#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTCL1	23255	hgsc.bcm.edu	37	18	8825393	8825394	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr18:8825393_8825394insG	ENST00000306329.11	+	13	4842_4843	c.4842_4843insG	c.(4843-4845)tgcfs	p.C1615fs	SOGA2_ENST00000518815.1_Frame_Shift_Ins_p.C621fs|SOGA2_ENST00000400050.3_Frame_Shift_Ins_p.C1255fs|SOGA2_ENST00000306285.7_Frame_Shift_Ins_p.C621fs|SOGA2_ENST00000517570.1_Frame_Shift_Ins_p.C1255fs|SOGA2_ENST00000359865.3_Frame_Shift_Ins_p.C1296fs														p.C1296fs*37(1)									GGAATGCCATCTGCTCCGGCCC	0.589																																					p.I1295fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3885_3886insG	18						.																																			8815394	SO:0001589	frameshift_variant	23255	exon15																														Exception_encountered	18.37:g.8825393_8825394insG	ENSP00000305027:p.Cys1615fs	Somatic		Capture	SOLID	Phase_I	8815393	NM_015210		Frame_Shift_Ins	INS	ENST00000306329.11	37																																																																																					0.589	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
EPHB4	2050	hgsc.bcm.edu	37	7	100402934	100402934	+	Silent	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr7:100402934G>A	ENST00000358173.3	-	16	3156	c.2688C>T	c.(2686-2688)caC>caT	p.H896H	EPHB4_ENST00000360620.3_Intron	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	896	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.H896H(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCAGGAGAGGGTGTGAGGCCC	0.617																																					p.H896H	GBM(200;2113 3072 25865 52728)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2688T	7						.						27.0	28.0	28.0					7																	100402934		2203	4300	6503	100240870	SO:0001819	synonymous_variant	2050	exon16			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2688C>T	7.37:g.100402934G>A		Somatic		Capture	SOLID	Phase_I	100240870	NM_004444	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	37	CCDS5706.1																																																																																				0.617	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
AEBP1	165	hgsc.bcm.edu	37	7	44153614	44153614	+	Silent	SNP	C	C	G	rs61736256	byFrequency	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr7:44153614C>G	ENST00000223357.3	+	21	3536	c.3231C>G	c.(3229-3231)ggC>ggG	p.G1077G	AEBP1_ENST00000450684.2_Silent_p.G652G	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	1077	Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.G1077G(1)		NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CCACCGCTGGCTGGGAGGAGT	0.642													C|||	229	0.0457268	0.0023	0.0303	5008	,	,		12773	0.0248		0.0308	False		,,,				2504	0.1524				p.G1077G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3231G	7						.	C		37,4369	39.2+/-71.8	1,35,2167	71.0	70.0	71.0		3231	4.4	1.0	7	dbSNP_129	71	448,8152	134.9+/-192.2	14,420,3866	no	coding-synonymous	AEBP1	NM_001129.3		15,455,6033	GG,GC,CC		5.2093,0.8398,3.729		1077/1159	44153614	485,12521	2203	4300	6503	44120139	SO:0001819	synonymous_variant	165	exon21			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.3231C>G	7.37:g.44153614C>G		Somatic		Capture	SOLID	Phase_I	44120139	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Silent	SNP	ENST00000223357.3	37	CCDS5476.1																																																																																				0.642	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
LRGUK	136332	hgsc.bcm.edu	37	7	133859313	133859313	+	Silent	SNP	T	T	C			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr7:133859313T>C	ENST00000285928.2	+	8	1014	c.945T>C	c.(943-945)gcT>gcC	p.A315A		NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing	315						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)	p.A315A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						AACAGATTGCTGAGCTGAGAG	0.318																																					p.A315A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T945C	7						.						54.0	63.0	60.0					7																	133859313		2202	4296	6498	133509853	SO:0001819	synonymous_variant	136332	exon8			AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.945T>C	7.37:g.133859313T>C		Somatic		Capture	SOLID	Phase_I	133509853	NM_144648	Q2M3I1	Silent	SNP	ENST00000285928.2	37	CCDS5830.1																																																																																				0.318	LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339442.1	NM_144648	
UQCC1	55245	hgsc.bcm.edu	37	20	33934982	33934982	+	Silent	SNP	G	G	A	rs370826751		TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr20:33934982G>A	ENST00000374385.5	-	7	735	c.558C>T	c.(556-558)cgC>cgT	p.R186R	UQCC1_ENST00000374377.5_Silent_p.R74R|UQCC1_ENST00000349714.5_Silent_p.R159R|UQCC1_ENST00000374384.2_Silent_p.R186R|UQCC1_ENST00000359226.2_Intron|UQCC1_ENST00000397554.1_Silent_p.R186R|UQCC1_ENST00000374380.2_Silent_p.R118R|UQCC1_ENST00000491125.1_5'UTR|UQCC1_ENST00000407996.2_Intron|UQCC1_ENST00000397556.3_Silent_p.R87R|UQCC1_ENST00000540457.1_Silent_p.R31R|UQCC1_ENST00000542501.1_Missense_Mutation_p.R143W	NM_018244.4	NP_060714.3	Q9NVA1	UQCC1_HUMAN	ubiquinol-cytochrome c reductase complex assembly factor 1	186						cytoplasmic membrane-bounded vesicle (GO:0016023)|mitochondrion (GO:0005739)		p.R186R(1)									TGACTCTGCCGCGCTGCTGAA	0.488																																					p.R186R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C558T	20						.	G	,,	2,4404	4.2+/-10.8	0,2,2201	218.0	190.0	200.0		354,558,558	-0.8	1.0	20		200	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	UQCC	NM_001184977.1,NM_018244.4,NM_199487.2	,,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,,	118/232,186/300,186/274	33934982	2,13004	2203	4300	6503	33398396	SO:0001819	synonymous_variant	55245	exon7			AK001712	CCDS13252.1, CCDS13253.1, CCDS13253.2, CCDS54458.1	20q11.22	2013-09-20	2013-09-20	2013-09-20	ENSG00000101019	ENSG00000101019		"""Mitochondrial respiratory chain complex assembly factors"""	15891	protein-coding gene	gene with protein product	"""Basic FGF-repressed Zic-binding protein"", ""cytochrome B protein synthesis 3 homolog (S. cerevisiae)"""	611797	"""chromosome 20 open reading frame 44"", ""ubiquinol-cytochrome c reductase complex chaperone"""	C20orf44, UQCC			Standard	NM_018244		Approved	FLJ10850, CBP3, BFZB	uc002xcd.3	Q9NVA1	OTTHUMG00000032335	ENST00000374385.5:c.558C>T	20.37:g.33934982G>A		Somatic		Capture	SOLID	Phase_I	33398396	NM_018244	B1AKV5|Q0VF37|Q5T348|Q5T351|Q5T353|Q86YU3|Q86YU4|Q96H66|Q9H438|Q9H452|Q9H9K8|Q9H9R5	Silent	SNP	ENST00000374385.5	37	CCDS13252.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.946967	0.34377	4.54E-4	0.0	ENSG00000101019	ENST00000542501	T	0.36878	1.23	4.41	-0.768	0.11013	.	0.000000	0.85682	D	0.000000	T	0.34948	0.0915	.	.	.	0.25900	N	0.983364	.	.	.	.	.	.	T	0.31364	-0.9946	7	0.87932	D	0	-0.1057	7.5069	0.27551	0.7352:0.1215:0.1433:0.0	.	.	.	.	W	143	ENSP00000445059:R143W	ENSP00000445059:R143W	R	-	1	2	UQCC	33398396	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	1.848000	0.39309	-0.227000	0.09884	-1.421000	0.01109	CGG		0.488	UQCC1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078866.1	NM_018244	
SLC2A10	81031	hgsc.bcm.edu	37	20	45354500	45354500	+	Silent	SNP	G	G	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr20:45354500G>T	ENST00000359271.2	+	2	1075	c.825G>T	c.(823-825)ggG>ggT	p.G275G		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	275					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)	p.G275G(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				CCTCTGTGGGGCTTGGCGCAG	0.642																																					p.G275G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G825T	20						.						106.0	99.0	101.0					20																	45354500		2203	4300	6503	44787907	SO:0001819	synonymous_variant	81031	exon2			AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.825G>T	20.37:g.45354500G>T		Somatic		Capture	SOLID	Phase_I	44787907	NM_030777	A8K4J6|Q3MIX5|Q9H4I6	Silent	SNP	ENST00000359271.2	37	CCDS13402.1																																																																																				0.642	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2		
CDH24	64403	hgsc.bcm.edu	37	14	23524795	23524795	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr14:23524795G>A	ENST00000267383.5	-	1	240	c.148C>T	c.(148-150)Cag>Tag	p.Q50*	CDH24_ENST00000487137.2_Nonsense_Mutation_p.Q50*|CDH24_ENST00000397359.3_Nonsense_Mutation_p.Q50*|CDH24_ENST00000554034.1_Nonsense_Mutation_p.Q50*			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	50	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)	p.Q50*(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		ACAAAGAACTGGTTCCAGACC	0.617											OREG0022594	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q50X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C148T	14						.						72.0	65.0	67.0					14																	23524795		2203	4300	6503	22594635	SO:0001587	stop_gained	64403	exon2			AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.148C>T	14.37:g.23524795G>A	ENSP00000267383:p.Gln50*	Somatic	764	Capture	SOLID	Phase_I	22594635	NM_022478	D3DS44|Q86UP1|Q9NT84	Nonsense_Mutation	SNP	ENST00000267383.5	37	CCDS9585.1	.	.	.	.	.	.	.	.	.	.	G	34	5.400300	0.96030	.	.	ENSG00000139880	ENST00000397359;ENST00000487137;ENST00000422751;ENST00000554034;ENST00000267383	.	.	.	4.06	3.16	0.36331	.	0.000000	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	10.9993	0.47596	0.0947:0.0:0.9053:0.0	.	.	.	.	X	50	.	ENSP00000267383:Q50X	Q	-	1	0	CDH24	22594635	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.263000	0.95617	1.074000	0.40909	0.455000	0.32223	CAG		0.617	CDH24-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257241.2	NM_022478	
NIN	51199	hgsc.bcm.edu	37	14	51233572	51233572	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr14:51233572C>T	ENST00000382041.3	-	13	1661	c.1471G>A	c.(1471-1473)Gca>Aca	p.A491T	NIN_ENST00000453196.1_Missense_Mutation_p.A491T|NIN_ENST00000389868.3_Missense_Mutation_p.A491T|NIN_ENST00000324330.9_Missense_Mutation_p.A491T|NIN_ENST00000245441.5_Missense_Mutation_p.A491T|NIN_ENST00000530997.2_Missense_Mutation_p.A491T|NIN_ENST00000382043.4_Missense_Mutation_p.A491T	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	491					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)	p.A497T(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					AACTTCTCTGCATTTTCTAGA	0.348			T	PDGFRB	MPD																																p.A491T			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1471A	14						.						163.0	156.0	158.0					14																	51233572		2203	4298	6501	50303322	SO:0001583	missense	51199	exon13			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.1471G>A	14.37:g.51233572C>T	ENSP00000371472:p.Ala491Thr	Somatic		Capture	SOLID	Phase_I	50303322	NM_182944	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	37	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822949	0.50739	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	T;T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99;1.99	5.83	4.93	0.64822	.	0.329814	0.36268	N	0.002681	T	0.26085	0.0636	L	0.40543	1.245	0.28015	N	0.934734	B;P;P;B;D	0.59767	0.323;0.831;0.89;0.028;0.986	B;B;P;B;P	0.58520	0.19;0.31;0.503;0.012;0.84	T	0.05632	-1.0873	10	0.12103	T	0.63	-8.0383	9.3597	0.38188	0.141:0.7858:0.0:0.0732	.	497;491;491;491;491	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	T	491;491;491;491;497;491;491;491	ENSP00000245441:A491T;ENSP00000374518:A491T;ENSP00000371474:A491T;ENSP00000371472:A491T;ENSP00000324210:A491T;ENSP00000412391:A491T	ENSP00000245441:A491T	A	-	1	0	NIN	50303322	0.981000	0.34729	1.000000	0.80357	0.989000	0.77384	1.479000	0.35453	2.759000	0.94783	0.650000	0.86243	GCA		0.348	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
ZNF254	9534	hgsc.bcm.edu	37	19	24309389	24309389	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr19:24309389A>G	ENST00000357002.4	+	4	702	c.587A>G	c.(586-588)cAt>cGt	p.H196R	ZNF254_ENST00000342944.6_Missense_Mutation_p.H111R	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	196					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H196R(1)					all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				ATGCTTTCACATAAAACCCAA	0.294																																					p.H196R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A587G	19						.						58.0	65.0	63.0					19																	24309389		2203	4291	6494	24101229	SO:0001583	missense	9534	exon4			AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.587A>G	19.37:g.24309389A>G	ENSP00000349494:p.His196Arg	Somatic		Capture	SOLID	Phase_I	24101229	NM_203282	A4QPC0|Q86XL7	Missense_Mutation	SNP	ENST00000357002.4	37	CCDS32983.1	.	.	.	.	.	.	.	.	.	.	A	1.775	-0.483364	0.04383	.	.	ENSG00000213096	ENST00000342944;ENST00000357002;ENST00000392281	T;T	0.42513	0.97;0.97	0.926	0.926	0.19430	.	.	.	.	.	T	0.38401	0.1039	M	0.78916	2.43	0.09310	N	1	B	0.22480	0.07	B	0.22880	0.042	T	0.37407	-0.9707	9	0.35671	T	0.21	.	2.9279	0.05789	0.5981:0.0:0.0:0.4019	.	196	O75437	ZN254_HUMAN	R	111;196;196	ENSP00000445527:H111R;ENSP00000349494:H196R	ENSP00000445527:H111R	H	+	2	0	ZNF254	24101229	0.000000	0.05858	0.122000	0.21767	0.127000	0.20565	-3.974000	0.00322	0.263000	0.21812	0.260000	0.18958	CAT		0.294	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466453.1	NM_004876	
HNRNPUL1	11100	hgsc.bcm.edu	37	19	41807468	41807468	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr19:41807468C>T	ENST00000392006.3	+	11	1719	c.1546C>T	c.(1546-1548)Cga>Tga	p.R516*	HNRNPUL1_ENST00000602130.1_Nonsense_Mutation_p.R516*|HNRNPUL1_ENST00000378215.4_Nonsense_Mutation_p.R402*|HNRNPUL1_ENST00000595018.1_Nonsense_Mutation_p.R416*|HNRNPUL1_ENST00000352456.3_Nonsense_Mutation_p.R416*|HNRNPUL1_ENST00000263367.3_Nonsense_Mutation_p.R427*|HNRNPUL1_ENST00000593587.1_Nonsense_Mutation_p.R416*	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	516	Necessary for interaction with BRD7 and transcriptional activation.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R516*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						AGCCCAGAGACGAAAAATGAG	0.438																																					p.R416X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1246T	19						.						138.0	127.0	130.0					19																	41807468		2203	4300	6503	46499308	SO:0001587	stop_gained	11100	exon11			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1546C>T	19.37:g.41807468C>T	ENSP00000375863:p.Arg516*	Somatic		Capture	SOLID	Phase_I	46499308	NM_144732	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Nonsense_Mutation	SNP	ENST00000392006.3	37	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	C	39	7.710932	0.98447	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	.	.	.	6.06	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.4764	11.3788	0.49743	0.142:0.7213:0.1367:0.0	.	.	.	.	X	416;516;402;427	.	ENSP00000263367:R427X	R	+	1	2	HNRNPUL1	46499308	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.236000	0.51336	1.563000	0.49615	0.650000	0.86243	CGA		0.438	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
PSG4	5672	hgsc.bcm.edu	37	19	43698637	43698637	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr19:43698637C>A	ENST00000405312.3	-	5	1335	c.1098G>T	c.(1096-1098)tgG>tgT	p.W366C	PSG4_ENST00000244295.9_Missense_Mutation_p.W273C|PSG4_ENST00000433626.2_Missense_Mutation_p.W273C	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	366	Ig-like C2-type 3.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)		p.W366C(1)|p.W273C(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				CATTAATTGTCCAAGAATATT	0.458																																					p.W366C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1098T	19						.						182.0	188.0	186.0					19																	43698637		2202	4295	6497	48390477	SO:0001583	missense	5672	exon5				CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.1098G>T	19.37:g.43698637C>A	ENSP00000384770:p.Trp366Cys	Somatic		Capture	SOLID	Phase_I	48390477	NM_002780	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Missense_Mutation	SNP	ENST00000405312.3	37	CCDS46093.1	.	.	.	.	.	.	.	.	.	.	c	9.621	1.133924	0.21123	.	.	ENSG00000243137	ENST00000244295;ENST00000405312;ENST00000433626	T;T;T	0.39997	1.05;1.05;1.05	1.4	1.4	0.22301	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74921	0.3780	H	0.99197	4.465	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.61637	-0.7022	9	0.87932	D	0	.	6.1537	0.20326	0.0:1.0:0.0:0.0	.	273;273;366	E7EX79;Q00888-2;Q00888	.;.;PSG4_HUMAN	C	273;366;273	ENSP00000244295:W273C;ENSP00000384770:W366C;ENSP00000387864:W273C	ENSP00000244295:W273C	W	-	3	0	PSG4	48390477	0.002000	0.14202	0.005000	0.12908	0.003000	0.03518	1.449000	0.35123	0.740000	0.32651	0.447000	0.29281	TGG		0.458	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633	
ASAH1	427	hgsc.bcm.edu	37	8	17921992	17921992	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr8:17921992G>A	ENST00000262097.6	-	6	742	c.431C>T	c.(430-432)aCt>aTt	p.T144I	ASAH1_ENST00000314146.10_Missense_Mutation_p.T138I|ASAH1_ENST00000417108.2_Intron|ASAH1_ENST00000381733.4_Missense_Mutation_p.T160I|ASAH1_ENST00000520781.1_Intron	NM_177924.3	NP_808592.2	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase (acid ceramidase) 1	144					cell death (GO:0008219)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lung development (GO:0030324)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|ceramidase activity (GO:0017040)	p.T160I(1)|p.T144I(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		TACTATTGAAGTACAAATGGT	0.318																																					p.T160I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C479T	8						.						40.0	37.0	38.0					8																	17921992		2202	4299	6501	17966272	SO:0001583	missense	427	exon6			U70063	CCDS6005.1, CCDS6006.1, CCDS47813.1	8p22	2007-03-27	2002-09-11	2002-09-13	ENSG00000104763	ENSG00000104763			735	protein-coding gene	gene with protein product		613468	"""N-acylsphingosine amidohydrolase (acid ceramidase)"""	ASAH		8955159, 10610716	Standard	NM_004315		Approved	AC, PHP32, FLJ21558	uc003wyn.2	Q13510	OTTHUMG00000096997	ENST00000262097.6:c.431C>T	8.37:g.17921992G>A	ENSP00000262097:p.Thr144Ile	Somatic		Capture	SOLID	Phase_I	17966272	NM_004315	E9PDS0|Q6W898|Q96AS2	Missense_Mutation	SNP	ENST00000262097.6	37	CCDS6006.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252033	0.59212	.	.	ENSG00000104763	ENST00000262097;ENST00000381733;ENST00000314146	D;D;D	0.91295	-2.82;-2.82;-2.82	5.56	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.96377	0.8818	M	0.94021	3.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97315	0.9940	10	0.87932	D	0	-6.2791	14.4761	0.67546	0.0715:0.0:0.9285:0.0	.	138;160;144	E9PDS0;Q13510-2;Q13510	.;.;ASAH1_HUMAN	I	144;160;138	ENSP00000262097:T144I;ENSP00000371152:T160I;ENSP00000326970:T138I	ENSP00000262097:T144I	T	-	2	0	ASAH1	17966272	1.000000	0.71417	0.999000	0.59377	0.250000	0.25880	8.771000	0.91751	1.493000	0.48517	0.655000	0.94253	ACT		0.318	ASAH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214077.2	NM_004315	
