#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HTRA1	5654	broad.mit.edu	37	10	124249134	124249134	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr10:124249134G>T	ENST00000368984.3	+	3	897	c.769G>T	c.(769-771)Gac>Tac	p.D257Y		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	257	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.D257Y(1)		endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				CATCAAAATTGACCACCAGGT	0.512																																					p.D257Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G769T	10						.						91.0	69.0	76.0					10																	124249134		2203	4300	6503	124239124	SO:0001583	missense	5654	exon3			AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.769G>T	10.37:g.124249134G>T	ENSP00000357980:p.Asp257Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	124239124	NM_002775	D3DRE4|Q9UNS5	Missense_Mutation	SNP	ENST00000368984.3	37	CCDS7630.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480736	0.44044	.	.	ENSG00000166033	ENST00000368984;ENST00000435263	D	0.89343	-2.5	5.13	5.13	0.70059	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.100619	0.64402	D	0.000002	D	0.90246	0.6950	M	0.83483	2.645	0.80722	D	1	B	0.25743	0.133	B	0.27887	0.084	D	0.89187	0.3548	10	0.59425	D	0.04	-36.4798	16.7968	0.85604	0.0:0.0:1.0:0.0	.	257	Q92743	HTRA1_HUMAN	Y	257;224	ENSP00000357980:D257Y	ENSP00000357980:D257Y	D	+	1	0	HTRA1	124239124	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	6.679000	0.74513	2.386000	0.81285	0.650000	0.86243	GAC		0.512	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128327.1	NM_002775	
ARHGAP21	57584	broad.mit.edu	37	10	24909061	24909061	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr10:24909061G>C	ENST00000396432.2	-	9	2249	c.1763C>G	c.(1762-1764)cCa>cGa	p.P588R	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.P375R	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	587					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.P587R(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TTTTAGATCTGGTGGAATTTT	0.423																																					p.P588R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1763G	10						.						71.0	71.0	71.0					10																	24909061		2203	4299	6502	24949067	SO:0001583	missense	57584	exon9			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1763C>G	10.37:g.24909061G>C	ENSP00000379709:p.Pro588Arg	Somatic		Capture	Illumina HiSeq	Phase_I	24949067	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	G	10.60	1.394781	0.25205	.	.	ENSG00000107863	ENST00000396432;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.50813	2.69;2.82;0.73;0.74	5.5	4.58	0.56647	.	0.619944	0.17605	N	0.168265	T	0.46776	0.1410	M	0.67953	2.075	0.36568	D	0.872842	B;P	0.41597	0.026;0.756	B;B	0.35727	0.032;0.209	T	0.62034	-0.6939	10	0.66056	D	0.02	.	14.9094	0.70743	0.0698:0.0:0.9302:0.0	.	578;587	F8W9U9;Q5T5U3	.;RHG21_HUMAN	R	588;375;578;588;423	ENSP00000379709:P588R;ENSP00000365604:P375R;ENSP00000365592:P578R;ENSP00000405018:P588R	ENSP00000365604:P375R	P	-	2	0	ARHGAP21	24949067	0.993000	0.37304	0.043000	0.18650	0.400000	0.30750	4.336000	0.59304	1.423000	0.47198	0.650000	0.86243	CCA		0.423	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
EXOC6	54536	broad.mit.edu	37	10	94669311	94669311	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr10:94669311T>A	ENST00000260762.6	+	6	600	c.586T>A	c.(586-588)Tcc>Acc	p.S196T	EXOC6_ENST00000443748.2_Missense_Mutation_p.S196T|EXOC6_ENST00000497262.1_3'UTR|EXOC6_ENST00000371552.4_Missense_Mutation_p.S191T|EXOC6_ENST00000371547.4_Missense_Mutation_p.S212T	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	196					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)		p.S196T(1)|p.S191T(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				TAAAGAAATCTCCATGTCTGA	0.343																																					p.S191T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T571A	10						.						87.0	87.0	87.0					10																	94669311		2203	4300	6503	94659291	SO:0001583	missense	54536	exon6			BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.586T>A	10.37:g.94669311T>A	ENSP00000260762:p.Ser196Thr	Somatic		Capture	Illumina HiSeq	Phase_I	94659291	NM_001013848	E9PHI3|Q5VXH8|Q9NZ24	Missense_Mutation	SNP	ENST00000260762.6	37	CCDS7424.2	.	.	.	.	.	.	.	.	.	.	T	27.0	4.791632	0.90367	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000443748;ENST00000260762	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.59197	0.2176	M	0.83953	2.67	0.37047	D	0.897405	P;D;P;B;B	0.58268	0.631;0.982;0.929;0.357;0.357	B;D;P;B;B	0.67548	0.423;0.952;0.57;0.142;0.217	T	0.70146	-0.4952	10	0.87932	D	0	-7.4382	16.2194	0.82247	0.0:0.0:0.0:1.0	.	212;196;188;196;191	F2Z2Q3;E7EW84;B4DEZ1;Q8TAG9;E9PHI3	.;.;.;EXOC6_HUMAN;.	T	212;191;196;196	ENSP00000360602:S212T;ENSP00000360607:S191T;ENSP00000396206:S196T;ENSP00000260762:S196T	ENSP00000260762:S196T	S	+	1	0	EXOC6	94659291	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.234000	0.73211	0.528000	0.53228	TCC		0.343	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049410.2	NM_019053	
TLL2	7093	broad.mit.edu	37	10	98155664	98155664	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr10:98155664A>G	ENST00000357947.3	-	12	1723	c.1498T>C	c.(1498-1500)Ttt>Ctt	p.F500L	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	500	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CCCACGTGAAACCCCTCTGAA	0.488											OREG0020398	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F500L												.	.	0			c.T1498C	10						.						120.0	112.0	115.0					10																	98155664		2203	4300	6503	98145654	SO:0001583	missense	7093	exon12			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1498T>C	10.37:g.98155664A>G	ENSP00000350630:p.Phe500Leu	None	1333	Capture	Illumina HiSeq	Phase_I	98145654	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.953421	0.92660	.	.	ENSG00000095587	ENST00000357947	T	0.33865	1.39	5.37	5.37	0.77165	CUB (5);	0.145674	0.31673	N	0.007244	T	0.42017	0.1184	L	0.40543	1.245	0.54753	D	0.999989	D	0.54047	0.964	P	0.53102	0.718	T	0.11542	-1.0583	10	0.30078	T	0.28	.	14.7123	0.69241	1.0:0.0:0.0:0.0	.	500	Q9Y6L7	TLL2_HUMAN	L	500	ENSP00000350630:F500L	ENSP00000350630:F500L	F	-	1	0	TLL2	98145654	1.000000	0.71417	0.270000	0.24601	0.642000	0.38348	9.087000	0.94110	2.254000	0.74563	0.460000	0.39030	TTT		0.488	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
C10orf90	118611	broad.mit.edu	37	10	128149983	128149983	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr10:128149983G>C	ENST00000284694.7	-	5	1826	c.1706C>G	c.(1705-1707)tCt>tGt	p.S569C	C10orf90_ENST00000480379.1_De_novo_Start_OutOfFrame|C10orf90_ENST00000544758.1_Missense_Mutation_p.S666C|C10orf90_ENST00000356858.3_Missense_Mutation_p.S522C|C10orf90_ENST00000454341.1_Missense_Mutation_p.S472C	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	569					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.S569C(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		CAAGGTCAAAGATCTTGCAGG	0.587																																					p.S569C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1706G	10						.						70.0	67.0	68.0					10																	128149983		2203	4300	6503	128139973	SO:0001583	missense	118611	exon5			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1706C>G	10.37:g.128149983G>C	ENSP00000284694:p.Ser569Cys	Somatic		Capture	Illumina HiSeq	Phase_I	128139973	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	37	CCDS31310.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.20|15.20	2.763105|2.763105	0.49574|0.49574	.|.	.|.	ENSG00000154493|ENSG00000154493	ENST00000424927|ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642	.|T;T;T;T	.|0.19806	.|2.12;2.15;2.13;2.12	5.02|5.02	3.09|3.09	0.35607|0.35607	.|.	.|0.445488	.|0.19120	.|N	.|0.122216	T|T	0.35595|0.35595	0.0937|0.0937	M|M	0.63843|0.63843	1.955|1.955	0.09310|0.09310	N|N	1|1	.|D;D;D	.|0.71674	.|0.997;0.998;0.997	.|P;P;P	.|0.60415	.|0.874;0.874;0.824	T|T	0.09422|0.09422	-1.0675|-1.0675	5|10	.|0.72032	.|D	.|0.01	-6.6399|-6.6399	8.6591|8.6591	0.34081|0.34081	0.0:0.1521:0.6491:0.1988|0.0:0.1521:0.6491:0.1988	.|.	.|666;569;472	.|F5GZL2;Q96M02;Q96M02-2	.|.;CJ090_HUMAN;.	V|C	112|522;569;472;666;569	.|ENSP00000284694:S569C;ENSP00000398786:S472C;ENSP00000444369:S666C;ENSP00000405995:S569C	.|ENSP00000284694:S569C	L|S	-|-	1|2	0|0	C10orf90|C10orf90	128139973|128139973	0.023000|0.023000	0.18921|0.18921	0.362000|0.362000	0.25862|0.25862	0.105000|0.105000	0.19272|0.19272	1.128000|1.128000	0.31369|0.31369	0.633000|0.633000	0.30452|0.30452	0.561000|0.561000	0.74099|0.74099	CTT|TCT		0.587	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
CFAP46	54777	broad.mit.edu	37	10	134752246	134752246	+	Frame_Shift_Del	DEL	A	A	-	rs555272927		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr10:134752246delA	ENST00000368586.5	-	5	483	c.383delT	c.(382-384)ttgfs	p.L128fs	TTC40_ENST00000368585.3_Frame_Shift_Del_p.L128fs|TTC40_ENST00000368582.2_Frame_Shift_Del_p.L128fs	NM_001200049.2	NP_001186978.2												p.L128fs*13(1)|p.L70fs*13(1)		breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						ATTGTACACCAAAAAGTAGTA	0.572																																					p.L128fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.383delT	10						.						119.0	107.0	111.0					10																	134752246		2203	4300	6503	134602236	SO:0001589	frameshift_variant	255352	exon5																														ENST00000368586.5:c.383delT	10.37:g.134752246delA	ENSP00000357575:p.Leu128fs	Somatic		Capture	Illumina HiSeq	Phase_I	134602236	NM_173572		Frame_Shift_Del	DEL	ENST00000368586.5	37	CCDS58101.1																																																																																				0.572	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
BDNF	627	broad.mit.edu	37	11	27679629	27679629	+	Silent	SNP	G	G	A	rs376008850		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr11:27679629G>A	ENST00000525528.1	-	1	1576	c.483C>T	c.(481-483)ggC>ggT	p.G161G	BDNF-AS_ENST00000502161.2_RNA|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000532997.1_Silent_p.G161G|BDNF_ENST00000439476.2_Silent_p.G161G|BDNF_ENST00000584049.1_5'UTR|BDNF_ENST00000395986.2_Silent_p.G176G|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000525950.1_Silent_p.G161G|BDNF_ENST00000530861.1_Silent_p.G161G|BDNF_ENST00000395978.3_Silent_p.G161G|BDNF_ENST00000533131.1_Silent_p.G161G|BDNF_ENST00000533246.1_Silent_p.G161G|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000438929.1_Silent_p.G243G|BDNF-AS_ENST00000499568.2_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000418212.1_Silent_p.G161G|BDNF_ENST00000395980.2_Silent_p.G161G|BDNF_ENST00000314915.6_Silent_p.G169G|BDNF_ENST00000395981.3_Silent_p.G161G|BDNF_ENST00000420794.1_Silent_p.G161G|BDNF_ENST00000395983.3_Silent_p.G161G|BDNF_ENST00000356660.4_Silent_p.G161G|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000500662.2_RNA	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	161					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)	p.G169G(1)		breast(1)|large_intestine(3)|lung(2)	6						TGACCGTCCCGCCCGACATGT	0.532																																					p.G161G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C483T	11						.						167.0	165.0	166.0					11																	27679629		2202	4299	6501	27636205	SO:0001819	synonymous_variant	627	exon2			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.483C>T	11.37:g.27679629G>A		Somatic		Capture	Illumina HiSeq	Phase_I	27636205	NM_001143805	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Silent	SNP	ENST00000525528.1	37	CCDS7866.1																																																																																				0.532	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735	
SMTNL1	219537	broad.mit.edu	37	11	57317580	57317581	+	Missense_Mutation	DNP	AA	AA	TG			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	AA	AA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr11:57317580_57317581AA>TG	ENST00000399154.2	+	8	1369_1370	c.1369_1370AA>TG	c.(1369-1371)AAg>TGg	p.K457W	SMTNL1_ENST00000457912.1_Missense_Mutation_p.K512W|SMTNL1_ENST00000527972.1_Missense_Mutation_p.K494W			A8MU46	SMTL1_HUMAN	smoothelin-like 1	457	Calmodulin-binding. {ECO:0000250}.				negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.K512>?(2)		endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						GACCAAGAAGAAGTGAGGAGGT	0.609																																					.												.	.	2	Complex(2)	large_intestine(2)	c.1480_1481TG	11						.																																			57074157	SO:0001583	missense	219537	exon7			BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		Exception_encountered	11.37:g.57317580_57317581delinsTG	ENSP00000382108:p.Lys457Trp	Somatic		Capture	Illumina HiSeq	Phase_I	57074156	NM_001105565		Missense_Mutation	DNP	ENST00000399154.2	37																																																																																					0.609	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_166203	
FAT3	120114	broad.mit.edu	37	11	92526140	92526140	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr11:92526140G>A	ENST00000298047.6	+	8	4836	c.4819G>A	c.(4819-4821)Gca>Aca	p.A1607T	FAT3_ENST00000409404.2_Missense_Mutation_p.A1607T|FAT3_ENST00000525166.1_Missense_Mutation_p.A1457T			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1607	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A1607T(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TACCATAGAAGCAGGTGAGAG	0.433										TCGA Ovarian(4;0.039)																											p.A1607T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4819A	11						.						62.0	63.0	63.0					11																	92526140		1970	4164	6134	92165788	SO:0001583	missense	120114	exon8			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4819G>A	11.37:g.92526140G>A	ENSP00000298047:p.Ala1607Thr	Somatic		Capture	Illumina HiSeq	Phase_I	92165788	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	20.6	4.012699	0.75161	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.52295	0.67;0.67;0.67	5.87	3.93	0.45458	.	.	.	.	.	T	0.40196	0.1107	N	0.11106	0.095	0.80722	D	1	P	0.50369	0.934	P	0.51170	0.661	T	0.44772	-0.9306	9	0.59425	D	0.04	.	14.3833	0.66926	0.0:0.0:0.4949:0.5051	.	1607	Q8TDW7-3	.	T	1607;1607;1457	ENSP00000298047:A1607T;ENSP00000387040:A1607T;ENSP00000432586:A1457T	ENSP00000298047:A1607T	A	+	1	0	FAT3	92165788	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.706000	0.47135	0.864000	0.35578	0.655000	0.94253	GCA		0.433	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
HTR3A	3359	broad.mit.edu	37	11	113853875	113853875	+	Silent	SNP	C	C	T	rs150595107	byFrequency	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr11:113853875C>T	ENST00000504030.2	+	5	853	c.408C>T	c.(406-408)taC>taT	p.Y136Y	HTR3A_ENST00000355556.2_Silent_p.Y142Y|HTR3A_ENST00000299961.5_Silent_p.Y121Y|HTR3A_ENST00000375498.2_Silent_p.Y142Y|HTR3A_ENST00000506841.2_Silent_p.Y136Y|HTR3A_ENST00000535865.1_5'UTR			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	136					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)	p.Y136Y(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	ATATCCCGTACGTGTATATTC	0.537													C|||	5	0.000998403	0.003	0.0014	5008	,	,		19928	0.0		0.0	False		,,,				2504	0.0				p.Y142Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C426T	11						.	C	,,	6,4396	12.9+/-30.5	0,6,2195	148.0	131.0	137.0		426,363,426	-3.4	0.3	11	dbSNP_134	137	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous,coding-synonymous,coding-synonymous	HTR3A	NM_000869.5,NM_001161772.2,NM_213621.3	,,	0,7,6490	TT,TC,CC		0.0116,0.1363,0.0539	,,	142/485,121/464,142/517	113853875	7,12987	2201	4296	6497	113359085	SO:0001819	synonymous_variant	3359	exon5			D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.408C>T	11.37:g.113853875C>T		Somatic		Capture	Illumina HiSeq	Phase_I	113359085	NM_000869	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Silent	SNP	ENST00000504030.2	37																																																																																					0.537	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000360822.2	NM_000869	
SLC48A1	55652	broad.mit.edu	37	12	48174090	48174091	+	3'UTR	INS	-	-	G	rs558008660	byFrequency	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr12:48174090_48174091insG	ENST00000442218.2	+	0	564_565				SLC48A1_ENST00000547002.1_3'UTR|SLC48A1_ENST00000442892.2_Intron	NM_017842.2	NP_060312.2	Q6P1K1	HRG1_HUMAN	solute carrier family 48 (heme transporter), member 1						heme transport (GO:0015886)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	heme transporter activity (GO:0015232)	p.L31fs*2(1)		large_intestine(1)|lung(3)|urinary_tract(1)	5						CTCTGCACCCTGGGGGGGCCTT	0.604													GGGGGGG|GGGGGGG|GGGGGGGG|insertion	3	0.000599042	0.0	0.0	5008	,	,		17812	0.001		0.001	False		,,,				2504	0.001				.												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	.	12						.			7,4257		0,7,2125						-2.1	0.4			53	12,8242		0,12,4115	no	utr-3	SLC48A1	NM_017842.2		0,19,6240	A1A1,A1R,RR		0.1454,0.1642,0.1518				19,12499				46460358	SO:0001624	3_prime_UTR_variant	55652	.				CCDS8755.2	12q13.11	2013-05-22			ENSG00000211584	ENSG00000211584		"""Solute carriers"""	26035	protein-coding gene	gene with protein product		612187				18418376	Standard	NM_017842		Approved	FLJ20489, hHRG-1, HRG1	uc001rqd.3	Q6P1K1	OTTHUMG00000156983	ENST00000442218.2:c.*27->G	12.37:g.48174097_48174097dupG		Somatic		Capture	Illumina HiSeq	Phase_I	46460357	.	Q9BUB3|Q9NX17	Frame_Shift_Ins	INS	ENST00000442218.2	37	CCDS8755.2																																																																																				0.604	SLC48A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346966.1	NM_017842	
APPL2	55198	broad.mit.edu	37	12	105568109	105568109	+	Missense_Mutation	SNP	C	C	T	rs367929771		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr12:105568109C>T	ENST00000258530.3	-	21	2203	c.1978G>A	c.(1978-1980)Gca>Aca	p.A660T	APPL2_ENST00000546731.1_Missense_Mutation_p.A103T|APPL2_ENST00000551662.1_Missense_Mutation_p.A666T|APPL2_ENST00000539978.2_Missense_Mutation_p.A617T	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	0					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)	p.A660T(1)		breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TCGGATTCTGCGCCTCTATGT	0.453													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22714	0.0		0.0	False		,,,				2504	0.0				p.A660T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1978A	12						.	C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	221.0	179.0	194.0		1978	5.0	1.0	12		194	0,8600		0,0,4300	no	missense	APPL2	NM_018171.3	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	660/665	105568109	1,13005	2203	4300	6503	104092239	SO:0001583	missense	55198	exon21			AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.1978G>A	12.37:g.105568109C>T	ENSP00000258530:p.Ala660Thr	Somatic		Capture	Illumina HiSeq	Phase_I	104092239	NM_018171	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	ENST00000258530.3	37	CCDS9101.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.231049	0.58777	2.27E-4	0.0	ENSG00000136044	ENST00000258530;ENST00000539978;ENST00000546731;ENST00000551662	T;T;T	0.25579	2.59;1.79;2.37	5.93	5.04	0.67666	.	0.361920	0.30620	N	0.009225	T	0.14141	0.0342	N	0.14661	0.345	0.30776	N	0.742491	B;B	0.22346	0.068;0.041	B;B	0.10450	0.005;0.002	T	0.12426	-1.0548	10	0.21540	T	0.41	-16.1914	10.5305	0.44973	0.0:0.7972:0.1333:0.0695	.	666;660	F8W1P5;Q8NEU8	.;DP13B_HUMAN	T	660;617;103;666	ENSP00000258530:A660T;ENSP00000444472:A617T;ENSP00000446917:A666T	ENSP00000258530:A660T	A	-	1	0	APPL2	104092239	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.954000	0.40362	1.507000	0.48752	0.655000	0.94253	GCA		0.453	APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406238.3	NM_018171	
KDM5A	5927	broad.mit.edu	37	12	416840	416840	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr12:416840G>A	ENST00000399788.2	-	23	4072	c.3710C>T	c.(3709-3711)cCc>cTc	p.P1237L	KDM5A_ENST00000382815.4_Missense_Mutation_p.P1237L	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1237					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.P1237L(2)		NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						CAACCGTACGGGCAACTTCTG	0.512			T	NUP98	AML																																p.P1237L			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3710T	12						.						74.0	74.0	74.0					12																	416840		1907	4119	6026	287101	SO:0001583	missense	5927	exon23				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.3710C>T	12.37:g.416840G>A	ENSP00000382688:p.Pro1237Leu	Somatic		Capture	Illumina HiSeq	Phase_I	287101	NM_001042603	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799037	0.90538	.	.	ENSG00000073614	ENST00000399788;ENST00000382815	T;T	0.00986	5.47;5.47	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.05410	0.0143	M	0.62088	1.915	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.986;0.994	T	0.20940	-1.0260	10	0.66056	D	0.02	-14.7736	20.0973	0.97856	0.0:0.0:1.0:0.0	.	1237;1237	P29375;P29375-2	KDM5A_HUMAN;.	L	1237	ENSP00000382688:P1237L;ENSP00000372265:P1237L	ENSP00000372265:P1237L	P	-	2	0	KDM5A	287101	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.815000	0.86186	2.830000	0.97506	0.585000	0.79938	CCC		0.512	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056	
