40346	0.533000	0.62120	CAG		0.333	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758	Missense_Mutation
TCF12	6938	hgsc.bcm.edu	37	15	57524546	57524546	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:57524546G>A	ENST00000267811.5	+	10	1047	c.743G>A	c.(742-744)gGt>gAt	p.G248D	TCF12_ENST00000543579.1_Missense_Mutation_p.G78D|TCF12_ENST00000452095.2_Missense_Mutation_p.G244D|TCF12_ENST00000557843.1_Missense_Mutation_p.G248D|TCF12_ENST00000537840.1_Intron|TCF12_ENST00000438423.2_Missense_Mutation_p.G248D|TCF12_ENST00000333725.5_Missense_Mutation_p.G248D|TCF12_ENST00000343827.3_Missense_Mutation_p.G78D|TCF12_ENST00000560764.1_Intron	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	248					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.G244D(1)	TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		AGCCAGCCTGGTTTTGGTGGA	0.423			T	TEC	extraskeletal myxoid chondrosarcoma																																p.G248D			Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G743A	15						.						156.0	149.0	151.0					15																	57524546		2192	4292	6484	55311838	SO:0001583	missense	6938	exon10			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.743G>A	15.37:g.57524546G>A	ENSP00000267811:p.Gly248Asp	Somatic		Capture	SOLID	Phase_I	55311838	NM_207037	Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	ENST00000267811.5	37	CCDS10159.1	.	.	.	.	.	.	.	.	.	.	G	35	5.533681	0.96460	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725;ENST00000543579;ENST00000343827	T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76	6.02	6.02	0.97574	.	0.043440	0.85682	D	0.000000	T	0.72407	0.3456	M	0.78049	2.395	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.998;1.0;0.992;0.987;0.992	D;D;D;P;P;P	0.97110	0.997;0.949;1.0;0.906;0.808;0.906	T	0.73113	-0.4085	10	0.72032	D	0.01	-7.6952	20.5373	0.99239	0.0:0.0:1.0:0.0	.	244;300;78;78;248;248	E9PGY0;F5H6Z6;F5GY10;Q99081-2;Q99081;Q99081-3	.;.;.;.;HTF4_HUMAN;.	D	300;248;248;244;248;78;78	ENSP00000267811:G248D;ENSP00000388940:G248D;ENSP00000396881:G244D;ENSP00000331057:G248D;ENSP00000440017:G78D;ENSP00000342459:G78D	ENSP00000267811:G248D	G	+	2	0	TCF12	55311838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.957000	0.87870	2.857000	0.98124	0.650000	0.86243	GGT		0.423	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255069.3	NM_003205	
RNF111	54778	hgsc.bcm.edu	37	15	59350567	59350567	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:59350567T>C	ENST00000557998.1	+	5	1471	c.1184T>C	c.(1183-1185)gTa>gCa	p.V395A	RNF111_ENST00000348370.4_Missense_Mutation_p.V395A|RNF111_ENST00000434298.1_Missense_Mutation_p.V395A|RNF111_ENST00000559209.1_Missense_Mutation_p.V395A|RNF111_ENST00000561186.1_Missense_Mutation_p.V395A	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	395	Interaction with AXIN1.|Ser-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V395A(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		CCTACTGTAGTACCAACCACT	0.343																																					p.V395A	NSCLC(72;983 1365 10746 34387 47081)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1184C	15						.						145.0	148.0	147.0					15																	59350567		2192	4291	6483	57137859	SO:0001583	missense	54778	exon5			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1184T>C	15.37:g.59350567T>C	ENSP00000452732:p.Val395Ala	Somatic		Capture	SOLID	Phase_I	57137859	NM_017610	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	ENST00000557998.1	37	CCDS58366.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.697550	0.88830	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.25579	1.79;1.8	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.41465	0.1160	L	0.32530	0.975	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;D;D	0.77557	0.99;0.978;0.99	T	0.27706	-1.0066	10	0.72032	D	0.01	-16.5751	15.6378	0.76970	0.0:0.0:0.0:1.0	.	395;395;395	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	A	395	ENSP00000288199:V395A;ENSP00000393641:V395A	ENSP00000288199:V395A	V	+	2	0	RNF111	57137859	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.298000	0.72763	2.293000	0.77203	0.477000	0.44152	GTA		0.343	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610	
TLN2	83660	hgsc.bcm.edu	37	15	63127965	63127965	+	Silent	SNP	C	C	T	rs139730009		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:63127965C>T	ENST00000561311.1	+	55	7388	c.7158C>T	c.(7156-7158)gaC>gaT	p.D2386D	TLN2_ENST00000306829.6_Silent_p.D2386D|RP11-1069G10.1_ENST00000558404.1_RNA|RP11-1069G10.1_ENST00000558888.1_RNA			Q9Y4G6	TLN2_HUMAN	talin 2	2386	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.D2386D(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						ATGCTGCAGACGACGGACAGT	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		20476	0.0		0.001	False		,,,				2504	0.0				p.D2386D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C7158T	15						.	C		0,4406		0,0,2203	191.0	194.0	193.0		7158	-2.9	0.9	15	dbSNP_134	193	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	TLN2	NM_015059.2		0,5,6498	TT,TC,CC		0.0581,0.0,0.0384		2386/2543	63127965	5,13001	2203	4300	6503	60915018	SO:0001819	synonymous_variant	83660	exon53			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.7158C>T	15.37:g.63127965C>T		Somatic		Capture	SOLID	Phase_I	60915018	NM_015059	A6NLB8	Silent	SNP	ENST00000561311.1	37	CCDS32261.1																																																																																				0.597	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
TRIP4	9325	hgsc.bcm.edu	37	15	64701942	64701942	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:64701942T>C	ENST00000261884.3	+	7	1018	c.958T>C	c.(958-960)Tct>Cct	p.S320P	TRIP4_ENST00000559565.1_3'UTR	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	320					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.S320P(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						TCGACACGCCTCTCGACTTTC	0.468																																					p.S320P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T958C	15						.						125.0	123.0	123.0					15																	64701942		2203	4300	6503	62488995	SO:0001583	missense	9325	exon7			L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.958T>C	15.37:g.64701942T>C	ENSP00000261884:p.Ser320Pro	Somatic		Capture	SOLID	Phase_I	62488995	NM_016213	B2RAS0|Q96ED7|Q9UKH0	Missense_Mutation	SNP	ENST00000261884.3	37	CCDS10194.1	.	.	.	.	.	.	.	.	.	.	T	32	5.115694	0.94339	.	.	ENSG00000103671	ENST00000261884	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.76371	0.3978	M	0.79011	2.435	0.80722	D	1	D	0.60160	0.987	P	0.57960	0.83	T	0.79645	-0.1717	9	0.62326	D	0.03	-4.962	15.884	0.79226	0.0:0.0:0.0:1.0	.	320	Q15650	TRIP4_HUMAN	P	320	.	ENSP00000261884:S320P	S	+	1	0	TRIP4	62488995	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.798000	0.69095	2.161000	0.67846	0.454000	0.30748	TCT		0.468	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2	NM_016213	
BBS4	585	hgsc.bcm.edu	37	15	73020282	73020282	+	Splice_Site	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:73020282T>C	ENST00000268057.4	+	9	630	c.589T>C	c.(589-591)Ttc>Ctc	p.F197L	BBS4_ENST00000395205.2_Splice_Site_p.F205L|BBS4_ENST00000542334.1_Splice_Site_p.F25L|BBS4_ENST00000539603.1_Splice_Site_p.F185L	NM_033028.4	NP_149017.2	Q96RK4	BBS4_HUMAN	Bardet-Biedl syndrome 4	197	Interaction with PCM1.				adult behavior (GO:0030534)|brain morphogenesis (GO:0048854)|centrosome organization (GO:0051297)|cerebral cortex development (GO:0021987)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|dendrite development (GO:0016358)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|maintenance of protein location in nucleus (GO:0051457)|melanosome transport (GO:0032402)|metabolic process (GO:0008152)|microtubule anchoring at centrosome (GO:0034454)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of systemic arterial blood pressure (GO:0003085)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of cilium assembly (GO:0045724)|positive regulation of multicellular organism growth (GO:0040018)|protein localization to centrosome (GO:0071539)|protein localization to organelle (GO:0033365)|protein transport (GO:0015031)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of cytokinesis (GO:0032465)|regulation of lipid metabolic process (GO:0019216)|retina homeostasis (GO:0001895)|retinal rod cell development (GO:0046548)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)|spermatid development (GO:0007286)|striatum development (GO:0021756)|visual perception (GO:0007601)	BBSome (GO:0034464)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary membrane (GO:0060170)|cilium (GO:0005929)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|dynactin binding (GO:0034452)|microtubule motor activity (GO:0003777)|RNA polymerase II repressing transcription factor binding (GO:0001103)	p.F197L(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(1)	19						ATGTTGCAGGTTCTCACCAGA	0.403									Bardet-Biedl syndrome																												p.F197L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T589C	15						.						117.0	104.0	109.0					15																	73020282		2198	4297	6495	70807335	SO:0001630	splice_region_variant	585	exon9	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF090947	CCDS10246.1, CCDS58377.1	15q22.3-q23	2013-01-10			ENSG00000140463	ENSG00000140463		"""Tetratricopeptide (TTC) repeat domain containing"""	969	protein-coding gene	gene with protein product		600374				7711739, 11381270	Standard	NM_033028		Approved		uc002avb.3	Q96RK4	OTTHUMG00000133510	ENST00000268057.4:c.588-1T>C	15.37:g.73020282T>C		Somatic		Capture	SOLID	Phase_I	70807335	NM_033028	B4E178|Q53DZ5|Q8NHU9|Q96H45	Missense_Mutation	SNP	ENST00000268057.4	37	CCDS10246.1	.	.	.	.	.	.	.	.	.	.	T	14.60	2.585003	0.46110	.	.	ENSG00000140463	ENST00000542334;ENST00000268057;ENST00000539603;ENST00000395205	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.7	5.7	0.88788	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.043955	0.85682	D	0.000000	T	0.09642	0.0237	N	0.00157	-1.96	0.52501	D	0.999956	B;B;B	0.12013	0.004;0.005;0.002	B;B;B	0.17979	0.009;0.009;0.02	T	0.36163	-0.9759	10	0.02654	T	1	-18.8428	10.3362	0.43852	0.0:0.0731:0.0:0.9269	.	185;205;197	F5H7I8;Q96RK4-2;Q96RK4	.;.;BBS4_HUMAN	L	25;197;185;205	ENSP00000445964:F25L;ENSP00000268057:F197L;ENSP00000442492:F185L;ENSP00000378631:F205L	ENSP00000268057:F197L	F	+	1	0	BBS4	70807335	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.854000	0.55949	2.171000	0.68590	0.533000	0.62120	TTC		0.403	BBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257473.2	NM_033028	Missense_Mutation
CYP11A1	1583	hgsc.bcm.edu	37	15	74640282	74640282	+	Silent	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:74640282G>T	ENST00000268053.6	-	2	538	c.384C>A	c.(382-384)gcC>gcA	p.A128A	CYP11A1_ENST00000541301.1_Silent_p.A128A|CYP11A1_ENST00000419019.2_Intron|CYP11A1_ENST00000358632.4_5'UTR	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	128					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.A128A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	ACTGGTGATAGGCGACCCAGG	0.582																																					p.A128A	Esophageal Squamous(87;818 1337 4093 9268 37314)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C384A	15						.						58.0	57.0	58.0					15																	74640282		2197	4296	6493	72427335	SO:0001819	synonymous_variant	1583	exon2			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.384C>A	15.37:g.74640282G>T		Somatic		Capture	SOLID	Phase_I	72427335	NM_000781	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Silent	SNP	ENST00000268053.6	37	CCDS32291.1																																																																																				0.582	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319737.1		
CIB2	10518	hgsc.bcm.edu	37	15	78403538	78403538	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:78403538A>G	ENST00000258930.3	-	3	495	c.167T>C	c.(166-168)aTg>aCg	p.M56T	CIB2_ENST00000560618.1_Missense_Mutation_p.M13T|CIB2_ENST00000539011.1_Missense_Mutation_p.M13T|CIB2_ENST00000557846.1_Intron	NM_006383.2	NP_006374.1	O75838	CIB2_HUMAN	calcium and integrin binding family member 2	56					calcium ion homeostasis (GO:0055074)|photoreceptor cell maintenance (GO:0045494)	blood microparticle (GO:0072562)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|photoreceptor inner segment (GO:0001917)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)	p.M56T(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	11						GATGAGGCTCATGGGCACGTG	0.602																																					p.M56T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T167C	15						.						113.0	107.0	109.0					15																	78403538		2196	4293	6489	76190593	SO:0001583	missense	10518	exon3			BC047381	CCDS10296.1, CCDS61722.1, CCDS61723.1	15q24	2013-01-10			ENSG00000136425	ENSG00000136425		"""EF-hand domain containing"""	24579	protein-coding gene	gene with protein product		605564	"""deafness, autosomal recessive 48"", ""Usher syndrome 1J (autosomal recessive)"""	DFNB48, USH1J		9931475, 23023331	Standard	NM_006383		Approved	KIP2	uc002bdb.2	O75838	OTTHUMG00000143731	ENST00000258930.3:c.167T>C	15.37:g.78403538A>G	ENSP00000258930:p.Met56Thr	Somatic		Capture	SOLID	Phase_I	76190593	NM_006383	B4DDF0|H0YM71|Q05BT6	Missense_Mutation	SNP	ENST00000258930.3	37	CCDS10296.1	.	.	.	.	.	.	.	.	.	.	A	13.69	2.312315	0.40895	.	.	ENSG00000136425	ENST00000258930;ENST00000539011	T;T	0.66460	-0.21;-0.08	4.73	4.73	0.59995	EF-hand-like domain (1);	0.063176	0.64402	D	0.000003	T	0.55065	0.1897	L	0.34521	1.04	0.45015	D	0.998038	P;B	0.37688	0.605;0.356	B;B	0.36922	0.152;0.236	T	0.54450	-0.8292	10	0.29301	T	0.29	-25.9437	13.3948	0.60846	1.0:0.0:0.0:0.0	.	56;56	B4DDF0;O75838	.;CIB2_HUMAN	T	56;13	ENSP00000258930:M56T;ENSP00000442459:M13T	ENSP00000258930:M56T	M	-	2	0	CIB2	76190593	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.894000	0.56250	1.766000	0.52107	0.482000	0.46254	ATG		0.602	CIB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289798.1	NM_006383	
AKAP13	11214	hgsc.bcm.edu	37	15	86122438	86122438	+	Missense_Mutation	SNP	G	G	A	rs115984398	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:86122438G>A	ENST00000394518.2	+	7	1234	c.1139G>A	c.(1138-1140)gGg>gAg	p.G380E	RP11-815J21.2_ENST00000561409.1_RNA|AKAP13_ENST00000361243.2_Missense_Mutation_p.G380E	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	380					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.G380E(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GAAAGAAAAGGGGAAGAGGTG	0.478																																					p.G380E	Melanoma(94;603 1453 3280 32295 32951)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1139A	15						.						83.0	88.0	87.0					15																	86122438		2202	4299	6501	83923442	SO:0001583	missense	11214	exon7			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1139G>A	15.37:g.86122438G>A	ENSP00000378026:p.Gly380Glu	Somatic		Capture	SOLID	Phase_I	83923442	NM_006738	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	7.005	0.555728	0.13436	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.12255	2.73;2.7	5.25	-0.0404	0.13871	.	.	.	.	.	T	0.08403	0.0209	L	0.29908	0.895	0.09310	N	0.999996	B;B	0.29646	0.164;0.253	B;B	0.29663	0.049;0.105	T	0.34725	-0.9817	9	0.62326	D	0.03	.	1.7533	0.02976	0.2423:0.1389:0.4757:0.1431	.	380;380	Q12802;Q12802-2	AKP13_HUMAN;.	E	380;380;379;379	ENSP00000354718:G380E;ENSP00000378026:G380E	ENSP00000354718:G380E	G	+	2	0	AKAP13	83923442	0.150000	0.22732	0.002000	0.10522	0.082000	0.17680	0.159000	0.16442	-0.077000	0.12752	-0.176000	0.13171	GGG		0.478	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
MFGE8	4240	hgsc.bcm.edu	37	15	89449968	89449968	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:89449968C>T	ENST00000566497.1	-	4	490	c.429G>A	c.(427-429)acG>acA	p.T143T	MFGE8_ENST00000542878.1_Silent_p.T99T|MFGE8_ENST00000268150.8_Silent_p.T143T|MFGE8_ENST00000539437.1_Silent_p.T135T|MFGE8_ENST00000268151.7_Silent_p.T143T|MFGE8_ENST00000559997.1_Intron			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	143	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)	p.T143T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					TGGCACCCTGCGTCACCACAC	0.537																																					p.T143T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G429A	15						.						99.0	82.0	88.0					15																	89449968		2200	4299	6499	87250972	SO:0001819	synonymous_variant	4240	exon4			U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.429G>A	15.37:g.89449968C>T		Somatic		Capture	SOLID	Phase_I	87250972	NM_001114614	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Silent	SNP	ENST00000566497.1	37	CCDS10347.1																																																																																				0.537	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000432804.1	NM_005928	
ANPEP	290	hgsc.bcm.edu	37	15	90335480	90335480	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:90335480C>A	ENST00000300060.6	-	18	2752	c.2439G>T	c.(2437-2439)tgG>tgT	p.W813C		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	813	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.W813C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	GGAACTGCTCCCAGGCGAAGT	0.617																																					p.W813C	NSCLC(30;827 977 2459 19669 26125)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2439T	15						.						137.0	132.0	134.0					15																	90335480		2200	4299	6499	88136484	SO:0001583	missense	290	exon18			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2439G>T	15.37:g.90335480C>A	ENSP00000300060:p.Trp813Cys	Somatic		Capture	SOLID	Phase_I	88136484	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	C	19.75	3.886058	0.72410	.	.	ENSG00000166825	ENST00000300060	T	0.05786	3.39	5.46	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.37046	0.0989	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56135	-0.8029	10	0.87932	D	0	.	13.8914	0.63740	0.0:0.8459:0.1541:0.0	.	813	P15144	AMPN_HUMAN	C	813	ENSP00000300060:W813C	ENSP00000300060:W813C	W	-	3	0	ANPEP	88136484	1.000000	0.71417	0.904000	0.35570	0.886000	0.51366	5.947000	0.70242	1.280000	0.44463	0.561000	0.74099	TGG		0.617	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
IQGAP1	8826	hgsc.bcm.edu	37	15	91026618	91026618	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:91026618G>A	ENST00000268182.5	+	29	3705	c.3581G>A	c.(3580-3582)cGa>cAa	p.R1194Q	IQGAP1_ENST00000560738.1_Missense_Mutation_p.R622Q	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1194	C1.|Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)	p.R1194Q(1)		breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CTTTATTATCGATACATGAAT	0.438																																					p.R1194Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3581A	15						.						64.0	58.0	60.0					15																	91026618		2198	4298	6496	88827622	SO:0001583	missense	8826	exon29			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.3581G>A	15.37:g.91026618G>A	ENSP00000268182:p.Arg1194Gln	Somatic		Capture	SOLID	Phase_I	88827622	NM_003870	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	37	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	G	33	5.260576	0.95368	.	.	ENSG00000140575	ENST00000268182	D	0.89270	-2.49	5.34	5.34	0.76211	Ras GTPase-activating protein, conserved site (1);Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.137184	0.49916	D	0.000123	D	0.94594	0.8258	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.94401	0.7623	10	0.62326	D	0.03	-14.5949	18.5696	0.91130	0.0:0.0:1.0:0.0	.	1194	P46940	IQGA1_HUMAN	Q	1194	ENSP00000268182:R1194Q	ENSP00000268182:R1194Q	R	+	2	0	IQGAP1	88827622	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.410000	0.97335	2.937000	0.99478	0.650000	0.86243	CGA		0.438	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
SLCO3A1	28232	hgsc.bcm.edu	37	15	92690230	92690230	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:92690230C>T	ENST00000318445.6	+	8	1743	c.1529C>T	c.(1528-1530)gCg>gTg	p.A510V	RP11-152L20.3_ENST00000561674.1_RNA|SLCO3A1_ENST00000555549.1_3'UTR|SLCO3A1_ENST00000424469.2_Missense_Mutation_p.A510V	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	510	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.A510V(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	ACGGGCTGTGCGTGCCTCACC	0.552																																					p.A510V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1529T	15						.						90.0	73.0	79.0					15																	92690230		2198	4298	6496	90491234	SO:0001583	missense	28232	exon8			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.1529C>T	15.37:g.92690230C>T	ENSP00000320634:p.Ala510Val	Somatic		Capture	SOLID	Phase_I	90491234	NM_013272	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.064566	0.36470	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000555549	T;T	0.39229	1.1;1.09	5.84	4.93	0.64822	Major facilitator superfamily domain, general substrate transporter (1);Protease inhibitor, Kazal-type (1);	0.334072	0.33534	N	0.004817	T	0.40247	0.1109	M	0.71871	2.18	0.50632	D	0.999887	B;P;B	0.40931	0.229;0.733;0.188	B;B;B	0.29862	0.057;0.084;0.108	T	0.49634	-0.8919	10	0.87932	D	0	.	14.698	0.69136	0.0:0.931:0.0:0.069	.	452;510;510	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	V	510;510;229	ENSP00000320634:A510V;ENSP00000387846:A510V	ENSP00000320634:A510V	A	+	2	0	SLCO3A1	90491234	0.059000	0.20769	1.000000	0.80357	0.988000	0.76386	1.835000	0.39181	1.475000	0.48197	0.655000	0.94253	GCG		0.552	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272	
ASB7	140460	hgsc.bcm.edu	37	15	101169728	101169728	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr15:101169728A>G	ENST00000332783.7	+	5	1083	c.298A>G	c.(298-300)Atg>Gtg	p.M100V	ASB7_ENST00000558747.1_Intron|ASB7_ENST00000343276.4_Missense_Mutation_p.M100V	NM_198243.2	NP_937886.1	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box containing 7	100					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.M100V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)	16	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			TGCACGCTTGATGTTAGAATC	0.507																																					p.M100V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A298G	15						.						64.0	64.0	64.0					15																	101169728		2203	4300	6503	98987251	SO:0001583	missense	140460	exon5				CCDS10387.1, CCDS10388.1	15q26.3	2013-01-10	2011-01-25		ENSG00000183475	ENSG00000183475		"""Ankyrin repeat domain containing"""	17182	protein-coding gene	gene with protein product		615052	"""ankyrin repeat and SOCS box-containing 7"""				Standard	NM_024708		Approved		uc002bwk.3	Q9H672	OTTHUMG00000149868	ENST00000332783.7:c.298A>G	15.37:g.101169728A>G	ENSP00000328327:p.Met100Val	Somatic		Capture	SOLID	Phase_I	98987251	NM_024708	A8K1E5|Q6GSJ6|Q7Z4S3	Missense_Mutation	SNP	ENST00000332783.7	37	CCDS10387.1	.	.	.	.	.	.	.	.	.	.	A	16.22	3.061903	0.55432	.	.	ENSG00000183475	ENST00000332783;ENST00000343276	T;T	0.52295	0.67;0.67	5.27	5.27	0.74061	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.36110	0.0955	N	0.13003	0.285	0.80722	D	1	B;B	0.15473	0.013;0.007	B;B	0.26693	0.072;0.005	T	0.25293	-1.0136	10	0.87932	D	0	-18.2456	15.4885	0.75587	1.0:0.0:0.0:0.0	.	100;100	Q9H672;Q9H672-2	ASB7_HUMAN;.	V	100	ENSP00000328327:M100V;ENSP00000339819:M100V	ENSP00000328327:M100V	M	+	1	0	ASB7	98987251	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.740000	0.91579	2.116000	0.64780	0.374000	0.22700	ATG		0.507	ASB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313617.1	NM_024708	
TRMT10A	93587	hgsc.bcm.edu	37	4	100472127	100472127	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:100472127C>T	ENST00000273962.3	-	7	978	c.666G>A	c.(664-666)gcG>gcA	p.A222A	TRMT10A_ENST00000394877.3_Silent_p.A222A|TRMT10A_ENST00000394876.2_Silent_p.A222A	NM_152292.4	NP_689505.1	Q8TBZ6	TM10A_HUMAN	tRNA methyltransferase 10 homolog A (S. cerevisiae)	222	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.				magnesium ion homeostasis (GO:0010960)	extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)	p.A222A(1)									CATAATCTGACGCTTGTTTAT	0.318																																					p.A222A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G666A	4						.						92.0	85.0	88.0					4																	100472127		2203	4300	6503	100691150	SO:0001819	synonymous_variant	93587	exon7			BC028373	CCDS3650.1	4q23	2012-06-28	2012-06-28	2012-06-28	ENSG00000145331	ENSG00000145331			28403	protein-coding gene	gene with protein product			"""RNA (guanine-9-) methyltransferase domain containing 2"""	RG9MTD2		12477932	Standard	NM_152292		Approved	MGC27034, TRM10	uc003hva.4	Q8TBZ6	OTTHUMG00000131025	ENST00000273962.3:c.666G>A	4.37:g.100472127C>T		Somatic		Capture	SOLID	Phase_I	100691150	NM_001134665	B2R8X7|Q9Y2T9	Silent	SNP	ENST00000273962.3	37	CCDS3650.1																																																																																				0.318	TRMT10A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253668.1	NM_152292	
LAMTOR3	8649	hgsc.bcm.edu	37	4	100806729	100806729	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:100806729T>C	ENST00000499666.2	-	5	399	c.207A>G	c.(205-207)aaA>aaG	p.K69K	LAMTOR3_ENST00000226522.8_Silent_p.K62K|LAMTOR3_ENST00000515100.1_5'UTR	NM_001243736.1|NM_021970.3	NP_001230665.1|NP_068805.1	Q9UHA4	LTOR3_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 3	69	Required for interaction with LAMTOR2. {ECO:0000250}.				cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Ragulator complex (GO:0071986)		p.K69K(1)		endometrium(1)|large_intestine(1)|lung(1)	3						AGATGATACTTTTATTTTTGG	0.343																																					p.K69K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A207G	4						.						78.0	75.0	76.0					4																	100806729		2203	4300	6503	101025752	SO:0001819	synonymous_variant	8649	exon5			AF201947	CCDS3652.1, CCDS58920.1	4q24-q26	2012-02-28	2011-02-15	2011-02-15	ENSG00000109270	ENSG00000109270			15606	protein-coding gene	gene with protein product	"""MEK partner 1"""	603296	"""mitogen-activated protein kinase kinase 1 interacting protein 1"", ""MAPK scaffold protein 1"""	MAP2K1IP1, MAPKSP1		9733512, 15016825	Standard	NM_021970		Approved	MP1, MAPBP, Ragulator3	uc003hvg.2	Q9UHA4	OTTHUMG00000131050	ENST00000499666.2:c.207A>G	4.37:g.100806729T>C		Somatic		Capture	SOLID	Phase_I	101025752	NM_021970	B2R4A1|J3KMX4|Q9H364	Silent	SNP	ENST00000499666.2	37	CCDS3652.1																																																																																				0.343	LAMTOR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253698.2	NM_021970	
BOD1L1	259282	hgsc.bcm.edu	37	4	13601673	13601673	+	Missense_Mutation	SNP	G	G	A	rs139355197		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:13601673G>A	ENST00000040738.5	-	10	6986	c.6851C>T	c.(6850-6852)gCg>gTg	p.A2284V		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2284						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A2284V(1)									CATCTCTTCCGCTGGTGTGAC	0.577																																					p.A2284V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6851T	4						.	G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	60.0	52.0	55.0		6851	-4.8	0.0	4	dbSNP_134	55	0,8600		0,0,4300	no	missense	BOD1L	NM_148894.2	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	2284/3052	13601673	1,13005	2203	4300	6503	13210771	SO:0001583	missense	259282	exon10			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6851C>T	4.37:g.13601673G>A	ENSP00000040738:p.Ala2284Val	Somatic		Capture	SOLID	Phase_I	13210771	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	G	0.230	-1.021542	0.02061	2.27E-4	0.0	ENSG00000038219	ENST00000040738	T	0.06687	3.27	5.22	-4.77	0.03219	.	1.298900	0.05477	N	0.554082	T	0.02649	0.0080	N	0.03177	-0.4	0.09310	N	1	B	0.14805	0.011	B	0.06405	0.002	T	0.43589	-0.9382	10	0.13108	T	0.6	-0.659	2.8236	0.05479	0.4457:0.193:0.2637:0.0976	.	2284	Q8NFC6	BOD1L_HUMAN	V	2284	ENSP00000040738:A2284V	ENSP00000040738:A2284V	A	-	2	0	BOD1L	13210771	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.123000	0.15708	-0.613000	0.05694	-0.312000	0.09012	GCG		0.577	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
INTS12	57117	hgsc.bcm.edu	37	4	106604196	106604196	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:106604196T>G	ENST00000451321.2	-	7	1562	c.1083A>C	c.(1081-1083)aaA>aaC	p.K361N	INTS12_ENST00000340139.5_Missense_Mutation_p.K361N|INTS12_ENST00000394735.1_Missense_Mutation_p.K361N	NM_001142471.1	NP_001135943.1	Q96CB8	INT12_HUMAN	integrator complex subunit 12	361	Ser-rich.				snRNA processing (GO:0016180)	integrator complex (GO:0032039)	zinc ion binding (GO:0008270)	p.K361N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		GTGGAGGTGGTTTTAAAGGTA	0.448																																					p.K361N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1083C	4						.						232.0	211.0	218.0					4																	106604196		2203	4300	6503	106823645	SO:0001583	missense	57117	exon7				CCDS3671.1	4q24	2013-01-28	2006-03-15	2006-03-15	ENSG00000138785	ENSG00000138785		"""Zinc fingers, PHD-type"""	25067	protein-coding gene	gene with protein product	"""hypothetical nuclear factor SBBI22"""	611355	"""PHD finger protein 22"""	PHF22		16239144	Standard	NM_020395		Approved	SBBI22, INT12	uc010ilr.3	Q96CB8	OTTHUMG00000131215	ENST00000451321.2:c.1083A>C	4.37:g.106604196T>G	ENSP00000415433:p.Lys361Asn	Somatic		Capture	SOLID	Phase_I	106823645	NM_001142471	B2RC48|Q3B6Z3|Q9HD71	Missense_Mutation	SNP	ENST00000451321.2	37	CCDS3671.1	.	.	.	.	.	.	.	.	.	.	T	15.54	2.864013	0.51482	.	.	ENSG00000138785	ENST00000394735;ENST00000340139;ENST00000451321	T;T;T	0.61158	0.13;0.13;0.13	4.31	0.644	0.17776	.	0.000000	0.85682	D	0.000000	T	0.59918	0.2229	L	0.32530	0.975	0.49483	D	0.999799	D	0.71674	0.998	D	0.78314	0.991	T	0.58014	-0.7711	10	0.62326	D	0.03	-13.3407	7.9929	0.30250	0.0:0.4716:0.0:0.5284	.	361	Q96CB8	INT12_HUMAN	N	361	ENSP00000378221:K361N;ENSP00000340737:K361N;ENSP00000415433:K361N	ENSP00000340737:K361N	K	-	3	2	INTS12	106823645	0.525000	0.26290	0.995000	0.50966	0.634000	0.38068	-0.279000	0.08479	0.295000	0.22570	0.460000	0.39030	AAA		0.448	INTS12-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318624.1	NM_020395	
SCOC	60592	hgsc.bcm.edu	37	4	141302166	141302166	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:141302166T>C	ENST00000608372.1	+	4	415	c.388T>C	c.(388-390)Tca>Cca	p.S130P	SCOC_ENST00000506597.1_Missense_Mutation_p.S102P|SCOC_ENST00000512749.1_Missense_Mutation_p.S53P|SCOC_ENST00000338517.4_Missense_Mutation_p.S93P|SCOC_ENST00000506322.1_Missense_Mutation_p.S53P|SCOC_ENST00000510586.1_Missense_Mutation_p.S53P|SCOC_ENST00000394205.3_Missense_Mutation_p.S93P|SCOC_ENST00000394201.4_Missense_Mutation_p.S53P|SCOC_ENST00000502535.1_Missense_Mutation_p.S53P|SCOC_ENST00000394203.3_Missense_Mutation_p.S93P			Q9UIL1	SCOC_HUMAN	short coiled-coil protein	130					positive regulation of macroautophagy (GO:0016239)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.S93P(1)		kidney(1)|large_intestine(1)|lung(2)|skin(1)	5	all_hematologic(180;0.162)					GAAGCTAAAATCAGAAAACCA	0.303																																					p.S93P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T277C	4						.						51.0	56.0	55.0					4																	141302166		2203	4298	6501	141521616	SO:0001583	missense	60592	exon4			AK027797	CCDS3750.1, CCDS54806.1, CCDS54807.1	4q28.3	2014-05-22	2003-03-19		ENSG00000153130	ENSG00000153130			20335	protein-coding gene	gene with protein product			"""short coiled coil protein"""			11303027	Standard	NM_032547		Approved	HRIHFB2072, SCOCO	uc011che.1	Q9UIL1	OTTHUMG00000133416	ENST00000608372.1:c.388T>C	4.37:g.141302166T>C	ENSP00000477352:p.Ser130Pro	Somatic		Capture	SOLID	Phase_I	141521616	NM_001153585	B7WPH7|D3DNY7|E9PB65|Q6P5T9|Q7L2Y0|Q7Z4P2|Q96JY9|Q9BZB2	Missense_Mutation	SNP	ENST00000608372.1	37	CCDS54806.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.188480	0.78789	.	.	ENSG00000153130	ENST00000394205;ENST00000338517;ENST00000394203;ENST00000506322;ENST00000512749;ENST00000394201;ENST00000506597;ENST00000502535	.	.	.	5.58	5.58	0.84498	.	0.057925	0.64402	D	0.000001	T	0.75715	0.3887	L	0.55213	1.73	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.999;0.999;0.999;0.999	T	0.78219	-0.2289	9	0.87932	D	0	-25.5695	15.746	0.77944	0.0:0.0:0.0:1.0	.	25;102;130;92;93	Q9UIL1-4;E9PB65;Q9UIL1;Q9UIL1-3;Q9UIL1-2	.;.;SCOC_HUMAN;.;.	P	93;93;93;53;53;130;102;53	.	ENSP00000345262:S93P	S	+	1	0	SCOC	141521616	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.010000	0.88615	2.130000	0.65690	0.477000	0.44152	TCA		0.303	SCOC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257274.2		