TMEM51	55092	hgsc.bcm.edu	37	1	15541763	15541763	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr1:15541763C>G	ENST00000428417.1	+	2	626	c.180C>G	c.(178-180)agC>agG	p.S60R	TMEM51_ENST00000400796.3_Missense_Mutation_p.S60R|TMEM51_ENST00000376014.3_Missense_Mutation_p.S60R|TMEM51_ENST00000434578.2_Missense_Mutation_p.S60R|TMEM51_ENST00000376008.2_Missense_Mutation_p.S60R	NM_001136217.1	NP_001129689.1	Q9NW97	TMM51_HUMAN	transmembrane protein 51	60						integral component of membrane (GO:0016021)		p.S60R(1)		breast(1)|central_nervous_system(1)|cervix(3)|large_intestine(2)|lung(5)|prostate(2)	14		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)		TCCTCAAGAGCAAGACCTTCT	0.612																																					p.S60R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C180G	1						.						146.0	141.0	142.0					1																	15541763		2203	4300	6503	15414350	SO:0001583	missense	55092	exon3			AK098467	CCDS154.1	1p36.21	2008-02-05	2005-05-22	2005-05-22	ENSG00000171729	ENSG00000171729			25488	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 72"""	C1orf72		12477932	Standard	NM_018022		Approved	FLJ10199	uc001avx.3	Q9NW97	OTTHUMG00000002046	ENST00000428417.1:c.180C>G	1.37:g.15541763C>G	ENSP00000394899:p.Ser60Arg	Somatic		Capture	SOLID	Phase_I	15414350	NM_001136216	A8K819	Missense_Mutation	SNP	ENST00000428417.1	37	CCDS154.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372215	0.82573	.	.	ENSG00000171729	ENST00000428417;ENST00000376014;ENST00000451326;ENST00000434578;ENST00000400796;ENST00000376008;ENST00000303840	T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42	5.43	4.52	0.55395	.	0.202607	0.64402	D	0.000011	T	0.39545	0.1082	L	0.59436	1.845	0.47949	D	0.999556	P;P	0.49090	0.919;0.919	P;P	0.48704	0.587;0.51	T	0.34428	-0.9829	10	0.72032	D	0.01	-3.3358	13.4184	0.60982	0.0:0.9241:0.0:0.0759	.	60;60	Q9BSA0;Q9NW97	.;TMM51_HUMAN	R	60	ENSP00000394899:S60R;ENSP00000365182:S60R;ENSP00000412298:S60R;ENSP00000409665:S60R;ENSP00000383600:S60R;ENSP00000365176:S60R	ENSP00000303666:S60R	S	+	3	2	TMEM51	15414350	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.288000	0.43514	1.305000	0.44909	0.655000	0.94253	AGC		0.612	TMEM51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005699.3	NM_018022	
FBXO42	54455	hgsc.bcm.edu	37	1	16577707	16577707	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr1:16577707G>A	ENST00000375592.3	-	10	1828	c.1612C>T	c.(1612-1614)Cat>Tat	p.H538Y		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	538								p.H538Y(1)		autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		GGTGGGGTATGCACACCATTT	0.577																																					p.H538Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1612T	1						.						101.0	72.0	82.0					1																	16577707		2203	4300	6503	16450294	SO:0001583	missense	54455	exon10			BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.1612C>T	1.37:g.16577707G>A	ENSP00000364742:p.His538Tyr	Somatic		Capture	SOLID	Phase_I	16450294	NM_018994	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Missense_Mutation	SNP	ENST00000375592.3	37	CCDS30613.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226547	0.79576	.	.	ENSG00000037637	ENST00000375592;ENST00000456164;ENST00000444116	T;T;T	0.62788	3.49;-0.0;-0.0	5.51	5.51	0.81932	.	0.105878	0.64402	D	0.000002	T	0.65059	0.2655	N	0.24115	0.695	0.80722	D	1	D	0.57899	0.981	D	0.65140	0.932	T	0.56529	-0.7964	10	0.10636	T	0.68	-15.7388	18.7669	0.91876	0.0:0.0:1.0:0.0	.	538	Q6P3S6	FBX42_HUMAN	Y	538;256;256	ENSP00000364742:H538Y;ENSP00000415663:H256Y;ENSP00000412416:H256Y	ENSP00000364742:H538Y	H	-	1	0	FBXO42	16450294	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.874000	0.92363	2.763000	0.94921	0.650000	0.86243	CAT		0.577	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006285.1		
SSR2	6746	hgsc.bcm.edu	37	1	155984777	155984777	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr1:155984777A>G	ENST00000295702.4	-	4	409	c.338T>C	c.(337-339)cTg>cCg	p.L113P	SSR2_ENST00000529008.1_Intron|SSR2_ENST00000480567.1_Missense_Mutation_p.L113P|SSR2_ENST00000496742.1_Intron	NM_003145.3	NP_003136.1	P43308	SSRB_HUMAN	signal sequence receptor, beta (translocon-associated protein beta)	113					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.L113P(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|stomach(1)	10	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTCCTGGGCCAGGTAAGTAAT	0.517																																					p.L113P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T338C	1						.						89.0	81.0	84.0					1																	155984777		2203	4300	6503	154251401	SO:0001583	missense	6746	exon4			BC000341	CCDS1126.1	1q21-q23	2008-02-05			ENSG00000163479	ENSG00000163479			11324	protein-coding gene	gene with protein product		600867				7789174	Standard	NM_003145		Approved	TLAP, TRAPB	uc001fmx.3	P43308	OTTHUMG00000017456	ENST00000295702.4:c.338T>C	1.37:g.155984777A>G	ENSP00000295702:p.Leu113Pro	Somatic		Capture	SOLID	Phase_I	154251401	NM_003145	B2R9K9|D3DVA7|Q53HI0|Q5VY95|Q5VY96|Q6IB31|Q9BWE4	Missense_Mutation	SNP	ENST00000295702.4	37	CCDS1126.1	.	.	.	.	.	.	.	.	.	.	A	17.32	3.359364	0.61403	.	.	ENSG00000163479	ENST00000295702;ENST00000480567;ENST00000531917	.	.	.	5.15	4.03	0.46877	.	0.076830	0.53938	D	0.000053	T	0.41903	0.1179	L	0.53249	1.67	0.80722	D	1	D;P	0.56287	0.975;0.937	P;P	0.51974	0.686;0.462	T	0.34551	-0.9824	9	0.37606	T	0.19	-6.8574	8.922	0.35617	0.9121:0.0:0.0879:0.0	.	134;113	Q6MZE4;P43308	.;SSRB_HUMAN	P	113	.	ENSP00000295702:L113P	L	-	2	0	SSR2	154251401	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	8.483000	0.90442	0.991000	0.38814	0.260000	0.18958	CTG		0.517	SSR2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046172.2	NM_003145	
LAMC1	3915	hgsc.bcm.edu	37	1	183101659	183101659	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr1:183101659G>A	ENST00000258341.4	+	21	3948	c.3691G>A	c.(3691-3693)Gag>Aag	p.E1231K		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	1231	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.E1231K(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						TGAGATTGAAGAGCTTAATAG	0.403																																					p.E1231K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3691A	1						.						130.0	120.0	123.0					1																	183101659		2203	4300	6503	181368282	SO:0001583	missense	3915	exon21			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.3691G>A	1.37:g.183101659G>A	ENSP00000258341:p.Glu1231Lys	Somatic		Capture	SOLID	Phase_I	181368282	NM_002293	Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	37	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.994040	0.54041	.	.	ENSG00000135862	ENST00000258341	T	0.32753	1.44	5.42	4.51	0.55191	.	0.146062	0.64402	D	0.000013	T	0.31734	0.0806	M	0.68317	2.08	0.58432	D	0.999999	B	0.18741	0.03	B	0.15870	0.014	T	0.09662	-1.0664	10	0.18710	T	0.47	.	14.0883	0.64973	0.0733:0.0:0.9267:0.0	.	1231	P11047	LAMC1_HUMAN	K	1231	ENSP00000258341:E1231K	ENSP00000258341:E1231K	E	+	1	0	LAMC1	181368282	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.074000	0.64401	1.301000	0.44836	-0.222000	0.12452	GAG		0.403	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
LAMC2	3918	hgsc.bcm.edu	37	1	183196726	183196726	+	Silent	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr1:183196726C>T	ENST00000264144.4	+	10	1427	c.1362C>T	c.(1360-1362)caC>caT	p.H454H	LAMC2_ENST00000493293.1_Silent_p.H454H	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	454	Laminin EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)	p.H454H(1)		breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						ACGATCCGCACGACCCCCGCA	0.567																																					p.H454H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1362T	1						.						132.0	124.0	127.0					1																	183196726		2203	4300	6503	181463349	SO:0001819	synonymous_variant	3918	exon10			Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.1362C>T	1.37:g.183196726C>T		Somatic		Capture	SOLID	Phase_I	181463349	NM_018891	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Silent	SNP	ENST00000264144.4	37	CCDS1352.1																																																																																				0.567	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1	NM_005562	
MFSD4	148808	hgsc.bcm.edu	37	1	205549033	205549033	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr1:205549033C>T	ENST00000367147.4	+	2	478	c.385C>T	c.(385-387)Cag>Tag	p.Q129*	MFSD4_ENST00000536357.1_Nonsense_Mutation_p.Q129*|MFSD4_ENST00000539267.1_Nonsense_Mutation_p.Q129*	NM_181644.4	NP_857595.3	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing 4	129					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.Q129*(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			GGCCAACATGCAGCTGGTAAG	0.652																																					p.Q129X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C385T	1						.						91.0	74.0	79.0					1																	205549033		2203	4300	6503	203815656	SO:0001587	stop_gained	148808	exon2			BC036549	CCDS1455.1	1q32.1	2008-02-05			ENSG00000174514	ENSG00000174514			25433	protein-coding gene	gene with protein product							Standard	NM_181644		Approved	DKFZp761N1114, FLJ34577, UNQ3064, FLJ25004	uc001hcv.4	Q8N468	OTTHUMG00000037197	ENST00000367147.4:c.385C>T	1.37:g.205549033C>T	ENSP00000356115:p.Gln129*	Somatic		Capture	SOLID	Phase_I	203815656	NM_181644	B7Z8X3|Q6UY25|Q8NAY0|Q8TCP4	Nonsense_Mutation	SNP	ENST00000367147.4	37	CCDS1455.1	.	.	.	.	.	.	.	.	.	.	C	34	5.376988	0.95945	.	.	ENSG00000174514	ENST00000367147;ENST00000539267;ENST00000536357	.	.	.	3.9	3.9	0.45041	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-20.6944	14.6542	0.68820	0.0:1.0:0.0:0.0	.	.	.	.	X	129	.	ENSP00000356115:Q129X	Q	+	1	0	MFSD4	203815656	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.278000	0.78587	2.029000	0.59856	0.549000	0.68633	CAG		0.652	MFSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090391.1	NM_181644	
USH2A	7399	hgsc.bcm.edu	37	1	216246251	216246251	+	Missense_Mutation	SNP	C	C	T	rs193921072		TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr1:216246251C>T	ENST00000307340.3	-	29	6223	c.5837G>A	c.(5836-5838)cGa>cAa	p.R1946Q	RP11-22M7.2_ENST00000446411.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.R1946Q|RP11-22M7.2_ENST00000445619.1_RNA|RP11-22M7.2_ENST00000430890.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1946	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.R1946Q(2)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGTACGTCCTCGACTCCAATC	0.363										HNSCC(13;0.011)																											p.R1946Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G5837A	1						.						149.0	124.0	132.0					1																	216246251		2203	4300	6503	214312874	SO:0001583	missense	7399	exon29			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5837G>A	1.37:g.216246251C>T	ENSP00000305941:p.Arg1946Gln	Somatic		Capture	SOLID	Phase_I	214312874	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614196	0.87359	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.39229	1.09;1.09	5.8	4.89	0.63831	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.41938	D	0.000781	T	0.56688	0.2002	M	0.68317	2.08	0.44309	D	0.997182	D	0.89917	1.0	D	0.69142	0.962	T	0.55075	-0.8197	10	0.12766	T	0.61	.	12.3658	0.55228	0.0:0.8617:0.0:0.1383	.	1946	O75445	USH2A_HUMAN	Q	1946	ENSP00000305941:R1946Q;ENSP00000355910:R1946Q	ENSP00000305941:R1946Q	R	-	2	0	USH2A	214312874	0.176000	0.23096	1.000000	0.80357	0.953000	0.61014	0.552000	0.23376	1.448000	0.47680	0.650000	0.86243	CGA		0.363	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
RUNX3	864	hgsc.bcm.edu	37	1	25245742	25245742	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr1:25245742C>T	ENST00000308873.6	-	3	541	c.533G>A	c.(532-534)cGg>cAg	p.R178Q	RUNX3_ENST00000496967.1_5'UTR|RUNX3_ENST00000540420.1_Missense_Mutation_p.R85Q|RUNX3_ENST00000338888.3_Missense_Mutation_p.R192Q|RUNX3_ENST00000399916.1_Missense_Mutation_p.R192Q	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	178	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R178Q(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		TCTGGGCTCCCGGGGTCCGTC	0.652																																					p.R192Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G575A	1						.						63.0	58.0	60.0					1																	25245742		2203	4300	6503	25118329	SO:0001583	missense	864	exon4			BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.533G>A	1.37:g.25245742C>T	ENSP00000308051:p.Arg178Gln	Somatic		Capture	SOLID	Phase_I	25118329	NM_001031680	B1AJV5|Q12969|Q13760	Missense_Mutation	SNP	ENST00000308873.6	37	CCDS257.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.004522	0.93287	.	.	ENSG00000020633	ENST00000399916;ENST00000308873;ENST00000338888;ENST00000540420;ENST00000428150	D;D;D;D	0.99706	-6.47;-6.47;-6.47;-6.47	5.07	5.07	0.68467	Acute myeloid leukemia 1 (AML 1)/Runt (2);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99667	0.9876	M	0.80422	2.495	0.80722	D	1	P;D;D	0.71674	0.871;0.998;0.998	P;D;D	0.73380	0.535;0.98;0.98	D	0.97844	1.0270	10	0.59425	D	0.04	-21.4961	18.4912	0.90848	0.0:1.0:0.0:0.0	.	178;192;178	E9PH34;B1AJV5;Q13761	.;.;RUNX3_HUMAN	Q	192;178;192;85;178	ENSP00000382800:R192Q;ENSP00000308051:R178Q;ENSP00000343477:R192Q;ENSP00000444872:R85Q	ENSP00000308051:R178Q	R	-	2	0	RUNX3	25118329	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	7.802000	0.85969	2.368000	0.80403	0.655000	0.94253	CGG		0.652	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009284.1	NM_004350	
NCDN	23154	hgsc.bcm.edu	37	1	36026698	36026698	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr1:36026698G>A	ENST00000373243.2	+	3	1329	c.946G>A	c.(946-948)Gtg>Atg	p.V316M	NCDN_ENST00000373253.3_Missense_Mutation_p.V299M|NCDN_ENST00000356090.4_Missense_Mutation_p.V316M	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	316					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)		p.V299M(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TCTGGCGTGCGTGGAAGTGCG	0.662																																					p.V299M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G895A	1						.						34.0	30.0	31.0					1																	36026698		2203	4300	6503	35799285	SO:0001583	missense	23154	exon3			AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.946G>A	1.37:g.36026698G>A	ENSP00000362340:p.Val316Met	Somatic		Capture	SOLID	Phase_I	35799285	NM_001014841	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Missense_Mutation	SNP	ENST00000373243.2	37	CCDS392.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.638924	0.67130	.	.	ENSG00000020129	ENST00000373253;ENST00000356090;ENST00000373243	T;T;T	0.68181	-0.31;-0.31;-0.31	4.94	4.94	0.65067	.	0.059616	0.64402	D	0.000003	T	0.79411	0.4441	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.81158	-0.1060	10	0.72032	D	0.01	.	17.3334	0.87272	0.0:0.0:1.0:0.0	.	316	Q9UBB6	NCDN_HUMAN	M	299;316;316	ENSP00000362350:V299M;ENSP00000348394:V316M;ENSP00000362340:V316M	ENSP00000348394:V316M	V	+	1	0	NCDN	35799285	1.000000	0.71417	0.962000	0.40283	0.977000	0.68977	7.104000	0.77024	2.575000	0.86900	0.561000	0.74099	GTG		0.662	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284	
NVL	4931	hgsc.bcm.edu	37	1	224468866	224468866	+	Silent	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr1:224468866G>A	ENST00000281701.6	-	16	2180	c.1921C>T	c.(1921-1923)Cta>Tta	p.L641L	NVL_ENST00000482491.1_Silent_p.L365L|NVL_ENST00000469075.1_Silent_p.L550L|NVL_ENST00000340871.4_Silent_p.L452L|NVL_ENST00000361463.3_Silent_p.L535L|NVL_ENST00000391875.2_Silent_p.L535L	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	641						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.L641L(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		ATAAAATTTAGTCCGGACTCA	0.328																																					p.L641L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1921T	1						.						100.0	101.0	101.0					1																	224468866		2203	4300	6503	222535489	SO:0001819	synonymous_variant	4931	exon16			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.1921C>T	1.37:g.224468866G>A		Somatic		Capture	SOLID	Phase_I	222535489	NM_002533	B4DMC4|B4DP98|Q96EM7	Silent	SNP	ENST00000281701.6	37	CCDS1541.1	.	.	.	.	.	.	.	.	.	.	g	9.305	1.054181	0.19907	.	.	ENSG00000143748	ENST00000469968	.	.	.	5.07	4.09	0.47781	.	.	.	.	.	T	0.68842	0.3045	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67707	-0.5601	4	.	.	.	-8.7876	13.3343	0.60507	0.0811:0.0:0.9189:0.0	.	.	.	.	I	523	.	.	T	-	2	0	NVL	222535489	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.247000	0.51422	1.148000	0.42385	0.486000	0.48141	ACT		0.328	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533	
C11orf40	143501	hgsc.bcm.edu	37	11	4593430	4593430	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr11:4593430C>T	ENST00000307616.1	-	3	402	c.403G>A	c.(403-405)Gac>Aac	p.D135N		NM_144663.1	NP_653264.1	Q8WZ69	CK040_HUMAN	chromosome 11 open reading frame 40	135								p.D135N(1)		large_intestine(3)|lung(1)|ovary(2)|stomach(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		TCCATTAAGTCACATAGAAGC	0.423																																					p.D135N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G403A	11						.						146.0	131.0	136.0					11																	4593430		2201	4298	6499	4550006	SO:0001583	missense	143501	exon3				CCDS31354.1	11p15.5	2005-10-03			ENSG00000171987	ENSG00000171987			23986	protein-coding gene	gene with protein product							Standard	NM_144663		Approved	NOV1	uc010qyg.2	Q8WZ69	OTTHUMG00000165345	ENST00000307616.1:c.403G>A	11.37:g.4593430C>T	ENSP00000302918:p.Asp135Asn	Somatic		Capture	SOLID	Phase_I	4550006	NM_144663		Missense_Mutation	SNP	ENST00000307616.1	37	CCDS31354.1	.	.	.	.	.	.	.	.	.	.	C	5.410	0.260859	0.10239	.	.	ENSG00000171987	ENST00000307616	T	0.56103	0.48	1.09	-1.08	0.09936	.	.	.	.	.	T	0.27205	0.0667	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.12656	-1.0539	9	0.87932	D	0	.	3.5974	0.08012	0.237:0.5733:0.0:0.1897	.	135	Q8WZ69	CK040_HUMAN	N	135	ENSP00000302918:D135N	ENSP00000302918:D135N	D	-	1	0	C11orf40	4550006	0.013000	0.17824	0.000000	0.03702	0.000000	0.00434	-0.509000	0.06336	-1.025000	0.03334	-1.324000	0.01287	GAC		0.423	C11orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383529.1	NM_144663	
