#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAM12	8038	broad.mit.edu	37	10	127726910	127726910	+	Missense_Mutation	SNP	C	C	T	rs199582085		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr10:127726910C>T	ENST00000368679.4	-	20	2567	c.2258G>A	c.(2257-2259)cGc>cAc	p.R753H		NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	753					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.R753H(2)		biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CCGGGAAGGGCGCACACACCT	0.557																																					p.R753H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2258A	10						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	46.0	43.0	44.0		2258	1.2	0.1	10		44	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ADAM12	NM_003474.4	29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	753/910	127726910	2,13004	2203	4300	6503	127716900	SO:0001583	missense	8038	exon20			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.2258G>A	10.37:g.127726910C>T	ENSP00000357668:p.Arg753His	Somatic		Capture	Illumina HiSeq	Phase_I	127716900	NM_003474	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	37	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	C	9.659	1.143687	0.21205	2.27E-4	1.16E-4	ENSG00000148848	ENST00000368679	T	0.01572	4.76	5.04	1.16	0.20824	.	0.617357	0.15120	N	0.279441	T	0.00967	0.0032	N	0.05124	-0.11	0.38982	D	0.958961	B	0.14438	0.01	B	0.06405	0.002	T	0.55237	-0.8172	10	0.23302	T	0.38	.	5.0282	0.14396	0.0:0.5366:0.1417:0.3217	.	753	O43184	ADA12_HUMAN	H	753	ENSP00000357668:R753H	ENSP00000357668:R753H	R	-	2	0	ADAM12	127716900	0.002000	0.14202	0.143000	0.22291	0.732000	0.41865	-0.283000	0.08433	0.049000	0.15920	-0.929000	0.02709	CGC		0.557	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
LARP4B	23185	broad.mit.edu	37	10	882390	882390	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr10:882390G>A	ENST00000316157.3	-	7	743	c.703C>T	c.(703-705)Cgc>Tgc	p.R235C		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	235	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)	p.R235C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						ACTATGCAGCGATTTTGATTT	0.353																																					p.R235C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C703T	10						.						173.0	168.0	170.0					10																	882390		2203	4300	6503	872390	SO:0001583	missense	23185	exon7			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.703C>T	10.37:g.882390G>A	ENSP00000326128:p.Arg235Cys	Somatic		Capture	Illumina HiSeq	Phase_I	872390	NM_015155	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	ENST00000316157.3	37	CCDS31131.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.453306	0.84209	.	.	ENSG00000107929	ENST00000316157	T	0.36157	1.27	5.85	4.95	0.65309	RNA-binding protein Lupus La (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.65481	0.2695	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73206	-0.4056	10	0.87932	D	0	-0.3617	15.1659	0.72825	0.0677:0.0:0.9323:0.0	.	235	Q92615	LAR4B_HUMAN	C	235	ENSP00000326128:R235C	ENSP00000326128:R235C	R	-	1	0	LARP4B	872390	1.000000	0.71417	0.600000	0.28864	0.808000	0.45660	9.671000	0.98627	1.472000	0.48140	0.655000	0.94253	CGC		0.353	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155	
ZEB1	6935	broad.mit.edu	37	10	31809461	31809461	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr10:31809461delG	ENST00000320985.10	+	7	1308	c.1198delG	c.(1198-1200)ggtfs	p.G400fs	ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000542815.3_Frame_Shift_Del_p.G333fs|ZEB1_ENST00000361642.5_Frame_Shift_Del_p.G401fs|ZEB1_ENST00000446923.2_Frame_Shift_Del_p.G384fs|ZEB1_ENST00000560721.2_Frame_Shift_Del_p.G380fs			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	400					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.G400fs*6(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				GCCAACAGTTGGTTTGGTGTC	0.428																																					p.G380fs	Ovarian(40;423 959 14296 36701 49589)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1138delG	10						.						90.0	86.0	87.0					10																	31809461		2203	4300	6503	31849467	SO:0001589	frameshift_variant	6935	exon6			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.1198delG	10.37:g.31809461delG	ENSP00000319248:p.Gly400fs	Somatic		Capture	Illumina HiSeq	Phase_I	31849467	NM_001174093	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Frame_Shift_Del	DEL	ENST00000320985.10	37	CCDS7169.1																																																																																				0.428	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
HK1	3098	broad.mit.edu	37	10	71129342	71129342	+	Silent	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr10:71129342G>A	ENST00000359426.6	+	7	941	c.837G>A	c.(835-837)agG>agA	p.R279R	HK1_ENST00000494253.1_3'UTR|HK1_ENST00000298649.3_Silent_p.R278R|HK1_ENST00000448642.2_Silent_p.R314R|HK1_ENST00000404387.2_Silent_p.R283R|HK1_ENST00000360289.2_Silent_p.R267R	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	279	Hexokinase type-2 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)	p.R283R(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						AGTTTGACAGGGAGATAGACC	0.473																																					p.R283R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G849A	10						.						103.0	99.0	100.0					10																	71129342		2203	4300	6503	70799348	SO:0001819	synonymous_variant	3098	exon10			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.837G>A	10.37:g.71129342G>A		Somatic		Capture	Illumina HiSeq	Phase_I	70799348	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Silent	SNP	ENST00000359426.6	37	CCDS7292.1																																																																																				0.473	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
TCERG1L	256536	broad.mit.edu	37	10	132944781	132944781	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr10:132944781C>G	ENST00000368642.4	-	7	1262	c.1177G>C	c.(1177-1179)Gag>Cag	p.E393Q		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	393								p.E352Q(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		GCTGGTGCCTCCAGCTTGCGT	0.498																																					p.E393Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1177C	10						.						106.0	101.0	102.0					10																	132944781		2203	4300	6503	132834771	SO:0001583	missense	256536	exon7			AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.1177G>C	10.37:g.132944781C>G	ENSP00000357631:p.Glu393Gln	Somatic		Capture	Illumina HiSeq	Phase_I	132834771	NM_174937	Q5VWI2|Q86XM8	Missense_Mutation	SNP	ENST00000368642.4	37	CCDS7662.2	.	.	.	.	.	.	.	.	.	.	C	17.00	3.276145	0.59649	.	.	ENSG00000176769	ENST00000368642	T	0.25912	1.77	4.83	3.93	0.45458	.	0.070613	0.53938	D	0.000053	T	0.22627	0.0546	L	0.48642	1.525	0.46260	D	0.998957	P	0.44195	0.828	B	0.38880	0.284	T	0.02603	-1.1135	10	0.45353	T	0.12	-5.1024	12.3222	0.54991	0.0:0.9175:0.0:0.0825	.	393	Q5VWI1	TCRGL_HUMAN	Q	393	ENSP00000357631:E393Q	ENSP00000357631:E393Q	E	-	1	0	TCERG1L	132834771	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	4.589000	0.61006	1.162000	0.42619	0.467000	0.42956	GAG		0.498	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937	
OR52N4	390072	broad.mit.edu	37	11	5776605	5776605	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr11:5776605A>G	ENST00000317254.3	+	1	683	c.635A>G	c.(634-636)gAc>gGc	p.D212G	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D212G(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		TGGGGCTTTGACATACTGTGT	0.502																																					p.D212G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A635G	11						.						196.0	182.0	187.0					11																	5776605		2166	4286	6452	5733181	SO:0001583	missense	390072	exon1			AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.635A>G	11.37:g.5776605A>G	ENSP00000323224:p.Asp212Gly	Somatic		Capture	Illumina HiSeq	Phase_I	5733181	NM_001005175	B2RNP8|Q6IF77	Missense_Mutation	SNP	ENST00000317254.3	37	CCDS44528.1	.	.	.	.	.	.	.	.	.	.	A	13.41	2.228101	0.39399	.	.	ENSG00000181074	ENST00000317254	T	0.37411	1.2	6.1	6.1	0.99115	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000151	T	0.74351	0.3705	H	0.98133	4.155	0.28249	N	0.925357	D	0.76494	0.999	D	0.74674	0.984	T	0.78607	-0.2138	10	0.87932	D	0	.	15.51	0.75772	1.0:0.0:0.0:0.0	.	212	Q8NGI2	O52N4_HUMAN	G	212	ENSP00000323224:D212G	ENSP00000323224:D212G	D	+	2	0	OR52N4	5733181	0.320000	0.24616	0.997000	0.53966	0.103000	0.19146	1.440000	0.35024	2.340000	0.79590	0.528000	0.53228	GAC		0.502	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143350.1	NM_001005175	
ANO5	203859	broad.mit.edu	37	11	22283796	22283796	+	Silent	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr11:22283796C>A	ENST00000324559.8	+	16	2069	c.1752C>A	c.(1750-1752)ggC>ggA	p.G584G	CTD-3064C13.1_ENST00000526935.1_RNA	NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	584					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)	p.G584G(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AGTTCGTAGGCTATCCTGGAA	0.358																																					p.G583G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1749A	11						.						132.0	130.0	131.0					11																	22283796		2203	4300	6503	22240372	SO:0001819	synonymous_variant	203859	exon16			AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.1752C>A	11.37:g.22283796C>A		Somatic		Capture	Illumina HiSeq	Phase_I	22240372	NM_001142649		Silent	SNP	ENST00000324559.8	37	CCDS31444.1																																																																																				0.358	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599	
OR5AS1	219447	broad.mit.edu	37	11	55798831	55798831	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr11:55798831G>A	ENST00000313555.1	+	1	937	c.937G>A	c.(937-939)Gaa>Aaa	p.E313K		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E313K(1)		endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					ATATTCAAATGAATGGTATTT	0.279																																					p.E313K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G937A	11						.						44.0	53.0	50.0					11																	55798831		2198	4292	6490	55555407	SO:0001583	missense	219447	exon1			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.937G>A	11.37:g.55798831G>A	ENSP00000324111:p.Glu313Lys	Somatic		Capture	Illumina HiSeq	Phase_I	55555407	NM_001001921	Q6IFB8	Missense_Mutation	SNP	ENST00000313555.1	37	CCDS31516.1	.	.	.	.	.	.	.	.	.	.	G	2.020	-0.424869	0.04734	.	.	ENSG00000181785	ENST00000313555	T	0.00355	7.91	4.55	-3.82	0.04281	.	.	.	.	.	T	0.00109	0.0003	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34601	-0.9822	9	0.05833	T	0.94	.	0.7074	0.00918	0.2644:0.1575:0.3475:0.2306	.	313	Q8N127	O5AS1_HUMAN	K	313	ENSP00000324111:E313K	ENSP00000324111:E313K	E	+	1	0	OR5AS1	55555407	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.040000	0.12104	-0.412000	0.07519	0.579000	0.79373	GAA		0.279	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921	
TMEM132A	54972	broad.mit.edu	37	11	60704039	60704039	+	Missense_Mutation	SNP	G	G	A	rs142666359		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr11:60704039G>A	ENST00000453848.2	+	11	2890	c.2732G>A	c.(2731-2733)cGg>cAg	p.R911Q	TMEM132A_ENST00000005286.4_Missense_Mutation_p.R912Q			Q24JP5	T132A_HUMAN	transmembrane protein 132A	911	Binds to HSPA5/GRP78. {ECO:0000250}.|Confers cellular localization similar to full-length form. {ECO:0000250}.					endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.R912Q(1)		breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CAGCTGGACCGGCAGTCCCCT	0.716													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12711	0.0		0.0	False		,,,				2504	0.0				p.R912Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2735A	11						.	G	GLN/ARG,GLN/ARG	1,4403		0,1,2201	19.0	23.0	21.0		2735,2732	4.1	1.0	11	dbSNP_134	21	0,8590		0,0,4295	yes	missense,missense	TMEM132A	NM_017870.3,NM_178031.2	43,43	0,1,6496	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	912/1025,911/1024	60704039	1,12993	2202	4295	6497	60460615	SO:0001583	missense	54972	exon11			AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.2732G>A	11.37:g.60704039G>A	ENSP00000405823:p.Arg911Gln	Somatic		Capture	Illumina HiSeq	Phase_I	60460615	NM_017870	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.657283	0.29425	2.27E-4	0.0	ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286	T;T	0.04917	3.53;3.53	5.04	4.11	0.48088	.	0.573941	0.15648	N	0.251534	T	0.06462	0.0166	L	0.34521	1.04	0.28858	N	0.895663	B;B	0.26258	0.145;0.145	B;B	0.19148	0.024;0.024	T	0.12116	-1.0560	10	0.87932	D	0	-24.5781	11.8565	0.52439	0.0:0.0:0.6834:0.3166	.	911;912	Q24JP5;Q24JP5-2	T132A_HUMAN;.	Q	662;911;912	ENSP00000405823:R911Q;ENSP00000005286:R912Q	ENSP00000005286:R912Q	R	+	2	0	TMEM132A	60460615	0.205000	0.23458	0.990000	0.47175	0.951000	0.60555	0.487000	0.22356	1.240000	0.43803	0.655000	0.94253	CGG		0.716	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
C11orf63	79864	broad.mit.edu	37	11	122795676	122795676	+	Silent	SNP	C	C	T	rs142483643		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr11:122795676C>T	ENST00000531316.1	+	3	1028	c.936C>T	c.(934-936)atC>atT	p.I312I	RNU4-23P_ENST00000362839.1_RNA|C11orf63_ENST00000227349.2_Silent_p.I312I			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	312					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.I312I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		ATGCTGCCATCGATCCTGAAG	0.403																																					p.I312I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C936T	11						.	C		1,4403	2.1+/-5.4	0,1,2201	185.0	154.0	164.0		936	-1.3	0.2	11	dbSNP_134	164	0,8598		0,0,4299	no	coding-synonymous	C11orf63	NM_024806.2		0,1,6500	TT,TC,CC		0.0,0.0227,0.0077		312/779	122795676	1,13001	2202	4299	6501	122300886	SO:0001819	synonymous_variant	79864	exon4			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.936C>T	11.37:g.122795676C>T		Somatic		Capture	Illumina HiSeq	Phase_I	122300886	NM_024806	A8K6G0|Q96GB5|Q9H5D6	Silent	SNP	ENST00000531316.1	37	CCDS8438.1																																																																																				0.403	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806	
KCNA1	3736	broad.mit.edu	37	12	5020749	5020749	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr12:5020749C>T	ENST00000382545.3	+	2	1312	c.205C>T	c.(205-207)Cgc>Tgc	p.R69C	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	69					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.R69C(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CCCTAAGAAACGCATGCGCTA	0.627																																					p.R69C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C205T	12						.						62.0	63.0	63.0					12																	5020749		2203	4300	6503	4891010	SO:0001583	missense	3736	exon2			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.205C>T	12.37:g.5020749C>T	ENSP00000371985:p.Arg69Cys	Somatic		Capture	Illumina HiSeq	Phase_I	4891010	NM_000217	A6NM83|Q3MIQ9	Missense_Mutation	SNP	ENST00000382545.3	37	CCDS8535.1	.	.	.	.	.	.	.	.	.	.	C	16.38	3.107420	0.56291	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	T	0.78246	-1.16	4.31	4.31	0.51392	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.88518	0.6458	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88446	0.3045	10	0.37606	T	0.19	.	16.3111	0.82872	0.0:1.0:0.0:0.0	.	69	Q09470	KCNA1_HUMAN	C	69	ENSP00000371985:R69C	ENSP00000228858:R69C	R	+	1	0	KCNA1	4891010	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	2.317000	0.43770	2.388000	0.81334	0.650000	0.86243	CGC		0.627	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
SCN8A	6334	broad.mit.edu	37	12	52201065	52201065	+	Missense_Mutation	SNP	G	G	A	rs371766742		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr12:52201065G>A	ENST00000354534.6	+	27	5973	c.5795G>A	c.(5794-5796)cGg>cAg	p.R1932Q	RP11-923I11.3_ENST00000565518.1_lincRNA|AC068987.1_ENST00000599343.1_5'Flank|SCN8A_ENST00000545061.1_Missense_Mutation_p.R1891Q	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1932					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.R1932Q(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	GGCACACACCGGGAGAAAAAA	0.532																																					p.R1932Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5795A	12						.	G	GLN/ARG,GLN/ARG	1,3877		0,1,1938	60.0	67.0	65.0		5795,5672	4.2	1.0	12		65	0,8294		0,0,4147	no	missense,missense	SCN8A	NM_014191.2,NM_001177984.1	43,43	0,1,6085	AA,AG,GG		0.0,0.0258,0.0082	benign,benign	1932/1981,1891/1940	52201065	1,12171	1939	4147	6086	50487332	SO:0001583	missense	6334	exon27			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5795G>A	12.37:g.52201065G>A	ENSP00000346534:p.Arg1932Gln	Somatic		Capture	Illumina HiSeq	Phase_I	50487332	NM_014191	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	G	6.721	0.501725	0.12822	2.58E-4	0.0	ENSG00000196876	ENST00000354534;ENST00000545061	D;D	0.95724	-3.79;-3.76	5.14	4.24	0.50183	.	0.732799	0.12422	N	0.470338	D	0.91418	0.7292	L	0.29908	0.895	0.34502	D	0.706204	B	0.09022	0.002	B	0.06405	0.002	D	0.90325	0.4347	10	0.48119	T	0.1	.	11.1009	0.48174	0.0:0.1393:0.716:0.1447	.	1932	Q9UQD0	SCN8A_HUMAN	Q	1932;1891	ENSP00000346534:R1932Q;ENSP00000440360:R1891Q	ENSP00000346534:R1932Q	R	+	2	0	SCN8A	50487332	0.997000	0.39634	0.999000	0.59377	0.978000	0.69477	1.513000	0.35823	1.510000	0.48803	0.655000	0.94253	CGG		0.532	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