ZNF827	152485	hgsc.bcm.edu	37	4	146744600	146744600	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:146744600A>G	ENST00000508784.1	-	8	2584	c.2357T>C	c.(2356-2358)gTg>gCg	p.V786A	ZNF827_ENST00000379448.4_Missense_Mutation_p.V786A|ZNF827_ENST00000513320.1_Missense_Mutation_p.V436A			Q17R98	ZN827_HUMAN	zinc finger protein 827	786					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V786A(2)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					TCCGTGCAGCACGGAGTCACT	0.443																																					p.V786A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2357C	4						.						146.0	145.0	145.0					4																	146744600		2203	4300	6503	146964050	SO:0001583	missense	152485	exon8			AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.2357T>C	4.37:g.146744600A>G	ENSP00000421863:p.Val786Ala	Somatic		Capture	SOLID	Phase_I	146964050	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	ENST00000508784.1	37		.	.	.	.	.	.	.	.	.	.	A	8.391	0.839816	0.16891	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000440280	T;T;T	0.06528	3.41;3.29;3.42	5.52	1.85	0.25348	.	0.893812	0.10033	N	0.724450	T	0.03095	0.0091	N	0.08118	0	0.29351	N	0.865324	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.46442	-0.9191	10	0.12766	T	0.61	-2.8413	6.7308	0.23383	0.6494:0.0:0.3506:0.0	.	436;786;786	G5E9Z1;Q17R98;Q17R98-2	.;ZN827_HUMAN;.	A	786;436;786;785;436	ENSP00000421863:V786A;ENSP00000423130:V436A;ENSP00000368761:V786A	ENSP00000281318:V785A	V	-	2	0	ZNF827	146964050	0.990000	0.36364	0.857000	0.33713	0.698000	0.40448	0.950000	0.29122	0.395000	0.25257	0.397000	0.26171	GTG		0.443	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
DCHS2	54798	hgsc.bcm.edu	37	4	155254352	155254352	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:155254352G>A	ENST00000357232.4	-	9	1510	c.1511C>T	c.(1510-1512)gCg>gTg	p.A504V	DCHS2_ENST00000507542.1_5'UTR|DCHS2_ENST00000339452.1_Missense_Mutation_p.A1003V	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	504	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A504V(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TCTGTCTTCCGCACGTGCGAG	0.602																																					p.A1003V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3008T	4						.						67.0	63.0	65.0					4																	155254352		2203	4300	6503	155473802	SO:0001583	missense	54798	exon5			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1511C>T	4.37:g.155254352G>A	ENSP00000349768:p.Ala504Val	Somatic		Capture	SOLID	Phase_I	155473802	NM_001142552	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685327	0.88639	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.59364	0.27;0.27	5.6	5.6	0.85130	Cadherin (4);Cadherin-like (1);	0.095877	0.43110	D	0.000615	T	0.77485	0.4137	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	T	0.78122	-0.2327	10	0.56958	D	0.05	.	19.612	0.95610	0.0:0.0:1.0:0.0	.	1003;504	E9PC11;Q6V1P9	.;PCD23_HUMAN	V	504;1003;1003	ENSP00000349768:A504V;ENSP00000345062:A1003V	ENSP00000345062:A1003V	A	-	2	0	DCHS2	155473802	1.000000	0.71417	0.046000	0.18839	0.463000	0.32649	9.773000	0.98989	2.632000	0.89209	0.563000	0.77884	GCG		0.602	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
FGA	2243	hgsc.bcm.edu	37	4	155507826	155507826	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:155507826G>C	ENST00000302053.3	-	5	833	c.755C>G	c.(754-756)aCa>aGa	p.T252R	FGA_ENST00000403106.3_Missense_Mutation_p.T252R	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	252					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)	p.T252R(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CGGCATGTCTGTTAATGCCTT	0.478																																					p.T252R	NSCLC(143;340 1922 20892 22370 48145)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C755G	4						.						132.0	140.0	137.0					4																	155507826		2203	4300	6503	155727276	SO:0001583	missense	2243	exon5				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.755C>G	4.37:g.155507826G>C	ENSP00000306361:p.Thr252Arg	Somatic		Capture	SOLID	Phase_I	155727276	NM_021871	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	G	8.234	0.805253	0.16467	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	D;D	0.82255	-1.59;-1.59	5.43	-5.49	0.02584	.	16.262400	0.00166	N	0.000000	T	0.72914	0.3520	L	0.52573	1.65	0.09310	N	1	B;B	0.24920	0.114;0.019	B;B	0.18871	0.023;0.006	T	0.53251	-0.8465	10	0.20519	T	0.43	.	3.5755	0.07933	0.2792:0.1538:0.4437:0.1234	.	252;252	P02671-2;P02671	.;FIBA_HUMAN	R	252	ENSP00000306361:T252R;ENSP00000385981:T252R	ENSP00000306361:T252R	T	-	2	0	FGA	155727276	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.051000	0.14141	-0.552000	0.06167	-0.150000	0.13652	ACA		0.478	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
LRAT	9227	hgsc.bcm.edu	37	4	155665641	155665641	+	Missense_Mutation	SNP	C	C	T	rs527236079		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:155665641C>T	ENST00000336356.3	+	2	416	c.163C>T	c.(163-165)Cgg>Tgg	p.R55W	LRAT_ENST00000507827.1_Missense_Mutation_p.R55W	NM_004744.3	NP_004735.2	O95237	LRAT_HUMAN	lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)	55					phototransduction, visible light (GO:0007603)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)	phosphatidylcholine-retinol O-acyltransferase activity (GO:0047173)|retinoic acid binding (GO:0001972)|retinol binding (GO:0019841)|transferase activity, transferring acyl groups (GO:0016746)	p.R55W(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)	16	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	GGAGGTGCCCCGGACCCACCT	0.592																																					p.R55W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C163T	4						.						93.0	91.0	92.0					4																	155665641		2203	4300	6503	155885091	SO:0001583	missense	9227	exon2			AF071510	CCDS3789.1	4q32.1	2014-01-28			ENSG00000121207	ENSG00000121207	2.3.1.135		6685	protein-coding gene	gene with protein product		604863				9920938	Standard	XM_006714412		Approved	LCA14	uc003ion.1	O95237	OTTHUMG00000161418	ENST00000336356.3:c.163C>T	4.37:g.155665641C>T	ENSP00000337224:p.Arg55Trp	Somatic		Capture	SOLID	Phase_I	155885091	NM_004744	A8K983|Q8N716	Missense_Mutation	SNP	ENST00000336356.3	37	CCDS3789.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657255	0.88154	.	.	ENSG00000121207	ENST00000502525;ENST00000507827;ENST00000336356	T;T;T	0.46063	0.88;0.88;0.88	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.75072	0.3800	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83107	-0.0125	10	0.87932	D	0	-8.1953	13.4877	0.61375	0.1562:0.8438:0.0:0.0	.	55	O95237	LRAT_HUMAN	W	55	ENSP00000422324:R55W;ENSP00000426761:R55W;ENSP00000337224:R55W	ENSP00000337224:R55W	R	+	1	2	LRAT	155885091	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	3.057000	0.49931	2.589000	0.87451	0.655000	0.94253	CGG		0.592	LRAT-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365246.1	NM_004744	
GUCY1A3	2982	hgsc.bcm.edu	37	4	156638325	156638325	+	Silent	SNP	C	C	T	rs112384014		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:156638325C>T	ENST00000296518.7	+	8	1796	c.1587C>T	c.(1585-1587)ggC>ggT	p.G529G	GUCY1A3_ENST00000513574.1_Silent_p.G529G|GUCY1A3_ENST00000511108.1_Silent_p.G529G|GUCY1A3_ENST00000511507.1_Silent_p.G529G|GUCY1A3_ENST00000393832.3_Silent_p.G271G|GUCY1A3_ENST00000506455.1_Silent_p.G529G|GUCY1A3_ENST00000455639.2_Silent_p.G529G			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	529	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.G529G(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		AGACCATTGGCGATGCCTATT	0.413																																					p.G529G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1587T	4						.						135.0	130.0	132.0					4																	156638325		2203	4300	6503	156857775	SO:0001819	synonymous_variant	2982	exon8				CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1587C>T	4.37:g.156638325C>T		Somatic		Capture	SOLID	Phase_I	156857775	NM_001130682	D3DP19|D6RDW3|O43843|Q8TAH3	Silent	SNP	ENST00000296518.7	37	CCDS34085.1																																																																																				0.413	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2		
GRIA2	2891	hgsc.bcm.edu	37	4	158281123	158281123	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:158281123A>G	ENST00000264426.9	+	13	2398	c.2119A>G	c.(2119-2121)Acg>Gcg	p.T707A	GRIA2_ENST00000296526.7_Missense_Mutation_p.T707A|AC079233.1_ENST00000578227.1_RNA|GRIA2_ENST00000449365.1_Missense_Mutation_p.T660A|GRIA2_ENST00000507898.1_Missense_Mutation_p.T660A|GRIA2_ENST00000393815.2_Missense_Mutation_p.T660A	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	707					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.T707A(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TGTGAGGACTACGGCCGAAGG	0.498																																					p.T660A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1978G	4						.						104.0	102.0	103.0					4																	158281123		2203	4300	6503	158500573	SO:0001583	missense	2891	exon13				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.2119A>G	4.37:g.158281123A>G	ENSP00000264426:p.Thr707Ala	Somatic		Capture	SOLID	Phase_I	158500573	NM_001083620	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	CCDS43274.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.81|16.81	3.226159|3.226159	0.58668|0.58668	.|.	.|.	ENSG00000120251|ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365|ENST00000510854	T;T;T;T;T|.	0.38077|.	1.16;1.16;1.16;1.16;1.16|.	5.69|5.69	5.69|5.69	0.88448|0.88448	Ionotropic glutamate receptor (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.55940|0.55940	0.1952|0.1952	L|L	0.31157|0.31157	0.91|0.91	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	0.973;0.992;1.0;0.998;0.992|.	D;D;D;D;D|.	0.87578|.	0.932;0.984;0.998;0.994;0.987|.	T|T	0.52442|0.52442	-0.8575|-0.8575	10|5	0.72032|.	D|.	0.01|.	.|.	15.9526|15.9526	0.79855|0.79855	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	735;707;707;707;660|.	Q59F93;P42262-3;P42262;P42262-2;A8MT92|.	.;.;GRIA2_HUMAN;.;.|.	A|C	660;660;707;707;660|37	ENSP00000426845:T660A;ENSP00000377403:T660A;ENSP00000296526:T707A;ENSP00000264426:T707A;ENSP00000389837:T660A|.	ENSP00000264426:T707A|.	T|Y	+|+	1|2	0|0	GRIA2|GRIA2	158500573|158500573	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.984000|0.984000	0.73092|0.73092	9.339000|9.339000	0.96797|0.96797	2.168000|2.168000	0.68352|0.68352	0.533000|0.533000	0.62120|0.62120	ACG|TAC		0.498	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
LETM1	3954	hgsc.bcm.edu	37	4	1818530	1818530	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:1818530T>C	ENST00000302787.2	-	12	2151	c.1855A>G	c.(1855-1857)Atc>Gtc	p.I619V		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	619					cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.I619V(1)		breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			AAGCCATCGATCTGCCCGATC	0.557																																					p.I619V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1855G	4						.						132.0	108.0	116.0					4																	1818530		2203	4300	6503	1788328	SO:0001583	missense	3954	exon12			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.1855A>G	4.37:g.1818530T>C	ENSP00000305653:p.Ile619Val	Somatic		Capture	SOLID	Phase_I	1788328	NM_012318	B4DED2|Q9UF65	Missense_Mutation	SNP	ENST00000302787.2	37	CCDS3355.1	.	.	.	.	.	.	.	.	.	.	t	10.66	1.413136	0.25465	.	.	ENSG00000168924	ENST00000302787	.	.	.	5.04	5.04	0.67666	.	0.161324	0.53938	D	0.000047	T	0.48624	0.1510	L	0.39397	1.21	0.54753	D	0.999988	B	0.26876	0.162	B	0.24006	0.05	T	0.43475	-0.9389	9	0.30854	T	0.27	-7.1101	14.7284	0.69362	0.0:0.0:0.0:1.0	.	619	O95202	LETM1_HUMAN	V	619	.	ENSP00000305653:I619V	I	-	1	0	LETM1	1788328	1.000000	0.71417	0.989000	0.46669	0.144000	0.21451	5.284000	0.65627	2.026000	0.59711	0.533000	0.62120	ATC		0.557	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241634.1		
ADAM29	11086	hgsc.bcm.edu	37	4	175897313	175897313	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:175897313C>T	ENST00000359240.3	+	5	1307	c.637C>T	c.(637-639)Cgt>Tgt	p.R213C	ADAM29_ENST00000404450.4_Missense_Mutation_p.R213C|ADAM29_ENST00000445694.1_Missense_Mutation_p.R213C|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000514159.1_Missense_Mutation_p.R213C	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	213	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R213C(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TCTGTACATTCGTTATGAAAG	0.338																																					p.R213C	Ovarian(140;1727 1835 21805 25838 41440)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C637T	4						.						84.0	84.0	84.0					4																	175897313		2203	4300	6503	176133888	SO:0001583	missense	11086	exon3			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.637C>T	4.37:g.175897313C>T	ENSP00000352177:p.Arg213Cys	Somatic		Capture	SOLID	Phase_I	176133888	NM_001130705	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383641	0.42308	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	3.74	2.87	0.33458	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.473650	0.15190	U	0.275633	T	0.71962	0.3402	M	0.71036	2.16	0.09310	N	1	D	0.71674	0.998	P	0.61592	0.891	T	0.59862	-0.7374	9	.	.	.	.	8.4958	0.33127	0.2313:0.7687:0.0:0.0	.	213	Q9UKF5	ADA29_HUMAN	C	213	ENSP00000352177:R213C;ENSP00000414544:R213C;ENSP00000384229:R213C;ENSP00000423517:R213C	.	R	+	1	0	ADAM29	176133888	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.302000	0.08221	1.102000	0.41551	0.643000	0.83706	CGT		0.338	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
PIGG	54872	hgsc.bcm.edu	37	4	514924	514924	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:514924A>G	ENST00000453061.2	+	7	1300	c.1194A>G	c.(1192-1194)tcA>tcG	p.S398S	PIGG_ENST00000503111.1_Intron|PIGG_ENST00000383028.4_Silent_p.S265S|PIGG_ENST00000296306.7_Intron|PIGG_ENST00000509768.1_Silent_p.S309S|PIGG_ENST00000310340.5_Silent_p.S398S|PIGG_ENST00000536264.1_Silent_p.S276S|PIGG_ENST00000504346.1_Silent_p.S309S	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	398					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)	p.S398S(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						AAAAGCATTCAGAAGTCCTAT	0.473																																					p.S398S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1194G	4						.						133.0	120.0	124.0					4																	514924		2203	4300	6503	504924	SO:0001819	synonymous_variant	54872	exon7				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1194A>G	4.37:g.514924A>G		Somatic		Capture	SOLID	Phase_I	504924	NM_017733	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Silent	SNP	ENST00000453061.2	37	CCDS46992.1																																																																																				0.473	PIGG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357494.1	NM_017733	
PDE6B	5158	hgsc.bcm.edu	37	4	651213	651213	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:651213G>A	ENST00000496514.1	+	10	1352	c.1331G>A	c.(1330-1332)cGc>cAc	p.R444H	RP11-1191J2.2_ENST00000489312.1_RNA|RP11-1191J2.2_ENST00000468356.1_RNA|PDE6B_ENST00000429163.2_Missense_Mutation_p.R165H|PDE6B_ENST00000255622.6_Missense_Mutation_p.R444H			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	444					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.R444H(1)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CTGGAGAACCGCAAGGACATC	0.597																																					p.R165H	GBM(71;463 1194 9848 25922 46834)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G494A	4						.						215.0	131.0	159.0					4																	651213		2203	4300	6503	641213	SO:0001583	missense	5158	exon8			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1331G>A	4.37:g.651213G>A	ENSP00000420295:p.Arg444His	Somatic		Capture	SOLID	Phase_I	641213	NM_001145292	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.287953	0.80803	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163	T;T;T	0.71341	-0.56;-0.56;-0.56	4.85	4.85	0.62838	.	0.176532	0.49305	N	0.000154	T	0.80144	0.4569	M	0.88640	2.97	0.58432	D	0.999999	D;D	0.58268	0.969;0.982	B;P	0.48654	0.381;0.585	D	0.85519	0.1202	10	0.87932	D	0	.	15.4521	0.75282	0.0:0.0:1.0:0.0	.	444;444	P35913;P35913-2	PDE6B_HUMAN;.	H	444;444;165	ENSP00000255622:R444H;ENSP00000420295:R444H;ENSP00000406334:R165H	ENSP00000255622:R444H	R	+	2	0	PDE6B	641213	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.355000	0.79434	2.224000	0.72417	0.447000	0.29281	CGC		0.597	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
NPFFR2	10886	hgsc.bcm.edu	37	4	73012910	73012910	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:73012910T>C	ENST00000308744.6	+	4	1048	c.950T>C	c.(949-951)aTg>aCg	p.M317T	NPFFR2_ENST00000344413.5_3'UTR|NPFFR2_ENST00000358749.3_Missense_Mutation_p.M215T|NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000395999.1_Missense_Mutation_p.M218T	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	317					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)	p.M317T(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			AATCAGGAAATGAGGAAGATC	0.458																																					p.M218T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T653C	4						.						110.0	93.0	99.0					4																	73012910		2203	4300	6503	73231774	SO:0001583	missense	10886	exon5			AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.950T>C	4.37:g.73012910T>C	ENSP00000307822:p.Met317Thr	Somatic		Capture	SOLID	Phase_I	73231774	NM_001144756	Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	37	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	T	11.68	1.709900	0.30322	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.36340	1.26;1.26;1.26	5.91	4.72	0.59763	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.51193	0.1660	M	0.62266	1.93	0.80722	D	1	D;D	0.55385	0.964;0.971	P;P	0.62089	0.713;0.898	T	0.43798	-0.9369	10	0.24483	T	0.36	.	12.3161	0.54958	0.1269:0.0:0.0:0.8731	.	218;317	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	T	317;218;215	ENSP00000307822:M317T;ENSP00000379321:M218T;ENSP00000351599:M215T	ENSP00000307822:M317T	M	+	2	0	NPFFR2	73231774	1.000000	0.71417	0.990000	0.47175	0.093000	0.18481	6.181000	0.71988	1.041000	0.40125	0.533000	0.62120	ATG		0.458	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885	
ADAMTS3	9508	hgsc.bcm.edu	37	4	73205264	73205264	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:73205264G>A	ENST00000286657.4	-	5	844	c.808C>T	c.(808-810)Cgt>Tgt	p.R270C		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	270	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R270S(1)|p.R270C(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CCATGGAAACGGACCACAGAG	0.453																																					p.R270C	NSCLC(168;1941 2048 2918 13048 43078)											.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C808T	4						.						322.0	323.0	323.0					4																	73205264		2203	4300	6503	73424128	SO:0001583	missense	9508	exon5			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.808C>T	4.37:g.73205264G>A	ENSP00000286657:p.Arg270Cys	Somatic		Capture	SOLID	Phase_I	73424128	NM_014243	A1L3U9|Q9BXZ8	Missense_Mutation	SNP	ENST00000286657.4	37	CCDS3553.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469675	0.84533	.	.	ENSG00000156140	ENST00000286657	T	0.64438	-0.1	5.31	5.31	0.75309	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.141009	0.48767	D	0.000166	T	0.78597	0.4308	M	0.76938	2.355	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.80473	-0.1367	10	0.72032	D	0.01	.	14.0595	0.64790	0.0:0.0:0.8494:0.1506	.	270	O15072	ATS3_HUMAN	C	270	ENSP00000286657:R270C	ENSP00000286657:R270C	R	-	1	0	ADAMTS3	73424128	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.609000	0.82925	2.763000	0.94921	0.563000	0.77884	CGT		0.453	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2		
GK2	2712	hgsc.bcm.edu	37	4	80329160	80329160	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:80329160G>A	ENST00000358842.3	-	1	212	c.195C>T	c.(193-195)taC>taT	p.Y65Y		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)	p.Y65Y(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						CTATACACTCGTAGACAGACT	0.408																																					p.Y65Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C195T	4						.						179.0	175.0	176.0					4																	80329160		2203	4300	6503	80548184	SO:0001819	synonymous_variant	2712	exon1			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.195C>T	4.37:g.80329160G>A		Somatic		Capture	SOLID	Phase_I	80548184	NM_033214	Q7Z4Q4	Silent	SNP	ENST00000358842.3	37	CCDS3585.1																																																																																				0.408	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214	
KLHL8	57563	hgsc.bcm.edu	37	4	88091665	88091665	+	Silent	SNP	A	A	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:88091665A>C	ENST00000273963.5	-	7	1652	c.1311T>G	c.(1309-1311)tcT>tcG	p.S437S	KLHL8_ENST00000545252.1_Silent_p.S86S|KLHL8_ENST00000512111.1_Silent_p.S437S|KLHL8_ENST00000425278.2_Silent_p.S254S|KLHL8_ENST00000498875.2_Silent_p.S361S	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	437					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)		p.S437S(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		TCCACTGATCAGATTCTATGT	0.423																																					p.S437S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1311G	4						.						121.0	109.0	113.0					4																	88091665		2203	4300	6503	88310689	SO:0001819	synonymous_variant	57563	exon7			AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.1311T>G	4.37:g.88091665A>C		Somatic		Capture	SOLID	Phase_I	88310689	NM_020803	Q53XA3|Q6N018	Silent	SNP	ENST00000273963.5	37	CCDS3617.1																																																																																				0.423	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253040.1		
SMARCAD1	56916	hgsc.bcm.edu	37	4	95173907	95173907	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:95173907C>T	ENST00000354268.4	+	9	1103	c.1030C>T	c.(1030-1032)Cgt>Tgt	p.R344C	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.R344C|SMARCAD1_ENST00000509418.1_5'Flank			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	344					ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.R344C(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		TAACAAGAAACGTAAAAAAAA	0.313																																					p.R344C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1030T	4						.						48.0	48.0	48.0					4																	95173907		2203	4300	6503	95392930	SO:0001583	missense	56916	exon9			AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.1030C>T	4.37:g.95173907C>T	ENSP00000346217:p.Arg344Cys	Somatic		Capture	SOLID	Phase_I	95392930	NM_001128429	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	37	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.636421	0.47049	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268	D;D;D	0.88431	-2.38;-2.38;-2.38	5.58	4.72	0.59763	.	0.313497	0.23185	N	0.050980	D	0.85974	0.5822	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.995;0.997	B;P	0.46975	0.446;0.533	D	0.87407	0.2373	10	0.59425	D	0.04	-15.9162	15.0285	0.71687	0.0:0.7033:0.2967:0.0	.	344;344	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	C	344	ENSP00000351947:R344C;ENSP00000415576:R344C;ENSP00000346217:R344C	ENSP00000346217:R344C	R	+	1	0	SMARCAD1	95392930	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.828000	0.48120	2.630000	0.89119	0.655000	0.94253	CGT		0.313	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159	
SNX25	83891	hgsc.bcm.edu	37	4	186260600	186260600	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr4:186260600T>C	ENST00000504273.1	+	11	1784	c.1490T>C	c.(1489-1491)aTg>aCg	p.M497T	SNX25_ENST00000512853.1_3'UTR|SNX25_ENST00000264694.8_Missense_Mutation_p.M497T			Q9H3E2	SNX25_HUMAN	sorting nexin 25	497					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.M497T(1)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		CAGCTGCACATGGCAAGAACG	0.418																																					p.M497T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1490C	4						.						95.0	84.0	87.0					4																	186260600		2203	4300	6503	186497594	SO:0001583	missense	83891	exon11			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.1490T>C	4.37:g.186260600T>C	ENSP00000426255:p.Met497Thr	Somatic		Capture	SOLID	Phase_I	186497594	NM_031953	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	T	15.30	2.792757	0.50102	.	.	ENSG00000109762	ENST00000504273;ENST00000264694;ENST00000264693	T;T	0.28895	1.59;1.59	5.71	5.71	0.89125	Phox homologous domain (1);	0.318072	0.39146	N	0.001460	T	0.30008	0.0751	L	0.59436	1.845	0.33855	D	0.633066	B;B;B	0.25007	0.049;0.116;0.049	B;B;B	0.20767	0.021;0.019;0.031	T	0.37619	-0.9698	10	0.11182	T	0.66	-11.6642	15.991	0.80206	0.0:0.0:0.0:1.0	.	268;30;497	Q8N6K3;Q9H5Q8;Q9H3E2	.;.;SNX25_HUMAN	T	497;497;30	ENSP00000426255:M497T;ENSP00000264694:M497T	ENSP00000264693:M30T	M	+	2	0	SNX25	186497594	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	7.654000	0.83653	2.168000	0.68352	0.523000	0.50628	ATG		0.418	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	
WWC3	55841	hgsc.bcm.edu	37	X	10062252	10062252	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:10062252C>T	ENST00000380861.4	+	7	979	c.588C>T	c.(586-588)ggC>ggT	p.G196G	WWC3_ENST00000454666.1_Silent_p.G196G	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	196					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.G196G(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						ACCATGTAGGCGTGCCTGGCG	0.577																																					p.G196G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C588T	X						.						141.0	122.0	129.0					X																	10062252		2203	4300	6503	10022252	SO:0001819	synonymous_variant	55841	exon7			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.588C>T	X.37:g.10062252C>T		Somatic		Capture	SOLID	Phase_I	10022252	NM_015691	A8KA96|Q659C1|Q9BTQ1	Silent	SNP	ENST00000380861.4	37	CCDS14136.1																																																																																				0.577	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
IRS4	8471	hgsc.bcm.edu	37	X	107975822	107975822	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:107975822G>T	ENST00000372129.2	-	1	3829	c.3753C>A	c.(3751-3753)gaC>gaA	p.D1251E	RP6-24A23.6_ENST00000563887.1_Missense_Mutation_p.D32E	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	1251					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.D1251E(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TTTTGGGAGAGTCGAACTGAT	0.463																																					p.D1251E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3753A	X						.						103.0	101.0	102.0					X																	107975822		2203	4300	6503	107862478	SO:0001583	missense	8471	exon1			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.3753C>A	X.37:g.107975822G>T	ENSP00000361202:p.Asp1251Glu	Somatic		Capture	SOLID	Phase_I	107862478	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.142376	0.57044	.	.	ENSG00000133124	ENST00000372129	T	0.35973	1.28	4.59	4.59	0.56863	.	1.162210	0.06442	N	0.726116	T	0.29458	0.0734	N	0.19112	0.55	0.26344	N	0.97732	B	0.26635	0.155	B	0.21360	0.034	T	0.15435	-1.0437	10	0.62326	D	0.03	.	13.7659	0.62995	0.0:0.0:1.0:0.0	.	1251	O14654	IRS4_HUMAN	E	1251	ENSP00000361202:D1251E	ENSP00000361202:D1251E	D	-	3	2	IRS4	107862478	1.000000	0.71417	0.984000	0.44739	0.878000	0.50629	4.332000	0.59279	2.517000	0.84864	0.600000	0.82982	GAC		0.463	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
AMOT	154796	hgsc.bcm.edu	37	X	112024258	112024258	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:112024258C>A	ENST00000524145.1	-	10	2403	c.2329G>T	c.(2329-2331)Gag>Tag	p.E777*	AMOT_ENST00000304758.1_Nonsense_Mutation_p.E368*|AMOT_ENST00000371959.3_Nonsense_Mutation_p.E777*|AMOT_ENST00000371958.1_Nonsense_Mutation_p.E545*|AMOT_ENST00000371962.1_Nonsense_Mutation_p.E545*|MIR4329_ENST00000582643.1_RNA			Q4VCS5	AMOT_HUMAN	angiomotin	777					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.E368*(2)|p.E777*(2)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						GACAGCTGCTCTGTCTTGCTC	0.547																																					p.E368X												.	.	4	Substitution - Nonsense(4)	large_intestine(2)|lung(2)	c.G1102T	X						.						213.0	195.0	201.0					X																	112024258		2203	4300	6503	111910914	SO:0001587	stop_gained	154796	exon10			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2329G>T	X.37:g.112024258C>A	ENSP00000429013:p.Glu777*	Somatic		Capture	SOLID	Phase_I	111910914	NM_133265	Q504X5|Q9HD27|Q9UPT1	Nonsense_Mutation	SNP	ENST00000524145.1	37	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	C	41	8.602446	0.98881	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000432214;ENST00000371958	.	.	.	5.69	5.69	0.88448	.	0.050467	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-18.8749	17.6377	0.88128	0.0:1.0:0.0:0.0	.	.	.	.	X	368;777;545;777;17;545	.	ENSP00000305557:E368X	E	-	1	0	AMOT	111910914	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.818000	0.86416	2.381000	0.81170	0.600000	0.82982	GAG		0.547	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265	
WDR44	54521	hgsc.bcm.edu	37	X	117527164	117527164	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:117527164A>G	ENST00000254029.3	+	4	1151	c.756A>G	c.(754-756)cgA>cgG	p.R252R	WDR44_ENST00000371822.5_Silent_p.R227R|WDR44_ENST00000371825.3_Silent_p.R252R|WDR44_ENST00000493448.1_3'UTR	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	252	Pro-rich.					endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.R252R(2)		breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						CTCCTTCTCGACCTGCTCCAC	0.468																																					p.R227R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A681G	X						.						123.0	129.0	127.0					X																	117527164		2203	4300	6503	117411192	SO:0001819	synonymous_variant	54521	exon3			AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.756A>G	X.37:g.117527164A>G		Somatic		Capture	SOLID	Phase_I	117411192	NM_001184966	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Silent	SNP	ENST00000254029.3	37	CCDS14572.1	.	.	.	.	.	.	.	.	.	.	A	10.89	1.477871	0.26511	.	.	ENSG00000131725	ENST00000371848	.	.	.	5.64	-1.37	0.09056	.	.	.	.	.	T	0.48554	0.1506	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34950	-0.9808	4	.	.	.	-6.8412	4.8604	0.13581	0.1773:0.0:0.478:0.3447	.	.	.	.	A	152	.	.	T	+	1	0	WDR44	117411192	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	1.095000	0.30964	-0.303000	0.08856	-0.382000	0.06688	ACC		0.468	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045	
BCORL1	63035	hgsc.bcm.edu	37	X	129171416	129171416	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:129171416G>A	ENST00000218147.7	+	9	4577	c.4380G>A	c.(4378-4380)ctG>ctA	p.L1460L	BCORL1_ENST00000303743.5_Silent_p.L1534L|BCORL1_ENST00000540052.1_Silent_p.L1460L|BCORL1_ENST00000359304.2_Silent_p.L1330L			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1460					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L1460L(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						ACACAGCCCTGCATGAGGCTT	0.577																																					p.L1460L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4380A	X						.						128.0	95.0	106.0					X																	129171416		2203	4300	6503	128999097	SO:0001819	synonymous_variant	63035	exon8			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.4380G>A	X.37:g.129171416G>A		Somatic		Capture	SOLID	Phase_I	128999097	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Silent	SNP	ENST00000218147.7	37	CCDS14616.1																																																																																				0.577	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
ATP11C	286410	hgsc.bcm.edu	37	X	138813896	138813896	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:138813896T>C	ENST00000327569.3	-	29	3414	c.3316A>G	c.(3316-3318)Agg>Ggg	p.R1106G	ATP11C_ENST00000370557.1_Intron|ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000361648.2_Intron	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	1106					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R1106G(1)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					TCAGATGCCCTTCTACAGCTC	0.358																																					p.R1106G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3316G	X						.						97.0	83.0	88.0					X																	138813896		2203	4299	6502	138641562	SO:0001583	missense	286410	exon29			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.3316A>G	X.37:g.138813896T>C	ENSP00000332756:p.Arg1106Gly	Somatic		Capture	SOLID	Phase_I	138641562	NM_173694	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.38|10.38	1.334365|1.334365	0.24253|0.24253	.|.	.|.	ENSG00000101974|ENSG00000101974	ENST00000433868|ENST00000327569	.|T	.|0.07021	.|3.23	5.76|5.76	4.58|4.58	0.56647|0.56647	.|.	.|0.787518	.|0.12294	.|N	.|0.481739	T|T	0.05731|0.05731	0.0150|0.0150	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.30534|0.30534	-0.9975|-0.9975	5|10	.|0.72032	.|D	.|0.01	.|.	11.4248|11.4248	0.50004|0.50004	0.0:0.0:0.149:0.851|0.0:0.0:0.149:0.851	.|.	.|1106	.|Q8NB49	.|AT11C_HUMAN	R|G	138|1106	.|ENSP00000332756:R1106G	.|ENSP00000332756:R1106G	K|R	-|-	2|1	0|2	ATP11C|ATP11C	138641562|138641562	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.237000|2.237000	0.43061|0.43061	0.789000|0.789000	0.33779|0.33779	0.486000|0.486000	0.48141|0.48141	AAG|AGG		0.358	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	