PLCZ1	89869	broad.mit.edu	37	12	18876437	18876437	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr12:18876437C>A	ENST00000266505.7	-	4	438	c.175G>T	c.(175-177)Gaa>Taa	p.E59*	PLCZ1_ENST00000435379.1_Intron|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000447925.2_Nonsense_Mutation_p.E57*|PLCZ1_ENST00000539875.1_Intron					phospholipase C, zeta 1									p.E59*(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					GCTCTAAATTCTTCTATGGTG	0.313																																					p.E59X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G175T	12						.						81.0	83.0	83.0					12																	18876437		2202	4298	6500	18767704	SO:0001587	stop_gained	89869	exon4			AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000266505.7:c.175G>T	12.37:g.18876437C>A	ENSP00000266505:p.Glu59*	Somatic		Capture	Illumina HiSeq	Phase_I	18767704	NM_033123		Nonsense_Mutation	SNP	ENST00000266505.7	37	CCDS8680.1	.	.	.	.	.	.	.	.	.	.	C	36	5.965602	0.97151	.	.	ENSG00000139151	ENST00000266505;ENST00000447925	.	.	.	5.02	5.02	0.67125	.	0.232307	0.30076	N	0.010470	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	15.4848	0.75557	0.0:1.0:0.0:0.0	.	.	.	.	X	59;57	.	ENSP00000266505:E59X	E	-	1	0	PLCZ1	18767704	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.770000	0.62309	2.325000	0.78763	0.563000	0.77884	GAA		0.313	PLCZ1-001	KNOWN	NAGNAG_splice_site|non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401667.3	NM_033123	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ACVRL1	94	broad.mit.edu	37	12	52309918	52309918	+	Missense_Mutation	SNP	G	G	A	rs148057374		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr12:52309918G>A	ENST00000388922.4	+	8	1430	c.1147G>A	c.(1147-1149)Gag>Aag	p.E383K	ACVRL1_ENST00000419526.2_Missense_Mutation_p.E209K|ACVRL1_ENST00000550683.1_Missense_Mutation_p.E397K	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	383	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.E383K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	GGTGCTGGACGAGCAGATCCG	0.607																																					p.E383K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1147A	12						.	G	LYS/GLU,LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	104.0	89.0	94.0		1147,1147	5.0	1.0	12	dbSNP_134	94	0,8600		0,0,4300	no	missense,missense	ACVRL1	NM_000020.2,NM_001077401.1	56,56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	383/504,383/504	52309918	1,13005	2203	4300	6503	50596185	SO:0001583	missense	94	exon7			L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.1147G>A	12.37:g.52309918G>A	ENSP00000373574:p.Glu383Lys	Somatic		Capture	Illumina HiSeq	Phase_I	50596185	NM_001077401	A6NGA8	Missense_Mutation	SNP	ENST00000388922.4	37	CCDS31804.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.155393	0.78114	2.27E-4	0.0	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000550683;ENST00000548659;ENST00000419526	D;D;D	0.93307	-3.2;-3.2;-3.2	4.98	4.98	0.66077	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45606	D	0.000350	D	0.94364	0.8188	L	0.35854	1.095	0.80722	D	1	D;D	0.69078	0.968;0.997	P;P	0.62491	0.718;0.903	D	0.94926	0.8078	10	0.87932	D	0	.	18.4442	0.90678	0.0:0.0:1.0:0.0	.	209;383	E7EN07;P37023	.;ACVL1_HUMAN	K	383;383;397;209;209	ENSP00000373574:E383K;ENSP00000447884:E397K;ENSP00000392492:E209K	ENSP00000267008:E383K	E	+	1	0	ACVRL1	50596185	1.000000	0.71417	0.967000	0.41034	0.073000	0.16967	9.648000	0.98483	2.763000	0.94921	0.563000	0.77884	GAG		0.607	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2		
ACVR1B	91	broad.mit.edu	37	12	52378999	52378999	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr12:52378999G>A	ENST00000257963.4	+	6	1080	c.1003G>A	c.(1003-1005)Gac>Aac	p.D335N	ACVR1B_ENST00000563121.1_3'UTR|ACVR1B_ENST00000426655.2_Missense_Mutation_p.D335N|ACVR1B_ENST00000542485.1_Missense_Mutation_p.D283N|ACVR1B_ENST00000541224.1_Missense_Mutation_p.D376N|RNU6-574P_ENST00000384265.1_RNA|ACVR1B_ENST00000415850.2_Missense_Mutation_p.D335N	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	335	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.D335N(1)|p.D376N(1)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TGCTCATCGAGACTTAAAGTC	0.438																																					p.D283N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G847A	12						.						83.0	79.0	81.0					12																	52378999		2203	4300	6503	50665266	SO:0001583	missense	91	exon6				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.1003G>A	12.37:g.52378999G>A	ENSP00000257963:p.Asp335Asn	Somatic		Capture	Illumina HiSeq	Phase_I	50665266	NM_020327	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	G	34	5.344962	0.95807	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	D;D;D;D;D	0.92965	-3.14;-3.14;-3.14;-3.14;-3.14	4.76	4.76	0.60689	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97170	0.9075	M	0.93150	3.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.997;0.998;0.999	D	0.98041	1.0382	10	0.87932	D	0	.	18.3505	0.90337	0.0:0.0:1.0:0.0	.	376;335;335;335	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	N	335;376;335;335;283	ENSP00000257963:D335N;ENSP00000442656:D376N;ENSP00000390477:D335N;ENSP00000397550:D335N;ENSP00000442885:D283N	ENSP00000257963:D335N	D	+	1	0	ACVR1B	50665266	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.646000	0.89796	0.563000	0.77884	GAC		0.438	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
PPFIA2	8499	broad.mit.edu	37	12	81675060	81675060	+	Nonsense_Mutation	SNP	A	A	C			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr12:81675060A>C	ENST00000549396.1	-	27	3348	c.3188T>G	c.(3187-3189)tTa>tGa	p.L1063*	PPFIA2_ENST00000552948.1_Nonsense_Mutation_p.L1042*|PPFIA2_ENST00000407050.4_Nonsense_Mutation_p.L962*|PPFIA2_ENST00000548586.1_Nonsense_Mutation_p.L1057*|PPFIA2_ENST00000550359.2_Nonsense_Mutation_p.L910*|RP11-121G22.3_ENST00000549161.1_lincRNA|PPFIA2_ENST00000443686.3_Nonsense_Mutation_p.L958*|PPFIA2_ENST00000541017.1_Nonsense_Mutation_p.L249*|PPFIA2_ENST00000333447.7_Nonsense_Mutation_p.L1048*|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000550584.2_Nonsense_Mutation_p.L1063*|PPFIA2_ENST00000541570.2_Nonsense_Mutation_p.L599*|PPFIA2_ENST00000549325.1_Nonsense_Mutation_p.L1048*	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1063	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)		p.L1063*(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CACCATTTTTAAATGGACACG	0.333																																					p.L1063X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T3188G	12						.						73.0	70.0	71.0					12																	81675060		1803	4066	5869	80199191	SO:0001587	stop_gained	8499	exon27			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3188T>G	12.37:g.81675060A>C	ENSP00000450337:p.Leu1063*	Somatic		Capture	Illumina HiSeq	Phase_I	80199191	NM_003625	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Nonsense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	40|40	8.132016|8.132016	0.98670|0.98670	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948|ENST00000550018	.|.	.|.	.|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|.	0.64402|.	D|.	0.000003|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	-8.1817|-8.1817	15.7394|15.7394	0.77876|0.77876	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	X|E	1063;1048;599;249;962;1074;1048;1057;958;1042|166	.|.	ENSP00000327416:L1048X|.	L|X	-|-	2|1	0|0	PPFIA2|PPFIA2	80199191|80199191	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.221000|9.221000	0.95188|0.95188	2.183000|2.183000	0.69458|0.69458	0.397000|0.397000	0.26171|0.26171	TTA|TAA		0.333	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
TRPV4	59341	broad.mit.edu	37	12	110232160	110232160	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr12:110232160C>T	ENST00000418703.2	-	7	1559	c.1465G>A	c.(1465-1467)Gcc>Acc	p.A489T	TRPV4_ENST00000346520.2_Missense_Mutation_p.A429T|TRPV4_ENST00000541794.1_Missense_Mutation_p.A442T|TRPV4_ENST00000392719.2_Missense_Mutation_p.A442T|TRPV4_ENST00000261740.2_Missense_Mutation_p.A489T|TRPV4_ENST00000537083.1_Missense_Mutation_p.A429T|TRPV4_ENST00000536838.1_Missense_Mutation_p.A455T|TRPV4_ENST00000544971.1_Missense_Mutation_p.A382T	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	489					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)	p.A489T(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						TGGTAGTAGGCGGTGAGAGTG	0.632																																					p.A489T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1465A	12						.						91.0	85.0	87.0					12																	110232160		2203	4300	6503	108716543	SO:0001583	missense	59341	exon8			AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.1465G>A	12.37:g.110232160C>T	ENSP00000406191:p.Ala489Thr	Somatic		Capture	Illumina HiSeq	Phase_I	108716543	NM_021625	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	37	CCDS9134.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847523	0.91277	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	D;D;D;D;D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.95217	0.8449	M	0.86178	2.8	0.80722	D	1	D;D;D;D;D	0.76494	0.997;0.999;0.998;0.987;0.999	P;P;D;P;D	0.67725	0.896;0.859;0.944;0.78;0.953	D	0.95193	0.8310	10	0.46703	T	0.11	-39.8092	16.3763	0.83401	0.0:1.0:0.0:0.0	.	429;489;382;442;455	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	T	489;489;442;429;382;429;442;455	ENSP00000406191:A489T;ENSP00000261740:A489T;ENSP00000376480:A442T;ENSP00000319003:A429T;ENSP00000443611:A382T;ENSP00000442738:A429T;ENSP00000442167:A442T;ENSP00000444336:A455T	ENSP00000261740:A489T	A	-	1	0	TRPV4	108716543	1.000000	0.71417	0.957000	0.39632	0.924000	0.55760	7.524000	0.81866	2.327000	0.79052	0.561000	0.74099	GCC		0.632	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625	
FAM155A	728215	broad.mit.edu	37	13	108518160	108518160	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr13:108518160C>A	ENST00000375915.2	-	1	923	c.785G>T	c.(784-786)aGg>aTg	p.R262M		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	262						integral component of membrane (GO:0016021)		p.R262M(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						GACGCACTGCCTGCAAGTGGT	0.512																																					p.R262M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G785T	13						.						143.0	126.0	132.0					13																	108518160		2203	4300	6503	107316161	SO:0001583	missense	728215	exon1			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.785G>T	13.37:g.108518160C>A	ENSP00000365080:p.Arg262Met	Somatic		Capture	Illumina HiSeq	Phase_I	107316161	NM_001080396	B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	37	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.576814	0.45902	.	.	ENSG00000204442	ENST00000375915	T	0.42513	0.97	5.9	5.05	0.67936	.	0.132562	0.52532	D	0.000069	T	0.36826	0.0981	N	0.03608	-0.345	0.41603	D	0.988862	D	0.71674	0.998	P	0.61592	0.891	T	0.44452	-0.9327	10	0.46703	T	0.11	.	13.5735	0.61860	0.0:0.9261:0.0:0.0738	.	262	B1AL88	F155A_HUMAN	M	262	ENSP00000365080:R262M	ENSP00000365080:R262M	R	-	2	0	FAM155A	107316161	0.995000	0.38212	0.995000	0.50966	0.978000	0.69477	3.013000	0.49582	2.793000	0.96121	0.563000	0.77884	AGG		0.512	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396	
PCDH9	5101	broad.mit.edu	37	13	67801775	67801775	+	Silent	SNP	G	G	A	rs143472326		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr13:67801775G>A	ENST00000377865.2	-	1	932	c.798C>T	c.(796-798)ccC>ccT	p.P266P	PCDH9_ENST00000328454.5_Silent_p.P266P|PCDH9_ENST00000377861.3_Silent_p.P266P|PCDH9_ENST00000456367.1_Silent_p.P266P|PCDH9_ENST00000544246.1_Silent_p.P266P			Q9HC56	PCDH9_HUMAN	protocadherin 9	266	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P266P(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		AGGTACCTACGGGAGCATTCT	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20115	0.0		0.0	False		,,,				2504	0.0				p.P266P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C798T	13						.						114.0	105.0	108.0					13																	67801775		2203	4300	6503	66699776	SO:0001819	synonymous_variant	5101	exon2			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.798C>T	13.37:g.67801775G>A		Somatic		Capture	Illumina HiSeq	Phase_I	66699776	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Silent	SNP	ENST00000377865.2	37	CCDS9444.1																																																																																				0.493	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
LIG4	3981	broad.mit.edu	37	13	108863304	108863304	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr13:108863304C>G	ENST00000356922.4	-	2	585	c.313G>C	c.(313-315)Gat>Cat	p.D105H	LIG4_ENST00000442234.1_Missense_Mutation_p.D105H|LIG4_ENST00000405925.1_Missense_Mutation_p.D105H	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	105					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.D105H(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TTGAGGGCATCTTTTCCATCT	0.378								Non-homologous end-joining																													p.D105H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G313C	13						.						131.0	139.0	136.0					13																	108863304		2203	4300	6503	107661305	SO:0001583	missense	3981	exon2			X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.313G>C	13.37:g.108863304C>G	ENSP00000349393:p.Asp105His	Somatic		Capture	Illumina HiSeq	Phase_I	107661305	NM_002312	Q8IY66|Q8TEU5	Missense_Mutation	SNP	ENST00000356922.4	37	CCDS9508.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765009	0.69878	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	T;T;T	0.19394	2.15;2.15;2.15	5.7	5.7	0.88788	DNA ligase, ATP-dependent, N-terminal (3);	0.095601	0.64402	D	0.000001	T	0.51210	0.1661	M	0.82132	2.575	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.54029	-0.8354	10	0.87932	D	0	.	18.8212	0.92097	0.0:1.0:0.0:0.0	.	105	P49917	DNLI4_HUMAN	H	105	ENSP00000385955:D105H;ENSP00000402030:D105H;ENSP00000349393:D105H	ENSP00000349393:D105H	D	-	1	0	LIG4	107661305	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.424000	0.80242	2.678000	0.91216	0.643000	0.83706	GAT		0.378	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045738.4	NM_002312	
MIA2	117153	broad.mit.edu	37	14	39716673	39716673	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr14:39716673G>C	ENST00000280082.3	+	4	1094	c.895G>C	c.(895-897)Gag>Cag	p.E299Q	RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.E299Q|MIA2_ENST00000556784.1_Missense_Mutation_p.E298Q	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	299					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)				NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		ATCTGAGTCAGAGCACATTCC	0.403																																					p.E299Q												.	.	0			c.G895C	14						.						127.0	126.0	126.0					14																	39716673		2203	4300	6503	38786424	SO:0001583	missense	117153	exon4			BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.895G>C	14.37:g.39716673G>C	ENSP00000280082:p.Glu299Gln	None		Capture	Illumina HiSeq	Phase_I	38786424	NM_054024	A1L4H0|Q9H6C1	Missense_Mutation	SNP	ENST00000280082.3	37	CCDS9672.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.760155	0.49468	.	.	ENSG00000150526;ENSG00000150526;ENSG00000258941	ENST00000280082;ENST00000556784;ENST00000553728	T;T;T	0.55052	0.54;0.59;2.86	4.95	4.95	0.65309	.	0.000000	0.43919	D	0.000502	T	0.70272	0.3205	M	0.66939	2.045	0.27391	N	0.955141	D;D	0.89917	1.0;1.0	D;D	0.79784	0.984;0.993	T	0.64198	-0.6464	9	.	.	.	-24.3311	16.5359	0.84373	0.0:0.0:1.0:0.0	.	299;299	Q96PC5;Q96PC5-2	MIA2_HUMAN;.	Q	299;298;299	ENSP00000280082:E299Q;ENSP00000451934:E298Q;ENSP00000452252:E299Q	.	E	+	1	0	MIA2;RP11-407N17.3	38786424	0.986000	0.35501	0.220000	0.23810	0.299000	0.27559	3.421000	0.52742	2.583000	0.87209	0.650000	0.86243	GAG		0.403	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3	NM_054024	
SYNE2	23224	broad.mit.edu	37	14	64675656	64675656	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr14:64675656C>G	ENST00000344113.4	+	101	18594	c.18382C>G	c.(18382-18384)Cgc>Ggc	p.R6128G	SYNE2_ENST00000554805.1_5'Flank|SYNE2_ENST00000358025.3_Missense_Mutation_p.R6128G|SYNE2_ENST00000357395.3_Missense_Mutation_p.R2513G|SYNE2_ENST00000555022.1_Missense_Mutation_p.R6G|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000554584.1_Missense_Mutation_p.R6090G|SYNE2_ENST00000555002.1_Missense_Mutation_p.R2762G|SYNE2_ENST00000394768.2_Missense_Mutation_p.R2513G	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6128					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CATGGAGCGGCGCATGAAGTA	0.517																																					p.R6128G												.	.	0			c.C18382G	14						.						68.0	51.0	57.0					14																	64675656		2203	4300	6503	63745409	SO:0001583	missense	23224	exon101			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.18382C>G	14.37:g.64675656C>G	ENSP00000341781:p.Arg6128Gly	None		Capture	Illumina HiSeq	Phase_I	63745409	NM_015180	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.373568	0.42105	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000556906;ENST00000555022	D;D;D;D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69;-1.69;-1.69;-1.69	5.66	5.66	0.87406	.	0.000000	0.46758	D	0.000264	D	0.89399	0.6704	L	0.52759	1.655	0.80722	D	1	D;P;P;D;D	0.61697	0.987;0.888;0.939;0.99;0.962	D;P;P;D;P	0.76071	0.93;0.869;0.51;0.987;0.866	D	0.88983	0.3409	10	0.54805	T	0.06	.	19.7468	0.96255	0.0:1.0:0.0:0.0	.	2513;516;6090;6128;6128	Q8WXH0-7;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	G	6128;2513;6128;6090;6096;2762;2513;98;6	ENSP00000350719:R6128G;ENSP00000349969:R2513G;ENSP00000341781:R6128G;ENSP00000452570:R6090G;ENSP00000450831:R2762G;ENSP00000378249:R2513G;ENSP00000452298:R98G;ENSP00000451009:R6G	ENSP00000261678:R6096G	R	+	1	0	SYNE2	63745409	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.460000	0.45031	2.678000	0.91216	0.563000	0.77884	CGC		0.517	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SPTB	6710	broad.mit.edu	37	14	65264522	65264522	+	Silent	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr14:65264522G>A	ENST00000389721.5	-	9	1139	c.1107C>T	c.(1105-1107)atC>atT	p.I369I	SPTB_ENST00000389722.3_Silent_p.I369I|SPTB_ENST00000389720.3_Silent_p.I369I|SPTB_ENST00000542895.1_Silent_p.I369I|SPTB_ENST00000556626.1_Silent_p.I369I	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	369					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.I369I(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TCCGGGACTGGATGGTAAAAA	0.428																																					p.I369I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1107T	14						.						190.0	170.0	177.0					14																	65264522		2203	4300	6503	64334275	SO:0001819	synonymous_variant	6710	exon9				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.1107C>T	14.37:g.65264522G>A		Somatic		Capture	Illumina HiSeq	Phase_I	64334275	NM_001024858	Q15510|Q15519	Silent	SNP	ENST00000389721.5	37	CCDS32100.1																																																																																				0.428	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
CLMN	79789	broad.mit.edu	37	14	95670423	95670423	+	Silent	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr14:95670423C>T	ENST00000298912.4	-	9	1376	c.1263G>A	c.(1261-1263)ccG>ccA	p.P421P		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	421					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.P421P(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		TTTTCTTGATCGGCAAAGAGT	0.502																																					p.P421P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1263A	14						.						122.0	118.0	119.0					14																	95670423		2203	4300	6503	94740176	SO:0001819	synonymous_variant	79789	exon9			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.1263G>A	14.37:g.95670423C>T		Somatic		Capture	Illumina HiSeq	Phase_I	94740176	NM_024734	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Silent	SNP	ENST00000298912.4	37	CCDS9933.1																																																																																				0.502	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2		
MAPKBP1	23005	broad.mit.edu	37	15	42113251	42113251	+	Silent	SNP	T	T	G			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr15:42113251T>G	ENST00000456763.2	+	24	2917	c.2721T>G	c.(2719-2721)acT>acG	p.T907T	MAPKBP1_ENST00000514566.1_Silent_p.T901T|MAPKBP1_ENST00000457542.2_Silent_p.T901T|MAPKBP1_ENST00000260357.7_Silent_p.T740T|MAPKBP1_ENST00000221214.6_Silent_p.T784T	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	907								p.T901T(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CCCTTGAGACTTCACTCACTA	0.607																																					p.T901T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2703G	15						.						63.0	60.0	61.0					15																	42113251		2203	4300	6503	39900543	SO:0001819	synonymous_variant	23005	exon23			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.2721T>G	15.37:g.42113251T>G		Somatic		Capture	Illumina HiSeq	Phase_I	39900543	NM_014994	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Silent	SNP	ENST00000456763.2	37	CCDS45239.1																																																																																				0.607	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
PYGO1	26108	broad.mit.edu	37	15	55838436	55838436	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr15:55838436C>T	ENST00000302000.6	-	3	1139	c.1045G>A	c.(1045-1047)Gag>Aag	p.E349K	PYGO1_ENST00000563719.1_Missense_Mutation_p.E349K	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	349	Interaction with H3K4me2.				hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.E349K(1)		endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		TCGTTCACCTCGTTTGTACAA	0.453																																					p.E349K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1045A	15						.						217.0	193.0	201.0					15																	55838436		2193	4292	6485	53625728	SO:0001583	missense	26108	exon3			AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.1045G>A	15.37:g.55838436C>T	ENSP00000302327:p.Glu349Lys	Somatic		Capture	Illumina HiSeq	Phase_I	53625728	NM_015617	A7Y2D6	Missense_Mutation	SNP	ENST00000302000.6	37	CCDS10155.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.616779	0.87359	.	.	ENSG00000171016	ENST00000302000;ENST00000401688	T	0.62788	-0.0	5.24	5.24	0.73138	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.79776	0.4504	M	0.74881	2.28	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.995	T	0.81726	-0.0801	10	0.72032	D	0.01	-16.7241	18.1934	0.89813	0.0:1.0:0.0:0.0	.	349;349	A7Y2D6;Q9Y3Y4	.;PYGO1_HUMAN	K	349	ENSP00000302327:E349K	ENSP00000302327:E349K	E	-	1	0	PYGO1	53625728	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.237000	0.78164	2.605000	0.88082	0.591000	0.81541	GAG		0.453	PYGO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254977.2	NM_015617	
UACA	55075	broad.mit.edu	37	15	70959811	70959814	+	Frame_Shift_Del	DEL	TGTT	TGTT	-			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	TGTT	TGTT	TGTT	-	TGTT	TGTT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr15:70959811_70959814delTGTT	ENST00000322954.6	-	16	3394_3397	c.3209_3212delAACA	c.(3208-3213)aaacagfs	p.KQ1070fs	UACA_ENST00000560441.1_Frame_Shift_Del_p.KQ1055fs|UACA_ENST00000379983.2_Frame_Shift_Del_p.KQ1057fs|UACA_ENST00000539319.1_Frame_Shift_Del_p.KQ961fs	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	1070					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.K1057fs*2(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						GTCTTTTAACTGTTTGTTTAGCTC	0.358																																					p.1070_1071del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.3209_3212del	15						.																																			68746868	SO:0001589	frameshift_variant	55075	exon16			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.3209_3212delAACA	15.37:g.70959815_70959818delTGTT	ENSP00000314556:p.Lys1070fs	Somatic		Capture	Illumina HiSeq	Phase_I	68746865	NM_018003	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Frame_Shift_Del	DEL	ENST00000322954.6	37	CCDS10235.1																																																																																				0.358	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