GAS2L3	283431	broad.mit.edu	37	12	101017695	101017695	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr12:101017695C>T	ENST00000539410.1	+	9	1498	c.1112C>T	c.(1111-1113)tCt>tTt	p.S371F	GAS2L3_ENST00000266754.5_Missense_Mutation_p.S371F|GAS2L3_ENST00000537247.1_Missense_Mutation_p.S267F|GAS2L3_ENST00000547754.1_Missense_Mutation_p.S371F			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	371					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)	p.S371F(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						TCAGTCCGTTCTAAATTGCCA	0.453																																					p.S371F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1112T	12						.						106.0	103.0	104.0					12																	101017695		2203	4300	6503	99541826	SO:0001583	missense	283431	exon10			AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.1112C>T	12.37:g.101017695C>T	ENSP00000439672:p.Ser371Phe	Somatic		Capture	Illumina HiSeq	Phase_I	99541826	NM_174942	B2RCN2	Missense_Mutation	SNP	ENST00000539410.1	37	CCDS9079.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466374	0.63625	.	.	ENSG00000139354	ENST00000266754;ENST00000547754;ENST00000537247;ENST00000539410	T;T;T;T	0.25912	1.78;1.78;1.77;1.78	5.69	5.69	0.88448	.	0.511874	0.19738	N	0.107200	T	0.40322	0.1112	L	0.53249	1.67	0.30388	N	0.781264	P	0.50710	0.938	P	0.51487	0.671	T	0.23297	-1.0192	10	0.45353	T	0.12	-0.5107	19.8228	0.96604	0.0:1.0:0.0:0.0	.	371	Q86XJ1	GA2L3_HUMAN	F	371;371;267;371	ENSP00000266754:S371F;ENSP00000448955:S371F;ENSP00000442406:S267F;ENSP00000439672:S371F	ENSP00000266754:S371F	S	+	2	0	GAS2L3	99541826	0.776000	0.28616	0.254000	0.24359	0.015000	0.08874	3.529000	0.53532	2.681000	0.91329	0.650000	0.86243	TCT		0.453	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409143.1	NM_174942	
FRY	10129	broad.mit.edu	37	13	32705925	32705925	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr13:32705925G>A	ENST00000380250.3	+	8	1329	c.833G>A	c.(832-834)cGa>cAa	p.R278Q		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	278						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R278Q(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		AAATTCTTTCGAATTAAGATG	0.408																																					p.R278Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G833A	13						.						141.0	126.0	131.0					13																	32705925		1842	4102	5944	31603925	SO:0001583	missense	10129	exon8			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.833G>A	13.37:g.32705925G>A	ENSP00000369600:p.Arg278Gln	Somatic		Capture	Illumina HiSeq	Phase_I	31603925	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	G	36	5.700527	0.96802	.	.	ENSG00000073910	ENST00000380250;ENST00000267067	T	0.30448	1.53	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.62221	0.2410	M	0.86502	2.82	0.80722	D	1	D	0.61697	0.99	D	0.63793	0.918	T	0.67484	-0.5659	10	0.87932	D	0	.	20.0586	0.97663	0.0:0.0:1.0:0.0	.	278	Q5TBA9	FRY_HUMAN	Q	278;206	ENSP00000369600:R278Q	ENSP00000267067:R206Q	R	+	2	0	FRY	31603925	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.741000	0.93983	0.650000	0.86243	CGA		0.408	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
FREM2	341640	broad.mit.edu	37	13	39262697	39262697	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr13:39262697C>T	ENST00000280481.7	+	1	1432	c.1216C>T	c.(1216-1218)Cgc>Tgc	p.R406C		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	406					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R406C(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGACCAGGAGCGCCTCTTTGA	0.547																																					p.R406C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1216T	13						.						67.0	74.0	72.0					13																	39262697		2203	4300	6503	38160697	SO:0001583	missense	341640	exon1			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1216C>T	13.37:g.39262697C>T	ENSP00000280481:p.Arg406Cys	Somatic		Capture	Illumina HiSeq	Phase_I	38160697	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684027	0.47991	.	.	ENSG00000150893	ENST00000280481	T	0.26518	1.73	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.54111	0.1838	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	T	0.56408	-0.7984	10	0.87932	D	0	.	16.5979	0.84801	0.1307:0.8693:0.0:0.0	.	406	Q5SZK8	FREM2_HUMAN	C	406	ENSP00000280481:R406C	ENSP00000280481:R406C	R	+	1	0	FREM2	38160697	1.000000	0.71417	0.989000	0.46669	0.627000	0.37826	3.983000	0.56916	2.826000	0.97356	0.561000	0.74099	CGC		0.547	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
SLC24A4	123041	broad.mit.edu	37	14	92953022	92953022	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr14:92953022G>A	ENST00000532405.1	+	14	1661	c.1435G>A	c.(1435-1437)Gga>Aga	p.G479R	SLC24A4_ENST00000298877.1_Missense_Mutation_p.G462R|SLC24A4_ENST00000351924.5_Missense_Mutation_p.G443R|SLC24A4_ENST00000531433.1_Missense_Mutation_p.G460R|SLC24A4_ENST00000393265.2_Missense_Mutation_p.G415R			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	479					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.G462R(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		GACTATTATCGGATACACACT	0.478																																					p.G479R	NSCLC(10;315 435 10383 28450 38798)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1435A	14						.						150.0	105.0	121.0					14																	92953022		2203	4300	6503	92022775	SO:0001583	missense	123041	exon14			AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1435G>A	14.37:g.92953022G>A	ENSP00000431840:p.Gly479Arg	Somatic		Capture	Illumina HiSeq	Phase_I	92022775	NM_153646	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	ENST00000532405.1	37	CCDS9903.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	20.4|20.4	3.979675|3.979675	0.74360|0.74360	.|.	.|.	ENSG00000140090|ENSG00000140090	ENST00000393265;ENST00000531433;ENST00000532405;ENST00000298877;ENST00000351924|ENST00000525557	T;T;T;T;T|.	0.64260|.	-0.09;-0.09;-0.09;-0.09;-0.09|.	4.95|4.95	4.95|4.95	0.65309|0.65309	Sodium/calcium exchanger membrane region (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87954|0.87954	0.6308|0.6308	H|H	0.95917|0.95917	3.74|3.74	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.997;0.997;1.0|.	D|D	0.92119|0.92119	0.5702|0.5702	10|5	0.87932|.	D|.	0|.	.|.	18.2116|18.2116	0.89872|0.89872	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	460;415;479|.	Q8NFF2-3;Q8NFF2-2;Q8NFF2|.	.;.;NCKX4_HUMAN|.	R|Q	415;460;479;462;443|344	ENSP00000376948:G415R;ENSP00000433302:G460R;ENSP00000431840:G479R;ENSP00000298877:G462R;ENSP00000337789:G443R|.	ENSP00000298877:G462R|.	G|R	+|+	1|2	0|0	SLC24A4|SLC24A4	92022775|92022775	1.000000|1.000000	0.71417|0.71417	0.457000|0.457000	0.27056|0.27056	0.487000|0.487000	0.33371|0.33371	9.572000|9.572000	0.98179|0.98179	2.293000|2.293000	0.77203|0.77203	0.561000|0.561000	0.74099|0.74099	GGA|CGG		0.478	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646	
EVL	51466	broad.mit.edu	37	14	100563888	100563888	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr14:100563888G>T	ENST00000402714.2	+	3	849	c.245G>T	c.(244-246)cGa>cTa	p.R82L	EVL_ENST00000555048.1_3'UTR|EVL_ENST00000544450.2_Missense_Mutation_p.R88L|EVL_ENST00000392920.3_Missense_Mutation_p.R84L			Q9UI08	EVL_HUMAN	Enah/Vasp-like	82	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)	p.R84L(1)		cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				CACCAGTGGCGAGATGCCCGC	0.478																																					p.R84L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G251T	14						.						97.0	87.0	91.0					14																	100563888		2203	4300	6503	99633641	SO:0001583	missense	51466	exon3			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.245G>T	14.37:g.100563888G>T	ENSP00000384720:p.Arg82Leu	Somatic		Capture	Illumina HiSeq	Phase_I	99633641	NM_016337	A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	ENST00000402714.2	37		.	.	.	.	.	.	.	.	.	.	G	35	5.421855	0.96111	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000555706;ENST00000539470;ENST00000557153	D;D;D;D;D	0.98762	-5.12;-5.12;-5.12;-5.12;-5.12	5.18	5.18	0.71444	EVH1 (3);Pleckstrin homology-type (1);	0.000000	0.64402	D	0.000001	D	0.99193	0.9720	M	0.84846	2.72	0.80722	D	1	D;D;D	0.89917	1.0;0.994;0.99	D;D;D	0.80764	0.994;0.932;0.913	D	0.99585	1.0974	10	0.72032	D	0.01	-12.9851	18.6942	0.91594	0.0:0.0:1.0:0.0	.	88;84;82	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	L	82;88;84;69;84;69	ENSP00000384720:R82L;ENSP00000437904:R88L;ENSP00000376652:R84L;ENSP00000450723:R69L;ENSP00000452327:R69L	ENSP00000376652:R84L	R	+	2	0	EVL	99633641	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.689000	0.98673	2.392000	0.81423	0.655000	0.94253	CGA		0.478	EVL-006	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000413958.1		
CHRFAM7A	89832	broad.mit.edu	37	15	30659641	30659641	+	Missense_Mutation	SNP	C	C	T	rs138139103	byFrequency	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr15:30659641C>T	ENST00000299847.2	-	9	1153	c.700G>A	c.(700-702)Ggg>Agg	p.G234R	CHRFAM7A_ENST00000397827.3_Missense_Mutation_p.G143R|CHRFAM7A_ENST00000401522.3_Missense_Mutation_p.G143R	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	234						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)	p.G234R(1)		large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		ATCTTGCCCCCGTCGGGGTCG	0.592													.|||	134	0.0267572	0.087	0.013	5008	,	,		27915	0.001		0.003	False		,,,				2504	0.0061				p.G234R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G700A	15						.	C	ARG/GLY,ARG/GLY	221,4161		8,205,1978	57.0	56.0	56.0		700,427	3.2	0.6	15	dbSNP_134	56	18,8548		0,18,4265	no	missense,missense	CHRFAM7A	NM_139320.1,NM_148911.1	125,125	8,223,6243	TT,TC,CC		0.2101,5.0434,1.8458	probably-damaging,probably-damaging	234/413,143/322	30659641	239,12709	2191	4283	6474	28446933	SO:0001583	missense	89832	exon9			AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.700G>A	15.37:g.30659641C>T	ENSP00000299847:p.Gly234Arg	Somatic		Capture	Illumina HiSeq	Phase_I	28446933	NM_139320	A8KAB9	Missense_Mutation	SNP	ENST00000299847.2	37	CCDS32184.1	.	.	.	.	.	.	.	.	.	.	.	17.75	3.466864	0.63625	0.050434	0.002101	ENSG00000166664	ENST00000299847;ENST00000397827;ENST00000401522	D;D;D	0.85171	-1.95;-1.95;-1.95	3.23	3.23	0.37069	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	T	0.49406	0.1555	L	0.54965	1.715	0.80722	D	1	P	0.36412	0.552	B	0.39379	0.298	T	0.73062	-0.4101	10	0.62326	D	0.03	.	12.3474	0.55128	0.0:1.0:0.0:0.0	.	234	Q494W8	CRFM7_HUMAN	R	234;143;143	ENSP00000299847:G234R;ENSP00000380927:G143R;ENSP00000385389:G143R	ENSP00000299847:G234R	G	-	1	0	CHRFAM7A	28446933	1.000000	0.71417	0.581000	0.28614	0.764000	0.43329	7.232000	0.78116	1.535000	0.49220	0.398000	0.26397	GGG		0.592	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430700.1	NM_148911	
RYR3	6263	broad.mit.edu	37	15	33876623	33876623	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr15:33876623A>C	ENST00000389232.4	+	15	1671	c.1601A>C	c.(1600-1602)aAt>aCt	p.N534T	RYR3_ENST00000415757.3_Missense_Mutation_p.N534T	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	534					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.N534T(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AACAGAAACAATTGCGCTCAA	0.403																																					p.N534T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1601C	15						.						64.0	59.0	60.0					15																	33876623		1864	4115	5979	31663915	SO:0001583	missense	6263	exon15				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1601A>C	15.37:g.33876623A>C	ENSP00000373884:p.Asn534Thr	Somatic		Capture	Illumina HiSeq	Phase_I	31663915	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.436606	0.83885	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.99422	-5.88;-5.88	5.08	5.08	0.68730	Intracellular calcium-release channel (1);	0.000000	0.85682	D	0.000000	D	0.99551	0.9839	M	0.88570	2.965	0.58432	D	0.999999	D;D	0.76494	0.998;0.999	D;D	0.85130	0.991;0.997	D	0.98147	1.0439	10	0.66056	D	0.02	.	15.0111	0.71550	1.0:0.0:0.0:0.0	.	534;534	Q15413-2;Q15413	.;RYR3_HUMAN	T	534	ENSP00000373884:N534T;ENSP00000399610:N534T	ENSP00000354735:N534T	N	+	2	0	RYR3	31663915	1.000000	0.71417	0.993000	0.49108	0.978000	0.69477	9.003000	0.93577	2.141000	0.66446	0.533000	0.62120	AAT		0.403	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
MEGF11	84465	broad.mit.edu	37	15	66416315	66416315	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr15:66416315G>A	ENST00000409699.2	-	3	294	c.122C>T	c.(121-123)tCg>tTg	p.S41L	MEGF11_ENST00000360698.4_Missense_Mutation_p.S41L|MEGF11_ENST00000395625.2_5'UTR|MEGF11_ENST00000395614.1_5'UTR|MEGF11_ENST00000422354.1_Missense_Mutation_p.S41L|MEGF11_ENST00000288745.3_5'UTR			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	41	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S41L(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						GTGTGCATACGATTCCTGGAC	0.512																																					p.S41L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C122T	15						.						204.0	151.0	169.0					15																	66416315		2201	4299	6500	64203369	SO:0001583	missense	84465	exon3			AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.122C>T	15.37:g.66416315G>A	ENSP00000386908:p.Ser41Leu	Somatic		Capture	Illumina HiSeq	Phase_I	64203369	NM_032445	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	ENST00000409699.2	37	CCDS10213.2	.	.	.	.	.	.	.	.	.	.	G	32	5.125545	0.94429	.	.	ENSG00000157890	ENST00000409699;ENST00000422354;ENST00000360698	D;D;D	0.87650	-2.28;-2.28;-2.22	5.71	5.71	0.89125	EMI domain (1);	.	.	.	.	D	0.92430	0.7597	L	0.58101	1.795	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	D	0.92413	0.5939	9	0.62326	D	0.03	.	18.8392	0.92176	0.0:0.0:1.0:0.0	.	41	A6BM72	MEG11_HUMAN	L	41	ENSP00000386908:S41L;ENSP00000414475:S41L;ENSP00000353919:S41L	ENSP00000353919:S41L	S	-	2	0	MEGF11	64203369	1.000000	0.71417	0.870000	0.34147	0.779000	0.44077	9.663000	0.98605	2.702000	0.92279	0.561000	0.74099	TCG		0.512	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329307.2	NM_032445	
CYP1A1	1543	broad.mit.edu	37	15	75015205	75015205	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr15:75015205A>C	ENST00000379727.3	-	2	432	c.234T>G	c.(232-234)atT>atG	p.I78M	CYP1A1_ENST00000567032.1_Missense_Mutation_p.I78M|CYP1A1_ENST00000395048.2_Missense_Mutation_p.I78M|CYP1A1_ENST00000395049.4_Missense_Mutation_p.I78M|CYP1A1_ENST00000564596.1_Intron			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	78			I -> T (in dbSNP:rs17861094). {ECO:0000269|PubMed:15469410, ECO:0000269|PubMed:15643613}.		9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)	p.I78M(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	GTGTGGAGCCAATTCGGATCT	0.637									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.I78M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T234G	15						.						60.0	51.0	54.0					15																	75015205		2197	4296	6493	72802258	SO:0001583	missense	1543	exon2	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.234T>G	15.37:g.75015205A>C	ENSP00000369050:p.Ile78Met	Somatic		Capture	Illumina HiSeq	Phase_I	72802258	NM_000499	A4F3V9|A4F3W0|Q53G18	Missense_Mutation	SNP	ENST00000379727.3	37	CCDS10268.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.633405	0.47049	.	.	ENSG00000140465	ENST00000379727;ENST00000395048;ENST00000395049;ENST00000268062	T;T;T	0.68025	-0.3;-0.3;-0.3	5.23	-6.64	0.01801	.	0.157959	0.56097	D	0.000027	T	0.66489	0.2794	L	0.42581	1.335	0.50632	D	0.999884	D;D	0.67145	0.996;0.993	D;D	0.72338	0.977;0.97	T	0.71454	-0.4588	10	0.87932	D	0	.	8.3578	0.32340	0.2821:0.3276:0.3904:0.0	.	78;78	E7EMT5;P04798	.;CP1A1_HUMAN	M	78	ENSP00000369050:I78M;ENSP00000378488:I78M;ENSP00000378489:I78M	ENSP00000268062:I78M	I	-	3	3	CYP1A1	72802258	0.022000	0.18835	0.241000	0.24154	0.344000	0.29017	-0.820000	0.04457	-1.672000	0.01464	0.379000	0.24179	ATT		0.637	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286396.1	NM_000499	
LINGO1	84894	broad.mit.edu	37	15	77907921	77907921	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr15:77907921C>T	ENST00000355300.6	-	2	502	c.328G>A	c.(328-330)Gtg>Atg	p.V110M	LINGO1_ENST00000561030.1_Missense_Mutation_p.V104M	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	110					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V104M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						CCGGGCTCCACGGCGCTCACG	0.622																																					p.V110M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G328A	15						.						37.0	42.0	40.0					15																	77907921		2051	4193	6244	75694976	SO:0001583	missense	84894	exon2			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.328G>A	15.37:g.77907921C>T	ENSP00000347451:p.Val110Met	Somatic		Capture	Illumina HiSeq	Phase_I	75694976	NM_032808	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	ENST00000355300.6	37	CCDS45313.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.147859	0.57151	.	.	ENSG00000169783	ENST00000355300	T	0.80566	-1.39	5.63	4.71	0.59529	.	0.057827	0.64402	D	0.000002	T	0.77315	0.4112	M	0.68952	2.095	0.51767	D	0.999933	P	0.48589	0.912	P	0.45610	0.487	T	0.75536	-0.3283	10	0.34782	T	0.22	.	5.3643	0.16105	0.0:0.7275:0.0:0.2725	.	110	Q96FE5	LIGO1_HUMAN	M	110	ENSP00000347451:V110M	ENSP00000347451:V110M	V	-	1	0	LINGO1	75694976	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.019000	0.57181	2.659000	0.90383	0.561000	0.74099	GTG		0.622	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419546.1	NM_032808	