OR56A1	120796	hgsc.bcm.edu	37	11	6048470	6048470	+	Silent	SNP	A	A	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr11:6048470A>G	ENST00000316650.5	-	1	501	c.465T>C	c.(463-465)atT>atC	p.I155I		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I155I(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCGCACCACAATGAAGACAC	0.488																																					p.I155I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T465C	11						.						148.0	128.0	134.0					11																	6048470		2201	4296	6497	6005046	SO:0001819	synonymous_variant	120796	exon1			AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.465T>C	11.37:g.6048470A>G		Somatic		Capture	SOLID	Phase_I	6005046	NM_001001917	B2RNI2|Q6IFL0	Silent	SNP	ENST00000316650.5	37	CCDS31405.1																																																																																				0.488	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383757.1	NM_001001917	
MS4A1	931	hgsc.bcm.edu	37	11	60233425	60233425	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr11:60233425G>T	ENST00000534668.1	+	5	657	c.368G>T	c.(367-369)aGc>aTc	p.S123I	MS4A1_ENST00000532073.1_Missense_Mutation_p.S123I|MS4A1_ENST00000528313.1_Intron|MS4A1_ENST00000345732.4_Missense_Mutation_p.S123I|MS4A1_ENST00000389939.2_Missense_Mutation_p.S123I	NM_152866.2	NP_690605.1	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member 1	123					B cell proliferation (GO:0042100)|humoral immune response (GO:0006959)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	MHC class II protein complex binding (GO:0023026)	p.S123I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)	AATTCATTGAGCCTCTTTGCT	0.313																																					p.S123I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G368T	11						.						64.0	67.0	66.0					11																	60233425		2203	4300	6503	59990001	SO:0001583	missense	931	exon5			M27394	CCDS31570.1	11q12-q13.1	2014-09-17				ENSG00000156738		"""CD molecules"""	7315	protein-coding gene	gene with protein product		112210		CD20		2448768	Standard	NM_152866		Approved	B1, Bp35, MS4A2	uc001npq.3	P11836		ENST00000534668.1:c.368G>T	11.37:g.60233425G>T	ENSP00000433277:p.Ser123Ile	Somatic		Capture	SOLID	Phase_I	59990001	NM_021950	A6NMS4|B4DT24|P08984|Q13963	Missense_Mutation	SNP	ENST00000534668.1	37	CCDS31570.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013264	0.75161	.	.	ENSG00000156738	ENST00000345732;ENST00000532073;ENST00000534668;ENST00000389939	T;T;T;T	0.06294	3.32;3.32;3.32;3.32	5.29	4.36	0.52297	.	0.316464	0.37437	N	0.002098	T	0.24392	0.0591	M	0.89095	3.005	0.37981	D	0.933598	D;D	0.58268	0.982;0.982	P;P	0.58077	0.832;0.832	T	0.24297	-1.0164	10	0.87932	D	0	-27.0524	12.0527	0.53515	0.0:0.1741:0.8259:0.0	.	123;123	E9PKH8;P11836	.;CD20_HUMAN	I	123	ENSP00000314620:S123I;ENSP00000433519:S123I;ENSP00000433277:S123I;ENSP00000374589:S123I	ENSP00000314620:S123I	S	+	2	0	MS4A1	59990001	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.880000	0.48530	1.328000	0.45358	0.655000	0.94253	AGC		0.313	MS4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395402.1		
SCGB2A1	4246	hgsc.bcm.edu	37	11	61976228	61976228	+	Silent	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr11:61976228C>T	ENST00000244930.4	+	1	89	c.25C>T	c.(25-27)Ctg>Ttg	p.L9L		NM_002407.2	NP_002398.1	O75556	SG2A1_HUMAN	secretoglobin, family 2A, member 1	9					androgen receptor signaling pathway (GO:0030521)	extracellular space (GO:0005615)	protein heterodimerization activity (GO:0046982)	p.L9L(1)		breast(1)|kidney(1)|large_intestine(2)|lung(2)	6						GGTCCTCATGCTGGCGGCCCT	0.602																																					p.L9L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C25T	11						.						103.0	93.0	96.0					11																	61976228		2202	4299	6501	61732804	SO:0001819	synonymous_variant	4246	exon1			AF071219	CCDS8016.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000124939	ENSG00000124939		"""Secretoglobins"""	7051	protein-coding gene	gene with protein product	"""lipophilin C"", ""mammaglobin B"", ""lacryglobin"""	604398	"""mammaglobin 2"""	MGB2		9806831, 22155607	Standard	NM_002407		Approved	UGB3, LPHC, MGC71973	uc001nta.2	O75556	OTTHUMG00000167506	ENST00000244930.4:c.25C>T	11.37:g.61976228C>T		Somatic		Capture	SOLID	Phase_I	61732804	NM_002407		Silent	SNP	ENST00000244930.4	37	CCDS8016.1																																																																																				0.602	SCGB2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394857.1	NM_002407	
DRD2	1813	hgsc.bcm.edu	37	11	113295183	113295183	+	Missense_Mutation	SNP	G	G	A	rs201137518		TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr11:113295183G>A	ENST00000362072.3	-	2	535	c.191C>T	c.(190-192)gCg>gTg	p.A64V	DRD2_ENST00000544518.1_Missense_Mutation_p.A64V|DRD2_ENST00000538967.1_Missense_Mutation_p.A64V|DRD2_ENST00000346454.3_Missense_Mutation_p.A64V|DRD2_ENST00000535984.1_5'UTR|DRD2_ENST00000542968.1_Missense_Mutation_p.A64V|DRD2_ENST00000355319.2_Missense_Mutation_p.A64V	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	64					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)	p.A64V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GGTCTGCAGCGCCTTCTCGCG	0.602																																					p.A64V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C191T	11						.						204.0	154.0	171.0					11																	113295183		2201	4296	6497	112800393	SO:0001583	missense	1813	exon2			M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.191C>T	11.37:g.113295183G>A	ENSP00000354859:p.Ala64Val	Somatic		Capture	SOLID	Phase_I	112800393	NM_000795	Q9NZR3|Q9UPA9	Missense_Mutation	SNP	ENST00000362072.3	37	CCDS8361.1	.	.	.	.	.	.	.	.	.	.	G	37	6.060003	0.97246	.	.	ENSG00000149295	ENST00000355319;ENST00000346454;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967;ENST00000543292	T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	5.52	5.52	0.82312	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.88306	0.6401	M	0.92691	3.335	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.72338	0.916;0.969;0.977;0.934	D	0.90740	0.4649	10	0.87932	D	0	.	19.43	0.94760	0.0:0.0:1.0:0.0	.	64;64;64;64	F8VUV1;P14416-3;P14416-2;P14416	.;.;.;DRD2_HUMAN	V	64	ENSP00000347474:A64V;ENSP00000278597:A64V;ENSP00000354859:A64V;ENSP00000441068:A64V;ENSP00000442172:A64V;ENSP00000438215:A64V;ENSP00000438419:A64V	ENSP00000278597:A64V	A	-	2	0	DRD2	112800393	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.791000	0.99081	2.586000	0.87340	0.561000	0.74099	GCG		0.602	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795	
PLEKHG1	57480	hgsc.bcm.edu	37	6	151152499	151152499	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr6:151152499C>T	ENST00000358517.2	+	15	2463	c.2252C>T	c.(2251-2253)cCg>cTg	p.P751L	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.P751L			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	751							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P751L(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		CCAGATCCTCCGTCGCTGGGT	0.562																																					p.P751L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2252T	6						.						59.0	56.0	57.0					6																	151152499		2203	4300	6503	151194192	SO:0001583	missense	57480	exon16			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.2252C>T	6.37:g.151152499C>T	ENSP00000351318:p.Pro751Leu	Somatic		Capture	SOLID	Phase_I	151194192	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	C	9.537	1.112447	0.20795	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.62364	0.03;0.03	5.72	4.85	0.62838	.	0.148544	0.64402	D	0.000007	T	0.43964	0.1271	L	0.54323	1.7	0.40044	D	0.975682	B;B;B	0.28850	0.225;0.08;0.08	B;B;B	0.20184	0.028;0.01;0.01	T	0.51585	-0.8687	10	0.52906	T	0.07	.	14.1356	0.65287	0.0:0.9283:0.0:0.0717	.	558;751;751	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	L	751	ENSP00000356297:P751L;ENSP00000351318:P751L	ENSP00000351318:P751L	P	+	2	0	PLEKHG1	151194192	0.965000	0.33210	0.052000	0.19188	0.084000	0.17831	4.455000	0.60075	2.709000	0.92574	0.561000	0.74099	CCG		0.562	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
TRIM26	7726	hgsc.bcm.edu	37	6	30166680	30166680	+	Silent	SNP	G	G	A	rs367664883		TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr6:30166680G>A	ENST00000454678.2	-	4	637	c.201C>T	c.(199-201)ccC>ccT	p.P67P	TRIM26_ENST00000437089.1_Silent_p.P67P|TRIM26_ENST00000487829.1_5'UTR|TRIM26_ENST00000453195.1_Silent_p.P67P	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	67					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.P67P(1)		lung(1)|ovary(2)	3						GTTGCCACACGGGTCGGATGT	0.622																																					p.P67P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C201T	6						.						72.0	69.0	70.0					6																	30166680		1509	2708	4217	30274659	SO:0001819	synonymous_variant	7726	exon4			AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.201C>T	6.37:g.30166680G>A		Somatic		Capture	SOLID	Phase_I	30274659	NM_003449	A6NG96|Q5SRL2	Silent	SNP	ENST00000454678.2	37	CCDS4678.1																																																																																				0.622	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253442.1	NM_003449	
FILIP1	27145	hgsc.bcm.edu	37	6	76018473	76018473	+	Silent	SNP	A	A	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr6:76018473A>G	ENST00000237172.7	-	6	3906	c.3576T>C	c.(3574-3576)tcT>tcC	p.S1192S	FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000393004.2_Intron|FILIP1_ENST00000370020.1_Silent_p.S1093S	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	1192								p.S1192S(1)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						CTATTTTCATAGACTGAGTCT	0.532																																					p.S1192S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3576C	6						.						86.0	83.0	84.0					6																	76018473		2203	4300	6503	76075193	SO:0001819	synonymous_variant	27145	exon6			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.3576T>C	6.37:g.76018473A>G		Somatic		Capture	SOLID	Phase_I	76075193	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Silent	SNP	ENST00000237172.7	37	CCDS4984.1																																																																																				0.532	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
SYNE1	23345	hgsc.bcm.edu	37	6	152779960	152779960	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr6:152779960T>C	ENST00000367255.5	-	22	3101	c.2500A>G	c.(2500-2502)Atc>Gtc	p.I834V	SYNE1_ENST00000367248.3_Missense_Mutation_p.I824V|SYNE1_ENST00000341594.5_Missense_Mutation_p.I841V|SYNE1_ENST00000265368.4_Missense_Mutation_p.I834V|SYNE1_ENST00000448038.1_Missense_Mutation_p.I841V|SYNE1_ENST00000367253.4_Missense_Mutation_p.I834V|SYNE1_ENST00000495090.2_Missense_Mutation_p.I401V|SYNE1_ENST00000413186.2_Missense_Mutation_p.I834V|SYNE1_ENST00000423061.1_Missense_Mutation_p.I841V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	834					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.I834V(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATTTCATTGATTTTCCCAAGT	0.398										HNSCC(10;0.0054)																											p.I841V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2521G	6						.						125.0	117.0	120.0					6																	152779960		2203	4300	6503	152821653	SO:0001583	missense	23345	exon22			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.2500A>G	6.37:g.152779960T>C	ENSP00000356224:p.Ile834Val	Somatic		Capture	SOLID	Phase_I	152821653	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	4.612	0.113778	0.08831	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000495090	T;T;T;T;T;T;T;T;T	0.48201	1.4;1.4;1.4;1.4;0.82;1.4;1.4;1.4;1.4	5.52	5.52	0.82312	.	0.105638	0.41396	D	0.000889	T	0.16300	0.0392	L	0.38175	1.15	0.80722	D	1	B;B;B;B;B;B;B	0.22851	0.076;0.004;0.028;0.028;0.057;0.004;0.007	B;B;B;B;B;B;B	0.23419	0.015;0.01;0.023;0.034;0.046;0.01;0.023	T	0.05550	-1.0878	10	0.05525	T	0.97	.	10.6498	0.45642	0.0:0.081:0.0:0.919	.	817;834;401;824;834;834;841	B3W695;Q8NF91;F5H422;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.;.	V	834;841;834;841;841;834;824;834;401	ENSP00000356224:I834V;ENSP00000396024:I841V;ENSP00000265368:I834V;ENSP00000390975:I841V;ENSP00000341887:I841V;ENSP00000356222:I834V;ENSP00000356217:I824V;ENSP00000414510:I834V;ENSP00000438508:I401V	ENSP00000265368:I834V	I	-	1	0	SYNE1	152821653	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.562000	0.36353	2.216000	0.71823	0.528000	0.53228	ATC		0.398	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
CDC6	990	hgsc.bcm.edu	37	17	38457180	38457180	+	Silent	SNP	A	A	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr17:38457180A>G	ENST00000209728.4	+	10	1821	c.1350A>G	c.(1348-1350)caA>caG	p.Q450Q	CTD-2267D19.6_ENST00000602403.1_lincRNA	NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	450					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)	p.Q450Q(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						CCTTGAGCCAAGAAGGAGCAC	0.453																																					p.Q450Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1350G	17						.						222.0	189.0	200.0					17																	38457180		2203	4300	6503	35710706	SO:0001819	synonymous_variant	990	exon10			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.1350A>G	17.37:g.38457180A>G		Somatic		Capture	SOLID	Phase_I	35710706	NM_001254	Q8TB30	Silent	SNP	ENST00000209728.4	37	CCDS11365.1																																																																																				0.453	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257129.1		
TMEM101	84336	hgsc.bcm.edu	37	17	42091846	42091846	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr17:42091846G>A	ENST00000589334.1	-	3	512	c.197C>T	c.(196-198)gCt>gTt	p.A66V	TMEM101_ENST00000206380.3_Missense_Mutation_p.A66V|TMEM101_ENST00000587529.1_Missense_Mutation_p.A66V|TMEM101_ENST00000542039.1_Missense_Mutation_p.A8V			Q96IK0	TM101_HUMAN	transmembrane protein 101	66					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)	p.A66V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Breast(137;0.0264)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CATGAAACTAGCGCACAGCAC	0.617																																					p.A66V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C197T	17						.						31.0	24.0	26.0					17																	42091846		2192	4284	6476	39447372	SO:0001583	missense	84336	exon2			AK172826	CCDS11474.1	17q21.31	2005-12-16							28653	protein-coding gene	gene with protein product						12761501	Standard	NM_032376		Approved	MGC4251, FLJ23987	uc002ieu.3	Q96IK0		ENST00000589334.1:c.197C>T	17.37:g.42091846G>A	ENSP00000468025:p.Ala66Val	Somatic		Capture	SOLID	Phase_I	39447372	NM_032376	B2R9N6	Missense_Mutation	SNP	ENST00000589334.1	37	CCDS11474.1	.	.	.	.	.	.	.	.	.	.	G	37	5.996037	0.97184	.	.	ENSG00000091947	ENST00000206380;ENST00000542039	.	.	.	4.85	4.85	0.62838	.	0.063541	0.64402	D	0.000010	T	0.56906	0.2017	L	0.29908	0.895	0.58432	D	0.999998	P	0.43788	0.817	P	0.49683	0.619	T	0.61431	-0.7064	9	0.66056	D	0.02	-9.2516	15.5243	0.75890	0.0:0.0:1.0:0.0	.	66	Q96IK0	TM101_HUMAN	V	66;8	.	ENSP00000206380:A66V	A	-	2	0	TMEM101	39447372	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	9.260000	0.95568	2.523000	0.85059	0.591000	0.81541	GCT		0.617	TMEM101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457665.1	NM_032376	
TMUB2	79089	hgsc.bcm.edu	37	17	42266939	42266939	+	Silent	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr17:42266939C>T	ENST00000587989.1	+	3	738	c.585C>T	c.(583-585)acC>acT	p.T195T	ASB16-AS1_ENST00000591166.1_RNA|TMUB2_ENST00000592825.1_Intron|ASB16-AS1_ENST00000592897.1_RNA|TMUB2_ENST00000319511.6_Silent_p.T175T|TMUB2_ENST00000538716.2_Silent_p.T195T|ASB16-AS1_ENST00000585457.1_RNA|TMUB2_ENST00000589184.1_Intron|TMUB2_ENST00000590235.1_Intron|ASB16-AS1_ENST00000588785.1_RNA|TMUB2_ENST00000357984.3_Silent_p.T175T|TMUB2_ENST00000446571.3_Silent_p.T138T|TMUB2_ENST00000587172.1_Intron|TMUB2_ENST00000589785.1_Silent_p.T175T|TMUB2_ENST00000589856.1_Silent_p.T175T			Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain containing 2	195	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					integral component of membrane (GO:0016021)		p.T175T(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(3)	8		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CAGAGGATACCGTGGGTGCCC	0.607																																					p.T195T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C585T	17						.						31.0	33.0	32.0					17																	42266939		2203	4300	6503	39622465	SO:0001819	synonymous_variant	79089	exon3				CCDS11479.1, CCDS54134.1	17q21	2006-06-27				ENSG00000168591			28459	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_177441		Approved	MGC3123	uc002ifo.3	Q71RG4		ENST00000587989.1:c.585C>T	17.37:g.42266939C>T		Somatic		Capture	SOLID	Phase_I	39622465	NM_001076674	B3KU81|Q8NDI2|Q9BPZ5|Q9HAG3	Silent	SNP	ENST00000587989.1	37	CCDS54134.1																																																																																				0.607	TMUB2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457711.1	NM_177441	