MYH11	4629	broad.mit.edu	37	16	15814712	15814712	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr16:15814712C>T	ENST00000300036.5	-	33	4884	c.4775G>A	c.(4774-4776)aGg>aAg	p.R1592K	NDE1_ENST00000342673.5_Intron|MYH11_ENST00000576790.2_Missense_Mutation_p.R1592K|MYH11_ENST00000452625.2_Missense_Mutation_p.R1599K|NDE1_ENST00000396354.1_Intron|NDE1_ENST00000396355.1_Intron|MYH11_ENST00000396324.3_Missense_Mutation_p.R1599K	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1592					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.R1592K(1)|p.R1599K(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTGCAGTTGCCTCCTCTTCTC	0.592			T	CBFB	AML																																p.R1599K			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4796A	16						.						82.0	74.0	77.0					16																	15814712		2197	4300	6497	15722213	SO:0001583	missense	4629	exon34			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.4775G>A	16.37:g.15814712C>T	ENSP00000300036:p.Arg1592Lys	Somatic		Capture	Illumina HiSeq	Phase_I	15722213	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	C	6.424	0.446297	0.12164	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81	4.97	4.01	0.46588	Myosin tail (1);	0.051894	0.85682	D	0.000000	T	0.67505	0.2900	L	0.33624	1.015	0.58432	D	0.999994	B;B;B;B;B	0.15930	0.015;0.009;0.009;0.009;0.009	B;B;B;B;B	0.29785	0.107;0.028;0.028;0.028;0.028	T	0.63664	-0.6586	10	0.45353	T	0.12	.	14.492	0.67657	0.0:0.8524:0.1476:0.0	.	1599;1592;1599;1592;1599	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	K	1592;1592;1599;1599;1599	ENSP00000300036:R1592K;ENSP00000345136:R1592K;ENSP00000379616:R1599K;ENSP00000407821:R1599K	ENSP00000300036:R1592K	R	-	2	0	MYH11	15722213	0.997000	0.39634	0.814000	0.32528	0.122000	0.20287	4.065000	0.57513	1.076000	0.40961	0.561000	0.74099	AGG		0.592	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
CREBBP	1387	broad.mit.edu	37	16	3790512	3790512	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr16:3790512G>A	ENST00000262367.5	-	24	4830	c.4021C>T	c.(4021-4023)Cga>Tga	p.R1341*	CREBBP_ENST00000382070.3_Nonsense_Mutation_p.R1303*	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1341	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R1341*(3)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTGTTCACTCGGTCTTCCAAG	0.567			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.R1341X			Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	.	3	Substitution - Nonsense(3)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	c.C4021T	16						.						70.0	72.0	71.0					16																	3790512		2197	4300	6497	3730513	SO:0001587	stop_gained	1387	exon24			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4021C>T	16.37:g.3790512G>A	ENSP00000262367:p.Arg1341*	Somatic		Capture	Illumina HiSeq	Phase_I	3730513	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Nonsense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	g	18.35	3.604790	0.66445	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	.	.	.	5.05	1.64	0.23874	.	0.094335	0.44483	D	0.000453	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.5698	11.1732	0.48584	0.0:0.1045:0.5694:0.3261	.	.	.	.	X	1341;1371;1303	.	ENSP00000262367:R1341X	R	-	1	2	CREBBP	3730513	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.982000	0.40638	0.582000	0.29556	0.555000	0.69702	CGA		0.567	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
STX1B	112755	broad.mit.edu	37	16	31008068	31008069	+	Missense_Mutation	DNP	GT	GT	CA			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	GT	GT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr16:31008068_31008069GT>CA	ENST00000215095.5	-	7	703_704	c.472_473AC>TG	c.(472-474)ACc>TGc	p.T158C	STX1B_ENST00000565419.1_Missense_Mutation_p.T158C	NM_052874.3	NP_443106.1	P61266	STX1B_HUMAN	syntaxin 1B	158					intracellular protein transport (GO:0006886)|neurotransmitter transport (GO:0006836)|regulation of exocytosis (GO:0017157)|regulation of gene expression (GO:0010468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)	p.T158>?(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(5)	13						GTTGGTGGTGGTCCTTCCAGCT	0.658																																					.												.	.	1	Complex(1)	large_intestine(1)	c.472_473TG	16						.																																			30915570	SO:0001583	missense	112755	exon7			AY028792	CCDS10699.1	16p12-p11	2008-02-05	2007-06-20	2007-06-20	ENSG00000099365	ENSG00000099365			18539	protein-coding gene	gene with protein product		601485	"""syntaxin 1B1"", ""syntaxin 1B2"""	STX1B1, STX1B2			Standard	NM_052874		Approved		uc010cad.2	P61266	OTTHUMG00000132391	ENST00000215095.5:c.472_473delinsCA	16.37:g.31008068_31008069delinsCA	ENSP00000215095:p.Thr158Cys	Somatic		Capture	Illumina HiSeq	Phase_I	30915569	NM_052874	Q15531|Q2VPS2	Missense_Mutation	DNP	ENST00000215095.5	37	CCDS10699.1																																																																																				0.658	STX1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255521.2		
CNGB1	1258	broad.mit.edu	37	16	57935303	57935303	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr16:57935303T>C	ENST00000251102.8	-	29	2989	c.2929A>G	c.(2929-2931)Agg>Ggg	p.R977G	CNGB1_ENST00000564448.1_Missense_Mutation_p.R971G	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	977					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						GAGCGAAGCCTCTTCAGCATG	0.572																																					p.R977G	Colon(156;1293 1853 16336 28962 38659)											.	.	0			c.A2929G	16						.						146.0	149.0	148.0					16																	57935303		2028	4178	6206	56492804	SO:0001583	missense	1258	exon29			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.2929A>G	16.37:g.57935303T>C	ENSP00000251102:p.Arg977Gly	None		Capture	Illumina HiSeq	Phase_I	56492804	NM_001297	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Missense_Mutation	SNP	ENST00000251102.8	37	CCDS42169.1	.	.	.	.	.	.	.	.	.	.	T	19.84	3.902145	0.72754	.	.	ENSG00000070729	ENST00000251102	D	0.96774	-4.12	5.2	-0.136	0.13473	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.057924	0.64402	D	0.000003	D	0.96929	0.8997	M	0.82323	2.585	0.80722	D	1	P;P	0.44521	0.837;0.786	P;P	0.50314	0.637;0.621	D	0.95940	0.8946	10	0.87932	D	0	.	16.3582	0.83244	0.0:0.0:0.6803:0.3197	.	349;977	Q14028-2;Q14028	.;CNGB1_HUMAN	G	977	ENSP00000251102:R977G	ENSP00000251102:R977G	R	-	1	2	CNGB1	56492804	0.999000	0.42202	0.986000	0.45419	0.995000	0.86356	0.580000	0.23803	-0.312000	0.08741	0.459000	0.35465	AGG		0.572	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2	NM_001297	
HS3ST3B1	9953	broad.mit.edu	37	17	14248413	14248413	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr17:14248413G>A	ENST00000360954.2	+	2	1059	c.623G>A	c.(622-624)cGg>cAg	p.R208Q		NM_006041.1	NP_006032.1	Q9Y662	HS3SB_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1	208					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)	p.R208Q(1)		large_intestine(3)|lung(3)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)		TTCGTCACGCGGGAGGCCCCT	0.622																																					p.R208Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G623A	17						.						68.0	44.0	52.0					17																	14248413		2203	4286	6489	14189138	SO:0001583	missense	9953	exon2			AF105377	CCDS11167.1	17p12	2007-04-02			ENSG00000125430	ENSG00000125430	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5198	protein-coding gene	gene with protein product		604058				9988767	Standard	NM_006041		Approved	3OST3B1, 30ST3B1	uc002goh.1	Q9Y662	OTTHUMG00000058810	ENST00000360954.2:c.623G>A	17.37:g.14248413G>A	ENSP00000354213:p.Arg208Gln	Somatic		Capture	Illumina HiSeq	Phase_I	14189138	NM_006041	B3KN58|D3DTS6	Missense_Mutation	SNP	ENST00000360954.2	37	CCDS11167.1	.	.	.	.	.	.	.	.	.	.	G	12.15	1.852779	0.32699	.	.	ENSG00000125430	ENST00000360954	T	0.41758	0.99	4.63	3.66	0.41972	Sulfotransferase domain (1);	0.147739	0.39341	U	0.001388	T	0.23492	0.0568	L	0.31476	0.935	0.36724	D	0.881322	B	0.26876	0.162	B	0.14578	0.011	T	0.16808	-1.0390	10	0.28530	T	0.3	.	4.1011	0.10014	0.3225:0.0:0.6775:0.0	.	208	Q9Y662	HS3SB_HUMAN	Q	208	ENSP00000354213:R208Q	ENSP00000354213:R208Q	R	+	2	0	HS3ST3B1	14189138	1.000000	0.71417	0.991000	0.47740	0.986000	0.74619	3.348000	0.52209	2.505000	0.84491	0.557000	0.71058	CGG		0.622	HS3ST3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129998.1	NM_006041	
OVCA2	124641	broad.mit.edu	37	17	1946137	1946137	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr17:1946137G>T	ENST00000572195.1	+	2	438	c.423G>T	c.(421-423)ttG>ttT	p.L141F	RP11-667K14.3_ENST00000572790.1_lincRNA|DPH1_ENST00000570477.1_3'UTR|RP11-667K14.4_ENST00000572404.1_RNA|DPH1_ENST00000263083.6_3'UTR	NM_080822.2	NP_543012.1	Q8WZ82	OVCA2_HUMAN	ovarian tumor suppressor candidate 2	141					metabolic process (GO:0008152)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.L141F(1)									GCTTCCCCTTGCCACGGTTTA	0.597											OREG0024078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L141F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G423T	17						.						94.0	89.0	91.0					17																	1946137		2203	4300	6503	1892887	SO:0001583	missense	124641	exon2			AF321875	CCDS11015.1	17p13.3	2012-10-08			ENSG00000262664	ENSG00000262664			24203	protein-coding gene	gene with protein product	"""candidate tumor suppressor in ovarian cancer 2"""	607896				11979432, 8616839, 16368187	Standard	NM_080822		Approved		uc002ftx.3	Q8WZ82	OTTHUMG00000132471	ENST00000572195.1:c.423G>T	17.37:g.1946137G>T	ENSP00000461388:p.Leu141Phe	Somatic	599	Capture	Illumina HiSeq	Phase_I	1892887	NM_080822	Q86XN3|Q8IW87|Q9UCX9	Missense_Mutation	SNP	ENST00000572195.1	37	CCDS11015.1	.	.	.	.	.	.	.	.	.	.	G	1.474	-0.559138	0.03967	.	.	ENSG00000214014	ENST00000263084	.	.	.	5.27	0.385	0.16249	.	0.181266	0.34700	U	0.003751	T	0.14399	0.0348	N	0.02775	-0.495	0.23156	N	0.998206	B	0.20261	0.043	B	0.17433	0.018	T	0.22347	-1.0219	9	0.54805	T	0.06	.	8.6757	0.34179	0.2249:0.1206:0.6546:0.0	.	141	Q8WZ82	OVCA2_HUMAN	F	141	.	ENSP00000263084:L141F	L	+	3	2	OVCA2	1892887	0.381000	0.25140	0.042000	0.18584	0.050000	0.14768	0.422000	0.21296	0.216000	0.20781	-0.216000	0.12614	TTG		0.597	OVCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255636.5	NM_080822	
NT5M	56953	broad.mit.edu	37	17	17226516	17226516	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr17:17226516G>T	ENST00000389022.4	+	3	602	c.386G>T	c.(385-387)tGc>tTc	p.C129F		NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial	129					dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)	p.C129F(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						GTCTTCATCTGCACAAGCCCC	0.557																																					p.C129F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G386T	17						.						304.0	270.0	282.0					17																	17226516		2203	4300	6503	17167241	SO:0001583	missense	56953	exon3			AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.386G>T	17.37:g.17226516G>T	ENSP00000373674:p.Cys129Phe	Somatic		Capture	Illumina HiSeq	Phase_I	17167241	NM_020201		Missense_Mutation	SNP	ENST00000389022.4	37	CCDS32581.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228131	0.58777	.	.	ENSG00000205309	ENST00000446264;ENST00000389022	T	0.45668	0.89	4.06	4.06	0.47325	HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.65004	0.2650	M	0.83953	2.67	0.52099	D	0.999947	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.99	T	0.70432	-0.4873	10	0.87932	D	0	-31.7492	11.9214	0.52793	0.0:0.0:1.0:0.0	.	129;129;129	Q2I378;Q9NPB1;F6S3X3	.;NT5M_HUMAN;.	F	129	ENSP00000373674:C129F	ENSP00000373674:C129F	C	+	2	0	NT5M	17167241	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.352000	0.66028	2.246000	0.74042	0.555000	0.69702	TGC		0.557	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446045.1		
SLFN11	91607	broad.mit.edu	37	17	33690472	33690472	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr17:33690472G>A	ENST00000394566.1	-	4	627	c.355C>T	c.(355-357)Cgc>Tgc	p.R119C	SLFN11_ENST00000308377.4_Missense_Mutation_p.R119C	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	119					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.R119C(1)		autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTGACAGAGCGATCTTCAGGG	0.468																																					p.R119C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C355T	17						.						59.0	57.0	58.0					17																	33690472		2203	4300	6503	30714585	SO:0001583	missense	91607	exon3			AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.355C>T	17.37:g.33690472G>A	ENSP00000378067:p.Arg119Cys	Somatic		Capture	Illumina HiSeq	Phase_I	30714585	NM_001104589	E1P643|Q8N3S8|Q8N762|Q8TEE0	Missense_Mutation	SNP	ENST00000394566.1	37	CCDS11294.1	.	.	.	.	.	.	.	.	.	.	G	9.844	1.191716	0.21954	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	T;T	0.02015	4.5;4.5	4.18	-4.22	0.03800	.	1.754140	0.03592	N	0.231977	T	0.01730	0.0055	N	0.22421	0.69	0.09310	N	1	P	0.36086	0.536	B	0.30029	0.11	T	0.40059	-0.9583	10	0.54805	T	0.06	.	5.9823	0.19413	0.0:0.3064:0.4526:0.2411	.	119	Q7Z7L1	SLN11_HUMAN	C	119	ENSP00000312402:R119C;ENSP00000378067:R119C	ENSP00000312402:R119C	R	-	1	0	SLFN11	30714585	0.000000	0.05858	0.007000	0.13788	0.002000	0.02628	-3.426000	0.00475	-1.263000	0.02455	-1.115000	0.02055	CGC		0.468	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
DHX40	79665	broad.mit.edu	37	17	57644004	57644004	+	Silent	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr17:57644004G>A	ENST00000251241.4	+	2	276	c.129G>A	c.(127-129)acG>acA	p.T43T	DHX40_ENST00000425628.3_Silent_p.T43T|DHX40_ENST00000451169.2_5'UTR	NM_024612.4	NP_078888.4	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	43							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)	p.T43T(1)		endometrium(7)|large_intestine(6)|lung(6)|prostate(1)	20	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					AAGGATGCACGTCCCAGGAGG	0.358																																					p.T43T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G129A	17						.						41.0	39.0	40.0					17																	57644004		2203	4300	6503	54998786	SO:0001819	synonymous_variant	79665	exon2			AF260270	CCDS11617.1, CCDS54150.1	17q22	2014-01-28	2003-06-13	2003-06-20		ENSG00000108406		"""DEAH-boxes"""	18018	protein-coding gene	gene with protein product		607570	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 40 (RNA helicase)"""	DDX40			Standard	NM_024612		Approved	ARG147, PAD, FLJ22060	uc002ixn.2	Q8IX18		ENST00000251241.4:c.129G>A	17.37:g.57644004G>A		Somatic		Capture	Illumina HiSeq	Phase_I	54998786	NM_024612	B3KTJ5|C9JR60|Q5JPH4|Q8TC86|Q8WY53|Q9BXM1|Q9H6M9	Silent	SNP	ENST00000251241.4	37	CCDS11617.1																																																																																				0.358	DHX40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446095.1	NM_024612	
FAM27L	284123	broad.mit.edu	37	17	21826094	21826094	+	lincRNA	SNP	A	A	C			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr17:21826094A>C	ENST00000426869.3	+	0	278					NR_028336.1		Q8N5T8	FA27L_HUMAN	family with sequence similarity 27-like									p.?(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (53;0.11)|BRCA - Breast invasive adenocarcinoma(1;0.00463)		CCTCTTTTCTAGGATCAAGAT	0.537																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	17						.						42.0	44.0	43.0					17																	21826094		1906	4132	6038	21750221			284123	.			BC031617		17p11.2	2014-01-28				ENSG00000178130			32410	protein-coding gene	gene with protein product							Standard	NR_028336		Approved	MGC35151	uc002gyz.4	Q8N5T8			17.37:g.21826094A>C		Somatic		Capture	Illumina HiSeq	Phase_I	21750221	.		Splice_Site	SNP	ENST00000426869.3	37		.	.	.	.	.	.	.	.	.	.	a	0.014	-1.575270	0.00887	.	.	ENSG00000178130	ENST00000426869	.	.	.	0.158	-0.317	0.12736	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	+	.	.	FAM27L	21750221	0.028000	0.19301	0.001000	0.08648	0.001000	0.01503	-1.014000	0.03641	-1.226000	0.02574	-1.256000	0.01477	.		0.537	FAM27L-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000389059.2	NM_203392	
CD300C	10871	broad.mit.edu	37	17	72540765	72540765	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr17:72540765T>A	ENST00000330793.1	-	2	743	c.383A>T	c.(382-384)gAg>gTg	p.E128V		NM_006678.3	NP_006669.1	Q08708	CLM6_HUMAN	CD300c molecule	128	Ig-like V-type.|Pro-rich.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.E128V(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|skin(2)|upper_aerodigestive_tract(1)	21						CACGGACACCTCAACCTCGAC	0.577																																					p.E128V	Esophageal Squamous(66;421 1121 20537 25337 27468)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A383T	17						.						134.0	118.0	123.0					17																	72540765		2203	4300	6503	70052360	SO:0001583	missense	10871	exon2			BC022279	CCDS11701.1	17q25.2	2014-05-15	2006-03-28		ENSG00000167850	ENSG00000167850		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19320	protein-coding gene	gene with protein product		606786	"""CD300c antigen"""			1349532, 10746781	Standard	NM_006678		Approved	CMRF35, LIR, CMRF-35A, CMRF35A, IGSF16	uc002jky.2	Q08708	OTTHUMG00000067608	ENST00000330793.1:c.383A>T	17.37:g.72540765T>A	ENSP00000329507:p.Glu128Val	Somatic		Capture	Illumina HiSeq	Phase_I	70052360	NM_006678		Missense_Mutation	SNP	ENST00000330793.1	37	CCDS11701.1	.	.	.	.	.	.	.	.	.	.	T	7.156	0.584829	0.13749	.	.	ENSG00000167850	ENST00000330793	T	0.04049	3.72	4.33	-8.67	0.00863	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.727610	0.03315	N	0.191014	T	0.04679	0.0127	L	0.35487	1.065	0.09310	N	1	B	0.25105	0.118	B	0.32289	0.143	T	0.17992	-1.0351	10	0.34782	T	0.22	.	8.1724	0.31262	0.419:0.0:0.4502:0.1308	.	128	Q08708	CLM6_HUMAN	V	128	ENSP00000329507:E128V	ENSP00000329507:E128V	E	-	2	0	CD300C	70052360	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-4.676000	0.00200	-3.237000	0.00208	0.454000	0.30748	GAG		0.577	CD300C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145084.1	NM_006678	
CDH2	1000	broad.mit.edu	37	18	25532169	25532169	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr18:25532169C>A	ENST00000269141.3	-	16	3092	c.2669G>T	c.(2668-2670)tGg>tTg	p.W890L	CDH2_ENST00000399380.3_Missense_Mutation_p.W859L|AC015933.2_ENST00000423367.1_RNA	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	890					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.W890L(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CCGTGGCCCCCAGTCGTTCAG	0.478																																					p.W890L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2669T	18						.						127.0	120.0	122.0					18																	25532169		2203	4300	6503	23786167	SO:0001583	missense	1000	exon16			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.2669G>T	18.37:g.25532169C>A	ENSP00000269141:p.Trp890Leu	Somatic		Capture	Illumina HiSeq	Phase_I	23786167	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872943	0.72180	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.79749	-1.3;-1.3	5.43	5.43	0.79202	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.88742	0.6519	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.88150	0.2850	10	0.48119	T	0.1	.	19.2485	0.93913	0.0:1.0:0.0:0.0	.	859;890	A8MWK3;P19022	.;CADH2_HUMAN	L	890;859	ENSP00000269141:W890L;ENSP00000382312:W859L	ENSP00000269141:W890L	W	-	2	0	CDH2	23786167	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.563000	0.86464	0.591000	0.81541	TGG		0.478	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
SMAD2	4087	broad.mit.edu	37	18	45374881	45374881	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr18:45374881C>T	ENST00000402690.2	-	8	1356	c.962G>A	c.(961-963)cGa>cAa	p.R321Q	SMAD2_ENST00000356825.4_Missense_Mutation_p.R291Q|SMAD2_ENST00000262160.6_Missense_Mutation_p.R321Q|SMAD2_ENST00000591214.1_Missense_Mutation_p.R291Q|SMAD2_ENST00000586040.1_Missense_Mutation_p.R291Q	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	321	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.R321Q(2)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						CGTGGCATTTCGGTTAACATT	0.398																																					p.R291Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G872A	18						.						125.0	117.0	120.0					18																	45374881		2203	4300	6503	43628879	SO:0001583	missense	4087	exon7			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.962G>A	18.37:g.45374881C>T	ENSP00000384449:p.Arg321Gln	Somatic		Capture	Illumina HiSeq	Phase_I	43628879	NM_001135937		Missense_Mutation	SNP	ENST00000402690.2	37	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	C	36	5.786143	0.96937	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.98296	-4.85;-4.85;-4.85	5.81	5.81	0.92471	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99263	0.9743	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.974;1.0	D	0.99146	1.0857	10	0.87932	D	0	.	20.0912	0.97820	0.0:1.0:0.0:0.0	.	291;291;321	B7Z5N5;Q15796-2;Q15796	.;.;SMAD2_HUMAN	Q	321;291;321	ENSP00000262160:R321Q;ENSP00000349282:R291Q;ENSP00000384449:R321Q	ENSP00000262160:R321Q	R	-	2	0	SMAD2	43628879	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.746000	0.94184	0.591000	0.81541	CGA		0.398	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901	
ZNF554	115196	broad.mit.edu	37	19	2834073	2834073	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:2834073T>A	ENST00000317243.5	+	5	1038	c.840T>A	c.(838-840)aaT>aaA	p.N280K	ZNF554_ENST00000591265.1_3'UTR	NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AATGTGGAAATGCCATCCGCC	0.458																																					p.N280K												.	.	0			c.T840A	19						.						82.0	86.0	84.0					19																	2834073		1966	4154	6120	2785073	SO:0001583	missense	115196	exon5			AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.840T>A	19.37:g.2834073T>A	ENSP00000321132:p.Asn280Lys	None		Capture	Illumina HiSeq	Phase_I	2785073	NM_001102651	Q8NAT3|Q9BWN3	Missense_Mutation	SNP	ENST00000317243.5	37	CCDS42462.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.640711	0.00799	.	.	ENSG00000172006	ENST00000317243	T	0.05319	3.46	2.77	0.522	0.17053	.	.	.	.	.	T	0.01765	0.0056	N	0.01874	-0.695	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.45948	-0.9226	9	0.02654	T	1	.	3.8201	0.08832	0.5675:0.1912:0.0:0.2413	.	280	Q86TJ5	ZN554_HUMAN	K	280	ENSP00000321132:N280K	ENSP00000321132:N280K	N	+	3	2	ZNF554	2785073	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.336000	0.07863	-0.078000	0.12730	-0.371000	0.07208	AAT		0.458	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451598.3	NM_152303	