NUBP1	4682	broad.mit.edu	37	16	10855644	10855644	+	Missense_Mutation	SNP	G	G	A	rs267604406		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr16:10855644G>A	ENST00000283027.5	+	9	767	c.748G>A	c.(748-750)Ggg>Agg	p.G250R	NUBP1_ENST00000433392.2_Missense_Mutation_p.G239R|NUBP1_ENST00000571790.1_3'UTR|TVP23A_ENST00000572980.1_Intron	NM_002484.2	NP_002475.2			nucleotide binding protein 1									p.G250R(1)		large_intestine(2)|lung(3)|ovary(1)|skin(4)	10						TCCCACAACCGGGGGCGCGGA	0.542																																					p.G250R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G748A	16						.						49.0	53.0	52.0					16																	10855644		2197	4300	6497	10763145	SO:0001583	missense	4682	exon9			U01833	CCDS10543.1, CCDS61839.1	16p13.13	2014-01-13	2011-05-19		ENSG00000103274	ENSG00000103274			8041	protein-coding gene	gene with protein product		600280	"""nucleotide binding protein 1 (E.coli MinD like)"", ""nucleotide binding protein 1 (MinD homolog, E. coli)"""	NBP1		7926816	Standard	NM_002484		Approved	NBP35	uc002daa.1	P53384	OTTHUMG00000129751	ENST00000283027.5:c.748G>A	16.37:g.10855644G>A	ENSP00000283027:p.Gly250Arg	Somatic		Capture	Illumina HiSeq	Phase_I	10763145	NM_002484		Missense_Mutation	SNP	ENST00000283027.5	37	CCDS10543.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.597126	0.66332	.	.	ENSG00000103274	ENST00000283027;ENST00000433392	T;T	0.42131	0.98;0.98	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.78666	0.4319	H	0.97983	4.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.987;1.0	D	0.86944	0.2081	10	0.87932	D	0	-21.9981	18.1999	0.89834	0.0:0.0:1.0:0.0	.	239;250	P53384-2;P53384	.;NUBP1_HUMAN	R	250;239	ENSP00000283027:G250R;ENSP00000409654:G239R	ENSP00000283027:G250R	G	+	1	0	NUBP1	10763145	1.000000	0.71417	0.928000	0.36995	0.011000	0.07611	9.269000	0.95684	2.594000	0.87642	0.655000	0.94253	GGG		0.542	NUBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251964.2	NM_002484	
KCTD13	253980	broad.mit.edu	37	16	29934513	29934513	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr16:29934513G>A	ENST00000568000.1	-	2	1413	c.412C>T	c.(412-414)Cag>Tag	p.Q138*	CTD-2574D22.4_ENST00000567795.1_RNA|KCTD13_ENST00000561540.1_Nonsense_Mutation_p.Q138*|KCTD13_ENST00000568721.1_5'Flank	NM_178863.3	NP_849194.1	Q8WZ19	BACD1_HUMAN	potassium channel tetramerization domain containing 13	138					cell migration (GO:0016477)|DNA replication (GO:0006260)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)	GTP-Rho binding (GO:0017049)	p.Q138*(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	7						GCCCTCACCTGCAGCGCCAGC	0.592																																					p.Q138X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C412T	16						.						44.0	41.0	42.0					16																	29934513		2197	4300	6497	29842014	SO:0001587	stop_gained	253980	exon2			AF289573	CCDS10661.1	16p11.2	2013-06-20	2013-06-20		ENSG00000174943	ENSG00000174943			22234	protein-coding gene	gene with protein product	"""polymerase delta-interacting protein 1"", ""TNFAIP1-like"""	608947	"""potassium channel tetramerisation domain containing 13"""			11593007	Standard	NM_178863		Approved	PDIP1, FKSG86, POLDIP1	uc002duv.4	Q8WZ19	OTTHUMG00000132120	ENST00000568000.1:c.412C>T	16.37:g.29934513G>A	ENSP00000455785:p.Gln138*	Somatic		Capture	Illumina HiSeq	Phase_I	29842014	NM_178863	A8K0R5|Q96P93|Q96SA1	Nonsense_Mutation	SNP	ENST00000568000.1	37	CCDS10661.1	.	.	.	.	.	.	.	.	.	.	G	36	5.834815	0.97003	.	.	ENSG00000174943	ENST00000308768	.	.	.	5.02	5.02	0.67125	.	0.203369	0.35179	N	0.003395	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-18.2559	17.2768	0.87118	0.0:0.0:1.0:0.0	.	.	.	.	X	138	.	ENSP00000311202:Q138X	Q	-	1	0	KCTD13	29842014	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.298000	0.96132	2.596000	0.87737	0.563000	0.77884	CAG		0.592	KCTD13-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255162.2	NM_178863	
WDR90	197335	broad.mit.edu	37	16	716916	716916	+	Silent	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr16:716916G>A	ENST00000293879.4	+	40	5016	c.5016G>A	c.(5014-5016)aaG>aaA	p.K1672K	WDR90_ENST00000547944.1_Silent_p.K271K|WDR90_ENST00000549091.1_Silent_p.K1674K|WDR90_ENST00000315764.4_Silent_p.K223K|RHOT2_ENST00000315082.4_5'Flank			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1672								p.K1672K(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				TGGTGGAGAAGATACCACTGC	0.647																																					p.K1672K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5016A	16						.						88.0	94.0	92.0					16																	716916		2114	4237	6351	656917	SO:0001819	synonymous_variant	197335	exon40			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.5016G>A	16.37:g.716916G>A		Somatic		Capture	Illumina HiSeq	Phase_I	656917	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Silent	SNP	ENST00000293879.4	37	CCDS42092.1																																																																																				0.647	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
NLRC5	84166	broad.mit.edu	37	16	57081523	57081523	+	Silent	SNP	G	G	A	rs140783117	byFrequency	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr16:57081523G>A	ENST00000262510.6	+	23	3630	c.3405G>A	c.(3403-3405)ccG>ccA	p.P1135P	NLRC5_ENST00000436936.1_Silent_p.P1135P|NLRC5_ENST00000308149.7_Silent_p.P1135P|NLRC5_ENST00000539144.1_Silent_p.P1135P	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1135					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.P1135P(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				AGGACTGCCCGGGACCCCTGG	0.622																																					p.P1135P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3405A	16						.						39.0	34.0	36.0					16																	57081523		2198	4300	6498	55639024	SO:0001819	synonymous_variant	84166	exon23			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3405G>A	16.37:g.57081523G>A		Somatic		Capture	Illumina HiSeq	Phase_I	55639024	NM_032206	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Silent	SNP	ENST00000262510.6	37	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.469140	0.01053	.	.	ENSG00000140853	ENST00000538805	.	.	.	3.77	-7.55	0.01327	.	.	.	.	.	T	0.16981	0.0408	.	.	.	0.23700	N	0.997073	.	.	.	.	.	.	T	0.18713	-1.0328	4	.	.	.	.	2.8864	0.05662	0.196:0.1237:0.4369:0.2434	.	.	.	.	R	888	.	.	G	+	1	0	NLRC5	55639024	0.000000	0.05858	0.528000	0.27938	0.008000	0.06430	-5.361000	0.00128	-2.089000	0.00860	-1.388000	0.01159	GGG		0.622	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
FAM65A	79567	broad.mit.edu	37	16	67580114	67580114	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr16:67580114G>A	ENST00000379312.3	+	21	3675	c.3554G>A	c.(3553-3555)cGg>cAg	p.R1185Q	FAM65A_ENST00000428437.2_Missense_Mutation_p.R1195Q|FAM65A_ENST00000422602.2_Missense_Mutation_p.R1201Q|FAM65A_ENST00000042381.4_Missense_Mutation_p.R1181Q|FAM65A_ENST00000540839.3_Missense_Mutation_p.R1200Q	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	1185						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.R1181Q(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		GAAGCTGCCCGGCAAAGCCTA	0.607																																					p.R1185Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3554A	16						.						59.0	60.0	60.0					16																	67580114		2198	4300	6498	66137615	SO:0001583	missense	79567	exon21			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.3554G>A	16.37:g.67580114G>A	ENSP00000368614:p.Arg1185Gln	Somatic		Capture	Illumina HiSeq	Phase_I	66137615	NM_001193522	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	.	.	.	.	.	.	.	.	.	.	G	19.74	3.883579	0.72410	.	.	ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	T;T;T	0.17213	2.32;2.32;2.29	5.08	5.08	0.68730	Armadillo-like helical (1);Armadillo-type fold (1);	0.109676	0.64402	D	0.000018	T	0.31104	0.0786	L	0.58810	1.83	0.31192	N	0.700854	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.63283	0.913;0.913;0.913	T	0.17806	-1.0357	10	0.37606	T	0.19	-18.9586	9.3591	0.38184	0.1037:0.0:0.8963:0.0	.	1195;1201;1185	B4DIM2;E9PBS3;Q6ZS17	.;.;FA65A_HUMAN	Q	1185;1181;1201;1195	ENSP00000368614:R1185Q;ENSP00000042381:R1181Q;ENSP00000400099:R1201Q	ENSP00000042381:R1181Q	R	+	2	0	FAM65A	66137615	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.984000	0.63838	2.537000	0.85549	0.561000	0.74099	CGG		0.607	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
DNAH9	1770	broad.mit.edu	37	17	11603098	11603098	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:11603098C>A	ENST00000262442.4	+	23	4991	c.4923C>A	c.(4921-4923)ttC>ttA	p.F1641L	DNAH9_ENST00000454412.2_Missense_Mutation_p.F1641L	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1641	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.F1641L(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGATGCGATTCCAGCTAGATG	0.507																																					p.F1641L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4923A	17						.						139.0	108.0	119.0					17																	11603098		2203	4300	6503	11543823	SO:0001583	missense	1770	exon23			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4923C>A	17.37:g.11603098C>A	ENSP00000262442:p.Phe1641Leu	Somatic		Capture	Illumina HiSeq	Phase_I	11543823	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580022	0.65992	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.63096	-0.02;-0.02	5.45	3.23	0.37069	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	T	0.66499	0.2795	M	0.61703	1.905	0.80722	D	1	B	0.33212	0.402	P	0.47134	0.539	T	0.62450	-0.6852	10	0.42905	T	0.14	.	8.2788	0.31887	0.0:0.7304:0.0:0.2696	.	1641	Q9NYC9	DYH9_HUMAN	L	1641;1641;223	ENSP00000262442:F1641L;ENSP00000414874:F1641L	ENSP00000262442:F1641L	F	+	3	2	DNAH9	11543823	1.000000	0.71417	0.957000	0.39632	0.833000	0.47200	1.201000	0.32259	0.508000	0.28173	-0.137000	0.14449	TTC		0.507	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
B9D1	27077	broad.mit.edu	37	17	19263656	19263656	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:19263656C>T	ENST00000261499.4	-	2	252	c.109G>A	c.(109-111)Ggc>Agc	p.G37S	B9D1_ENST00000268841.6_Missense_Mutation_p.G37S|B9D1_ENST00000395616.3_Missense_Mutation_p.G37S|B9D1_ENST00000477478.2_Silent_p.T12T|B9D1_ENST00000575403.1_Silent_p.T12T|B9D1_ENST00000461069.2_Missense_Mutation_p.G37S|B9D1_ENST00000395615.1_Missense_Mutation_p.G37S	NM_015681.3	NP_056496.1	Q9UPM9	B9D1_HUMAN	B9 protein domain 1	37	B9. {ECO:0000255|PROSITE- ProRule:PRU00713}.				camera-type eye development (GO:0043010)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|in utero embryonic development (GO:0001701)|neuroepithelial cell differentiation (GO:0060563)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)|vasculature development (GO:0001944)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)	hedgehog receptor activity (GO:0008158)	p.G37S(1)		large_intestine(3)|urinary_tract(1)	4	all_cancers(12;2.04e-05)|all_epithelial(12;0.000806)|Hepatocellular(7;0.00345)|Breast(13;0.143)					CAGTCCTGGCCGTACACAAAG	0.517																																					p.G37S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G109A	17						.						115.0	119.0	117.0					17																	19263656		2203	4300	6503	19204249	SO:0001583	missense	27077	exon2			BC002944	CCDS11205.1, CCDS58528.1	17p11.2	2014-09-17			ENSG00000108641	ENSG00000108641			24123	protein-coding gene	gene with protein product	"""endothelial precursor protein B9"""	614144				21493627	Standard	NM_015681		Approved	B9, EPPB9, MKS9	uc010vyr.2	Q9UPM9	OTTHUMG00000059586	ENST00000261499.4:c.109G>A	17.37:g.19263656C>T	ENSP00000261499:p.Gly37Ser	Somatic		Capture	Illumina HiSeq	Phase_I	19204249	NM_015681	Q9BU22	Missense_Mutation	SNP	ENST00000261499.4	37	CCDS11205.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.989720	0.93106	.	.	ENSG00000108641	ENST00000395615;ENST00000261499;ENST00000395616;ENST00000268841;ENST00000440841	T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.89515	0.6737	H	0.94658	3.565	0.80722	D	1	P	0.36837	0.571	P	0.50440	0.641	D	0.90703	0.4622	10	0.54805	T	0.06	.	16.803	0.85618	0.0:1.0:0.0:0.0	.	37	Q9UPM9	B9D1_HUMAN	S	37;37;37;37;28	ENSP00000378977:G37S;ENSP00000261499:G37S;ENSP00000378978:G37S;ENSP00000268841:G37S;ENSP00000410835:G28S	ENSP00000261499:G37S	G	-	1	0	B9D1	19204249	0.997000	0.39634	0.991000	0.47740	0.992000	0.81027	3.866000	0.56040	2.559000	0.86315	0.555000	0.69702	GGC		0.517	B9D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132494.1	NM_015681	
SLFN11	91607	broad.mit.edu	37	17	33689936	33689936	+	Silent	SNP	G	G	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:33689936G>T	ENST00000394566.1	-	4	1163	c.891C>A	c.(889-891)ctC>ctA	p.L297L	SLFN11_ENST00000308377.4_Silent_p.L297L	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	297					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.L297L(1)		autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TCACAATTTTGAGTGTGAAGG	0.423																																					p.L297L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C891A	17						.						183.0	181.0	181.0					17																	33689936		2203	4300	6503	30714049	SO:0001819	synonymous_variant	91607	exon3			AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.891C>A	17.37:g.33689936G>T		Somatic		Capture	Illumina HiSeq	Phase_I	30714049	NM_001104589	E1P643|Q8N3S8|Q8N762|Q8TEE0	Silent	SNP	ENST00000394566.1	37	CCDS11294.1																																																																																				0.423	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
C17orf85	55421	broad.mit.edu	37	17	3724562	3724562	+	Silent	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:3724562C>T	ENST00000389005.4	-	9	1008	c.981G>A	c.(979-981)tcG>tcA	p.S327S	C17orf85_ENST00000158149.3_Silent_p.S47S|C17orf85_ENST00000577169.1_5'Flank	NM_001114118.2	NP_001107590.1	Q53F19	CQ085_HUMAN	chromosome 17 open reading frame 85	327							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S47S(1)		endometrium(2)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)		GATGTTTATACGACGTCAAGC	0.443																																					p.S327S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G981A	17						.						159.0	127.0	138.0					17																	3724562		2203	4300	6503	3671311	SO:0001819	synonymous_variant	55421	exon9				CCDS45578.1	17p13.2	2012-10-23			ENSG00000074356	ENSG00000074356			24612	protein-coding gene	gene with protein product	"""ELG protein"""					11412301	Standard	NM_001114118		Approved	HSA277841, ELG	uc010ckl.2	Q53F19	OTTHUMG00000177672	ENST00000389005.4:c.981G>A	17.37:g.3724562C>T		Somatic		Capture	Illumina HiSeq	Phase_I	3671311	NM_001114118	B3KWG7|Q7L406|Q96FK1|Q9NXZ4	Silent	SNP	ENST00000389005.4	37	CCDS45578.1																																																																																				0.443	C17orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438385.1	NM_018553	
NR1D1	9572	broad.mit.edu	37	17	38253428	38253428	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:38253428G>A	ENST00000246672.3	-	2	890	c.260C>T	c.(259-261)tCg>tTg	p.S87L		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	87	Crucial for activation of GJA1. {ECO:0000250}.|Modulating.|Poly-Ser.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.S87L(1)		endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					ggatgacgacgaggaagatga	0.617																																					p.S87L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C260T	17						.						62.0	62.0	62.0					17																	38253428		2203	4300	6503	35506954	SO:0001583	missense	9572	exon2			X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.260C>T	17.37:g.38253428G>A	ENSP00000246672:p.Ser87Leu	Somatic		Capture	Illumina HiSeq	Phase_I	35506954	NM_021724	Q0P5Z4|Q15304	Missense_Mutation	SNP	ENST00000246672.3	37	CCDS11361.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081182	0.36758	.	.	ENSG00000126368	ENST00000246672	D	0.91740	-2.9	4.72	3.74	0.42951	.	0.218701	0.28952	N	0.013601	D	0.83741	0.5320	L	0.29908	0.895	0.09310	N	0.999999	B	0.25105	0.118	B	0.14578	0.011	T	0.69011	-0.5258	10	0.20046	T	0.44	.	8.1614	0.31201	0.087:0.1578:0.7552:0.0	.	87	P20393	NR1D1_HUMAN	L	87	ENSP00000246672:S87L	ENSP00000246672:S87L	S	-	2	0	NR1D1	35506954	0.669000	0.27502	0.130000	0.21974	0.065000	0.16274	2.696000	0.47052	1.214000	0.43395	0.462000	0.41574	TCG		0.617	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257135.1		
TEX14	56155	broad.mit.edu	37	17	56663414	56663414	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:56663414C>A	ENST00000240361.8	-	18	2921	c.2836G>T	c.(2836-2838)Gct>Tct	p.A946S	TEX14_ENST00000389934.3_Missense_Mutation_p.A940S|TEX14_ENST00000349033.5_Missense_Mutation_p.A940S			Q8IWB6	TEX14_HUMAN	testis expressed 14	946					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.A940S(1)|p.A946S(1)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGTCCAGTAGCTGCTTTCTTT	0.478																																					p.A940S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2818T	17						.						131.0	131.0	131.0					17																	56663414		2203	4300	6503	54018413	SO:0001583	missense	56155	exon18			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.2836G>T	17.37:g.56663414C>A	ENSP00000240361:p.Ala946Ser	Somatic		Capture	Illumina HiSeq	Phase_I	54018413	NM_198393	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336802	0.81801	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	D;D;D	0.83673	-1.75;-1.74;-1.62	5.62	4.63	0.57726	.	0.258617	0.33938	N	0.004406	D	0.88306	0.6401	M	0.62723	1.935	0.24107	N	0.995858	D;D;D	0.89917	1.0;0.989;1.0	D;P;D	0.69479	0.921;0.905;0.964	T	0.81182	-0.1049	10	0.66056	D	0.02	-7.2426	11.6747	0.51424	0.1772:0.8228:0.0:0.0	.	946;940;940	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	S	946;940;940	ENSP00000240361:A946S;ENSP00000374584:A940S;ENSP00000268910:A940S	ENSP00000240361:A946S	A	-	1	0	TEX14	54018413	1.000000	0.71417	0.965000	0.40720	0.972000	0.66771	2.350000	0.44063	1.329000	0.45376	0.561000	0.74099	GCT		0.478	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