TUBD1	51174	hgsc.bcm.edu	37	17	57955635	57955635	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr17:57955635C>T	ENST00000592426.1	-	4	598	c.598G>A	c.(598-600)Gcc>Acc	p.A200T	TUBD1_ENST00000591611.1_5'Flank|TUBD1_ENST00000394239.3_Missense_Mutation_p.A200T|TUBD1_ENST00000346141.6_Intron|TUBD1_ENST00000325752.3_Missense_Mutation_p.A200T|TUBD1_ENST00000340993.6_Missense_Mutation_p.A200T|TUBD1_ENST00000376094.4_Missense_Mutation_p.A200T|TUBD1_ENST00000539018.1_5'UTR			Q9UJT1	TBD_HUMAN	tubulin, delta 1	200					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|protein polymerization (GO:0051258)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.A200T(1)		NS(2)|breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(2)	21	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		Vinblastine(DB00570)	AGAAGGAGGGCGTCTGAAGAT	0.403																																					p.A81T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G241A	17						.						161.0	142.0	148.0					17																	57955635		2203	4300	6503	55310417	SO:0001583	missense	51174	exon6			AF201333	CCDS11620.1, CCDS54151.1, CCDS54152.1, CCDS54153.1, CCDS54154.1	17q23.1	2007-03-16						"""Tubulins"""	16811	protein-coding gene	gene with protein product		607344				10620804	Standard	NM_016261		Approved	FLJ12709, TUBD	uc002ixw.2	Q9UJT1		ENST00000592426.1:c.598G>A	17.37:g.57955635C>T	ENSP00000468518:p.Ala200Thr	Somatic		Capture	SOLID	Phase_I	55310417	NM_001193612	B4DPT8|B4DW01|D3DU02|E9PCA7|E9PCQ8|Q5KU36|Q9BWG9|Q9H7Z8	Missense_Mutation	SNP	ENST00000592426.1	37	CCDS11620.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.953140	0.92660	.	.	ENSG00000108423	ENST00000325752;ENST00000340993;ENST00000394239;ENST00000376094	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.51	5.51	0.81932	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	D	0.88134	0.6355	M	0.91196	3.185	0.80722	D	1	D;D;D;D;D	0.89917	0.987;0.999;1.0;0.999;0.993	P;D;D;D;P	0.91635	0.871;0.956;0.999;0.926;0.842	D	0.90235	0.4282	10	0.72032	D	0.01	-9.3368	19.4091	0.94662	0.0:1.0:0.0:0.0	.	200;200;200;200;200	E9PCA7;Q5KU37;E9PCQ8;Q9UJT1-2;Q9UJT1	.;.;.;.;TBD_HUMAN	T	200	ENSP00000320797:A200T;ENSP00000342399:A200T;ENSP00000377785:A200T;ENSP00000365262:A200T	ENSP00000320797:A200T	A	-	1	0	TUBD1	55310417	1.000000	0.71417	0.982000	0.44146	0.769000	0.43574	7.484000	0.81180	2.576000	0.86940	0.555000	0.69702	GCC		0.403	TUBD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448815.1	NM_016261	
KCNJ12	3768	hgsc.bcm.edu	37	17	21319651	21319653	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	GAG	GAG	GAG	-	GAG	GAG	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr17:21319651_21319653delGAG	ENST00000583088.1	+	3	1892_1894	c.997_999delGAG	c.(997-999)gagdel	p.E334del	KCNJ12_ENST00000331718.5_In_Frame_Del_p.E334del	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	334				Missing (in Ref. 2; AAC50615). {ECO:0000305}.	muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.E333delE(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CGTGCTCTTCGAGGAGAAGAACC	0.581										Prostate(3;0.18)																											p.333_333del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.997_999del	17						.																																			21260246	SO:0001651	inframe_deletion	3768	exon3			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.997_999delGAG	17.37:g.21319654_21319656delGAG	ENSP00000463778:p.Glu334del	Somatic		Capture	SOLID	Phase_I	21260244	NM_021012	O43401|Q15756|Q8NG63	In_Frame_Del	DEL	ENST00000583088.1	37	CCDS11219.1																																																																																				0.581	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
SLFN13	146857	hgsc.bcm.edu	37	17	33769228	33769229	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	AC	AC	AC	AC	AC	AC	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr17:33769228_33769229delAC	ENST00000285013.6	-	5	1550_1551	c.1275_1276delGT	c.(1273-1278)gagttafs	p.EL425fs	SLFN13_ENST00000526861.1_Frame_Shift_Del_p.EL425fs|SLFN13_ENST00000533791.1_Frame_Shift_Del_p.EL425fs|SLFN13_ENST00000534689.1_Frame_Shift_Del_p.EL107fs|SLFN13_ENST00000360502.2_Frame_Shift_Del_p.EL107fs|SLFN13_ENST00000542635.1_Frame_Shift_Del_p.EL425fs	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	425						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TTGTGTATTAACTCCTTTAGTC	0.47																																					p.425_426del												.	.	0			c.1275_1276del	17						.																																			30793342	SO:0001589	frameshift_variant	146857	exon5			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1275_1276delGT	17.37:g.33769228_33769229delAC	ENSP00000285013:p.Glu425fs	None		Capture	SOLID	Phase_I	30793341	NM_144682	E1P645|Q658M1|Q6ZS51|Q96A81	Frame_Shift_Del	DEL	ENST00000285013.6	37	CCDS32620.1																																																																																				0.470	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
RPTOR	57521	hgsc.bcm.edu	37	17	78867617	78867617	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr17:78867617G>A	ENST00000306801.3	+	20	2715	c.2353G>A	c.(2353-2355)Gac>Aac	p.D785N	RPTOR_ENST00000544334.2_Missense_Mutation_p.D627N|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	785					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.D785N(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CGAGACCATCGACAAGATGCG	0.657																																					p.D785N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2353A	17						.						107.0	97.0	100.0					17																	78867617		2203	4300	6503	76482212	SO:0001583	missense	57521	exon20				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.2353G>A	17.37:g.78867617G>A	ENSP00000307272:p.Asp785Asn	Somatic		Capture	SOLID	Phase_I	76482212	NM_020761	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	g	18.10	3.547730	0.65311	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.42513	0.97;1.33	4.89	3.92	0.45320	Armadillo-type fold (1);	0.058325	0.64402	D	0.000004	T	0.46600	0.1401	N	0.22421	0.69	0.80722	D	1	D;D	0.76494	0.999;0.964	D;B	0.76575	0.988;0.248	T	0.25467	-1.0131	10	0.13108	T	0.6	.	14.7026	0.69166	0.0:0.0:0.8536:0.1464	.	627;785	F5H7J5;Q8N122	.;RPTOR_HUMAN	N	785;627	ENSP00000307272:D785N;ENSP00000442479:D627N	ENSP00000307272:D785N	D	+	1	0	RPTOR	76482212	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.725000	0.84808	1.066000	0.40716	-0.127000	0.14921	GAC		0.657	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
TEKT5	146279	hgsc.bcm.edu	37	16	10783858	10783858	+	Silent	SNP	G	G	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr16:10783858G>T	ENST00000283025.2	-	2	660	c.589C>A	c.(589-591)Cga>Aga	p.R197R	RP11-109M19.1_ENST00000576710.1_RNA	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	197						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.R197R(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						CTCTTCTCTCGATGGTACAGA	0.522																																					p.R197R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C589A	16						.						100.0	88.0	92.0					16																	10783858		2197	4300	6497	10691359	SO:0001819	synonymous_variant	146279	exon2				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.589C>A	16.37:g.10783858G>T		Somatic		Capture	SOLID	Phase_I	10691359	NM_144674	A1L3Z3	Silent	SNP	ENST00000283025.2	37	CCDS10542.1																																																																																				0.522	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251963.1	NM_144674	
GPR114	221188	hgsc.bcm.edu	37	16	57601918	57601918	+	Silent	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr16:57601918G>A	ENST00000340339.4	+	9	1495	c.972G>A	c.(970-972)gcG>gcA	p.A324A	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Silent_p.A324A	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	324					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A324A(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						TGCACTACGCGCTGCTCAGCT	0.607																																					p.A324A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G972A	16						.						106.0	82.0	90.0					16																	57601918		2198	4300	6498	56159419	SO:0001819	synonymous_variant	221188	exon9			AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.972G>A	16.37:g.57601918G>A		Somatic		Capture	SOLID	Phase_I	56159419	NM_153837	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Silent	SNP	ENST00000340339.4	37	CCDS10785.1																																																																																				0.607	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257336.3	NM_153837	
CDH11	1009	hgsc.bcm.edu	37	16	64981783	64981783	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr16:64981783C>A	ENST00000268603.4	-	13	2729	c.2114G>T	c.(2113-2115)aGa>aTa	p.R705I	CDH11_ENST00000566827.1_Missense_Mutation_p.R579I|CDH11_ENST00000394156.3_3'UTR	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	705					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R705I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GAGCCCAGGTCTAGGCATGTA	0.517			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.R705I			Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2114T	16						.						128.0	121.0	123.0					16																	64981783		2203	4300	6503	63539284	SO:0001583	missense	1009	exon13			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.2114G>T	16.37:g.64981783C>A	ENSP00000268603:p.Arg705Ile	Somatic		Capture	SOLID	Phase_I	63539284	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.805334	0.90623	.	.	ENSG00000140937	ENST00000268603;ENST00000538390	T	0.77750	-1.12	6.17	6.17	0.99709	Cadherin, cytoplasmic domain (1);	0.044001	0.85682	D	0.000000	D	0.88328	0.6407	M	0.81497	2.545	0.80722	D	1	D	0.59357	0.985	P	0.61275	0.886	D	0.88468	0.3060	10	0.87932	D	0	.	19.8676	0.96824	0.0:1.0:0.0:0.0	.	705	P55287	CAD11_HUMAN	I	705;688	ENSP00000268603:R705I	ENSP00000268603:R705I	R	-	2	0	CDH11	63539284	0.975000	0.34042	0.977000	0.42913	0.988000	0.76386	4.775000	0.62346	2.941000	0.99782	0.655000	0.94253	AGA		0.517	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
CDH1	999	hgsc.bcm.edu	37	16	68845757	68845757	+	Nonsense_Mutation	SNP	C	C	T	rs587780784		TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr16:68845757C>T	ENST00000261769.5	+	7	1194	c.1003C>T	c.(1003-1005)Cga>Tga	p.R335*	RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000422392.2_Nonsense_Mutation_p.R335*|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	335	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.R335*(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TGGGCTGGACCGAGAGGTCAG	0.507			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																												p.R335X		yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|breast(1)	c.C1003T	16	GRCh37	CM022775	CDH1	M		.						75.0	71.0	72.0					16																	68845757		2198	4300	6498	67403258	SO:0001587	stop_gained	999	exon7	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1003C>T	16.37:g.68845757C>T	ENSP00000261769:p.Arg335*	Somatic		Capture	SOLID	Phase_I	67403258	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	ENST00000261769.5	37	CCDS10869.1	.	.	.	.	.	.	.	.	.	.	C	37	6.218011	0.97385	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.47	3.22	0.36961	.	0.000000	0.44688	D	0.000437	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3929	0.60834	0.4318:0.5681:0.0:0.0	.	.	.	.	X	335	.	ENSP00000261769:R335X	R	+	1	2	CDH1	67403258	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.320000	0.33666	1.416000	0.47057	0.561000	0.74099	CGA		0.507	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
ANKRD12	23253	hgsc.bcm.edu	37	18	9256855	9256855	+	Missense_Mutation	SNP	C	C	T	rs138768144		TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr18:9256855C>T	ENST00000262126.4	+	9	3830	c.3590C>T	c.(3589-3591)cCg>cTg	p.P1197L	RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000383440.2_Missense_Mutation_p.P1174L|ANKRD12_ENST00000400020.3_Missense_Mutation_p.P1174L	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1197						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P1197L(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AATGAAAAGCCGGGTCTCAGC	0.413													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17845	0.0		0.0	False		,,,				2504	0.0				p.P1197L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3590T	18						.	C	LEU/PRO,LEU/PRO,LEU/PRO	1,4403		0,1,2201	42.0	44.0	44.0		3521,3521,3590	1.3	0.1	18	dbSNP_134	44	0,8598		0,0,4299	no	missense,missense,missense	ANKRD12	NM_001083625.2,NM_001204056.1,NM_015208.4	98,98,98	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign	1174/2040,1174/2040,1197/2063	9256855	1,13001	2202	4299	6501	9246855	SO:0001583	missense	23253	exon9			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.3590C>T	18.37:g.9256855C>T	ENSP00000262126:p.Pro1197Leu	Somatic		Capture	SOLID	Phase_I	9246855	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	C	1.640	-0.516731	0.04200	2.27E-4	0.0	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.66099	-0.18;-0.19	5.79	1.26	0.21427	.	0.966598	0.08613	N	0.919736	T	0.39279	0.1072	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.20140	-1.0284	10	0.17832	T	0.49	-13.4927	9.7013	0.40189	0.0:0.4767:0.0:0.5232	.	1174;1197	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	L	1174;1197	ENSP00000372932:P1174L;ENSP00000262126:P1197L	ENSP00000262126:P1197L	P	+	2	0	ANKRD12	9246855	0.007000	0.16637	0.090000	0.20809	0.500000	0.33767	0.221000	0.17680	-0.061000	0.13110	-0.345000	0.07892	CCG		0.413	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ATP2B2	491	hgsc.bcm.edu	37	3	10401708	10401708	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr3:10401708C>T	ENST00000352432.4	-	12	1828	c.1759G>A	c.(1759-1761)Gtg>Atg	p.V587M	ATP2B2_ENST00000343816.4_Missense_Mutation_p.V573M|ATP2B2_ENST00000360273.2_Missense_Mutation_p.V587M|ATP2B2_ENST00000397077.1_Missense_Mutation_p.V542M|ATP2B2_ENST00000383800.4_Missense_Mutation_p.V542M			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	587					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.V542M(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						TGGCTGCGCACGGGCTCGTAG	0.617																																					p.V542M	Ovarian(125;1619 1709 15675 19819 38835)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1624A	3						.						84.0	70.0	75.0					3																	10401708		2203	4300	6503	10376708	SO:0001583	missense	491	exon10			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1759G>A	3.37:g.10401708C>T	ENSP00000324172:p.Val587Met	Somatic		Capture	SOLID	Phase_I	10376708	NM_001683	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196555	0.79015	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	T;T;T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52;-0.52;-0.52	4.93	4.93	0.64822	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.058710	0.64402	D	0.000003	T	0.71600	0.3359	L	0.41356	1.27	0.54753	D	0.999984	D;P;P	0.57899	0.981;0.705;0.733	P;B;B	0.49829	0.623;0.426;0.391	T	0.76473	-0.2946	10	0.87932	D	0	-27.2715	18.1486	0.89667	0.0:1.0:0.0:0.0	.	522;554;587	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	M	587;542;542;587;573;522;443;587	ENSP00000324172:V587M;ENSP00000373311:V542M;ENSP00000380267:V542M;ENSP00000353414:V587M;ENSP00000344677:V573M;ENSP00000414854:V443M	ENSP00000342954:V587M	V	-	1	0	ATP2B2	10376708	0.999000	0.42202	0.996000	0.52242	0.995000	0.86356	3.881000	0.56152	2.272000	0.75746	0.591000	0.81541	GTG		0.617	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
TRIM42	287015	hgsc.bcm.edu	37	3	140401686	140401686	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr3:140401686C>T	ENST00000286349.3	+	2	915	c.724C>T	c.(724-726)Cgc>Tgc	p.R242C		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	242						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.R242C(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CCAGGTCTGCCGCAACAAGCG	0.622																																					p.R242C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C724T	3						.						76.0	75.0	75.0					3																	140401686		2203	4300	6503	141884376	SO:0001583	missense	287015	exon2			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.724C>T	3.37:g.140401686C>T	ENSP00000286349:p.Arg242Cys	Somatic		Capture	SOLID	Phase_I	141884376	NM_152616	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	37	CCDS3113.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561186	0.65538	.	.	ENSG00000155890	ENST00000286349	T	0.38401	1.14	5.2	4.24	0.50183	.	0.225081	0.29021	N	0.013400	T	0.23451	0.0567	L	0.39898	1.24	0.44092	D	0.996859	P	0.39551	0.678	B	0.26202	0.067	T	0.10683	-1.0619	10	0.72032	D	0.01	-33.3748	9.3272	0.37999	0.2692:0.7308:0.0:0.0	.	242	Q8IWZ5	TRI42_HUMAN	C	242	ENSP00000286349:R242C	ENSP00000286349:R242C	R	+	1	0	TRIM42	141884376	0.978000	0.34361	0.997000	0.53966	0.686000	0.39977	1.304000	0.33482	2.435000	0.82474	0.561000	0.74099	CGC		0.622	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
SCN10A	6336	hgsc.bcm.edu	37	3	38740002	38740002	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr3:38740002G>A	ENST00000449082.2	-	27	4708	c.4709C>T	c.(4708-4710)aCg>aTg	p.T1570M		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1570					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.T1570M(3)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TCTGAAGAGCGTTGGGGAGAA	0.483																																					p.T1570M												.	.	3	Substitution - Missense(3)	large_intestine(2)|central_nervous_system(1)	c.C4709T	3						.						67.0	68.0	68.0					3																	38740002		2203	4300	6503	38715006	SO:0001583	missense	6336	exon27			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.4709C>T	3.37:g.38740002G>A	ENSP00000390600:p.Thr1570Met	Somatic		Capture	SOLID	Phase_I	38715006	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.924514	0.52653	.	.	ENSG00000185313	ENST00000449082	D	0.97575	-4.44	5.21	5.21	0.72293	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99108	0.9693	H	0.97291	3.975	0.58432	D	0.999998	D	0.89917	1.0	D	0.77557	0.99	D	0.99091	1.0840	10	0.87932	D	0	.	18.9486	0.92632	0.0:0.0:1.0:0.0	.	1570	Q9Y5Y9	SCNAA_HUMAN	M	1570	ENSP00000390600:T1570M	ENSP00000390600:T1570M	T	-	2	0	SCN10A	38715006	1.000000	0.71417	0.102000	0.21198	0.303000	0.27691	7.716000	0.84723	2.713000	0.92767	0.655000	0.94253	ACG		0.483	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