PLIN4	729359	broad.mit.edu	37	19	4511750	4511750	+	Missense_Mutation	SNP	G	G	A	rs202029971		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:4511750G>A	ENST00000301286.3	-	3	2179	c.2180C>T	c.(2179-2181)gCg>gTg	p.A727V		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	727	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.A655V(1)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GGCCACATTCGCAGCACCGGT	0.582																																					p.A727V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2180T	19						.						153.0	142.0	145.0					19																	4511750		2041	4179	6220	4462750	SO:0001583	missense	729359	exon3			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2180C>T	19.37:g.4511750G>A	ENSP00000301286:p.Ala727Val	Somatic		Capture	Illumina HiSeq	Phase_I	4462750	NM_001080400	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	g	0.054	-1.241882	0.01493	.	.	ENSG00000167676	ENST00000301286	T	0.02863	4.13	4.56	-2.07	0.07276	.	1.845790	0.03331	N	0.193423	T	0.00936	0.0031	N	0.00146	-1.995	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.48647	-0.9017	10	0.20519	T	0.43	-0.0672	10.3918	0.44175	0.5964:0.0:0.4036:0.0	.	727	Q96Q06	PLIN4_HUMAN	V	727	ENSP00000301286:A727V	ENSP00000301286:A727V	A	-	2	0	PLIN4	4462750	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.348000	0.07740	-0.544000	0.06232	-2.613000	0.00159	GCG		0.582	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
ELAVL3	1995	broad.mit.edu	37	19	11568959	11568959	+	Silent	SNP	C	C	T	rs144875735		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:11568959C>T	ENST00000359227.3	-	5	1054	c.630G>A	c.(628-630)acG>acA	p.T210T	ELAVL3_ENST00000438662.2_Silent_p.T210T	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	210					cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)	p.T210T(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						GCGCCTGCCCCGTCTTCTGAC	0.632													c|||	1	0.000199681	0.0	0.0	5008	,	,		17049	0.001		0.0	False		,,,				2504	0.0				p.T210T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G630A	19						.						89.0	80.0	83.0					19																	11568959		2203	4300	6503	11429959	SO:0001819	synonymous_variant	1995	exon5				CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.630G>A	19.37:g.11568959C>T		Somatic		Capture	Illumina HiSeq	Phase_I	11429959	NM_001420	Q16135|Q96CL8|Q96QS9	Silent	SNP	ENST00000359227.3	37	CCDS32912.1																																																																																				0.632	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458827.2	NM_001420	
MEGF8	1954	broad.mit.edu	37	19	42848895	42848895	+	Silent	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:42848895G>A	ENST00000251268.6	+	12	2007	c.2007G>A	c.(2005-2007)acG>acA	p.T669T	MEGF8_ENST00000334370.4_Silent_p.T669T	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	669					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)	p.T669T(2)|p.T210T(1)		breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TCTTCGTCACGTCCCTGGAGG	0.667																																					p.T669T												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G2007A	19						.						67.0	67.0	67.0					19																	42848895		2203	4300	6503	47540735	SO:0001819	synonymous_variant	1954	exon12			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2007G>A	19.37:g.42848895G>A		Somatic		Capture	Illumina HiSeq	Phase_I	47540735	NM_001410	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	37																																																																																					0.667	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
ZNF114	163071	broad.mit.edu	37	19	48790081	48790081	+	Silent	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:48790081G>A	ENST00000595607.1	+	6	1694	c.1200G>A	c.(1198-1200)tcG>tcA	p.S400S	ZNF114_ENST00000315849.1_Silent_p.S400S|ZNF114_ENST00000597695.1_Silent_p.S366S|ZNF114_ENST00000600687.1_Silent_p.S400S			Q8NC26	ZN114_HUMAN	zinc finger protein 114	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S400S(1)		endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		TTGCAAAGTCGTCAGGACTTA	0.373																																					p.S400S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1200A	19						.						66.0	69.0	68.0					19																	48790081		2202	4300	6502	53481893	SO:0001819	synonymous_variant	163071	exon5			BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.1200G>A	19.37:g.48790081G>A		Somatic		Capture	Illumina HiSeq	Phase_I	53481893	NM_153608	A8K6B0|Q08AQ6	Silent	SNP	ENST00000595607.1	37	CCDS12713.1																																																																																				0.373	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465601.1	NM_153608	
CCDC114	93233	broad.mit.edu	37	19	48800642	48800642	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:48800642G>A	ENST00000315396.7	-	14	2286	c.1604C>T	c.(1603-1605)aCc>aTc	p.T535I		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	535					outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)		p.T535I(1)|p.T328I(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		GGGGTGCCTGGTGGGCACCAG	0.677																																					p.T535I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1604T	19						.						32.0	38.0	36.0					19																	48800642		2202	4295	6497	53492454	SO:0001583	missense	93233	exon14			BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.1604C>T	19.37:g.48800642G>A	ENSP00000318429:p.Thr535Ile	Somatic		Capture	Illumina HiSeq	Phase_I	53492454	NM_144577	Q6ZRL4|Q96M06|Q9UFG8	Missense_Mutation	SNP	ENST00000315396.7	37	CCDS12714.2	.	.	.	.	.	.	.	.	.	.	G	8.622	0.891688	0.17613	.	.	ENSG00000105479	ENST00000315396	T	0.23348	1.91	2.41	1.35	0.21983	.	.	.	.	.	T	0.15046	0.0363	N	0.19112	0.55	0.09310	N	1	B	0.22983	0.078	B	0.21708	0.036	T	0.24190	-1.0167	9	0.62326	D	0.03	-1.0633	5.2567	0.15552	0.1678:0.0:0.8322:0.0	.	535	Q96M63	CC114_HUMAN	I	535	ENSP00000318429:T535I	ENSP00000318429:T535I	T	-	2	0	CCDC114	53492454	0.006000	0.16342	0.001000	0.08648	0.002000	0.02628	0.544000	0.23253	0.563000	0.29222	0.561000	0.74099	ACC		0.677	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343207.1	NM_144577	
TSKS	60385	broad.mit.edu	37	19	50266336	50266336	+	Splice_Site	SNP	C	C	G			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:50266336C>G	ENST00000246801.3	-	1	251	c.169G>C	c.(169-171)Ggg>Cgg	p.G57R	RNU6-841P_ENST00000383872.1_RNA	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	57					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)	p.G57R(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		CAAACCCACCCGTGGAACGAC	0.622																																					p.G57R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G169C	19						.						107.0	98.0	101.0					19																	50266336		2203	4300	6503	54958148	SO:0001630	splice_region_variant	60385	exon1			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.170+1G>C	19.37:g.50266336C>G		Somatic		Capture	Illumina HiSeq	Phase_I	54958148	NM_021733	Q8WXJ0	Missense_Mutation	SNP	ENST00000246801.3	37	CCDS12780.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631974	0.67015	.	.	ENSG00000126467	ENST00000246801	T	0.56275	0.47	4.41	4.41	0.53225	.	0.000000	0.43579	D	0.000548	T	0.56307	0.1976	L	0.27053	0.805	0.80722	D	1	D	0.63046	0.992	P	0.61003	0.882	T	0.61695	-0.7010	10	0.87932	D	0	-25.9814	14.0223	0.64563	0.0:1.0:0.0:0.0	.	57	Q9UJT2	TSKS_HUMAN	R	57	ENSP00000246801:G57R	ENSP00000246801:G57R	G	-	1	0	TSKS	54958148	1.000000	0.71417	1.000000	0.80357	0.611000	0.37282	1.703000	0.37846	2.299000	0.77371	0.467000	0.42956	GGG		0.622	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465795.1	NM_021733	Missense_Mutation
VSTM1	284415	broad.mit.edu	37	19	54544290	54544290	+	Silent	SNP	G	G	A	rs140870757		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:54544290G>A	ENST00000338372.2	-	9	811	c.636C>T	c.(634-636)agC>agT	p.S212S	VSTM1_ENST00000425006.2_3'UTR|VSTM1_ENST00000366170.2_Silent_p.S124S|VSTM1_ENST00000376626.1_Silent_p.S181S	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	212					immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.S212S(1)		breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		CAGACAGGGCGCTGGTGCTTA	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		12187	0.0		0.001	False		,,,				2504	0.0				p.S212S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C636T	19						.	G		2,4404	4.2+/-10.8	0,2,2201	52.0	48.0	50.0		636	-5.3	0.0	19	dbSNP_134	50	10,8590	7.7+/-29.5	0,10,4290	no	coding-synonymous	VSTM1	NM_198481.3		0,12,6491	AA,AG,GG		0.1163,0.0454,0.0923		212/237	54544290	12,12994	2203	4300	6503	59236102	SO:0001819	synonymous_variant	284415	exon9			AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.636C>T	19.37:g.54544290G>A		Somatic		Capture	Illumina HiSeq	Phase_I	59236102	NM_198481	B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Silent	SNP	ENST00000338372.2	37	CCDS12872.1																																																																																				0.517	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139358.3	NM_198481	
ZSCAN5A	79149	broad.mit.edu	37	19	56733338	56733338	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:56733338G>A	ENST00000587340.1	-	7	1792	c.1097C>T	c.(1096-1098)aCg>aTg	p.T366M	ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.T366M|ZSCAN5A_ENST00000587492.1_Missense_Mutation_p.T220M|ZSCAN5A_ENST00000254165.3_Missense_Mutation_p.T249M|ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.T365M			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	366					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.T366M(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						GGAATTACACGTAAACCTCTT	0.527																																					p.T366M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1097T	19						.						76.0	75.0	75.0					19																	56733338		2203	4300	6503	61425150	SO:0001583	missense	79149	exon5			AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.1097C>T	19.37:g.56733338G>A	ENSP00000467631:p.Thr366Met	Somatic		Capture	Illumina HiSeq	Phase_I	61425150	NM_024303	B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	ENST00000587340.1	37	CCDS12941.1	.	.	.	.	.	.	.	.	.	.	G	7.944	0.743446	0.15642	.	.	ENSG00000131848	ENST00000391713;ENST00000254165	T;T	0.07800	3.16;3.16	2.7	-5.39	0.02664	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07999	0.0200	L	0.44542	1.39	0.09310	N	1	D;D	0.63880	0.993;0.975	P;P	0.47981	0.563;0.454	T	0.01386	-1.1368	9	0.56958	D	0.05	.	3.5147	0.07721	0.1114:0.3026:0.4331:0.1529	.	249;366	B4DX98;Q9BUG6	.;ZSA5A_HUMAN	M	366;249	ENSP00000375593:T366M;ENSP00000254165:T249M	ENSP00000254165:T249M	T	-	2	0	ZSCAN5A	61425150	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.486000	0.00064	-2.614000	0.00443	-0.502000	0.04539	ACG		0.527	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458110.1	NM_024303	
ACTL9	284382	broad.mit.edu	37	19	8808060	8808060	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:8808060C>T	ENST00000324436.3	-	1	1112	c.992G>A	c.(991-993)cGc>cAc	p.R331H		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	331						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R331H(2)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						CAAGTCCGCGCGCATCTCCAG	0.667																																					p.R331H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G992A	19						.						38.0	38.0	38.0					19																	8808060		2202	4297	6499	8669060	SO:0001583	missense	284382	exon1				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.992G>A	19.37:g.8808060C>T	ENSP00000316674:p.Arg331His	Somatic		Capture	Illumina HiSeq	Phase_I	8669060	NM_178525	A8K893|Q6X960	Missense_Mutation	SNP	ENST00000324436.3	37	CCDS12207.1	.	.	.	.	.	.	.	.	.	.	c	13.31	2.200241	0.38905	.	.	ENSG00000181786	ENST00000324436	D	0.95885	-3.84	4.45	1.16	0.20824	.	0.515035	0.14737	U	0.301383	D	0.93471	0.7917	M	0.78456	2.415	0.09310	N	0.999994	P	0.48911	0.917	B	0.40101	0.319	D	0.87077	0.2163	10	0.87932	D	0	.	8.0852	0.30769	0.0:0.65:0.0:0.35	.	331	Q8TC94	ACTL9_HUMAN	H	331	ENSP00000316674:R331H	ENSP00000316674:R331H	R	-	2	0	ACTL9	8669060	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.348000	0.20031	0.247000	0.21414	0.306000	0.20318	CGC		0.667	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459953.1	NM_178525	
GATAD2A	54815	broad.mit.edu	37	19	19603499	19603499	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:19603499delA	ENST00000360315.3	+	4	824	c.512delA	c.(511-513)caafs	p.Q171fs	GATAD2A_ENST00000537887.1_Intron|GATAD2A_ENST00000429563.2_Frame_Shift_Del_p.Q28fs|GATAD2A_ENST00000404158.1_Frame_Shift_Del_p.Q171fs|GATAD2A_ENST00000358713.3_Frame_Shift_Del_p.Q171fs|GATAD2A_ENST00000252577.5_Frame_Shift_Del_p.Q171fs	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	171	CR1; MBD2-binding.				anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.K172fs*16(1)|p.K29fs*16(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						AGTCAAATACAAAAGGAAGCC	0.527																																					p.Q171fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.512delA	19						.						116.0	108.0	111.0					19																	19603499		2203	4300	6503	19464499	SO:0001589	frameshift_variant	54815	exon4			AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.512delA	19.37:g.19603499delA	ENSP00000353463:p.Gln171fs	Somatic		Capture	Illumina HiSeq	Phase_I	19464499	NM_017660	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Frame_Shift_Del	DEL	ENST00000360315.3	37	CCDS12402.2																																																																																				0.527	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660	
ZNF329	79673	broad.mit.edu	37	19	58640027	58640027	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr19:58640027T>G	ENST00000598312.1	-	4	1077	c.844A>C	c.(844-846)Aca>Cca	p.T282P	ZNF329_ENST00000358067.4_Missense_Mutation_p.T282P	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	282					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T282P(1)		NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		TTCTCGCCTGTGTGAATTCTC	0.433																																					p.T282P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A844C	19						.						133.0	129.0	131.0					19																	58640027		2203	4300	6503	63331839	SO:0001583	missense	79673	exon4			AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.844A>C	19.37:g.58640027T>G	ENSP00000470008:p.Thr282Pro	Somatic		Capture	Illumina HiSeq	Phase_I	63331839	NM_024620	B3KR32|Q9H9R7	Missense_Mutation	SNP	ENST00000598312.1	37	CCDS12972.1	.	.	.	.	.	.	.	.	.	.	T	16.57	3.160263	0.57368	.	.	ENSG00000181894	ENST00000358067;ENST00000500161	T;T	0.25749	1.78;1.78	4.16	3.14	0.36123	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000209	T	0.44307	0.1287	M	0.77313	2.365	0.54753	D	0.999984	D	0.54772	0.968	P	0.58820	0.846	T	0.43637	-0.9379	10	0.72032	D	0.01	-14.1532	9.8217	0.40887	0.1541:0.0:0.0:0.8458	.	282	Q86UD4	ZN329_HUMAN	P	282	ENSP00000350773:T282P;ENSP00000439527:T282P	ENSP00000350773:T282P	T	-	1	0	ZNF329	63331839	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	2.869000	0.48444	0.924000	0.37069	0.533000	0.62120	ACA		0.433	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466724.1	NM_024620	
ATXN7L2	127002	broad.mit.edu	37	1	110033679	110033680	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:110033679_110033680insC	ENST00000369870.3	+	10	1509_1510	c.1494_1495insC	c.(1495-1497)cccfs	p.P499fs	CYB561D1_ENST00000393709.3_5'Flank|ATXN7L2_ENST00000459635.1_3'UTR	NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	499								p.T501fs*21(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		CAGCCTCCATGCCCCCCACCAA	0.658											OREG0013635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M498fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1494_1495insC	1						.																																			109835203	SO:0001589	frameshift_variant	127002	exon10			BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.1500dupC	1.37:g.110033685_110033685dupC	ENSP00000358886:p.Pro499fs	Somatic	1424	Capture	Illumina HiSeq	Phase_I	109835202	NM_153340		Frame_Shift_Ins	INS	ENST00000369870.3	37	CCDS30794.1																																																																																				0.658	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030331.1	NM_153340	
RSBN1	54665	broad.mit.edu	37	1	114309020	114309020	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:114309020C>T	ENST00000261441.5	-	7	2054	c.1991G>A	c.(1990-1992)cGt>cAt	p.R664H	RSBN1_ENST00000369581.2_5'UTR	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	664						nucleus (GO:0005634)		p.R664H(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTAGCATAACGAATGCCTTC	0.398																																					p.R664H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1991A	1						.						77.0	71.0	73.0					1																	114309020		2203	4299	6502	114110543	SO:0001583	missense	54665	exon7			AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.1991G>A	1.37:g.114309020C>T	ENSP00000261441:p.Arg664His	Somatic		Capture	Illumina HiSeq	Phase_I	114110543	NM_018364	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Missense_Mutation	SNP	ENST00000261441.5	37	CCDS862.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.042533	0.75732	.	.	ENSG00000081019	ENST00000261441	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.55657	0.1934	M	0.75615	2.305	0.80722	D	1	P	0.36125	0.538	B	0.32211	0.142	T	0.65393	-0.6179	9	0.87932	D	0	-8.6133	19.8965	0.96963	0.0:1.0:0.0:0.0	.	664	Q5VWQ0	RSBN1_HUMAN	H	664	.	ENSP00000261441:R664H	R	-	2	0	RSBN1	114110543	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.039000	0.70972	2.771000	0.95319	0.563000	0.77884	CGT		0.398	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
FMO5	2330	broad.mit.edu	37	1	146687457	146687457	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:146687457G>A	ENST00000254090.4	-	3	579	c.191C>T	c.(190-192)tCt>tTt	p.S64F	FMO5_ENST00000369272.3_Missense_Mutation_p.S64F|RP11-337C18.10_ENST00000606856.1_RNA|FMO5_ENST00000465173.1_5'UTR|FMO5_ENST00000441068.2_Missense_Mutation_p.S64F	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5	64						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.S64F(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					CATCTCTTTAGAAGTATTGAT	0.388																																					p.S64F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C191T	1						.						151.0	144.0	146.0					1																	146687457		2203	4300	6503	145154081	SO:0001583	missense	2330	exon2			Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607	ENST00000254090.4:c.191C>T	1.37:g.146687457G>A	ENSP00000254090:p.Ser64Phe	Somatic		Capture	Illumina HiSeq	Phase_I	145154081	NM_001144830	B2RBG1|C9JJD1|Q8IV22	Missense_Mutation	SNP	ENST00000254090.4	37	CCDS926.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504849	0.85176	.	.	ENSG00000131781	ENST00000441068;ENST00000254090;ENST00000369272;ENST00000533174;ENST00000533848	T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34	6.14	6.14	0.99180	.	0.045343	0.85682	D	0.000000	T	0.78874	0.4352	H	0.94345	3.525	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.87578	0.99;0.992;0.998;0.996	T	0.82950	-0.0203	10	0.66056	D	0.02	-25.8835	18.3535	0.90348	0.0:0.0:1.0:0.0	.	64;64;64;64	Q9HA79;Q8IV22;P49326;C9JJD1	.;.;FMO5_HUMAN;.	F	64	ENSP00000416011:S64F;ENSP00000254090:S64F;ENSP00000358277:S64F;ENSP00000436429:S64F;ENSP00000432569:S64F	ENSP00000254090:S64F	S	-	2	0	FMO5	145154081	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.220000	0.78008	2.937000	0.99478	0.650000	0.86243	TCT		0.388	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040373.2	NM_001461	
C1orf54	79630	broad.mit.edu	37	1	150249034	150249034	+	Silent	SNP	G	G	A	rs141645512		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:150249034G>A	ENST00000369102.1	+	6	1064	c.294G>A	c.(292-294)acG>acA	p.T98T	C1orf54_ENST00000369098.3_Silent_p.T98T|C1orf54_ENST00000369099.3_Silent_p.T98T			Q8WWF1	CA054_HUMAN	chromosome 1 open reading frame 54	98						extracellular region (GO:0005576)		p.T98T(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGTAACAACGGAACCTGTGA	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		19134	0.001		0.0	False		,,,				2504	0.0				p.T98T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G294A	1						.	G		3,4403	6.2+/-15.9	0,3,2200	87.0	79.0	81.0		294	3.2	0.0	1	dbSNP_134	81	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	C1orf54	NM_024579.3		0,7,6496	AA,AG,GG		0.0465,0.0681,0.0538		98/132	150249034	7,12999	2203	4300	6503	148515658	SO:0001819	synonymous_variant	79630	exon4			BC017761	CCDS948.1, CCDS72905.1	1q21.2	2012-06-25			ENSG00000118292	ENSG00000118292			26258	protein-coding gene	gene with protein product						12477932	Standard	NM_024579		Approved	FLJ23221	uc001eud.3	Q8WWF1	OTTHUMG00000012546	ENST00000369102.1:c.294G>A	1.37:g.150249034G>A		Somatic		Capture	Illumina HiSeq	Phase_I	148515658	NM_024579	Q9H5P3	Silent	SNP	ENST00000369102.1	37	CCDS948.1																																																																																				0.498	C1orf54-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035055.1	NM_024579	
FLG	2312	broad.mit.edu	37	1	152281795	152281795	+	Missense_Mutation	SNP	C	C	T	rs111360507	byFrequency	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:152281795C>T	ENST00000368799.1	-	3	5602	c.5567G>A	c.(5566-5568)cGt>cAt	p.R1856H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1856	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R1856H(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGACTGCCCACGGGAGACATC	0.547									Ichthyosis				T|||	12	0.00239617	0.0076	0.0029	5008	,	,		21735	0.0		0.0	False		,,,				2504	0.0				p.R1856H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5567A	1						.	T	HIS/ARG	27,4379	823.6+/-416.5	0,27,2176	346.0	342.0	343.0		5567	-3.9	0.0	1	dbSNP_132	343	2,8598	819.1+/-406.8	0,2,4298	yes	missense	FLG	NM_002016.1	29	0,29,6474	TT,TC,CC		0.0233,0.6128,0.223	benign	1856/4062	152281795	29,12977	2203	4300	6503	150548419	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5567G>A	1.37:g.152281795C>T	ENSP00000357789:p.Arg1856His	Somatic		Capture	Illumina HiSeq	Phase_I	150548419	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	T	4.022	0.001485	0.07819	0.006128	2.33E-4	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.00816	5.66	2.72	-3.86	0.04230	.	.	.	.	.	T	0.00144	0.0004	N	0.05351	-0.065	0.09310	N	1	B	0.29301	0.241	B	0.17098	0.017	T	0.36744	-0.9735	9	0.02654	T	1	0.627	9.5303	0.39189	0.0:0.5776:0.0:0.4224	.	1856	P20930	FILA_HUMAN	H	1856;91	ENSP00000357789:R1856H	ENSP00000271820:R91H	R	-	2	0	FLG	150548419	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.527000	0.06200	-1.173000	0.02758	-2.458000	0.00206	CGT		0.547	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CD5L	922	broad.mit.edu	37	1	157804254	157804254	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:157804254C>A	ENST00000368174.4	-	4	757	c.661G>T	c.(661-663)Ggg>Tgg	p.G221W	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	221	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCCCAAGGCCCAGAAGGGCAA	0.502																																					p.G221W												.	.	0			c.G661T	1						.						56.0	48.0	51.0					1																	157804254		2203	4300	6503	156070878	SO:0001583	missense	922	exon4			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.661G>T	1.37:g.157804254C>A	ENSP00000357156:p.Gly221Trp	None		Capture	Illumina HiSeq	Phase_I	156070878	NM_005894	A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.704996	0.48412	.	.	ENSG00000073754	ENST00000368174	T	0.35421	1.31	4.97	-3.61	0.04556	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.654950	0.03271	N	0.184762	T	0.29028	0.0721	L	0.46819	1.47	0.09310	N	1	D	0.63046	0.992	D	0.65323	0.934	T	0.24621	-1.0155	10	0.66056	D	0.02	.	5.6118	0.17410	0.0:0.3353:0.2425:0.4222	.	221	O43866	CD5L_HUMAN	W	221	ENSP00000357156:G221W	ENSP00000357156:G221W	G	-	1	0	CD5L	156070878	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-2.148000	0.01292	-0.995000	0.03459	-0.818000	0.03119	GGG		0.502	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