CLEC10A	10462	broad.mit.edu	37	17	6981402	6981402	+	Missense_Mutation	SNP	C	C	T	rs200835319		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:6981402C>T	ENST00000254868.4	-	3	426	c.98G>A	c.(97-99)cGt>cAt	p.R33H	CLEC10A_ENST00000576617.1_Missense_Mutation_p.R33H|CLEC10A_ENST00000571664.1_Missense_Mutation_p.R33H|CLEC10A_ENST00000416562.2_Missense_Mutation_p.R33H	NM_182906.2	NP_878910.1	Q8IUN9	CLC10_HUMAN	C-type lectin domain family 10, member A	33					endocytosis (GO:0006897)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.R33H(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						AGAGCAGAGACGCTGCAGGAG	0.627																																					p.R33H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G98A	17						.						99.0	101.0	100.0					17																	6981402		2203	4300	6503	6922126	SO:0001583	missense	10462	exon3			D50532	CCDS11087.1, CCDS45597.1	17p13.2	2014-05-20	2005-02-09	2005-02-11		ENSG00000132514		"""C-type lectin domain containing"", ""CD molecules"""	16916	protein-coding gene	gene with protein product	"""macrophage lectin 2 (calcium dependent)"""	605999	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 14 (macrophage-derived)"""	CLECSF13, CLECSF14		8598452	Standard	XM_005256411		Approved	HML2, HML, CD301	uc002gej.3	Q8IUN9		ENST00000254868.4:c.98G>A	17.37:g.6981402C>T	ENSP00000254868:p.Arg33His	Somatic		Capture	Illumina HiSeq	Phase_I	6922126	NM_182906	A8K8J8|Q14538|Q6PIW3	Missense_Mutation	SNP	ENST00000254868.4	37	CCDS11087.1	.	.	.	.	.	.	.	.	.	.	C	11.14	1.551290	0.27739	.	.	ENSG00000132514	ENST00000254868;ENST00000416562	T;T	0.34859	1.34;1.34	4.43	-8.86	0.00795	Hepatic lectin, N-terminal (1);	2.091170	0.01921	N	0.040492	T	0.34687	0.0906	M	0.72894	2.215	0.09310	N	1	B;B;B;B	0.28350	0.208;0.113;0.004;0.007	B;B;B;B	0.20184	0.015;0.028;0.003;0.017	T	0.27806	-1.0063	10	0.59425	D	0.04	.	10.5418	0.45037	0.0:0.2258:0.1026:0.6716	.	33;33;33;33	Q8IUN9-3;A8K7G0;Q8IUN9;Q8IUN9-2	.;.;CLC10_HUMAN;.	H	33	ENSP00000254868:R33H;ENSP00000414938:R33H	ENSP00000254868:R33H	R	-	2	0	CLEC10A	6922126	0.000000	0.05858	0.000000	0.03702	0.106000	0.19336	-2.541000	0.00936	-2.605000	0.00448	-1.169000	0.01745	CGT		0.627	CLEC10A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000439837.2	NM_006344	
EFNB3	1949	broad.mit.edu	37	17	7611350	7611350	+	Missense_Mutation	SNP	G	G	A	rs370940378		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:7611350G>A	ENST00000226091.2	+	2	594	c.197G>A	c.(196-198)cGg>cAg	p.R66Q		NM_001406.3	NP_001397.1	Q15768	EFNB3_HUMAN	ephrin-B3	66	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				adult walking behavior (GO:0007628)|axon choice point recognition (GO:0016198)|axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)	p.R66Q(1)		large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	8		all_cancers(10;1.14e-06)|Prostate(122;0.081)				CCCCGGGCCCGGCCTCCTGGC	0.632																																					p.R66Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G197A	17						.	G	GLN/ARG	0,4404		0,0,2202	38.0	46.0	43.0		197	4.8	1.0	17		43	2,8598	2.2+/-6.3	0,2,4298	no	missense	EFNB3	NM_001406.3	43	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	benign	66/341	7611350	2,13002	2202	4300	6502	7552075	SO:0001583	missense	1949	exon2			U57001	CCDS11120.1	17p13.1	2011-03-09			ENSG00000108947	ENSG00000108947		"""Ephrins"""	3228	protein-coding gene	gene with protein product		602297		EPLG8		9126477	Standard	NM_001406		Approved	LERK-8	uc002gis.3	Q15768	OTTHUMG00000108161	ENST00000226091.2:c.197G>A	17.37:g.7611350G>A	ENSP00000226091:p.Arg66Gln	Somatic		Capture	Illumina HiSeq	Phase_I	7552075	NM_001406	B2RBW2|D3DTQ6|O00680|Q8TBH7|Q92875	Missense_Mutation	SNP	ENST00000226091.2	37	CCDS11120.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207846	0.58343	0.0	2.33E-4	ENSG00000108947	ENST00000226091	D	0.92965	-3.14	4.84	4.84	0.62591	Cupredoxin (2);	0.172916	0.41605	D	0.000856	D	0.83069	0.5174	N	0.19112	0.55	0.31006	N	0.719813	B	0.23937	0.094	B	0.18561	0.022	T	0.77776	-0.2461	10	0.45353	T	0.12	-17.1952	6.1375	0.20241	0.0931:0.0:0.7199:0.187	.	66	Q15768	EFNB3_HUMAN	Q	66	ENSP00000226091:R66Q	ENSP00000226091:R66Q	R	+	2	0	EFNB3	7552075	0.997000	0.39634	1.000000	0.80357	0.972000	0.66771	2.268000	0.43338	2.509000	0.84616	0.579000	0.79373	CGG		0.632	EFNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226965.1	NM_001406	
KDM6B	23135	broad.mit.edu	37	17	7755866	7755866	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:7755866G>A	ENST00000448097.2	+	20	4853	c.4522G>A	c.(4522-4524)Gtc>Atc	p.V1508I	TMEM88_ENST00000574668.1_5'Flank|TMEM88_ENST00000301599.6_5'Flank|KDM6B_ENST00000254846.5_Missense_Mutation_p.V1508I			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1508					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.V1508I(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						GGTGAAGAACGTCAAATCCAT	0.537											OREG0024145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V1508I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4522A	17						.						125.0	101.0	109.0					17																	7755866		2203	4300	6503	7696591	SO:0001583	missense	23135	exon20			AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.4522G>A	17.37:g.7755866G>A	ENSP00000412513:p.Val1508Ile	Somatic	644	Capture	Illumina HiSeq	Phase_I	7696591	NM_001080424	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	G	15.26	2.780270	0.49891	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.71103	-0.54;-0.54	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.84188	0.5417	M	0.75777	2.31	0.58432	D	0.999995	P;D	0.89917	0.617;1.0	B;D	0.81914	0.124;0.995	D	0.85306	0.1076	10	0.66056	D	0.02	-19.3566	18.2813	0.90099	0.0:0.0:1.0:0.0	.	1508;1508	O15054;O15054-1	KDM6B_HUMAN;.	I	1508	ENSP00000254846:V1508I;ENSP00000412513:V1508I	ENSP00000254846:V1508I	V	+	1	0	KDM6B	7696591	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	9.388000	0.97237	2.700000	0.92200	0.462000	0.41574	GTC		0.537	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
GUCY2D	3000	broad.mit.edu	37	17	7909845	7909845	+	Silent	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:7909845C>T	ENST00000254854.4	+	4	1341	c.1191C>T	c.(1189-1191)gaC>gaT	p.D397D		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	397					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.D397D(1)		skin(1)	1		Prostate(122;0.157)				TAGGAGGAGACGAGGAGCCCC	0.687																																					p.D397D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1191T	17						.						34.0	36.0	35.0					17																	7909845		2203	4300	6503	7850570	SO:0001819	synonymous_variant	3000	exon4			L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1191C>T	17.37:g.7909845C>T		Somatic		Capture	Illumina HiSeq	Phase_I	7850570	NM_000180	Q6LEA7	Silent	SNP	ENST00000254854.4	37	CCDS11127.1																																																																																				0.687	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
CACNG5	27091	broad.mit.edu	37	17	64876751	64876751	+	Missense_Mutation	SNP	G	G	A	rs201783473		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr17:64876751G>A	ENST00000533854.1	+	4	598	c.361G>A	c.(361-363)Gga>Aga	p.G121R	CACNG5_ENST00000169565.3_Missense_Mutation_p.G121R|CACNG5_ENST00000307139.3_Missense_Mutation_p.G121R			Q9UF02	CCG5_HUMAN	calcium channel, voltage-dependent, gamma subunit 5	121					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ion transmembrane transporter activity (GO:0015075)|voltage-gated calcium channel activity (GO:0005245)	p.G121R(3)|p.G121*(2)		NS(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	24			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			GAACAACATCGGACACATCCG	0.483																																					p.G121R												.	.	5	Substitution - Missense(3)|Substitution - Nonsense(2)	large_intestine(3)|lung(2)	c.G361A	17						.	G	ARG/GLY	0,4406		0,0,2203	299.0	237.0	258.0		361	3.7	1.0	17		258	1,8599	1.2+/-3.3	0,1,4299	no	missense	CACNG5	NM_145811.2	125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	121/276	64876751	1,13005	2203	4300	6503	62307213	SO:0001583	missense	27091	exon3			AF148220	CCDS11665.1	17q24	2004-02-16				ENSG00000075429		"""Calcium channel subunits"""	1409	protein-coding gene	gene with protein product		606405				10613843	Standard	NM_145811		Approved		uc010wqj.2	Q9UF02		ENST00000533854.1:c.361G>A	17.37:g.64876751G>A	ENSP00000436836:p.Gly121Arg	Somatic		Capture	Illumina HiSeq	Phase_I	62307213	NM_014404	A8K2A6|Q547R3|Q8WXS7|Q9UHM3	Missense_Mutation	SNP	ENST00000533854.1	37	CCDS11665.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347514	0.82022	0.0	1.16E-4	ENSG00000075429	ENST00000533854;ENST00000307139;ENST00000169565	D;D;D	0.91068	-2.78;-2.78;-2.78	3.67	3.67	0.42095	.	0.000000	0.64402	U	0.000001	D	0.94212	0.8142	M	0.66506	2.035	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94812	0.7979	10	0.66056	D	0.02	-4.7538	15.2223	0.73320	0.0:0.0:1.0:0.0	.	121	Q9UF02	CCG5_HUMAN	R	121	ENSP00000436836:G121R;ENSP00000303092:G121R;ENSP00000169565:G121R	ENSP00000169565:G121R	G	+	1	0	CACNG5	62307213	1.000000	0.71417	0.983000	0.44433	0.981000	0.71138	9.351000	0.97073	1.966000	0.57179	0.591000	0.81541	GGA		0.483	CACNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389882.1	NM_014404, NM_145811	
SMAD4	4089	broad.mit.edu	37	18	48591807	48591807	+	Missense_Mutation	SNP	T	T	C	rs377767339|rs377767340		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr18:48591807T>C	ENST00000342988.3	+	9	1508	c.970T>C	c.(970-972)Tgt>Cgt	p.C324R	SMAD4_ENST00000398417.2_Missense_Mutation_p.C324R|SMAD4_ENST00000588745.1_Missense_Mutation_p.C228R	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	324	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.W323fs*11(1)|p.C324R(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TGAGTATTGGTGTTCCATTGC	0.408																																					p.C324R												SMAD4,thyroid,NS,Substitution - Missense,-1 	.	40	Whole gene deletion(36)|Unknown(2)|Substitution - Missense(1)|Deletion - Frameshift(1)	pancreas(26)|large_intestine(4)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|small_intestine(1)|oesophagus(1)	c.T970C	18	GRCh37	CM081440	SMAD4	M		.						247.0	213.0	224.0					18																	48591807		2203	4300	6503	46845805	SO:0001583	missense	4089	exon9			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.970T>C	18.37:g.48591807T>C	ENSP00000341551:p.Cys324Arg	Somatic		Capture	Illumina HiSeq	Phase_I	46845805	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.436114	0.83885	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98207	-4.79;-4.79	5.99	5.99	0.97316	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99278	0.9748	H	0.95294	3.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98925	1.0785	10	0.87932	D	0	.	15.4768	0.75489	0.0:0.0:0.0:1.0	.	324	Q13485	SMAD4_HUMAN	R	324	ENSP00000341551:C324R;ENSP00000381452:C324R	ENSP00000341551:C324R	C	+	1	0	SMAD4	46845805	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.890000	0.87313	2.291000	0.77112	0.533000	0.62120	TGT		0.408	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
POLI	11201	broad.mit.edu	37	18	51804159	51804159	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr18:51804159C>G	ENST00000579534.1	+	4	636	c.493C>G	c.(493-495)Cta>Gta	p.L165V	POLI_ENST00000406285.3_Missense_Mutation_p.L165V|POLI_ENST00000579434.1_Missense_Mutation_p.L62V|POLI_ENST00000217800.5_Missense_Mutation_p.L39V	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	165	UmuC. {ECO:0000255|PROSITE- ProRule:PRU00216}.				DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.L140V(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		TGAGAAGAGACTACAGCAGCT	0.373								DNA polymerases (catalytic subunits)																													p.L165V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C493G	18						.						112.0	109.0	110.0					18																	51804159		2203	4300	6503	50058157	SO:0001583	missense	11201	exon4				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.493C>G	18.37:g.51804159C>G	ENSP00000462664:p.Leu165Val	Somatic		Capture	Illumina HiSeq	Phase_I	50058157	NM_007195	Q8N590|Q9H0S1|Q9NYH6	Missense_Mutation	SNP	ENST00000579534.1	37	CCDS11954.2	.	.	.	.	.	.	.	.	.	.	C	10.36	1.329902	0.24167	.	.	ENSG00000101751	ENST00000406285;ENST00000217800	T	0.76578	-1.03	5.44	3.46	0.39613	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.464123	0.21782	N	0.069189	T	0.77370	0.4120	M	0.64997	1.995	0.41654	D	0.989147	P;P	0.48089	0.875;0.905	P;P	0.51866	0.682;0.456	T	0.74979	-0.3479	10	0.39692	T	0.17	-2.9081	4.8083	0.13331	0.1706:0.6399:0.0:0.1895	.	164;165	B7Z780;Q9UNA4	.;POLI_HUMAN	V	165	ENSP00000385196:L165V	ENSP00000217800:L165V	L	+	1	2	POLI	50058157	0.999000	0.42202	0.933000	0.37362	0.973000	0.67179	0.621000	0.24418	1.225000	0.43566	0.591000	0.81541	CTA		0.373	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3	NM_007195	
DOK6	220164	broad.mit.edu	37	18	67345064	67345064	+	Silent	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr18:67345064C>T	ENST00000382713.5	+	4	574	c.384C>T	c.(382-384)gcC>gcT	p.A128A	DOK6_ENST00000584435.1_3'UTR	NM_152721.5	NP_689934.2	Q6PKX4	DOK6_HUMAN	docking protein 6	128								p.A128A(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	20		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				ACCTTCTGGCCGCAGGAGTGC	0.527																																					p.A128A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C384T	18						.						80.0	72.0	75.0					18																	67345064		2203	4300	6503	65496044	SO:0001819	synonymous_variant	220164	exon4			AK057795	CCDS32841.1	18q22.2	2013-01-10	2005-01-18	2005-01-18		ENSG00000206052		"""Pleckstrin homology (PH) domain containing"""	28301	protein-coding gene	gene with protein product		611402	"""docking protein 5-like"""	DOK5L		15286081	Standard	NM_152721		Approved	MGC20785, HsT3226	uc002lkl.3	Q6PKX4		ENST00000382713.5:c.384C>T	18.37:g.67345064C>T		Somatic		Capture	Illumina HiSeq	Phase_I	65496044	NM_152721	A6NNG3|Q4V9S3|Q8WUZ8|Q96HI2|Q96LU2	Silent	SNP	ENST00000382713.5	37	CCDS32841.1																																																																																				0.527	DOK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442969.1	NM_152721	
ADNP2	22850	broad.mit.edu	37	18	77895407	77895407	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr18:77895407C>T	ENST00000262198.4	+	4	2566	c.2111C>T	c.(2110-2112)cCg>cTg	p.P704L		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	704					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P704L(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		GAGCTCTTTCCGTCCAACGTC	0.552																																					p.P704L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2111T	18						.						140.0	124.0	129.0					18																	77895407		2203	4300	6503	75996398	SO:0001583	missense	22850	exon4			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2111C>T	18.37:g.77895407C>T	ENSP00000262198:p.Pro704Leu	Somatic		Capture	Illumina HiSeq	Phase_I	75996398	NM_014913	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028473	0.54790	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.02	5.02	0.67125	Zinc finger, C2H2-like (1);	0.000000	0.64402	D	0.000002	T	0.78065	0.4225	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77381	-0.2609	8	.	.	.	-22.82	18.5186	0.90943	0.0:1.0:0.0:0.0	.	704	Q6IQ32	ADNP2_HUMAN	L	704	.	.	P	+	2	0	ADNP2	75996398	1.000000	0.71417	0.592000	0.28758	0.046000	0.14306	6.685000	0.74543	2.606000	0.88127	0.585000	0.79938	CCG		0.552	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913	
CACNA1A	773	broad.mit.edu	37	19	13340931	13340931	+	Silent	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:13340931G>A	ENST00000360228.5	-	36	5492	c.5493C>T	c.(5491-5493)taC>taT	p.Y1831Y	CACNA1A_ENST00000573710.2_Silent_p.Y1832Y|CACNA1A_ENST00000574822.1_5'UTR	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1832					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.Y1832Y(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	AGACACGCACGTACTCATCCA	0.577																																					p.R1833C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C5497T	19						.						72.0	80.0	78.0					19																	13340931		2089	4241	6330	13201931	SO:0001819	synonymous_variant	773	exon36			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5493C>T	19.37:g.13340931G>A		Somatic		Capture	Illumina HiSeq	Phase_I	13201931	NM_001174080	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																				0.577	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
OR7A10	390892	broad.mit.edu	37	19	14952086	14952086	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:14952086C>A	ENST00000248058.1	-	1	603	c.604G>T	c.(604-606)Gca>Tca	p.A202S		NM_001005190.1	NP_001005190.1	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A, member 10	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A202S(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|stomach(1)	19	Ovarian(108;0.203)					AGCGCTACTGCAAAATACATC	0.453																																					p.A202S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G604T	19						.						63.0	61.0	62.0					19																	14952086		2203	4300	6503	14813086	SO:0001583	missense	390892	exon1				CCDS32936.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8356	protein-coding gene	gene with protein product							Standard	NM_001005190		Approved		uc002mzx.1	O76100		ENST00000248058.1:c.604G>T	19.37:g.14952086C>A	ENSP00000248058:p.Ala202Ser	Somatic		Capture	Illumina HiSeq	Phase_I	14813086	NM_001005190	Q6IFP0|Q96R97	Missense_Mutation	SNP	ENST00000248058.1	37	CCDS32936.1	.	.	.	.	.	.	.	.	.	.	c	1.926	-0.447055	0.04572	.	.	ENSG00000127515	ENST00000248058	T	0.00137	8.68	2.75	-2.55	0.06288	GPCR, rhodopsin-like superfamily (1);	1.586400	0.04606	N	0.399461	T	0.00109	0.0003	N	0.16098	0.37	0.09310	N	1	B	0.22211	0.066	B	0.25614	0.062	T	0.10382	-1.0632	10	0.45353	T	0.12	.	2.3729	0.04335	0.3896:0.2622:0.0:0.3483	.	202	O76100	OR7AA_HUMAN	S	202	ENSP00000248058:A202S	ENSP00000248058:A202S	A	-	1	0	OR7A10	14813086	0.000000	0.05858	0.000000	0.03702	0.140000	0.21249	-1.964000	0.01512	-0.247000	0.09597	0.134000	0.15878	GCA		0.453	OR7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466520.1	NM_001005190	