SCN11A	11280	hgsc.bcm.edu	37	3	38908898	38908898	+	Missense_Mutation	SNP	C	C	T	rs536925812	byFrequency	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr3:38908898C>T	ENST00000302328.3	-	23	4063	c.3865G>A	c.(3865-3867)Gta>Ata	p.V1289I	SCN11A_ENST00000450244.1_Missense_Mutation_p.V1289I|SCN11A_ENST00000456224.3_Missense_Mutation_p.V1251I|SCN11A_ENST00000444237.2_Missense_Mutation_p.V1289I	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1289					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.V1289I(2)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATAAAGACTACGAAGTAAATG	0.338													C|||	3	0.000599042	0.0	0.0014	5008	,	,		19155	0.0		0.001	False		,,,				2504	0.001				p.V1289I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3865A	3						.						133.0	129.0	130.0					3																	38908898		2203	4300	6503	38883902	SO:0001583	missense	11280	exon23			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3865G>A	3.37:g.38908898C>T	ENSP00000307599:p.Val1289Ile	Somatic		Capture	SOLID	Phase_I	38883902	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	10.70	1.424285	0.25639	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98567	-5.0;-5.0;-5.0;-5.0	5.27	3.48	0.39840	Ion transport (1);	0.126562	0.53938	N	0.000059	D	0.96636	0.8902	L	0.61218	1.895	0.42202	D	0.991773	P	0.38504	0.634	B	0.39419	0.299	D	0.94349	0.7577	10	0.40728	T	0.16	.	10.9198	0.47158	0.0:0.8467:0.0:0.1533	.	1289	Q9UI33	SCNBA_HUMAN	I	1289;1289;1251;1289	ENSP00000307599:V1289I;ENSP00000400945:V1289I;ENSP00000416757:V1251I;ENSP00000408028:V1289I	ENSP00000307599:V1289I	V	-	1	0	SCN11A	38883902	1.000000	0.71417	0.296000	0.24974	0.161000	0.22273	2.730000	0.47335	0.615000	0.30124	0.561000	0.74099	GTA		0.338	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
CTNNB1	1499	hgsc.bcm.edu	37	3	41267325	41267325	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr3:41267325T>G	ENST00000349496.5	+	6	1189	c.909T>G	c.(907-909)atT>atG	p.I303M	CTNNB1_ENST00000396185.3_Missense_Mutation_p.I303M|CTNNB1_ENST00000396183.3_Missense_Mutation_p.I303M|CTNNB1_ENST00000453024.1_Missense_Mutation_p.I296M|CTNNB1_ENST00000405570.1_Missense_Mutation_p.I303M	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	303					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.I303M(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GCCTTCAAATTTTAGCTTATG	0.413		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.I303M	Colon(6;3 56 14213 18255)		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T909G	3						.						101.0	98.0	99.0					3																	41267325		2203	4300	6503	41242329	SO:0001583	missense	1499	exon6	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.909T>G	3.37:g.41267325T>G	ENSP00000344456:p.Ile303Met	Somatic		Capture	SOLID	Phase_I	41242329	NM_001098210	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	10.54	1.377763	0.24944	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11	5.72	4.58	0.56647	Armadillo-like helical (1);Armadillo-type fold (1);	0.045194	0.85682	D	0.000000	T	0.51991	0.1707	L	0.50333	1.59	0.80722	D	1	B;B	0.21381	0.055;0.055	B;B	0.26969	0.075;0.075	T	0.49360	-0.8948	10	0.39692	T	0.17	-8.2442	4.4745	0.11729	0.1443:0.154:0.0:0.7017	.	231;303	B4DSW9;P35222	.;CTNB1_HUMAN	M	303;303;303;296;303	ENSP00000385604:I303M;ENSP00000379486:I303M;ENSP00000344456:I303M;ENSP00000411226:I296M;ENSP00000379488:I303M	ENSP00000344456:I303M	I	+	3	3	CTNNB1	41242329	0.996000	0.38824	1.000000	0.80357	0.991000	0.79684	0.358000	0.20216	1.014000	0.39417	0.482000	0.46254	ATT		0.413	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
IP6K1	9807	hgsc.bcm.edu	37	3	49765690	49765690	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr3:49765690A>T	ENST00000321599.4	-	5	939	c.638T>A	c.(637-639)gTg>gAg	p.V213E	IP6K1_ENST00000395238.1_Missense_Mutation_p.V48E|IP6K1_ENST00000468463.1_Missense_Mutation_p.V213E|IP6K1_ENST00000460540.1_Missense_Mutation_p.V48E	NM_001242829.1|NM_153273.3	NP_001229758.1|NP_695005.1	Q92551	IP6K1_HUMAN	inositol hexakisphosphate kinase 1	213					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.V213E(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	15						GTGGTGCACCACGTTCTCAAG	0.577																																					p.V213E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T638A	3						.						88.0	74.0	79.0					3																	49765690		2203	4300	6503	49740694	SO:0001583	missense	9807	exon5			D87452	CCDS33760.1, CCDS43092.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000176095	ENSG00000176095			18360	protein-coding gene	gene with protein product		606991	"""inositol hexaphosphate kinase 1"""	IHPK1			Standard	NM_001242829		Approved	KIAA0263	uc003cxm.1	Q92551	OTTHUMG00000158197	ENST00000321599.4:c.638T>A	3.37:g.49765690A>T	ENSP00000323780:p.Val213Glu	Somatic		Capture	SOLID	Phase_I	49740694	NM_153273	A8K157|A8MUX4|Q7L3I7|Q96E38	Missense_Mutation	SNP	ENST00000321599.4	37	CCDS33760.1	.	.	.	.	.	.	.	.	.	.	A	34	5.319193	0.95682	.	.	ENSG00000176095	ENST00000321599;ENST00000395238;ENST00000468463;ENST00000460540	T;T;T;T	0.21361	2.01;2.01;2.01;2.01	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.50292	0.1607	M	0.81682	2.555	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.997;0.995	T	0.55579	-0.8119	10	0.87932	D	0	-19.7637	16.0032	0.80310	1.0:0.0:0.0:0.0	.	213;213	C9JNA8;Q92551	.;IP6K1_HUMAN	E	213;48;213;48	ENSP00000323780:V213E;ENSP00000378659:V48E;ENSP00000420467:V213E;ENSP00000420762:V48E	ENSP00000323780:V213E	V	-	2	0	IP6K1	49740694	1.000000	0.71417	0.990000	0.47175	0.986000	0.74619	9.339000	0.96797	2.187000	0.69744	0.528000	0.53228	GTG		0.577	IP6K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350380.1	NM_153273	
IGSF10	285313	hgsc.bcm.edu	37	3	151164717	151164717	+	Missense_Mutation	SNP	C	C	T	rs372539492	byFrequency	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr3:151164717C>T	ENST00000282466.3	-	4	3051	c.3052G>A	c.(3052-3054)Gga>Aga	p.G1018R		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1018					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.G1018*(1)|p.G1018R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CGCCCCCTTCCGCCAATTTTC	0.478													C|||	2	0.000399361	0.0	0.0	5008	,	,		20977	0.0		0.0	False		,,,				2504	0.002				p.G1018R												.	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|lung(1)	c.G3052A	3						.	C	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	72.0	74.0	73.0		3052	1.5	0.5	3		73	0,8600		0,0,4300	no	missense	IGSF10	NM_178822.4	125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	1018/2624	151164717	1,13005	2203	4300	6503	152647407	SO:0001583	missense	285313	exon4			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.3052G>A	3.37:g.151164717C>T	ENSP00000282466:p.Gly1018Arg	Somatic		Capture	SOLID	Phase_I	152647407	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.039376	0.35989	2.27E-4	0.0	ENSG00000152580	ENST00000282466	T	0.77877	-1.13	5.46	1.49	0.22878	.	0.424588	0.19662	N	0.108955	T	0.74891	0.3776	L	0.27053	0.805	0.29328	N	0.866906	D	0.69078	0.997	P	0.61201	0.885	T	0.68138	-0.5488	10	0.33141	T	0.24	.	9.2081	0.37302	0.0:0.687:0.0:0.313	.	1018	Q6WRI0	IGS10_HUMAN	R	1018	ENSP00000282466:G1018R	ENSP00000282466:G1018R	G	-	1	0	IGSF10	152647407	1.000000	0.71417	0.536000	0.28039	0.002000	0.02628	0.737000	0.26144	0.244000	0.21351	0.591000	0.81541	GGA		0.478	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
VWF	7450	hgsc.bcm.edu	37	12	6061626	6061626	+	Silent	SNP	T	T	C			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr12:6061626T>C	ENST00000261405.5	-	49	8300	c.8046A>G	c.(8044-8046)ggA>ggG	p.G2682G		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2682					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.G2682G(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	AGAAGTACTCTCCTCTCTCAT	0.502																																					p.G2682G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A8046G	12						.						146.0	125.0	132.0					12																	6061626		2203	4300	6503	5931887	SO:0001819	synonymous_variant	7450	exon49				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.8046A>G	12.37:g.6061626T>C		Somatic		Capture	SOLID	Phase_I	5931887	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	CCDS8539.1																																																																																				0.502	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
RNF10	9921	hgsc.bcm.edu	37	12	121001288	121001288	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr12:121001288G>A	ENST00000325954.4	+	9	1854	c.1393G>A	c.(1393-1395)Gag>Aag	p.E465K	RNF10_ENST00000413266.2_Missense_Mutation_p.E470K	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	465					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E465K(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGGTTGCCAGAGGCCTGTGA	0.527																																					p.E465K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1393A	12						.						75.0	74.0	74.0					12																	121001288		2203	4300	6503	119485671	SO:0001583	missense	9921	exon9			AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.1393G>A	12.37:g.121001288G>A	ENSP00000322242:p.Glu465Lys	Somatic		Capture	SOLID	Phase_I	119485671	NM_014868	Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	37	CCDS9201.1	.	.	.	.	.	.	.	.	.	.	G	33	5.226361	0.95173	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266;ENST00000540046	T;T	0.45668	0.89;0.89	5.88	5.88	0.94601	.	0.485319	0.21102	N	0.080148	T	0.30448	0.0765	L	0.29908	0.895	0.53005	D	0.999963	B;B	0.30361	0.277;0.079	B;B	0.23852	0.049;0.023	T	0.10917	-1.0609	10	0.07482	T	0.82	.	18.4186	0.90579	0.0:0.0:1.0:0.0	.	470;465	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	K	465;465;470;11	ENSP00000322242:E465K;ENSP00000415682:E470K	ENSP00000322242:E465K	E	+	1	0	RNF10	119485671	1.000000	0.71417	0.990000	0.47175	0.973000	0.67179	7.438000	0.80431	2.779000	0.95612	0.650000	0.86243	GAG		0.527	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4		
DHX37	57647	hgsc.bcm.edu	37	12	125438516	125438516	+	Missense_Mutation	SNP	T	T	C	rs4516060	byFrequency	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr12:125438516T>C	ENST00000308736.2	-	20	2703	c.2605A>G	c.(2605-2607)Agc>Ggc	p.S869G	DHX37_ENST00000544745.1_Missense_Mutation_p.S656G	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	869			S -> G (in dbSNP:rs4516060). {ECO:0000269|PubMed:15489334}.				ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.S869G(1)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GGTGTGCAGCTGGCATACTCA	0.662													C|||	3284	0.655751	0.4463	0.6513	5008	,	,		15431	0.8462		0.5994	False		,,,				2504	0.8037				p.S869G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2605G	12						.	C	GLY/SER	1942,2464		416,1110,677	30.0	30.0	30.0		2605	5.2	0.8	12	dbSNP_111	30	5036,3564		1490,2056,754	yes	missense	DHX37	NM_032656.3	56	1906,3166,1431	CC,CT,TT		41.4419,44.0763,46.3478	benign	869/1158	125438516	6978,6028	2203	4300	6503	124004469	SO:0001583	missense	57647	exon20			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2605A>G	12.37:g.125438516T>C	ENSP00000311135:p.Ser869Gly	Somatic		Capture	SOLID	Phase_I	124004469	NM_032656	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	1365	0.625	208	0.42276422764227645	230	0.6353591160220995	483	0.8444055944055944	444	0.5857519788918206	C	3.102	-0.184466	0.06340	0.440763	0.585581	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.02395	4.31;4.31	5.24	5.24	0.73138	.	0.047424	0.85682	N	0.000000	T	0.00012	0.0000	N	0.00217	-1.83	0.42596	P	0.006735999999999964	B	0.02656	0.0	B	0.01281	0.0	T	0.25710	-1.0124	9	0.02654	T	1	-31.5727	13.7179	0.62710	0.0:0.9246:0.0:0.0754	rs4516060;rs52810536;rs60757108;rs4516060	869	Q8IY37	DHX37_HUMAN	G	869;656	ENSP00000311135:S869G;ENSP00000439009:S656G	ENSP00000311135:S869G	S	-	1	0	DHX37	124004469	1.000000	0.71417	0.837000	0.33122	0.052000	0.14988	5.545000	0.67237	1.222000	0.43521	-0.355000	0.07637	AGC		0.662	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
DHX37	57647	hgsc.bcm.edu	37	12	125438523	125438523	+	Silent	SNP	C	C	T	rs4258464	byFrequency	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr12:125438523C>T	ENST00000308736.2	-	20	2696	c.2598G>A	c.(2596-2598)gaG>gaA	p.E866E	DHX37_ENST00000544745.1_Silent_p.E653E	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	866							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.E866E(1)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		AGCTGGCATACTCACAGGCTC	0.657													C|||	3287	0.65635	0.4463	0.6571	5008	,	,		15398	0.8462		0.5984	False		,,,				2504	0.8037				p.E866E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2598A	12						.	C		1936,2468		414,1108,680	31.0	31.0	31.0		2598	3.4	1.0	12	dbSNP_111	31	5012,3588		1479,2054,767	no	coding-synonymous	DHX37	NM_032656.3		1893,3162,1447	TT,TC,CC		41.7209,43.96,46.5703		866/1158	125438523	6948,6056	2202	4300	6502	124004476	SO:0001819	synonymous_variant	57647	exon20			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2598G>A	12.37:g.125438523C>T		Somatic		Capture	SOLID	Phase_I	124004476	NM_032656	Q9BUI7|Q9P211	Silent	SNP	ENST00000308736.2	37	CCDS9261.1																																																																																				0.657	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
ENPEP	2028	hgsc.bcm.edu	37	4	111452431	111452431	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr4:111452431A>G	ENST00000265162.5	+	11	2147	c.1805A>G	c.(1804-1806)gAa>gGa	p.E602G		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	602					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E602G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		TCAGAAAAAGAAGGTAAATAT	0.244																																					p.E602G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1805G	4						.						24.0	26.0	25.0					4																	111452431		2122	4223	6345	111671880	SO:0001583	missense	2028	exon11			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.1805A>G	4.37:g.111452431A>G	ENSP00000265162:p.Glu602Gly	Somatic		Capture	SOLID	Phase_I	111671880	NM_001977	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	A	14.17	2.455796	0.43634	.	.	ENSG00000138792	ENST00000265162	T	0.01464	4.86	5.32	-2.84	0.05751	.	2.786880	0.00644	N	0.000524	T	0.00998	0.0033	N	0.02412	-0.56	0.25714	N	0.985454	B	0.02656	0.0	B	0.04013	0.001	T	0.47182	-0.9137	10	0.25751	T	0.34	.	6.6553	0.22984	0.6:0.1436:0.2565:0.0	.	602	Q07075	AMPE_HUMAN	G	602	ENSP00000265162:E602G	ENSP00000265162:E602G	E	+	2	0	ENPEP	111671880	0.003000	0.15002	0.975000	0.42487	0.946000	0.59487	-1.326000	0.02685	-0.243000	0.09653	-0.468000	0.05107	GAA		0.244	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
CTSO	1519	hgsc.bcm.edu	37	4	156860560	156860560	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr4:156860560C>A	ENST00000433477.3	-	4	584	c.515G>T	c.(514-516)gGa>gTa	p.G172V		NM_001334.2	NP_001325.1	P43235	CATK_HUMAN	cathepsin O	179					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)	p.G172V(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|prostate(1)	16	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.05)|Kidney(143;0.0627)|COAD - Colon adenocarcinoma(41;0.148)		AGTAGAGCCTCCATTGCAGCC	0.423																																					p.G172V	Pancreas(148;2303 2598 8989 35298)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G515T	4						.						108.0	112.0	111.0					4																	156860560		2203	4300	6503	157080010	SO:0001583	missense	1519	exon4			X77383	CCDS3794.1	4q32.1	2012-10-03			ENSG00000256043	ENSG00000256043		"""Cathepsins"""	2542	protein-coding gene	gene with protein product		600550		CTSO1		9790772	Standard	NM_001334		Approved		uc003ipg.3	P43234	OTTHUMG00000161942	ENST00000433477.3:c.515G>T	4.37:g.156860560C>A	ENSP00000414904:p.Gly172Val	Somatic		Capture	SOLID	Phase_I	157080010	NM_001334	Q6FHS6	Missense_Mutation	SNP	ENST00000433477.3	37	CCDS3794.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.974527	0.92919	.	.	ENSG00000256043	ENST00000433477	T	0.59083	0.29	5.98	5.98	0.97165	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.86777	0.6014	H	0.98333	4.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91045	0.4874	10	0.87932	D	0	.	20.4447	0.99122	0.0:1.0:0.0:0.0	.	172	P43234	CATO_HUMAN	V	172	ENSP00000414904:G172V	ENSP00000281527:G172V	G	-	2	0	CTSO	157080010	1.000000	0.71417	0.986000	0.45419	0.952000	0.60782	7.480000	0.81109	2.834000	0.97654	0.655000	0.94253	GGA		0.423	CTSO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366469.1	NM_001334	
GRIA2	2891	hgsc.bcm.edu	37	4	158257029	158257029	+	Splice_Site	SNP	G	G	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr4:158257029G>T	ENST00000264426.9	+	10	1752	c.1473G>T	c.(1471-1473)ggG>ggT	p.G491G	GRIA2_ENST00000393815.2_Splice_Site_p.G444G|GRIA2_ENST00000507898.1_Splice_Site_p.G444G|GRIA2_ENST00000296526.7_Splice_Site_p.G491G|GRIA2_ENST00000449365.1_Splice_Site_p.G444G	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	491					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.G491G(2)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TTGTATATGGGGTAAGTATAG	0.408																																					p.G444G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1332T	4						.						127.0	118.0	121.0					4																	158257029		2203	4300	6503	158476479	SO:0001630	splice_region_variant	2891	exon10				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1473+1G>T	4.37:g.158257029G>T		Somatic		Capture	SOLID	Phase_I	158476479	NM_001083620	A8MT92|I6L997|Q96FP6	Silent	SNP	ENST00000264426.9	37	CCDS43274.1																																																																																				0.408	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		Silent
KCTD8	386617	hgsc.bcm.edu	37	4	44176848	44176848	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr4:44176848G>A	ENST00000360029.3	-	2	1664	c.1381C>T	c.(1381-1383)Cgc>Tgc	p.R461C		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	461					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)		p.R461C(1)		central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						TGCCATTGGCGTTTGCGCTCT	0.363										HNSCC(17;0.042)																											p.R461C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1381T	4						.						111.0	116.0	114.0					4																	44176848		2203	4300	6503	43871605	SO:0001583	missense	386617	exon2			AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1381C>T	4.37:g.44176848G>A	ENSP00000353129:p.Arg461Cys	Somatic		Capture	SOLID	Phase_I	43871605	NM_198353	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948563	0.53186	.	.	ENSG00000183783	ENST00000360029	T	0.44083	0.93	4.91	4.91	0.64330	.	0.000000	0.52532	D	0.000075	T	0.50154	0.1599	N	0.24115	0.695	0.46798	D	0.999203	D	0.89917	1.0	D	0.64595	0.927	T	0.54636	-0.8264	10	0.72032	D	0.01	.	17.6253	0.88092	0.0:0.0:1.0:0.0	.	461	Q6ZWB6	KCTD8_HUMAN	C	461	ENSP00000353129:R461C	ENSP00000353129:R461C	R	-	1	0	KCTD8	43871605	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	3.936000	0.56568	2.699000	0.92147	0.650000	0.86243	CGC		0.363	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