ATP1A2	477	broad.mit.edu	37	1	160106160	160106160	+	Splice_Site	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:160106160G>A	ENST00000361216.3	+	18	2652	c.2563G>A	c.(2563-2565)Ggg>Agg	p.G855R	ATP1A2_ENST00000392233.3_Splice_Site_p.G855R	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	855					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.G855R(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CGGACAGATCGGTGCGCCAAG	0.582																																					p.G855R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2563A	1						.						58.0	60.0	59.0					1																	160106160		2203	4300	6503	158372784	SO:0001630	splice_region_variant	477	exon18			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2563+1G>A	1.37:g.160106160G>A		Somatic		Capture	Illumina HiSeq	Phase_I	158372784	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	37	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	G	34	5.334756	0.95758	.	.	ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866	D;D	0.97941	-4.62;-4.62	4.71	4.71	0.59529	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98592	0.9529	H	0.98314	4.2	0.80722	D	1	D	0.56968	0.978	P	0.46389	0.515	D	0.99884	1.1119	10	0.87932	D	0	.	16.9397	0.86213	0.0:0.0:1.0:0.0	.	855	P50993	AT1A2_HUMAN	R	855;855;558	ENSP00000354490:G855R;ENSP00000376066:G855R	ENSP00000354490:G855R	G	+	1	0	ATP1A2	158372784	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.490000	0.73645	2.590000	0.87494	0.561000	0.74099	GGG		0.582	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	Missense_Mutation
FAM58BP	339521	broad.mit.edu	37	1	200182893	200182893	+	IGR	SNP	C	C	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:200182893C>A								NR5A2 (36341 upstream) : RP11-532L16.3 (101669 downstream)																							CGAGACCATCCTGGACGCCTT	0.532																																					p.L68M												.	.	0			c.C202A	1						.						197.0	186.0	190.0					1																	200182893		2203	4300	6503	198449516	SO:0001628	intergenic_variant	339521	exon1																															1.37:g.200182893C>A		Somatic		Capture	Illumina HiSeq	Phase_I	198449516	NM_001105517		Missense_Mutation	SNP		37																																																																																				0	0.532								
TBCE	6905	broad.mit.edu	37	1	235612028	235612028	+	Nonsense_Mutation	SNP	T	T	G			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:235612028T>G	ENST00000366601.3	+	17	1711	c.1535T>G	c.(1534-1536)tTa>tGa	p.L512*	TBCE_ENST00000472011.1_3'UTR|TBCE_ENST00000406207.1_Nonsense_Mutation_p.L512*|TBCE_ENST00000543662.1_Nonsense_Mutation_p.L563*			Q15813	TBCE_HUMAN	tubulin folding cofactor E	512					'de novo' posttranslational protein folding (GO:0051084)|adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|microtubule cytoskeleton organization (GO:0000226)|muscle atrophy (GO:0014889)|peripheral nervous system neuron axonogenesis (GO:0048936)|post-chaperonin tubulin folding pathway (GO:0007023)|post-embryonic development (GO:0009791)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	chaperone binding (GO:0051087)	p.L512*(1)		NS(1)|endometrium(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	14	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			CTAAAGTCATTACAGTTTTAT	0.403																																					p.L512X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T1535G	1						.						76.0	78.0	77.0					1																	235612028		2203	4300	6503	233678651	SO:0001587	stop_gained	6905	exon17			U61232	CCDS1605.1, CCDS73052.1	1q42.3	2014-02-04	2006-11-21		ENSG00000116957	ENSG00000116957			11582	protein-coding gene	gene with protein product		604934	"""tubulin-specific chaperone e"", ""Kenny-Caffey syndrome"", ""hypoparathyroidism, growth and mental retardation, and dysmorphism"""	KCS, HRD		8706133, 9806825, 12389028	Standard	NM_001079515		Approved	KCS1, pac2	uc001hxa.1	Q15813	OTTHUMG00000039987	ENST00000366601.3:c.1535T>G	1.37:g.235612028T>G	ENSP00000355560:p.Leu512*	Somatic		Capture	Illumina HiSeq	Phase_I	233678651	NM_001079515	A8K8C2|B7Z3P1	Nonsense_Mutation	SNP	ENST00000366601.3	37	CCDS1605.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.629684	0.87660	.	.	ENSG00000116957	ENST00000366601;ENST00000406207;ENST00000543662	.	.	.	4.96	4.96	0.65561	.	0.073034	0.53938	D	0.000047	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.4114	14.7987	0.69898	0.0:0.0:0.0:1.0	.	.	.	.	X	512;512;563	.	ENSP00000355560:L512X	L	+	2	0	TBCE	233678651	1.000000	0.71417	0.996000	0.52242	0.426000	0.31534	5.712000	0.68407	2.074000	0.62210	0.459000	0.35465	TTA		0.403	TBCE-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096458.3	NM_003193	
RYR2	6262	broad.mit.edu	37	1	237729972	237729972	+	Missense_Mutation	SNP	C	C	T	rs200236750		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:237729972C>T	ENST00000366574.2	+	28	3637	c.3320C>T	c.(3319-3321)aCg>aTg	p.T1107M	RYR2_ENST00000542537.1_Missense_Mutation_p.T1091M|RYR2_ENST00000360064.6_Missense_Mutation_p.T1105M	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1107	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.T1105M(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAATTTGAGACGGTCACTGCT	0.552																																					p.T1107M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3320T	1						.	C	MET/THR	0,4016		0,0,2008	177.0	177.0	177.0		3320	5.4	1.0	1		177	5,8333		0,5,4164	yes	missense	RYR2	NM_001035.2	81	0,5,6172	TT,TC,CC		0.06,0.0,0.0405	possibly-damaging	1107/4968	237729972	5,12349	2008	4169	6177	235796595	SO:0001583	missense	6262	exon28			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3320C>T	1.37:g.237729972C>T	ENSP00000355533:p.Thr1107Met	Somatic		Capture	Illumina HiSeq	Phase_I	235796595	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.189986	0.58017	0.0	6.0E-4	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.68624	-0.34;-0.34;-0.34	5.41	5.41	0.78517	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.283792	0.27764	N	0.017960	T	0.61986	0.2391	L	0.47716	1.5	0.80722	D	1	P	0.37038	0.579	B	0.32533	0.147	T	0.66468	-0.5916	10	0.62326	D	0.03	.	19.1954	0.93686	0.0:1.0:0.0:0.0	.	1107	Q92736	RYR2_HUMAN	M	1107;1105;1091	ENSP00000355533:T1107M;ENSP00000353174:T1105M;ENSP00000443798:T1091M	ENSP00000353174:T1105M	T	+	2	0	RYR2	235796595	0.866000	0.29940	0.997000	0.53966	0.941000	0.58515	1.727000	0.38095	2.536000	0.85505	0.655000	0.94253	ACG		0.552	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
OR14A16	284532	broad.mit.edu	37	1	247978755	247978755	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:247978755G>T	ENST00000357627.1	-	1	276	c.277C>A	c.(277-279)Ctt>Att	p.L93I		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L93I(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						ACACAGCCAAGGAATGAAATG	0.438																																					p.L93I	Ovarian(112;180 1586 15073 21914 33526)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C277A	1						.						91.0	91.0	91.0					1																	247978755		2203	4300	6503	246045378	SO:0001583	missense	284532	exon1			BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.277C>A	1.37:g.247978755G>T	ENSP00000350248:p.Leu93Ile	Somatic		Capture	Illumina HiSeq	Phase_I	246045378	NM_001001966	Q6IF96	Missense_Mutation	SNP	ENST00000357627.1	37	CCDS31097.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025844	0.35701	.	.	ENSG00000196772	ENST00000357627	T	0.02656	4.21	3.51	-2.44	0.06502	GPCR, rhodopsin-like superfamily (1);	1.240890	0.06236	U	0.689518	T	0.02807	0.0084	L	0.49571	1.57	0.09310	N	1	B	0.32731	0.382	B	0.33690	0.168	T	0.44019	-0.9355	10	0.22109	T	0.4	.	0.6865	0.00884	0.2548:0.322:0.1961:0.227	.	93	Q8NHC5	O14AG_HUMAN	I	93	ENSP00000350248:L93I	ENSP00000350248:L93I	L	-	1	0	OR14A16	246045378	0.000000	0.05858	0.000000	0.03702	0.675000	0.39556	-5.671000	0.00105	-0.640000	0.05495	0.590000	0.80494	CTT		0.438	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096856.1	NM_001001966	
PTPRU	10076	broad.mit.edu	37	1	29606126	29606126	+	Silent	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:29606126C>T	ENST00000345512.3	+	10	1851	c.1722C>T	c.(1720-1722)ggC>ggT	p.G574G	PTPRU_ENST00000428026.2_Silent_p.G574G|PTPRU_ENST00000373779.3_Silent_p.G574G|PTPRU_ENST00000356870.3_Silent_p.G574G|PTPRU_ENST00000460170.2_Silent_p.G574G|PTPRU_ENST00000323874.8_Silent_p.G574G|PTPRU_ENST00000415600.2_3'UTR	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	574	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G574G(2)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CAGGCAAAGGCTTCGGCCAGG	0.612																																					p.G574G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1722T	1						.						105.0	110.0	108.0					1																	29606126		2203	4300	6503	29478713	SO:0001819	synonymous_variant	10076	exon10			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.1722C>T	1.37:g.29606126C>T		Somatic		Capture	Illumina HiSeq	Phase_I	29478713	NM_005704	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Silent	SNP	ENST00000345512.3	37	CCDS334.1																																																																																				0.612	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
C1orf87	127795	broad.mit.edu	37	1	60476071	60476071	+	Silent	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:60476071C>T	ENST00000371201.3	-	9	1292	c.1185G>A	c.(1183-1185)ttG>ttA	p.L395L	C1orf87_ENST00000395552.1_5'Flank|C1orf87_ENST00000450089.2_Silent_p.L166L|C1orf87_ENST00000486478.1_5'Flank	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	395							calcium ion binding (GO:0005509)	p.L395L(2)		breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						CACCTGTAGGCAAATCAGATA	0.388																																					p.L395L	NSCLC(75;811 1386 4923 13371 51772)											.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G1185A	1						.						126.0	125.0	125.0					1																	60476071		2203	4300	6503	60248659	SO:0001819	synonymous_variant	127795	exon9			AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.1185G>A	1.37:g.60476071C>T		Somatic		Capture	Illumina HiSeq	Phase_I	60248659	NM_152377	Q6ZU07|Q8IVS0	Silent	SNP	ENST00000371201.3	37	CCDS614.1																																																																																				0.388	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024943.1	NM_152377	
HFM1	164045	broad.mit.edu	37	1	91781372	91781372	+	Splice_Site	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:91781372G>A	ENST00000370425.3	-	28	3238	c.3140C>T	c.(3139-3141)aCg>aTg	p.T1047M	HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000294696.5_Splice_Site_p.T279M|HFM1_ENST00000370424.3_Splice_Site_p.T726M	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1047	SEC63.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.T1047M(1)		breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TCACACTTACGTAATCTTGTG	0.313																																					p.T1047M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3140T	1						.						66.0	64.0	64.0					1																	91781372		2201	4299	6500	91553960	SO:0001630	splice_region_variant	164045	exon28			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3140+1C>T	1.37:g.91781372G>A		Somatic		Capture	Illumina HiSeq	Phase_I	91553960	NM_001017975	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	CCDS30769.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	5.133|5.133	0.210150|0.210150	0.09757|0.09757	.|.	.|.	ENSG00000162669|ENSG00000162669	ENST00000430465|ENST00000370425;ENST00000294696;ENST00000370424;ENST00000370421	.|T;T;T	.|0.62232	.|0.04;0.04;0.04	5.25|5.25	4.12|4.12	0.48240|0.48240	.|Sec63 domain (2);	.|0.765588	.|0.12875	.|N	.|0.431977	T|T	0.11281|0.11281	0.0275|0.0275	N|N	0.00855|0.00855	-1.145|-1.145	0.25714|0.25714	N|N	0.985443|0.985443	.|B;B;B	.|0.14012	.|0.009;0.0;0.005	.|B;B;B	.|0.09377	.|0.001;0.002;0.004	T|T	0.31971|0.31971	-0.9924|-0.9924	5|9	.|.	.|.	.|.	.|.	11.1879|11.1879	0.48669|0.48669	0.9269:0.0:0.0731:0.0|0.9269:0.0:0.0731:0.0	.|.	.|726;258;1047	.|A6NGI5;B1B0B5;A2PYH4	.|.;.;HFM1_HUMAN	W|M	259|1047;279;726;731	.|ENSP00000359454:T1047M;ENSP00000294696:T279M;ENSP00000359453:T726M	.|.	R|T	-|-	1|2	2|0	HFM1|HFM1	91553960|91553960	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.100000|0.100000	0.18952|0.18952	3.507000|3.507000	0.53371|0.53371	0.832000|0.832000	0.34804|0.34804	-0.606000|-0.606000	0.04082|0.04082	CGG|ACG		0.313	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	Missense_Mutation
OR2T6	254879	broad.mit.edu	37	1	248551672	248551672	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr1:248551672G>T	ENST00000355728.2	+	1	763	c.763G>T	c.(763-765)Gcc>Tcc	p.A255S		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A255S(1)		endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTATGGGGCTGCCTTGTATAC	0.473																																					p.A255S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G763T	1						.						214.0	192.0	199.0					1																	248551672		2203	4300	6503	246618295	SO:0001583	missense	254879	exon1			AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.763G>T	1.37:g.248551672G>T	ENSP00000347965:p.Ala255Ser	Somatic		Capture	Illumina HiSeq	Phase_I	246618295	NM_001005471	A6NE36	Missense_Mutation	SNP	ENST00000355728.2	37	CCDS31114.1	.	.	.	.	.	.	.	.	.	.	G	11.95	1.792647	0.31685	.	.	ENSG00000198104	ENST00000355728	T	0.00179	8.61	4.02	3.02	0.34903	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45126	D	0.000388	T	0.00271	0.0008	L	0.47716	1.5	0.09310	N	0.999998	P	0.45283	0.855	P	0.50617	0.646	T	0.59306	-0.7479	10	0.48119	T	0.1	.	12.9179	0.58216	0.0:0.2777:0.7223:0.0	.	255	Q8NHC8	OR2T6_HUMAN	S	255	ENSP00000347965:A255S	ENSP00000347965:A255S	A	+	1	0	OR2T6	246618295	0.000000	0.05858	0.996000	0.52242	0.134000	0.20937	-0.071000	0.11505	2.237000	0.73441	0.643000	0.83706	GCC		0.473	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471	
GZF1	64412	broad.mit.edu	37	20	23345357	23345357	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr20:23345357G>A	ENST00000338121.5	+	2	414	c.337G>A	c.(337-339)Gct>Act	p.A113T	GZF1_ENST00000542987.1_Intron|GZF1_ENST00000377051.2_Missense_Mutation_p.A113T|GZF1_ENST00000544236.1_Intron			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	113					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					GCTGGAAGTGGCTGAAAAGCT	0.393																																					p.A113T												.	.	0			c.G337A	20						.						80.0	84.0	83.0					20																	23345357		2203	4300	6503	23293357	SO:0001583	missense	64412	exon1			AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.337G>A	20.37:g.23345357G>A	ENSP00000338290:p.Ala113Thr	None		Capture	Illumina HiSeq	Phase_I	23293357	NM_022482	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	ENST00000338121.5	37	CCDS13151.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844633	0.71488	.	.	ENSG00000125812	ENST00000338121;ENST00000377051	D;D	0.87650	-2.28;-2.28	5.33	4.39	0.52855	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.64402	D	0.000019	D	0.90490	0.7021	M	0.91140	3.18	0.80722	D	1	P	0.41475	0.751	B	0.42827	0.399	D	0.91506	0.5223	10	0.72032	D	0.01	.	13.0465	0.58928	0.0775:0.0:0.9225:0.0	.	113	Q9H116	GZF1_HUMAN	T	113	ENSP00000338290:A113T;ENSP00000366250:A113T	ENSP00000338290:A113T	A	+	1	0	GZF1	23293357	1.000000	0.71417	0.998000	0.56505	0.659000	0.38960	9.780000	0.99024	1.275000	0.44379	-0.142000	0.14014	GCT		0.393	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078333.1	NM_022482	
TP53TG5	27296	broad.mit.edu	37	20	44003773	44003774	+	Missense_Mutation	DNP	AC	AC	TG			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	AC	AC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr20:44003773_44003774AC>TG	ENST00000372726.3	-	4	829_830	c.673_674GT>CA	c.(673-675)GTg>CAg	p.V225Q	TP53TG5_ENST00000494455.1_5'Flank|TP53TG5_ENST00000537995.1_Missense_Mutation_p.V209Q|SYS1-DBNDD2_ENST00000475242.1_Intron|SYS1-DBNDD2_ENST00000452133.1_Intron|SYS1_ENST00000426004.1_3'UTR	NM_014477.2	NP_055292.1	Q9Y2B4	T53G5_HUMAN	TP53 target 5	225					intracellular signal transduction (GO:0035556)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V225>?(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	12						TCTGCACATCACCCTGGGCGCC	0.594																																					.												.	.	1	Complex(1)	large_intestine(1)	c.673_674CA	20						.																																			43437188	SO:0001583	missense	27296	exon4			AB017802	CCDS13352.1	20q13.12	2008-09-18	2008-09-18	2008-09-18	ENSG00000124251	ENSG00000124251			15856	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 10"""	C20orf10			Standard	NM_014477		Approved	CLG01, dJ453C12.5	uc002xny.3	Q9Y2B4	OTTHUMG00000032582	ENST00000372726.3:c.673_674delinsTG	20.37:g.44003773_44003774delinsTG	ENSP00000361811:p.Val225Gln	Somatic		Capture	Illumina HiSeq	Phase_I	43437187	NM_014477		Missense_Mutation	DNP	ENST00000372726.3	37	CCDS13352.1																																																																																				0.594	TP53TG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079460.1	NM_014477	
CDH26	60437	broad.mit.edu	37	20	58564025	58564025	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr20:58564025G>A	ENST00000244047.5	+	9	1401	c.1090G>A	c.(1090-1092)Gtc>Atc	p.V364I	CDH26_ENST00000348616.4_Missense_Mutation_p.V364I			Q8IXH8	CAD26_HUMAN	cadherin 26	364	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V364I(2)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GGAGAGGCTCGTCTTCTGTGA	0.557																																					p.V364I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1090A	20						.						62.0	69.0	66.0					20																	58564025		2203	4300	6503	57997420	SO:0001583	missense	60437	exon9			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1090G>A	20.37:g.58564025G>A	ENSP00000244047:p.Val364Ile	Somatic		Capture	Illumina HiSeq	Phase_I	57997420	NM_177980	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	37		.	.	.	.	.	.	.	.	.	.	T	16.08	3.021735	0.54576	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.59906	0.23;0.32	5.03	1.31	0.21738	.	0.478557	0.21750	N	0.069687	T	0.35595	0.0937	N	0.20445	0.575	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.17868	-1.0355	10	0.18710	T	0.47	.	7.8258	0.29313	0.1324:0.0:0.4131:0.4545	.	364	Q8IXH8-4	.	I	364	ENSP00000244047:V364I;ENSP00000339390:V364I	ENSP00000244047:V364I	V	+	1	0	CDH26	57997420	0.005000	0.15991	0.000000	0.03702	0.005000	0.04900	0.494000	0.22467	-0.251000	0.09542	-0.256000	0.11100	GTC		0.557	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	
MYO18B	84700	broad.mit.edu	37	22	26422789	26422789	+	Silent	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr22:26422789G>A	ENST00000407587.2	+	43	7021	c.6852G>A	c.(6850-6852)acG>acA	p.T2284T	MYO18B_ENST00000335473.7_Silent_p.T2283T|MYO18B_ENST00000536101.1_Silent_p.T2283T			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2283						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.T2284T(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TTTACCAGACGACTGGGGCCT	0.642																																					p.T2283T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6849A	22						.						16.0	19.0	18.0					22																	26422789		1884	4101	5985	24752789	SO:0001819	synonymous_variant	84700	exon43			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6852G>A	22.37:g.26422789G>A		Somatic		Capture	Illumina HiSeq	Phase_I	24752789	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	G	4.562	0.104389	0.08731	.	.	ENSG00000133454	ENST00000543971	.	.	.	4.67	0.655	0.17839	.	.	.	.	.	T	0.42966	0.1226	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21042	-1.0257	4	.	.	.	.	2.2379	0.04012	0.1412:0.4342:0.2573:0.1672	.	.	.	.	Q	233	.	.	R	+	2	0	MYO18B	24752789	0.993000	0.37304	0.997000	0.53966	0.510000	0.34073	0.117000	0.15583	-0.104000	0.12154	-0.823000	0.03104	CGA		0.642	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
SCN2A	6326	broad.mit.edu	37	2	166152459	166152459	+	Silent	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr2:166152459G>A	ENST00000375437.2	+	2	416	c.126G>A	c.(124-126)aaG>aaA	p.K42K	SCN2A_ENST00000283256.6_Silent_p.K42K|SCN2A_ENST00000357398.3_Silent_p.K42K|SCN2A_ENST00000375427.2_Silent_p.K42K	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	42					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.K42K(2)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGGAACGCAAGGATGAGGATG	0.463																																					p.K42K												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G126A	2						.						104.0	93.0	97.0					2																	166152459		2203	4300	6503	165860705	SO:0001819	synonymous_variant	6326	exon1			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.126G>A	2.37:g.166152459G>A		Somatic		Capture	Illumina HiSeq	Phase_I	165860705	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	ENST00000375437.2	37	CCDS33314.1																																																																																				0.463	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