HAPLN4	404037	broad.mit.edu	37	19	19371814	19371814	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:19371814C>T	ENST00000291481.7	-	3	355	c.292G>A	c.(292-294)Gtc>Atc	p.V98I	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	98	Ig-like C2-type.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.V98I(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	GCCACGAAGACGTCGGTGAAG	0.697																																					p.V98I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G292A	19						.						52.0	54.0	54.0					19																	19371814		2203	4299	6502	19232814	SO:0001583	missense	404037	exon3			AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.292G>A	19.37:g.19371814C>T	ENSP00000291481:p.Val98Ile	Somatic		Capture	Illumina HiSeq	Phase_I	19232814	NM_023002	A5PKW5|Q96PW2	Missense_Mutation	SNP	ENST00000291481.7	37	CCDS12398.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928041	0.92389	.	.	ENSG00000187664	ENST00000291481	T	0.66460	-0.21	4.52	4.52	0.55395	Immunoglobulin V-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.74974	0.3787	L	0.57130	1.785	0.43830	D	0.996403	D	0.76494	0.999	P	0.61874	0.895	T	0.72197	-0.4363	10	0.27082	T	0.32	-42.3238	14.7558	0.69564	0.0:1.0:0.0:0.0	.	98	Q86UW8	HPLN4_HUMAN	I	98	ENSP00000291481:V98I	ENSP00000291481:V98I	V	-	1	0	HAPLN4	19232814	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.140000	0.77322	2.334000	0.79466	0.561000	0.74099	GTC		0.697	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460117.2	NM_023002	
TSHZ3	57616	broad.mit.edu	37	19	31768415	31768415	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:31768415C>A	ENST00000240587.4	-	2	2611	c.2284G>T	c.(2284-2286)Gct>Tct	p.A762S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	762					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A579S(1)|p.A762S(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GTGGCCACAGCAGCCTTCTCC	0.597																																					p.A762S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2284T	19						.						64.0	64.0	64.0					19																	31768415		2203	4300	6503	36460255	SO:0001583	missense	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2284G>T	19.37:g.31768415C>A	ENSP00000240587:p.Ala762Ser	Somatic		Capture	Illumina HiSeq	Phase_I	36460255	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234900	0.39498	.	.	ENSG00000121297	ENST00000240587	T	0.38887	1.11	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.41465	0.1160	L	0.43152	1.355	0.80722	D	1	P	0.46987	0.888	B	0.42163	0.378	T	0.29882	-0.9997	10	0.42905	T	0.14	-21.2116	19.1085	0.93307	0.0:1.0:0.0:0.0	.	762	Q63HK5	TSH3_HUMAN	S	762	ENSP00000240587:A762S	ENSP00000240587:A762S	A	-	1	0	TSHZ3	36460255	1.000000	0.71417	0.862000	0.33874	0.252000	0.25951	7.461000	0.80834	2.501000	0.84356	0.655000	0.94253	GCT		0.597	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
FEM1A	55527	broad.mit.edu	37	19	4793598	4793598	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:4793598G>A	ENST00000269856.3	+	1	1871	c.1732G>A	c.(1732-1734)Gat>Aat	p.D578N	AC005523.2_ENST00000596170.1_RNA|AC005523.2_ENST00000601192.1_RNA|AC005523.3_ENST00000598782.1_lincRNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	578					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)	p.D578N(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		GGACAGCAGGGATTTTGACAA	0.612																																					p.D578N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1732A	19						.						58.0	54.0	56.0					19																	4793598		2203	4300	6503	4744598	SO:0001583	missense	55527	exon1			BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.1732G>A	19.37:g.4793598G>A	ENSP00000269856:p.Asp578Asn	Somatic		Capture	Illumina HiSeq	Phase_I	4744598	NM_018708	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Missense_Mutation	SNP	ENST00000269856.3	37	CCDS12135.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464952	0.84425	.	.	ENSG00000141965	ENST00000269856	T	0.74842	-0.88	4.92	4.92	0.64577	Ankyrin repeat-containing domain (4);	0.000000	0.85682	U	0.000000	T	0.80396	0.4615	L	0.43701	1.375	0.80722	D	1	D	0.60160	0.987	D	0.63381	0.914	T	0.78214	-0.2291	10	0.30854	T	0.27	-23.6231	18.1288	0.89595	0.0:0.0:1.0:0.0	.	578	Q9BSK4	FEM1A_HUMAN	N	578	ENSP00000269856:D578N	ENSP00000269856:D578N	D	+	1	0	FEM1A	4744598	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.634000	0.98435	2.264000	0.75181	0.491000	0.48974	GAT		0.612	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1		
ATP4A	495	broad.mit.edu	37	19	36049521	36049521	+	Silent	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:36049521G>A	ENST00000262623.3	-	9	1351	c.1323C>T	c.(1321-1323)cgC>cgT	p.R441R		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	441					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.R441R(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	TGAAGGCGGCGCGGTTGCACA	0.701																																					p.R441R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1323T	19						.						13.0	14.0	14.0					19																	36049521		2199	4294	6493	40741361	SO:0001819	synonymous_variant	495	exon9				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.1323C>T	19.37:g.36049521G>A		Somatic		Capture	Illumina HiSeq	Phase_I	40741361	NM_000704	O00738	Silent	SNP	ENST00000262623.3	37	CCDS12467.1																																																																																				0.701	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
PSG7	5676	broad.mit.edu	37	19	43433832	43433832	+	RNA	SNP	G	G	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:43433832G>T	ENST00000406070.2	-	0	567				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				CCTCCCTGGGGTTGAAATTGC	0.532																																					p.N157K												.	.	0			c.C471A	19						.						175.0	176.0	176.0					19																	43433832		2201	4300	6501	48125672			5676	exon3					19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43433832G>T		Somatic		Capture	Illumina HiSeq	Phase_I	48125672	NM_002783	Q15232	Missense_Mutation	SNP	ENST00000406070.2	37																																																																																					0.532	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650	
PPP2R1A	5518	broad.mit.edu	37	19	52716329	52716329	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:52716329G>A	ENST00000322088.6	+	6	831	c.773G>A	c.(772-774)cGc>cAc	p.R258H	PPP2R1A_ENST00000444322.2_Missense_Mutation_p.R203H|PPP2R1A_ENST00000462990.1_Missense_Mutation_p.R79H	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	258	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.			R -> A (in Ref. 2; AAA36399). {ECO:0000305}.	apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.R258H(5)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		AAGTCCTGGCGCGTCCGCTAC	0.602			Mis		clear cell ovarian carcinoma																																p.R258H			Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	.	5	Substitution - Missense(5)	endometrium(3)|large_intestine(1)|lung(1)	c.G773A	19						.						45.0	41.0	42.0					19																	52716329		2203	4300	6503	57408141	SO:0001583	missense	5518	exon6				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.773G>A	19.37:g.52716329G>A	ENSP00000324804:p.Arg258His	Somatic		Capture	Illumina HiSeq	Phase_I	57408141	NM_014225	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.910787	0.92178	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.06371	3.31;3.31	4.48	4.48	0.54585	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.53938	D	0.000042	T	0.33118	0.0852	H	0.94620	3.56	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.997;0.997	D;B;B	0.65010	0.931;0.438;0.438	T	0.48352	-0.9043	10	0.87932	D	0	-12.8578	15.0762	0.72080	0.0:0.0:1.0:0.0	.	203;258;258	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	H	248;178;258;203	ENSP00000324804:R258H;ENSP00000415067:R203H	ENSP00000324804:R258H	R	+	2	0	PPP2R1A	57408141	1.000000	0.71417	0.961000	0.40146	0.965000	0.64279	8.389000	0.90172	2.490000	0.84030	0.655000	0.94253	CGC		0.602	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
RANBP3	8498	broad.mit.edu	37	19	5941695	5941695	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:5941695A>G	ENST00000340578.6	-	5	400	c.343T>C	c.(343-345)Tac>Cac	p.Y115H	RANBP3_ENST00000439268.2_Missense_Mutation_p.Y115H|RANBP3_ENST00000541471.1_Intron|RANBP3_ENST00000591092.1_Missense_Mutation_p.Y47H|RANBP3_ENST00000034275.8_Missense_Mutation_p.Y47H|RANBP3_ENST00000591124.1_5'UTR	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	115					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)	p.Y115H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						GGAGGGCAGTAATTTCCATCT	0.413																																					p.Y115H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T343C	19						.						172.0	163.0	166.0					19																	5941695		1933	4135	6068	5892695	SO:0001583	missense	8498	exon5			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.343T>C	19.37:g.5941695A>G	ENSP00000341483:p.Tyr115His	Somatic		Capture	Illumina HiSeq	Phase_I	5892695	NM_003624	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	ENST00000340578.6	37	CCDS42478.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.289043	0.80914	.	.	ENSG00000031823	ENST00000340578;ENST00000439268;ENST00000034275;ENST00000324807	T;T;T	0.39592	1.09;1.07;1.82	5.26	5.26	0.73747	.	0.119998	0.64402	D	0.000016	T	0.49609	0.1567	L	0.32530	0.975	0.80722	D	1	D;D;D;D	0.69078	0.995;0.997;0.983;0.983	P;D;P;P	0.65987	0.873;0.94;0.851;0.713	T	0.40905	-0.9538	10	0.30078	T	0.28	-15.4906	13.15	0.59484	1.0:0.0:0.0:0.0	.	47;47;115;115	B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.;.;.;RANB3_HUMAN	H	115;115;47;46	ENSP00000341483:Y115H;ENSP00000404837:Y115H;ENSP00000034275:Y47H	ENSP00000034275:Y47H	Y	-	1	0	RANBP3	5892695	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.018000	0.70811	1.996000	0.58369	0.533000	0.62120	TAC		0.413	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322	
ZNF320	162967	broad.mit.edu	37	19	53384812	53384812	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:53384812G>T	ENST00000595635.1	-	8	1068	c.567C>A	c.(565-567)taC>taA	p.Y189*	ZNF320_ENST00000391781.2_Nonsense_Mutation_p.Y189*|ZNF320_ENST00000600930.1_Intron|ZNF320_ENST00000597909.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	189					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y189*(1)		NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		CCTTACATTTGTATGGTTTCT	0.363																																					p.Y189X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C567A	19						.						75.0	71.0	72.0					19																	53384812		2203	4300	6503	58076624	SO:0001587	stop_gained	162967	exon4			AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.567C>A	19.37:g.53384812G>T	ENSP00000473091:p.Tyr189*	Somatic		Capture	Illumina HiSeq	Phase_I	58076624	NM_207333	Q8NDR6	Nonsense_Mutation	SNP	ENST00000595635.1	37	CCDS33095.1	.	.	.	.	.	.	.	.	.	.	-	15.87	2.959527	0.53400	.	.	ENSG00000182986	ENST00000391781	.	.	.	1.75	-2.23	0.06930	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.394	0.26926	0.3886:0.0:0.6114:0.0	.	.	.	.	X	189	.	ENSP00000375660:Y189X	Y	-	3	2	ZNF320	58076624	0.000000	0.05858	0.003000	0.11579	0.270000	0.26580	-0.331000	0.07914	-0.338000	0.08413	0.194000	0.17425	TAC		0.363	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1	NM_207333	
NLRP5	126206	broad.mit.edu	37	19	56538391	56538391	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:56538391A>T	ENST00000390649.3	+	7	792	c.792A>T	c.(790-792)caA>caT	p.Q264H		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	264					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.Q264H(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CGGAAATGCAAACGTTGGCTG	0.527																																					p.Q264H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A792T	19						.						61.0	61.0	61.0					19																	56538391		1989	4083	6072	61230203	SO:0001583	missense	126206	exon7			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.792A>T	19.37:g.56538391A>T	ENSP00000375063:p.Gln264His	Somatic		Capture	Illumina HiSeq	Phase_I	61230203	NM_153447	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	A	4.933	0.173394	0.09391	.	.	ENSG00000171487	ENST00000390649	T	0.72942	-0.7	3.45	-2.8	0.05823	.	0.693619	0.11942	N	0.514558	T	0.42630	0.1211	N	0.08118	0	0.09310	N	1	B	0.17852	0.024	B	0.11329	0.006	T	0.15435	-1.0437	10	0.36615	T	0.2	.	4.7719	0.13160	0.3295:0.3566:0.3139:0.0	.	264	P59047	NALP5_HUMAN	H	264	ENSP00000375063:Q264H	ENSP00000375063:Q264H	Q	+	3	2	NLRP5	61230203	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.685000	0.05167	-0.786000	0.04516	-1.209000	0.01634	CAA		0.527	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
VAV1	7409	broad.mit.edu	37	19	6829894	6829894	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:6829894C>T	ENST00000602142.1	+	14	1445	c.1363C>T	c.(1363-1365)Cgg>Tgg	p.R455W	VAV1_ENST00000596764.1_Missense_Mutation_p.R423W|VAV1_ENST00000539284.1_Missense_Mutation_p.R358W|VAV1_ENST00000304076.2_Missense_Mutation_p.R455W|VAV1_ENST00000599806.1_Missense_Mutation_p.R400W	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	455	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R455W(1)		biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CTTCCAGGTTCGGGATGACTC	0.552																																					p.R455W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1363T	19						.						129.0	110.0	117.0					19																	6829894		2203	4300	6503	6780894	SO:0001583	missense	7409	exon14				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1363C>T	19.37:g.6829894C>T	ENSP00000472929:p.Arg455Trp	Somatic		Capture	Illumina HiSeq	Phase_I	6780894	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791878	0.70452	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.77489	-1.1;-1.1	4.92	4.92	0.64577	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000002	D	0.85818	0.5785	L	0.57536	1.79	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.986;0.991	D	0.86965	0.2094	10	0.66056	D	0.02	.	15.9747	0.80054	0.0:1.0:0.0:0.0	.	358;455;400;455	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	W	455;358	ENSP00000302269:R455W;ENSP00000443242:R358W	ENSP00000302269:R455W	R	+	1	2	VAV1	6780894	0.761000	0.28439	1.000000	0.80357	0.664000	0.39144	0.963000	0.29293	2.444000	0.82710	0.655000	0.94253	CGG		0.552	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
PEG3	5178	broad.mit.edu	37	19	57328158	57328158	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr19:57328158C>A	ENST00000326441.9	-	10	2015	c.1652G>T	c.(1651-1653)aGt>aTt	p.S551I	ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.S551I|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.S425I|PEG3_ENST00000598410.1_Missense_Mutation_p.S427I|ZIM2_ENST00000593711.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	551					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S551I(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CTGAAGCTCACTAAAGGTGGG	0.453																																					p.S551I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1652T	19						.						150.0	143.0	145.0					19																	57328158		2203	4300	6503	62019970	SO:0001583	missense	5178	exon7			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1652G>T	19.37:g.57328158C>A	ENSP00000326581:p.Ser551Ile	Somatic		Capture	Illumina HiSeq	Phase_I	62019970	NM_001146186	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	12.32	1.901382	0.33535	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02631	4.22;4.22	4.14	1.98	0.26296	.	0.242445	0.29707	N	0.011413	T	0.08088	0.0202	M	0.64997	1.995	.	.	.	P;D;D	0.76494	0.718;0.998;0.999	B;D;D	0.83275	0.246;0.991;0.996	T	0.25433	-1.0132	9	0.21014	T	0.42	-9.8706	4.2151	0.10530	0.0:0.5732:0.2175:0.2093	.	427;551;486	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	I	551	ENSP00000326581:S551I;ENSP00000403051:S551I	ENSP00000326581:S551I	S	-	2	0	ZIM2	62019970	0.000000	0.05858	0.505000	0.27651	0.604000	0.37047	-0.588000	0.05774	0.685000	0.31468	-0.219000	0.12488	AGT		0.453	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
ADAR	103	broad.mit.edu	37	1	154574478	154574478	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr1:154574478C>T	ENST00000368474.4	-	2	839	c.640G>A	c.(640-642)Gac>Aac	p.D214N	ADAR_ENST00000368471.3_5'UTR|ADAR_ENST00000471068.1_5'Flank|ADAR_ENST00000292205.5_Missense_Mutation_p.D257N	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	214					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.D214N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		CTATGACCGTCTGGTCTTACC	0.517																																					p.D214N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G640A	1						.						94.0	99.0	97.0					1																	154574478		2203	4300	6503	152841102	SO:0001583	missense	103	exon2			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.640G>A	1.37:g.154574478C>T	ENSP00000357459:p.Asp214Asn	Somatic		Capture	Illumina HiSeq	Phase_I	152841102	NM_015841	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	C	7.069	0.567865	0.13560	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000529168	T;T;T	0.13420	2.59;2.6;2.62	2.54	1.58	0.23477	.	1.816150	0.03411	N	0.204721	T	0.03178	0.0093	L	0.43923	1.385	0.09310	N	1	B;B;B	0.31125	0.288;0.288;0.309	B;B;B	0.27380	0.079;0.079;0.039	T	0.35724	-0.9777	10	0.06757	T	0.87	-6.1474	8.5287	0.33321	0.2329:0.7671:0.0:0.0	.	214;214;214	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	N	257;214;209	ENSP00000292205:D257N;ENSP00000357459:D214N;ENSP00000431794:D209N	ENSP00000292205:D257N	D	-	1	0	ADAR	152841102	0.001000	0.12720	0.002000	0.10522	0.031000	0.12232	1.186000	0.32078	0.581000	0.29539	0.313000	0.20887	GAC		0.517	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