MAMLD1	10046	hgsc.bcm.edu	37	X	149638162	149638162	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:149638162C>T	ENST00000370401.2	+	4	627	c.317C>T	c.(316-318)gCa>gTa	p.A106V	MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000426613.2_Missense_Mutation_p.A81V|MAMLD1_ENST00000432680.2_Missense_Mutation_p.A81V|MAMLD1_ENST00000262858.5_Missense_Mutation_p.A106V|MAMLD1_ENST00000468306.1_3'UTR			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	106					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A106V(1)|p.A33V(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					ACTGCTTGTGCAGAACTGCAG	0.512																																					p.A81V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C242T	X						.						117.0	110.0	112.0					X																	149638162		2203	4300	6503	149388820	SO:0001583	missense	10046	exon2			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.317C>T	X.37:g.149638162C>T	ENSP00000359428:p.Ala106Val	Somatic		Capture	SOLID	Phase_I	149388820	NM_001177466	B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252161	0.39797	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000358892;ENST00000262858;ENST00000426613	T;T;T;T	0.66460	0.18;-0.21;0.18;0.19	5.36	5.36	0.76844	.	0.540056	0.19618	N	0.109963	T	0.62708	0.2450	L	0.40543	1.245	0.80722	D	1	P;P;P;P	0.42296	0.774;0.775;0.573;0.775	B;B;B;B	0.41412	0.31;0.273;0.343;0.356	T	0.62544	-0.6832	10	0.35671	T	0.21	-1.2032	18.2098	0.89866	0.0:1.0:0.0:0.0	.	68;81;81;106	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	V	68;106;81;106;106;81	ENSP00000359428:A106V;ENSP00000414517:A81V;ENSP00000262858:A106V;ENSP00000397438:A81V	ENSP00000262858:A106V	A	+	2	0	MAMLD1	149388820	0.710000	0.27896	0.331000	0.25455	0.175000	0.22909	2.835000	0.48175	2.237000	0.73441	0.600000	0.82982	GCA		0.512	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491	
TKTL1	8277	hgsc.bcm.edu	37	X	153539470	153539470	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:153539470C>T	ENST00000369915.3	+	5	740	c.551C>T	c.(550-552)aCt>aTt	p.T184I	TKTL1_ENST00000369912.2_Missense_Mutation_p.T128I|TKTL1_ENST00000217905.7_Intron	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	184					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)	p.T184I(1)		NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGTGGAACACTTATGTGGTG	0.552																																					p.T178I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C533T	X						.						111.0	98.0	102.0					X																	153539470		2203	4300	6503	153192664	SO:0001583	missense	8277	exon5			X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.551C>T	X.37:g.153539470C>T	ENSP00000358931:p.Thr184Ile	Somatic		Capture	SOLID	Phase_I	153192664	NM_001145933	A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	ENST00000369915.3	37	CCDS35448.1	.	.	.	.	.	.	.	.	.	.	C	19.06	3.754913	0.69648	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000426989;ENST00000369912	T;T;T	0.26660	1.72;1.72;1.72	4.59	4.59	0.56863	Transketolase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.51635	0.1686	M	0.83223	2.63	0.80722	D	1	D;D	0.56746	0.96;0.977	P;P	0.62560	0.862;0.904	T	0.60596	-0.7232	10	0.87932	D	0	-32.0158	15.271	0.73702	0.0:1.0:0.0:0.0	.	178;184	B7Z7I0;P51854	.;TKTL1_HUMAN	I	184;128;184;128	ENSP00000358931:T184I;ENSP00000401111:T184I;ENSP00000358928:T128I	ENSP00000358928:T128I	T	+	2	0	TKTL1	153192664	1.000000	0.71417	0.952000	0.39060	0.520000	0.34377	7.274000	0.78538	2.108000	0.64289	0.529000	0.55759	ACT		0.552	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058923.1	NM_012253	
TXLNG	55787	hgsc.bcm.edu	37	X	16855758	16855758	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:16855758A>G	ENST00000380122.5	+	8	1163	c.1102A>G	c.(1102-1104)Atg>Gtg	p.M368V	TXLNG_ENST00000398155.4_Missense_Mutation_p.M236V	NM_018360.2	NP_060830.2	Q9NUQ3	TXLNG_HUMAN	taxilin gamma	368					cell cycle (GO:0007049)|regulation of bone mineralization (GO:0030500)|regulation of cell cycle (GO:0051726)|regulation of cell cycle process (GO:0010564)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)	protein heterodimerization activity (GO:0046982)	p.M368V(1)		breast(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	15						CCAGACTACCATGGCAAAAAG	0.313																																					p.M368V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1102G	X						.						89.0	77.0	81.0					X																	16855758		2202	4300	6502	16765679	SO:0001583	missense	55787	exon8			AK002071	CCDS14178.1, CCDS55373.1	Xp22.2	2014-05-07	2010-04-20	2010-04-20	ENSG00000086712	ENSG00000086712			18578	protein-coding gene	gene with protein product	"""lipopolysaccharide specific response-5 protein"", ""factor inhibiting activating transcription factor 4 (ATF4)-mediated transcription"""	300677	"""chromosome X open reading frame 15"""	CXorf15		15911876, 15184072, 16831913	Standard	NM_018360		Approved	FLJ11209, LSR5, FIAT, MGC126621, MGC126625, TXLNGX	uc004cxq.2	Q9NUQ3	OTTHUMG00000021196	ENST00000380122.5:c.1102A>G	X.37:g.16855758A>G	ENSP00000369465:p.Met368Val	Somatic		Capture	SOLID	Phase_I	16765679	NM_018360	Q2KQ75|Q5JNZ7|Q9P0X1	Missense_Mutation	SNP	ENST00000380122.5	37	CCDS14178.1	.	.	.	.	.	.	.	.	.	.	A	15.67	2.902047	0.52227	.	.	ENSG00000086712	ENST00000380122;ENST00000398155	T;T	0.27890	1.64;1.64	5.41	5.41	0.78517	.	0.048168	0.85682	D	0.000000	T	0.25344	0.0616	N	0.11560	0.145	0.52099	D	0.99994	B;B	0.32968	0.371;0.392	B;B	0.42062	0.217;0.374	T	0.21999	-1.0229	10	0.56958	D	0.05	-23.2923	14.7272	0.69354	1.0:0.0:0.0:0.0	.	236;368	Q9NUQ3-2;Q9NUQ3	.;TXLNG_HUMAN	V	368;236	ENSP00000369465:M368V;ENSP00000381222:M236V	ENSP00000369465:M368V	M	+	1	0	TXLNG	16765679	0.997000	0.39634	1.000000	0.80357	0.990000	0.78478	3.766000	0.55280	1.927000	0.55829	0.356000	0.21956	ATG		0.313	TXLNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055912.1	NM_018360	
MAGEB1	4112	hgsc.bcm.edu	37	X	30269583	30269583	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:30269583C>T	ENST00000378981.3	+	4	1294	c.973C>T	c.(973-975)Cgt>Tgt	p.R325C	MAGEB1_ENST00000397548.2_Missense_Mutation_p.R325C|MAGEB1_ENST00000397550.1_Missense_Mutation_p.R325C	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	325								p.R325C(1)		NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						TAGAGCCAGGCGTCGCACTAC	0.527																																					p.R325C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C973T	X						.						89.0	78.0	82.0					X																	30269583		2202	4300	6502	30179504	SO:0001583	missense	4112	exon4				CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.973C>T	X.37:g.30269583C>T	ENSP00000368264:p.Arg325Cys	Somatic		Capture	SOLID	Phase_I	30179504	NM_002363	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	ENST00000378981.3	37	CCDS14222.1	.	.	.	.	.	.	.	.	.	.	C	9.704	1.155363	0.21454	.	.	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.01613	4.73;4.73;4.73	3.55	-1.44	0.08856	.	2.591500	0.02042	N	0.049376	T	0.01800	0.0057	L	0.40543	1.245	0.09310	N	1	D	0.53151	0.958	B	0.35182	0.197	T	0.47724	-0.9095	10	0.54805	T	0.06	.	5.491	0.16777	0.0:0.3987:0.2058:0.3955	.	325	P43366	MAGB1_HUMAN	C	325	ENSP00000368264:R325C;ENSP00000380683:R325C;ENSP00000380681:R325C	ENSP00000368264:R325C	R	+	1	0	MAGEB1	30179504	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.869000	0.01643	-0.535000	0.06307	-0.322000	0.08575	CGT		0.527	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	NM_002363	
MAOA	4128	hgsc.bcm.edu	37	X	43572004	43572004	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:43572004T>C	ENST00000338702.3	+	5	587	c.464T>C	c.(463-465)aTg>aCg	p.M155T	MAOA_ENST00000497485.1_3'UTR|MAOA_ENST00000542639.1_Missense_Mutation_p.M22T	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	155					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)	p.M155T(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	TGGGACAAAATGACCATGAAA	0.413																																					p.M155T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T464C	X						.						116.0	96.0	103.0					X																	43572004		2203	4299	6502	43456948	SO:0001583	missense	4128	exon5				CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.464T>C	X.37:g.43572004T>C	ENSP00000340684:p.Met155Thr	Somatic		Capture	SOLID	Phase_I	43456948	NM_000240	B4DF46|Q16426	Missense_Mutation	SNP	ENST00000338702.3	37	CCDS14260.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.152921	0.38021	.	.	ENSG00000189221	ENST00000338702;ENST00000542639	D;T	0.92099	-2.97;2.99	5.11	3.94	0.45596	Amine oxidase (1);	0.199506	0.64402	D	0.000011	D	0.92958	0.7759	M	0.74467	2.265	0.45342	D	0.998333	P	0.48230	0.907	P	0.50860	0.652	D	0.91700	0.5373	10	0.66056	D	0.02	.	10.094	0.42464	0.0:0.0802:0.0:0.9197	.	155	P21397	AOFA_HUMAN	T	155;22	ENSP00000340684:M155T;ENSP00000440846:M22T	ENSP00000340684:M155T	M	+	2	0	MAOA	43456948	1.000000	0.71417	0.272000	0.24630	0.238000	0.25445	6.826000	0.75298	0.633000	0.30452	0.352000	0.21897	ATG		0.413	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	
KDM6A	7403	hgsc.bcm.edu	37	X	44922738	44922738	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:44922738G>A	ENST00000377967.4	+	16	1640	c.1599G>A	c.(1597-1599)ctG>ctA	p.L533L	KDM6A_ENST00000543216.1_Silent_p.L454L|KDM6A_ENST00000382899.4_Silent_p.L540L|KDM6A_ENST00000536777.1_Silent_p.L488L	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	533	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.0(2)|p.L533L(1)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						ACTCATCACTGCCTACAAACT	0.522			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.L533L	Colon(129;1273 1667 15230 27352 52914)		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	.	9	Whole gene deletion(6)|No detectable mRNA/protein(2)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(2)|oesophagus(2)|breast(2)|pancreas(2)|large_intestine(1)	c.G1599A	X						.						78.0	62.0	67.0					X																	44922738		2203	4300	6503	44807682	SO:0001819	synonymous_variant	7403	exon16			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.1599G>A	X.37:g.44922738G>A		Somatic		Capture	SOLID	Phase_I	44807682	NM_021140	Q52LL9|Q5JVQ7	Silent	SNP	ENST00000377967.4	37	CCDS14265.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	9.027|9.027	0.986425|0.986425	0.18889|0.18889	.|.	.|.	ENSG00000147050|ENSG00000147050	ENST00000414389;ENST00000433797|ENST00000451692	.|.	.|.	.|.	5.03|5.03	5.03|5.03	0.67393|0.67393	.|.	.|.	.|.	.|.	.|.	T|T	0.73877|0.73877	0.3643|0.3643	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.73630|0.73630	-0.3922|-0.3922	4|4	.|.	.|.	.|.	-4.8012|-4.8012	17.756|17.756	0.88449|0.88449	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	T|Y	131;176|163	.|.	.|.	A|C	+|+	1|2	0|0	KDM6A|KDM6A	44807682|44807682	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	6.983000|6.983000	0.76180|0.76180	2.210000|2.210000	0.71456|0.71456	0.509000|0.509000	0.49947|0.49947	GCC|TGC		0.522	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
CDK16	5127	hgsc.bcm.edu	37	X	47083885	47083885	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:47083885C>T	ENST00000357227.4	+	3	728	c.304C>T	c.(304-306)Cgc>Tgc	p.R102C	CDK16_ENST00000518022.1_Missense_Mutation_p.R102C|CDK16_ENST00000457458.2_Missense_Mutation_p.R108C|CDK16_ENST00000276052.6_Missense_Mutation_p.R176C	NM_006201.4	NP_006192.1	Q00536	CDK16_HUMAN	cyclin-dependent kinase 16	102					exocytosis (GO:0006887)|growth hormone secretion (GO:0030252)|neuron projection development (GO:0031175)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|spermatogenesis (GO:0007283)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein serine/threonine kinase activity (GO:0004674)	p.R102C(2)		breast(1)|endometrium(3)|large_intestine(4)|lung(3)	11						AGTGCGTATGCGCAACCATCC	0.587																																					p.R102C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C304T	X						.						106.0	67.0	80.0					X																	47083885		2203	4300	6503	46968829	SO:0001583	missense	5127	exon3				CCDS14276.1, CCDS48101.1, CCDS55408.1	Xp11	2011-11-08	2009-12-16	2009-12-16	ENSG00000102225	ENSG00000102225		"""Cyclin-dependent kinases"""	8749	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase"""	311550	"""PCTAIRE protein kinase 1"""	PCTK1		1437147, 19884882	Standard	NM_033018		Approved	PCTAIRE, PCTAIRE1, PCTGAIRE, FLJ16665	uc011mll.2	Q00536	OTTHUMG00000021438	ENST00000357227.4:c.304C>T	X.37:g.47083885C>T	ENSP00000349762:p.Arg102Cys	Somatic		Capture	SOLID	Phase_I	46968829	NM_006201	A8K280|B7Z7C8|J3KN74|J3KQP7	Missense_Mutation	SNP	ENST00000357227.4	37	CCDS14276.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911228	0.72983	.	.	ENSG00000102225	ENST00000457458;ENST00000357227;ENST00000519758;ENST00000520893;ENST00000540877;ENST00000540311;ENST00000517426;ENST00000518391;ENST00000518022;ENST00000276052	T;T;T;T;T;T	0.74526	-0.66;-0.65;-0.85;0.43;-0.65;-0.7	5.96	4.17	0.49024	.	0.055231	0.64402	D	0.000002	T	0.81721	0.4882	M	0.71036	2.16	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.998;0.998	P;P;P;P	0.61275	0.886;0.836;0.799;0.841	T	0.81376	-0.0961	10	0.87932	D	0	-8.4029	9.416	0.38521	0.1435:0.7792:0.0:0.0774	.	176;102;200;102	B7Z7C8;B7Z461;B7Z8T0;Q00536	.;.;.;CDK16_HUMAN	C	108;102;102;102;200;54;102;102;102;176	ENSP00000405798:R108C;ENSP00000349762:R102C;ENSP00000429985:R102C;ENSP00000429044:R102C;ENSP00000429751:R102C;ENSP00000276052:R176C	ENSP00000276052:R176C	R	+	1	0	CDK16	46968829	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	1.006000	0.29847	0.611000	0.30052	0.600000	0.82982	CGC		0.587	CDK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056406.2	NM_006201	
WDR13	64743	hgsc.bcm.edu	37	X	48458879	48458879	+	Silent	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:48458879C>A	ENST00000218056.5	+	5	1201	c.696C>A	c.(694-696)ctC>ctA	p.L232L	WDR13_ENST00000376729.5_Silent_p.L232L	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	232						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L232L(1)		endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						ATGACATCCTCGTGTCCACCT	0.632																																					p.L140L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C420A	X						.						110.0	67.0	82.0					X																	48458879		2203	4300	6503	48343823	SO:0001819	synonymous_variant	64743	exon4			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.696C>A	X.37:g.48458879C>A		Somatic		Capture	SOLID	Phase_I	48343823	NM_001166426	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Silent	SNP	ENST00000218056.5	37	CCDS14302.1																																																																																				0.632	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2		
CACNA1F	778	hgsc.bcm.edu	37	X	49087333	49087333	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:49087333T>C	ENST00000376265.2	-	4	561	c.500A>G	c.(499-501)gAc>gGc	p.D167G	CACNA1F_ENST00000376251.1_Missense_Mutation_p.D102G|CACNA1F_ENST00000323022.5_Missense_Mutation_p.D167G	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	167					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.D167G(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GATGATGAAGTCGAGTAGGTT	0.612																																					p.D167G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A500G	X						.						38.0	25.0	29.0					X																	49087333		2191	4286	6477	48974277	SO:0001583	missense	778	exon4			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.500A>G	X.37:g.49087333T>C	ENSP00000365441:p.Asp167Gly	Somatic		Capture	SOLID	Phase_I	48974277	NM_005183	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	T	18.38	3.610272	0.66558	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.99388	-5.81;-5.81;-5.81	4.63	4.63	0.57726	Ion transport (1);	0.099552	0.64402	D	0.000003	D	0.99708	0.9888	H	0.99712	4.72	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97152	0.9832	10	0.72032	D	0.01	.	12.2952	0.54842	0.0:0.0:0.0:1.0	.	167;167	F5CIQ9;O60840	.;CAC1F_HUMAN	G	102;167;167	ENSP00000365427:D102G;ENSP00000321618:D167G;ENSP00000365441:D167G	ENSP00000321618:D167G	D	-	2	0	CACNA1F	48974277	1.000000	0.71417	0.995000	0.50966	0.760000	0.43138	7.836000	0.86788	1.538000	0.49270	0.237000	0.17872	GAC		0.612	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	
SMC1A	8243	hgsc.bcm.edu	37	X	53440066	53440066	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:53440066T>C	ENST00000322213.4	-	5	765	c.638A>G	c.(637-639)aAg>aGg	p.K213R	SMC1A_ENST00000375340.6_Intron	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	213					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.K213R(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						TACCTCATCCTTCAGGCGCTG	0.532																																					p.K213R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A638G	X						.						96.0	76.0	83.0					X																	53440066		2203	4300	6503	53456791	SO:0001583	missense	8243	exon5			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.638A>G	X.37:g.53440066T>C	ENSP00000323421:p.Lys213Arg	Somatic		Capture	SOLID	Phase_I	53456791	NM_006306	O14995|Q16351|Q2M228	Missense_Mutation	SNP	ENST00000322213.4	37	CCDS14352.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.38|10.38	1.332903|1.332903	0.24167|0.24167	.|.	.|.	ENSG00000072501|ENSG00000072501	ENST00000322213|ENST00000428014	T|.	0.78481|.	-1.18|.	4.52|4.52	4.52|4.52	0.55395|0.55395	RecF/RecN/SMC (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.50497|0.50497	0.1619|0.1619	N|N	0.25647|0.25647	0.755|0.755	0.80722|0.80722	D|D	1|1	B;B;B|.	0.30973|.	0.093;0.117;0.302|.	B;B;P|.	0.44946|.	0.028;0.317;0.465|.	T|T	0.45411|0.45411	-0.9263|-0.9263	10|5	0.15066|.	T|.	0.55|.	.|.	12.2945|12.2945	0.54838|0.54838	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	191;213;213|.	Q6MZR8;A8K7A6;Q14683|.	.;.;SMC1A_HUMAN|.	R|G	213|218	ENSP00000323421:K213R|.	ENSP00000323421:K213R|.	K|R	-|-	2|1	0|2	SMC1A|SMC1A	53456791|53456791	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.975000|0.975000	0.68041|0.68041	4.037000|4.037000	0.57311|0.57311	1.605000|1.605000	0.50152|0.50152	0.356000|0.356000	0.21956|0.21956	AAG|AGG		0.532	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
HUWE1	10075	hgsc.bcm.edu	37	X	53587256	53587256	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:53587256G>A	ENST00000342160.3	-	55	8086	c.7629C>T	c.(7627-7629)atC>atT	p.I2543I	HUWE1_ENST00000262854.6_Silent_p.I2543I			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2543					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.I2406I(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GACTGCGCCCGATGCCCTGGG	0.567																																					p.I2543I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C7629T	X						.						106.0	73.0	85.0					X																	53587256		2203	4300	6503	53603981	SO:0001819	synonymous_variant	10075	exon56			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7629C>T	X.37:g.53587256G>A		Somatic		Capture	SOLID	Phase_I	53603981	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	G	6.788	0.514281	0.12944	.	.	ENSG00000086758	ENST00000427052	.	.	.	5.69	-8.74	0.00838	.	.	.	.	.	T	0.58206	0.2106	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65475	-0.6159	4	.	.	.	.	13.2029	0.59778	0.6907:0.0799:0.2294:0.0	.	.	.	.	W	1577	.	.	R	-	1	2	HUWE1	53603981	0.259000	0.24043	0.716000	0.30569	0.908000	0.53690	-0.424000	0.07025	-1.744000	0.01338	-0.909000	0.02823	CGG		0.567	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
KIF4A	24137	hgsc.bcm.edu	37	X	69563579	69563579	+	Silent	SNP	C	C	T	rs370260378		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:69563579C>T	ENST00000374403.3	+	12	1375	c.1293C>T	c.(1291-1293)aaC>aaT	p.N431N	KIF4A_ENST00000374388.3_Silent_p.N431N	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	431					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.N431N(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						AAAAAATGAACGCCAAGCTAG	0.478																																					p.N431N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1293T	X						.	C		1,3834		0,0,1,1632,570	67.0	53.0	58.0		1293	-6.4	0.2	X		58	0,6728		0,0,0,2428,1872	no	coding-synonymous	KIF4A	NM_012310.4		0,0,1,4060,2442	TT,TC,T,CC,C		0.0,0.0261,0.0095		431/1233	69563579	1,10562	2203	4300	6503	69480304	SO:0001819	synonymous_variant	24137	exon12			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1293C>T	X.37:g.69563579C>T		Somatic		Capture	SOLID	Phase_I	69480304	NM_012310	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Silent	SNP	ENST00000374403.3	37	CCDS14401.1																																																																																				0.478	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310	
DACH2	117154	hgsc.bcm.edu	37	X	85403878	85403878	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:85403878G>A	ENST00000373125.4	+	1	254	c.254G>A	c.(253-255)gGc>gAc	p.G85D	DACH2_ENST00000373131.1_Missense_Mutation_p.G85D	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	85	DACHbox-N.				development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G85D(2)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CTGATGGACGGCCAGGAACTG	0.567																																					p.G85D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G254A	X						.						114.0	82.0	93.0					X																	85403878		2203	4300	6503	85290534	SO:0001583	missense	117154	exon1			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.254G>A	X.37:g.85403878G>A	ENSP00000362217:p.Gly85Asp	Somatic		Capture	SOLID	Phase_I	85290534	NM_053281	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.465899	0.63513	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125	D;D	0.94828	-3.53;-3.53	4.38	3.5	0.40072	DNA binding domain, putative (1);Transforming protein Ski (2);	0.124234	0.36066	N	0.002817	D	0.95822	0.8640	M	0.79805	2.47	0.80722	D	1	P;P	0.45531	0.697;0.86	B;P	0.52424	0.393;0.698	D	0.95431	0.8516	10	0.72032	D	0.01	.	12.8822	0.58024	0.0:0.0:0.836:0.164	.	85;85	Q96NX9-2;Q96NX9	.;DACH2_HUMAN	D	85	ENSP00000362223:G85D;ENSP00000362217:G85D	ENSP00000345134:G85D	G	+	2	0	DACH2	85290534	1.000000	0.71417	0.998000	0.56505	0.907000	0.53573	8.894000	0.92506	0.832000	0.34804	0.538000	0.68166	GGC		0.567	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
GAB3	139716	hgsc.bcm.edu	37	X	153928305	153928305	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chrX:153928305G>A	ENST00000369575.3	-	5	1127	c.1096C>T	c.(1096-1098)Cga>Tga	p.R366*	GAB3_ENST00000424127.2_Nonsense_Mutation_p.R367*|GAB3_ENST00000496390.1_5'UTR	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	366					macrophage differentiation (GO:0030225)			p.R366*(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CGCTTGTCTCGGTGTCTTAAG	0.393																																					p.R367X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1099T	X						.						159.0	142.0	148.0					X																	153928305		2203	4300	6503	153581499	SO:0001587	stop_gained	139716	exon5			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1096C>T	X.37:g.153928305G>A	ENSP00000358588:p.Arg366*	Somatic		Capture	SOLID	Phase_I	153581499	NM_001081573	A6NHF8|E9PB44	Nonsense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	.	.	.	.	.	.	.	.	.	.	G	37	6.374336	0.97515	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	.	.	.	5.76	4.87	0.63330	.	0.871922	0.09643	N	0.774794	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-7.1472	10.7036	0.45942	0.0:0.0:0.6542:0.3458	.	.	.	.	X	366;367;367	.	ENSP00000358581:R367X	R	-	1	2	GAB3	153581499	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.916000	0.39986	1.147000	0.42369	0.468000	0.43344	CGA		0.393	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573	
RANBP2	5903	hgsc.bcm.edu	37	2	109381259	109381259	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:109381259A>G	ENST00000283195.6	+	20	4390	c.4264A>G	c.(4264-4266)Agt>Ggt	p.S1422G		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1422					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.S1422G(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CTGGGATTGTAGTATTTGTTT	0.378																																					p.S1422G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A4264G	2						.						89.0	89.0	89.0					2																	109381259		2203	4300	6503	108747691	SO:0001583	missense	5903	exon20			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.4264A>G	2.37:g.109381259A>G	ENSP00000283195:p.Ser1422Gly	Somatic		Capture	SOLID	Phase_I	108747691	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.319719	0.23994	.	.	ENSG00000153201	ENST00000283195	T	0.59772	0.24	5.48	4.33	0.51752	Zinc finger, RanBP2-type (4);	.	.	.	.	T	0.46658	0.1404	L	0.35723	1.085	0.19775	N	0.99995	B	0.09022	0.002	B	0.09377	0.004	T	0.30909	-0.9962	9	0.29301	T	0.29	-9.2903	11.0023	0.47614	0.9263:0.0:0.0737:0.0	.	1422	P49792	RBP2_HUMAN	G	1422	ENSP00000283195:S1422G	ENSP00000283195:S1422G	S	+	1	0	RANBP2	108747691	0.088000	0.21588	0.977000	0.42913	0.967000	0.64934	1.764000	0.38471	0.908000	0.36671	0.533000	0.62120	AGT		0.378	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
ARHGEF4	50649	hgsc.bcm.edu	37	2	131704183	131704183	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:131704183C>T	ENST00000326016.5	+	4	921	c.402C>T	c.(400-402)ggC>ggT	p.G134G	ARHGEF4_ENST00000428230.2_Silent_p.G134G|ARHGEF4_ENST00000525839.1_Silent_p.G134G|ARHGEF4_ENST00000392953.3_Silent_p.G134G|ARHGEF4_ENST00000409303.1_Silent_p.G134G|ARHGEF4_ENST00000409359.1_Silent_p.G990G	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	134					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.G134G(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		ACCACATGGGCTGGCCAGAGC	0.532																																					p.G134G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C402T	2						.						119.0	113.0	115.0					2																	131704183		2203	4300	6503	131420653	SO:0001819	synonymous_variant	50649	exon4			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.402C>T	2.37:g.131704183C>T		Somatic		Capture	SOLID	Phase_I	131420653	NM_015320	Q9HDC6|Q9UPP0	Silent	SNP	ENST00000326016.5	37	CCDS2165.1																																																																																				0.532	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
LRP1B	53353	hgsc.bcm.edu	37	2	141259268	141259268	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:141259268C>T	ENST00000389484.3	-	55	9809	c.8838G>A	c.(8836-8838)ccG>ccA	p.P2946P		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2946	EGF-like 11. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.P2946P(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TATAACTGACCGGAAGGTCTT	0.363										TSP Lung(27;0.18)																											p.P2946P	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G8838A	2						.						106.0	109.0	108.0					2																	141259268		2203	4299	6502	140975738	SO:0001819	synonymous_variant	53353	exon55			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8838G>A	2.37:g.141259268C>T		Somatic		Capture	SOLID	Phase_I	140975738	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																				0.363	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
NBAS	51594	hgsc.bcm.edu	37	2	15567883	15567883	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:15567883T>C	ENST00000281513.5	-	22	2400	c.2375A>G	c.(2374-2376)cAt>cGt	p.H792R	NBAS_ENST00000441750.1_Missense_Mutation_p.H792R	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	792					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.H792R(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TTTATGTTCATGCCAAGGAAT	0.413																																					p.H792R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2375G	2						.						76.0	67.0	70.0					2																	15567883		2203	4300	6503	15485334	SO:0001583	missense	51594	exon22			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.2375A>G	2.37:g.15567883T>C	ENSP00000281513:p.His792Arg	Somatic		Capture	SOLID	Phase_I	15485334	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	T	9.853	1.194276	0.22037	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.08546	3.08;3.28	5.7	0.607	0.17564	Secretory pathway Sec39 (1);	0.487586	0.24647	N	0.036751	T	0.03695	0.0105	N	0.08118	0	0.19575	N	0.999961	B	0.02656	0.0	B	0.06405	0.002	T	0.35943	-0.9768	10	0.87932	D	0	.	4.8615	0.13587	0.0:0.2424:0.1559:0.6016	.	792	A2RRP1	NBAS_HUMAN	R	792	ENSP00000413201:H792R;ENSP00000281513:H792R	ENSP00000281513:H792R	H	-	2	0	NBAS	15485334	0.996000	0.38824	0.843000	0.33291	0.217000	0.24651	1.473000	0.35387	-0.109000	0.12044	0.533000	0.62120	CAT		0.413	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
RIF1	55183	hgsc.bcm.edu	37	2	152296638	152296638	+	Silent	SNP	G	G	C	rs146690640		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:152296638G>C	ENST00000243326.5	+	14	2127	c.1644G>C	c.(1642-1644)acG>acC	p.T548T	RIF1_ENST00000453091.2_Silent_p.T548T|RIF1_ENST00000433166.2_3'UTR|RIF1_ENST00000444746.2_Silent_p.T548T|RIF1_ENST00000428287.2_Silent_p.T548T|RIF1_ENST00000430328.2_Silent_p.T548T			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.T548T(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TATCAAAAACGCTGGTAAGTA	0.308																																					p.T548T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1644C	2						.						50.0	57.0	55.0					2																	152296638		2202	4299	6501	152004884	SO:0001819	synonymous_variant	55183	exon15			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.1644G>C	2.37:g.152296638G>C		Somatic		Capture	SOLID	Phase_I	152004884	NM_001177664	A0AVS0|Q9NS16	Silent	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	G	5.729	0.318930	0.10845	.	.	ENSG00000080345	ENST00000414861	.	.	.	5.04	2.58	0.30949	.	.	.	.	.	T	0.55081	0.1898	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44847	-0.9301	4	.	.	.	-2.799	7.1451	0.25579	0.7727:0.1471:0.0802:0.0	.	.	.	.	P	540	.	.	A	+	1	0	RIF1	152004884	0.064000	0.20934	1.000000	0.80357	0.822000	0.46500	-0.057000	0.11768	0.303000	0.22785	-0.384000	0.06662	GCT		0.308	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		
DDX1	1653	hgsc.bcm.edu	37	2	15763662	15763662	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:15763662T>A	ENST00000381341.2	+	20	1939	c.1550T>A	c.(1549-1551)aTt>aAt	p.I517N	DDX1_ENST00000233084.3_Missense_Mutation_p.I517N			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	517	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)	p.I517N(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		AGAACCAAAATTGACTGTGAT	0.348																																					p.I517N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1550A	2						.						113.0	109.0	111.0					2																	15763662		2203	4300	6503	15681113	SO:0001583	missense	1653	exon19			X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1550T>A	2.37:g.15763662T>A	ENSP00000370745:p.Ile517Asn	Somatic		Capture	SOLID	Phase_I	15681113	NM_004939	B4DME8|B4DPN6	Missense_Mutation	SNP	ENST00000381341.2	37	CCDS1686.1	.	.	.	.	.	.	.	.	.	.	T	19.45	3.829937	0.71258	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	D;D	0.86694	-2.16;-2.16	6.17	6.17	0.99709	Helicase, C-terminal (1);	0.042254	0.85682	D	0.000000	T	0.77150	0.4088	N	0.10945	0.07	0.80722	D	1	B	0.32010	0.351	B	0.31245	0.126	T	0.75536	-0.3283	10	0.27785	T	0.31	-20.9586	16.8222	0.85835	0.0:0.0:0.0:1.0	.	517	Q92499	DDX1_HUMAN	N	517;517;501	ENSP00000370745:I517N;ENSP00000233084:I517N	ENSP00000233084:I517N	I	+	2	0	DDX1	15681113	1.000000	0.71417	0.974000	0.42286	0.993000	0.82548	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	ATT		0.348	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207141.2	NM_004939	
GALNT13	114805	hgsc.bcm.edu	37	2	155295198	155295198	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:155295198A>G	ENST00000392825.3	+	12	2057	c.1490A>G	c.(1489-1491)cAc>cGc	p.H497R	GALNT13_ENST00000409237.1_Missense_Mutation_p.H497R|AC009227.2_ENST00000434635.1_RNA	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	497	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.H497R(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						TTAAAATGCCACCATATGAGA	0.338																																					p.H497R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1490G	2						.						133.0	135.0	134.0					2																	155295198		2203	4300	6503	155003444	SO:0001583	missense	114805	exon12			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1490A>G	2.37:g.155295198A>G	ENSP00000376570:p.His497Arg	Somatic		Capture	SOLID	Phase_I	155003444	NM_052917	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.599391	0.87055	.	.	ENSG00000144278	ENST00000392825;ENST00000409237;ENST00000453715	T;T;T	0.27256	1.68;1.68;1.68	5.76	5.76	0.90799	Ricin B-related lectin (1);Ricin B lectin (3);	0.000000	0.85682	D	0.000000	T	0.53916	0.1826	M	0.86420	2.815	0.80722	D	1	D;D	0.71674	0.992;0.998	D;P	0.65684	0.937;0.808	T	0.59005	-0.7535	10	0.44086	T	0.13	.	14.0157	0.64523	1.0:0.0:0.0:0.0	.	497;497	Q08ER7;Q8IUC8	.;GLT13_HUMAN	R	497;497;32	ENSP00000376570:H497R;ENSP00000387239:H497R;ENSP00000396612:H32R	ENSP00000376570:H497R	H	+	2	0	GALNT13	155003444	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.158000	0.94723	2.197000	0.70478	0.533000	0.62120	CAC		0.338	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917	