TTN	7273	broad.mit.edu	37	2	179640233	179640233	+	Missense_Mutation	SNP	G	G	A	rs116158152		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr2:179640233G>A	ENST00000591111.1	-	28	6582	c.6358C>T	c.(6358-6360)Cgg>Tgg	p.R2120W	TTN_ENST00000359218.5_Missense_Mutation_p.R2074W|TTN_ENST00000460472.2_Missense_Mutation_p.R2074W|TTN_ENST00000589042.1_Missense_Mutation_p.R2120W|TTN_ENST00000342992.6_Missense_Mutation_p.R2120W|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R2074W|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.R2120W|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12808	Ig-like 10.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R2074W(7)|p.R2120W(5)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGGTCAGACCGTTCAATTTTG	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		20442	0.0		0.001	False		,,,				2504	0.0				p.R2120W												.	.	12	Substitution - Missense(12)	prostate(7)|large_intestine(5)	c.C6358T	2						.						83.0	87.0	86.0					2																	179640233		2203	4300	6503	179348478	SO:0001583	missense	7273	exon28			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.6358C>T	2.37:g.179640233G>A	ENSP00000465570:p.Arg2120Trp	Somatic		Capture	Illumina HiSeq	Phase_I	179348478	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	4.249	0.045200	0.08196	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.33	2.32	0.28847	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77903	0.4200	L	0.52905	1.665	0.25501	N	0.987556	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.983;0.983;0.983;0.977;0.997	T	0.70167	-0.4946	9	0.87932	D	0	.	14.6496	0.68786	0.0:0.0:0.3582:0.6418	.	2074;2074;2074;2120;2120	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	W	2120;2074;2074;2074;2074;2120	ENSP00000343764:R2120W;ENSP00000434586:R2074W;ENSP00000340554:R2074W;ENSP00000352154:R2074W;ENSP00000354117:R2120W	ENSP00000340554:R2074W	R	-	1	2	TTN	179348478	0.997000	0.39634	0.142000	0.22268	0.509000	0.34042	2.730000	0.47335	0.579000	0.29504	-0.152000	0.13540	CGG		0.493	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SLC19A3	80704	broad.mit.edu	37	2	228563644	228563645	+	Missense_Mutation	DNP	CA	CA	TT	rs78613486		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr2:228563644_228563645CA>TT	ENST00000258403.3	-	3	857_858	c.786_787TG>AA	c.(784-789)ttTGtg>ttAAtg	p.262_263FV>LM	SLC19A3_ENST00000409287.1_Intron|SLC19A3_ENST00000541617.1_Missense_Mutation_p.258_259FV>LM	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	262					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.F262>?(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	AACCACTGCACAAAAACGTCCA	0.465																																					.												.	.	1	Complex(1)	large_intestine(1)	c.786_787AA	2						.																																			228271889	SO:0001583	missense	80704	exon3			AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.786_787delinsTT	2.37:g.228563644_228563645delinsTT	ENSP00000258403:p.F262_V263delinsLM	Somatic		Capture	Illumina HiSeq	Phase_I	228271888	NM_025243		Missense_Mutation	DNP	ENST00000258403.3	37	CCDS2468.1																																																																																				0.465	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1		
GPR55	9290	broad.mit.edu	37	2	231775353	231775353	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr2:231775353C>G	ENST00000392040.1	-	2	517	c.325G>C	c.(325-327)Gtc>Ctc	p.V109L	GPR55_ENST00000392039.2_Missense_Mutation_p.V109L|AC012507.4_ENST00000454890.1_RNA	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	109					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)	p.V109L(1)		endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		ATGGTGAAGACGCTTCCGTAC	0.582																																					p.V109L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G325C	2						.						68.0	45.0	53.0					2																	231775353		2203	4300	6503	231483597	SO:0001583	missense	9290	exon2			AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.325G>C	2.37:g.231775353C>G	ENSP00000375894:p.Val109Leu	Somatic		Capture	Illumina HiSeq	Phase_I	231483597	NM_005683	Q8N580	Missense_Mutation	SNP	ENST00000392040.1	37	CCDS2480.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.614281	0.46631	.	.	ENSG00000135898	ENST00000392040;ENST00000392039;ENST00000438398	T;T;T	0.73363	-0.74;-0.74;-0.74	5.38	0.155	0.14906	GPCR, rhodopsin-like superfamily (1);	0.176917	0.47455	D	0.000226	T	0.67202	0.2868	M	0.69358	2.11	0.29535	N	0.852533	P	0.40376	0.715	B	0.37091	0.241	T	0.64487	-0.6396	10	0.72032	D	0.01	-29.0992	9.1034	0.36683	0.0:0.4769:0.0:0.5231	.	109	Q9Y2T6	GPR55_HUMAN	L	109	ENSP00000375894:V109L;ENSP00000375893:V109L;ENSP00000412768:V109L	ENSP00000375893:V109L	V	-	1	0	GPR55	231483597	0.037000	0.19845	0.090000	0.20809	0.869000	0.49853	0.290000	0.18975	-0.257000	0.09459	-0.136000	0.14681	GTC		0.582	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332618.1	NM_005683	
LHCGR	3973	broad.mit.edu	37	2	48915290	48915290	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr2:48915290A>C	ENST00000294954.7	-	11	1667	c.1646T>G	c.(1645-1647)aTt>aGt	p.I549S	LHCGR_ENST00000344775.3_Missense_Mutation_p.I487S|LHCGR_ENST00000403273.1_3'UTR|LHCGR_ENST00000401907.1_Intron|LHCGR_ENST00000405626.1_Missense_Mutation_p.I522S|STON1-GTF2A1L_ENST00000402114.2_Intron	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	549					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)	p.I549S(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TGCAAAATAAATTTTAATGTA	0.378																																					p.I549S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1646G	2						.						100.0	102.0	101.0					2																	48915290		2203	4300	6503	48768794	SO:0001583	missense	3973	exon11				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1646T>G	2.37:g.48915290A>C	ENSP00000294954:p.Ile549Ser	Somatic		Capture	Illumina HiSeq	Phase_I	48768794	NM_000233	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	A	18.73	3.686159	0.68157	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.57752	0.38;0.38;0.38	5.68	5.68	0.88126	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.81781	0.4895	H	0.96748	3.875	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.87969	0.2735	9	.	.	.	.	15.1242	0.72469	1.0:0.0:0.0:0.0	.	549	P22888	LSHR_HUMAN	S	487;549;522	ENSP00000344301:I487S;ENSP00000294954:I549S;ENSP00000386033:I522S	.	I	-	2	0	LHCGR	48768794	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.176000	0.68965	0.477000	0.44152	ATT		0.378	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
TSGA10	80705	broad.mit.edu	37	2	99720474	99720474	+	Silent	SNP	G	G	A	rs201138854		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr2:99720474G>A	ENST00000393483.3	-	10	1411	c.567C>T	c.(565-567)acC>acT	p.T189T	TSGA10_ENST00000355053.4_Silent_p.T189T|TSGA10_ENST00000410001.1_Silent_p.T189T|TSGA10_ENST00000539964.1_Silent_p.T189T|TSGA10_ENST00000478090.1_5'UTR|TSGA10_ENST00000542655.1_Silent_p.T189T	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	189					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.T189T(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						GTTCACTTTCGGTATCCATTG	0.348																																					p.T189T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C567T	2						.						241.0	213.0	223.0					2																	99720474		2202	4299	6501	99086906	SO:0001819	synonymous_variant	80705	exon10			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.567C>T	2.37:g.99720474G>A		Somatic		Capture	Illumina HiSeq	Phase_I	99086906	NM_025244	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Silent	SNP	ENST00000393483.3	37	CCDS2037.1																																																																																				0.348	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
OR6B3	150681	broad.mit.edu	37	2	240984709	240984709	+	Missense_Mutation	SNP	G	G	A	rs201369797	byFrequency	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr2:240984709G>A	ENST00000319423.4	-	1	780	c.781C>T	c.(781-783)Cgg>Tgg	p.R261W	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R261W(1)		endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		GCCTGGGGCCGGACATACATG	0.547													g|||	2	0.000399361	0.0	0.0	5008	,	,		19295	0.002		0.0	False		,,,				2504	0.0				p.R261W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C781T	2						.						85.0	92.0	90.0					2																	240984709		1986	4151	6137	240633382	SO:0001583	missense	150681	exon1				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.781C>T	2.37:g.240984709G>A	ENSP00000322435:p.Arg261Trp	Somatic		Capture	Illumina HiSeq	Phase_I	240633382	NM_173351	Q6IFH3	Missense_Mutation	SNP	ENST00000319423.4	37	CCDS42837.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	g	12.44	1.937197	0.34189	.	.	ENSG00000178586	ENST00000319423	T	0.37915	1.17	3.88	2.0	0.26442	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42294	D	0.000722	T	0.38931	0.1059	M	0.81802	2.56	0.31305	N	0.68779	P	0.42649	0.786	B	0.42245	0.381	T	0.50533	-0.8817	10	0.72032	D	0.01	.	6.3177	0.21200	0.1031:0.0:0.7067:0.1902	.	261	Q8NGW1	OR6B3_HUMAN	W	261	ENSP00000322435:R261W	ENSP00000322435:R261W	R	-	1	2	OR6B3	240633382	0.338000	0.24775	0.733000	0.30861	0.397000	0.30659	2.077000	0.41557	0.543000	0.28864	-0.199000	0.12753	CGG		0.547	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1		
WDR49	151790	broad.mit.edu	37	3	167249045	167249046	+	In_Frame_Ins	INS	-	-	AGA			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	-	-	-	AGA	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr3:167249045_167249046insAGA	ENST00000308378.3	-	9	1324_1325	c.1019_1020insTCT	c.(1018-1020)ctc>ctTCTc	p.340_340L>LL	WDR49_ENST00000479765.1_Intron|WDR49_ENST00000476376.1_In_Frame_Ins_p.165_165L>LL|WDR49_ENST00000453925.2_In_Frame_Ins_p.404_404L>LL	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	340								p.L340_S341insL(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						TCCCAGCACTGAGAAGTTTTTG	0.441																																					p.L340delinsLL												.	.	1	Insertion - In frame(1)	large_intestine(1)	c.1020_1021insTCT	3						.																																			168731740	SO:0001652	inframe_insertion	151790	exon9			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.1017_1019dupTCT	3.37:g.167249046_167249048dupAGA	ENSP00000311343:p.Leu340dup	Somatic		Capture	Illumina HiSeq	Phase_I	168731739	NM_178824	Q8N297	In_Frame_Ins	INS	ENST00000308378.3	37	CCDS3201.1																																																																																				0.441	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
COL6A6	131873	broad.mit.edu	37	3	130286997	130286997	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr3:130286997C>A	ENST00000358511.6	+	5	1981	c.1950C>A	c.(1948-1950)agC>agA	p.S650R	COL6A6_ENST00000453409.2_Missense_Mutation_p.S650R	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	650	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.S650R(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						ACCTGGTGAGCAAGTCTCAGA	0.423																																					p.S650R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1950A	3						.						145.0	138.0	140.0					3																	130286997		1865	4115	5980	131769687	SO:0001583	missense	131873	exon5			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1950C>A	3.37:g.130286997C>A	ENSP00000351310:p.Ser650Arg	Somatic		Capture	Illumina HiSeq	Phase_I	131769687	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673073	0.47781	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.78707	-1.2;-1.2	5.53	5.53	0.82687	von Willebrand factor, type A (3);	0.087958	0.50627	D	0.000111	T	0.76328	0.3972	L	0.39566	1.225	0.38616	D	0.951021	P	0.43231	0.801	P	0.45829	0.494	T	0.75431	-0.3320	10	0.30078	T	0.28	.	19.0569	0.93069	0.0:1.0:0.0:0.0	.	650	A6NMZ7	CO6A6_HUMAN	R	650	ENSP00000351310:S650R;ENSP00000399236:S650R	ENSP00000351310:S650R	S	+	3	2	COL6A6	131769687	0.964000	0.33143	1.000000	0.80357	0.288000	0.27193	0.528000	0.23002	2.616000	0.88540	0.655000	0.94253	AGC		0.423	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
EPHB1	2047	broad.mit.edu	37	3	134670233	134670233	+	Silent	SNP	C	C	T	rs371726436		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr3:134670233C>T	ENST00000398015.3	+	3	514	c.144C>T	c.(142-144)taC>taT	p.Y48Y	EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	48	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.Y48Y(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TCAGTGGCTACGATGAAAACC	0.502																																					p.Y48Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C144T	3						.	C		0,4318		0,0,2159	36.0	40.0	39.0		144	-7.7	0.6	3		39	1,8559		0,1,4279	no	coding-synonymous	EPHB1	NM_004441.4		0,1,6438	TT,TC,CC		0.0117,0.0,0.0078		48/985	134670233	1,12877	2159	4280	6439	136152923	SO:0001819	synonymous_variant	2047	exon3			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.144C>T	3.37:g.134670233C>T		Somatic		Capture	Illumina HiSeq	Phase_I	136152923	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Silent	SNP	ENST00000398015.3	37	CCDS46921.1																																																																																				0.502	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
SRGAP3	9901	broad.mit.edu	37	3	9055203	9055203	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr3:9055203C>T	ENST00000383836.3	-	17	2363	c.1936G>A	c.(1936-1938)Gac>Aac	p.D646N	SRGAP3-AS1_ENST00000414633.1_RNA|SRGAP3_ENST00000433332.3_5'Flank|SRGAP3_ENST00000360413.3_Missense_Mutation_p.D622N	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	646	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.D646N(1)	SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		ATGTTCTCGTCGCTATACTGG	0.542			T	RAF1	pilocytic astrocytoma																																p.D646N			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1936A	3						.						94.0	89.0	91.0					3																	9055203		2203	4300	6503	9030203	SO:0001583	missense	9901	exon17			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.1936G>A	3.37:g.9055203C>T	ENSP00000373347:p.Asp646Asn	Somatic		Capture	Illumina HiSeq	Phase_I	9030203	NM_014850	Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	37	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	C	35	5.456980	0.96223	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.46451	0.87;1.9	5.54	5.54	0.83059	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.61874	0.2382	L	0.60957	1.885	0.80722	D	1	D;P	0.58620	0.983;0.634	D;P	0.65443	0.935;0.452	T	0.61912	-0.6965	10	0.59425	D	0.04	.	19.075	0.93158	0.0:1.0:0.0:0.0	.	622;646	O43295-2;O43295	.;SRGP2_HUMAN	N	646;622	ENSP00000373347:D646N;ENSP00000353587:D622N	ENSP00000353587:D622N	D	-	1	0	SRGAP3	9030203	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	7.770000	0.85390	2.606000	0.88127	0.655000	0.94253	GAC		0.542	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3		
TGFBR2	7048	broad.mit.edu	37	3	30732957	30732957	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr3:30732957G>A	ENST00000295754.5	+	7	1952	c.1570G>A	c.(1570-1572)Gac>Aac	p.D524N	TGFBR2_ENST00000359013.4_Missense_Mutation_p.D549N	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	524	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.D524N(1)|p.D524Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CTGGGACCACGACCCAGAGGC	0.607																																					p.D524N												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.G1570A	3	GRCh37	CM064328	TGFBR2	M		.						71.0	64.0	67.0					3																	30732957		2203	4300	6503	30707961	SO:0001583	missense	7048	exon7				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1570G>A	3.37:g.30732957G>A	ENSP00000295754:p.Asp524Asn	Somatic		Capture	Illumina HiSeq	Phase_I	30707961	NM_003242	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	37	CCDS2648.1	.	.	.	.	.	.	.	.	.	.	G	36	5.728444	0.96856	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.94280	-3.39;-3.39	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95717	0.8607	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93204	0.6594	10	0.21540	T	0.41	.	20.3052	0.98627	0.0:0.0:1.0:0.0	.	524;549	P37173;D2JYI1	TGFR2_HUMAN;.	N	524;549;354	ENSP00000295754:D524N;ENSP00000351905:D549N	ENSP00000295754:D524N	D	+	1	0	TGFBR2	30707961	1.000000	0.71417	0.974000	0.42286	0.985000	0.73830	9.869000	0.99810	2.808000	0.96608	0.655000	0.94253	GAC		0.607	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2		
CADPS	8618	broad.mit.edu	37	3	62501799	62501799	+	Missense_Mutation	SNP	C	C	T	rs184805711	byFrequency	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr3:62501799C>T	ENST00000383710.4	-	16	2865	c.2516G>A	c.(2515-2517)cGt>cAt	p.R839H	CADPS_ENST00000283269.9_Missense_Mutation_p.R839H|CADPS_ENST00000357948.3_Missense_Mutation_p.R822H	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	839	Interaction with DRD2.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.R839H(2)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CAGACATTTACGGATAACTGT	0.418													C|||	2	0.000399361	0.0	0.0	5008	,	,		19528	0.002		0.0	False		,,,				2504	0.0				p.R822H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2465A	3						.						150.0	130.0	137.0					3																	62501799		2203	4300	6503	62476839	SO:0001583	missense	8618	exon16			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2516G>A	3.37:g.62501799C>T	ENSP00000373215:p.Arg839His	Somatic		Capture	Illumina HiSeq	Phase_I	62476839	NM_183393	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	2|2	9.157509157509158E-4|9.157509157509158E-4	0|0	0.0|0.0	0|0	0.0|0.0	2|2	0.0034965034965034965|0.0034965034965034965	0|0	0.0|0.0	C|C	19.54|19.54	3.846573|3.846573	0.71603|0.71603	.|.	.|.	ENSG00000163618|ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269|ENST00000468271	T;T;T|.	0.33216|.	1.42;1.42;1.42|.	5.95|5.95	5.95|5.95	0.96441|0.96441	Calcium-dependent secretion activator (1);|.	0.053597|.	0.64402|.	D|.	0.000001|.	T|T	0.78065|0.78065	0.4225|0.4225	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D;B;P|.	0.89917|.	0.998;1.0;0.132;0.507|.	D;D;B;B|.	0.79784|.	0.955;0.993;0.039;0.139|.	T|T	0.75522|0.75522	-0.3288|-0.3288	10|5	0.87932|.	D|.	0|.	.|.	20.3932|20.3932	0.98965|0.98965	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	822;839;839;839|.	Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4|.	.;.;CAPS1_HUMAN;.|.	H|I	839;839;822;839|237	ENSP00000373215:R839H;ENSP00000350632:R822H;ENSP00000283269:R839H|.	ENSP00000283269:R839H|.	R|V	-|-	2|1	0|0	CADPS|CADPS	62476839|62476839	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.958000|4.958000	0.63660|0.63660	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	CGT|GTA		0.418	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
PPP2R3A	5523	broad.mit.edu	37	3	135722324	135722324	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr3:135722324G>A	ENST00000264977.3	+	2	2601	c.1984G>A	c.(1984-1986)Gag>Aag	p.E662K	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	662					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)	p.E662K(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GCAGACTCCAGAGGTGATCAA	0.363																																					p.E662K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1984A	3						.						60.0	57.0	58.0					3																	135722324		2202	4298	6500	137205014	SO:0001583	missense	5523	exon2			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.1984G>A	3.37:g.135722324G>A	ENSP00000264977:p.Glu662Lys	Somatic		Capture	Illumina HiSeq	Phase_I	137205014	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	37	CCDS3087.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044063	0.93685	.	.	ENSG00000073711	ENST00000264977	T	0.08193	3.12	5.83	4.96	0.65561	.	0.125415	0.53938	D	0.000056	T	0.20740	0.0499	L	0.55990	1.75	0.80722	D	1	D	0.67145	0.996	P	0.60609	0.877	T	0.00431	-1.1743	10	0.49607	T	0.09	.	13.8759	0.63653	0.0:0.0:0.8477:0.1523	.	662	Q06190	P2R3A_HUMAN	K	662	ENSP00000264977:E662K	ENSP00000264977:E662K	E	+	1	0	PPP2R3A	137205014	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.461000	0.90372	1.462000	0.47948	0.563000	0.77884	GAG		0.363	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
ADAMTS3	9508	broad.mit.edu	37	4	73156638	73156638	+	Silent	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr4:73156638G>A	ENST00000286657.4	-	20	2901	c.2865C>T	c.(2863-2865)ccC>ccT	p.P955P		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	955	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P955P(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGCGGCTCTCGGGACGGTCAC	0.562																																					p.P955P	NSCLC(168;1941 2048 2918 13048 43078)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2865T	4						.						118.0	101.0	107.0					4																	73156638		2203	4300	6503	73375502	SO:0001819	synonymous_variant	9508	exon20			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.2865C>T	4.37:g.73156638G>A		Somatic		Capture	Illumina HiSeq	Phase_I	73375502	NM_014243	A1L3U9|Q9BXZ8	Silent	SNP	ENST00000286657.4	37	CCDS3553.1																																																																																				0.562	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2		
SHROOM3	57619	broad.mit.edu	37	4	77660995	77660996	+	Missense_Mutation	DNP	GT	GT	AG			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	GT	GT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr4:77660995_77660996GT>AG	ENST00000296043.6	+	5	2622_2623	c.1669_1670GT>AG	c.(1669-1671)GTc>AGc	p.V557S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	557					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)		p.V556>?(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCCCTCCAAAGTCCATTTCTGT	0.525																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1669_1670AG	4						.																																			77880020	SO:0001583	missense	57619	exon5			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	Exception_encountered	4.37:g.77660995_77660996delinsAG	ENSP00000296043:p.Val557Ser	Somatic		Capture	Illumina HiSeq	Phase_I	77880019	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	DNP	ENST00000296043.6	37	CCDS3579.2																																																																																				0.525	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