IGSF21	84966	broad.mit.edu	37	1	18703331	18703331	+	Missense_Mutation	SNP	G	G	A	rs201284891		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr1:18703331G>A	ENST00000251296.1	+	8	1522	c.1139G>A	c.(1138-1140)cGg>cAg	p.R380Q	IGSF21_ENST00000473951.1_3'UTR	NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	380	Ig-like 2.					extracellular region (GO:0005576)		p.R380Q(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		ACGTGGACGCGGGTTGGGAGC	0.642																																					p.R380Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1139A	1						.						46.0	47.0	47.0					1																	18703331		2203	4300	6503	18575918	SO:0001583	missense	84966	exon8			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.1139G>A	1.37:g.18703331G>A	ENSP00000251296:p.Arg380Gln	Somatic		Capture	Illumina HiSeq	Phase_I	18575918	NM_032880	Q8NBR8	Missense_Mutation	SNP	ENST00000251296.1	37	CCDS184.1	.	.	.	.	.	.	.	.	.	.	G	31	5.091823	0.94149	.	.	ENSG00000117154	ENST00000251296	T	0.12879	2.64	5.31	5.31	0.75309	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.067227	0.64402	D	0.000010	T	0.20659	0.0497	M	0.82193	2.58	0.58432	D	0.999999	B	0.33612	0.419	B	0.21151	0.033	T	0.04065	-1.0980	10	0.46703	T	0.11	-13.8719	17.5256	0.87799	0.0:0.0:1.0:0.0	.	380	Q96ID5	IGS21_HUMAN	Q	380	ENSP00000251296:R380Q	ENSP00000251296:R380Q	R	+	2	0	IGSF21	18575918	1.000000	0.71417	0.979000	0.43373	0.942000	0.58702	7.491000	0.81471	2.460000	0.83146	0.591000	0.81541	CGG		0.642	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880	
TAS1R2	80834	broad.mit.edu	37	1	19181040	19181040	+	Silent	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr1:19181040C>T	ENST00000375371.3	-	3	945	c.924G>A	c.(922-924)ccG>ccA	p.P308P	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	308					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.P308P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TGTGCAGGACCGGGTCGATGG	0.642																																					p.P308P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G924A	1						.						54.0	53.0	53.0					1																	19181040		2203	4300	6503	19053627	SO:0001819	synonymous_variant	80834	exon3				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.924G>A	1.37:g.19181040C>T		Somatic		Capture	Illumina HiSeq	Phase_I	19053627	NM_152232	Q5TZ19	Silent	SNP	ENST00000375371.3	37	CCDS187.1																																																																																				0.642	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
OR6K3	391114	broad.mit.edu	37	1	158687131	158687131	+	Missense_Mutation	SNP	A	A	C	rs371617141		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr1:158687131A>C	ENST00000368146.1	-	1	822	c.823T>G	c.(823-825)Ttg>Gtg	p.L275V	OR6K3_ENST00000368145.1_Missense_Mutation_p.L259V			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L275V(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					CTGAAACGCAAGTACATGAGT	0.463																																					p.L259V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T775G	1						.						149.0	129.0	136.0					1																	158687131		2203	4300	6503	156953755	SO:0001583	missense	391114	exon1			AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.823T>G	1.37:g.158687131A>C	ENSP00000357128:p.Leu275Val	Somatic		Capture	Illumina HiSeq	Phase_I	156953755	NM_001005327	Q5VUV0|Q6IFR5	Missense_Mutation	SNP	ENST00000368146.1	37		.	.	.	.	.	.	.	.	.	.	A	3.786	-0.044731	0.07452	.	.	ENSG00000203757	ENST00000368145;ENST00000368146	T;T	0.39787	1.06;1.06	3.77	-7.03	0.01584	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.21145	0.0509	L	0.31578	0.945	0.09310	N	1	D	0.76494	0.999	D	0.79784	0.993	T	0.26430	-1.0103	9	0.07325	T	0.83	.	11.1424	0.48411	0.2662:0.0:0.6266:0.1072	.	275	Q8NGY3	OR6K3_HUMAN	V	259;275	ENSP00000357127:L259V;ENSP00000357128:L275V	ENSP00000357127:L259V	L	-	1	2	OR6K3	156953755	0.000000	0.05858	0.000000	0.03702	0.209000	0.24338	-3.859000	0.00348	-1.710000	0.01397	0.383000	0.25322	TTG		0.463	OR6K3-201	KNOWN	basic	protein_coding	protein_coding			
KCNH1	3756	broad.mit.edu	37	1	210856831	210856831	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr1:210856831G>A	ENST00000271751.4	-	11	2789	c.2762C>T	c.(2761-2763)aCg>aTg	p.T921M	KCNH1_ENST00000367007.4_Missense_Mutation_p.T894M			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	921					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.T921M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GGCCTGCAGCGTCTGCTCAGG	0.562																																					p.T894M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2681T	1						.						70.0	60.0	63.0					1																	210856831		2203	4300	6503	208923454	SO:0001583	missense	3756	exon11			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2762C>T	1.37:g.210856831G>A	ENSP00000271751:p.Thr921Met	Somatic		Capture	Illumina HiSeq	Phase_I	208923454	NM_002238	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.330186	0.60743	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98968	-5.23;-5.28	5.07	5.07	0.68467	.	0.097739	0.64402	D	0.000001	D	0.97558	0.9200	L	0.34521	1.04	0.43729	D	0.99621	D;P	0.57257	0.979;0.933	P;B	0.50082	0.63;0.34	D	0.98214	1.0474	10	0.54805	T	0.06	.	18.462	0.90741	0.0:0.0:1.0:0.0	.	894;921	Q14CL3;O95259	.;KCNH1_HUMAN	M	921;894	ENSP00000271751:T921M;ENSP00000355974:T894M	ENSP00000271751:T921M	T	-	2	0	KCNH1	208923454	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.976000	0.63785	2.360000	0.80028	0.655000	0.94253	ACG		0.562	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
CENPF	1063	broad.mit.edu	37	1	214814979	214814979	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr1:214814979A>G	ENST00000366955.3	+	12	3466	c.3298A>G	c.(3298-3300)Atg>Gtg	p.M1100V		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.M1100V(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TCAGAATCTGATGCTAGAGTT	0.383																																					p.M1100V	Colon(80;575 1284 11000 14801 43496)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3298G	1						.						73.0	74.0	74.0					1																	214814979		2203	4300	6503	212881602	SO:0001583	missense	1063	exon12			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3298A>G	1.37:g.214814979A>G	ENSP00000355922:p.Met1100Val	Somatic		Capture	Illumina HiSeq	Phase_I	212881602	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.378800	0.00205	.	.	ENSG00000117724	ENST00000366955	T	0.02787	4.16	4.92	-4.14	0.03892	.	1.117940	0.06873	N	0.801189	T	0.01454	0.0047	.	.	.	0.09310	N	1	B	0.15930	0.015	B	0.06405	0.002	T	0.49716	-0.8910	9	0.09084	T	0.74	.	7.7867	0.29095	0.3854:0.215:0.3996:0.0	.	1100	P49454	CENPF_HUMAN	V	1100	ENSP00000355922:M1100V	ENSP00000355922:M1100V	M	+	1	0	CENPF	212881602	0.000000	0.05858	0.000000	0.03702	0.095000	0.18619	-0.823000	0.04443	-1.035000	0.03291	-0.320000	0.08662	ATG		0.383	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
OBSCN	84033	broad.mit.edu	37	1	228474603	228474603	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr1:228474603G>A	ENST00000422127.1	+	35	9451	c.9407G>A	c.(9406-9408)cGg>cAg	p.R3136Q	OBSCN_ENST00000366707.4_Missense_Mutation_p.R255Q|OBSCN_ENST00000284548.11_Missense_Mutation_p.R3136Q|OBSCN_ENST00000570156.2_Missense_Mutation_p.R3565Q|OBSCN_ENST00000366709.4_Missense_Mutation_p.R255Q|OBSCN_ENST00000359599.6_Missense_Mutation_p.R1983Q	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3136	Ig-like 31.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.R3190Q(1)|p.R3419Q(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AAGACCCTGCGGGGGTCTGCC	0.637																																					p.R3136Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G9407A	1						.						30.0	35.0	34.0					1																	228474603		1990	4149	6139	226541226	SO:0001583	missense	84033	exon35			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.9407G>A	1.37:g.228474603G>A	ENSP00000409493:p.Arg3136Gln	Somatic		Capture	Illumina HiSeq	Phase_I	226541226	NM_052843	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	18.70	3.679220	0.68042	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	5.17	5.17	0.71159	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.070001	0.53938	D	0.000041	T	0.63319	0.2501	L	0.42744	1.35	0.34006	D	0.650889	P;D	0.55172	0.66;0.97	B;P	0.47162	0.19;0.54	T	0.65487	-0.6156	10	0.11485	T	0.65	.	17.8266	0.88667	0.0:0.0:1.0:0.0	.	3136;3136	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	Q	3136;3136;255;255;1983	ENSP00000284548:R3136Q;ENSP00000409493:R3136Q;ENSP00000355668:R255Q;ENSP00000355670:R255Q;ENSP00000352613:R1983Q	ENSP00000284548:R3136Q	R	+	2	0	OBSCN	226541226	1.000000	0.71417	0.509000	0.27700	0.004000	0.04260	2.557000	0.45871	2.681000	0.91329	0.561000	0.74099	CGG		0.637	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
GRIK3	2899	broad.mit.edu	37	1	37307519	37307519	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr1:37307519G>A	ENST00000373091.3	-	10	1364	c.1348C>T	c.(1348-1350)Cgg>Tgg	p.R450W	GRIK3_ENST00000373093.4_Missense_Mutation_p.R450W	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	450					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.R450W(2)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				TCTGATTTCCGAAACATGACG	0.567																																					p.R450W												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1348T	1						.						142.0	131.0	135.0					1																	37307519		2203	4300	6503	37080106	SO:0001583	missense	2899	exon10			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1348C>T	1.37:g.37307519G>A	ENSP00000362183:p.Arg450Trp	Somatic		Capture	Illumina HiSeq	Phase_I	37080106	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.061139	0.55432	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.11930	2.73;2.73	4.95	4.03	0.46877	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.063724	0.64402	D	0.000006	T	0.35856	0.0946	M	0.80183	2.485	0.40728	D	0.982729	D;D	0.89917	1.0;1.0	D;D	0.63597	0.916;0.916	T	0.35025	-0.9805	10	0.87932	D	0	.	12.6274	0.56638	0.0:0.0:0.5737:0.4262	.	450;450	A9Z1Z8;Q13003	.;GRIK3_HUMAN	W	450	ENSP00000362183:R450W;ENSP00000362185:R450W	ENSP00000362183:R450W	R	-	1	2	GRIK3	37080106	1.000000	0.71417	1.000000	0.80357	0.446000	0.32137	3.851000	0.55926	1.195000	0.43115	0.655000	0.94253	CGG		0.567	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
RPE65	6121	broad.mit.edu	37	1	68910517	68910517	+	Missense_Mutation	SNP	C	C	T	rs62642583|rs143056561	byFrequency	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr1:68910517C>T	ENST00000262340.5	-	4	348	c.295G>A	c.(295-297)Gtc>Atc	p.V99I		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	99			V -> I (found in a patient with LCA2; uncertain pathological significance). {ECO:0000269|PubMed:21602930}.		cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)	p.V99I(2)		central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						TCTGTTATGACGATCCTTTTC	0.418													C|||	6	0.00119808	0.0	0.0	5008	,	,		18969	0.006		0.0	False		,,,				2504	0.0				p.V99I												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G295A	1						.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	99.0	93.0	95.0		295	4.9	1.0	1	dbSNP_134	95	0,8600		0,0,4300	no	missense	RPE65	NM_000329.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	99/534	68910517	1,13005	2203	4300	6503	68683105	SO:0001583	missense	6121	exon4			U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.295G>A	1.37:g.68910517C>T	ENSP00000262340:p.Val99Ile	Somatic		Capture	Illumina HiSeq	Phase_I	68683105	NM_000329	A8K1L0|Q5T9U3	Missense_Mutation	SNP	ENST00000262340.5	37	CCDS643.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	19.84	3.901362	0.72754	2.27E-4	0.0	ENSG00000116745	ENST00000262340	D	0.95137	-3.62	4.88	4.88	0.63580	.	0.165641	0.53938	D	0.000059	D	0.91573	0.7338	M	0.65975	2.015	0.80722	D	1	B	0.22909	0.077	B	0.24155	0.051	D	0.89404	0.3698	10	0.45353	T	0.12	-5.1559	18.2168	0.89889	0.0:1.0:0.0:0.0	.	99	Q16518	RPE65_HUMAN	I	99	ENSP00000262340:V99I	ENSP00000262340:V99I	V	-	1	0	RPE65	68683105	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.320000	0.79064	2.545000	0.85829	0.655000	0.94253	GTC		0.418	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329	
OR2M4	26245	broad.mit.edu	37	1	248403107	248403107	+	Missense_Mutation	SNP	C	C	T	rs531102387		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr1:248403107C>T	ENST00000306687.1	+	1	877	c.877C>T	c.(877-879)Cgc>Tgc	p.R293C		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	293					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R293C(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TTATAGCCTCCGCAACAAAGA	0.438													c|||	1	0.000199681	0.0	0.0	5008	,	,		18194	0.001		0.0	False		,,,				2504	0.0				p.R293C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C877T	1						.						79.0	73.0	75.0					1																	248403107		2203	4300	6503	246469730	SO:0001583	missense	26245	exon1			X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.877C>T	1.37:g.248403107C>T	ENSP00000306688:p.Arg293Cys	Somatic		Capture	Illumina HiSeq	Phase_I	246469730	NM_017504	Q15611|Q8NG82	Missense_Mutation	SNP	ENST00000306687.1	37	CCDS31108.1	.	.	.	.	.	.	.	.	.	.	c	8.596	0.885645	0.17540	.	.	ENSG00000171180	ENST00000306687	T	0.40476	1.03	3.34	-0.264	0.12950	.	0.000000	0.37304	N	0.002142	T	0.50888	0.1642	H	0.98027	4.13	0.09310	N	1	B	0.25667	0.131	B	0.21151	0.033	T	0.56080	-0.8038	10	0.72032	D	0.01	.	3.39	0.07285	0.4765:0.2975:0.0:0.2259	.	293	Q96R27	OR2M4_HUMAN	C	293	ENSP00000306688:R293C	ENSP00000306688:R293C	R	+	1	0	OR2M4	246469730	0.000000	0.05858	0.070000	0.20053	0.811000	0.45836	0.091000	0.15046	0.175000	0.19841	0.543000	0.68304	CGC		0.438	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	NM_017504	
MACROD2	140733	broad.mit.edu	37	20	13976423	13976423	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr20:13976423A>G	ENST00000310348.4	+	1	14	c.14A>G	c.(13-15)aAc>aGc	p.N5S	SEL1L2_ENST00000486903.1_5'Flank|MACROD2_ENST00000217246.4_Missense_Mutation_p.N5S			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	5					brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.N5S(1)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				TACCCCAGCAACAAGAAGAAA	0.637																																					p.N5S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A14G	20						.						43.0	37.0	39.0					20																	13976423		2203	4300	6503	13924423	SO:0001583	missense	140733	exon1			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.14A>G	20.37:g.13976423A>G	ENSP00000309809:p.Asn5Ser	Somatic		Capture	Illumina HiSeq	Phase_I	13924423	NM_080676	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	A	11.67	1.706910	0.30232	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	T;T	0.48522	0.81;0.81	4.65	3.51	0.40186	.	0.266895	0.36268	N	0.002693	T	0.38931	0.1059	L	0.31294	0.92	0.80722	D	1	P;P	0.48162	0.849;0.906	B;P	0.49085	0.396;0.6	T	0.07868	-1.0750	10	0.14656	T	0.56	-8.8733	9.4008	0.38431	0.8401:0.0:0.0:0.1599	.	5;5	A1Z1Q3;A1Z1Q3-2	MACD2_HUMAN;.	S	5	ENSP00000217246:N5S;ENSP00000309809:N5S	ENSP00000217246:N5S	N	+	2	0	MACROD2	13924423	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.904000	0.48719	0.758000	0.33059	0.383000	0.25322	AAC		0.637	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	
PPP1R16B	26051	broad.mit.edu	37	20	37547041	37547041	+	Missense_Mutation	SNP	C	C	T	rs201345539		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr20:37547041C>T	ENST00000299824.1	+	11	1625	c.1436C>T	c.(1435-1437)aCg>aTg	p.T479M	PPP1R16B_ENST00000373331.2_Missense_Mutation_p.T437M	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	479					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)	p.T479M(1)		biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				AGCCCTCAGACGCTTCTGGAG	0.647																																					p.T437M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1310T	20						.						48.0	49.0	49.0					20																	37547041		2203	4300	6503	36980455	SO:0001583	missense	26051	exon10			AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.1436C>T	20.37:g.37547041C>T	ENSP00000299824:p.Thr479Met	Somatic		Capture	Illumina HiSeq	Phase_I	36980455	NM_001172735	A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Missense_Mutation	SNP	ENST00000299824.1	37	CCDS13309.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.4|24.4	4.523648|4.523648	0.85600|0.85600	.|.	.|.	ENSG00000101445|ENSG00000101445	ENST00000438192|ENST00000299824;ENST00000373331	.|D;D	.|0.87729	.|-1.81;-2.29	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92351|0.92351	0.7573|0.7573	M|M	0.64997|0.64997	1.995|1.995	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.92643|0.92643	0.6126|0.6126	5|10	.|0.56958	.|D	.|0.05	.|.	16.9091|16.9091	0.86136|0.86136	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|437;479	.|E9PFS8;Q96T49	.|.;PP16B_HUMAN	C|M	380|479;437	.|ENSP00000299824:T479M;ENSP00000362428:T437M	.|ENSP00000299824:T479M	R|T	+|+	1|2	0|0	PPP1R16B|PPP1R16B	36980455|36980455	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	6.732000|6.732000	0.74790|0.74790	2.417000|2.417000	0.82017|0.82017	0.655000|0.655000	0.94253|0.94253	CGC|ACG		0.647	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079220.2	NM_015568	
NCOA5	57727	broad.mit.edu	37	20	44692145	44692145	+	Missense_Mutation	SNP	C	C	T	rs35315891		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr20:44692145C>T	ENST00000290231.6	-	7	1168	c.1004G>A	c.(1003-1005)cGt>cAt	p.R335H		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R335H(2)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				GTGGCCCCCACGCACTCCCTC	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		18207	0.0		0.001	False		,,,				2504	0.0				p.R335H												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G1004A	20						.	C	HIS/ARG	0,4406		0,0,2203	78.0	67.0	71.0		1004	5.4	0.1	20	dbSNP_126	71	4,8596	3.7+/-12.6	0,4,4296	yes	missense	NCOA5	NM_020967.2	29	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	probably-damaging	335/580	44692145	4,13002	2203	4300	6503	44125552	SO:0001583	missense	57727	exon7				CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.1004G>A	20.37:g.44692145C>T	ENSP00000290231:p.Arg335His	Somatic		Capture	Illumina HiSeq	Phase_I	44125552	NM_020967	B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Missense_Mutation	SNP	ENST00000290231.6	37	CCDS13392.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.96	2.986486	0.53934	0.0	4.65E-4	ENSG00000124160	ENST00000290231	T	0.50277	0.75	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000001	T	0.57359	0.2048	L	0.38175	1.15	0.23180	N	0.998163	D	0.89917	1.0	D	0.87578	0.998	T	0.51702	-0.8672	10	0.72032	D	0.01	-13.5924	11.7429	0.51803	0.0:0.9207:0.0:0.0793	rs35315891	335	Q9HCD5	NCOA5_HUMAN	H	335	ENSP00000290231:R335H	ENSP00000290231:R335H	R	-	2	0	NCOA5	44125552	0.985000	0.35326	0.073000	0.20177	0.856000	0.48823	7.651000	0.83577	2.816000	0.96949	0.561000	0.74099	CGT		0.582	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079559.1	NM_020967	