CYTIP	9595	hgsc.bcm.edu	37	2	158272275	158272275	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:158272275T>C	ENST00000264192.3	-	8	1115	c.994A>G	c.(994-996)Agc>Ggc	p.S332G	CYTIP_ENST00000540637.1_Missense_Mutation_p.S226G	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	332					regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)		p.S332G(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						CCCTTTCTGCTCTTCCGGGGC	0.517																																					p.S332G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A994G	2						.						98.0	92.0	94.0					2																	158272275		2203	4300	6503	157980521	SO:0001583	missense	9595	exon8			L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.994A>G	2.37:g.158272275T>C	ENSP00000264192:p.Ser332Gly	Somatic		Capture	SOLID	Phase_I	157980521	NM_004288	B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	ENST00000264192.3	37	CCDS2204.1	.	.	.	.	.	.	.	.	.	.	T	15.30	2.791715	0.50102	.	.	ENSG00000115165	ENST00000264192;ENST00000540637	T;T	0.46063	2.17;0.88	6.17	3.82	0.43975	.	0.210405	0.64402	N	0.000017	T	0.39963	0.1098	M	0.67953	2.075	0.33633	D	0.606246	B	0.11235	0.004	B	0.06405	0.002	T	0.46679	-0.9174	10	0.40728	T	0.16	-6.6749	10.1538	0.42809	0.0:0.1345:0.0:0.8655	.	332	O60759	CYTIP_HUMAN	G	332;226	ENSP00000264192:S332G;ENSP00000440801:S226G	ENSP00000264192:S332G	S	-	1	0	CYTIP	157980521	0.999000	0.42202	0.939000	0.37840	0.988000	0.76386	3.132000	0.50523	0.576000	0.29452	0.533000	0.62120	AGC		0.517	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254926.1	NM_004288	
CCDC148	130940	hgsc.bcm.edu	37	2	159035417	159035417	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:159035417G>A	ENST00000283233.5	-	12	1775	c.1462C>T	c.(1462-1464)Cgg>Tgg	p.R488W	CCDC148-AS1_ENST00000412781.2_RNA|CCDC148_ENST00000409187.1_Missense_Mutation_p.R497W	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	488								p.R488W(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						TCTAGCCGCCGTGCTCTCTCT	0.363																																					p.R488W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1462T	2						.						92.0	91.0	92.0					2																	159035417		2203	4300	6503	158743663	SO:0001583	missense	130940	exon12				CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.1462C>T	2.37:g.159035417G>A	ENSP00000283233:p.Arg488Trp	Somatic		Capture	SOLID	Phase_I	158743663	NM_138803	F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Missense_Mutation	SNP	ENST00000283233.5	37	CCDS33304.1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.329189	0.24167	.	.	ENSG00000153237	ENST00000283233;ENST00000409187	T;T	0.25579	1.79;1.8	5.71	0.694	0.18062	.	.	.	.	.	T	0.31199	0.0789	L	0.29908	0.895	0.48288	D	0.999625	D;D	0.71674	0.998;0.998	P;P	0.62491	0.903;0.903	T	0.02975	-1.1087	9	0.72032	D	0.01	-5.1571	9.5733	0.39442	0.0:0.0659:0.4636:0.4705	.	497;488	B8ZZV3;Q8NFR7	.;CC148_HUMAN	W	488;497	ENSP00000283233:R488W;ENSP00000386674:R497W	ENSP00000283233:R488W	R	-	1	2	CCDC148	158743663	0.945000	0.32115	0.267000	0.24556	0.049000	0.14656	2.067000	0.41461	-0.137000	0.11455	-2.726000	0.00130	CGG		0.363	CCDC148-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333270.1	NM_138803	
SCN2A	6326	hgsc.bcm.edu	37	2	166165268	166165268	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:166165268C>A	ENST00000375437.2	+	5	859	c.569C>A	c.(568-570)cCa>cAa	p.P190Q	SCN2A_ENST00000283256.6_Missense_Mutation_p.P190Q|SCN2A_ENST00000357398.3_Missense_Mutation_p.P190Q|SCN2A_ENST00000375427.2_Missense_Mutation_p.P190Q	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	190					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.P190Q(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTACGGGATCCATGGAATTGG	0.338																																					p.P190Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C569A	2						.						112.0	113.0	113.0					2																	166165268		2202	4298	6500	165873514	SO:0001583	missense	6326	exon4			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.569C>A	2.37:g.166165268C>A	ENSP00000364586:p.Pro190Gln	Somatic		Capture	SOLID	Phase_I	165873514	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.811686	0.70797	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D;D	0.98792	-5.14;-5.14;-5.14;-5.14;-5.14	5.57	5.57	0.84162	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.99527	0.9831	H	0.97265	3.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98100	1.0414	10	0.87932	D	0	.	19.9066	0.97010	0.0:1.0:0.0:0.0	.	190;190	Q99250-2;Q99250	.;SCN2A_HUMAN	Q	190	ENSP00000406454:P190Q;ENSP00000364586:P190Q;ENSP00000349973:P190Q;ENSP00000283256:P190Q;ENSP00000364576:P190Q	ENSP00000283256:P190Q	P	+	2	0	SCN2A	165873514	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.776000	0.85560	2.785000	0.95823	0.650000	0.86243	CCA		0.338	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
TTC30A	92104	hgsc.bcm.edu	37	2	178481446	178481446	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:178481446C>A	ENST00000355689.5	-	1	2248	c.1984G>T	c.(1984-1986)Gga>Tga	p.G662*	AC073834.3_ENST00000357045.4_RNA	NM_152275.3	NP_689488.3	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	662					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.G662*(1)		autonomic_ganglia(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			TTATTCCATCCTATAATCTCA	0.343																																					p.G662X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1984T	2						.						151.0	151.0	151.0					2																	178481446		2203	4300	6503	178189692	SO:0001587	stop_gained	92104	exon1			AK024008	CCDS2276.1	2q31.2	2013-01-11			ENSG00000197557	ENSG00000197557		"""Tetratricopeptide (TTC) repeat domain containing"""	25853	protein-coding gene	gene with protein product						12477932	Standard	NM_152275		Approved	FLJ13946	uc002ulo.3	Q86WT1	OTTHUMG00000132528	ENST00000355689.5:c.1984G>T	2.37:g.178481446C>A	ENSP00000347915:p.Gly662*	Somatic		Capture	SOLID	Phase_I	178189692	NM_152275	A8K8N0|Q8IVP2	Nonsense_Mutation	SNP	ENST00000355689.5	37	CCDS2276.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455778	0.84209	.	.	ENSG00000197557	ENST00000355689;ENST00000545660	.	.	.	5.83	5.83	0.93111	.	0.200819	0.52532	D	0.000067	.	.	.	.	.	.	0.47065	D	0.999301	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	14.9707	0.71232	0.1426:0.8574:0.0:0.0	.	.	.	.	X	662;123	.	ENSP00000347915:G662X	G	-	1	0	TTC30A	178189692	0.992000	0.36948	0.994000	0.49952	0.071000	0.16799	3.908000	0.56355	2.781000	0.95711	0.586000	0.80456	GGA		0.343	TTC30A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255728.2	NM_152275	
TTN	7273	hgsc.bcm.edu	37	2	179669350	179669350	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:179669350G>A	ENST00000591111.1	-	2	244	c.20C>T	c.(19-21)aCg>aTg	p.T7M	TTN_ENST00000342175.6_Missense_Mutation_p.T7M|TTN_ENST00000589042.1_Missense_Mutation_p.T7M|TTN_ENST00000342992.6_Missense_Mutation_p.T7M|TTN_ENST00000359218.5_Missense_Mutation_p.T7M|TTN_ENST00000460472.2_Missense_Mutation_p.T7M|TTN_ENST00000360870.5_Missense_Mutation_p.T7M			Q8WZ42	TITIN_HUMAN	titin	32618	Ig-like 1.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T7M(5)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGCGTAAACGTCGGTGCTTG	0.453																																					p.T7M												.	.	5	Substitution - Missense(5)	large_intestine(5)	c.C20T	2						.						118.0	99.0	105.0					2																	179669350		2203	4300	6503	179377595	SO:0001583	missense	7273	exon2			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.20C>T	2.37:g.179669350G>A	ENSP00000465570:p.Thr7Met	Somatic		Capture	SOLID	Phase_I	179377595	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	15.87	2.960033	0.53400	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000412264	T;T;T;T;T;T	0.69435	-0.28;-0.28;-0.28;-0.28;-0.28;-0.4	6.17	5.29	0.74685	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.58264	0.2110	N	0.17800	0.525	0.36786	D	0.884587	P;B;P;B;D	0.69078	0.607;0.327;0.638;0.327;0.997	B;B;B;B;P	0.46110	0.123;0.06;0.06;0.06;0.504	T	0.70299	-0.4910	9	0.87932	D	0	.	16.034	0.80608	0.0647:0.0:0.9353:0.0	.	7;7;7;7;7	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	M	7;7;7;7;7;7;22	ENSP00000343764:T7M;ENSP00000434586:T7M;ENSP00000340554:T7M;ENSP00000352154:T7M;ENSP00000354117:T7M;ENSP00000394672:T22M	ENSP00000340554:T7M	T	-	2	0	TTN	179377595	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.011000	0.88624	1.596000	0.50062	0.655000	0.94253	ACG		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NCKAP1	10787	hgsc.bcm.edu	37	2	183818006	183818006	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:183818006G>T	ENST00000361354.4	-	21	2579	c.2207C>A	c.(2206-2208)cCt>cAt	p.P736H	NCKAP1_ENST00000360982.2_Missense_Mutation_p.P742H	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	736					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)	p.P742H(1)		breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AAGTTCTGAAGGTTTTGCAAT	0.363																																					p.P736H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2207A	2						.						152.0	142.0	146.0					2																	183818006		2203	4300	6503	183526251	SO:0001583	missense	10787	exon21			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.2207C>A	2.37:g.183818006G>T	ENSP00000355348:p.Pro736His	Somatic		Capture	SOLID	Phase_I	183526251	NM_013436	O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	ENST00000361354.4	37	CCDS2287.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693502	0.88735	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.63580	-0.05;-0.05	5.84	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.81927	0.4926	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85064	0.0936	10	0.87932	D	0	-14.6356	15.3577	0.74440	0.0678:0.0:0.9322:0.0	.	736;742	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	H	736;742	ENSP00000355348:P736H;ENSP00000354251:P742H	ENSP00000354251:P742H	P	-	2	0	NCKAP1	183526251	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	2.760000	0.94817	0.655000	0.94253	CCT		0.363	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842	
COL3A1	1281	hgsc.bcm.edu	37	2	189857629	189857629	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:189857629C>A	ENST00000304636.3	+	15	1183	c.1013C>A	c.(1012-1014)cCt>cAt	p.P338H	COL3A1_ENST00000317840.5_Missense_Mutation_p.P338H	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	338	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.P338H(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	CCTGGTCCTCCTGGAACTGCC	0.383																																					p.P338H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1013A	2						.						90.0	98.0	95.0					2																	189857629		2203	4300	6503	189565874	SO:0001583	missense	1281	exon15			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.1013C>A	2.37:g.189857629C>A	ENSP00000304408:p.Pro338His	Somatic		Capture	SOLID	Phase_I	189565874	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415218	0.62511	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.96168	-3.93;-3.19	5.8	5.8	0.92144	.	0.000000	0.48767	D	0.000164	D	0.97275	0.9109	M	0.83312	2.635	0.52099	D	0.999942	D	0.69078	0.997	P	0.60173	0.87	D	0.97465	1.0037	10	0.72032	D	0.01	.	14.8454	0.70257	0.1437:0.8563:0.0:0.0	.	338	P02461	CO3A1_HUMAN	H	338	ENSP00000304408:P338H;ENSP00000315243:P338H	ENSP00000304408:P338H	P	+	2	0	COL3A1	189565874	0.998000	0.40836	0.998000	0.56505	0.976000	0.68499	5.621000	0.67743	2.748000	0.94277	0.655000	0.94253	CCT		0.383	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
CASP8	841	hgsc.bcm.edu	37	2	202131331	202131331	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:202131331C>A	ENST00000432109.2	+	3	311	c.122C>A	c.(121-123)gCc>gAc	p.A41D	CASP8_ENST00000392259.2_Missense_Mutation_p.A41D|CASP8_ENST00000392266.3_Missense_Mutation_p.A41D|CASP8_ENST00000392258.3_Missense_Mutation_p.A41D|CASP8_ENST00000264275.5_Missense_Mutation_p.A41D|CASP8_ENST00000323492.7_Missense_Mutation_p.A41D|CASP8_ENST00000358485.4_Missense_Mutation_p.A100D|CASP8_ENST00000264274.9_Missense_Mutation_p.A41D	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	41	DED 1. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.A41D(1)|p.A100D(1)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						ATCAAGGATGCCTTGATGTTA	0.463										HNSCC(4;0.00038)																											p.A41D	Melanoma(82;831 1348 20716 36952 40159)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C122A	2						.						75.0	76.0	76.0					2																	202131331		2203	4300	6503	201839576	SO:0001583	missense	841	exon2			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.122C>A	2.37:g.202131331C>A	ENSP00000412523:p.Ala41Asp	Somatic		Capture	SOLID	Phase_I	201839576	NM_033356	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	ENST00000432109.2	37	CCDS2342.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466288	0.63625	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000392259;ENST00000392266;ENST00000432109;ENST00000264275;ENST00000440732;ENST00000392258;ENST00000447616;ENST00000358485;ENST00000392261;ENST00000413726;ENST00000323492;ENST00000429881	D;D;D;D;D;D;D;D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.47	4.59	0.56863	DEATH-like (2);Death effector (3);	0.429819	0.26467	N	0.024214	D	0.91563	0.7335	M	0.89214	3.015	0.28370	N	0.92005	D;D;D;D;D;D;D;D;D	0.69078	0.967;0.981;0.987;0.981;0.993;0.996;0.997;0.995;0.985	P;P;P;D;D;D;D;D;P	0.72075	0.732;0.832;0.809;0.91;0.943;0.976;0.97;0.923;0.854	D	0.87012	0.2123	10	0.45353	T	0.12	.	13.7106	0.62665	0.0:0.9247:0.0:0.0753	.	41;41;41;41;100;41;41;41;41	Q14790-3;E7ETB7;Q14790-7;A8MU92;Q14790-9;Q14790;Q14790-2;Q14790-4;Q14790-5	.;.;.;.;.;CASP8_HUMAN;.;.;.	D	41;41;41;41;41;41;41;41;41;100;41;41;41;41	ENSP00000376091:A41D;ENSP00000264274:A41D;ENSP00000376088:A41D;ENSP00000376094:A41D;ENSP00000412523:A41D;ENSP00000264275:A41D;ENSP00000396869:A41D;ENSP00000376087:A41D;ENSP00000388306:A41D;ENSP00000351273:A100D;ENSP00000397528:A41D;ENSP00000325722:A41D;ENSP00000390641:A41D	ENSP00000264274:A41D	A	+	2	0	CASP8	201839576	0.830000	0.29337	0.002000	0.10522	0.424000	0.31475	3.162000	0.50755	1.268000	0.44264	0.561000	0.74099	GCC		0.463	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228	
MARCH4	57574	hgsc.bcm.edu	37	2	217142408	217142408	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:217142408G>A	ENST00000273067.4	-	3	2618	c.852C>T	c.(850-852)gaC>gaT	p.D284D		NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	284						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D284D(1)		breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		TGCACACCACGTCCATGAAGC	0.562																																					p.D284D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C852T	2						.						204.0	175.0	185.0					2																	217142408		2203	4300	6503	216850653	SO:0001819	synonymous_variant	57574	exon3			AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.852C>T	2.37:g.217142408G>A		Somatic		Capture	SOLID	Phase_I	216850653	NM_020814	Q4KMN7|Q86WR8	Silent	SNP	ENST00000273067.4	37	CCDS33376.1																																																																																				0.562	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814	
SGPP2	130367	hgsc.bcm.edu	37	2	223423406	223423406	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:223423406T>C	ENST00000321276.7	+	5	1075	c.989T>C	c.(988-990)gTg>gCg	p.V330A		NM_152386.2	NP_689599.2	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphatase 2	330					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	sphingosine-1-phosphate phosphatase activity (GO:0042392)	p.V330A(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	18		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		AAATTTGCAGTGGGAATTGTG	0.463																																					p.V330A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T989C	2						.						118.0	110.0	112.0					2																	223423406		2203	4300	6503	223131650	SO:0001583	missense	130367	exon5			AF542512	CCDS2453.1	2q36.3	2010-05-26	2010-05-26		ENSG00000163082	ENSG00000163082			19953	protein-coding gene	gene with protein product		612827				12411432	Standard	NM_152386		Approved	SPP2, FLJ39004	uc010zlo.2	Q8IWX5	OTTHUMG00000133156	ENST00000321276.7:c.989T>C	2.37:g.223423406T>C	ENSP00000315137:p.Val330Ala	Somatic		Capture	SOLID	Phase_I	223131650	NM_152386	A3KPB4|Q8N8Q6	Missense_Mutation	SNP	ENST00000321276.7	37	CCDS2453.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.466069	0.84425	.	.	ENSG00000163082	ENST00000321276	.	.	.	5.4	5.4	0.78164	.	0.074627	0.53938	D	0.000059	T	0.67924	0.2945	M	0.64997	1.995	0.50632	D	0.999884	D	0.62365	0.991	P	0.54759	0.76	T	0.72207	-0.4360	9	0.72032	D	0.01	-24.5183	15.4523	0.75282	0.0:0.0:0.0:1.0	.	330	Q8IWX5	SGPP2_HUMAN	A	330	.	ENSP00000315137:V330A	V	+	2	0	SGPP2	223131650	1.000000	0.71417	0.990000	0.47175	0.894000	0.52154	3.961000	0.56759	2.050000	0.60909	0.533000	0.62120	GTG		0.463	SGPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256856.2		
EFHD1	80303	hgsc.bcm.edu	37	2	233546386	233546386	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:233546386G>A	ENST00000264059.3	+	4	1154	c.677G>A	c.(676-678)cGc>cAc	p.R226H	EFHD1_ENST00000410095.1_Missense_Mutation_p.R114H|EFHD1_ENST00000409708.1_Missense_Mutation_p.R114H|EFHD1_ENST00000409613.1_Missense_Mutation_p.R130H|snoU13_ENST00000459149.1_RNA	NM_025202.3	NP_079478.1	Q9BUP0	EFHD1_HUMAN	EF-hand domain family, member D1	226					neuron projection development (GO:0031175)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)	p.R226H(1)		NS(1)|breast(1)|large_intestine(2)|lung(3)	7		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Breast(86;0.0199)|Renal(207;0.025)		Epithelial(121;2.08e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00825)|Lung(119;0.0101)		AGGCGGCTCCGCCAGGCAGCC	0.567																																					p.R226H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G677A	2						.						81.0	72.0	75.0					2																	233546386		2203	4300	6503	233254630	SO:0001583	missense	80303	exon4				CCDS2497.1, CCDS58755.1	2q37.1	2014-07-01	2005-01-25		ENSG00000115468	ENSG00000115468		"""EF-hand domain containing"""	29556	protein-coding gene	gene with protein product	"""swiprosin-2"""	611617	"""EF hand domain containing 1"""			21244694	Standard	NM_025202		Approved	FLJ13612	uc002vtc.3	Q9BUP0	OTTHUMG00000133263	ENST00000264059.3:c.677G>A	2.37:g.233546386G>A	ENSP00000264059:p.Arg226His	Somatic		Capture	SOLID	Phase_I	233254630	NM_025202	B2RD83|E9PFH3|Q9BTF8|Q9H8I2|Q9HBQ0	Missense_Mutation	SNP	ENST00000264059.3	37	CCDS2497.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610823	0.66558	.	.	ENSG00000115468	ENST00000409613;ENST00000264059;ENST00000540187;ENST00000409708;ENST00000410095	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.65	4.77	0.60923	.	0.100872	0.64402	N	0.000002	T	0.58552	0.2130	M	0.71871	2.18	0.80722	D	1	B;D	0.56287	0.032;0.975	B;P	0.52159	0.007;0.691	T	0.64360	-0.6426	10	0.72032	D	0.01	-11.9883	13.4861	0.61366	0.0759:0.0:0.9241:0.0	.	130;226	E9PFH3;Q9BUP0	.;EFHD1_HUMAN	H	130;226;129;114;114	ENSP00000386556:R130H;ENSP00000264059:R226H;ENSP00000386243:R114H;ENSP00000386685:R114H	ENSP00000264059:R226H	R	+	2	0	EFHD1	233254630	1.000000	0.71417	0.998000	0.56505	0.829000	0.46940	6.076000	0.71267	1.406000	0.46857	0.586000	0.80456	CGC		0.567	EFHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257040.2	NM_025202	
DGKD	8527	hgsc.bcm.edu	37	2	234346101	234346101	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:234346101G>A	ENST00000264057.2	+	8	910	c.898G>A	c.(898-900)Gct>Act	p.A300T	DGKD_ENST00000409813.3_Missense_Mutation_p.A256T	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	300					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.A300T(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CCCACCCACGGCTCTCAACAG	0.542																																					p.A300T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G898A	2						.						153.0	128.0	136.0					2																	234346101		2203	4300	6503	234010840	SO:0001583	missense	8527	exon8			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.898G>A	2.37:g.234346101G>A	ENSP00000264057:p.Ala300Thr	Somatic		Capture	SOLID	Phase_I	234010840	NM_152879	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347340	0.82022	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;D	0.81579	-1.34;-1.51	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000001	D	0.86640	0.5981	M	0.74881	2.28	0.80722	D	1	P;D;P	0.55605	0.864;0.972;0.951	P;P;P	0.53912	0.53;0.737;0.682	D	0.86487	0.1795	10	0.44086	T	0.13	.	18.7819	0.91937	0.0:0.0:1.0:0.0	.	184;256;300	Q53SE4;Q16760-2;Q16760	.;.;DGKD_HUMAN	T	300;256	ENSP00000264057:A300T;ENSP00000386455:A256T	ENSP00000264057:A300T	A	+	1	0	DGKD	234010840	1.000000	0.71417	0.206000	0.23566	0.796000	0.44982	9.657000	0.98554	2.746000	0.94184	0.655000	0.94253	GCT		0.542	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
ASB1	51665	hgsc.bcm.edu	37	2	239355107	239355107	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:239355107G>A	ENST00000264607.4	+	5	1210	c.963G>A	c.(961-963)tcG>tcA	p.S321S	ASB1_ENST00000409297.1_Silent_p.S220S	NM_001040445.1	NP_001035535.1	Q9Y576	ASB1_HUMAN	ankyrin repeat and SOCS box containing 1	321	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|male genitalia development (GO:0030539)|negative regulation of cytokine biosynthetic process (GO:0042036)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)		p.S321S(1)		breast(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)		TGATTCCTTCGCTGCCTCTGC	0.537																																					p.S321S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G963A	2						.						129.0	122.0	125.0					2																	239355107		2203	4300	6503	239019846	SO:0001819	synonymous_variant	51665	exon5			AF156777	CCDS33416.1	2q37	2013-01-10	2011-01-25		ENSG00000065802	ENSG00000065802		"""Ankyrin repeat domain containing"""	16011	protein-coding gene	gene with protein product		605758	"""ankyrin repeat and SOCS box-containing 1"""				Standard	XR_241235		Approved	ASB-1	uc002vyg.3	Q9Y576	OTTHUMG00000152866	ENST00000264607.4:c.963G>A	2.37:g.239355107G>A		Somatic		Capture	SOLID	Phase_I	239019846	NM_001040445	A6NL50|Q4ZG29|Q9ULS4	Silent	SNP	ENST00000264607.4	37	CCDS33416.1																																																																																				0.537	ASB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328294.1	NM_001040445	
ANKMY1	51281	hgsc.bcm.edu	37	2	241447028	241447028	+	Silent	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:241447028G>T	ENST00000272972.3	-	12	2422	c.2208C>A	c.(2206-2208)gcC>gcA	p.A736A	ANKMY1_ENST00000373320.4_Silent_p.A506A|ANKMY1_ENST00000401804.1_Silent_p.A825A|ANKMY1_ENST00000373318.2_Intron|ANKMY1_ENST00000361678.4_Silent_p.A512A|ANKMY1_ENST00000391987.1_Silent_p.A736A|ANKMY1_ENST00000406958.1_Silent_p.A497A|ANKMY1_ENST00000403283.1_Silent_p.A638A	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	736							metal ion binding (GO:0046872)	p.A736A(1)		central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		TCAGGTCACAGGCAACACACA	0.622																																					p.A736A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2208A	2						.						103.0	90.0	94.0					2																	241447028		2203	4300	6503	241095701	SO:0001819	synonymous_variant	51281	exon12			AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.2208C>A	2.37:g.241447028G>T		Somatic		Capture	SOLID	Phase_I	241095701	NM_016552	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Silent	SNP	ENST00000272972.3	37	CCDS2536.1	.	.	.	.	.	.	.	.	.	.	g	0.624	-0.819895	0.02776	.	.	ENSG00000144504	ENST00000391988	.	.	.	2.16	1.17	0.20885	.	.	.	.	.	T	0.52484	0.1737	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41610	-0.9499	4	.	.	.	-15.704	6.3464	0.21351	0.0:0.3133:0.6867:0.0	.	.	.	.	M	166	.	.	L	-	1	2	ANKMY1	241095701	0.578000	0.26717	0.685000	0.30070	0.113000	0.19764	0.087000	0.14958	0.405000	0.25532	0.282000	0.19409	CTG		0.622	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
CAD	790	hgsc.bcm.edu	37	2	27464223	27464223	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:27464223C>T	ENST00000403525.1	+	37	5797	c.5653C>T	c.(5653-5655)Cgt>Tgt	p.R1885C	CAD_ENST00000264705.4_Missense_Mutation_p.R1948C			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.R1948C(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACACACACTGCGTATGATGGT	0.572																																					p.R1948C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5842T	2						.						230.0	220.0	224.0					2																	27464223		2203	4300	6503	27317727	SO:0001583	missense	790	exon38			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.5653C>T	2.37:g.27464223C>T	ENSP00000384510:p.Arg1885Cys	Somatic		Capture	SOLID	Phase_I	27317727	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.017437|4.017437	0.75161|0.75161	.|.	.|.	ENSG00000084774|ENSG00000084774	ENST00000456311|ENST00000264705;ENST00000403525	.|D;D	.|0.98567	.|-5.0;-5.0	4.46|4.46	3.56|3.56	0.40772|0.40772	.|Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (1);	.|0.171135	.|0.51477	.|D	.|0.000086	D|D	0.98883|0.98883	0.9622|0.9622	M|M	0.88570|0.88570	2.965|2.965	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.83275	.|0.996;0.957	D|D	0.99490|0.99490	1.0950|1.0950	5|10	.|0.87932	.|D	.|0	0.5822|0.5822	11.3862|11.3862	0.49787|0.49787	0.182:0.8179:0.0:0.0|0.182:0.8179:0.0:0.0	.|.	.|1885;1948	.|F8VPD4;P27708	.|.;PYR1_HUMAN	V|C	252|1948;1885	.|ENSP00000264705:R1948C;ENSP00000384510:R1885C	.|ENSP00000264705:R1948C	A|R	+|+	2|1	0|0	CAD|CAD	27317727|27317727	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.450000|3.450000	0.52957|0.52957	1.048000|1.048000	0.40298|0.40298	0.561000|0.561000	0.74099|0.74099	GCG|CGT		0.572	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
PLB1	151056	hgsc.bcm.edu	37	2	28789703	28789703	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:28789703G>A	ENST00000327757.5	+	20	1365	c.1321G>A	c.(1321-1323)Gcg>Acg	p.A441T	PLB1_ENST00000422425.2_Missense_Mutation_p.A452T|PLB1_ENST00000329020.6_Missense_Mutation_p.A129T	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	441	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)	p.A441T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					TACCACCCTGGCGAGTGAGTA	0.657											OREG0014523	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A452T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1354A	2						.						74.0	78.0	77.0					2																	28789703		2203	4300	6503	28643207	SO:0001583	missense	151056	exon20				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.1321G>A	2.37:g.28789703G>A	ENSP00000330442:p.Ala441Thr	Somatic	804	Capture	SOLID	Phase_I	28643207	NM_001170585	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.44|16.44	3.123372|3.123372	0.56613|0.56613	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000436544;ENST00000329020|ENST00000404858	T;T;T;T|.	0.14640|.	2.49;2.49;2.49;2.49|.	5.35|5.35	-3.34|-3.34	0.04943|0.04943	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);|.	0.555609|.	0.18559|.	N|.	0.137686|.	T|.	0.76751|.	0.4031|.	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	P;P;B|.	0.44946|.	0.846;0.721;0.202|.	P;P;B|.	0.51999|.	0.687;0.476;0.215|.	T|.	0.74785|.	-0.3547|.	10|.	0.49607|.	T|.	0.09|.	-7.6911|-7.6911	22.0359|22.0359	0.99965|0.99965	0.0:0.7984:0.2016:0.0|0.0:0.7984:0.2016:0.0	.|.	452;129;441|.	Q6P1J6-3;Q6P1J6-2;Q6P1J6|.	.;.;PLB1_HUMAN|.	T|X	441;452;151;129|450	ENSP00000330442:A441T;ENSP00000416440:A452T;ENSP00000392493:A151T;ENSP00000330729:A129T|.	ENSP00000330442:A441T|.	A|W	+|+	1|3	0|0	PLB1|PLB1	28643207|28643207	0.164000|0.164000	0.22935|0.22935	0.371000|0.371000	0.25978|0.25978	0.315000|0.315000	0.28087|0.28087	-0.249000|-0.249000	0.08842|0.08842	-1.155000|-1.155000	0.02822|0.02822	0.561000|0.561000	0.74099|0.74099	GCG|TGG		0.657	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
CDC42EP3	10602	hgsc.bcm.edu	37	2	37873390	37873390	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:37873390C>T	ENST00000295324.3	-	2	1341	c.341G>A	c.(340-342)gGa>gAa	p.G114E	AC006369.2_ENST00000419425.1_RNA	NM_001270436.1|NM_001270437.1|NM_001270438.1|NM_006449.4	NP_001257365.1|NP_001257366.1|NP_001257367.1|NP_006440.2	Q9UKI2	BORG2_HUMAN	CDC42 effector protein (Rho GTPase binding) 3	114					regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	cytoskeletal regulatory protein binding (GO:0005519)	p.G114E(1)		endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|prostate(1)	11		all_hematologic(82;0.172)				AGCTTGGGATCCTCCAATGGT	0.547																																					p.G114E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G341A	2						.						75.0	75.0	75.0					2																	37873390		2203	4300	6503	37726894	SO:0001583	missense	10602	exon2			AF094521	CCDS1791.1	2p21	2008-05-21			ENSG00000163171	ENSG00000163171			16943	protein-coding gene	gene with protein product		606133				9535835, 11035016	Standard	NM_001270436		Approved	CEP3, UB1, BORG2	uc031rnz.1	Q9UKI2	OTTHUMG00000100971	ENST00000295324.3:c.341G>A	2.37:g.37873390C>T	ENSP00000295324:p.Gly114Glu	Somatic		Capture	SOLID	Phase_I	37726894	NM_006449	B2R8S0|O95353|Q9UQJ0	Missense_Mutation	SNP	ENST00000295324.3	37	CCDS1791.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.607182	0.66558	.	.	ENSG00000163171	ENST00000295324;ENST00000457889	T;T	0.29397	1.57;1.57	5.91	5.91	0.95273	.	0.047118	0.85682	D	0.000000	T	0.54046	0.1834	M	0.68593	2.085	0.52501	D	0.999954	D	0.76494	0.999	D	0.69824	0.966	T	0.42361	-0.9456	10	0.35671	T	0.21	.	17.7923	0.88558	0.0:1.0:0.0:0.0	.	114	Q9UKI2	BORG2_HUMAN	E	114	ENSP00000295324:G114E;ENSP00000403298:G114E	ENSP00000295324:G114E	G	-	2	0	CDC42EP3	37726894	1.000000	0.71417	0.992000	0.48379	0.932000	0.56968	5.853000	0.69496	2.793000	0.96121	0.655000	0.94253	GGA		0.547	CDC42EP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218581.3	NM_006449	
MSH6	2956	hgsc.bcm.edu	37	2	48033695	48033695	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:48033695A>G	ENST00000234420.5	+	9	4058	c.3906A>G	c.(3904-3906)gcA>gcG	p.A1302A	MSH6_ENST00000540021.1_Silent_p.A1172A|MSH6_ENST00000538136.1_Silent_p.A1000A|FBXO11_ENST00000405808.1_Intron	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	1302					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GCTTTAATGCAGCAAGGCTTG	0.398			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.A1302A		yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	.	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.A3906G	2						.						52.0	54.0	53.0					2																	48033695		2203	4300	6503	47887199	SO:0001819	synonymous_variant	2956	exon9	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.3906A>G	2.37:g.48033695A>G		Somatic		Capture	SOLID	Phase_I	47887199	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Silent	SNP	ENST00000234420.5	37	CCDS1836.1																																																																																				0.398	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
SPTBN1	6711	hgsc.bcm.edu	37	2	54753560	54753560	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:54753560C>T	ENST00000356805.4	+	2	286	c.5C>T	c.(4-6)aCg>aTg	p.T2M	AC092839.3_ENST00000433475.1_RNA	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	2	Actin-binding.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.T2M(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			TTCAAGATGACGACCACAGTA	0.458																																					p.T2M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5T	2						.						144.0	134.0	138.0					2																	54753560		2203	4300	6503	54607064	SO:0001583	missense	6711	exon2				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.5C>T	2.37:g.54753560C>T	ENSP00000349259:p.Thr2Met	Somatic		Capture	SOLID	Phase_I	54607064	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.929465	0.73327	.	.	ENSG00000115306	ENST00000356805;ENST00000389980	T;T	0.34275	1.37;1.37	5.71	5.71	0.89125	.	0.059185	0.64402	D	0.000002	T	0.28928	0.0718	N	0.22421	0.69	0.80722	D	1	B	0.31548	0.328	B	0.23852	0.049	T	0.09818	-1.0657	10	0.87932	D	0	.	19.8773	0.96884	0.0:1.0:0.0:0.0	.	2	Q01082	SPTB2_HUMAN	M	2	ENSP00000349259:T2M;ENSP00000374630:T2M	ENSP00000349259:T2M	T	+	2	0	SPTBN1	54607064	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.644000	0.67902	2.686000	0.91538	0.650000	0.86243	ACG		0.458	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