APC	324	broad.mit.edu	37	5	112174094	112174095	+	Frame_Shift_Ins	INS	-	-	A	rs398123120		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr5:112174094_112174095insA	ENST00000457016.1	+	16	3183_3184	c.2803_2804insA	c.(2803-2805)tacfs	p.Y935fs	APC_ENST00000508376.2_Frame_Shift_Ins_p.Y935fs|APC_ENST00000257430.4_Frame_Shift_Ins_p.Y935fs|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	935	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Y935fs*1(4)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTCAAACACTTACAATTTCACT	0.366		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Y935_N936delinsX	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,-2 	.	5	Insertion - Frameshift(4)|Unknown(1)	large_intestine(3)|thyroid(1)|skin(1)	c.2803_2804insA	5	GRCh37	CI023287|CI991958	APC	I		.																																			112201994	SO:0001589	frameshift_variant	324	exon16	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2804dupA	5.37:g.112174095_112174095dupA	ENSP00000413133:p.Tyr935fs	Somatic		Capture	Illumina HiSeq	Phase_I	112201993	NM_000038	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Ins	INS	ENST00000457016.1	37	CCDS4107.1																																																																																				0.366	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DNAH5	1767	broad.mit.edu	37	5	13850794	13850794	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr5:13850794T>A	ENST00000265104.4	-	31	5185	c.5081A>T	c.(5080-5082)gAc>gTc	p.D1694V		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1694	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.D1694V(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTCCAACTGGTCCAGCAAGTG	0.493									Kartagener syndrome																												p.D1694V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5081T	5						.						72.0	69.0	70.0					5																	13850794		2203	4300	6503	13903794	SO:0001583	missense	1767	exon31	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5081A>T	5.37:g.13850794T>A	ENSP00000265104:p.Asp1694Val	Somatic		Capture	Illumina HiSeq	Phase_I	13903794	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	18.05	3.537010	0.65085	.	.	ENSG00000039139	ENST00000265104	T	0.62232	0.04	5.63	5.63	0.86233	Dynein heavy chain, domain-2 (1);	0.105364	0.64402	D	0.000004	T	0.56934	0.2019	L	0.40543	1.245	0.80722	D	1	B	0.09022	0.002	B	0.19946	0.027	T	0.55438	-0.8141	10	0.72032	D	0.01	.	15.8443	0.78876	0.0:0.0:0.0:1.0	.	1694	Q8TE73	DYH5_HUMAN	V	1694	ENSP00000265104:D1694V	ENSP00000265104:D1694V	D	-	2	0	DNAH5	13903794	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.813000	0.86123	2.142000	0.66516	0.482000	0.46254	GAC		0.493	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
DNAH5	1767	broad.mit.edu	37	5	13919391	13919391	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr5:13919391C>T	ENST00000265104.4	-	7	973	c.869G>A	c.(868-870)tGg>tAg	p.W290*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	290	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.W290*(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCTTTTTTTCCAGTGCTCCAG	0.522									Kartagener syndrome																												p.W290X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G869A	5						.						144.0	155.0	152.0					5																	13919391		2203	4300	6503	13972391	SO:0001587	stop_gained	1767	exon7	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.869G>A	5.37:g.13919391C>T	ENSP00000265104:p.Trp290*	Somatic		Capture	Illumina HiSeq	Phase_I	13972391	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	.	38	7.276717	0.98182	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.3809	0.90451	0.0:1.0:0.0:0.0	.	.	.	.	X	290	.	ENSP00000265104:W290X	W	-	2	0	DNAH5	13972391	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.729000	0.84864	2.593000	0.87608	0.491000	0.48974	TGG		0.522	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
HINT1	3094	broad.mit.edu	37	5	130498276	130498276	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr5:130498276C>A	ENST00000304043.5	-	2	484	c.205G>T	c.(205-207)Gat>Tat	p.D69Y	HINT1_ENST00000506908.1_Missense_Mutation_p.D69Y|HINT1_ENST00000506207.1_5'UTR|HINT1_ENST00000513012.1_3'UTR|HINT1_ENST00000508488.1_Missense_Mutation_p.D69Y	NM_005340.6	NP_005331.1	P49773	HINT1_HUMAN	histidine triad nucleotide binding protein 1	69	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|purine ribonucleotide catabolic process (GO:0009154)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)|protein kinase C binding (GO:0005080)	p.D69Y(1)		endometrium(1)|large_intestine(1)|lung(3)	5		all_cancers(142;0.0452)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Adenosine monophosphate(DB00131)	CTTTCATCATCATCTTCTGCC	0.358																																					p.D69Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G205T	5						.						110.0	102.0	105.0					5																	130498276		2203	4300	6503	130526175	SO:0001583	missense	3094	exon2			BC007090	CCDS4147.1	5q31.2	2010-03-30	2001-11-28	2002-03-08	ENSG00000169567	ENSG00000169567			4912	protein-coding gene	gene with protein product		601314	"""histidine triad nucleotide-binding protein"""	PRKCNH1, HINT		8812426	Standard	NM_005340		Approved	PKCI-1	uc003kve.4	P49773	OTTHUMG00000128995	ENST00000304043.5:c.205G>T	5.37:g.130498276C>A	ENSP00000304229:p.Asp69Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	130526175	NM_005340	Q9H5W8	Missense_Mutation	SNP	ENST00000304043.5	37	CCDS4147.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.087171|4.087171	0.76642|0.76642	.|.	.|.	ENSG00000169567|ENSG00000169567	ENST00000304043;ENST00000508488;ENST00000506908|ENST00000520028	D;D;D|.	0.92048|.	-2.96;-2.96;-2.96|.	3.97|3.97	3.97|3.97	0.46021|0.46021	Histidine triad motif (1);Histidine triad-like motif (1);|.	0.307769|.	0.33753|.	N|.	0.004592|.	T|T	0.73521|0.73521	0.3597|0.3597	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	B|.	0.25390|.	0.125|.	B|.	0.30316|.	0.114|.	T|T	0.74621|0.74621	-0.3604|-0.3604	10|5	0.87932|.	D|.	0|.	-12.1134|-12.1134	14.3379|14.3379	0.66603|0.66603	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	69|.	P49773|.	HINT1_HUMAN|.	Y|I	69|15	ENSP00000304229:D69Y;ENSP00000427499:D69Y;ENSP00000426860:D69Y|.	ENSP00000304229:D69Y|.	D|M	-|-	1|3	0|0	HINT1|HINT1	130526175|130526175	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.313000|4.313000	0.59160|0.59160	2.479000|2.479000	0.83701|0.83701	0.655000|0.655000	0.94253|0.94253	GAT|ATG		0.358	HINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250984.1	NM_005340	
SLC35A4	113829	broad.mit.edu	37	5	139946758	139946758	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr5:139946758A>T	ENST00000514199.1	+	2	1690	c.4A>T	c.(4-6)Agt>Tgt	p.S2C	SLC35A4_ENST00000323146.3_Missense_Mutation_p.S2C|APBB3_ENST00000507279.1_Intron|APBB3_ENST00000357560.4_5'Flank|APBB3_ENST00000511201.2_5'Flank|APBB3_ENST00000508496.2_5'Flank|APBB3_ENST00000354402.5_5'Flank|APBB3_ENST00000358580.5_5'Flank|APBB3_ENST00000356738.2_5'Flank|SLC35A4_ENST00000508770.1_3'UTR|APBB3_ENST00000412920.3_5'Flank			Q96G79	S35A4_HUMAN	solute carrier family 35, member A4	2						Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sugar:proton symporter activity (GO:0005351)	p.S2C(1)		endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGGGTATGAGTGTAGAGGA	0.607																																					p.S2C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4T	5						.						73.0	78.0	76.0					5																	139946758		2203	4300	6503	139926942	SO:0001583	missense	113829	exon3			AJ420598	CCDS4231.1	5q31.3	2013-05-22			ENSG00000176087	ENSG00000176087		"""Solute carriers"""	20753	protein-coding gene	gene with protein product							Standard	NM_080670		Approved		uc003lgg.1	Q96G79	OTTHUMG00000129495	ENST00000514199.1:c.4A>T	5.37:g.139946758A>T	ENSP00000424566:p.Ser2Cys	Somatic		Capture	Illumina HiSeq	Phase_I	139926942	NM_080670	A8K013	Missense_Mutation	SNP	ENST00000514199.1	37	CCDS4231.1	.	.	.	.	.	.	.	.	.	.	A	13.15	2.151450	0.38021	.	.	ENSG00000176087	ENST00000323146;ENST00000514199	T;T	0.47177	0.85;0.85	5.68	5.68	0.88126	.	0.545677	0.19840	N	0.104866	T	0.22244	0.0536	N	0.08118	0	0.29528	N	0.853018	P	0.46327	0.876	B	0.36289	0.221	T	0.06092	-1.0846	9	.	.	.	-18.9803	7.3386	0.26623	0.873:0.0:0.127:0.0	.	2	Q96G79	S35A4_HUMAN	C	2	ENSP00000327133:S2C;ENSP00000424566:S2C	.	S	+	1	0	SLC35A4	139926942	0.996000	0.38824	1.000000	0.80357	0.647000	0.38526	3.057000	0.49931	2.164000	0.68074	0.418000	0.28097	AGT		0.607	SLC35A4-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372815.1	NM_080670	
DHX29	54505	broad.mit.edu	37	5	54579552	54579552	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr5:54579552T>C	ENST00000251636.5	-	11	1592	c.1444A>G	c.(1444-1446)Atg>Gtg	p.M482V	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	482						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)	p.M482V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TTGGTTTCCATTTTATTTAAT	0.378																																					p.M482V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1444G	5						.						149.0	135.0	139.0					5																	54579552		2203	4300	6503	54615309	SO:0001583	missense	54505	exon11			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.1444A>G	5.37:g.54579552T>C	ENSP00000251636:p.Met482Val	Somatic		Capture	Illumina HiSeq	Phase_I	54615309	NM_019030	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	ENST00000251636.5	37	CCDS34158.1	.	.	.	.	.	.	.	.	.	.	T	11.55	1.671758	0.29693	.	.	ENSG00000067248	ENST00000251636	T	0.03212	4.01	5.59	5.59	0.84812	.	0.216895	0.53938	D	0.000043	T	0.03434	0.0099	N	0.19112	0.55	0.40035	D	0.975585	B	0.06786	0.001	B	0.04013	0.001	T	0.53005	-0.8499	10	0.19590	T	0.45	.	15.7621	0.78091	0.0:0.0:0.0:1.0	.	482	Q7Z478	DHX29_HUMAN	V	482	ENSP00000251636:M482V	ENSP00000251636:M482V	M	-	1	0	DHX29	54615309	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.917000	0.48821	2.134000	0.65973	0.482000	0.46254	ATG		0.378	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	
FAT2	2196	broad.mit.edu	37	5	150886868	150886869	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr5:150886868_150886869CC>AG	ENST00000261800.5	-	22	12375_12376	c.12363_12364GG>CT	c.(12361-12366)aaGGcc>aaCTcc	p.4121_4122KA>NS	CTC-251D13.1_ENST00000606930.1_RNA	NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	4121					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K4121>?(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGAACAGAGGCCTTGCTGGGTT	0.579																																					.												.	.	1	Complex(1)	large_intestine(1)	c.12363_12364CT	5						.																																			150867062	SO:0001583	missense	2196	exon22			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.12363_12364delinsAG	5.37:g.150886868_150886869delinsAG	ENSP00000261800:p.K4121_A4122delinsNS	Somatic		Capture	Illumina HiSeq	Phase_I	150867061	NM_001447	O75091|Q9NSR7	Missense_Mutation	DNP	ENST00000261800.5	37	CCDS4317.1																																																																																				0.579	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
PHACTR1	221692	broad.mit.edu	37	6	13053736	13053736	+	Silent	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr6:13053736C>T	ENST00000379350.1	+	4	519	c.390C>T	c.(388-390)agC>agT	p.S130S	PHACTR1_ENST00000482982.1_3'UTR|PHACTR1_ENST00000457702.2_5'UTR|PHACTR1_ENST00000379345.2_5'UTR|PHACTR1_ENST00000332995.7_Silent_p.S130S			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	130					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)	p.S130S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			AGAAGAAAAGCGAAAAGTTCA	0.438																																					p.S130S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C390T	6						.						52.0	50.0	51.0					6																	13053736		1928	4137	6065	13161722	SO:0001819	synonymous_variant	221692	exon4			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.390C>T	6.37:g.13053736C>T		Somatic		Capture	Illumina HiSeq	Phase_I	13161722	NM_030948	A8K1V2|Q3MJ93|Q5JSJ2	Silent	SNP	ENST00000379350.1	37		.	.	.	.	.	.	.	.	.	.	C	9.425	1.084061	0.20309	.	.	ENSG00000112137	ENST00000406205	.	.	.	5.63	-8.58	0.00897	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.4736	20.1883	0.98225	0.0:0.1237:0.0:0.8763	.	.	.	.	X	166	.	.	R	+	1	2	PHACTR1	13161722	0.000000	0.05858	0.478000	0.27316	0.964000	0.63967	-1.816000	0.01720	-1.825000	0.01207	-0.904000	0.02843	CGA		0.438	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039876.1	XM_166420	
CNKSR3	154043	broad.mit.edu	37	6	154727769	154727769	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr6:154727769G>A	ENST00000607772.1	-	13	1931	c.1387C>T	c.(1387-1389)Cgg>Tgg	p.R463W	CNKSR3_ENST00000433165.2_Missense_Mutation_p.R288W|CNKSR3_ENST00000479339.1_Missense_Mutation_p.R383W	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	463	DUF1170.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.R463W(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		CTGAAATACCGGCAAAGGGCA	0.577																																					p.R463W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1387T	6						.						38.0	38.0	38.0					6																	154727769		2203	4300	6503	154769461	SO:0001583	missense	154043	exon13			AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.1387C>T	6.37:g.154727769G>A	ENSP00000475915:p.Arg463Trp	Somatic		Capture	Illumina HiSeq	Phase_I	154769461	NM_173515	Q5SGD5|Q96N65	Missense_Mutation	SNP	ENST00000607772.1	37	CCDS5246.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560513	0.65538	.	.	ENSG00000153721	ENST00000367213;ENST00000433165;ENST00000479339	T;T;T	0.63417	0.62;-0.04;-0.02	5.03	2.85	0.33270	Connector enhancer of kinase suppressor of ras 2 (1);	0.068999	0.53938	D	0.000049	T	0.70254	0.3203	M	0.76574	2.34	0.40646	D	0.981992	D	0.89917	1.0	D	0.74674	0.984	T	0.75912	-0.3150	10	0.87932	D	0	.	12.7744	0.57439	0.0:0.0:0.5534:0.4466	.	463	Q6P9H4	CNKR3_HUMAN	W	463;288;383	ENSP00000356182:R463W;ENSP00000414185:R288W;ENSP00000418975:R383W	ENSP00000356182:R463W	R	-	1	2	CNKSR3	154769461	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	2.934000	0.48956	1.200000	0.43188	0.655000	0.94253	CGG		0.577	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042792.2	NM_173515	
PACRG	135138	broad.mit.edu	37	6	163149320	163149320	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr6:163149320C>T	ENST00000337019.3	+	2	277	c.53C>T	c.(52-54)cCg>cTg	p.P18L	PACRG_ENST00000366888.2_Missense_Mutation_p.P18L|PACRG_ENST00000366889.2_Missense_Mutation_p.P18L|PARK2_ENST00000366896.1_5'Flank|PARK2_ENST00000366892.1_5'Flank|PACRG_ENST00000542669.1_3'UTR|PARK2_ENST00000338468.3_5'Flank|PARK2_ENST00000366897.1_5'Flank|PARK2_ENST00000366894.1_5'Flank|PARK2_ENST00000366898.1_5'Flank	NM_152410.2	NP_689623.2	Q96M98	PACRG_HUMAN	PARK2 co-regulated	18					spermatid development (GO:0007286)	cell body (GO:0044297)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm midpiece (GO:0097225)		p.P18L(1)		endometrium(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		GACAAGATGCCGAAGAGGACC	0.463																																					p.P18L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C53T	6						.						118.0	131.0	127.0					6																	163149320		2203	4300	6503	163069310	SO:0001583	missense	135138	exon2			AK057286	CCDS5284.1, CCDS43524.1	6q26	2004-07-01			ENSG00000112530	ENSG00000112530			19152	protein-coding gene	gene with protein product		608427				12547187	Standard	NM_001080378		Approved	PARK2CRG, FLJ32724, Glup, HAK005771	uc003qua.3	Q96M98	OTTHUMG00000016116	ENST00000337019.3:c.53C>T	6.37:g.163149320C>T	ENSP00000337946:p.Pro18Leu	Somatic		Capture	Illumina HiSeq	Phase_I	163069310	NM_001080378	E1P5B5|Q6IMB8|Q8IZM1|Q8NHP5|Q9H1V9	Missense_Mutation	SNP	ENST00000337019.3	37	CCDS5284.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741027	0.49151	.	.	ENSG00000112530	ENST00000337019;ENST00000366889;ENST00000366888	T	0.41758	0.99	5.34	3.27	0.37495	.	0.335695	0.26133	N	0.026141	T	0.10337	0.0253	N	0.14661	0.345	0.40517	D	0.980798	B;B	0.25809	0.006;0.135	B;B	0.15870	0.008;0.014	T	0.09378	-1.0677	10	0.48119	T	0.1	-18.8427	4.648	0.12580	0.2196:0.6671:0.0:0.1133	.	18;18	Q96M98-2;Q96M98	.;PACRG_HUMAN	L	18	ENSP00000337946:P18L	ENSP00000337946:P18L	P	+	2	0	PACRG	163069310	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.548000	0.23314	2.492000	0.84095	0.557000	0.71058	CCG		0.463	PACRG-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400424.1	NM_152410	
RPS6KA2	6196	broad.mit.edu	37	6	166843953	166843953	+	Silent	SNP	G	G	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr6:166843953G>T	ENST00000265678.4	-	16	1792	c.1569C>A	c.(1567-1569)ctC>ctA	p.L523L	RPS6KA2_ENST00000481261.2_Silent_p.L434L|RPS6KA2_ENST00000405189.3_Silent_p.L434L|RPS6KA2_ENST00000510118.1_Silent_p.L548L|RPS6KA2_ENST00000503859.1_Silent_p.L531L	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	523	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)	p.L523L(1)|p.L531L(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CCTGGGAATGGAGGTAGTCCA	0.607																																					p.L523L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1569A	6						.						125.0	112.0	116.0					6																	166843953		2203	4300	6503	166763943	SO:0001819	synonymous_variant	6196	exon16			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.1569C>A	6.37:g.166843953G>T		Somatic		Capture	Illumina HiSeq	Phase_I	166763943	NM_021135	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Silent	SNP	ENST00000265678.4	37	CCDS5294.1																																																																																				0.607	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	NM_021135	
STK19	8859	broad.mit.edu	37	6	31939837	31939837	+	Missense_Mutation	SNP	T	T	C	rs202228977		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr6:31939837T>C	ENST00000375333.2	+	1	117	c.64T>C	c.(64-66)Tcc>Ccc	p.S22P	STK19_ENST00000375331.2_Missense_Mutation_p.S22P|DXO_ENST00000375356.3_5'Flank|DXO_ENST00000375349.3_5'UTR|DXO_ENST00000478221.1_5'UTR|DXO_ENST00000337523.5_5'UTR	NM_032454.1	NP_115830.1	P49842	STK19_HUMAN	serine/threonine kinase 19	22					protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S22P(1)		skin(5)|upper_aerodigestive_tract(2)	7						GGCAAACCCCTCCCGGGGCGG	0.642																																					p.S22P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T64C	6						.						63.0	71.0	68.0					6																	31939837		2203	4300	6503	32047816	SO:0001583	missense	8859	exon1			X77474	CCDS4733.1, CCDS34417.1	6p21.33	2011-09-15			ENSG00000204344	ENSG00000204344			11398	protein-coding gene	gene with protein product		604977				8012361, 9812991	Standard	NM_032454		Approved	D6S60, G11, RP1	uc003nyv.3	P49842	OTTHUMG00000166424	ENST00000375333.2:c.64T>C	6.37:g.31939837T>C	ENSP00000364482:p.Ser22Pro	Somatic		Capture	Illumina HiSeq	Phase_I	32047816	NM_004197	A6NF95|A6NFW8|B0QZR5|Q13159|Q31617|Q5JP77|Q5ST72|Q5ST75	Missense_Mutation	SNP	ENST00000375333.2	37	CCDS4733.1	.	.	.	.	.	.	.	.	.	.	T	10.97	1.501024	0.26861	.	.	ENSG00000204344	ENST00000460018;ENST00000375331;ENST00000375333	T;T;T	0.54675	0.56;1.57;1.57	3.12	-1.23	0.09465	.	.	.	.	.	T	0.09335	0.0230	N	0.14661	0.345	0.09310	N	1	P;B;B	0.44309	0.832;0.122;0.074	B;B;B	0.29440	0.102;0.04;0.018	T	0.14144	-1.0483	9	0.87932	D	0	.	2.1718	0.03851	0.3164:0.2939:0.0:0.3897	.	22;22;22	B4E0M4;P49842-2;P49842	.;.;STK19_HUMAN	P	22	ENSP00000418350:S22P;ENSP00000364480:S22P;ENSP00000364482:S22P	ENSP00000364480:S22P	S	+	1	0	STK19	32047816	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.189000	0.17037	-0.084000	0.12595	0.379000	0.24179	TCC		0.642	STK19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076484.3		
PKHD1	5314	broad.mit.edu	37	6	51914958	51914958	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr6:51914958G>A	ENST00000371117.3	-	22	2551	c.2276C>T	c.(2275-2277)gCa>gTa	p.A759V	PKHD1_ENST00000340994.4_Missense_Mutation_p.A759V	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	759					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.A759V(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TCCTTACCGTGCAGTGATGAG	0.552											OREG0017493	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A759V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2276T	6						.						60.0	54.0	56.0					6																	51914958		2203	4300	6503	52022917	SO:0001583	missense	5314	exon22			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2276C>T	6.37:g.51914958G>A	ENSP00000360158:p.Ala759Val	Somatic	981	Capture	Illumina HiSeq	Phase_I	52022917	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	G	4.281	0.051214	0.08243	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.86297	-1.9;-2.1	5.64	4.77	0.60923	.	0.511935	0.19464	N	0.113628	T	0.52517	0.1739	N	0.24115	0.695	0.09310	N	1	B;B	0.27229	0.138;0.172	B;B	0.21151	0.033;0.023	T	0.48007	-0.9072	10	0.02654	T	1	.	7.3131	0.26485	0.2579:0.0:0.7421:0.0	.	759;759	P08F94-2;P08F94	.;PKHD1_HUMAN	V	759	ENSP00000360158:A759V;ENSP00000341097:A759V	ENSP00000341097:A759V	A	-	2	0	PKHD1	52022917	0.011000	0.17503	0.866000	0.34008	0.907000	0.53573	0.943000	0.29030	1.382000	0.46385	0.655000	0.94253	GCA		0.552	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
DLL1	28514	broad.mit.edu	37	6	170595386	170595386	+	Splice_Site	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr6:170595386G>A	ENST00000366756.3	-	5	1004	c.671C>T	c.(670-672)cCg>cTg	p.P224L		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	224					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)	p.P224L(1)		NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		CAGGCAGATCGCTACAAGCAA	0.537																																					p.P224L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C671T	6						.						173.0	149.0	157.0					6																	170595386		2203	4300	6503	170437311	SO:0001630	splice_region_variant	28514	exon5			AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.671-1C>T	6.37:g.170595386G>A		Somatic		Capture	Illumina HiSeq	Phase_I	170437311	NM_005618	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Missense_Mutation	SNP	ENST00000366756.3	37	CCDS5313.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476224	0.44044	.	.	ENSG00000198719	ENST00000366756	T	0.13196	2.61	5.01	5.01	0.66863	.	0.128951	0.52532	U	0.000074	T	0.14056	0.0340	M	0.87381	2.88	0.80722	D	1	P	0.43750	0.816	B	0.34242	0.178	T	0.21586	-1.0241	10	0.72032	D	0.01	.	18.307	0.90185	0.0:0.0:1.0:0.0	.	224	O00548	DLL1_HUMAN	L	224	ENSP00000355718:P224L	ENSP00000355718:P224L	P	-	2	0	DLL1	170437311	1.000000	0.71417	0.363000	0.25875	0.027000	0.11550	9.348000	0.97062	2.330000	0.79161	0.655000	0.94253	CCG		0.537	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043254.1		Missense_Mutation