HAO1	54363	broad.mit.edu	37	20	7894842	7894842	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr20:7894842G>A	ENST00000378789.3	-	3	565	c.514C>T	c.(514-516)Cgt>Tgt	p.R172C		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	172	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.R172C(2)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						AATCTGTTACGCACATCATCC	0.532																																					p.R172C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C514T	20						.						188.0	131.0	151.0					20																	7894842		2203	4300	6503	7842842	SO:0001583	missense	54363	exon3			AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.514C>T	20.37:g.7894842G>A	ENSP00000368066:p.Arg172Cys	Somatic		Capture	Illumina HiSeq	Phase_I	7842842	NM_017545	Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	ENST00000378789.3	37	CCDS13100.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480420	0.84747	.	.	ENSG00000101323	ENST00000378789	T	0.38401	1.14	6.16	5.21	0.72293	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.044141	0.85682	D	0.000000	T	0.73528	0.3598	H	0.98068	4.14	0.80722	D	1	D;D	0.53619	0.961;0.961	D;D	0.63033	0.91;0.91	D	0.85025	0.0914	10	0.87932	D	0	-3.4352	16.9264	0.86177	0.0:0.0:0.8709:0.1291	.	172;172	A8K058;Q9UJM8	.;HAOX1_HUMAN	C	172	ENSP00000368066:R172C	ENSP00000368066:R172C	R	-	1	0	HAO1	7842842	1.000000	0.71417	0.988000	0.46212	0.776000	0.43924	7.587000	0.82613	1.597000	0.50072	0.650000	0.86243	CGT		0.532	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
ZBTB46	140685	broad.mit.edu	37	20	62421649	62421649	+	Silent	SNP	C	C	T	rs573566471		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr20:62421649C>T	ENST00000245663.4	-	2	612	c.462G>A	c.(460-462)acG>acA	p.T154T	ZBTB46_ENST00000480766.1_5'Flank|ZBTB46_ENST00000395104.1_Silent_p.T154T|ZBTB46_ENST00000302995.2_Silent_p.T154T	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	154					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.T154T(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					TGAGAGCTTCCGTGCTGCTGC	0.632													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21102	0.0		0.0	False		,,,				2504	0.0				p.T154T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G462A	20						.						31.0	28.0	29.0					20																	62421649		2203	4300	6503	61892093	SO:0001819	synonymous_variant	140685	exon2			AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.462G>A	20.37:g.62421649C>T		Somatic		Capture	Illumina HiSeq	Phase_I	61892093	NM_025224	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Silent	SNP	ENST00000245663.4	37	CCDS13538.1																																																																																				0.632	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224	
ETS2	2114	broad.mit.edu	37	21	40191440	40191440	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr21:40191440C>A	ENST00000360214.3	+	9	1285	c.825C>A	c.(823-825)gaC>gaA	p.D275E	ETS2_ENST00000360938.3_Missense_Mutation_p.D275E	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	275					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D275E(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				CTCCCAAAGACCACGACTCCC	0.557																																					p.D275E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C825A	21						.						76.0	68.0	71.0					21																	40191440		2203	4300	6503	39113310	SO:0001583	missense	2114	exon8				CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.825C>A	21.37:g.40191440C>A	ENSP00000353344:p.Asp275Glu	Somatic		Capture	Illumina HiSeq	Phase_I	39113310	NM_005239	A6NM68|D3DSH6|Q53Y89	Missense_Mutation	SNP	ENST00000360214.3	37	CCDS13659.1	.	.	.	.	.	.	.	.	.	.	C	7.248	0.602699	0.13939	.	.	ENSG00000157557	ENST00000360214;ENST00000360938	T;T	0.10192	2.9;2.9	5.9	-4.29	0.03721	.	0.613165	0.17743	N	0.163511	T	0.03390	0.0098	N	0.05414	-0.055	0.20196	N	0.999927	B	0.02656	0.0	B	0.01281	0.0	T	0.43572	-0.9383	10	0.02654	T	1	.	9.9915	0.41874	0.1324:0.2725:0.5306:0.0645	.	275	P15036	ETS2_HUMAN	E	275	ENSP00000353344:D275E;ENSP00000354194:D275E	ENSP00000353344:D275E	D	+	3	2	ETS2	39113310	0.002000	0.14202	0.044000	0.18714	0.271000	0.26615	-1.067000	0.03451	-0.423000	0.07394	0.650000	0.86243	GAC		0.557	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207544.1		
CBS	875	broad.mit.edu	37	21	44486463	44486463	+	Missense_Mutation	SNP	G	G	A	rs121964964		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr21:44486463G>A	ENST00000398165.3	-	5	600	c.341C>T	c.(340-342)gCg>gTg	p.A114V	CBS_ENST00000544202.1_Missense_Mutation_p.A26V|CBS_ENST00000352178.5_Missense_Mutation_p.A114V|CBS_ENST00000398158.1_Missense_Mutation_p.A114V|CBS_ENST00000470912.1_5'UTR|CBS_ENST00000359624.3_Missense_Mutation_p.A114V|CBS_ENST00000398168.1_Missense_Mutation_p.A114V	NM_000071.2	NP_000062.1	P35520	CBS_HUMAN	cystathionine-beta-synthase	114			A -> V (in CBSD; mild form; when linked with W-58 severe form; partial loss of activity; affects tetramer formation by promoting formation of larger aggregates). {ECO:0000269|PubMed:11359213, ECO:0000269|PubMed:8353501}.		cellular nitrogen compound metabolic process (GO:0034641)|cysteine biosynthetic process from serine (GO:0006535)|cysteine biosynthetic process via cystathionine (GO:0019343)|homocysteine catabolic process (GO:0043418)|homocysteine metabolic process (GO:0050667)|hydrogen sulfide biosynthetic process (GO:0070814)|L-cysteine catabolic process (GO:0019448)|L-serine catabolic process (GO:0006565)|L-serine metabolic process (GO:0006563)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|transsulfuration (GO:0019346)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenyl nucleotide binding (GO:0030554)|cystathionine beta-synthase activity (GO:0004122)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|modified amino acid binding (GO:0072341)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|ubiquitin protein ligase binding (GO:0031625)	p.A114V(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(8)	17					L-Cysteine(DB00151)|L-Serine(DB00133)|S-Adenosylmethionine(DB00118)	GCTCCCGCCCGCGTTGAAGAA	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		16027	0.0		0.001	False		,,,				2504	0.0				p.A114V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C341T	21	GRCh37	CM930080	CBS	M	rs121964964	.	G	VAL/ALA,VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	66.0	62.0	63.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	341,341,341	5.4	1.0	21	dbSNP_133	63	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense,missense	CBS	NM_000071.2,NM_001178008.1,NM_001178009.1	64,64,64	0,5,6498	AA,AG,GG		0.0465,0.0227,0.0384	possibly-damaging,possibly-damaging,possibly-damaging	114/552,114/552,114/552	44486463	5,13001	2203	4300	6503	43359532	SO:0001583	missense	875	exon5			L14577	CCDS13693.1	21q22.3	2014-09-17			ENSG00000160200	ENSG00000160200	4.2.1.22		1550	protein-coding gene	gene with protein product		613381				9790750	Standard	NM_000071		Approved	HIP4	uc002zcv.2	P35520	OTTHUMG00000086834	ENST00000398165.3:c.341C>T	21.37:g.44486463G>A	ENSP00000381231:p.Ala114Val	Somatic		Capture	Illumina HiSeq	Phase_I	43359532	NM_001178008	B2R993|D3DSK4|Q99425|Q9BWC5	Missense_Mutation	SNP	ENST00000398165.3	37	CCDS13693.1	.	.	.	.	.	.	.	.	.	.	G	36	5.628227	0.96671	2.27E-4	4.65E-4	ENSG00000160200	ENST00000398158;ENST00000398165;ENST00000359624;ENST00000352178;ENST00000398168;ENST00000539520;ENST00000544202;ENST00000441030	D;D;D;D;D;D;D	0.96685	-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09	5.36	5.36	0.76844	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.000000	0.85682	D	0.000000	D	0.95825	0.8641	L	0.55481	1.735	0.58432	A	0.999995	D;D	0.60160	0.969;0.987	B;P	0.48627	0.428;0.584	D	0.96795	0.9585	9	0.66056	D	0.02	-46.0386	16.8759	0.86051	0.0:0.0:1.0:0.0	.	114;71	P35520;B7Z2D6	CBS_HUMAN;.	V	114;114;114;114;114;71;26;114	ENSP00000381225:A114V;ENSP00000381231:A114V;ENSP00000352643:A114V;ENSP00000344460:A114V;ENSP00000381234:A114V;ENSP00000439332:A26V;ENSP00000388235:A114V	ENSP00000344460:A114V	A	-	2	0	CBS	43359532	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.379000	0.90146	2.481000	0.83766	0.655000	0.94253	GCG		0.622	CBS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195525.1	NM_000071	
C22orf42	150297	broad.mit.edu	37	22	32548575	32548575	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr22:32548575C>A	ENST00000382097.3	-	3	418	c.346G>T	c.(346-348)Gtg>Ttg	p.V116L	C22orf42_ENST00000490640.1_5'Flank	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	116								p.V116L(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						TTCTCCTCCACACCGCCGTGT	0.463																																					p.V116L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G346T	22						.						44.0	53.0	50.0					22																	32548575		2202	4299	6501	30878575	SO:0001583	missense	150297	exon3			BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.346G>T	22.37:g.32548575C>A	ENSP00000371529:p.Val116Leu	Somatic		Capture	Illumina HiSeq	Phase_I	30878575	NM_001010859	A4QPH5	Missense_Mutation	SNP	ENST00000382097.3	37	CCDS33639.1	.	.	.	.	.	.	.	.	.	.	C	2.657	-0.280536	0.05642	.	.	ENSG00000205856	ENST00000382097	T	0.28069	1.63	0.826	0.826	0.18829	.	.	.	.	.	T	0.14917	0.0360	N	0.08118	0	0.09310	N	1	B	0.32829	0.386	B	0.35240	0.198	T	0.20571	-1.0271	9	0.49607	T	0.09	.	5.0315	0.14411	0.0:1.0:0.0:0.0	.	116	Q6IC83	CV042_HUMAN	L	116	ENSP00000371529:V116L	ENSP00000371529:V116L	V	-	1	0	C22orf42	30878575	0.007000	0.16637	0.002000	0.10522	0.007000	0.05969	0.169000	0.16641	0.741000	0.32674	0.384000	0.25694	GTG		0.463	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075268.2	NM_001010859	
MYH9	4627	broad.mit.edu	37	22	36680482	36680482	+	Silent	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr22:36680482G>A	ENST00000216181.5	-	39	5789	c.5559C>T	c.(5557-5559)gaC>gaT	p.D1853D	MYH9_ENST00000475726.1_5'UTR	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1853					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.D1853D(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TCCTCCGCTCGTCATCCACCT	0.647			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.D1853D			Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5559T	22						.						155.0	97.0	117.0					22																	36680482		2203	4300	6503	35010428	SO:0001819	synonymous_variant	4627	exon39	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.5559C>T	22.37:g.36680482G>A		Somatic		Capture	Illumina HiSeq	Phase_I	35010428	NM_002473	A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	ENST00000216181.5	37	CCDS13927.1																																																																																				0.647	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
SULT4A1	25830	broad.mit.edu	37	22	44221961	44221961	+	Missense_Mutation	SNP	C	C	T	rs374057069		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr22:44221961C>T	ENST00000330884.4	-	7	895	c.775G>A	c.(775-777)Gtc>Atc	p.V259I	SULT4A1_ENST00000540422.1_Missense_Mutation_p.V146I	NM_014351.3	NP_055166.1	Q9BR01	ST4A1_HUMAN	sulfotransferase family 4A, member 1	259					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)	p.V259I(1)		kidney(1)|large_intestine(3)|lung(4)|ovary(1)	9		Ovarian(80;0.024)|all_neural(38;0.0416)		Colorectal(1;0.00242)|READ - Rectum adenocarcinoma(1;0.0419)		TTCATGGAGACGGTGAAGATG	0.453																																					p.V259I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G775A	22						.						162.0	146.0	151.0					22																	44221961		2203	4300	6503	42553294	SO:0001583	missense	25830	exon7			AF188698	CCDS14051.1	22q13.2	2012-11-05			ENSG00000130540	ENSG00000130540		"""Sulfotransferases, cytosolic"""	14903	protein-coding gene	gene with protein product		608359				10698717	Standard	NM_014351		Approved	SULTX3, hBR-STL-1	uc003bee.1	Q9BR01	OTTHUMG00000141314	ENST00000330884.4:c.775G>A	22.37:g.44221961C>T	ENSP00000332565:p.Val259Ile	Somatic		Capture	Illumina HiSeq	Phase_I	42553294	NM_014351	B2R7N3|O43728	Missense_Mutation	SNP	ENST00000330884.4	37	CCDS14051.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979406	0.74360	.	.	ENSG00000130540	ENST00000330884;ENST00000540422	D;D	0.83506	-1.73;-1.73	5.63	5.63	0.86233	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.89403	0.6705	M	0.77313	2.365	0.80722	D	1	D;D	0.61697	0.981;0.99	P;P	0.55260	0.75;0.772	D	0.90527	0.4493	10	0.87932	D	0	.	18.6703	0.91508	0.0:1.0:0.0:0.0	.	146;259	B7Z2E1;Q9BR01	.;ST4A1_HUMAN	I	259;146	ENSP00000332565:V259I;ENSP00000439141:V146I	ENSP00000332565:V259I	V	-	1	0	SULT4A1	42553294	1.000000	0.71417	0.984000	0.44739	0.048000	0.14542	7.642000	0.83385	2.639000	0.89480	0.655000	0.94253	GTC		0.453	SULT4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280660.2	NM_014351	
CELSR1	9620	broad.mit.edu	37	22	46859732	46859732	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr22:46859732G>A	ENST00000262738.3	-	2	4054	c.4055C>T	c.(4054-4056)cCg>cTg	p.P1352L	CELSR1_ENST00000395964.1_Missense_Mutation_p.P1352L	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1352	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)	p.P1352L(1)		breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GAAGCCGGGCGGGCAGCGGCA	0.706																																					p.P1352L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4055T	22						.						32.0	31.0	31.0					22																	46859732		2200	4298	6498	45238396	SO:0001583	missense	9620	exon2			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4055C>T	22.37:g.46859732G>A	ENSP00000262738:p.Pro1352Leu	Somatic		Capture	Illumina HiSeq	Phase_I	45238396	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.8|28.8	4.950692|4.950692	0.92660|0.92660	.|.	.|.	ENSG00000075275|ENSG00000075275	ENST00000262738;ENST00000395964|ENST00000454637	T;T|.	0.50813|.	0.73;0.73|.	4.75|4.75	4.75|4.75	0.60458|0.60458	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);|.	0.000000|.	0.64402|.	U|.	0.000003|.	T|T	0.73393|0.73393	0.3581|0.3581	M|M	0.67397|0.67397	2.05|2.05	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.77004|.	0.989|.	T|T	0.73588|0.73588	-0.3935|-0.3935	10|5	0.51188|.	T|.	0.08|.	.|.	17.3622|17.3622	0.87354|0.87354	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1352|.	Q9NYQ6|.	CELR1_HUMAN|.	L|C	1352|727	ENSP00000262738:P1352L;ENSP00000379293:P1352L|.	ENSP00000262738:P1352L|.	P|R	-|-	2|1	0|0	CELSR1|CELSR1	45238396|45238396	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	9.033000|9.033000	0.93741|0.93741	2.173000|2.173000	0.68751|0.68751	0.655000|0.655000	0.94253|0.94253	CCG|CGC		0.706	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
IL18R1	8809	broad.mit.edu	37	2	102992421	102992421	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:102992421G>A	ENST00000409599.1	+	6	879	c.523G>A	c.(523-525)Gcc>Acc	p.A175T	IL18R1_ENST00000233957.1_Missense_Mutation_p.A175T			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	175	Ig-like C2-type 2.				immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)	p.A175T(1)		breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						AAAGAAGAACGCCGAGTTTGA	0.318																																					p.A175T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G523A	2						.						61.0	62.0	61.0					2																	102992421		2203	4300	6503	102358853	SO:0001583	missense	8809	exon4			U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.523G>A	2.37:g.102992421G>A	ENSP00000387211:p.Ala175Thr	Somatic		Capture	Illumina HiSeq	Phase_I	102358853	NM_003855	B2R9Y5|Q52LC9	Missense_Mutation	SNP	ENST00000409599.1	37	CCDS2060.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347139	0.41599	.	.	ENSG00000115604	ENST00000410040;ENST00000409599;ENST00000233957	T;T;T	0.12465	2.68;2.68;2.68	4.9	4.9	0.64082	.	0.216248	0.32935	N	0.005478	T	0.31888	0.0811	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	T	0.00899	-1.1522	10	0.37606	T	0.19	.	13.9163	0.63899	0.0:0.0:1.0:0.0	.	175;175	B7ZKV7;Q13478	.;IL18R_HUMAN	T	175	ENSP00000386663:A175T;ENSP00000387211:A175T;ENSP00000233957:A175T	ENSP00000233957:A175T	A	+	1	0	IL18R1	102358853	0.991000	0.36638	0.300000	0.25030	0.005000	0.04900	4.354000	0.59417	2.402000	0.81655	0.655000	0.94253	GCC		0.318	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253294.2	NM_003855	