TECRL	253017	hgsc.bcm.edu	37	4	65274875	65274875	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr4:65274875A>C	ENST00000381210.3	-	1	305	c.195T>G	c.(193-195)ttT>ttG	p.F65L	TECRL_ENST00000507440.1_Missense_Mutation_p.F65L	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	65					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)	p.F65L(1)		endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						TTTGAGCATCAAATATTTCAA	0.338																																					p.F65L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T195G	4						.						60.0	56.0	57.0					4																	65274875		2203	4300	6503	64957470	SO:0001583	missense	253017	exon1			AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.195T>G	4.37:g.65274875A>C	ENSP00000370607:p.Phe65Leu	Somatic		Capture	SOLID	Phase_I	64957470	NM_001010874		Missense_Mutation	SNP	ENST00000381210.3	37	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	A	4.040	0.005120	0.07866	.	.	ENSG00000205678	ENST00000507440;ENST00000381210;ENST00000509536	T;T;T	0.42900	0.96;0.96;0.96	4.99	0.834	0.18880	.	0.075989	0.53938	N	0.000042	T	0.06826	0.0174	N	0.00108	-2.11	0.20926	N	0.999825	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42361	-0.9456	10	0.02654	T	1	-0.1462	5.8567	0.18724	0.5747:0.336:0.0893:0.0	.	65;65	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	L	65	ENSP00000426043:F65L;ENSP00000370607:F65L;ENSP00000422497:F65L	ENSP00000370607:F65L	F	-	3	2	TECRL	64957470	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.273000	0.33121	0.321000	0.23259	0.533000	0.62120	TTT		0.338	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874	
SCARB2	950	hgsc.bcm.edu	37	4	77100781	77100781	+	Silent	SNP	G	G	C			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr4:77100781G>C	ENST00000264896.2	-	4	850	c.501C>G	c.(499-501)ctC>ctG	p.L167L	SCARB2_ENST00000452464.2_Intron	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	167	Important for interaction with GBA.				cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)	p.L167L(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			GAGTCACAAAGAGCTTCTGCT	0.483																																					p.L167L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C501G	4						.						223.0	211.0	215.0					4																	77100781		2203	4300	6503	77319805	SO:0001819	synonymous_variant	950	exon4			D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.501C>G	4.37:g.77100781G>C		Somatic		Capture	SOLID	Phase_I	77319805	NM_005506	B4DKD8|E7EM68|Q53Y63	Silent	SNP	ENST00000264896.2	37	CCDS3577.1																																																																																				0.483	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252403.1	NM_005506	
SMARCAD1	56916	hgsc.bcm.edu	37	4	95198281	95198281	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr4:95198281G>C	ENST00000354268.4	+	16	2126	c.2053G>C	c.(2053-2055)Gaa>Caa	p.E685Q	SMARCAD1_ENST00000509418.1_Missense_Mutation_p.E255Q|SMARCAD1_ENST00000457823.2_Missense_Mutation_p.E685Q			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	685					ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.E685Q(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		TAGCACCAGTGAAATACGAAG	0.388																																					p.E685Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2053C	4						.						177.0	171.0	173.0					4																	95198281		2203	4300	6503	95417304	SO:0001583	missense	56916	exon16			AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.2053G>C	4.37:g.95198281G>C	ENSP00000346217:p.Glu685Gln	Somatic		Capture	SOLID	Phase_I	95417304	NM_001128429	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	37	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756341	0.49362	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.19	5.52	5.52	0.82312	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.48286	D	0.000190	D	0.90249	0.6951	L	0.38175	1.15	0.58432	D	0.999993	B;B	0.09022	0.002;0.001	B;B	0.16722	0.016;0.009	D	0.85338	0.1094	10	0.24483	T	0.36	-24.6187	19.4533	0.94876	0.0:0.0:1.0:0.0	.	685;685	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	Q	685;685;685;255	ENSP00000351947:E685Q;ENSP00000415576:E685Q;ENSP00000346217:E685Q;ENSP00000423286:E255Q	ENSP00000346217:E685Q	E	+	1	0	SMARCAD1	95417304	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.251000	0.78297	2.604000	0.88044	0.555000	0.69702	GAA		0.388	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159	
TRAPPC11	60684	hgsc.bcm.edu	37	4	184606283	184606283	+	Silent	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr4:184606283C>T	ENST00000334690.6	+	16	1816	c.1614C>T	c.(1612-1614)ctC>ctT	p.L538L	TRAPPC11_ENST00000512476.1_Silent_p.L144L|TRAPPC11_ENST00000357207.4_Silent_p.L538L	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	538					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.L538L(1)									AAAAGAACCTCATAAATGTTT	0.294																																					p.L538L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1614T	4						.						77.0	86.0	83.0					4																	184606283		2197	4297	6494	184843277	SO:0001819	synonymous_variant	60684	exon16				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.1614C>T	4.37:g.184606283C>T		Somatic		Capture	SOLID	Phase_I	184843277	NM_199053	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Silent	SNP	ENST00000334690.6	37	CCDS34112.1																																																																																				0.294	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2	NM_021942	
ARSD	414	hgsc.bcm.edu	37	X	2836211	2836211	+	Missense_Mutation	SNP	A	A	T	rs73632977	byFrequency	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chrX:2836211A>T	ENST00000381154.1	-	5	572	c.497T>A	c.(496-498)cTg>cAg	p.L166Q	ARSD_ENST00000217890.6_5'UTR	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	166					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.L166Q(1)		large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCCGTGGTTCAGGGGGTGGTG	0.572																																					p.L166Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T497A	X						.						34.0	20.0	25.0					X																	2836211		2200	4289	6489	2846211	SO:0001583	missense	414	exon5			X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.497T>A	X.37:g.2836211A>T	ENSP00000370546:p.Leu166Gln	Somatic		Capture	SOLID	Phase_I	2846211	NM_009589	Q9UHJ8	Missense_Mutation	SNP	ENST00000381154.1	37	CCDS35196.1	142	0.08559373116335142	33	0.07432432432432433	27	0.07988165680473373	33	0.06111111111111111	59	0.081267217630854	a	10.90	1.480007	0.26598	.	.	ENSG00000006756	ENST00000381154;ENST00000217890	D	0.94184	-3.37	3.47	3.47	0.39725	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.183165	0.37304	U	0.002147	T	0.65186	0.2667	M	0.79805	2.47	0.80722	P	0.0	D;D	0.61080	0.98;0.989	D;D	0.64877	0.93;0.917	T	0.81662	-0.0831	9	0.62326	D	0.03	.	7.379	0.26845	0.8026:0.0:0.0:0.1974	.	166;166	E9PAW5;P51689	.;ARSD_HUMAN	Q	166	ENSP00000370546:L166Q	ENSP00000217890:L166Q	L	-	2	0	ARSD	2846211	0.026000	0.19158	0.027000	0.17364	0.309000	0.27889	2.195000	0.42677	1.132000	0.42129	0.343000	0.21770	CTG		0.572	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1		
NLGN4X	57502	hgsc.bcm.edu	37	X	6069466	6069466	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chrX:6069466G>T	ENST00000381095.3	-	2	669	c.42C>A	c.(40-42)ttC>ttA	p.F14L	NLGN4X_ENST00000381093.2_Missense_Mutation_p.F14L|NLGN4X_ENST00000538097.1_Missense_Mutation_p.F14L|NLGN4X_ENST00000469740.1_5'UTR|NLGN4X_ENST00000381092.1_Missense_Mutation_p.F14L|NLGN4X_ENST00000275857.6_Missense_Mutation_p.F14L	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	14					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.F14L(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						AGACCGGGGTGAACAACAAAG	0.512																																					p.F14L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C42A	X						.						96.0	70.0	79.0					X																	6069466		2203	4300	6503	6079466	SO:0001583	missense	57502	exon2			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.42C>A	X.37:g.6069466G>T	ENSP00000370485:p.Phe14Leu	Somatic		Capture	SOLID	Phase_I	6079466	NM_020742	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	G	0.303	-0.972696	0.02215	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.63580	-0.04;-0.05;-0.04;-0.04;-0.04	3.93	1.13	0.20643	.	.	.	.	.	T	0.35595	0.0937	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.002	T	0.20505	-1.0273	9	0.11794	T	0.64	.	8.1747	0.31275	0.2808:0.0:0.7192:0.0	.	14;14;14	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	L	14	ENSP00000370485:F14L;ENSP00000370483:F14L;ENSP00000275857:F14L;ENSP00000370482:F14L;ENSP00000439203:F14L	ENSP00000275857:F14L	F	-	3	2	NLGN4X	6079466	1.000000	0.71417	0.000000	0.03702	0.010000	0.07245	2.221000	0.42917	-0.180000	0.10637	-0.312000	0.09012	TTC		0.512	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
FGD1	2245	hgsc.bcm.edu	37	X	54492163	54492163	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chrX:54492163G>T	ENST00000375135.3	-	7	2196	c.1463C>A	c.(1462-1464)tCc>tAc	p.S488Y		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	488	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.S488Y(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AAACTGGGTGGAGCGCTCTGT	0.552																																					p.S488Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1463A	X						.						82.0	65.0	71.0					X																	54492163		2203	4300	6503	54508888	SO:0001583	missense	2245	exon7			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1463C>A	X.37:g.54492163G>T	ENSP00000364277:p.Ser488Tyr	Somatic		Capture	SOLID	Phase_I	54508888	NM_004463	Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306700	0.81247	.	.	ENSG00000102302	ENST00000375135	T	0.65732	-0.17	5.54	5.54	0.83059	Dbl homology (DH) domain (5);	0.000000	0.51477	D	0.000090	T	0.79885	0.4523	M	0.78049	2.395	0.58432	D	0.999994	D;D	0.69078	0.997;0.994	D;D	0.72982	0.979;0.979	T	0.82575	-0.0389	10	0.87932	D	0	-18.7076	17.2074	0.86921	0.0:0.0:1.0:0.0	.	246;488	B4DS99;P98174	.;FGD1_HUMAN	Y	488	ENSP00000364277:S488Y	ENSP00000364277:S488Y	S	-	2	0	FGD1	54508888	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.750000	0.98875	2.329000	0.79093	0.523000	0.50628	TCC		0.552	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463	
NPHP1	4867	hgsc.bcm.edu	37	2	110917718	110917718	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:110917718A>G	ENST00000393272.3	-	11	1331	c.1234T>C	c.(1234-1236)Ttt>Ctt	p.F412L	NPHP1_ENST00000445609.2_Missense_Mutation_p.F357L|NPHP1_ENST00000417665.1_Missense_Mutation_p.F356L|NPHP1_ENST00000355301.4_Missense_Mutation_p.F294L|NPHP1_ENST00000316534.4_Missense_Mutation_p.F413L	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	412					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)	p.F413L(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						TTACCATCAAATAGACAGAGG	0.378																																					p.F357L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1069C	2						.						107.0	105.0	106.0					2																	110917718		2203	4300	6503	110275007	SO:0001583	missense	4867	exon11			AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.1234T>C	2.37:g.110917718A>G	ENSP00000376953:p.Phe412Leu	Somatic		Capture	SOLID	Phase_I	110275007	NM_001128178	O14837	Missense_Mutation	SNP	ENST00000393272.3	37	CCDS46385.1	.	.	.	.	.	.	.	.	.	.	A	17.52	3.409019	0.62399	.	.	ENSG00000144061	ENST00000316534;ENST00000445609;ENST00000393272;ENST00000355301;ENST00000417665	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	5.71	5.71	0.89125	.	0.230912	0.44688	N	0.000438	T	0.81706	0.4879	M	0.72894	2.215	0.80722	D	1	B;B;B;B;B;B	0.30114	0.176;0.088;0.027;0.146;0.269;0.096	B;B;B;B;B;B	0.25291	0.025;0.059;0.019;0.059;0.057;0.05	T	0.81660	-0.0832	10	0.72032	D	0.01	-13.6074	13.9352	0.64021	1.0:0.0:0.0:0.0	.	356;356;294;412;357;413	B4DQY0;C9JNM7;O15259-3;O15259;O15259-2;O15259-4	.;.;.;NPHP1_HUMAN;.;.	L	413;357;412;294;356	ENSP00000313169:F413L;ENSP00000389879:F357L;ENSP00000376953:F412L;ENSP00000347452:F294L;ENSP00000402176:F356L	ENSP00000313169:F413L	F	-	1	0	NPHP1	110275007	1.000000	0.71417	0.655000	0.29622	0.957000	0.61999	7.530000	0.81962	2.168000	0.68352	0.460000	0.39030	TTT		0.378	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272	
MGAT5	4249	hgsc.bcm.edu	37	2	135180413	135180413	+	Missense_Mutation	SNP	C	C	T	rs141050390		TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:135180413C>T	ENST00000409645.1	+	14	1969	c.1717C>T	c.(1717-1719)Cgg>Tgg	p.R573W	MGAT5_ENST00000281923.2_Missense_Mutation_p.R573W			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	573					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)	p.R573W(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		TTTCATCGGGCGGCCACATGT	0.428																																					p.R573W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1717T	2						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	128.0	132.0	130.0		1717	5.8	1.0	2	dbSNP_134	130	1,8599	1.2+/-3.3	0,1,4299	no	missense	MGAT5	NM_002410.3	101	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	573/742	135180413	2,13004	2203	4300	6503	134896883	SO:0001583	missense	4249	exon13			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.1717C>T	2.37:g.135180413C>T	ENSP00000386377:p.Arg573Trp	Somatic		Capture	SOLID	Phase_I	134896883	NM_002410	D3DP70	Missense_Mutation	SNP	ENST00000409645.1	37	CCDS2171.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.546984	0.65198	2.27E-4	1.16E-4	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.79	5.79	0.91817	.	0.335735	0.36338	N	0.002641	T	0.51805	0.1696	L	0.42245	1.32	0.40295	D	0.97854	D	0.60160	0.987	P	0.47705	0.555	T	0.57318	-0.7832	9	0.87932	D	0	-13.3921	13.0004	0.58672	0.2673:0.7327:0.0:0.0	.	573	Q09328	MGT5A_HUMAN	W	573	.	ENSP00000281923:R573W	R	+	1	2	MGAT5	134896883	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.158000	0.42329	2.739000	0.93911	0.563000	0.77884	CGG		0.428	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410	
ARHGAP15	55843	hgsc.bcm.edu	37	2	143986187	143986187	+	Silent	SNP	C	C	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:143986187C>A	ENST00000295095.6	+	5	501	c.334C>A	c.(334-336)Cga>Aga	p.R112R	ARHGAP15_ENST00000409869.1_Silent_p.R112R	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	112	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)	p.R112R(1)		endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		TCTTTCTAGTCGAAGAATTGA	0.303																																					p.R112R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C334A	2						.						89.0	95.0	93.0					2																	143986187		2203	4298	6501	143702657	SO:0001819	synonymous_variant	55843	exon5			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.334C>A	2.37:g.143986187C>A		Somatic		Capture	SOLID	Phase_I	143702657	NM_018460	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Silent	SNP	ENST00000295095.6	37	CCDS2184.1																																																																																				0.303	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
APOB	338	hgsc.bcm.edu	37	2	21260004	21260004	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:21260004C>A	ENST00000233242.1	-	6	788	c.661G>T	c.(661-663)Ggc>Tgc	p.G221C	APOB_ENST00000399256.4_Missense_Mutation_p.G221C	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	221	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.G221C(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGCTGATGCCTGTGCGGATG	0.498																																					p.G221C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G661T	2						.						156.0	125.0	136.0					2																	21260004		2203	4300	6503	21113509	SO:0001583	missense	338	exon6			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.661G>T	2.37:g.21260004C>A	ENSP00000233242:p.Gly221Cys	Somatic		Capture	SOLID	Phase_I	21113509	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	2.826	-0.243794	0.05906	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.57436	0.4;0.4	5.64	3.82	0.43975	Lipid transport protein, beta-sheet shell (1);Lipid transport protein, N-terminal (3);Vitellinogen, beta-sheet N-terminal (1);	0.362392	0.23541	N	0.047064	T	0.48857	0.1523	L	0.57536	1.79	0.09310	N	1	P	0.45126	0.851	P	0.47626	0.552	T	0.44757	-0.9307	10	0.39692	T	0.17	.	2.3934	0.04384	0.2689:0.4667:0.1126:0.1518	.	221	P04114	APOB_HUMAN	C	221	ENSP00000233242:G221C;ENSP00000382200:G221C	ENSP00000233242:G221C	G	-	1	0	APOB	21113509	0.000000	0.05858	0.004000	0.12327	0.035000	0.12851	0.126000	0.15769	0.841000	0.35020	0.650000	0.86243	GGC		0.498	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
SCN1A	6323	hgsc.bcm.edu	37	2	166900218	166900218	+	Silent	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:166900218C>T	ENST00000303395.4	-	11	2003	c.2004G>A	c.(2002-2004)ctG>ctA	p.L668L	SCN1A_ENST00000375405.3_Silent_p.L668L|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000423058.2_Silent_p.L668L|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000409050.1_Intron|AC010127.3_ENST00000599041.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	668					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.L668L(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCACCTCTGGCAGAAGCTGTC	0.478																																					p.L668L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2004A	2						.						88.0	80.0	83.0					2																	166900218		2203	4300	6503	166608464	SO:0001819	synonymous_variant	6323	exon11			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2004G>A	2.37:g.166900218C>T		Somatic		Capture	SOLID	Phase_I	166608464	NM_006920	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																				0.478	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