MUC17	140453	broad.mit.edu	37	7	100686142	100686142	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr7:100686142A>T	ENST00000306151.4	+	3	11509	c.11445A>T	c.(11443-11445)ttA>ttT	p.L3815F		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3815	Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.L3815F(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGCACTTTATTGACAACTG	0.488																																					p.L3815F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A11445T	7						.						99.0	88.0	92.0					7																	100686142		2203	4300	6503	100472862	SO:0001583	missense	140453	exon3			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11445A>T	7.37:g.100686142A>T	ENSP00000302716:p.Leu3815Phe	Somatic		Capture	Illumina HiSeq	Phase_I	100472862	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	a	7.889	0.731940	0.15507	.	.	ENSG00000169876	ENST00000306151	T	0.02301	4.35	1.31	-2.61	0.06171	.	.	.	.	.	T	0.02342	0.0072	N	0.14661	0.345	0.09310	N	1	D	0.60575	0.988	P	0.55508	0.777	T	0.34204	-0.9838	9	0.49607	T	0.09	.	2.3535	0.04290	0.2582:0.4089:0.0:0.3329	.	3815	Q685J3	MUC17_HUMAN	F	3815	ENSP00000302716:L3815F	ENSP00000302716:L3815F	L	+	3	2	MUC17	100472862	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-1.504000	0.02275	-1.301000	0.02338	0.158000	0.16466	TTA		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
CCZ1	51622	broad.mit.edu	37	7	5939988	5939988	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr7:5939988G>A	ENST00000325974.6	+	2	260	c.194G>A	c.(193-195)tGt>tAt	p.C65Y	CCZ1_ENST00000537980.1_5'UTR	NM_015622.5	NP_056437.4	P86791	CCZ1_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)	65						lysosome (GO:0005764)|membrane (GO:0016020)		p.C65Y(1)		large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	6						GTCGGATTGTGTGAAGCTATT	0.343																																					p.C65Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G194A	7						.						42.0	45.0	44.0					7																	5939988		2187	4282	6469	5906514	SO:0001583	missense	51622	exon2			AF151801	CCDS34597.1	7p22.1	2014-02-13	2010-06-29	2010-06-29	ENSG00000122674	ENSG00000122674			21691	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 28A"""	C7orf28A		10810093, 20305638	Standard	NM_015622		Approved	CGI-43, CCZ1A	uc003spf.3	P86791	OTTHUMG00000155502	ENST00000325974.6:c.194G>A	7.37:g.5939988G>A	ENSP00000325681:p.Cys65Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	5906514	NM_015622	A2RU45|O95766|Q9UG65|Q9Y359	Missense_Mutation	SNP	ENST00000325974.6	37	CCDS34597.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074374	0.76415	.	.	ENSG00000122674	ENST00000325974	.	.	.	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.74688	0.3749	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.68483	0.958	T	0.74847	-0.3525	9	0.40728	T	0.16	-14.1859	16.534	0.84368	0.0:0.0:1.0:0.0	.	65	P86790	CCZ1L_HUMAN	Y	65	.	ENSP00000325681:C65Y	C	+	2	0	CCZ1	5906514	1.000000	0.71417	0.976000	0.42696	0.974000	0.67602	9.498000	0.97972	2.127000	0.65507	0.508000	0.49915	TGT		0.343	CCZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340391.1	NM_015622	
ITGB8	3696	broad.mit.edu	37	7	20444303	20444303	+	Silent	SNP	T	T	G			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr7:20444303T>G	ENST00000222573.4	+	11	2424	c.1740T>G	c.(1738-1740)ggT>ggG	p.G580G	ITGB8_ENST00000537992.1_Silent_p.G445G	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	580	Cysteine-rich tandem repeats.				cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)	p.G580G(2)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						GCTGGGAAGGTGATCGATGCC	0.542																																					p.G580G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1740G	7						.						125.0	100.0	108.0					7																	20444303		2203	4300	6503	20410828	SO:0001819	synonymous_variant	3696	exon11				CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.1740T>G	7.37:g.20444303T>G		Somatic		Capture	Illumina HiSeq	Phase_I	20410828	NM_002214	A4D133|B4DHD4	Silent	SNP	ENST00000222573.4	37	CCDS5370.1																																																																																				0.542	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3	NM_002214	
CRHR2	1395	broad.mit.edu	37	7	30706870	30706870	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr7:30706870G>T	ENST00000471646.1	-	3	706	c.289C>A	c.(289-291)Cag>Aag	p.Q97K	CRHR2_ENST00000341843.4_Missense_Mutation_p.Q83K|CRHR2_ENST00000348438.4_Missense_Mutation_p.Q124K|CRHR2_ENST00000506074.2_Missense_Mutation_p.Q97K	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	97					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)	p.Q97K(1)|p.Q83K(1)		breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GGCTCACACTGTGAGTAGTTG	0.522																																					p.Q97K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C289A	7						.						208.0	160.0	176.0					7																	30706870		2203	4300	6503	30673395	SO:0001583	missense	1395	exon3				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.289C>A	7.37:g.30706870G>T	ENSP00000418722:p.Gln97Lys	Somatic		Capture	Illumina HiSeq	Phase_I	30673395	NM_001883	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	ENST00000471646.1	37	CCDS5429.1	.	.	.	.	.	.	.	.	.	.	G	12.85	2.060277	0.36373	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.65	4.74	0.60224	GPCR, family 2, extracellular hormone receptor domain (3);	0.280852	0.40385	N	0.001111	T	0.64461	0.2600	M	0.77616	2.38	0.31290	N	0.689535	B;B;B;B;B	0.19331	0.016;0.028;0.035;0.014;0.016	B;B;B;B;B	0.25614	0.029;0.029;0.062;0.039;0.029	T	0.66077	-0.6013	10	0.33940	T	0.23	.	14.4761	0.67546	0.0:0.1481:0.8519:0.0	.	97;97;124;83;97	B3SXT0;B3SXS6;Q13324-2;Q13324-3;Q13324	.;.;.;.;CRFR2_HUMAN	K	97;124;83;97	ENSP00000418722:Q97K;ENSP00000340943:Q124K;ENSP00000344304:Q83K;ENSP00000426498:Q97K	ENSP00000344304:Q83K	Q	-	1	0	CRHR2	30673395	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	4.954000	0.63631	1.476000	0.48215	0.561000	0.74099	CAG		0.522	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250448.3		
BMPER	168667	broad.mit.edu	37	7	34192858	34192858	+	Silent	SNP	C	C	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr7:34192858C>A	ENST00000297161.2	+	16	2405	c.2031C>A	c.(2029-2031)atC>atA	p.I677I	BMPER_ENST00000426693.1_Silent_p.I677I	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	677	TIL.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.I677I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GAAGGTGCATCAAGCCAGTCC	0.507																																					p.I677I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2031A	7						.						148.0	115.0	126.0					7																	34192858		2203	4300	6503	34159383	SO:0001819	synonymous_variant	168667	exon15				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.2031C>A	7.37:g.34192858C>A		Somatic		Capture	Illumina HiSeq	Phase_I	34159383	NM_133468	A8K1P8|Q8TF36	Silent	SNP	ENST00000297161.2	37	CCDS5442.1																																																																																				0.507	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
ABCA13	154664	broad.mit.edu	37	7	48619827	48619827	+	Missense_Mutation	SNP	G	G	A	rs373171750		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr7:48619827G>A	ENST00000435803.1	+	56	14386	c.14362G>A	c.(14362-14364)Gtg>Atg	p.V4788M	ABCA13_ENST00000544596.1_Missense_Mutation_p.V518M	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4788	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.V4788M(1)|p.V4733M(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CAGAGACGCCGTGGACCTGTC	0.527													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15782	0.0		0.0	False		,,,				2504	0.0				p.P4733P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G14199A	7						.	G	MET/VAL	0,3954		0,0,1977	29.0	30.0	30.0		14362	1.6	0.0	7		30	1,8327		0,1,4163	no	missense	ABCA13	NM_152701.3	21	0,1,6140	AA,AG,GG		0.012,0.0,0.0081	benign	4788/5059	48619827	1,12281	1977	4164	6141	48590373	SO:0001583	missense	154664	exon54			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14362G>A	7.37:g.48619827G>A	ENSP00000411096:p.Val4788Met	Somatic		Capture	Illumina HiSeq	Phase_I	48590373	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	8.139	0.784861	0.16189	0.0	1.2E-4	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	T;T;T	0.39997	1.05;1.05;1.05	5.0	1.63	0.23807	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.543006	0.15041	N	0.283848	T	0.25121	0.0610	L	0.46614	1.455	0.09310	N	1	P;D;P	0.54207	0.538;0.965;0.716	B;B;B	0.32149	0.062;0.139;0.141	T	0.22277	-1.0221	10	0.52906	T	0.07	.	4.8804	0.13677	0.1386:0.4397:0.4217:0.0	.	518;2490;4788	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	M	4788;561;518	ENSP00000411096:V4788M;ENSP00000391042:V561M;ENSP00000442634:V518M	ENSP00000391042:V561M	V	+	1	0	ABCA13	48590373	0.519000	0.26242	0.006000	0.13384	0.021000	0.10359	0.609000	0.24238	0.487000	0.27698	-0.196000	0.12772	GTG		0.527	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ABCF2	10061	broad.mit.edu	37	7	150912142	150912142	+	Silent	SNP	G	G	A	rs545658338		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr7:150912142G>A	ENST00000287844.2	-	14	1666	c.1557C>T	c.(1555-1557)gaC>gaT	p.D519D	ABCF2_ENST00000222388.2_Silent_p.D519D	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	519	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)	p.D519D(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACTTCTGCCCGTCTGACAAGT	0.547													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19190	0.0		0.0	False		,,,				2504	0.0				p.D519D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1557T	7						.						70.0	51.0	58.0					7																	150912142		2203	4300	6503	150543075	SO:0001819	synonymous_variant	10061	exon14			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1557C>T	7.37:g.150912142G>A		Somatic		Capture	Illumina HiSeq	Phase_I	150543075	NM_005692	O60864|Q75MJ0|Q75MJ1|Q96TE8	Silent	SNP	ENST00000287844.2	37	CCDS5923.1																																																																																				0.547	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336086.1	NM_005692	
SGCZ	137868	broad.mit.edu	37	8	13965707	13965707	+	Silent	SNP	C	C	T	rs550319628		TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr8:13965707C>T	ENST00000382080.1	-	6	1300	c.585G>A	c.(583-585)acG>acA	p.T195T	SGCZ_ENST00000421524.2_Silent_p.T148T	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	182					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)		p.T195T(1)		NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		TGATGTGCGGCGTCTCCACAG	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		15352	0.0		0.0	False		,,,				2504	0.001				p.T195T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G585A	8						.						95.0	85.0	89.0					8																	13965707		2203	4300	6503	14010078	SO:0001819	synonymous_variant	137868	exon6			AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.585G>A	8.37:g.13965707C>T		Somatic		Capture	Illumina HiSeq	Phase_I	14010078	NM_139167	Q6REU0	Silent	SNP	ENST00000382080.1	37	CCDS5992.2																																																																																				0.458	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167	
TTI2	80185	broad.mit.edu	37	8	33360955	33360955	+	Silent	SNP	A	A	C			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr8:33360955A>C	ENST00000431156.2	-	6	1869	c.1251T>G	c.(1249-1251)acT>acG	p.T417T	TTI2_ENST00000519356.1_5'UTR|TTI2_ENST00000520636.1_Silent_p.T386T|TTI2_ENST00000360742.5_Silent_p.T417T	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	417								p.T417T(1)									ACCTGGGCCAAGTATGTTGCA	0.398																																					p.T417T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1251G	8						.						114.0	113.0	113.0					8																	33360955		2203	4300	6503	33480497	SO:0001819	synonymous_variant	80185	exon5			AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1251T>G	8.37:g.33360955A>C		Somatic		Capture	Illumina HiSeq	Phase_I	33480497	NM_025115	D3DSV7|Q96IM2|Q9H5N4	Silent	SNP	ENST00000431156.2	37	CCDS6090.1																																																																																				0.398	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
TG	7038	broad.mit.edu	37	8	133925455	133925455	+	Silent	SNP	G	G	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr8:133925455G>T	ENST00000220616.4	+	20	4363	c.4323G>T	c.(4321-4323)tcG>tcT	p.S1441S	TG_ENST00000377869.1_Silent_p.S1441S	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1441					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.S1441S(2)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TTGGGTGCTCGGAAGGATTCT	0.567																																					p.S1441S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G4323T	8						.						102.0	85.0	91.0					8																	133925455		2203	4300	6503	133994637	SO:0001819	synonymous_variant	7038	exon20			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4323G>T	8.37:g.133925455G>T		Somatic		Capture	Illumina HiSeq	Phase_I	133994637	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Silent	SNP	ENST00000220616.4	37	CCDS34944.1																																																																																				0.567	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
DFNB31	25861	broad.mit.edu	37	9	117266581	117266582	+	Missense_Mutation	DNP	GT	GT	AC			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	GT	GT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr9:117266581_117266582GT>AC	ENST00000362057.3	-	1	668_669	c.500_501AC>GT	c.(499-501)tAC>tGT	p.Y167C	DFNB31_ENST00000265134.6_5'Flank|DFNB31_ENST00000374057.3_Missense_Mutation_p.Y167C|DFNB31_ENST00000480518.1_5'UTR	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	167	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)		p.Y167>?(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCAGAGACACGTAGATGCCCAC	0.663																																					.												.	.	1	Complex(1)	large_intestine(1)	c.500_501GT	9						.																																			116306403	SO:0001583	missense	25861	exon1			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.500_501delinsAC	9.37:g.117266581_117266582delinsAC	ENSP00000354623:p.Tyr167Cys	Somatic		Capture	Illumina HiSeq	Phase_I	116306402	NM_015404	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	DNP	ENST00000362057.3	37	CCDS6806.1																																																																																				0.663	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404	
CCDC171	203238	broad.mit.edu	37	9	15777817	15777817	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr9:15777817C>T	ENST00000380701.3	+	19	3219	c.2891C>T	c.(2890-2892)cCc>cTc	p.P964L	CCDC171_ENST00000297641.3_Missense_Mutation_p.P964L|RNU6-14P_ENST00000384630.1_RNA	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	964								p.P964L(1)|p.P231L(1)									GGCCATGTGCCCATTACGGTA	0.358																																					p.P964L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2891T	9						.						62.0	63.0	63.0					9																	15777817		2203	4300	6503	15767817	SO:0001583	missense	203238	exon19			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2891C>T	9.37:g.15777817C>T	ENSP00000370077:p.Pro964Leu	Somatic		Capture	Illumina HiSeq	Phase_I	15767817	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	37	CCDS6481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.52|14.52	2.559947|2.559947	0.45590|0.45590	.|.	.|.	ENSG00000164989|ENSG00000164989	ENST00000297641;ENST00000380689;ENST00000380701|ENST00000449575;ENST00000432954	T;T|T	0.15718|0.53423	2.4;2.4|0.62	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.051951|0.051951	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.53753|0.53753	0.1816|0.1816	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.999;0.999|.	D;D;D|.	0.69479|.	0.964;0.922;0.964|.	T|T	0.53809|0.53809	-0.8386|-0.8386	10|8	0.28530|0.66056	T|D	0.3|0.02	-8.0522|-8.0522	18.1891|18.1891	0.89802|0.89802	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	972;231;964|.	B7ZM22;A6NK04;Q6TFL3|.	.;.;CI093_HUMAN|.	L|S	964;231;964|204;18	ENSP00000297641:P964L;ENSP00000370077:P964L|ENSP00000399526:P18S	ENSP00000297641:P964L|ENSP00000399526:P18S	P|P	+|+	2|1	0|0	C9orf93|C9orf93	15767817|15767817	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.276000|0.276000	0.26787|0.26787	5.294000|5.294000	0.65687|0.65687	2.723000|2.723000	0.93209|0.93209	0.650000|0.650000	0.86243|0.86243	CCC|CCA		0.358	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
ROR2	4920	broad.mit.edu	37	9	94493333	94493334	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr9:94493333_94493334GG>CT	ENST00000375708.3	-	7	1239_1240	c.1041_1042CC>AG	c.(1039-1044)agCCac>agAGac	p.347_348SH>RD	ROR2_ENST00000375715.1_Missense_Mutation_p.207_208SH>RD|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	347	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.S347>?(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GACAGGTGGTGGCTGTGGGGGT	0.634																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1041_1042AG	9						.																																			93533155	SO:0001583	missense	4920	exon7			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1041_1042delinsCT	9.37:g.94493333_94493334delinsCT	ENSP00000364860:p.S347_H348delinsRD	Somatic		Capture	Illumina HiSeq	Phase_I	93533154	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	DNP	ENST00000375708.3	37	CCDS6691.1																																																																																				0.634	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
AK8	158067	broad.mit.edu	37	9	135750544	135750544	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chr9:135750544T>G	ENST00000298545.3	-	2	648	c.127A>C	c.(127-129)Atc>Ctc	p.I43L	AK8_ENST00000477396.1_5'UTR|C9orf9_ENST00000372136.3_5'Flank	NM_152572.2	NP_689785.1	Q96MA6	KAD8_HUMAN	adenylate kinase 8	43					nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)	p.I43L(2)		NS(1)|kidney(2)|large_intestine(4)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(2)	23						ATGAAGGGGATGGGATCTTCG	0.582																																					p.I43L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A127C	9						.						296.0	228.0	251.0					9																	135750544		2203	4300	6503	134740365	SO:0001583	missense	158067	exon2			AK093446	CCDS6954.1	9q34.13	2013-04-29	2010-12-07	2010-12-07	ENSG00000165695	ENSG00000165695	2.7.4.3	"""Adenylate kinases"""	26526	protein-coding gene	gene with protein product		615365	"""chromosome 9 open reading frame 98"""	C9orf98		21080915	Standard	NM_152572		Approved	FLJ32704	uc004cbu.1	Q96MA6	OTTHUMG00000021009	ENST00000298545.3:c.127A>C	9.37:g.135750544T>G	ENSP00000298545:p.Ile43Leu	Somatic		Capture	Illumina HiSeq	Phase_I	134740365	NM_152572	A8K821|Q8N9W9	Missense_Mutation	SNP	ENST00000298545.3	37	CCDS6954.1	.	.	.	.	.	.	.	.	.	.	T	3.647	-0.072379	0.07228	.	.	ENSG00000165695	ENST00000298545	T	0.75050	-0.9	4.77	3.62	0.41486	.	0.055961	0.64402	D	0.000001	T	0.56529	0.1991	L	0.27053	0.805	0.36378	D	0.861739	B	0.02656	0.0	B	0.08055	0.003	T	0.50849	-0.8779	10	0.15066	T	0.55	-20.3497	8.361	0.32359	0.0:0.0909:0.0:0.9091	.	43	Q96MA6	KAD8_HUMAN	L	43	ENSP00000298545:I43L	ENSP00000298545:I43L	I	-	1	0	AK8	134740365	1.000000	0.71417	0.982000	0.44146	0.104000	0.19210	3.378000	0.52432	0.658000	0.30925	-0.558000	0.04189	ATC		0.582	AK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055413.1	NM_152572	
BRWD3	254065	broad.mit.edu	37	X	79932573	79932573	+	Silent	SNP	G	G	T			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chrX:79932573G>T	ENST00000373275.4	-	41	5160	c.4944C>A	c.(4942-4944)acC>acA	p.T1648T	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1648					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)			p.T1648T(1)		breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TTTTAGGTCTGGTTTGTATGA	0.423																																					p.T1648T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4944A	X						.						290.0	266.0	274.0					X																	79932573		2203	4300	6503	79819229	SO:0001819	synonymous_variant	254065	exon41				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.4944C>A	X.37:g.79932573G>T		Somatic		Capture	Illumina HiSeq	Phase_I	79819229	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Silent	SNP	ENST00000373275.4	37	CCDS14447.1																																																																																				0.423	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
MORF4L2	9643	broad.mit.edu	37	X	102931701	102931701	+	Silent	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chrX:102931701G>A	ENST00000441076.2	-	4	559	c.255C>T	c.(253-255)aaC>aaT	p.N85N	MORF4L2_ENST00000492116.1_5'UTR|MORF4L2_ENST00000451301.1_Silent_p.N85N|MORF4L2_ENST00000423833.2_Silent_p.N85N|MORF4L2_ENST00000433176.2_Silent_p.N85N|MORF4L2_ENST00000360458.1_Silent_p.N85N|MORF4L2_ENST00000422154.2_Silent_p.N85N	NM_001142419.1|NM_012286.2	NP_001135891.1|NP_036418.1	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	85					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA repair (GO:0006281)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.N85N(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)	13						CACCATCTCCGTTTCCAGGAG	0.562																																					p.N85N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C255T	X						.						72.0	65.0	67.0					X																	102931701		2203	4300	6503	102818357	SO:0001819	synonymous_variant	9643	exon5			AF100620	CCDS14512.1	Xq22	2010-11-24			ENSG00000123562	ENSG00000123562			16849	protein-coding gene	gene with protein product	"""MORF-related gene X"""	300409				9891081, 7584026	Standard	NM_012286		Approved	KIAA0026, MRGX	uc011msa.2	Q15014	OTTHUMG00000022104	ENST00000441076.2:c.255C>T	X.37:g.102931701G>A		Somatic		Capture	Illumina HiSeq	Phase_I	102818357	NM_001142429	B3KP92|D3DXA5|Q567V0|Q8J026	Silent	SNP	ENST00000441076.2	37	CCDS14512.1																																																																																				0.562	MORF4L2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057732.1	NM_012286	
PCDH11Y	83259	broad.mit.edu	37	Y	4967268	4967268	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A029-01A-01W-A00E-09	TCGA-AA-A029-10A-01W-A00E-09	g.chrY:4967268G>A	ENST00000333703.4	+	5	2129	c.1616G>A	c.(1615-1617)cGt>cAt	p.R539H	PCDH11Y_ENST00000215473.6_Missense_Mutation_p.R550H|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.R550H	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	550	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R539H(1)|p.R550H(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						CTGGATCGTCGTACAGGCATG	0.438																																					p.R539H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1616A	Y						.																																			5027268	SO:0001583	missense	83259	exon5			AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.1616G>A	Y.37:g.4967268G>A	ENSP00000330552:p.Arg539His	Somatic		Capture	Illumina HiSeq	Phase_I	5027268	NM_032971	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	CCDS14776.1																																																																																				0.438	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