RTN4	57142	hgsc.bcm.edu	37	2	55254061	55254061	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:55254061G>A	ENST00000337526.6	-	3	1417	c.1174C>T	c.(1174-1176)Cga>Tga	p.R392*	RTN4_ENST00000354474.6_Nonsense_Mutation_p.R160*|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000404909.1_Nonsense_Mutation_p.R186*|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000405240.1_Nonsense_Mutation_p.R186*|RTN4_ENST00000357376.3_Nonsense_Mutation_p.R186*|RTN4_ENST00000394611.2_Nonsense_Mutation_p.R186*|RTN4_ENST00000317610.7_Intron	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	392					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.R186*(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						TCCCATACTCGCTCAAATGGT	0.383																																					p.R392X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1174T	2						.						199.0	200.0	200.0					2																	55254061		2203	4300	6503	55107565	SO:0001587	stop_gained	57142	exon3			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.1174C>T	2.37:g.55254061G>A	ENSP00000337838:p.Arg392*	Somatic		Capture	SOLID	Phase_I	55107565	NM_020532	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Nonsense_Mutation	SNP	ENST00000337526.6	37	CCDS42684.1	.	.	.	.	.	.	.	.	.	.	G	33	5.212492	0.95069	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	.	.	.	5.99	5.99	0.97316	.	0.695263	0.14325	N	0.326736	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	0.5125	20.4753	0.99175	0.0:0.0:1.0:0.0	.	.	.	.	X	186;186;392;186;186;160	.	ENSP00000337838:R392X	R	-	1	2	RTN4	55107565	0.999000	0.42202	0.762000	0.31397	0.980000	0.70556	6.778000	0.75043	2.844000	0.97970	0.650000	0.86243	CGA		0.383	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
COMMD1	150684	hgsc.bcm.edu	37	2	62228014	62228014	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:62228014G>A	ENST00000311832.5	+	2	391	c.359G>A	c.(358-360)cGg>cAg	p.R120Q	COMMD1_ENST00000538736.1_Missense_Mutation_p.R120Q|COMMD1_ENST00000472729.1_3'UTR	NM_152516.2	NP_689729.1	Q8N668	COMD1_HUMAN	copper metabolism (Murr1) domain containing 1	120	COMM. {ECO:0000255|PROSITE- ProRule:PRU00602}.				copper ion homeostasis (GO:0055070)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of protein ubiquitination (GO:0031398)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)	p.R120Q(1)		large_intestine(1)|liver(2)|lung(5)|ovary(1)	9	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)			AGCGGGCTTCGGGGCCTGAGC	0.493																																					p.R120Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G359A	2						.						67.0	71.0	69.0					2																	62228014		2203	4300	6503	62081518	SO:0001583	missense	150684	exon2			BC022046	CCDS1869.1	2p15	2004-03-02	2004-02-13	2004-02-18	ENSG00000173163	ENSG00000173163			23024	protein-coding gene	gene with protein product	"""copper metabolism gene MURR1"""	607238	"""chromosome 2 open reading frame 5 (MURR1)"""	C2orf5		9001233, 11809725	Standard	NM_152516		Approved	MURR1, MGC27155	uc002sbp.3	Q8N668	OTTHUMG00000129445	ENST00000311832.5:c.359G>A	2.37:g.62228014G>A	ENSP00000308236:p.Arg120Gln	Somatic		Capture	SOLID	Phase_I	62081518	NM_152516	B4DFQ4|Q96GS0	Missense_Mutation	SNP	ENST00000311832.5	37	CCDS1869.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.541305	0.45280	.	.	ENSG00000173163	ENST00000311832;ENST00000538736	T;T	0.09350	2.99;2.99	5.88	1.58	0.23477	COMM domain (1);	0.155416	0.56097	N	0.000027	T	0.07413	0.0187	L	0.39898	1.24	0.42993	D	0.994492	P	0.39862	0.692	B	0.31547	0.132	T	0.25641	-1.0126	10	0.66056	D	0.02	.	8.2231	0.31554	0.4905:0.0:0.5094:0.0	.	120	Q8N668	COMD1_HUMAN	Q	120	ENSP00000308236:R120Q;ENSP00000438961:R120Q	ENSP00000308236:R120Q	R	+	2	0	COMMD1	62081518	1.000000	0.71417	0.971000	0.41717	0.935000	0.57460	2.227000	0.42972	0.413000	0.25759	0.460000	0.39030	CGG		0.493	COMMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251607.2	NM_152516	
KDM3A	55818	hgsc.bcm.edu	37	2	86684135	86684135	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:86684135C>T	ENST00000409556.1	+	9	1149	c.784C>T	c.(784-786)Cgc>Tgc	p.R262C	KDM3A_ENST00000542128.1_Missense_Mutation_p.R210C|KDM3A_ENST00000409064.1_Missense_Mutation_p.R262C|KDM3A_ENST00000312912.5_Missense_Mutation_p.R262C			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	262					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.R262C(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						AGCTGTAAAACGCAAGTCTTC	0.368																																					p.R262C	NSCLC(96;1150 1523 6936 46253 49736)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C784T	2						.						57.0	57.0	57.0					2																	86684135		2203	4300	6503	86537646	SO:0001583	missense	55818	exon8			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.784C>T	2.37:g.86684135C>T	ENSP00000386660:p.Arg262Cys	Somatic		Capture	SOLID	Phase_I	86537646	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	ENST00000409556.1	37	CCDS1990.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.913887	0.72983	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.66280	-0.18;-0.18;-0.18;-0.2	5.61	4.68	0.58851	.	0.072482	0.56097	D	0.000036	T	0.73544	0.3600	L	0.57536	1.79	0.53688	D	0.999974	D;D	0.89917	1.0;0.972	D;P	0.87578	0.998;0.541	T	0.75001	-0.3471	10	0.72032	D	0.01	.	10.9908	0.47549	0.1858:0.8141:0.0:0.0	.	210;262	F5H070;Q9Y4C1	.;KDM3A_HUMAN	C	262;262;262;262;210	ENSP00000386660:R262C;ENSP00000323659:R262C;ENSP00000386516:R262C;ENSP00000438324:R210C	ENSP00000323659:R262C	R	+	1	0	KDM3A	86537646	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.816000	0.38992	2.627000	0.88993	0.561000	0.74099	CGC		0.368	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
RNF103	7844	hgsc.bcm.edu	37	2	86832099	86832099	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:86832099G>A	ENST00000237455.4	-	4	1893	c.925C>T	c.(925-927)Ctt>Ttt	p.L309F	RNF103_ENST00000477307.1_5'UTR|AC015971.2_ENST00000426549.1_RNA|RNF103-CHMP3_ENST00000604011.1_Intron|AC015971.2_ENST00000597638.1_RNA|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000439077.1_RNA|CHMP3_ENST00000439940.2_Intron	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	309					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L309F(1)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						ATGGCCTGAAGGGATATAAAT	0.373																																					p.L305F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C913T	2						.						87.0	95.0	93.0					2																	86832099		2203	4300	6503	86685610	SO:0001583	missense	7844	exon5			D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.925C>T	2.37:g.86832099G>A	ENSP00000237455:p.Leu309Phe	Somatic		Capture	SOLID	Phase_I	86685610	NM_001198951	A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Missense_Mutation	SNP	ENST00000237455.4	37	CCDS33237.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.275031	0.59649	.	.	ENSG00000239305	ENST00000237455	T	0.53206	0.63	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.67401	0.2889	M	0.62723	1.935	0.54753	D	0.999981	D	0.76494	0.999	D	0.80764	0.994	T	0.67872	-0.5558	10	0.51188	T	0.08	-14.6038	18.8478	0.92213	0.0:0.0:1.0:0.0	.	309	O00237	RN103_HUMAN	F	309	ENSP00000237455:L309F	ENSP00000237455:L309F	L	-	1	0	RNF103	86685610	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.621000	0.83083	2.468000	0.83385	0.460000	0.39030	CTT		0.373	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330041.2	NM_005667	
REV1	51455	hgsc.bcm.edu	37	2	100037986	100037986	+	Silent	SNP	C	C	T	rs368718842		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:100037986C>T	ENST00000258428.3	-	11	2034	c.1806G>A	c.(1804-1806)acG>acA	p.T602T	REV1_ENST00000393445.3_Silent_p.T601T|REV1_ENST00000465835.1_5'UTR	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	602	UmuC. {ECO:0000255|PROSITE- ProRule:PRU00216}.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)	p.T602T(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAGCACATTTCGTCTGGTCTT	0.383								Direct reversal of damage																													p.T602T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1806A	2						.	C	,	0,4406		0,0,2203	180.0	167.0	171.0		1803,1806	-7.2	0.0	2		171	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	REV1	NM_001037872.1,NM_016316.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	601/1251,602/1252	100037986	1,13005	2203	4300	6503	99404418	SO:0001819	synonymous_variant	51455	exon11			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.1806G>A	2.37:g.100037986C>T		Somatic		Capture	SOLID	Phase_I	99404418	NM_016316	O95941|Q53SI7|Q9C0J4|Q9NUP2	Silent	SNP	ENST00000258428.3	37	CCDS2045.1																																																																																				0.383	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
MTERF4	130916	hgsc.bcm.edu	37	2	242035428	242035428	+	Silent	SNP	G	G	A	rs114558653	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr2:242035428G>A	ENST00000391980.2	-	4	1189	c.1131C>T	c.(1129-1131)gaC>gaT	p.D377D	MTERFD2_ENST00000464344.2_Intron|MTERFD2_ENST00000406593.1_Silent_p.D189D|MTERFD2_ENST00000495694.1_Intron	NM_182501.3	NP_872307.2	Q7Z6M4	MTEF4_HUMAN		377					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	rRNA binding (GO:0019843)	p.D377D(1)		endometrium(3)|large_intestine(6)|lung(5)|ovary(1)|skin(2)|urinary_tract(3)	20		all_cancers(19;4.67e-31)|all_epithelial(40;8.67e-13)|Breast(86;0.000141)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;2.47e-32)|all cancers(36;1.79e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-14)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;2.81e-06)|Lung(119;0.000509)|LUSC - Lung squamous cell carcinoma(224;0.00442)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0886)		CCTCCtcgtcgtcgtcctcat	0.478													g|||	11	0.00219649	0.0083	0.0	5008	,	,		21478	0.0		0.0	False		,,,				2504	0.0				p.D377D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1131T	2						.	A		19,4387	26.2+/-53.5	0,19,2184	341.0	255.0	284.0		1131	-2.1	0.0	2	dbSNP_132	284	0,8600		0,0,4300	no	coding-synonymous	MTERFD2	NM_182501.3		0,19,6484	AA,AG,GG		0.0,0.4312,0.1461		377/382	242035428	19,12987	2203	4300	6503	241684101	SO:0001819	synonymous_variant	130916	exon4																														ENST00000391980.2:c.1131C>T	2.37:g.242035428G>A		Somatic		Capture	SOLID	Phase_I	241684101	NM_182501	A8K6K0|Q9P0E0	Silent	SNP	ENST00000391980.2	37	CCDS2544.1																																																																																				0.478	MTERFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323798.4		
TGFBR1	7046	hgsc.bcm.edu	37	9	101911534	101911534	+	Missense_Mutation	SNP	C	C	T	rs111426349	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:101911534C>T	ENST00000374994.4	+	9	1576	c.1459C>T	c.(1459-1461)Cgg>Tgg	p.R487W	TGFBR1_ENST00000552516.1_Missense_Mutation_p.R491W|TGFBR1_ENST00000550253.1_Missense_Mutation_p.R418W|TGFBR1_ENST00000374990.2_Missense_Mutation_p.R410W	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	487	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> P (in LDS1). {ECO:0000269|PubMed:15731757, ECO:0000269|PubMed:16928994}.|R -> Q (in LDS1). {ECO:0000269|PubMed:16791849, ECO:0000269|PubMed:16928994, ECO:0000269|PubMed:22113417}.|R -> W (in LDS1). {ECO:0000269|PubMed:16928994}.		activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.R487W(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TACAGCATTGCGGATTAAGAA	0.368																																					p.R487W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1459T	9	GRCh37	CM064321	TGFBR1	M	rs111426349	.						87.0	78.0	81.0					9																	101911534		2203	4300	6503	100951355	SO:0001583	missense	7046	exon9				CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1459C>T	9.37:g.101911534C>T	ENSP00000364133:p.Arg487Trp	Somatic		Capture	SOLID	Phase_I	100951355	NM_004612	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	37	CCDS6738.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414724	0.62511	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000550253	D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24	5.66	3.77	0.43336	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97464	0.9170	H	0.94385	3.53	0.80722	A	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.98609	1.0662	9	0.87932	D	0	.	14.2017	0.65710	0.2725:0.7275:0.0:0.0	.	410;487	P36897-3;P36897	.;TGFR1_HUMAN	W	487;449;410;491;418	ENSP00000364133:R487W;ENSP00000364129:R410W;ENSP00000447297:R491W;ENSP00000450052:R418W	ENSP00000364129:R410W	R	+	1	2	TGFBR1	100951355	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.561000	0.45905	0.804000	0.34136	0.655000	0.94253	CGG		0.368	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3		
TEX10	54881	hgsc.bcm.edu	37	9	103092364	103092364	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:103092364A>G	ENST00000374902.4	-	6	1514	c.1338T>C	c.(1336-1338)aaT>aaC	p.N446N	TEX10_ENST00000535814.1_Silent_p.N449N|TEX10_ENST00000537512.1_Silent_p.N381N	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	446						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)		p.N446N(1)		NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		AAGTTGACGCATTTGCCAGGG	0.388																																					p.N446N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1338C	9						.						139.0	131.0	134.0					9																	103092364		2203	4300	6503	102132185	SO:0001819	synonymous_variant	54881	exon6			AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1338T>C	9.37:g.103092364A>G		Somatic		Capture	SOLID	Phase_I	102132185	NM_017746	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Silent	SNP	ENST00000374902.4	37	CCDS6748.1																																																																																				0.388	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746	
GRIN3A	116443	hgsc.bcm.edu	37	9	104433234	104433234	+	Missense_Mutation	SNP	C	C	T	rs139560863	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:104433234C>T	ENST00000361820.3	-	3	2060	c.1460G>A	c.(1459-1461)gGa>gAa	p.G487E		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	487			G -> R (in dbSNP:rs10989589). {ECO:0000269|PubMed:11735224, ECO:0000269|PubMed:11880201}.		calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.G487E(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GACAATCTTTCCCCCCTGCCA	0.502																																					p.G487E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1460A	9						.						167.0	162.0	164.0					9																	104433234		2203	4300	6503	103473055	SO:0001583	missense	116443	exon3				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1460G>A	9.37:g.104433234C>T	ENSP00000355155:p.Gly487Glu	Somatic		Capture	SOLID	Phase_I	103473055	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238747	0.79800	.	.	ENSG00000198785	ENST00000361820	T	0.11604	2.76	5.76	5.76	0.90799	.	0.135566	0.49305	D	0.000160	T	0.38026	0.1025	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	T	0.02398	-1.1165	10	0.45353	T	0.12	.	20.3242	0.98691	0.0:1.0:0.0:0.0	.	487	Q8TCU5	NMD3A_HUMAN	E	487	ENSP00000355155:G487E	ENSP00000355155:G487E	G	-	2	0	GRIN3A	103473055	1.000000	0.71417	0.251000	0.24312	0.986000	0.74619	7.710000	0.84655	2.882000	0.98803	0.655000	0.94253	GGA		0.502	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
SUSD1	64420	hgsc.bcm.edu	37	9	114904601	114904601	+	Splice_Site	SNP	T	T	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:114904601T>G	ENST00000374270.3	-	5	877	c.705A>C	c.(703-705)caA>caC	p.Q235H	SUSD1_ENST00000374263.3_Splice_Site_p.Q235H|SUSD1_ENST00000374264.2_Splice_Site_p.Q235H|SUSD1_ENST00000482851.1_5'UTR	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	235	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.Q235H(1)	SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						AAAACTCACCTTGGCAATGTA	0.388																																					p.Q235H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A705C	9						.						110.0	113.0	112.0					9																	114904601		2203	4300	6503	113944422	SO:0001630	splice_region_variant	64420	exon5			AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.706+1A>C	9.37:g.114904601T>G		Somatic		Capture	SOLID	Phase_I	113944422	NM_022486	A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Missense_Mutation	SNP	ENST00000374270.3	37	CCDS6783.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.56|14.56	2.573070|2.573070	0.45902|0.45902	.|.	.|.	ENSG00000106868|ENSG00000106868	ENST00000415074|ENST00000374270;ENST00000374263;ENST00000374264	.|T;T;T	.|0.25085	.|1.82;1.82;1.82	5.66|5.66	4.52|4.52	0.55395|0.55395	.|Complement control module (2);Sushi/SCR/CCP (1);	.|0.178426	.|0.27139	.|N	.|0.020747	T|T	0.20577|0.20577	0.0495|0.0495	L|L	0.32530|0.32530	0.975|0.975	0.40488|0.40488	D|D	0.980514|0.980514	.|B;B;B	.|0.15930	.|0.015;0.007;0.009	.|B;B;B	.|0.16289	.|0.015;0.01;0.006	T|T	0.03112|0.03112	-1.1071|-1.1071	5|10	.|0.38643	.|T	.|0.18	-20.6059|-20.6059	12.3907|12.3907	0.55356|0.55356	0.0:0.0:0.141:0.859|0.0:0.0:0.141:0.859	.|.	.|235;235;235	.|F8WAQ1;Q6UWL2-2;Q6UWL2	.|.;.;SUSD1_HUMAN	T|H	49|235	.|ENSP00000363388:Q235H;ENSP00000363381:Q235H;ENSP00000363382:Q235H	.|ENSP00000363381:Q235H	K|Q	-|-	2|3	0|2	SUSD1|SUSD1	113944422|113944422	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	3.526000|3.526000	0.53509|0.53509	1.070000|1.070000	0.40811|0.40811	-0.299000|-0.299000	0.09455|0.09455	AAG|CAA		0.388	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053668.3	NM_022486	Missense_Mutation
RGS3	5998	hgsc.bcm.edu	37	9	116346190	116346190	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:116346190C>T	ENST00000374140.2	+	21	2707	c.2498C>T	c.(2497-2499)aCc>aTc	p.T833I	RGS3_ENST00000394646.3_Intron|RGS3_ENST00000343817.5_Missense_Mutation_p.T552I|RGS3_ENST00000350696.5_Missense_Mutation_p.T833I|RGS3_ENST00000374134.3_Missense_Mutation_p.T154I|RGS3_ENST00000342620.5_Intron|RP11-168K11.2_ENST00000428429.1_RNA|RGS3_ENST00000462143.1_Missense_Mutation_p.T154I	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	833					inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.T833I(1)|p.T729I(1)		cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						ACTGAGGACACCATGAGCTCC	0.647																																					p.T833I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2498T	9						.						85.0	92.0	90.0					9																	116346190		2203	4300	6503	115386011	SO:0001583	missense	5998	exon21			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.2498C>T	9.37:g.116346190C>T	ENSP00000363255:p.Thr833Ile	Somatic		Capture	SOLID	Phase_I	115386011	NM_144488	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	ENST00000374140.2	37	CCDS43869.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694588	0.48202	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000343817;ENST00000462143;ENST00000374134	T;T;T;T;T	0.58210	0.86;0.86;0.37;0.35;0.35	4.72	0.614	0.17603	.	0.536829	0.17507	N	0.171751	T	0.44540	0.1298	L	0.27053	0.805	0.09310	N	0.999995	D;B;B;B;B;B	0.63880	0.993;0.012;0.01;0.002;0.003;0.003	P;B;B;B;B;B	0.55112	0.769;0.007;0.027;0.004;0.003;0.003	T	0.31998	-0.9923	10	0.87932	D	0	.	2.6138	0.04898	0.1513:0.5316:0.1468:0.1703	.	172;729;154;552;723;833	B4DWF9;P49796-6;Q6ZV17;P49796-4;B3KWG8;P49796	.;.;.;.;.;RGS3_HUMAN	I	833;833;552;154;154	ENSP00000363255:T833I;ENSP00000259406:T833I;ENSP00000340284:T552I;ENSP00000420356:T154I;ENSP00000363249:T154I	ENSP00000340284:T552I	T	+	2	0	RGS3	115386011	0.675000	0.27558	0.004000	0.12327	0.006000	0.05464	1.311000	0.33562	0.018000	0.15052	0.563000	0.77884	ACC		0.647	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790	
DEC1	50514	hgsc.bcm.edu	37	9	118162670	118162670	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:118162670C>A	ENST00000374016.1	+	6	565	c.46C>A	c.(46-48)Cca>Aca	p.P16T		NM_017418.2	NP_059114.1	Q9P2X7	DEC1_HUMAN	deleted in esophageal cancer 1	16					negative regulation of cell proliferation (GO:0008285)			p.P16T(1)		kidney(1)|large_intestine(1)|ovary(1)	3						gagcattgtgccagcacctgg	0.433																																					p.P16T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C46A	9						.						131.0	118.0	122.0					9																	118162670		2203	4300	6503	117202491	SO:0001583	missense	50514	exon6			AB022761	CCDS6812.1	9q32	2008-02-05			ENSG00000173077	ENSG00000173077			23658	protein-coding gene	gene with protein product		604767				8603412, 10612805	Standard	NM_017418		Approved	CTS9	uc004bjk.1	Q9P2X7	OTTHUMG00000020549	ENST00000374016.1:c.46C>A	9.37:g.118162670C>A	ENSP00000363128:p.Pro16Thr	Somatic		Capture	SOLID	Phase_I	117202491	NM_017418		Missense_Mutation	SNP	ENST00000374016.1	37	CCDS6812.1	.	.	.	.	.	.	.	.	.	.	c	4.178	0.031525	0.08101	.	.	ENSG00000173077	ENST00000374016	T	0.60424	0.19	0.946	-1.37	0.09056	.	.	.	.	.	T	0.40423	0.1116	.	.	.	0.09310	N	1	P	0.40578	0.722	B	0.32980	0.156	T	0.21999	-1.0229	8	0.87932	D	0	.	6.5631	0.22497	0.0:0.4005:0.5995:0.0	.	16	Q9P2X7	DEC1_HUMAN	T	16	ENSP00000363128:P16T	ENSP00000363128:P16T	P	+	1	0	DEC1	117202491	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.199000	0.09491	-0.540000	0.06265	-0.806000	0.03193	CCA		0.433	DEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053791.1	NM_017418	
OR1J1	347168	hgsc.bcm.edu	37	9	125239536	125239536	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:125239536T>C	ENST00000259357.2	-	1	699	c.670A>G	c.(670-672)Acc>Gcc	p.T224A	RP11-542K23.9_ENST00000412262.2_RNA	NM_001004451.1	NP_001004451.1	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J, member 1	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T224A(1)		endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	16						TGGAGGATGGTGACCCCAATG	0.468																																					p.T224A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A670G	9						.						141.0	125.0	131.0					9																	125239536		2203	4300	6503	124279357	SO:0001583	missense	347168	exon1			AL353767	CCDS35120.1	9q33.2	2013-09-20			ENSG00000136834	ENSG00000136834		"""GPCR / Class A : Olfactory receptors"""	8208	protein-coding gene	gene with protein product							Standard	NM_001004451		Approved	hg32	uc011lyu.2	Q8NGS3	OTTHUMG00000020603	ENST00000259357.2:c.670A>G	9.37:g.125239536T>C	ENSP00000259357:p.Thr224Ala	Somatic		Capture	SOLID	Phase_I	124279357	NM_001004451	A3KFL8|Q6IF10|Q96R88	Missense_Mutation	SNP	ENST00000259357.2	37	CCDS35120.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.611743	0.00835	.	.	ENSG00000136834	ENST00000259357	T	0.00029	8.91	4.93	3.76	0.43208	GPCR, rhodopsin-like superfamily (1);	0.205127	0.34676	N	0.003774	T	0.00073	0.0002	N	0.10837	0.055	0.19775	N	0.99996	B	0.31581	0.329	B	0.37387	0.248	T	0.02526	-1.1146	10	0.27082	T	0.32	.	7.7363	0.28817	0.0:0.1688:0.0:0.8312	.	224	Q8NGS3	OR1J1_HUMAN	A	224	ENSP00000259357:T224A	ENSP00000259357:T224A	T	-	1	0	OR1J1	124279357	0.000000	0.05858	0.970000	0.41538	0.072000	0.16883	-0.203000	0.09438	0.996000	0.38943	0.487000	0.48397	ACC		0.468	OR1J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053931.1		
SPTAN1	6709	hgsc.bcm.edu	37	9	131344156	131344156	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:131344156G>A	ENST00000372731.4	+	12	1667	c.1557G>A	c.(1555-1557)caG>caA	p.Q519Q	SPTAN1_ENST00000372739.3_Silent_p.Q519Q|SPTAN1_ENST00000358161.5_Silent_p.Q519Q	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	519					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.Q519Q(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TTAGTGCCCAGGAGGAAAAGA	0.443																																					p.Q519Q	NSCLC(120;833 1744 2558 35612 37579)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1557A	9						.						139.0	140.0	140.0					9																	131344156		2203	4300	6503	130383977	SO:0001819	synonymous_variant	6709	exon12			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.1557G>A	9.37:g.131344156G>A		Somatic		Capture	SOLID	Phase_I	130383977	NM_001195532	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	ENST00000372731.4	37	CCDS6905.1																																																																																				0.443	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
NUP188	23511	hgsc.bcm.edu	37	9	131733046	131733046	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:131733046T>G	ENST00000372577.2	+	11	943	c.922T>G	c.(922-924)Tgt>Ggt	p.C308G		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	308					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.C308G(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GGATATGGACTGTTTAATGTT	0.468																																					p.C308G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T922G	9						.						198.0	180.0	186.0					9																	131733046		2203	4300	6503	130772867	SO:0001583	missense	23511	exon11			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.922T>G	9.37:g.131733046T>G	ENSP00000361658:p.Cys308Gly	Somatic		Capture	SOLID	Phase_I	130772867	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	T	5.041	0.193272	0.09599	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.28666	1.6	5.92	1.64	0.23874	.	0.989497	0.08276	N	0.970581	T	0.14141	0.0342	N	0.08118	0	0.09310	N	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.32534	-0.9903	10	0.24483	T	0.36	-9.9221	4.1633	0.10295	0.3653:0.3804:0.0:0.2543	.	308	Q5SRE5	NU188_HUMAN	G	197;308	ENSP00000361658:C308G	ENSP00000349125:C197G	C	+	1	0	NUP188	130772867	0.668000	0.27493	0.318000	0.25279	0.794000	0.44872	0.772000	0.26647	0.031000	0.15407	-2.661000	0.00147	TGT		0.468	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
NUP188	23511	hgsc.bcm.edu	37	9	131748882	131748882	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:131748882A>T	ENST00000372577.2	+	21	2143	c.2122A>T	c.(2122-2124)Atg>Ttg	p.M708L		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	708					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.M708L(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						ACCCTGTGTAATGTTTGTGCT	0.483																																					p.M708L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2122T	9						.						194.0	169.0	178.0					9																	131748882		2203	4300	6503	130788703	SO:0001583	missense	23511	exon21			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.2122A>T	9.37:g.131748882A>T	ENSP00000361658:p.Met708Leu	Somatic		Capture	SOLID	Phase_I	130788703	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	A	11.63	1.696913	0.30142	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.27402	1.67	5.5	5.5	0.81552	.	0.098407	0.85682	D	0.000000	T	0.09992	0.0245	N	0.01874	-0.695	0.35724	D	0.817423	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.27054	-1.0085	10	0.12766	T	0.61	-0.0649	5.7085	0.17921	0.7377:0.173:0.0893:0.0	.	41;708	E9PET9;Q5SRE5	.;NU188_HUMAN	L	597;708	ENSP00000361658:M708L	ENSP00000349125:M597L	M	+	1	0	NUP188	130788703	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.380000	0.52448	2.216000	0.71823	0.402000	0.26972	ATG		0.483	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
NUP214	8021	hgsc.bcm.edu	37	9	134006180	134006180	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:134006180T>C	ENST00000359428.5	+	5	764	c.620T>C	c.(619-621)cTg>cCg	p.L207P	RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000587264.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.L207P|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.L207P			P35658	NU214_HUMAN	nucleoporin 214kDa	207	Seven-bladed beta propeller.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)	p.L207P(1)		NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		GGAAAGCAGCTGGCAGTGGGA	0.413			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.L207P	Pancreas(4;24 48 25510 30394 32571)		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T620C	9						.						116.0	120.0	119.0					9																	134006180		2203	4300	6503	132996001	SO:0001583	missense	8021	exon5			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.620T>C	9.37:g.134006180T>C	ENSP00000352400:p.Leu207Pro	Somatic		Capture	SOLID	Phase_I	132996001	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.902050	0.92035	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375	D;D;D	0.94000	-3.33;-3.33;-3.33	5.87	5.87	0.94306	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.33075	N	0.005302	D	0.96510	0.8861	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.96937	0.9685	10	0.87932	D	0	-11.7155	15.7569	0.78037	0.0:0.0:0.0:1.0	.	207;207	P35658-4;P35658	.;NU214_HUMAN	P	207	ENSP00000352400:L207P;ENSP00000396576:L207P;ENSP00000405014:L207P	ENSP00000352400:L207P	L	+	2	0	NUP214	132996001	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.274000	0.78538	2.371000	0.80710	0.533000	0.62120	CTG		0.413	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
GTF3C5	9328	hgsc.bcm.edu	37	9	135929862	135929862	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:135929862C>T	ENST00000372097.5	+	7	1379	c.1056C>T	c.(1054-1056)acC>acT	p.T352T	GTF3C5_ENST00000372108.5_Silent_p.T352T|GTF3C5_ENST00000372095.5_Silent_p.T227T|GTF3C5_ENST00000372099.6_Silent_p.T343T|GTF3C5_ENST00000342018.8_Silent_p.T283T	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	352					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.T352T(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		TCCCCATCACCGTCAAGAAGA	0.612																																					p.T352T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1056T	9						.						97.0	84.0	88.0					9																	135929862		2203	4300	6503	134919683	SO:0001819	synonymous_variant	9328	exon7			AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.1056C>T	9.37:g.135929862C>T		Somatic		Capture	SOLID	Phase_I	134919683	NM_001122823	A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Silent	SNP	ENST00000372097.5	37	CCDS6958.1	.	.	.	.	.	.	.	.	.	.	C	2.611	-0.290758	0.05568	.	.	ENSG00000148308	ENST00000434175;ENST00000435745	.	.	.	5.65	-9.53	0.00575	.	.	.	.	.	T	0.34308	0.0893	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43032	-0.9416	4	.	.	.	0.0629	2.6359	0.04957	0.1664:0.1801:0.1544:0.4991	.	.	.	.	L	124;31	.	.	P	+	2	0	GTF3C5	134919683	0.000000	0.05858	0.542000	0.28115	0.344000	0.29017	-1.621000	0.02044	-1.437000	0.01967	-0.794000	0.03295	CCG		0.612	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054826.1	NM_001122823	
SURF4	6836	hgsc.bcm.edu	37	9	136233511	136233511	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:136233511G>A	ENST00000371989.3	-	3	405	c.276C>T	c.(274-276)taC>taT	p.Y92Y	SURF4_ENST00000485435.2_Silent_p.Y92Y|SURF4_ENST00000371991.3_Silent_p.Y92Y|SURF4_ENST00000545297.1_Silent_p.Y92Y|SURF4_ENST00000467910.1_Intron	NM_001280788.1|NM_001280790.1|NM_001280791.1|NM_033161.2	NP_001267717.1|NP_001267719.1|NP_001267720.1|NP_149351.1	O15260	SURF4_HUMAN	surfeit 4	92					Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.Y92Y(1)		kidney(1)|large_intestine(2)|lung(5)	8				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		CGAAGCAGGCGTACTGCACGA	0.612																																					p.Y92Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C276T	9						.						68.0	59.0	62.0					9																	136233511		2203	4300	6503	135223332	SO:0001819	synonymous_variant	6836	exon3				CCDS6968.1, CCDS65177.1, CCDS65178.1, CCDS75929.1	9q33-q34	2008-07-21			ENSG00000148248	ENSG00000148248			11476	protein-coding gene	gene with protein product	"""surfeit locus protein 4"", ""surface 4 integral membrane protein"""	185660				8499913, 7540914	Standard	NM_033161		Approved	ERV29, FLJ22993, MGC102753	uc004cdj.3	O15260	OTTHUMG00000020868	ENST00000371989.3:c.276C>T	9.37:g.136233511G>A		Somatic		Capture	SOLID	Phase_I	135223332	NM_033161	B7Z6A4|O60923|Q5T8U6|Q9UNZ0|Q9UNZ1	Silent	SNP	ENST00000371989.3	37	CCDS6968.1																																																																																				0.612	SURF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054886.1	NM_033161	
RIC1	57589	hgsc.bcm.edu	37	9	5765498	5765498	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:5765498C>T	ENST00000414202.2	+	20	3117	c.2926C>T	c.(2926-2928)Cga>Tga	p.R976*	KIAA1432_ENST00000418622.3_Nonsense_Mutation_p.R897*|KIAA1432_ENST00000251879.6_Nonsense_Mutation_p.R976*|KIAA1432_ENST00000381532.2_Nonsense_Mutation_p.R897*|KIAA1432_ENST00000449720.2_Nonsense_Mutation_p.R860*	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.R897*(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		GGACCTTTGTCGACACATGAT	0.443																																					p.R897X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2689T	9						.						186.0	171.0	176.0					9																	5765498		2203	4300	6503	5755498	SO:0001587	stop_gained	57589	exon19																														ENST00000414202.2:c.2926C>T	9.37:g.5765498C>T	ENSP00000416696:p.Arg976*	Somatic		Capture	SOLID	Phase_I	5755498	NM_020829		Nonsense_Mutation	SNP	ENST00000414202.2	37	CCDS34982.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.324379|7.324379	0.98214|0.98214	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720|ENST00000545641	.|.	.|.	.|.	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.71796	.|0.3382	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.68720	.|-0.5334	.|4	0.09590|.	T|.	0.72|.	-10.5606|-10.5606	15.3963|15.3963	0.74798|0.74798	0.1392:0.8608:0.0:0.0|0.1392:0.8608:0.0:0.0	.|.	.|.	.|.	.|.	X|L	976;976;897;897;860|867	.|.	ENSP00000251879:R976X|.	R|S	+|+	1|2	2|0	KIAA1432|KIAA1432	5755498|5755498	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.624000|0.624000	0.37722|0.37722	4.517000|4.517000	0.60503|0.60503	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	CGA|TCG		0.443	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