ABCA12	26154	hgsc.bcm.edu	37	2	215813823	215813823	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:215813823C>A	ENST00000272895.7	-	46	7122	c.6903G>T	c.(6901-6903)aaG>aaT	p.K2301N	ABCA12_ENST00000389661.4_Missense_Mutation_p.K1983N|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2301	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.K2301N(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTGTCAGCATCTTGAATATAG	0.393																																					p.K2301N	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6903T	2						.						158.0	151.0	153.0					2																	215813823		2203	4300	6503	215522068	SO:0001583	missense	26154	exon46			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6903G>T	2.37:g.215813823C>A	ENSP00000272895:p.Lys2301Asn	Somatic		Capture	SOLID	Phase_I	215522068	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963490	0.74016	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.81078	-1.45;-1.45	5.63	3.51	0.40186	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000004	T	0.80518	0.4638	N	0.17278	0.47	0.80722	D	1	D;D	0.89917	0.973;1.0	D;D	0.80764	0.958;0.994	T	0.82824	-0.0266	10	0.87932	D	0	.	11.8814	0.52578	0.0:0.7899:0.0:0.2101	.	2301;1983	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	N	2301;1983	ENSP00000272895:K2301N;ENSP00000374312:K1983N	ENSP00000272895:K2301N	K	-	3	2	ABCA12	215522068	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.228000	0.32588	1.382000	0.46385	0.655000	0.94253	AAG		0.393	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
CAD	790	hgsc.bcm.edu	37	2	27446567	27446567	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:27446567A>C	ENST00000403525.1	+	7	1090	c.946A>C	c.(946-948)Aat>Cat	p.N316H	CAD_ENST00000264705.4_Missense_Mutation_p.N316H			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.N316H(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCAACGCCAATGATGGTTC	0.542																																					p.N316H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A946C	2						.						271.0	257.0	261.0					2																	27446567		2203	4300	6503	27300071	SO:0001583	missense	790	exon7			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.946A>C	2.37:g.27446567A>C	ENSP00000384510:p.Asn316His	Somatic		Capture	SOLID	Phase_I	27300071	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.	.	.	.	.	.	.	.	.	.	A	23.3	4.393856	0.83011	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.91351	-2.83;-2.83	5.45	5.45	0.79879	Glutamine amidotransferase type 1 (2);	0.000000	0.85682	D	0.000000	D	0.96972	0.9011	H	0.97465	4.01	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.999	D	0.98081	1.0404	10	0.87932	D	0	-0.0435	13.4523	0.61178	1.0:0.0:0.0:0.0	.	316;316	F8VPD4;P27708	.;PYR1_HUMAN	H	316	ENSP00000264705:N316H;ENSP00000384510:N316H	ENSP00000264705:N316H	N	+	1	0	CAD	27300071	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	8.694000	0.91293	2.069000	0.61940	0.402000	0.26972	AAT		0.542	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
TTC27	55622	hgsc.bcm.edu	37	2	33037597	33037597	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:33037597C>A	ENST00000317907.4	+	18	2454	c.2223C>A	c.(2221-2223)taC>taA	p.Y741*		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	741								p.Y741*(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						CAAAGGCATACAAGTGTGACA	0.393																																					p.Y691X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2073A	2						.						132.0	125.0	127.0					2																	33037597		2203	4300	6503	32891101	SO:0001587	stop_gained	55622	exon18			BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.2223C>A	2.37:g.33037597C>A	ENSP00000313953:p.Tyr741*	Somatic		Capture	SOLID	Phase_I	32891101	NM_001193509	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Nonsense_Mutation	SNP	ENST00000317907.4	37	CCDS33176.1	.	.	.	.	.	.	.	.	.	.	C	38	6.795043	0.97845	.	.	ENSG00000018699	ENST00000317907	.	.	.	5.04	3.95	0.45737	.	0.196537	0.43260	D	0.000581	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.8198	12.1796	0.54204	0.0:0.863:0.0:0.137	.	.	.	.	X	741	.	ENSP00000313953:Y741X	Y	+	3	2	TTC27	32891101	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.145000	0.31577	2.325000	0.78763	0.561000	0.74099	TAC		0.393	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
CCDC88A	55704	hgsc.bcm.edu	37	2	55646028	55646028	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:55646028C>T	ENST00000436346.1	-	2	929	c.88G>A	c.(88-90)Gca>Aca	p.A30T	CCDC88A_ENST00000413716.2_Missense_Mutation_p.A30T|CCDC88A_ENST00000336838.6_Missense_Mutation_p.A30T|CCDC88A_ENST00000263630.8_Missense_Mutation_p.A30T|CCDC88A_ENST00000471947.1_5'UTR	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	30					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)	p.A30T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						CCATTTCCTGCGGCCAGAGGT	0.463																																					p.A30T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G88A	2						.						135.0	125.0	129.0					2																	55646028		2203	4300	6503	55499532	SO:0001583	missense	55704	exon2			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.88G>A	2.37:g.55646028C>T	ENSP00000410608:p.Ala30Thr	Somatic		Capture	SOLID	Phase_I	55499532	NM_001135597	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37		.	.	.	.	.	.	.	.	.	.	C	12.03	1.817121	0.32145	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	5.56	5.56	0.83823	.	0.177575	0.26380	U	0.024705	T	0.11922	0.0290	N	0.08118	0	0.80722	D	1	B;B;B	0.32425	0.023;0.371;0.052	B;B;B	0.21360	0.017;0.034;0.012	T	0.20806	-1.0264	10	0.24483	T	0.36	-12.7911	12.8219	0.57698	0.0:0.9254:0.0:0.0746	.	30;30;30	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	T	30	ENSP00000338728:A30T;ENSP00000263630:A30T;ENSP00000410608:A30T;ENSP00000404431:A30T	ENSP00000263630:A30T	A	-	1	0	CCDC88A	55499532	0.688000	0.27680	1.000000	0.80357	0.809000	0.45718	1.670000	0.37502	2.615000	0.88500	0.563000	0.77884	GCA		0.463	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
REG3A	5068	hgsc.bcm.edu	37	2	79385481	79385481	+	Missense_Mutation	SNP	C	C	T	rs199992892	byFrequency	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:79385481C>T	ENST00000409839.3	-	4	340	c.304G>A	c.(304-306)Gtc>Atc	p.V102I	AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000393878.1_Missense_Mutation_p.V102I|REG3A_ENST00000305165.2_Missense_Mutation_p.V102I	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	102	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)	p.V102I(1)		breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						CCAATCCAGACGTATGAGTAG	0.577													C|||	5	0.000998403	0.0	0.0029	5008	,	,		19685	0.001		0.0	False		,,,				2504	0.002				p.V102I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G304A	2						.						132.0	106.0	115.0					2																	79385481		2203	4300	6503	79238989	SO:0001583	missense	5068	exon4			S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.304G>A	2.37:g.79385481C>T	ENSP00000386630:p.Val102Ile	Somatic		Capture	SOLID	Phase_I	79238989	NM_002580		Missense_Mutation	SNP	ENST00000409839.3	37	CCDS1965.1	124	0.056776556776556776	43	0.08739837398373984	29	0.08011049723756906	25	0.043706293706293704	27	0.03562005277044855	C	1.610	-0.524315	0.04141	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.17854	2.25;2.25;2.25	4.02	-6.97	0.01616	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.011050	0.07946	N	0.980151	T	0.00356	0.0011	N	0.25201	0.72	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40572	-0.9556	10	0.13853	T	0.58	.	13.264	0.60122	0.0:0.6394:0.0:0.3606	.	102	Q06141	REG3A_HUMAN	I	102	ENSP00000386630:V102I;ENSP00000377456:V102I;ENSP00000304311:V102I	ENSP00000304311:V102I	V	-	1	0	REG3A	79238989	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-2.623000	0.00876	-1.445000	0.01948	-1.155000	0.01812	GTC		0.577	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580	
FZD7	8324	hgsc.bcm.edu	37	2	202900305	202900305	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:202900305G>A	ENST00000286201.1	+	1	996	c.935G>A	c.(934-936)cGc>cAc	p.R312H	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	312					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R312H(1)		breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						CTAGAGGACCGCGCCGTGTGC	0.642											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R312H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G935A	2						.						67.0	67.0	67.0					2																	202900305		2203	4300	6503	202608550	SO:0001583	missense	8324	exon1			AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.935G>A	2.37:g.202900305G>A	ENSP00000286201:p.Arg312His	Somatic	2133	Capture	SOLID	Phase_I	202608550	NM_003507	O94816|Q53S59|Q96B74	Missense_Mutation	SNP	ENST00000286201.1	37	CCDS2351.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938880	0.73557	.	.	ENSG00000155760	ENST00000286201	D	0.82255	-1.59	5.01	5.01	0.66863	GPCR, family 2-like (1);	0.066642	0.64402	D	0.000016	D	0.86163	0.5867	L	0.58583	1.82	0.52099	D	0.999946	D	0.59357	0.985	P	0.51487	0.671	D	0.87818	0.2636	10	0.72032	D	0.01	.	18.523	0.90960	0.0:0.0:1.0:0.0	.	312	O75084	FZD7_HUMAN	H	312	ENSP00000286201:R312H	ENSP00000286201:R312H	R	+	2	0	FZD7	202608550	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.114000	0.77103	2.618000	0.88619	0.563000	0.77884	CGC		0.642	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
HDAC4	9759	hgsc.bcm.edu	37	2	240078376	240078376	+	Silent	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr2:240078376G>A	ENST00000345617.3	-	7	1496	c.705C>T	c.(703-705)gcC>gcT	p.A235A	HDAC4_ENST00000541256.1_Silent_p.A204A|HDAC4_ENST00000553145.1_5'Flank|HDAC4_ENST00000543185.1_5'Flank	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	235	Interaction with MEF2A.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A235A(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		AGTCATCTTTGGCGTCGTACA	0.597																																					p.A235A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C705T	2						.						124.0	121.0	122.0					2																	240078376		2203	4300	6503	239743313	SO:0001819	synonymous_variant	9759	exon7			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.705C>T	2.37:g.240078376G>A		Somatic		Capture	SOLID	Phase_I	239743313	NM_006037	Q9UND6	Silent	SNP	ENST00000345617.3	37	CCDS2529.1																																																																																				0.597	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037	
PCDH17	27253	hgsc.bcm.edu	37	13	58207105	58207105	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr13:58207105C>T	ENST00000377918.3	+	1	451	c.425C>T	c.(424-426)tCg>tTg	p.S142L		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	142	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S142L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		ATGGACATCTCGGAGAACGCT	0.612																																					p.S142L	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C425T	13						.						91.0	75.0	81.0					13																	58207105		2203	4300	6503	57105106	SO:0001583	missense	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.425C>T	13.37:g.58207105C>T	ENSP00000367151:p.Ser142Leu	Somatic		Capture	SOLID	Phase_I	57105106	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.985990	0.74589	.	.	ENSG00000118946	ENST00000377918	T	0.53857	0.6	5.1	5.1	0.69264	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.67249	0.2873	L	0.46741	1.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.63941	-0.6523	9	.	.	.	.	18.7125	0.91662	0.0:1.0:0.0:0.0	.	142;142	O14917-2;O14917	.;PCD17_HUMAN	L	142	ENSP00000367151:S142L	.	S	+	2	0	PCDH17	57105106	1.000000	0.71417	0.980000	0.43619	0.728000	0.41692	7.617000	0.83032	2.669000	0.90835	0.650000	0.86243	TCG		0.612	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
PCDH9	5101	hgsc.bcm.edu	37	13	67802127	67802127	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr13:67802127A>T	ENST00000377865.2	-	1	580	c.446T>A	c.(445-447)aTt>aAt	p.I149N	PCDH9_ENST00000456367.1_Missense_Mutation_p.I149N|PCDH9_ENST00000377861.3_Missense_Mutation_p.I149N|PCDH9_ENST00000544246.1_Missense_Mutation_p.I149N|PCDH9_ENST00000328454.5_Missense_Mutation_p.I149N			Q9HC56	PCDH9_HUMAN	protocadherin 9	149	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I149N(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TGGAATGGAAATATTGATGAC	0.393																																					p.I149N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T446A	13						.						106.0	105.0	105.0					13																	67802127		2203	4300	6503	66700128	SO:0001583	missense	5101	exon2			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.446T>A	13.37:g.67802127A>T	ENSP00000367096:p.Ile149Asn	Somatic		Capture	SOLID	Phase_I	66700128	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	A	15.48	2.845104	0.51164	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5	6.04	6.04	0.98038	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.75627	0.3875	M	0.83774	2.66	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.995;1.0;1.0;1.0	T	0.79351	-0.1839	10	0.87932	D	0	.	16.5763	0.84648	1.0:0.0:0.0:0.0	.	149;149;149;149	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	N	149	ENSP00000442186:I149N;ENSP00000367096:I149N;ENSP00000401699:I149N;ENSP00000332060:I149N;ENSP00000367092:I149N	ENSP00000332060:I149N	I	-	2	0	PCDH9	66700128	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.317000	0.78254	0.459000	0.35465	ATT		0.393	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
GPC6	10082	hgsc.bcm.edu	37	13	94197666	94197666	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr13:94197666A>C	ENST00000377047.4	+	2	926	c.311A>C	c.(310-312)aAa>aCa	p.K104T		NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	104					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.K104T(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				AGGCATAAGAAATTTGACGGT	0.358																																					p.K104T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A311C	13						.						139.0	135.0	137.0					13																	94197666		2203	4300	6503	92995667	SO:0001583	missense	10082	exon2			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.311A>C	13.37:g.94197666A>C	ENSP00000366246:p.Lys104Thr	Somatic		Capture	SOLID	Phase_I	92995667	NM_005708	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	CCDS9469.1	.	.	.	.	.	.	.	.	.	.	A	11.54	1.669519	0.29693	.	.	ENSG00000183098	ENST00000377047	T	0.51325	0.71	4.99	4.99	0.66335	.	0.404883	0.25683	N	0.028987	T	0.50990	0.1648	M	0.70787	2.145	0.29255	N	0.871723	P;B	0.39759	0.687;0.11	B;B	0.43018	0.405;0.14	T	0.51442	-0.8705	10	0.15952	T	0.53	.	15.0257	0.71669	1.0:0.0:0.0:0.0	.	104;104	B4E2M1;Q9Y625	.;GPC6_HUMAN	T	104	ENSP00000366246:K104T	ENSP00000366246:K104T	K	+	2	0	GPC6	92995667	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.791000	0.55469	2.009000	0.58944	0.524000	0.50904	AAA		0.358	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	
ABHD13	84945	hgsc.bcm.edu	37	13	108881601	108881601	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr13:108881601A>G	ENST00000375898.3	+	2	336	c.35A>G	c.(34-36)gAa>gGa	p.E12G		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	12						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.E12G(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					AACTTTGTTGAAAGATGGCTA	0.393																																					p.E12G	Pancreas(22;506 789 38166 45896 51596)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A35G	13						.						132.0	127.0	129.0					13																	108881601		2203	4299	6502	107679602	SO:0001583	missense	84945	exon2			AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	ENST00000375898.3:c.35A>G	13.37:g.108881601A>G	ENSP00000365063:p.Glu12Gly	Somatic		Capture	SOLID	Phase_I	107679602	NM_032859	B3KWE7|Q8NBW1|Q96JX9	Missense_Mutation	SNP	ENST00000375898.3	37	CCDS32007.1	.	.	.	.	.	.	.	.	.	.	A	9.351	1.065495	0.20067	.	.	ENSG00000139826	ENST00000375898	T	0.19669	2.13	5.75	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.13884	0.0336	N	0.24115	0.695	0.58432	D	0.999999	B	0.09022	0.002	B	0.06405	0.002	T	0.07443	-1.0772	10	0.26408	T	0.33	-23.8754	10.8366	0.46690	0.9262:0.0:0.0738:0.0	.	12	Q7L211	ABHDD_HUMAN	G	12	ENSP00000365063:E12G	ENSP00000365063:E12G	E	+	2	0	ABHD13	107679602	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.054000	0.76649	0.992000	0.38840	0.455000	0.32223	GAA		0.393	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045743.1	NM_032859	
CREM	1390	hgsc.bcm.edu	37	10	35500607	35500607	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr10:35500607G>A	ENST00000395895.2	+	10	1124	c.962G>A	c.(961-963)cGt>cAt	p.R321H	RP11-324I22.3_ENST00000602435.1_RNA|CREM_ENST00000342105.3_Missense_Mutation_p.R205H|CREM_ENST00000484283.1_Missense_Mutation_p.R179H|CREM_ENST00000374728.3_Missense_Mutation_p.R181H|CREM_ENST00000487763.1_Missense_Mutation_p.R81H|CREM_ENST00000429130.3_Missense_Mutation_p.R305H|CREM_ENST00000479070.1_Missense_Mutation_p.R272H|CREM_ENST00000439705.1_3'UTR|CREM_ENST00000395887.3_Missense_Mutation_p.R242H|CREM_ENST00000344351.5_3'UTR|CREM_ENST00000468236.1_Missense_Mutation_p.R85H|CREM_ENST00000460270.1_3'UTR|CREM_ENST00000333809.8_3'UTR|CREM_ENST00000490511.1_Missense_Mutation_p.R73H|CREM_ENST00000348787.2_Missense_Mutation_p.R181H|CREM_ENST00000488328.1_Missense_Mutation_p.R69H|CREM_ENST00000361599.4_Missense_Mutation_p.R230H|CREM_ENST00000345491.3_Missense_Mutation_p.R260H|CREM_ENST00000474362.1_Missense_Mutation_p.R56H|CREM_ENST00000356917.5_3'UTR|CREM_ENST00000354759.3_3'UTR|CREM_ENST00000463314.1_Missense_Mutation_p.R98H|CREM_ENST00000463960.1_Missense_Mutation_p.R154H|CREM_ENST00000374721.3_3'UTR|CREM_ENST00000473940.1_3'UTR			Q03060	CREM_HUMAN	cAMP responsive element modulator	321	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cell differentiation (GO:0030154)|glycosphingolipid metabolic process (GO:0006687)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	cAMP response element binding protein binding (GO:0008140)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R242H(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14						GAATGTCGACGTCGAAAGAAA	0.408																																					p.R260H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G779A	10						.						86.0	86.0	86.0					10																	35500607		2203	4300	6503	35540613	SO:0001583	missense	1390	exon8				CCDS7180.1, CCDS7181.1, CCDS7182.1, CCDS7183.1, CCDS7184.1, CCDS7185.1, CCDS7186.1, CCDS7187.1, CCDS7188.1, CCDS31181.1, CCDS53519.1, CCDS53520.1, CCDS53517.1, CCDS53518.1, CCDS53521.1, CCDS58074.1, CCDS58075.1, CCDS58076.1	10p12.1-p11.1	2013-01-10			ENSG00000095794	ENSG00000095794		"""basic leucine zipper proteins"""	2352	protein-coding gene	gene with protein product		123812				1461747, 7916662	Standard	NM_182717		Approved	hCREM-2	uc001iyb.3	Q03060	OTTHUMG00000017953	ENST00000395895.2:c.962G>A	10.37:g.35500607G>A	ENSP00000379232:p.Arg321His	Somatic		Capture	SOLID	Phase_I	35540613	NM_181571	A8K014|A8K3J7|A8K6A1|A8MPQ2|B4DXC1|C9J785|C9JZ10|E9PAR4|E9PHM1|O75519|Q14501|Q14503|Q14504|Q14505|Q14506|Q15731|Q16114|Q16116|Q5T9H7|Q5W1A6|Q5W1A7|Q5W1A8|Q5W1A9|Q5W1B0|Q5W1B2|Q7Z2Q6|Q8IVD4|Q96AG7|Q9NZ98|Q9NZ99|Q9NZB9	Missense_Mutation	SNP	ENST00000395895.2	37		.	.	.	.	.	.	.	.	.	.	G	18.29	3.590349	0.66105	.	.	ENSG00000095794	ENST00000474362;ENST00000345491;ENST00000395895;ENST00000374728;ENST00000487132;ENST00000479070;ENST00000429130;ENST00000489627;ENST00000493508;ENST00000490263;ENST00000348787;ENST00000374722;ENST00000361599;ENST00000484283;ENST00000395887;ENST00000463314;ENST00000342105;ENST00000463960;ENST00000487763;ENST00000488328;ENST00000468236;ENST00000490511	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43	5.95	5.95	0.96441	Basic-leucine zipper (bZIP) transcription factor (3);bZIP transcription factor, bZIP-1 (1);	.	.	.	.	T	0.75525	0.3861	M	0.87097	2.86	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.91635	0.993;0.987;0.994;0.998;0.999;0.997;0.996;0.996;0.999;0.999	T	0.79019	-0.1974	9	0.87932	D	0	-8.0015	13.577	0.61879	0.0705:0.0:0.9295:0.0	.	73;69;81;309;321;205;179;230;181;260	E9PAR4;Q03060-11;Q03060-10;Q03060-1;Q03060;Q03060-7;Q03060-13;Q03060-12;Q5W1A7;Q03060-16	.;.;.;.;CREM_HUMAN;.;.;.;.;.	H	56;260;321;181;181;272;305;165;114;230;181;293;230;179;242;98;205;154;81;69;85;73	ENSP00000419018:R56H;ENSP00000265372:R260H;ENSP00000379232:R321H;ENSP00000363860:R181H;ENSP00000418798:R181H;ENSP00000420511:R272H;ENSP00000393538:R305H;ENSP00000345384:R181H;ENSP00000354593:R230H;ENSP00000417165:R179H;ENSP00000379225:R242H;ENSP00000418336:R98H;ENSP00000341875:R205H;ENSP00000419684:R154H;ENSP00000417807:R81H;ENSP00000417460:R69H;ENSP00000419810:R85H;ENSP00000417327:R73H	ENSP00000341875:R205H	R	+	2	0	CREM	35540613	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.692000	0.74578	2.827000	0.97445	0.650000	0.86243	CGT		0.408	CREM-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001881	