PSIP1	11168	hgsc.bcm.edu	37	9	15466799	15466799	+	Silent	SNP	G	G	A	rs145017529	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:15466799G>A	ENST00000380733.4	-	15	1822	c.1479C>T	c.(1477-1479)aaC>aaT	p.N493N	PSIP1_ENST00000380738.4_Silent_p.N493N			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	493					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)	p.N493N(1)		breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		TGCTCTCCCCGTTATGTTGTG	0.403													G|||	2	0.000399361	0.0015	0.0	5008	,	,		20605	0.0		0.0	False		,,,				2504	0.0				p.N493N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1479T	9						.	G	,	13,4393	20.2+/-43.8	0,13,2190	256.0	215.0	229.0		1479,1479	0.4	0.9	9	dbSNP_134	229	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PSIP1	NM_001128217.1,NM_033222.3	,	0,14,6489	AA,AG,GG		0.0116,0.2951,0.1076	,	493/531,493/531	15466799	14,12992	2203	4300	6503	15456799	SO:0001819	synonymous_variant	11168	exon15			AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.1479C>T	9.37:g.15466799G>A		Somatic		Capture	SOLID	Phase_I	15456799	NM_001128217	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Silent	SNP	ENST00000380733.4	37	CCDS6479.1																																																																																				0.403	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055445.1	NM_033222	
DENND4C	55667	hgsc.bcm.edu	37	9	19305499	19305499	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:19305499T>C	ENST00000380432.2	+	6	786	c.753T>C	c.(751-753)atT>atC	p.I251I	DENND4C_ENST00000602925.1_Silent_p.I487I|DENND4C_ENST00000434457.2_Silent_p.I487I			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	251	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.I251I(1)		breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TTGTTTGCATTGACTTGGATA	0.348																																					p.I251I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T753C	9						.						188.0	182.0	184.0					9																	19305499		2203	4300	6503	19295499	SO:0001819	synonymous_variant	55667	exon6			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.753T>C	9.37:g.19305499T>C		Somatic		Capture	SOLID	Phase_I	19295499	NM_017925	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Silent	SNP	ENST00000380432.2	37																																																																																					0.348	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925	
MLLT3	4300	hgsc.bcm.edu	37	9	20414280	20414280	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:20414280G>A	ENST00000380338.4	-	5	850	c.564C>T	c.(562-564)agC>agT	p.S188S	MLLT3_ENST00000429426.2_Silent_p.S185S|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	188	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S188S(1)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		TGGTActactgctgctgctgc	0.502			T	MLL	ALL																																p.S188S			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C564T	9						.						77.0	84.0	82.0					9																	20414280		2203	4300	6503	20404280	SO:0001819	synonymous_variant	4300	exon5			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.564C>T	9.37:g.20414280G>A		Somatic		Capture	SOLID	Phase_I	20404280	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																				0.502	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
CLTA	1211	hgsc.bcm.edu	37	9	36199033	36199033	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:36199033T>C	ENST00000242285.6	+	3	433	c.313T>C	c.(313-315)Tca>Cca	p.S105P	CLTA_ENST00000470744.1_Missense_Mutation_p.S105P|CLTA_ENST00000538225.1_Missense_Mutation_p.S105P|CLTA_ENST00000396603.2_Missense_Mutation_p.S105P|CLTA_ENST00000433436.2_Missense_Mutation_p.S105P|CLTA_ENST00000540080.1_Intron|CLTA_ENST00000466396.1_Intron|CLTA_ENST00000345519.5_Missense_Mutation_p.S105P			P09496	CLCA_HUMAN	clathrin, light chain A	105	Involved in binding clathrin heavy chain.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	clathrin heavy chain binding (GO:0032050)|peptide binding (GO:0042277)|structural molecule activity (GO:0005198)	p.S105P(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	6			STAD - Stomach adenocarcinoma(86;0.228)			TCGATTGCAGTCAGAGCCTGA	0.398																																					p.S105P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T313C	9						.						189.0	178.0	182.0					9																	36199033		2203	4300	6503	36189033	SO:0001583	missense	1211	exon3				CCDS6600.1, CCDS6601.1, CCDS43802.1, CCDS55306.1, CCDS55307.1	9p13.3	2010-05-11	2010-05-11		ENSG00000122705	ENSG00000122705			2090	protein-coding gene	gene with protein product		118960	"""clathrin, light polypeptide (Lca)"""			7713494	Standard	NM_007096		Approved	Lca	uc003zzc.3	P09496	OTTHUMG00000019896	ENST00000242285.6:c.313T>C	9.37:g.36199033T>C	ENSP00000242285:p.Ser105Pro	Somatic		Capture	SOLID	Phase_I	36189033	NM_001184760	A8K4W3|B4DIN1|F5H6N3|Q2XPN5|Q53XZ1	Missense_Mutation	SNP	ENST00000242285.6	37	CCDS6601.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.980656	0.74474	.	.	ENSG00000122705	ENST00000433436;ENST00000538225;ENST00000345519;ENST00000470744;ENST00000242285;ENST00000396603;ENST00000462562	.	.	.	5.75	5.75	0.90469	.	0.057216	0.64402	D	0.000002	T	0.46776	0.1410	L	0.36672	1.1	0.80722	D	1	B;P;P;P	0.40360	0.006;0.714;0.572;0.501	B;B;B;B	0.43754	0.026;0.417;0.43;0.366	T	0.44112	-0.9349	9	0.40728	T	0.16	-22.1402	10.3621	0.44001	0.0:0.0:0.1645:0.8355	.	105;105;105;105	B4DIN1;P09496-2;P09496-3;P09496	.;.;.;CLCA_HUMAN	P	105	.	ENSP00000242285:S105P	S	+	1	0	CLTA	36189033	0.982000	0.34865	1.000000	0.80357	0.997000	0.91878	1.637000	0.37155	2.320000	0.78422	0.528000	0.53228	TCA		0.398	CLTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052405.1	NM_007096	
TMC1	117531	hgsc.bcm.edu	37	9	75435836	75435836	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:75435836G>T	ENST00000297784.5	+	20	2382	c.1842G>T	c.(1840-1842)tgG>tgT	p.W614C	TMC1_ENST00000340019.3_Missense_Mutation_p.W614C|TMC1_ENST00000396237.3_Missense_Mutation_p.W614C|TMC1_ENST00000486417.1_3'UTR	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	614					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)	p.W614C(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						TCCAGTGCTGGGCCGTTATGT	0.498																																					p.W614C	Pancreas(75;173 1345 14232 34245 43413)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1842T	9						.						175.0	152.0	159.0					9																	75435836		2203	4300	6503	74625656	SO:0001583	missense	117531	exon20			AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.1842G>T	9.37:g.75435836G>T	ENSP00000297784:p.Trp614Cys	Somatic		Capture	SOLID	Phase_I	74625656	NM_138691	A8MVZ2|B1AM91	Missense_Mutation	SNP	ENST00000297784.5	37	CCDS6643.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672937	0.88445	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000542143;ENST00000396237	T;T;T	0.63417	-0.04;-0.04;-0.04	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.78027	0.4219	L	0.60957	1.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.76735	-0.2850	10	0.54805	T	0.06	-12.3497	20.2406	0.98372	0.0:0.0:1.0:0.0	.	581;581;614	A5D8Y1;A4FUA6;Q8TDI8	.;.;TMC1_HUMAN	C	614;614;581;581;608;614	ENSP00000297784:W614C;ENSP00000341433:W614C;ENSP00000379538:W614C	ENSP00000297784:W614C	W	+	3	0	TMC1	74625656	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.813000	0.99286	2.857000	0.98124	0.650000	0.86243	TGG		0.498	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1		
PTCH1	5727	hgsc.bcm.edu	37	9	98244256	98244256	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:98244256A>T	ENST00000331920.6	-	5	1020	c.721T>A	c.(721-723)Tta>Ata	p.L241I	PTCH1_ENST00000437951.1_Missense_Mutation_p.L175I|PTCH1_ENST00000375274.2_Missense_Mutation_p.L240I|PTCH1_ENST00000548379.1_5'UTR|PTCH1_ENST00000429896.2_Missense_Mutation_p.L90I|PTCH1_ENST00000421141.1_Missense_Mutation_p.L90I|PTCH1_ENST00000468211.2_Missense_Mutation_p.L175I|PTCH1_ENST00000418258.1_Missense_Mutation_p.L90I|PTCH1_ENST00000430669.2_Missense_Mutation_p.L175I	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	241					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.L241I(2)|p.L240I(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CCAGACTGTAATTTCGCCCCT	0.403																																					p.L90I												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.T268A	9						.						86.0	74.0	78.0					9																	98244256		2203	4300	6503	97284077	SO:0001583	missense	5727	exon5			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.721T>A	9.37:g.98244256A>T	ENSP00000332353:p.Leu241Ile	Somatic		Capture	SOLID	Phase_I	97284077	NM_001083605	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	A	16.59	3.164362	0.57476	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000553011;ENST00000551845;ENST00000547672;ENST00000546820;ENST00000468211;ENST00000551630	D;D;D;D;D;D;D;D;D;D;D;D;D	0.92858	-3.08;-3.08;-3.04;-3.04;-3.08;-3.04;-3.12;-2.46;-2.46;-2.46;-2.46;-2.6;-2.04	5.97	-0.104	0.13605	.	0.000000	0.85682	D	0.000000	D	0.93805	0.8019	M	0.74546	2.27	0.48762	D	0.999704	D;P;D	0.69078	0.997;0.938;0.974	D;P;P	0.63877	0.919;0.822;0.677	D	0.90990	0.4834	10	0.33940	T	0.23	-7.9205	11.2017	0.48745	0.4666:0.0:0.5334:0.0	.	175;240;241	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	I	241;175;90;90;175;90;240;90;90;90;90;175;90	ENSP00000332353:L241I;ENSP00000389744:L175I;ENSP00000399981:L90I;ENSP00000396135:L90I;ENSP00000410287:L175I;ENSP00000414823:L90I;ENSP00000364423:L240I;ENSP00000447797:L90I;ENSP00000447008:L90I;ENSP00000447878:L90I;ENSP00000448843:L90I;ENSP00000449745:L175I;ENSP00000450131:L90I	ENSP00000332353:L241I	L	-	1	2	PTCH1	97284077	1.000000	0.71417	0.854000	0.33618	0.594000	0.36715	1.672000	0.37523	-0.033000	0.13736	0.533000	0.62120	TTA		0.403	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
DBH	1621	hgsc.bcm.edu	37	9	136501745	136501745	+	Silent	SNP	C	C	T	rs570356950		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr9:136501745C>T	ENST00000393056.2	+	1	264	c.252C>T	c.(250-252)ggC>ggT	p.G84G		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	84	DOMON. {ECO:0000255|PROSITE- ProRule:PRU00246}.				behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)	p.G84G(1)		central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	TCAAGGCTGGCGTCCTGTTTG	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		17929	0.0		0.001	False		,,,				2504	0.0				p.G84G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C252T	9						.						80.0	59.0	66.0					9																	136501745		2203	4300	6503	135491566	SO:0001819	synonymous_variant	1621	exon1			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.252C>T	9.37:g.136501745C>T		Somatic		Capture	SOLID	Phase_I	135491566	NM_000787	Q5T381|Q96AG2	Silent	SNP	ENST00000393056.2	37	CCDS6977.2																																																																																				0.612	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	NM_000787	
METTL21C	196541	hgsc.bcm.edu	37	13	103338488	103338488	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:103338488C>T	ENST00000267273.6	-	4	693	c.688G>A	c.(688-690)Gac>Aac	p.D230N		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	230					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)	p.D230N(1)		breast(1)|large_intestine(3)|lung(2)|skin(1)	7						AATTCATAGTCGGTGCTGAAC	0.433																																					p.D230N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G688A	13						.						69.0	65.0	67.0					13																	103338488		2203	4300	6503	102136489	SO:0001583	missense	196541	exon4				CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.688G>A	13.37:g.103338488C>T	ENSP00000267273:p.Asp230Asn	Somatic		Capture	SOLID	Phase_I	102136489	NM_001010977		Missense_Mutation	SNP	ENST00000267273.6	37	CCDS32003.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.000631	0.93227	.	.	ENSG00000139780	ENST00000267273	T	0.08634	3.07	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.38321	0.1036	M	0.88979	2.995	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.31308	-0.9948	10	0.59425	D	0.04	-6.6016	19.7905	0.96454	0.0:1.0:0.0:0.0	.	230	Q5VZV1	MT21C_HUMAN	N	230	ENSP00000267273:D230N	ENSP00000267273:D230N	D	-	1	0	METTL21C	102136489	1.000000	0.71417	0.378000	0.26068	0.814000	0.46013	7.447000	0.80620	2.691000	0.91804	0.650000	0.86243	GAC		0.433	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977	
SACS	26278	hgsc.bcm.edu	37	13	23932552	23932552	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:23932552C>T	ENST00000382292.3	-	6	799	c.526G>A	c.(526-528)Gca>Aca	p.A176T	SACS_ENST00000382298.3_Missense_Mutation_p.A176T|SACS_ENST00000402364.1_5'UTR			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	176					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.A29T(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CTGCTTCTTGCTATTTCTTGA	0.448																																					p.A176T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G526A	13						.						167.0	162.0	163.0					13																	23932552		2203	4300	6503	22830552	SO:0001583	missense	26278	exon7			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.526G>A	13.37:g.23932552C>T	ENSP00000371729:p.Ala176Thr	Somatic		Capture	SOLID	Phase_I	22830552	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.638111|5.638111	0.96693|0.96693	.|.	.|.	ENSG00000151835|ENSG00000151835	ENST00000382292;ENST00000382298|ENST00000455470	D;D|.	0.85702|.	-2.02;-2.02|.	5.51|5.51	5.51|5.51	0.81932|0.81932	ATPase-like, ATP-binding domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77398|0.77398	0.4124|0.4124	M|M	0.75884|0.75884	2.315|2.315	0.58432|0.58432	D|D	0.999998|0.999998	P;D|.	0.53151|.	0.817;0.958|.	P;P|.	0.55055|.	0.686;0.767|.	T|T	0.76629|0.76629	-0.2889|-0.2889	10|5	0.62326|.	D|.	0.03|.	.|.	19.4157|19.4157	0.94697|0.94697	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	75;176|.	B2REB1;Q9NZJ4|.	.;SACS_HUMAN|.	T|N	176|75	ENSP00000371729:A176T;ENSP00000371735:A176T|.	ENSP00000371729:A176T|.	A|S	-|-	1|2	0|0	SACS|SACS	22830552|22830552	1.000000|1.000000	0.71417|0.71417	0.745000|0.745000	0.31077|0.31077	0.983000|0.983000	0.72400|0.72400	7.785000|7.785000	0.85724|0.85724	2.589000|2.589000	0.87451|0.87451	0.563000|0.563000	0.77884|0.77884	GCA|AGC		0.448	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
LNX2	222484	hgsc.bcm.edu	37	13	28122587	28122587	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:28122587G>A	ENST00000316334.3	-	10	2087	c.1958C>T	c.(1957-1959)gCc>gTc	p.A653V		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	653	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)	p.A653V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		CCCATTTACGGCCACAATCAT	0.433																																					p.A653V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1958T	13						.						96.0	78.0	84.0					13																	28122587		2203	4300	6503	27020587	SO:0001583	missense	222484	exon10			AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.1958C>T	13.37:g.28122587G>A	ENSP00000325929:p.Ala653Val	Somatic		Capture	SOLID	Phase_I	27020587	NM_153371	Q5W0P0|Q6ZMH2|Q96SH4	Missense_Mutation	SNP	ENST00000316334.3	37	CCDS9323.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333036	0.81801	.	.	ENSG00000139517	ENST00000316334	T	0.30182	1.54	5.98	5.98	0.97165	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.64249	0.2581	M	0.87900	2.915	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.67055	-0.5767	10	0.62326	D	0.03	.	20.4379	0.99098	0.0:0.0:1.0:0.0	.	653	Q8N448	LNX2_HUMAN	V	653	ENSP00000325929:A653V	ENSP00000325929:A653V	A	-	2	0	LNX2	27020587	1.000000	0.71417	0.934000	0.37439	0.113000	0.19764	9.869000	0.99810	2.838000	0.97847	0.585000	0.79938	GCC		0.433	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		
MTRF1	9617	hgsc.bcm.edu	37	13	41814474	41814474	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:41814474C>T	ENST00000379480.4	-	6	893	c.793G>A	c.(793-795)Gag>Aag	p.E265K	MTRF1_ENST00000430347.2_Missense_Mutation_p.E278K|MTRF1_ENST00000379477.1_Missense_Mutation_p.E265K	NM_004294.2	NP_004285.2	O75570	RF1M_HUMAN	mitochondrial translational release factor 1	265					regulation of translational termination (GO:0006449)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)	p.E265K(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(6)	14		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		AGGCCCACCTCGGGGATGCGC	0.552																																					p.E265K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G793A	13						.						125.0	108.0	114.0					13																	41814474		2203	4300	6503	40712474	SO:0001583	missense	9617	exon6			AF072934	CCDS9378.1	13q14.1-q14.3	2008-07-18			ENSG00000120662	ENSG00000120662			7469	protein-coding gene	gene with protein product	"""mitochontrial peptide chain release factor 1"""	604601				9838146, 10773675	Standard	NM_004294		Approved	RF1, MTTRF1, MGC47721	uc001uxy.3	O75570	OTTHUMG00000016790	ENST00000379480.4:c.793G>A	13.37:g.41814474C>T	ENSP00000368793:p.Glu265Lys	Somatic		Capture	SOLID	Phase_I	40712474	NM_004294	B4DG01|Q5T6Y5|Q8IUQ6	Missense_Mutation	SNP	ENST00000379480.4	37	CCDS9378.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415463	0.83449	.	.	ENSG00000120662	ENST00000379480;ENST00000379477;ENST00000430347	T;T;T	0.11495	2.77;2.77;2.77	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.12603	0.0306	N	0.12831	0.26	0.80722	D	1	D;D	0.62365	0.991;0.983	P;P	0.49953	0.627;0.532	T	0.07790	-1.0754	10	0.49607	T	0.09	-20.7415	19.9371	0.97144	0.0:1.0:0.0:0.0	.	278;265	B4DG01;O75570	.;RF1M_HUMAN	K	265;265;278	ENSP00000368793:E265K;ENSP00000368790:E265K;ENSP00000400031:E278K	ENSP00000368790:E265K	E	-	1	0	MTRF1	40712474	1.000000	0.71417	0.993000	0.49108	0.747000	0.42532	5.833000	0.69349	2.718000	0.92993	0.491000	0.48974	GAG		0.552	MTRF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044666.3	NM_004294	
AKAP11	11215	hgsc.bcm.edu	37	13	42874395	42874395	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:42874395C>T	ENST00000025301.2	+	8	1688	c.1513C>T	c.(1513-1515)Cgt>Tgt	p.R505C		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	505					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)	p.R505C(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		CTCAGTTCTTCGTACCCACCA	0.313																																					p.R505C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1513T	13						.						78.0	78.0	78.0					13																	42874395		2203	4300	6503	41772395	SO:0001583	missense	11215	exon8			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.1513C>T	13.37:g.42874395C>T	ENSP00000025301:p.Arg505Cys	Somatic		Capture	SOLID	Phase_I	41772395	NM_016248	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	C	4.856	0.159155	0.09236	.	.	ENSG00000023516	ENST00000025301	T	0.47528	0.84	5.63	2.98	0.34508	.	0.705178	0.14644	N	0.307025	T	0.24547	0.0595	N	0.08118	0	0.26443	N	0.975737	B	0.13594	0.008	B	0.06405	0.002	T	0.15954	-1.0419	10	0.59425	D	0.04	.	4.6382	0.12536	0.2278:0.5016:0.0:0.2706	.	505	Q9UKA4	AKA11_HUMAN	C	505	ENSP00000025301:R505C	ENSP00000025301:R505C	R	+	1	0	AKAP11	41772395	1.000000	0.71417	0.287000	0.24848	0.094000	0.18550	2.151000	0.42263	0.411000	0.25702	0.585000	0.79938	CGT		0.313	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
ZC3H13	23091	hgsc.bcm.edu	37	13	46542110	46542110	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:46542110G>A	ENST00000242848.4	-	15	4198	c.3850C>T	c.(3850-3852)Cga>Tga	p.R1284*	ZC3H13_ENST00000282007.3_Nonsense_Mutation_p.R1284*|ZC3H13_ENST00000378921.2_Nonsense_Mutation_p.R240*			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1284	Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R1284*(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		TGGACCTGTCGATCTGACTCT	0.408																																					p.R1284X	Esophageal Squamous(187;747 2077 11056 31291 44172)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3850T	13						.						168.0	156.0	160.0					13																	46542110		2203	4300	6503	45440111	SO:0001587	stop_gained	23091	exon15			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.3850C>T	13.37:g.46542110G>A	ENSP00000242848:p.Arg1284*	Somatic		Capture	SOLID	Phase_I	45440111	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Nonsense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	G	46	12.262329	0.99651	.	.	ENSG00000123200	ENST00000242848;ENST00000378921;ENST00000282007	.	.	.	5.18	5.18	0.71444	.	0.000000	0.48286	D	0.000187	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.0542	0.93056	0.0:0.0:1.0:0.0	.	.	.	.	X	1284;240;1284	.	ENSP00000242848:R1284X	R	-	1	2	ZC3H13	45440111	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.637000	0.67854	2.567000	0.86603	0.591000	0.81541	CGA		0.408	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
ZC3H13	23091	hgsc.bcm.edu	37	13	46559723	46559723	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:46559723G>A	ENST00000242848.4	-	10	1777	c.1429C>T	c.(1429-1431)Cgg>Tgg	p.R477W	ZC3H13_ENST00000282007.3_Missense_Mutation_p.R477W			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	477	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R477W(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		CTTGAGTCCCGCATGTCTCTG	0.527																																					p.R477W	Esophageal Squamous(187;747 2077 11056 31291 44172)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1429T	13						.						192.0	190.0	190.0					13																	46559723		2203	4300	6503	45457724	SO:0001583	missense	23091	exon10			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1429C>T	13.37:g.46559723G>A	ENSP00000242848:p.Arg477Trp	Somatic		Capture	SOLID	Phase_I	45457724	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	G	14.32	2.501462	0.44455	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	T;T	0.48836	1.74;0.8	5.82	5.82	0.92795	.	0.000000	0.56097	D	0.000040	T	0.61974	0.2390	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.63404	-0.6645	10	0.87932	D	0	.	20.099	0.97865	0.0:0.0:1.0:0.0	.	477;477	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	W	477;477;293	ENSP00000242848:R477W;ENSP00000282007:R477W	ENSP00000242848:R477W	R	-	1	2	ZC3H13	45457724	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.531000	0.60602	2.752000	0.94435	0.655000	0.94253	CGG		0.527	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
HTR2A	3356	hgsc.bcm.edu	37	13	47409038	47409038	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:47409038C>T	ENST00000378688.4	-	3	1481	c.1350G>A	c.(1348-1350)aaG>aaA	p.K450K	HTR2A_ENST00000542664.1_Silent_p.K450K|HTR2A_ENST00000543956.1_Silent_p.K366K			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	450					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.K450K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CAGAATGCTGCTTTCCTAGAG	0.448																																					p.K366K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1098A	13						.						156.0	149.0	152.0					13																	47409038		2203	4300	6503	46307039	SO:0001819	synonymous_variant	3356	exon3			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.1350G>A	13.37:g.47409038C>T		Somatic		Capture	SOLID	Phase_I	46307039	NM_001165947	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Silent	SNP	ENST00000378688.4	37	CCDS9405.1																																																																																				0.448	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621	
VPS36	51028	hgsc.bcm.edu	37	13	52991254	52991254	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:52991254C>G	ENST00000378060.4	-	12	955	c.928G>C	c.(928-930)Gtc>Ctc	p.V310L		NM_001282168.1|NM_001282169.1|NM_016075.2	NP_001269097.1|NP_001269098.1|NP_057159.2	Q86VN1	VPS36_HUMAN	vacuolar protein sorting 36 homolog (S. cerevisiae)	310					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)	p.V310L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	17		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.14e-08)		ATTACCATGACGCCACTGTCA	0.468																																					p.V310L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G928C	13						.						70.0	62.0	65.0					13																	52991254		2203	4300	6503	51889255	SO:0001583	missense	51028	exon12			AF151903	CCDS9434.1, CCDS73577.1	13q14.13	2008-02-05	2007-01-12	2005-08-02	ENSG00000136100	ENSG00000136100			20312	protein-coding gene	gene with protein product		610903	"""chromosome 13 open reading frame 9"", ""vacuolar protein sorting 36 homolog (yeast)"""	C13orf9		11278625, 15755741	Standard	NM_016075		Approved	CGI-145, Eap45	uc001vgs.3	Q86VN1	OTTHUMG00000016964	ENST00000378060.4:c.928G>C	13.37:g.52991254C>G	ENSP00000367299:p.Val310Leu	Somatic		Capture	SOLID	Phase_I	51889255	NM_016075	A8K125|Q3ZCV7|Q5H9S1|Q5VXB6|Q9H8Z5|Q9Y3E3	Missense_Mutation	SNP	ENST00000378060.4	37	CCDS9434.1	.	.	.	.	.	.	.	.	.	.	.	24.6	4.553310	0.86127	.	.	ENSG00000136100	ENST00000378060	.	.	.	5.77	4.92	0.64577	.	0.052702	0.85682	D	0.000000	T	0.44540	0.1298	L	0.27053	0.805	0.80722	D	1	P	0.41848	0.763	P	0.44623	0.455	T	0.22626	-1.0211	9	0.14656	T	0.56	-24.5231	15.3407	0.74293	0.1405:0.8595:0.0:0.0	.	310	Q86VN1	VPS36_HUMAN	L	310	.	ENSP00000367299:V310L	V	-	1	0	VPS36	51889255	1.000000	0.71417	0.989000	0.46669	0.953000	0.61014	7.452000	0.80683	1.424000	0.47217	0.561000	0.74099	GTC		0.468	VPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045059.3		
EDNRB	1910	hgsc.bcm.edu	37	13	78492289	78492289	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:78492289G>A	ENST00000334286.5	-	1	656	c.420C>T	c.(418-420)atC>atT	p.I140I	EDNRB_ENST00000475537.1_5'Flank|EDNRB_ENST00000377211.4_Silent_p.I230I|RNF219-AS1_ENST00000607862.1_RNA|EDNRB_ENST00000446573.1_Silent_p.I140I	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	140				I -> V (in Ref. 8). {ECO:0000305}.	aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)	p.I140I(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	CCAAGCTGGCGATCAAGATAT	0.507																																					p.I140I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C420T	13						.						128.0	115.0	120.0					13																	78492289		2203	4300	6503	77390290	SO:0001819	synonymous_variant	1910	exon1			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.420C>T	13.37:g.78492289G>A		Somatic		Capture	SOLID	Phase_I	77390290	NM_001122659	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Silent	SNP	ENST00000334286.5	37	CCDS9461.1																																																																																				0.507	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1		
TM9SF2	9375	hgsc.bcm.edu	37	13	100196154	100196154	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:100196154A>G	ENST00000376387.4	+	10	1245	c.1055A>G	c.(1054-1056)cAt>cGt	p.H352R		NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	352					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.H352R(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					AAACTTGTTCATGGTGATATA	0.403																																					p.H352R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1055G	13						.						151.0	149.0	150.0					13																	100196154		2203	4300	6503	98994155	SO:0001583	missense	9375	exon10			U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.1055A>G	13.37:g.100196154A>G	ENSP00000365567:p.His352Arg	Somatic		Capture	SOLID	Phase_I	98994155	NM_004800	A8K399|Q2TAY5	Missense_Mutation	SNP	ENST00000376387.4	37	CCDS9493.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.798067	0.90538	.	.	ENSG00000125304	ENST00000376387	T	0.58210	0.35	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.77445	0.4131	H	0.96720	3.87	0.80722	D	1	D;P	0.56035	0.974;0.932	P;P	0.53102	0.718;0.612	D	0.85778	0.1359	10	0.87932	D	0	-35.8448	16.3979	0.83621	1.0:0.0:0.0:0.0	.	318;352	E9PHW5;Q99805	.;TM9S2_HUMAN	R	352	ENSP00000365567:H352R	ENSP00000365567:H352R	H	+	2	0	TM9SF2	98994155	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.333000	0.79357	0.533000	0.62120	CAT		0.403	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045602.3		
ARHGEF7	8874	hgsc.bcm.edu	37	13	111953184	111953184	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr13:111953184A>T	ENST00000218789.5	+	19	2427	c.1930A>T	c.(1930-1932)Ata>Tta	p.I644L	ARHGEF7_ENST00000370623.3_Missense_Mutation_p.I670L|ARHGEF7_ENST00000375736.4_Missense_Mutation_p.I585L|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.I660L|ARHGEF7_ENST00000426073.2_Missense_Mutation_p.I585L			Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	0					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I585L(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			TCAGACAGTGATAGAAGAAAA	0.443																																					p.I585L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1753T	13						.						78.0	92.0	88.0					13																	111953184		2203	4300	6503	110751185	SO:0001583	missense	8874	exon18			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000218789.5:c.1930A>T	13.37:g.111953184A>T	ENSP00000218789:p.Ile644Leu	Somatic		Capture	SOLID	Phase_I	110751185	NM_001113513	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	ENST00000218789.5	37		.	.	.	.	.	.	.	.	.	.	A	12.39	1.923623	0.33908	.	.	ENSG00000102606	ENST00000370623;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737	T;T;T;T;T	0.51817	0.75;0.69;0.75;0.75;0.79	5.25	4.07	0.47477	.	.	.	.	.	T	0.25680	0.0625	N	0.16130	0.375	0.80722	D	1	B	0.09022	0.002	B	0.12837	0.008	T	0.10989	-1.0606	9	0.02654	T	1	.	10.8868	0.46972	0.9256:0.0:0.0744:0.0	.	660	B7Z6G2	.	L	670;644;585;585;660	ENSP00000359657:I670L;ENSP00000218789:I644L;ENSP00000364888:I585L;ENSP00000397068:I585L;ENSP00000364889:I660L	ENSP00000218789:I644L	I	+	1	0	ARHGEF7	110751185	1.000000	0.71417	0.974000	0.42286	0.978000	0.69477	2.415000	0.44635	0.821000	0.34540	0.459000	0.35465	ATA		0.443	ARHGEF7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000045805.3	NM_001113511	
BTRC	8945	hgsc.bcm.edu	37	10	103296324	103296324	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:103296324A>G	ENST00000370187.3	+	12	1609	c.1491A>G	c.(1489-1491)gcA>gcG	p.A497A	BTRC_ENST00000408038.2_Silent_p.A461A|BTRC_ENST00000393441.4_Silent_p.A456A|BTRC_ENST00000493877.1_3'UTR	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	497					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.A497A(1)		endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		AATGTGGTGCATGTTTACGAG	0.403																																					p.A461A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1383G	10						.						234.0	222.0	226.0					10																	103296324		2203	4300	6503	103286314	SO:0001819	synonymous_variant	8945	exon11			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1491A>G	10.37:g.103296324A>G		Somatic		Capture	SOLID	Phase_I	103286314	NM_003939	B5MD49|Q5W141|Q5W142|Q9Y213	Silent	SNP	ENST00000370187.3	37	CCDS7512.1																																																																																				0.403	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
KCNIP2	30819	hgsc.bcm.edu	37	10	103587144	103587144	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:103587144A>G	ENST00000356640.2	-	10	1054	c.779T>C	c.(778-780)aTg>aCg	p.M260T	KCNIP2_ENST00000353068.3_Missense_Mutation_p.M217T|KCNIP2-AS1_ENST00000412353.1_RNA|KCNIP2_ENST00000370046.1_Missense_Mutation_p.M174T|KCNIP2_ENST00000355657.2_5'UTR|KCNIP2_ENST00000358038.3_Missense_Mutation_p.M242T|KCNIP2_ENST00000348850.5_Missense_Mutation_p.M215T|KCNIP2_ENST00000461105.1_Missense_Mutation_p.M275T|KCNIP2_ENST00000343195.4_Missense_Mutation_p.M210T	NM_014591.4|NM_173191.2	NP_055406.2|NP_775283.1	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2	260	Interaction with KCND2. {ECO:0000250}.				clustering of voltage-gated potassium channels (GO:0045163)|detection of calcium ion (GO:0005513)|membrane repolarization (GO:0086009)|muscle contraction (GO:0006936)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|calcium ion binding (GO:0005509)|ER retention sequence binding (GO:0046923)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein N-terminus binding (GO:0047485)	p.M275T(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)		CATGGACCTCATGATGTTCTC	0.537																																					p.M242T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T725C	10						.						147.0	130.0	135.0					10																	103587144		2203	4300	6503	103577134	SO:0001583	missense	30819	exon9				CCDS7521.1, CCDS7522.1, CCDS7523.1, CCDS7524.1, CCDS7525.1, CCDS7526.1, CCDS41562.1	10q24.32	2013-09-20	2001-11-29		ENSG00000120049	ENSG00000120049		"""EF-hand domain containing"""	15522	protein-coding gene	gene with protein product		604661	"""Kv channel-interacting protein 2"""			10676964	Standard	NM_173192		Approved	KCHIP2	uc001kuc.3	Q9NS61	OTTHUMG00000018937	ENST00000356640.2:c.779T>C	10.37:g.103587144A>G	ENSP00000349055:p.Met260Thr	Somatic		Capture	SOLID	Phase_I	103577134	NM_173192	A6NJE5|A8MQ75|Q3YAC6|Q3YAC8|Q3YAC9|Q7Z6F1|Q96K86|Q96T41|Q96T42|Q96T43|Q96T44|Q9H0N4|Q9HD10|Q9HD11|Q9NS60|Q9NY10|Q9NZI1	Missense_Mutation	SNP	ENST00000356640.2	37	CCDS7522.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.208522	0.39003	.	.	ENSG00000120049	ENST00000348850;ENST00000358038;ENST00000359877;ENST00000370059;ENST00000356640;ENST00000370046;ENST00000434163;ENST00000353068;ENST00000461105;ENST00000343195	T;T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;1.0;-0.18;-0.18;-0.18	4.97	4.97	0.65823	EF-hand-like domain (1);	0.076555	0.85682	D	0.000000	T	0.75910	0.3914	M	0.67953	2.075	0.80722	D	1	B;D;D;D;D;P;D;P;P;P;B	0.63046	0.299;0.992;0.987;0.992;0.957;0.953;0.992;0.548;0.497;0.548;0.012	B;D;P;D;D;P;D;B;P;B;B	0.66497	0.435;0.925;0.844;0.925;0.944;0.825;0.925;0.12;0.564;0.12;0.132	T	0.78727	-0.2091	10	0.66056	D	0.02	.	15.1016	0.72284	1.0:0.0:0.0:0.0	.	204;206;209;210;242;217;275;260;191;215;167	B4DHY9;Q9NS61-5;Q3YAC7;Q9NS61-3;Q9NS61-2;Q9NS61-7;Q9NS61-6;Q9NS61;B3KSZ5;Q3YAC6;Q9NS61-8	.;.;.;.;.;.;.;KCIP2_HUMAN;.;.;.	T	215;242;191;242;260;174;167;217;275;210	ENSP00000239118:M215T;ENSP00000350733:M242T;ENSP00000349055:M260T;ENSP00000359063:M174T;ENSP00000411679:M167T;ENSP00000341624:M217T;ENSP00000420040:M275T;ENSP00000344169:M210T	ENSP00000344169:M210T	M	-	2	0	KCNIP2	103577134	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.087000	0.94110	2.216000	0.71823	0.459000	0.35465	ATG		0.537	KCNIP2-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049973.1		