ALOX5	240	hgsc.bcm.edu	37	10	45877981	45877981	+	Silent	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr10:45877981G>A	ENST00000374391.2	+	2	254	c.201G>A	c.(199-201)ctG>ctA	p.L67L	ALOX5_ENST00000542434.1_Silent_p.L67L	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	67	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)	p.L67L(1)		breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	AGATCCAGCTGGTCAGAATCG	0.562																																					p.L67L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G201A	10						.						158.0	118.0	132.0					10																	45877981		2203	4300	6503	45197987	SO:0001819	synonymous_variant	240	exon2			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.201G>A	10.37:g.45877981G>A		Somatic		Capture	SOLID	Phase_I	45197987	NM_000698	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Silent	SNP	ENST00000374391.2	37	CCDS7212.1																																																																																				0.562	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1		
ANK3	288	hgsc.bcm.edu	37	10	61823930	61823930	+	Missense_Mutation	SNP	C	C	T	rs184370155		TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr10:61823930C>T	ENST00000280772.2	-	39	12627	c.12436G>A	c.(12436-12438)Gga>Aga	p.G4146R	ANK3_ENST00000373827.2_Missense_Mutation_p.G1527R|ANK3_ENST00000503366.1_Missense_Mutation_p.G1534R|ANK3_ENST00000355288.2_Missense_Mutation_p.G667R	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4146	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.G4146R(1)|p.G667R(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GCATTTTTTCCGTCTCTGGTA	0.299													C|||	1	0.000199681	0.0	0.0	5008	,	,		16955	0.001		0.0	False		,,,				2504	0.0				p.G4146R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G12436A	10						.						80.0	84.0	83.0					10																	61823930		2202	4298	6500	61493936	SO:0001583	missense	288	exon39			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12436G>A	10.37:g.61823930C>T	ENSP00000280772:p.Gly4146Arg	Somatic		Capture	SOLID	Phase_I	61493936	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	26.6	4.754327	0.89843	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817	D;D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82;-3.82	5.4	5.4	0.78164	Death (3);DEATH-like (2);	0.000000	0.38548	N	0.001650	D	0.97714	0.9250	M	0.78801	2.425	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;1.0;0.995;0.999;0.999;1.0;0.999	D	0.98356	1.0546	10	0.87932	D	0	.	19.1741	0.93597	0.0:1.0:0.0:0.0	.	1534;667;1527;4146;768;667;66	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2;B1AQT0	.;.;.;ANK3_HUMAN;.;.;.	R	4146;1527;125;667;667;1534;1513;768	ENSP00000280772:G4146R;ENSP00000362933:G1527R;ENSP00000362926:G125R;ENSP00000347436:G667R;ENSP00000425236:G1534R	ENSP00000280772:G4146R	G	-	1	0	ANK3	61493936	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.530000	0.85305	0.655000	0.94253	GGA		0.299	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
APC	324	hgsc.bcm.edu	37	5	112173917	112173917	+	Nonsense_Mutation	SNP	C	C	T	rs121913333		TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr5:112173917C>T	ENST00000457016.1	+	16	3006	c.2626C>T	c.(2626-2628)Cga>Tga	p.R876*	APC_ENST00000508376.2_Nonsense_Mutation_p.R876*|APC_ENST00000257430.4_Nonsense_Mutation_p.R876*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	876	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R876*(38)|p.S874_R876>*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTCTTCAAAGCGAGGTTTGCA	0.463		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R858X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0	.	40	Substitution - Nonsense(38)|Unknown(1)|Complex - deletion inframe(1)	large_intestine(37)|lung(1)|breast(1)|skin(1)	c.C2572T	5	GRCh37	CM942020	APC	M	rs121913333	.						70.0	72.0	71.0					5																	112173917		2202	4300	6502	112201816	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2626C>T	5.37:g.112173917C>T	ENSP00000413133:p.Arg876*	Somatic		Capture	SOLID	Phase_I	112201816	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.588996	0.97688	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.92	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2738	14.8639	0.70401	0.3912:0.6088:0.0:0.0	.	.	.	.	X	876;858;876;876;876	.	ENSP00000257430:R876X	R	+	1	2	APC	112201816	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.385000	0.34408	0.785000	0.33685	0.557000	0.71058	CGA		0.463	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PLCXD3	345557	hgsc.bcm.edu	37	5	41382235	41382235	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr5:41382235T>C	ENST00000377801.3	-	2	579	c.505A>G	c.(505-507)Aaa>Gaa	p.K169E	PLCXD3_ENST00000328457.3_Missense_Mutation_p.K169E			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	169	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)	p.K169E(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GGGCACATTTTATTTCCATAG	0.428																																					p.K169E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A505G	5						.						102.0	103.0	103.0					5																	41382235		2203	4300	6503	41417992	SO:0001583	missense	345557	exon2				CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.505A>G	5.37:g.41382235T>C	ENSP00000367032:p.Lys169Glu	Somatic		Capture	SOLID	Phase_I	41417992	NM_001005473	A6NL04	Missense_Mutation	SNP	ENST00000377801.3	37	CCDS34150.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.945930	0.53079	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	T;T	0.63096	-0.02;-0.02	5.81	5.81	0.92471	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (2);	0.045391	0.85682	D	0.000000	T	0.65281	0.2676	M	0.82630	2.6	0.52501	D	0.999958	B	0.33807	0.426	B	0.31547	0.132	T	0.65442	-0.6167	10	0.29301	T	0.29	-17.41	16.1668	0.81768	0.0:0.0:0.0:1.0	.	169	Q63HM9	PLCX3_HUMAN	E	169	ENSP00000367032:K169E;ENSP00000333751:K169E	ENSP00000333751:K169E	K	-	1	0	PLCXD3	41417992	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.742000	0.68646	2.210000	0.71456	0.533000	0.62120	AAA		0.428	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367109.1	XM_293875	
PELO	53918	hgsc.bcm.edu	37	5	52096723	52096723	+	Silent	SNP	G	G	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr5:52096723G>A	ENST00000274311.2	+	2	1480	c.495G>A	c.(493-495)gtG>gtA	p.V165V	ITGA1_ENST00000504086.1_Intron|ITGA1_ENST00000282588.6_Intron|PELO_ENST00000506949.1_Intron	NM_015946.4	NP_057030.3	Q9BRX2	PELO_HUMAN	pelota homolog (Drosophila)	165					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA catabolic process, non-stop decay (GO:0070481)|RNA surveillance (GO:0071025)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.V165V(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	11		Lung NSC(810;4.94e-05)|Breast(144;0.0848)				AGGTGGAGGTGAACATCCCTA	0.577																																					p.V165V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G495A	5						.						92.0	80.0	84.0					5																	52096723		2203	4300	6503	52132480	SO:0001819	synonymous_variant	53918	exon2				CCDS3956.1	5q11.2	2008-07-18	2001-11-28		ENSG00000152684	ENSG00000152684			8829	protein-coding gene	gene with protein product		605757	"""pelota (Drosophila) homolog"""			11060452	Standard	NM_015946		Approved		uc003jos.3	Q9BRX2	OTTHUMG00000096973	ENST00000274311.2:c.495G>A	5.37:g.52096723G>A		Somatic		Capture	SOLID	Phase_I	52132480	NM_015946	Q9GZS6|Q9Y306	Silent	SNP	ENST00000274311.2	37	CCDS3956.1																																																																																				0.577	PELO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214040.1	NM_015946	
MAP1B	4131	hgsc.bcm.edu	37	5	71496024	71496024	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr5:71496024C>T	ENST00000296755.7	+	5	7140	c.6842C>T	c.(6841-6843)tCg>tTg	p.S2281L		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2281					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.S2281L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AAAGAATCCTCGGATAAAGTG	0.498																																					p.S2281L	Melanoma(17;367 822 11631 31730 47712)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6842T	5						.						96.0	107.0	103.0					5																	71496024		2203	4300	6503	71531780	SO:0001583	missense	4131	exon5			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6842C>T	5.37:g.71496024C>T	ENSP00000296755:p.Ser2281Leu	Somatic		Capture	SOLID	Phase_I	71531780	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591594	0.28357	.	.	ENSG00000131711	ENST00000296755	T	0.03330	3.97	6.03	3.74	0.42951	.	0.271416	0.26055	N	0.026606	T	0.01592	0.0051	N	0.03084	-0.415	0.31744	N	0.635391	B;B	0.20671	0.047;0.001	B;B	0.12156	0.007;0.001	T	0.28744	-1.0034	10	0.25751	T	0.34	-4.0381	4.5234	0.11969	0.0:0.47:0.0:0.53	.	2155;2281	A2BDK6;P46821	.;MAP1B_HUMAN	L	2281	ENSP00000296755:S2281L	ENSP00000296755:S2281L	S	+	2	0	MAP1B	71531780	0.968000	0.33430	0.994000	0.49952	0.528000	0.34623	2.466000	0.45084	1.301000	0.44836	0.655000	0.94253	TCG		0.498	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
CRHBP	1393	hgsc.bcm.edu	37	5	76254586	76254586	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr5:76254586A>G	ENST00000274368.4	+	5	987	c.565A>G	c.(565-567)Act>Gct	p.T189A	CRHBP_ENST00000506501.1_Missense_Mutation_p.T189A|CRHBP_ENST00000514258.1_3'UTR	NM_001882.3	NP_001873.2	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	189					behavioral response to ethanol (GO:0048149)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cellular response to cocaine (GO:0071314)|cellular response to drug (GO:0035690)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to potassium ion (GO:0035865)|cellular response to stress (GO:0033554)|cellular response to tumor necrosis factor (GO:0071356)|female pregnancy (GO:0007565)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|inflammatory response (GO:0006954)|learning or memory (GO:0007611)|maternal aggressive behavior (GO:0002125)|negative regulation of corticotropin secretion (GO:0051460)|negative regulation of corticotropin-releasing hormone receptor activity (GO:1900011)|regulated secretory pathway (GO:0045055)|regulation of corticotropin secretion (GO:0051459)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|synaptic transmission, dopaminergic (GO:0001963)	axon terminus (GO:0043679)|dendrite (GO:0030425)|dense core granule (GO:0031045)|extracellular space (GO:0005615)|intracellular (GO:0005622)|microtubule (GO:0005874)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|perikaryon (GO:0043204)|secondary lysosome (GO:0005767)|secretory granule (GO:0030141)|varicosity (GO:0043196)	corticotropin-releasing hormone binding (GO:0051424)|peptide binding (GO:0042277)	p.T189A(1)		kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		CATTTCTCAGACTCCAAATGG	0.358																																					p.T189A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A565G	5						.						83.0	81.0	81.0					5																	76254586		2203	4300	6503	76290342	SO:0001583	missense	1393	exon5			X58022	CCDS4034.1	5q	2008-07-18	2001-11-28		ENSG00000145708	ENSG00000145708			2356	protein-coding gene	gene with protein product		122559	"""corticotropin releasing hormone-binding protein"""			8198617	Standard	NM_001882		Approved	CRF-BP, CRFBP	uc003ker.3	P24387	OTTHUMG00000102133	ENST00000274368.4:c.565A>G	5.37:g.76254586A>G	ENSP00000274368:p.Thr189Ala	Somatic		Capture	SOLID	Phase_I	76290342	NM_001882	Q53F32|Q6FHT5	Missense_Mutation	SNP	ENST00000274368.4	37	CCDS4034.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.700225	0.30142	.	.	ENSG00000145708	ENST00000274368;ENST00000506501	.	.	.	4.68	4.68	0.58851	.	0.202388	0.43579	D	0.000555	T	0.60869	0.2302	M	0.69823	2.125	0.41436	D	0.987898	P;P	0.42203	0.773;0.64	P;B	0.46172	0.506;0.334	T	0.62996	-0.6735	9	0.41790	T	0.15	-4.3053	9.7586	0.40519	0.8457:0.0:0.0:0.1542	.	189;189	D6RHH7;P24387	.;CRHBP_HUMAN	A	189	.	ENSP00000274368:T189A	T	+	1	0	CRHBP	76290342	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	3.192000	0.50989	1.855000	0.53841	0.254000	0.18369	ACT		0.358	CRHBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219972.2	NM_001882	
EDIL3	10085	hgsc.bcm.edu	37	5	83433156	83433156	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr5:83433156T>G	ENST00000296591.5	-	5	790	c.372A>C	c.(370-372)gaA>gaC	p.E124D	EDIL3_ENST00000380138.3_Missense_Mutation_p.E114D	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	124	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.E124D(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		AAGGCTCAACTTCGCATTCAT	0.333																																					p.E124D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A372C	5						.						167.0	149.0	155.0					5																	83433156		2203	4300	6503	83468912	SO:0001583	missense	10085	exon5			U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.372A>C	5.37:g.83433156T>G	ENSP00000296591:p.Glu124Asp	Somatic		Capture	SOLID	Phase_I	83468912	NM_005711	B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	37	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.616113	0.46631	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.91740	-2.9;-2.9	5.2	5.2	0.72013	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.91399	0.7286	N	0.20401	0.57	0.54753	D	0.999986	D;B	0.56035	0.974;0.04	D;B	0.70487	0.969;0.008	D	0.91286	0.5055	10	0.52906	T	0.07	-31.4283	9.8348	0.40963	0.0:0.0771:0.0:0.9229	.	114;124	O43854-2;O43854	.;EDIL3_HUMAN	D	124;114	ENSP00000296591:E124D;ENSP00000369483:E114D	ENSP00000296591:E124D	E	-	3	2	EDIL3	83468912	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	4.470000	0.60175	2.103000	0.63969	0.460000	0.39030	GAA		0.333	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711	
MCTP1	79772	hgsc.bcm.edu	37	5	94248566	94248566	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr5:94248566C>A	ENST00000515393.1	-	9	1465	c.1466G>T	c.(1465-1467)gGg>gTg	p.G489V	MCTP1_ENST00000505208.1_Missense_Mutation_p.G268V|MCTP1_ENST00000505078.1_Missense_Mutation_p.G5V|MCTP1_ENST00000312216.8_Missense_Mutation_p.G268V|MCTP1_ENST00000429576.2_Missense_Mutation_p.G222V	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	489	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.G489V(1)		breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		ATCGCTCAACCCGTTGGAATC	0.468																																					p.G268V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G803T	5						.						173.0	155.0	161.0					5																	94248566		2203	4300	6503	94274322	SO:0001583	missense	79772	exon9				CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.1466G>T	5.37:g.94248566C>A	ENSP00000424126:p.Gly489Val	Somatic		Capture	SOLID	Phase_I	94274322	NM_001002796	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Missense_Mutation	SNP	ENST00000515393.1	37	CCDS34203.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.292511	0.80914	.	.	ENSG00000175471	ENST00000515393;ENST00000429576;ENST00000505078;ENST00000312216;ENST00000508509;ENST00000512425;ENST00000505208;ENST00000506568;ENST00000415885;ENST00000507214	T;D;T;T;D;T;T;D;D	0.84442	0.57;-1.75;0.57;0.57;-1.75;0.57;0.57;-1.75;-1.85	5.72	5.72	0.89469	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.051231	0.85682	D	0.000000	D	0.94781	0.8315	M	0.93241	3.395	0.80722	D	1	D;D;D	0.89917	1.0;0.995;1.0	D;D;D	0.91635	0.999;0.973;0.995	D	0.95311	0.8412	10	0.66056	D	0.02	-15.7944	19.8868	0.96915	0.0:1.0:0.0:0.0	.	489;222;268	Q6DN14;Q6DN14-3;Q6DN14-2	MCTP1_HUMAN;.;.	V	489;222;5;268;209;150;268;90;184;191	ENSP00000424126:G489V;ENSP00000391639:G222V;ENSP00000426417:G5V;ENSP00000308957:G268V;ENSP00000423410:G209V;ENSP00000431075:G150V;ENSP00000426438:G268V;ENSP00000426294:G90V;ENSP00000424936:G191V	ENSP00000308957:G268V	G	-	2	0	MCTP1	94274322	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.487000	0.81328	2.689000	0.91719	0.650000	0.86243	GGG		0.468	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	NM_024717	
APC	324	hgsc.bcm.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00U-01A-01W-A005-10	TCGA-AA-A00U-10A-01W-A005-10	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*|APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Capture	SOLID	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		0.478	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