PDCD11	22984	hgsc.bcm.edu	37	10	105184969	105184969	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:105184969G>A	ENST00000369797.3	+	20	3086	c.2992G>A	c.(2992-2994)Gct>Act	p.A998T		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	998					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.A998T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GGAGGGGCCGGCTGCCAAGAG	0.542																																					p.A998T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2992A	10						.						83.0	73.0	76.0					10																	105184969		2203	4300	6503	105174959	SO:0001583	missense	22984	exon20			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.2992G>A	10.37:g.105184969G>A	ENSP00000358812:p.Ala998Thr	Somatic		Capture	SOLID	Phase_I	105174959	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265701	0.59540	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.09723	2.95	5.95	5.95	0.96441	.	0.354634	0.32819	N	0.005607	T	0.10852	0.0265	L	0.29908	0.895	0.46416	D	0.999038	B	0.25351	0.124	B	0.20184	0.028	T	0.11348	-1.0591	10	0.38643	T	0.18	-9.9718	18.5524	0.91069	0.0:0.0:1.0:0.0	.	998	Q14690	RRP5_HUMAN	T	998	ENSP00000358812:A998T	ENSP00000358812:A998T	A	+	1	0	PDCD11	105174959	0.666000	0.27475	1.000000	0.80357	0.983000	0.72400	3.365000	0.52335	2.826000	0.97356	0.491000	0.48974	GCT		0.542	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
EIF3A	8661	hgsc.bcm.edu	37	10	120801576	120801576	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:120801576A>G	ENST00000369144.3	-	19	3583	c.3456T>C	c.(3454-3456)gcT>gcC	p.A1152A	EIF3A_ENST00000541549.1_Silent_p.A1118A	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)	p.A1152A(1)		endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		GATCATCATCAGCACGTCTTG	0.493																																					p.A1152A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3456C	10						.						162.0	127.0	139.0					10																	120801576		2203	4300	6503	120791566	SO:0001819	synonymous_variant	8661	exon19			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.3456T>C	10.37:g.120801576A>G		Somatic		Capture	SOLID	Phase_I	120791566	NM_003750	B7ZBG9|Q6IBN8|Q96TD5	Silent	SNP	ENST00000369144.3	37	CCDS7608.1																																																																																				0.493	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750	
DHTKD1	55526	hgsc.bcm.edu	37	10	12160774	12160774	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:12160774G>A	ENST00000263035.4	+	15	2491	c.2429G>A	c.(2428-2430)gGc>gAc	p.G810D	U6_ENST00000606801.1_RNA	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	810					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.G810D(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			TTCTGCTCCGGCAAACATTTC	0.483																																					p.G810D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2429A	10						.						148.0	160.0	156.0					10																	12160774		2203	4300	6503	12200780	SO:0001583	missense	55526	exon15			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.2429G>A	10.37:g.12160774G>A	ENSP00000263035:p.Gly810Asp	Somatic		Capture	SOLID	Phase_I	12200780	NM_018706	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	CCDS7087.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644508	0.67358	.	.	ENSG00000181192	ENST00000263035	T	0.27890	1.64	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.73908	0.3647	H	0.98866	4.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85790	0.1367	10	0.87932	D	0	-8.3847	18.7995	0.92010	0.0:0.0:1.0:0.0	.	810	Q96HY7	DHTK1_HUMAN	D	810	ENSP00000263035:G810D	ENSP00000263035:G810D	G	+	2	0	DHTKD1	12200780	1.000000	0.71417	0.994000	0.49952	0.183000	0.23260	9.411000	0.97342	2.516000	0.84829	0.448000	0.29417	GGC		0.483	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
SEC61A2	55176	hgsc.bcm.edu	37	10	12206306	12206306	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:12206306T>C	ENST00000298428.9	+	12	1373	c.1284T>C	c.(1282-1284)atT>atC	p.I428I	SEC61A2_ENST00000304267.8_Intron|SEC61A2_ENST00000495368.1_Intron|SEC61A2_ENST00000379033.3_Silent_p.I406I|SEC61A2_ENST00000379020.4_Silent_p.I362I	NM_018144.3	NP_060614.2	Q9H9S3	S61A2_HUMAN	Sec61 alpha 2 subunit (S. cerevisiae)	428					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ribosome binding (GO:0043022)	p.I428I(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Renal(717;0.228)				GTTTGTGCATTGGCGCCCTGT	0.532																																					p.I406I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1218C	10						.						67.0	63.0	64.0					10																	12206306		2203	4300	6503	12246312	SO:0001819	synonymous_variant	55176	exon11			AF346603	CCDS7088.1, CCDS44358.1, CCDS44359.1	10p14	2004-01-06			ENSG00000065665	ENSG00000065665			17702	protein-coding gene	gene with protein product							Standard	NM_018144		Approved	FLJ10578	uc001ile.2	Q9H9S3	OTTHUMG00000017679	ENST00000298428.9:c.1284T>C	10.37:g.12206306T>C		Somatic		Capture	SOLID	Phase_I	12246312	NM_001142628	A8K8D0|B4DX72|F8W773	Silent	SNP	ENST00000298428.9	37	CCDS7088.1	.	.	.	.	.	.	.	.	.	.	T	3.709	-0.059927	0.07317	.	.	ENSG00000065665	ENST00000419021	.	.	.	5.91	-11.3	0.00108	.	.	.	.	.	T	0.71854	0.3389	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.80327	-0.1429	4	.	.	.	-6.3888	23.081	0.99979	0.0:0.7053:0.0:0.2947	.	.	.	.	R	180	.	.	W	+	1	0	SEC61A2	12246312	0.000000	0.05858	0.135000	0.22099	0.524000	0.34500	-2.258000	0.01179	-2.503000	0.00509	-1.003000	0.02500	TGG		0.532	SEC61A2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046795.1	NM_018144	
EIF3A	8661	hgsc.bcm.edu	37	10	120810158	120810158	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:120810158A>G	ENST00000369144.3	-	16	2475	c.2348T>C	c.(2347-2349)tTa>tCa	p.L783S	EIF3A_ENST00000541549.1_Missense_Mutation_p.L749S	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)	p.L783S(1)		endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		TTCTTCTGCTAATCGCTCTTC	0.418																																					p.L783S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2348C	10						.						243.0	208.0	220.0					10																	120810158		2203	4300	6503	120800148	SO:0001583	missense	8661	exon16			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.2348T>C	10.37:g.120810158A>G	ENSP00000358140:p.Leu783Ser	Somatic		Capture	SOLID	Phase_I	120800148	NM_003750	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	37	CCDS7608.1	.	.	.	.	.	.	.	.	.	.	A	13.35	2.212065	0.39102	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.33438	1.41;1.41	5.57	5.57	0.84162	.	0.000000	0.30840	N	0.008775	T	0.57125	0.2032	M	0.84683	2.71	0.80722	D	1	D	0.69078	0.997	P	0.61397	0.888	T	0.63598	-0.6601	10	0.54805	T	0.06	-6.957	15.4492	0.75259	1.0:0.0:0.0:0.0	.	783	Q14152	EIF3A_HUMAN	S	783;749	ENSP00000358140:L783S;ENSP00000438178:L749S	ENSP00000358140:L783S	L	-	2	0	EIF3A	120800148	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	8.386000	0.90166	2.135000	0.66039	0.454000	0.30748	TTA		0.418	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750	
AKR1C2	1646	hgsc.bcm.edu	37	10	5045982	5045982	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:5045982T>C	ENST00000380753.4	-	1	233	c.46A>G	c.(46-48)Atg>Gtg	p.M16V	AKR1C2_ENST00000604428.1_5'Flank|U8_ENST00000459141.1_RNA|AKR1C2_ENST00000407674.1_Missense_Mutation_p.M16V|AKR1C2_ENST00000421196.3_Missense_Mutation_p.M16V|AKR1C2_ENST00000455190.1_Missense_Mutation_p.M16V	NM_205845.2	NP_995317.1	P52895	AK1C2_HUMAN	aldo-keto reductase family 1, member C2	16					cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway (GO:0007186)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|response to prostaglandin (GO:0034694)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin F receptor activity (GO:0004958)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.M16V(2)		breast(1)|large_intestine(5)|lung(3)|skin(1)	10					Ursodeoxycholic acid(DB01586)	AGGACAGGCATGAAGTGACCA	0.453																																					p.M16V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A46G	10						.						221.0	165.0	184.0					10																	5045982		2203	4300	6503	5035982	SO:0001583	missense	1646	exon2			L32592	CCDS7062.1, CCDS44350.1	10p15-p14	2014-01-29	2012-12-04		ENSG00000151632	ENSG00000151632	1.3.1.20, 1.1.1.213	"""Aldo-keto reductases"""	385	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III"""	600450	"""aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III)"", ""testicular 17,20-desmolase deficiency"""	DDH2, TDD		9716498, 21802064	Standard	NM_001354		Approved	DD, BABP, DD2, HAKRD, MCDR2	uc001iht.3	P52895	OTTHUMG00000017584	ENST00000380753.4:c.46A>G	10.37:g.5045982T>C	ENSP00000370129:p.Met16Val	Somatic		Capture	SOLID	Phase_I	5035982	NM_205845	A8K2N9|B4DKR9|Q14133|Q5SR16|Q7M4N1|Q96A71	Missense_Mutation	SNP	ENST00000380753.4	37	CCDS7062.1	.	.	.	.	.	.	.	.	.	.	T	7.677	0.688176	0.14973	.	.	ENSG00000151632	ENST00000380753;ENST00000421196;ENST00000407674;ENST00000455190	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	1.51	1.51	0.23008	NADP-dependent oxidoreductase domain (2);	0.341392	0.24683	N	0.036441	T	0.39759	0.1090	M	0.80422	2.495	0.09310	N	1	B;B;B	0.19073	0.033;0.03;0.033	B;B;B	0.17098	0.017;0.009;0.017	T	0.39121	-0.9629	10	0.51188	T	0.08	.	5.1902	0.15205	0.0:0.0:0.0:1.0	.	16;16;16	B4DKR9;B4DK69;P52895	.;.;AK1C2_HUMAN	V	16	ENSP00000370129:M16V;ENSP00000392694:M16V;ENSP00000385221:M16V;ENSP00000408440:M16V	ENSP00000370129:M16V	M	-	1	0	AKR1C2	5035982	0.988000	0.35896	0.040000	0.18447	0.089000	0.18198	2.881000	0.48538	0.963000	0.38082	0.163000	0.16589	ATG		0.453	AKR1C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046531.1	NM_001354	
FBXO18	84893	hgsc.bcm.edu	37	10	5965614	5965614	+	Missense_Mutation	SNP	A	A	G	rs556256147		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:5965614A>G	ENST00000362091.4	+	16	2468	c.2353A>G	c.(2353-2355)Att>Gtt	p.I785V	FBXO18_ENST00000379999.5_Missense_Mutation_p.I836V|FBXO18_ENST00000397269.3_Missense_Mutation_p.I272V	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	785					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)	p.I836V(1)		NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GGACAGAATCATTGATATTTG	0.408																																					p.I836V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2506G	10						.						94.0	94.0	94.0					10																	5965614		2203	4300	6503	6005620	SO:0001583	missense	84893	exon17			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2353A>G	10.37:g.5965614A>G	ENSP00000355415:p.Ile785Val	Somatic		Capture	SOLID	Phase_I	6005620	NM_032807	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.879484	0.33162	.	.	ENSG00000134452	ENST00000397269;ENST00000362091;ENST00000379999	D;D;D	0.81821	-1.54;-1.54;-1.54	5.9	4.76	0.60689	.	0.308107	0.35407	N	0.003237	T	0.62109	0.2401	N	0.19112	0.55	0.29483	N	0.856224	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.09377	0.004;0.002;0.0	T	0.50189	-0.8857	10	0.13470	T	0.59	-15.5156	5.68	0.17769	0.7712:0.0:0.0797:0.1492	.	836;785;711	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	V	272;785;836	ENSP00000380439:I272V;ENSP00000355415:I785V;ENSP00000369335:I836V	ENSP00000355415:I785V	I	+	1	0	FBXO18	6005620	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.606000	0.24194	1.059000	0.40554	0.456000	0.33151	ATT		0.408	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
ITIH5	80760	hgsc.bcm.edu	37	10	7618918	7618918	+	Silent	SNP	G	G	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:7618918G>T	ENST00000256861.6	-	10	1554	c.1476C>A	c.(1474-1476)ccC>ccA	p.P492P	ITIH5_ENST00000397146.2_Silent_p.P492P|ITIH5_ENST00000446830.2_Silent_p.P274P|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000298441.6_Silent_p.P278P|ITIH5_ENST00000397145.2_Silent_p.P492P	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	492					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P492P(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CCACTGAGCTGGGGGGATAAT	0.587																																					p.P492P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1476A	10						.						76.0	73.0	74.0					10																	7618918		2203	4300	6503	7658924	SO:0001819	synonymous_variant	80760	exon10					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1476C>A	10.37:g.7618918G>T		Somatic		Capture	SOLID	Phase_I	7658924	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37																																																																																					0.587	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
FAM171A1	221061	hgsc.bcm.edu	37	10	15296787	15296787	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:15296787C>T	ENST00000378116.4	-	4	516	c.510G>A	c.(508-510)acG>acA	p.T170T		NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	170						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T170T(3)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						AGCTGGCGGCCGTGAGAAACG	0.542																																					p.T170T												.	.	3	Substitution - coding silent(3)	lung(2)|large_intestine(1)	c.G510A	10						.						64.0	61.0	62.0					10																	15296787		2203	4300	6503	15336793	SO:0001819	synonymous_variant	221061	exon4			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.510G>A	10.37:g.15296787C>T		Somatic		Capture	SOLID	Phase_I	15336793	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	ENST00000378116.4	37	CCDS31154.1																																																																																				0.542	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
VIM	7431	hgsc.bcm.edu	37	10	17277213	17277213	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:17277213G>A	ENST00000224237.5	+	6	1199	c.1054G>A	c.(1054-1056)Gcc>Acc	p.A352T	RP11-124N14.3_ENST00000456355.1_RNA|VIM_ENST00000544301.1_Missense_Mutation_p.A352T			P08670	VIME_HUMAN	vimentin	352	Coil 2.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)	p.A352T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGAGAACTTTGCCGTTGAAGC	0.478																																					p.A352T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1054A	10						.						124.0	108.0	113.0					10																	17277213		2203	4300	6503	17317219	SO:0001583	missense	7431	exon7			M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.1054G>A	10.37:g.17277213G>A	ENSP00000224237:p.Ala352Thr	Somatic		Capture	SOLID	Phase_I	17317219	NM_003380	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	ENST00000224237.5	37	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.549459	0.65311	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533	D;D	0.89196	-2.48;-2.48	5.91	2.82	0.32997	Filament (1);	0.145914	0.31102	N	0.008248	D	0.89770	0.6811	M	0.62154	1.92	0.49915	D	0.999833	B;B;B;B	0.27166	0.17;0.071;0.08;0.087	B;B;B;B	0.40782	0.34;0.168;0.14;0.271	D	0.87457	0.2405	10	0.45353	T	0.12	.	14.6934	0.69103	0.0:0.0:0.6213:0.3787	.	352;339;352;352	Q53HU8;F5H288;B0YJC4;P08670	.;.;.;VIME_HUMAN	T	352;352;339	ENSP00000446007:A352T;ENSP00000224237:A352T	ENSP00000224237:A352T	A	+	1	0	VIM	17317219	0.971000	0.33674	0.950000	0.38849	0.992000	0.81027	0.944000	0.29043	0.784000	0.33661	0.643000	0.83706	GCC		0.478	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
NEBL	10529	hgsc.bcm.edu	37	10	21097467	21097467	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:21097467A>G	ENST00000377122.4	-	26	3129	c.2733T>C	c.(2731-2733)agT>agC	p.S911S	NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	911	Linker.				cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)	p.S911S(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTGTTACCTCACTGCAGCATG	0.428																																					p.S911S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2733C	10						.						118.0	110.0	113.0					10																	21097467		2203	4300	6503	21137473	SO:0001819	synonymous_variant	10529	exon26			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2733T>C	10.37:g.21097467A>G		Somatic		Capture	SOLID	Phase_I	21137473	NM_006393	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	ENST00000377122.4	37	CCDS7134.1																																																																																				0.428	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393	
PTCHD3	374308	hgsc.bcm.edu	37	10	27688021	27688021	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:27688021A>G	ENST00000438700.3	-	4	1623	c.1506T>C	c.(1504-1506)taT>taC	p.Y502Y		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	502	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.Y502Y(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TAATCCCTGTATATAAGGCCA	0.398																																					p.Y502Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1506C	10						.						99.0	90.0	93.0					10																	27688021		2203	4299	6502	27728027	SO:0001819	synonymous_variant	374308	exon4			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1506T>C	10.37:g.27688021A>G		Somatic		Capture	SOLID	Phase_I	27728027	NM_001034842	I3L499|Q6ZU28	Silent	SNP	ENST00000438700.3	37	CCDS31173.1																																																																																				0.398	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
BMS1	9790	hgsc.bcm.edu	37	10	43326480	43326480	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:43326480A>G	ENST00000374518.5	+	23	3848	c.3785A>G	c.(3784-3786)cAg>cGg	p.Q1262R	RNU6-885P_ENST00000516607.1_RNA	NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	1262					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.Q1262R(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTCAGAATTCAGGGGCAGAAG	0.547																																					p.Q1262R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3785G	10						.						36.0	27.0	30.0					10																	43326480		2203	4300	6503	42646486	SO:0001583	missense	9790	exon23			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.3785A>G	10.37:g.43326480A>G	ENSP00000363642:p.Gln1262Arg	Somatic		Capture	SOLID	Phase_I	42646486	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	A	6.282	0.420195	0.11928	.	.	ENSG00000165733	ENST00000374518	T	0.08282	3.11	5.16	4.03	0.46877	.	0.283792	0.31113	N	0.008230	T	0.05181	0.0138	L	0.33093	0.98	0.24853	N	0.992391	B	0.10296	0.003	B	0.06405	0.002	T	0.36817	-0.9732	10	0.16420	T	0.52	.	3.0996	0.06322	0.4394:0.0:0.1369:0.4237	.	1262	Q14692	BMS1_HUMAN	R	1262	ENSP00000363642:Q1262R	ENSP00000363642:Q1262R	Q	+	2	0	BMS1	42646486	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.190000	0.65104	1.940000	0.56252	0.379000	0.24179	CAG		0.547	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
OGDHL	55753	hgsc.bcm.edu	37	10	50958940	50958940	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:50958940T>G	ENST00000374103.4	-	7	926	c.841A>C	c.(841-843)Atc>Ctc	p.I281L	OGDHL_ENST00000432695.1_Missense_Mutation_p.I72L|OGDHL_ENST00000419399.1_Missense_Mutation_p.I224L	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	281					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.I281L(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						GATTTGTCGATGATGGTCTTG	0.572																																					p.I224L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A670C	10						.						104.0	83.0	90.0					10																	50958940		2203	4300	6503	50628946	SO:0001583	missense	55753	exon6			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.841A>C	10.37:g.50958940T>G	ENSP00000363216:p.Ile281Leu	Somatic		Capture	SOLID	Phase_I	50628946	NM_001143996	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.637141	0.87760	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	T;T;D	0.95885	2.68;2.68;-3.84	5.93	5.93	0.95920	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.95674	0.8593	L	0.48935	1.535	0.58432	D	0.999998	P;B;P	0.40376	0.668;0.077;0.715	B;B;P	0.50754	0.389;0.175;0.649	D	0.95843	0.8868	10	0.62326	D	0.03	.	16.3871	0.83514	0.0:0.0:0.0:1.0	.	224;72;281	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	L	281;224;72	ENSP00000363216:I281L;ENSP00000401356:I224L;ENSP00000390240:I72L	ENSP00000363216:I281L	I	-	1	0	OGDHL	50628946	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	6.043000	0.71004	2.265000	0.75225	0.533000	0.62120	ATC		0.572	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
CSTF2T	23283	hgsc.bcm.edu	37	10	53457715	53457715	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:53457715C>T	ENST00000331173.4	-	1	1640	c.1595G>A	c.(1594-1596)gGc>gAc	p.G532D	PRKG1_ENST00000373985.1_Intron|PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373980.4_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	532	9 X 5 AA tandem repeats of G-[AT]-G-[MI]- Q.|Gly-rich.				mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G532D(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		tccttgtatgcctgccccctg	0.557																																					p.G532D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1595A	10						.						133.0	97.0	109.0					10																	53457715		2203	4300	6503	53127721	SO:0001583	missense	23283	exon1			AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.1595G>A	10.37:g.53457715C>T	ENSP00000332444:p.Gly532Asp	Somatic		Capture	SOLID	Phase_I	53127721	NM_015235	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Missense_Mutation	SNP	ENST00000331173.4	37	CCDS7245.1	.	.	.	.	.	.	.	.	.	.	C	0.780	-0.762616	0.02996	.	.	ENSG00000177613	ENST00000331173	T	0.23147	1.92	4.64	4.64	0.57946	.	0.571814	0.16464	N	0.213291	T	0.14313	0.0346	N	0.08118	0	0.09310	N	1	B	0.32968	0.392	B	0.31686	0.134	T	0.15435	-1.0437	10	0.41790	T	0.15	-5.2643	13.221	0.59887	0.0:1.0:0.0:0.0	.	532	Q9H0L4	CSTFT_HUMAN	D	532	ENSP00000332444:G532D	ENSP00000332444:G532D	G	-	2	0	CSTF2T	53127721	0.052000	0.20516	0.023000	0.16930	0.003000	0.03518	2.499000	0.45372	2.575000	0.86900	0.561000	0.74099	GGC		0.557	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048097.1	NM_015235	
PSAP	5660	hgsc.bcm.edu	37	10	73591662	73591662	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:73591662C>T	ENST00000394936.3	-	3	337	c.190G>A	c.(190-192)Gac>Aac	p.D64N	PSAP_ENST00000394934.1_Missense_Mutation_p.D64N			P07602	SAP_HUMAN	prosaposin	64	Saposin B-type 1. {ECO:0000255|PROSITE- ProRule:PRU00415}.				blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)	p.D64N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						TTGCATATGTCGCAGGGAAGG	0.517																																					p.D64N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G190A	10						.						160.0	151.0	154.0					10																	73591662		2203	4300	6503	73261668	SO:0001583	missense	5660	exon3			BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.190G>A	10.37:g.73591662C>T	ENSP00000378394:p.Asp64Asn	Somatic		Capture	SOLID	Phase_I	73261668	NM_001042465	P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Missense_Mutation	SNP	ENST00000394936.3	37	CCDS7311.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987042	0.53934	.	.	ENSG00000197746	ENST00000394936;ENST00000373120;ENST00000357471;ENST00000394934;ENST00000394929;ENST00000404083	D;D	0.86097	-2.07;-2.07	5.2	2.27	0.28462	Saposin-like (2);Saposin-like type B, 1 (1);Saposin B (2);	0.136331	0.64402	D	0.000004	D	0.90731	0.7091	M	0.85542	2.76	0.47511	D	0.999443	D	0.76494	0.999	D	0.67382	0.951	D	0.88749	0.3249	10	0.62326	D	0.03	-2.2513	7.9912	0.30242	0.0:0.7203:0.1325:0.1471	.	64	P07602	SAP_HUMAN	N	64;64;64;64;64;67	ENSP00000378394:D64N;ENSP00000378392:D64N	ENSP00000350063:D64N	D	-	1	0	PSAP	73261668	0.993000	0.37304	0.063000	0.19743	0.395000	0.30598	3.215000	0.51169	0.275000	0.22094	0.563000	0.77884	GAC		0.517	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778	
USP54	159195	hgsc.bcm.edu	37	10	75276602	75276602	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:75276602A>G	ENST00000339859.4	-	19	3682	c.3582T>C	c.(3580-3582)gaT>gaC	p.D1194D	RP11-137L10.6_ENST00000600206.1_RNA|RP11-137L10.6_ENST00000597958.1_RNA|USP54_ENST00000394811.2_Silent_p.D282D|USP54_ENST00000497106.1_5'UTR|USP54_ENST00000422491.2_Silent_p.D376D|RP11-137L10.6_ENST00000593790.1_RNA|USP54_ENST00000428547.1_Silent_p.D1044D|RP11-137L10.6_ENST00000595069.1_RNA|USP54_ENST00000408019.1_Silent_p.D1194D			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1194					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)	p.D1194D(1)|p.D282D(1)		breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					AAAGTGGTCTATCCCCACCCT	0.517																																					p.D1194D	Colon(195;880 2046 8854 25025 38456)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T3582C	10						.						160.0	167.0	164.0					10																	75276602		2203	4300	6503	74946608	SO:0001819	synonymous_variant	159195	exon18			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.3582T>C	10.37:g.75276602A>G		Somatic		Capture	SOLID	Phase_I	74946608	NM_152586	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Silent	SNP	ENST00000339859.4	37	CCDS7329.2																																																																																				0.517	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
C10orf55	414236	hgsc.bcm.edu	37	10	75673801	75673801	+	Intron	SNP	G	G	A	rs147117027	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:75673801G>A	ENST00000409178.1	-	3	268				C10orf55_ENST00000412307.2_Intron|PLAU_ENST00000372762.4_Silent_p.T212T|PLAU_ENST00000372764.3_Silent_p.T248T|PLAU_ENST00000446342.1_Silent_p.T231T	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55									p.T248T(1)		endometrium(1)	1	Prostate(51;0.0112)					ACTCCAACACGCAAGGGGAGA	0.517													G|||	3	0.000599042	0.0023	0.0	5008	,	,		22202	0.0		0.0	False		,,,				2504	0.0				p.T248T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G744A	10						.	G	,,	2,4404	4.2+/-10.8	0,2,2201	113.0	88.0	97.0		,693,744	-10.7	0.0	10	dbSNP_134	97	0,8600		0,0,4300	no	intron,coding-synonymous,coding-synonymous	PLAU,C10orf55	NM_001001791.2,NM_001145031.1,NM_002658.3	,,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,,	,231/415,248/432	75673801	2,13004	2203	4300	6503	75343807	SO:0001627	intron_variant	5328	exon8				CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.73-968C>T	10.37:g.75673801G>A		Somatic		Capture	SOLID	Phase_I	75343807	NM_002658	Q3KRG4|Q8NAK4	Silent	SNP	ENST00000409178.1	37	CCDS53541.1																																																																																				0.517	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048746.1	NM_001001791	
VCL	7414	hgsc.bcm.edu	37	10	75854134	75854134	+	Silent	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:75854134G>A	ENST00000211998.4	+	11	1552	c.1458G>A	c.(1456-1458)ccG>ccA	p.P486P	VCL_ENST00000417648.2_Intron|VCL_ENST00000372755.3_Silent_p.P486P|VCL_ENST00000478896.2_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	486	3 X 112 AA tandem repeats.|N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.P486P(1)	VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					ACAGCAGACCGGCCAAAGCAG	0.582																																					p.P486P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1458A	10						.						64.0	53.0	57.0					10																	75854134		2203	4300	6503	75524140	SO:0001819	synonymous_variant	7414	exon11			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.1458G>A	10.37:g.75854134G>A		Somatic		Capture	SOLID	Phase_I	75524140	NM_014000	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Silent	SNP	ENST00000211998.4	37	CCDS7341.1																																																																																				0.582	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000	
DNTT	1791	hgsc.bcm.edu	37	10	98064310	98064310	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:98064310C>T	ENST00000371174.2	+	1	158	c.56C>T	c.(55-57)aCg>aTg	p.T19M	DNTT_ENST00000419175.1_Missense_Mutation_p.T19M|RP11-35J23.1_ENST00000454484.2_RNA			P04053	TDT_HUMAN	DNA nucleotidylexotransferase	19					DNA modification (GO:0006304)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA nucleotidylexotransferase activity (GO:0003912)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.T19M(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		CCCCGGCAGACGGGTGCCTTG	0.567																																					p.T19M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C56T	10						.						50.0	56.0	54.0					10																	98064310		2203	4300	6503	98054300	SO:0001583	missense	1791	exon1			AB046378	CCDS7447.1	10q23-q24	2013-05-21	2013-05-21		ENSG00000107447	ENSG00000107447	2.7.7.31	"""DNA polymerases"""	2983	protein-coding gene	gene with protein product	"""Terminal deoxynucleotidyltransferase"""	187410	"""deoxynucleotidyltransferase, terminal"""				Standard	NM_004088		Approved	TDT	uc001kmf.3	P04053	OTTHUMG00000018832	ENST00000371174.2:c.56C>T	10.37:g.98064310C>T	ENSP00000360216:p.Thr19Met	Somatic		Capture	SOLID	Phase_I	98054300	NM_004088	Q53FH1|Q5W103|Q96E50	Missense_Mutation	SNP	ENST00000371174.2	37	CCDS7447.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.454495	0.26161	.	.	ENSG00000107447	ENST00000419175;ENST00000371174	T;T	0.11712	2.75;2.75	5.76	-0.974	0.10293	.	0.613982	0.19384	N	0.115597	T	0.05090	0.0136	N	0.08118	0	0.09310	N	1	B;B	0.17268	0.021;0.012	B;B	0.12837	0.008;0.003	T	0.34254	-0.9836	10	0.38643	T	0.18	-2.9864	10.4253	0.44373	0.0:0.2216:0.0:0.7784	.	19;19	P04053-2;P04053	.;TDT_HUMAN	M	19	ENSP00000401169:T19M;ENSP00000360216:T19M	ENSP00000360216:T19M	T	+	2	0	DNTT	98054300	0.012000	0.17670	0.000000	0.03702	0.082000	0.17680	0.057000	0.14279	-0.444000	0.07170	0.655000	0.94253	ACG		0.567	DNTT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049607.1	NM_004088	
TLL2	7093	hgsc.bcm.edu	37	10	98155001	98155001	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:98155001T>C	ENST00000357947.3	-	13	1894	c.1669A>G	c.(1669-1671)Aag>Gag	p.K557E	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	557	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.K557E(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GACACAAACTTCATCCACAGT	0.483																																					p.K557E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1669G	10						.						100.0	101.0	101.0					10																	98155001		2203	4300	6503	98144991	SO:0001583	missense	7093	exon13			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1669A>G	10.37:g.98155001T>C	ENSP00000350630:p.Lys557Glu	Somatic		Capture	SOLID	Phase_I	98144991	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.989756	0.93106	.	.	ENSG00000095587	ENST00000357947	T	0.34667	1.35	5.27	5.27	0.74061	CUB (5);	0.000000	0.47852	D	0.000220	T	0.52741	0.1753	L	0.49350	1.555	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.46843	-0.9162	10	0.34782	T	0.22	.	14.5217	0.67853	0.0:0.0:0.0:1.0	.	557	Q9Y6L7	TLL2_HUMAN	E	557	ENSP00000350630:K557E	ENSP00000350630:K557E	K	-	1	0	TLL2	98144991	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.825000	0.86693	2.216000	0.71823	0.459000	0.35465	AAG		0.483	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
TUBGCP2	10844	hgsc.bcm.edu	37	10	135103444	135103444	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr10:135103444C>T	ENST00000252936.3	-	8	1283	c.1244G>A	c.(1243-1245)cGg>cAg	p.R415Q	TUBGCP2_ENST00000368563.2_Missense_Mutation_p.R415Q|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.R285Q|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.R443Q|TUBGCP2_ENST00000368562.1_Missense_Mutation_p.R8Q			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	415					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)		p.R415Q(1)		breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CCTCTCCTTCCGCAGCTCGTG	0.582																																					p.R415Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1244A	10						.						265.0	180.0	209.0					10																	135103444		2203	4300	6503	134953434	SO:0001583	missense	10844	exon9			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1244G>A	10.37:g.135103444C>T	ENSP00000252936:p.Arg415Gln	Somatic		Capture	SOLID	Phase_I	134953434	NM_006659	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	ENST00000252936.3	37	CCDS7676.1	.	.	.	.	.	.	.	.	.	.	C	5.949	0.359038	0.11239	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.28454	2.5;2.24;2.5;1.61;2.48	5.64	1.2	0.21068	.	0.053819	0.85682	D	0.000000	T	0.08133	0.0203	N	0.01464	-0.85	0.37154	D	0.902271	B;B;B	0.14012	0.008;0.009;0.003	B;B;B	0.12156	0.004;0.007;0.007	T	0.30179	-0.9987	10	0.06365	T	0.9	-37.8972	6.6516	0.22965	0.0:0.4575:0.0:0.5425	.	443;443;415	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	Q	415;285;415;8;443	ENSP00000252936:R415Q;ENSP00000395666:R285Q;ENSP00000357551:R415Q;ENSP00000357550:R8Q;ENSP00000446093:R443Q	ENSP00000252936:R415Q	R	-	2	0	TUBGCP2	134953434	1.000000	0.71417	0.998000	0.56505	0.486000	0.33341	2.625000	0.46452	0.431000	0.26258	0.655000	0.94253	CGG		0.582	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
FNIP1	96459	hgsc.bcm.edu	37	5	131008603	131008603	+	Missense_Mutation	SNP	C	C	T	rs575638728		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:131008603C>T	ENST00000510461.1	-	14	1629	c.1534G>A	c.(1534-1536)Gct>Act	p.A512T	CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307954.8_Missense_Mutation_p.A467T|FNIP1_ENST00000307968.7_Missense_Mutation_p.A484T	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	512					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.A512T(1)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		GAGCCAATAGCGCCATACAAG	0.388													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19364	0.0		0.0	False		,,,				2504	0.0				p.A512T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1534A	5						.						62.0	65.0	64.0					5																	131008603		2192	4294	6486	131036502	SO:0001583	missense	96459	exon14			DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1534G>A	5.37:g.131008603C>T	ENSP00000421985:p.Ala512Thr	Somatic		Capture	SOLID	Phase_I	131036502	NM_133372	D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747061	0.69418	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461	T;T;T	0.34667	1.35;1.35;1.35	5.88	5.88	0.94601	.	.	.	.	.	T	0.58352	0.2116	M	0.83603	2.65	0.80722	D	1	D;D;D	0.67145	0.996;0.996;0.985	P;P;P	0.54140	0.714;0.714;0.743	T	0.58411	-0.7641	9	0.39692	T	0.17	-8.106	20.2228	0.98330	0.0:1.0:0.0:0.0	.	512;484;512	A8K8V8;Q8TF40-3;Q8TF40	.;.;FNIP1_HUMAN	T	484;467;272;512	ENSP00000309266:A484T;ENSP00000310453:A467T;ENSP00000421985:A512T	ENSP00000310453:A467T	A	-	1	0	FNIP1	131036502	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	4.586000	0.60984	2.789000	0.95967	0.655000	0.94253	GCT		0.388	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
P4HA2	8974	hgsc.bcm.edu	37	5	131531144	131531144	+	Silent	SNP	G	G	T	rs144114714		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:131531144G>T	ENST00000401867.1	-	14	1969	c.1401C>A	c.(1399-1401)acC>acA	p.T467T	P4HA2_ENST00000360568.3_Silent_p.T465T|P4HA2-AS1_ENST00000417667.1_RNA|P4HA2_ENST00000379104.2_Silent_p.T467T|P4HA2_ENST00000379100.2_Silent_p.T465T|P4HA2_ENST00000166534.4_Silent_p.T467T|P4HA2_ENST00000379086.1_Silent_p.T465T			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	467	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)	p.T467T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	CAGGGAAGACGGTGGCACCAC	0.483																																					p.T465T	Esophageal Squamous(68;117 1135 17362 19256 34242)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1395A	5						.						126.0	113.0	117.0					5																	131531144		2203	4300	6503	131559043	SO:0001819	synonymous_variant	8974	exon13			U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.1401C>A	5.37:g.131531144G>T		Somatic		Capture	SOLID	Phase_I	131559043	NM_001017974	D3DQ85|D3DQ86|Q8WWN0	Silent	SNP	ENST00000401867.1	37	CCDS4151.1																																																																																				0.483	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132653.4	NM_004199	
DNAH5	1767	hgsc.bcm.edu	37	5	13737542	13737542	+	Silent	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:13737542C>T	ENST00000265104.4	-	66	11378	c.11274G>A	c.(11272-11274)aaG>aaA	p.K3758K		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3758	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K3758K(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTTCTAGTTCCTTCATCCTTC	0.378									Kartagener syndrome																												p.K3758K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G11274A	5						.						184.0	164.0	171.0					5																	13737542		2203	4300	6503	13790542	SO:0001819	synonymous_variant	1767	exon66	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11274G>A	5.37:g.13737542C>T		Somatic		Capture	SOLID	Phase_I	13790542	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																				0.378	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
IL9	3578	hgsc.bcm.edu	37	5	135228169	135228169	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:135228169T>G	ENST00000274520.1	-	5	356	c.346A>C	c.(346-348)Acc>Ccc	p.T116P		NM_000590.1	NP_000581.1	P15248	IL9_HUMAN	interleukin 9	116					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-5 biosynthetic process (GO:0045407)	extracellular space (GO:0005615)		p.T116P(1)		large_intestine(3)|lung(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCTGCCGTGGTTTGGTTGCAT	0.443																																					p.T116P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A346C	5						.						75.0	83.0	80.0					5																	135228169		2203	4300	6503	135256068	SO:0001583	missense	3578	exon5			S63356	CCDS4189.1	5q31-q35	2008-07-18			ENSG00000145839	ENSG00000145839		"""Interleukins and interleukin receptors"""	6029	protein-coding gene	gene with protein product	"""p40 T-cell and mast cell growth factor"", ""T-cell growth factor p40"", ""p40 cytokine"", ""homolog of mouse T cell and mast cell growth factor 40"""	146931				8379467	Standard	NM_000590		Approved	IL-9, HP40, P40	uc003lbb.1	P15248	OTTHUMG00000129147	ENST00000274520.1:c.346A>C	5.37:g.135228169T>G	ENSP00000274520:p.Thr116Pro	Somatic		Capture	SOLID	Phase_I	135256068	NM_000590		Missense_Mutation	SNP	ENST00000274520.1	37	CCDS4189.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.214678	0.79352	.	.	ENSG00000145839	ENST00000274520	T	0.49720	0.77	5.48	3.07	0.35406	.	0.362471	0.23879	N	0.043665	T	0.60104	0.2243	M	0.63843	1.955	0.20074	N	0.999938	D	0.76494	0.999	D	0.73708	0.981	T	0.50634	-0.8805	10	0.66056	D	0.02	-18.4896	7.112	0.25396	0.0:0.1799:0.0:0.8201	.	116	P15248	IL9_HUMAN	P	116	ENSP00000274520:T116P	ENSP00000274520:T116P	T	-	1	0	IL9	135256068	0.084000	0.21492	0.408000	0.26446	0.786000	0.44442	0.547000	0.23299	0.381000	0.24851	0.533000	0.62120	ACC		0.443	IL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251210.1	NM_000590	
PCDHB1	29930	hgsc.bcm.edu	37	5	140431991	140431991	+	Silent	SNP	T	T	C			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:140431991T>C	ENST00000306549.3	+	1	1013	c.936T>C	c.(934-936)atT>atC	p.I312I		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	312	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I312I(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTGAAGCCATTGAAACATACG	0.463																																					p.I312I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T936C	5						.						110.0	107.0	108.0					5																	140431991		2203	4300	6503	140412175	SO:0001819	synonymous_variant	29930	exon1			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.936T>C	5.37:g.140431991T>C		Somatic		Capture	SOLID	Phase_I	140412175	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	37	CCDS4243.1																																																																																				0.463	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
ARHGAP26	23092	hgsc.bcm.edu	37	5	142586942	142586942	+	Missense_Mutation	SNP	A	A	G	rs562055157	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:142586942A>G	ENST00000274498.4	+	21	2546	c.2168A>G	c.(2167-2169)cAt>cGt	p.H723R	ARHGAP26_ENST00000378004.3_Intron|ARHGAP26_ENST00000486650.1_Intron	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	723					actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.H723R(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCTCTCTTCATGCAGTGTTC	0.517													A|||	3	0.000599042	0.0	0.0	5008	,	,		20709	0.0		0.0	False		,,,				2504	0.0031				p.H723R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2168G	5						.						178.0	137.0	151.0					5																	142586942		2203	4300	6503	142567135	SO:0001583	missense	23092	exon21			AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.2168A>G	5.37:g.142586942A>G	ENSP00000274498:p.His723Arg	Somatic		Capture	SOLID	Phase_I	142567135	NM_015071	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	37	CCDS4277.1	.	.	.	.	.	.	.	.	.	.	A	13.29	2.192628	0.38707	.	.	ENSG00000145819	ENST00000274498	T	0.07688	3.17	6.17	6.17	0.99709	Src homology-3 domain (1);	0.571392	0.18224	N	0.147786	T	0.04770	0.0129	N	0.08118	0	0.80722	D	1	B	0.26445	0.149	B	0.20955	0.032	T	0.50734	-0.8793	10	0.14656	T	0.56	.	13.214	0.59844	1.0:0.0:0.0:0.0	.	723	Q9UNA1	RHG26_HUMAN	R	723	ENSP00000274498:H723R	ENSP00000274498:H723R	H	+	2	0	ARHGAP26	142567135	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.708000	0.47152	2.371000	0.80710	0.533000	0.62120	CAT		0.517	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	
PDE6A	5145	hgsc.bcm.edu	37	5	149247666	149247666	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:149247666G>A	ENST00000255266.5	-	18	2310	c.2191C>T	c.(2191-2193)Cag>Tag	p.Q731*		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	731					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.Q731*(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	ACCTGGCTCTGCACCTCCCAG	0.582																																					p.Q731X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2191T	5						.						151.0	130.0	137.0					5																	149247666		2203	4300	6503	149227859	SO:0001587	stop_gained	5145	exon18				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.2191C>T	5.37:g.149247666G>A	ENSP00000255266:p.Gln731*	Somatic		Capture	SOLID	Phase_I	149227859	NM_000440	Q0P638	Nonsense_Mutation	SNP	ENST00000255266.5	37	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	G	42	9.608429	0.99219	.	.	ENSG00000132915	ENST00000255266	.	.	.	5.32	5.32	0.75619	.	0.259107	0.38548	N	0.001648	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.8707	0.86040	0.0:0.0:1.0:0.0	.	.	.	.	X	731	.	ENSP00000255266:Q731X	Q	-	1	0	PDE6A	149227859	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	8.828000	0.92047	2.655000	0.90218	0.462000	0.41574	CAG		0.582	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2		
GRIA1	2890	hgsc.bcm.edu	37	5	153078521	153078521	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:153078521C>T	ENST00000285900.5	+	10	1683	c.1340C>T	c.(1339-1341)gCc>gTc	p.A447V	GRIA1_ENST00000448073.4_Missense_Mutation_p.A457V|GRIA1_ENST00000521843.2_Missense_Mutation_p.A378V|GRIA1_ENST00000340592.5_Missense_Mutation_p.A447V|GRIA1_ENST00000518783.1_Missense_Mutation_p.A457V|GRIA1_ENST00000518142.1_Missense_Mutation_p.A367V	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	447					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.A447V(1)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GCAGAGATTGCCAAGCACGTG	0.537																																					p.A447V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1340T	5						.						114.0	101.0	106.0					5																	153078521		2203	4300	6503	153058714	SO:0001583	missense	2890	exon10				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1340C>T	5.37:g.153078521C>T	ENSP00000285900:p.Ala447Val	Somatic		Capture	SOLID	Phase_I	153058714	NM_001114183	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	C	35	5.488198	0.96323	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;D;T;T;T;D	0.81908	1.05;1.05;-1.55;1.05;1.05;1.05;-1.55	5.44	5.44	0.79542	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.92632	0.7659	M	0.93016	3.37	0.80722	D	1	P;P;D;P;P;P	0.62365	0.693;0.693;0.991;0.693;0.644;0.825	B;B;P;B;B;P	0.61533	0.361;0.361;0.89;0.361;0.246;0.58	D	0.94190	0.7440	10	0.87932	D	0	.	18.2393	0.89961	0.0:1.0:0.0:0.0	.	457;457;367;457;447;447	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	V	447;447;367;401;447;378;378;457;457	ENSP00000285900:A447V;ENSP00000427920:A367V;ENSP00000339343:A447V;ENSP00000427864:A378V;ENSP00000442108:A378V;ENSP00000428994:A457V;ENSP00000415569:A457V	ENSP00000285900:A447V	A	+	2	0	GRIA1	153058714	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.642000	0.83385	2.548000	0.85928	0.655000	0.94253	GCC		0.537	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
ADCY2	108	hgsc.bcm.edu	37	5	7695919	7695919	+	Silent	SNP	G	G	A	rs192786032		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:7695919G>A	ENST00000338316.4	+	6	1013	c.924G>A	c.(922-924)ccG>ccA	p.P308P	ADCY2_ENST00000537121.1_Silent_p.P128P	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	308					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.P308P(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						ACTGCTCCCCGGGAGAACTAG	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		14445	0.0		0.001	False		,,,				2504	0.0				p.P308P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G924A	5						.						104.0	95.0	98.0					5																	7695919		2203	4300	6503	7748919	SO:0001819	synonymous_variant	108	exon6			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.924G>A	5.37:g.7695919G>A		Somatic		Capture	SOLID	Phase_I	7748919	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																				0.438	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
CDH12	1010	hgsc.bcm.edu	37	5	21975425	21975425	+	Missense_Mutation	SNP	C	C	T	rs556552265		TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:21975425C>T	ENST00000382254.1	-	6	1387	c.301G>A	c.(301-303)Gtt>Att	p.V101I	CDH12_ENST00000522262.1_Missense_Mutation_p.V101I|CDH12_ENST00000504376.2_Missense_Mutation_p.V101I	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	101	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V101I(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						ATGGTAAAAACGGTGCCAGCG	0.488										HNSCC(59;0.17)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		16207	0.0		0.0	False		,,,				2504	0.0				p.V101I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G301A	5						.						61.0	63.0	62.0					5																	21975425		2036	3858	5894	22011182	SO:0001583	missense	1010	exon6			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.301G>A	5.37:g.21975425C>T	ENSP00000371689:p.Val101Ile	Somatic		Capture	SOLID	Phase_I	22011182	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	C	2.265	-0.368414	0.05069	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.50548	0.74;0.74;0.74	5.16	4.28	0.50868	Cadherin (5);Cadherin-like (1);	0.110368	0.64402	D	0.000007	T	0.17152	0.0412	N	0.01817	-0.705	0.38784	D	0.954826	B;B	0.10296	0.0;0.003	B;B	0.11329	0.006;0.002	T	0.24728	-1.0152	10	0.02654	T	1	.	9.4669	0.38817	0.0:0.8414:0.0:0.1586	.	101;101	B7Z2U6;P55289	.;CAD12_HUMAN	I	101	ENSP00000423577:V101I;ENSP00000371689:V101I;ENSP00000428786:V101I	ENSP00000371689:V101I	V	-	1	0	CDH12	22011182	0.996000	0.38824	0.991000	0.47740	0.623000	0.37688	3.047000	0.49854	2.414000	0.81942	0.484000	0.47621	GTT		0.488	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
ADAMTS12	81792	hgsc.bcm.edu	37	5	33596123	33596123	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:33596123C>A	ENST00000504830.1	-	17	2905	c.2570G>T	c.(2569-2571)gGg>gTg	p.G857V	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.G772V	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	857	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G857V(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TTTCACCATCCCGCGGCCCTT	0.512										HNSCC(64;0.19)																											p.G857V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2570T	5						.						187.0	164.0	172.0					5																	33596123		2203	4300	6503	33631880	SO:0001583	missense	81792	exon17			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2570G>T	5.37:g.33596123C>A	ENSP00000422554:p.Gly857Val	Somatic		Capture	SOLID	Phase_I	33631880	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946950	0.92593	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.61392	0.14;0.11	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.77558	0.4148	M	0.77616	2.38	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.87578	0.998;0.978	T	0.72636	-0.4233	10	0.30078	T	0.28	.	20.3559	0.98840	0.0:1.0:0.0:0.0	.	772;857	P58397-3;P58397	.;ATS12_HUMAN	V	857;772	ENSP00000422554:G857V;ENSP00000344847:G772V	ENSP00000344847:G772V	G	-	2	0	ADAMTS12	33631880	1.000000	0.71417	0.858000	0.33744	0.972000	0.66771	6.999000	0.76283	2.890000	0.99128	0.585000	0.79938	GGG		0.512	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
DNAJC21	134218	hgsc.bcm.edu	37	5	34937649	34937649	+	Silent	SNP	G	G	A	rs77480286	byFrequency	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:34937649G>A	ENST00000342382.4	+	5	884	c.657G>A	c.(655-657)gcG>gcA	p.A219A	DNAJC21_ENST00000382021.2_Silent_p.A219A|DNAJC21_ENST00000303525.7_Silent_p.A219A			Q5F1R6	DJC21_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 21	219					protein folding (GO:0006457)	ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A219A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			GAGTGCAGGCGCATCGAAAAC	0.478													G|||	41	0.0081869	0.0303	0.0014	5008	,	,		18843	0.0		0.0	False		,,,				2504	0.0				p.A219A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G657A	5						.	G	,	68,4338	61.1+/-98.1	1,66,2136	77.0	85.0	82.0		657,657	-11.1	0.0	5	dbSNP_132	82	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	DNAJC21	NM_001012339.2,NM_194283.3	,	1,68,6434	AA,AG,GG		0.0233,1.5433,0.5382	,	219/532,219/577	34937649	70,12936	2203	4300	6503	34973406	SO:0001819	synonymous_variant	134218	exon5				CCDS3907.2, CCDS34144.1	5p13-p12	2012-10-05			ENSG00000168724	ENSG00000168724		"""Heat shock proteins / DNAJ (HSP40)"""	27030	protein-coding gene	gene with protein product	"""JJJ1 DnaJ domain protein homolog (S. cerevisiae)"""					15067379	Standard	XM_005248250		Approved	GS3, DNAJA5, JJJ1	uc003jjc.3	Q5F1R6	OTTHUMG00000074103	ENST00000342382.4:c.657G>A	5.37:g.34937649G>A		Somatic		Capture	SOLID	Phase_I	34973406	NM_194283	Q3B7J9|Q6P086|Q6ZS43|Q86VC6	Silent	SNP	ENST00000342382.4	37	CCDS34144.1																																																																																				0.478	DNAJC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157337.1	NM_194283	
DEPDC1B	55789	hgsc.bcm.edu	37	5	59934715	59934715	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:59934715G>A	ENST00000265036.5	-	7	827	c.760C>T	c.(760-762)Ccc>Tcc	p.P254S	DEPDC1B_ENST00000545085.1_Missense_Mutation_p.P227S|DEPDC1B_ENST00000453022.2_Missense_Mutation_p.P254S	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	254	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.P254S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				GAACAGTTGGGCCCTATTTTC	0.358																																					p.P254S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C760T	5						.						74.0	76.0	75.0					5																	59934715		2203	4297	6500	59970472	SO:0001583	missense	55789	exon7			AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.760C>T	5.37:g.59934715G>A	ENSP00000265036:p.Pro254Ser	Somatic		Capture	SOLID	Phase_I	59970472	NM_018369	A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Missense_Mutation	SNP	ENST00000265036.5	37	CCDS3977.1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.897065	0.72639	.	.	ENSG00000035499	ENST00000265036;ENST00000453022;ENST00000545085	T;T;T	0.33216	1.42;1.42;1.42	5.62	4.76	0.60689	Rho GTPase-activating protein domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.61664	0.2365	M	0.88842	2.985	0.58432	D	0.999999	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.95	T	0.69573	-0.5109	9	.	.	.	-4.439	14.6372	0.68699	0.0699:0.0:0.9301:0.0	.	254;254	B4DUT4;Q8WUY9	.;DEP1B_HUMAN	S	254;254;227	ENSP00000265036:P254S;ENSP00000389101:P254S;ENSP00000438320:P227S	.	P	-	1	0	DEPDC1B	59970472	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	8.625000	0.90965	1.372000	0.46190	0.650000	0.86243	CCC		0.358	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1	NM_018369	
PPWD1	23398	hgsc.bcm.edu	37	5	64878979	64878979	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:64878979C>T	ENST00000261308.5	+	8	1537	c.1465C>T	c.(1465-1467)Cga>Tga	p.R489*	PPWD1_ENST00000535264.1_Nonsense_Mutation_p.R459*|PPWD1_ENST00000538977.1_Nonsense_Mutation_p.R333*	NM_015342.3	NP_056157.1	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat containing 1	489					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.R489*(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	19		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		AGGACCTAAACGAGTTTCGGA	0.398																																					p.R489X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1465T	5						.						176.0	166.0	170.0					5																	64878979		2203	4300	6503	64914735	SO:0001587	stop_gained	23398	exon8			AK025679	CCDS3985.1, CCDS64161.1, CCDS64162.1	5q12.3	2013-01-09			ENSG00000113593	ENSG00000113593		"""WD repeat domain containing"""	28954	protein-coding gene	gene with protein product						7584044	Standard	NM_015342		Approved	KIAA0073	uc003jtv.5	Q96BP3	OTTHUMG00000131226	ENST00000261308.5:c.1465C>T	5.37:g.64878979C>T	ENSP00000261308:p.Arg489*	Somatic		Capture	SOLID	Phase_I	64914735	NM_015342	B4DWR9|Q15002|Q7KZ89	Nonsense_Mutation	SNP	ENST00000261308.5	37	CCDS3985.1	.	.	.	.	.	.	.	.	.	.	C	37	6.099175	0.97281	.	.	ENSG00000113593	ENST00000261308;ENST00000535264;ENST00000538977	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7987	0.78433	0.1442:0.8558:0.0:0.0	.	.	.	.	X	489;459;333	.	ENSP00000261308:R489X	R	+	1	2	PPWD1	64914735	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.170000	0.50816	2.754000	0.94517	0.655000	0.94253	CGA		0.398	PPWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253970.2	NM_015342	
CD180	4064	hgsc.bcm.edu	37	5	66479308	66479308	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:66479308A>G	ENST00000256447.4	-	3	1520	c.1363T>C	c.(1363-1365)Tgc>Cgc	p.C455R	CTD-2306M10.1_ENST00000602471.1_lincRNA	NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	455					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.C455R(1)		cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		TCAAGGAAGCAGTAAGTGAGA	0.448																																					p.C455R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1363C	5						.						152.0	158.0	156.0					5																	66479308		2203	4300	6503	66515064	SO:0001583	missense	4064	exon3			D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.1363T>C	5.37:g.66479308A>G	ENSP00000256447:p.Cys455Arg	Somatic		Capture	SOLID	Phase_I	66515064	NM_005582	B2R7Z7|Q32MM5	Missense_Mutation	SNP	ENST00000256447.4	37	CCDS3992.1	.	.	.	.	.	.	.	.	.	.	A	13.85	2.360732	0.41801	.	.	ENSG00000134061	ENST00000256447	T	0.26810	1.71	5.0	3.81	0.43845	.	0.174692	0.39274	N	0.001405	T	0.36082	0.0954	M	0.83118	2.625	0.22947	N	0.998524	D	0.60160	0.987	P	0.46543	0.52	T	0.37957	-0.9683	10	0.72032	D	0.01	.	9.5145	0.39098	0.7195:0.0:0.0:0.2805	.	455	Q99467	CD180_HUMAN	R	455	ENSP00000256447:C455R	ENSP00000256447:C455R	C	-	1	0	CD180	66515064	0.398000	0.25279	0.963000	0.40424	0.931000	0.56810	2.009000	0.40903	0.893000	0.36288	0.460000	0.39030	TGC		0.448	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253973.2	NM_005582	
CCDC125	202243	hgsc.bcm.edu	37	5	68595874	68595874	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:68595874C>T	ENST00000396496.2	-	8	888	c.781G>A	c.(781-783)Gat>Aat	p.D261N	CCDC125_ENST00000396499.1_Missense_Mutation_p.D261N|CCDC125_ENST00000383374.2_Missense_Mutation_p.D260N|CCDC125_ENST00000511257.1_Missense_Mutation_p.D136N|CCDC125_ENST00000460090.1_5'UTR			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	261						cytoplasm (GO:0005737)		p.D261N(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		CCACTTTTATCACAGCACATG	0.453																																					p.D261N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G781A	5						.						288.0	259.0	269.0					5																	68595874		2203	4300	6503	68631630	SO:0001583	missense	202243	exon7			AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.781G>A	5.37:g.68595874C>T	ENSP00000379754:p.Asp261Asn	Somatic		Capture	SOLID	Phase_I	68631630	NM_176816	Q86Z19	Missense_Mutation	SNP	ENST00000396496.2	37	CCDS4000.1	.	.	.	.	.	.	.	.	.	.	C	4.938	0.174181	0.09391	.	.	ENSG00000183323	ENST00000396496;ENST00000396499;ENST00000383374;ENST00000511257	T;T;T	0.42513	1.01;1.01;0.97	4.15	-1.21	0.09524	.	1.367000	0.05001	N	0.469117	T	0.25195	0.0612	N	0.25380	0.74	0.09310	N	1	B;B	0.29037	0.001;0.231	B;B	0.28232	0.003;0.087	T	0.12708	-1.0537	10	0.11794	T	0.64	-26.068	4.3022	0.10930	0.0:0.2098:0.3425:0.4477	.	136;261	Q86Z20-2;Q86Z20	.;CC125_HUMAN	N	261;261;260;136	ENSP00000379754:D261N;ENSP00000379756:D261N;ENSP00000372865:D260N	ENSP00000372865:D260N	D	-	1	0	CCDC125	68631630	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.866000	0.27954	-0.250000	0.09555	-0.229000	0.12294	GAT		0.453	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254027.4	NM_176816	
VCAN	1462	hgsc.bcm.edu	37	5	82833949	82833949	+	Silent	SNP	A	A	G			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:82833949A>G	ENST00000265077.3	+	8	5692	c.5127A>G	c.(5125-5127)acA>acG	p.T1709T	VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000343200.5_Silent_p.T722T|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1709	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.T1709T(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TAAGTGAAACAGACACTTCTG	0.418																																					p.T722T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2166G	5						.						84.0	85.0	85.0					5																	82833949		2203	4300	6503	82869705	SO:0001819	synonymous_variant	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5127A>G	5.37:g.82833949A>G		Somatic		Capture	SOLID	Phase_I	82869705	NM_001164097	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																				0.418	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
CCNH	902	hgsc.bcm.edu	37	5	86708551	86708551	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:86708551T>A	ENST00000256897.4	-	1	285	c.61A>T	c.(61-63)Aga>Tga	p.R21*	CCNH_ENST00000504878.1_De_novo_Start_OutOfFrame|CCNH_ENST00000508855.1_5'Flank|CCNH_ENST00000513499.1_5'UTR	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	21					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)	p.R21*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		GCCCGCAGTCTTGCCAGCTGC	0.562								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																													p.R21X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A61T	5						.						94.0	71.0	79.0					5																	86708551		2203	4300	6503	86744307	SO:0001587	stop_gained	902	exon1			U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.61A>T	5.37:g.86708551T>A	ENSP00000256897:p.Arg21*	Somatic		Capture	SOLID	Phase_I	86744307	NM_001239	Q53X72|Q8TBL9	Nonsense_Mutation	SNP	ENST00000256897.4	37	CCDS4064.1	.	.	.	.	.	.	.	.	.	.	T	37	6.444989	0.97572	.	.	ENSG00000134480	ENST00000256897	.	.	.	5.54	0.653	0.17828	.	0.193110	0.46442	D	0.000286	.	.	.	.	.	.	0.33944	D	0.643557	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-3.7287	4.2413	0.10648	0.1277:0.2231:0.5257:0.1236	.	.	.	.	X	21	.	ENSP00000256897:R21X	R	-	1	2	CCNH	86744307	0.979000	0.34478	0.000000	0.03702	0.743000	0.42351	2.670000	0.46833	-0.060000	0.13132	-0.213000	0.12676	AGA		0.562	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239291.3	NM_001239	
FAM172A	83989	hgsc.bcm.edu	37	5	93388915	93388915	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:93388915C>A	ENST00000395965.3	-	3	266	c.124G>T	c.(124-126)Gat>Tat	p.D42Y	FAM172A_ENST00000509163.1_5'UTR|FAM172A_ENST00000504768.2_5'UTR|FAM172A_ENST00000509739.1_5'UTR|FAM172A_ENST00000505869.1_5'UTR	NM_032042.5	NP_114431.2	Q8WUF8	F172A_HUMAN	family with sequence similarity 172, member A	42						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)		p.D42Y(1)		endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9						TCATCCAAATCTATCCTAGAT	0.254																																					p.D42Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G124T	5						.						48.0	53.0	52.0					5																	93388915		2199	4280	6479	93414671	SO:0001583	missense	83989	exon3				CCDS4069.1, CCDS54879.1, CCDS54880.1	5q15	2008-06-16	2008-06-16	2008-06-16	ENSG00000113391	ENSG00000113391			25365	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 21"""	C5orf21		11230166	Standard	NM_032042		Approved	DKFZP564D172	uc010jbd.3	Q8WUF8	OTTHUMG00000131329	ENST00000395965.3:c.124G>T	5.37:g.93388915C>A	ENSP00000379294:p.Asp42Tyr	Somatic		Capture	SOLID	Phase_I	93414671	NM_032042	B2R7C6|B4DJ14|B4DLG5|Q9H0U8	Missense_Mutation	SNP	ENST00000395965.3	37	CCDS4069.1	.	.	.	.	.	.	.	.	.	.	C	19.39	3.817846	0.71028	.	.	ENSG00000113391	ENST00000395965	T	0.53857	0.6	5.76	4.89	0.63831	.	0.096323	0.64402	D	0.000002	T	0.61476	0.2350	L	0.56769	1.78	0.80722	D	1	D;D	0.67145	0.994;0.996	P;D	0.65874	0.87;0.939	T	0.61262	-0.7098	10	0.05721	T	0.95	-29.2957	13.2865	0.60245	0.0:0.9231:0.0:0.0769	.	42;42	Q8WUF8;Q8WUF8-2	F172A_HUMAN;.	Y	42	ENSP00000379294:D42Y	ENSP00000379294:D42Y	D	-	1	0	FAM172A	93414671	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.368000	0.66133	1.438000	0.47492	0.655000	0.94253	GAT		0.254	FAM172A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254100.3	NM_032042	
TTC37	9652	hgsc.bcm.edu	37	5	94872781	94872781	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:94872781A>T	ENST00000358746.2	-	9	906	c.608T>A	c.(607-609)gTa>gAa	p.V203E		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	203						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)		p.V203E(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						CCTATAAAGTACTTGGTGATC	0.299																																					p.V203E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T608A	5						.						67.0	70.0	69.0					5																	94872781		2200	4298	6498	94898537	SO:0001583	missense	9652	exon9			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.608T>A	5.37:g.94872781A>T	ENSP00000351596:p.Val203Glu	Somatic		Capture	SOLID	Phase_I	94898537	NM_014639	O15077|Q6PJI3	Missense_Mutation	SNP	ENST00000358746.2	37	CCDS4072.1	.	.	.	.	.	.	.	.	.	.	A	0.151	-1.091171	0.01858	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	T;T	0.75589	-0.95;0.03	5.6	-0.00913	0.14002	.	0.825388	0.11127	N	0.596850	T	0.52208	0.1720	L	0.36672	1.1	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.09377	0.004;0.002	T	0.37430	-0.9706	10	0.02654	T	1	.	1.5809	0.02634	0.5035:0.1012:0.1332:0.2622	.	155;203	D6RCE2;Q6PGP7	.;TTC37_HUMAN	E	203;155	ENSP00000351596:V203E;ENSP00000423742:V155E	ENSP00000351596:V203E	V	-	2	0	TTC37	94898537	0.000000	0.05858	0.003000	0.11579	0.446000	0.32137	0.301000	0.19174	0.046000	0.15833	0.520000	0.50463	GTA		0.299	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639	
CANX	821	hgsc.bcm.edu	37	5	179147487	179147487	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00R-01A-01W-A005-10	TCGA-AA-A00R-10A-01W-A005-10	g.chr5:179147487C>T	ENST00000247461.4	+	10	1308	c.1108C>T	c.(1108-1110)Cag>Tag	p.Q370*	CANX_ENST00000504734.1_Nonsense_Mutation_p.Q370*|CANX_ENST00000452673.2_Nonsense_Mutation_p.Q370*|CANX_ENST00000512607.2_Nonsense_Mutation_p.Q262*|CANX_ENST00000415618.2_Nonsense_Mutation_p.Q405*	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	370	4 X approximate repeats.|P domain (Extended arm). {ECO:0000250}.				aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)	p.Q370*(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	TGGTGTCTGGCAGCGACCTGT	0.488																																					p.Q370X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1108T	5						.						163.0	150.0	155.0					5																	179147487		2203	4300	6503	179080093	SO:0001587	stop_gained	821	exon10			L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.1108C>T	5.37:g.179147487C>T	ENSP00000247461:p.Gln370*	Somatic		Capture	SOLID	Phase_I	179080093	NM_001024649	B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Nonsense_Mutation	SNP	ENST00000247461.4	37	CCDS4447.1	.	.	.	.	.	.	.	.	.	.	C	36	5.875491	0.97055	.	.	ENSG00000127022	ENST00000504734;ENST00000415618;ENST00000452673;ENST00000247461;ENST00000502673;ENST00000512607;ENST00000376953	.	.	.	5.77	5.77	0.91146	.	0.098590	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.7711	19.9727	0.97289	0.0:1.0:0.0:0.0	.	.	.	.	X	370;405;370;370;306;262;306	.	ENSP00000247461:Q370X	Q	+	1	0	CANX	179080093	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.259000	0.43259	2.723000	0.93209	0.650000	0.86243	CAG		0.488	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253500.2	NM_001024649	