LRP2	4036	broad.mit.edu	37	2	170101368	170101368	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:170101368G>A	ENST00000263816.3	-	22	3550	c.3265C>T	c.(3265-3267)Cgc>Tgc	p.R1089C	LRP2_ENST00000443831.1_Missense_Mutation_p.R952C	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1089	LDL-receptor class A 9. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R1089C(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAGTCGTTGCGTTTGTCACAG	0.512																																					p.R1089C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3265T	2						.						218.0	171.0	187.0					2																	170101368		2203	4300	6503	169809614	SO:0001583	missense	4036	exon22				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.3265C>T	2.37:g.170101368G>A	ENSP00000263816:p.Arg1089Cys	Somatic		Capture	Illumina HiSeq	Phase_I	169809614	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.411758	0.62399	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.95554	-3.74;-3.74	6.06	1.11	0.20524	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.561822	0.21430	N	0.074680	D	0.95711	0.8605	M	0.74467	2.265	0.09310	N	1	P;P	0.49783	0.928;0.758	P;P	0.55303	0.773;0.601	D	0.90345	0.4362	10	0.62326	D	0.03	.	7.9256	0.29872	0.1771:0.2117:0.6113:0.0	.	952;1089	E9PC35;P98164	.;LRP2_HUMAN	C	1089;952	ENSP00000263816:R1089C;ENSP00000409813:R952C	ENSP00000263816:R1089C	R	-	1	0	LRP2	169809614	1.000000	0.71417	0.000000	0.03702	0.054000	0.15201	3.273000	0.51623	-0.068000	0.12953	-0.145000	0.13849	CGC		0.512	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TTN	7273	broad.mit.edu	37	2	179401144	179401144	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:179401144T>C	ENST00000591111.1	-	307	95631	c.95407A>G	c.(95407-95409)Aca>Gca	p.T31803A	TTN_ENST00000359218.5_Missense_Mutation_p.T24504A|TTN_ENST00000460472.2_Missense_Mutation_p.T24379A|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T24571A|TTN_ENST00000342992.6_Missense_Mutation_p.T30876A|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T33444A|TTN-AS1_ENST00000442329.2_RNA			Q8WZ42	TITIN_HUMAN	titin	31803	Fibronectin type-III 131. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T30874A(1)|p.T24379A(1)|p.T24571A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTCTTCTGTTGTCACAGAA	0.408																																					p.Q24378Q												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A73134G	2						.						78.0	75.0	76.0					2																	179401144		1867	4110	5977	179109390	SO:0001583	missense	7273	exon185			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.95407A>G	2.37:g.179401144T>C	ENSP00000465570:p.Thr31803Ala	Somatic		Capture	Illumina HiSeq	Phase_I	179109390	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	18.17	3.564554	0.65651	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	5.76	5.76	0.90799	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62159	0.2405	L	0.42245	1.32	0.53688	D	0.99997	D;D;D;D	0.57899	0.962;0.962;0.962;0.981	P;P;P;P	0.58077	0.726;0.726;0.726;0.832	T	0.65319	-0.6197	9	0.87932	D	0	.	16.0677	0.80897	0.0:0.0:0.0:1.0	.	24379;24504;24571;31803	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	30876;24379;24571;24504;24376	ENSP00000343764:T30876A;ENSP00000434586:T24379A;ENSP00000340554:T24571A;ENSP00000352154:T24504A	ENSP00000340554:T24571A	T	-	1	0	TTN	179109390	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.970000	0.63742	2.185000	0.69588	0.460000	0.39030	ACA		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
GTF3C3	9330	broad.mit.edu	37	2	197664264	197664264	+	Silent	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:197664264C>A	ENST00000263956.3	-	1	161	c.72G>T	c.(70-72)cgG>cgT	p.R24R	GTF3C3_ENST00000409364.3_Silent_p.R24R	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	24					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.R24R(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TCTCTTCTCTCCGCCGTTCGA	0.537																																					p.R24R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G72T	2						.						128.0	136.0	134.0					2																	197664264		2203	4300	6503	197372509	SO:0001819	synonymous_variant	9330	exon1			AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.72G>T	2.37:g.197664264C>A		Somatic		Capture	Illumina HiSeq	Phase_I	197372509	NM_012086	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Silent	SNP	ENST00000263956.3	37	CCDS2316.1																																																																																				0.537	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
ABCA12	26154	broad.mit.edu	37	2	215845284	215845284	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:215845284G>T	ENST00000272895.7	-	31	4882	c.4663C>A	c.(4663-4665)Ctt>Att	p.L1555I	ABCA12_ENST00000389661.4_Missense_Mutation_p.L1237I	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1555	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.L1555I(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CAGCACCTAAGCCCACCCTGC	0.502																																					p.L1555I	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4663A	2						.						118.0	109.0	112.0					2																	215845284		2203	4300	6503	215553529	SO:0001583	missense	26154	exon31			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4663C>A	2.37:g.215845284G>T	ENSP00000272895:p.Leu1555Ile	Somatic		Capture	Illumina HiSeq	Phase_I	215553529	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879064	0.91740	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.94280	-3.39;-3.39	5.95	5.95	0.96441	ABC transporter-like (1);	0.000000	0.64402	D	0.000009	D	0.95645	0.8584	L	0.42487	1.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	D	0.95617	0.8677	10	0.87932	D	0	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	1555;1237	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	I	1555;1237	ENSP00000272895:L1555I;ENSP00000374312:L1237I	ENSP00000272895:L1555I	L	-	1	0	ABCA12	215553529	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.534000	0.73833	2.827000	0.97445	0.650000	0.86243	CTT		0.502	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
NYAP2	57624	broad.mit.edu	37	2	226447451	226447451	+	Missense_Mutation	SNP	G	G	A	rs551391208		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:226447451G>A	ENST00000272907.6	+	4	1731	c.1318G>A	c.(1318-1320)Gtc>Atc	p.V440I	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	440	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.V440I(1)									TCCCTCCCCCGTCAGCATGGG	0.642																																					p.V440I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1318A	2						.						35.0	39.0	37.0					2																	226447451		2007	4183	6190	226155695	SO:0001583	missense	57624	exon4			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1318G>A	2.37:g.226447451G>A	ENSP00000272907:p.Val440Ile	Somatic		Capture	Illumina HiSeq	Phase_I	226155695	NM_020864	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121708	0.77436	.	.	ENSG00000144460	ENST00000272907	T	0.33654	1.4	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.51941	0.1704	L	0.41824	1.3	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.41538	-0.9503	10	0.30854	T	0.27	-12.6994	18.7321	0.91739	0.0:0.0:1.0:0.0	.	440	Q9P242	K1486_HUMAN	I	440	ENSP00000272907:V440I	ENSP00000272907:V440I	V	+	1	0	KIAA1486	226155695	1.000000	0.71417	0.039000	0.18376	0.943000	0.58893	9.476000	0.97823	2.415000	0.81967	0.563000	0.77884	GTC		0.642	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
EIF4E2	9470	broad.mit.edu	37	2	233421209	233421209	+	Missense_Mutation	SNP	G	G	A	rs149079029		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:233421209G>A	ENST00000258416.3	+	2	777	c.104G>A	c.(103-105)cGa>cAa	p.R35Q	EIF4E2_ENST00000409098.1_Missense_Mutation_p.R35Q|EIF4E2_ENST00000409322.1_Missense_Mutation_p.R35Q|EIF4E2_ENST00000409394.1_Missense_Mutation_p.R35Q|EIF4E2_ENST00000409167.3_Missense_Mutation_p.R35Q|EIF4E2_ENST00000409495.1_Missense_Mutation_p.R35Q|EIF4E2_ENST00000409514.1_Missense_Mutation_p.R35Q|EIF4E2_ENST00000479834.1_3'UTR	NM_004846.2	NP_004837.1	O60573	IF4E2_HUMAN	eukaryotic translation initiation factor 4E family member 2	35					cytokine-mediated signaling pathway (GO:0019221)|in utero embryonic development (GO:0001701)|negative regulation of translation (GO:0017148)	cytosol (GO:0005829)|mRNA cap binding complex (GO:0005845)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)|ubiquitin protein ligase binding (GO:0031625)	p.R35Q(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;2.3e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000912)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AAAACGGAACGAGACAAGAAT	0.413																																					p.R35Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G104A	2						.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	251.0	196.0	215.0		104	5.6	1.0	2	dbSNP_134	215	0,8600		0,0,4300	no	missense	EIF4E2	NM_004846.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	35/246	233421209	1,13005	2203	4300	6503	233129453	SO:0001583	missense	9470	exon2			AF038957	CCDS2496.1, CCDS63158.1, CCDS63159.1, CCDS74671.1	2q37.1	2008-02-05	2006-11-13	2004-10-30	ENSG00000135930	ENSG00000135930			3293	protein-coding gene	gene with protein product		605895	"""eukaryotic translation initiation factor 4E-like 3"""	EIF4EL3		9653160, 9582349	Standard	XM_005246975		Approved	IF4e, 4EHP	uc002vta.3	O60573	OTTHUMG00000133256	ENST00000258416.3:c.104G>A	2.37:g.233421209G>A	ENSP00000258416:p.Arg35Gln	Somatic		Capture	Illumina HiSeq	Phase_I	233129453	NM_004846	B8ZZJ9|O75349	Missense_Mutation	SNP	ENST00000258416.3	37	CCDS2496.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.204138	0.38905	2.27E-4	0.0	ENSG00000135930	ENST00000258416;ENST00000409514;ENST00000409098;ENST00000409495;ENST00000409167;ENST00000409322;ENST00000409394;ENST00000454501	T;T;T;T;T;T;T;T	0.42131	1.45;1.45;1.45;1.45;0.98;1.0;0.98;1.45	5.56	5.56	0.83823	Translation Initiation factor eIF- 4e-like  domain (2);	0.269088	0.33572	N	0.004777	T	0.28599	0.0708	L	0.29908	0.895	0.27200	N	0.960186	B;B;B;B	0.13594	0.008;0.003;0.003;0.001	B;B;B;B	0.06405	0.001;0.002;0.002;0.002	T	0.11470	-1.0586	10	0.17832	T	0.49	-37.2667	10.4479	0.44505	0.0878:0.0:0.9122:0.0	.	35;35;35;35	B4E1E4;B8ZZJ9;O60573;B8ZZ50	.;.;IF4E2_HUMAN;.	Q	35;35;35;35;35;35;35;30	ENSP00000258416:R35Q;ENSP00000387336:R35Q;ENSP00000386996:R35Q;ENSP00000386876:R35Q;ENSP00000387328:R35Q;ENSP00000386424:R35Q;ENSP00000386983:R35Q;ENSP00000390904:R30Q	ENSP00000258416:R35Q	R	+	2	0	EIF4E2	233129453	1.000000	0.71417	0.964000	0.40570	0.932000	0.56968	5.781000	0.68964	2.624000	0.88883	0.650000	0.86243	CGA		0.413	EIF4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257033.2	NM_004846	
PRR21	643905	broad.mit.edu	37	2	240981996	240981996	+	Missense_Mutation	SNP	G	G	C	rs568535538|rs78477080	byFrequency	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:240981996G>C	ENST00000408934.1	-	1	403	c.404C>G	c.(403-405)cCt>cGt	p.P135R		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	135	Pro-rich.							p.P135R(4)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GAGGCATGGAGGAAGGGCCGT	0.642																																					p.P135R												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C404G	2						.						3.0	3.0	3.0					2																	240981996		1158	2510	3668	240630669	SO:0001583	missense	643905	exon1			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.404C>G	2.37:g.240981996G>C	ENSP00000386166:p.Pro135Arg	Somatic		Capture	Illumina HiSeq	Phase_I	240630669	NM_001080835		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	N	0.004	-2.241787	0.00274	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13307	2.6;2.6	1.73	-3.46	0.04767	.	.	.	.	.	T	0.06280	0.0162	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.22753	0.041	T	0.44283	-0.9338	9	0.13853	T	0.58	.	11.1434	0.48415	0.0:0.0:0.7795:0.2205	.	135	Q8WXC7	PRR21_HUMAN	R	135	ENSP00000386166:P135R;ENSP00000418240:P135R	ENSP00000386166:P135R	P	-	2	0	PRR21	240630669	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-2.073000	0.00878	-1.240000	0.01540	CCT		0.642	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
KIF1A	547	broad.mit.edu	37	2	241657526	241657526	+	Silent	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:241657526G>A	ENST00000320389.7	-	46	5129	c.4971C>T	c.(4969-4971)agC>agT	p.S1657S	KIF1A_ENST00000498729.2_Silent_p.S1758S	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	1657	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.S1657S(1)		NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		TGTCCTTGTCGCTGGCGGCCT	0.667																																					p.S1657S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4971T	2						.						30.0	38.0	35.0					2																	241657526		2169	4262	6431	241306199	SO:0001819	synonymous_variant	547	exon46			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.4971C>T	2.37:g.241657526G>A		Somatic		Capture	Illumina HiSeq	Phase_I	241306199	NM_004321	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Silent	SNP	ENST00000320389.7	37	CCDS46561.1																																																																																				0.667	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
ANO7	50636	broad.mit.edu	37	2	242147067	242147067	+	Silent	SNP	C	C	T	rs140168050	byFrequency	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:242147067C>T	ENST00000274979.8	+	11	1324	c.1221C>T	c.(1219-1221)agC>agT	p.S407S	ANO7_ENST00000402430.3_Silent_p.S406S	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	407					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)	p.S407S(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						TGCTCTCCAGCGCCTGTGCCC	0.622																																					p.S407S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1221T	2						.	C		0,4406		0,0,2203	94.0	89.0	90.0		1221	-4.0	0.1	2	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ANO7	NM_001001891.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		407/934	242147067	1,13005	2203	4300	6503	241795740	SO:0001819	synonymous_variant	50636	exon11			AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1221C>T	2.37:g.242147067C>T		Somatic		Capture	Illumina HiSeq	Phase_I	241795740	NM_001001891	Q6IWH6	Silent	SNP	ENST00000274979.8	37	CCDS33423.1																																																																																				0.622	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
PSME4	23198	broad.mit.edu	37	2	54120906	54120906	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:54120906C>G	ENST00000404125.1	-	35	3998	c.3943G>C	c.(3943-3945)Gat>Cat	p.D1315H	PSME4_ENST00000421748.2_Missense_Mutation_p.D459H	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1315					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)	p.D1201H(1)		breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AATTTAGGATCAGAAAAATGA	0.279																																					p.D1315H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3943C	2						.						34.0	37.0	36.0					2																	54120906		2191	4280	6471	53974410	SO:0001583	missense	23198	exon35			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.3943G>C	2.37:g.54120906C>G	ENSP00000384211:p.Asp1315His	Somatic		Capture	Illumina HiSeq	Phase_I	53974410	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084670	0.76642	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.27557	1.66;1.67	5.7	4.64	0.57946	Armadillo-type fold (1);	0.046747	0.85682	D	0.000000	T	0.51635	0.1686	M	0.81497	2.545	0.80722	D	1	D;P;P	0.58268	0.982;0.741;0.946	P;P;P	0.56434	0.798;0.495;0.479	T	0.55692	-0.8101	10	0.52906	T	0.07	-7.8766	15.5662	0.76294	0.0:0.9231:0.0:0.0769	.	690;459;1315	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	H	459;1315	ENSP00000410830:D459H;ENSP00000384211:D1315H	ENSP00000384211:D1315H	D	-	1	0	PSME4	53974410	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.875000	0.69660	2.706000	0.92434	0.557000	0.71058	GAT		0.279	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
ADD2	119	broad.mit.edu	37	2	70933527	70933527	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:70933527G>A	ENST00000264436.4	-	3	458	c.14C>T	c.(13-15)aCg>aTg	p.T5M	ADD2_ENST00000355733.3_Missense_Mutation_p.T5M|ADD2_ENST00000473232.1_5'Flank|ADD2_ENST00000413157.2_Missense_Mutation_p.T5M|ADD2_ENST00000430656.1_Missense_Mutation_p.T21M|ADD2_ENST00000407644.2_Missense_Mutation_p.T5M	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	5					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)	p.T5M(2)		autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CTCGGGGACCGTCTCTTCGCT	0.637																																					p.T5M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C14T	2						.						47.0	49.0	48.0					2																	70933527		2202	4300	6502	70787035	SO:0001583	missense	119	exon3			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.14C>T	2.37:g.70933527G>A	ENSP00000264436:p.Thr5Met	Somatic		Capture	Illumina HiSeq	Phase_I	70787035	NM_001185054	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	37	CCDS1906.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.566111	0.45694	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320;ENST00000355733;ENST00000522886;ENST00000264439;ENST00000356565;ENST00000517596;ENST00000413157;ENST00000430656;ENST00000415348;ENST00000425976;ENST00000447731	T;T;T;T;T;T;T;T	0.39997	3.31;3.31;3.1;1.84;3.01;1.05;1.43;1.41	5.64	3.74	0.42951	.	0.838109	0.10718	N	0.642033	T	0.23532	0.0569	N	0.14661	0.345	0.09310	N	1	P;P;P;P;P;P	0.50819	0.916;0.773;0.606;0.861;0.939;0.872	B;B;B;B;B;B	0.37480	0.179;0.229;0.058;0.179;0.179;0.251	T	0.05852	-1.0860	10	0.87932	D	0	-0.0539	8.2528	0.31737	0.0844:0.0:0.7569:0.1586	.	21;5;5;5;5;5	B4DM17;P35612-4;E9PAN1;Q05DK5;P35612;P35612-3	.;.;.;.;ADDB_HUMAN;.	M	5;5;5;5;5;5;5;5;5;21;5;5;5	ENSP00000264436:T5M;ENSP00000384677:T5M;ENSP00000347972:T5M;ENSP00000430243:T5M;ENSP00000388072:T5M;ENSP00000398112:T21M;ENSP00000412357:T5M;ENSP00000412681:T5M	ENSP00000264436:T5M	T	-	2	0	ADD2	70787035	0.162000	0.22906	0.105000	0.21289	0.736000	0.42039	1.508000	0.35769	2.807000	0.96579	0.591000	0.81541	ACG		0.637	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
NCAPH	23397	broad.mit.edu	37	2	97009958	97009958	+	Silent	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:97009958G>A	ENST00000240423.4	+	6	754	c.711G>A	c.(709-711)cgG>cgA	p.R237R	NCAPH_ENST00000427946.1_Silent_p.R101R|NCAPH_ENST00000455200.1_Silent_p.R226R	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	237					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.R237R(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				AAGCAGATCGGAAGTGTGAGG	0.463																																					p.R237R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G711A	2						.						111.0	104.0	107.0					2																	97009958		2203	4300	6503	96373685	SO:0001819	synonymous_variant	23397	exon6			BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.711G>A	2.37:g.97009958G>A		Somatic		Capture	Illumina HiSeq	Phase_I	96373685	NM_015341	B4E189|Q8TB87	Silent	SNP	ENST00000240423.4	37	CCDS2021.1																																																																																				0.463	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	NM_015341	
AFF3	3899	broad.mit.edu	37	2	100199261	100199261	+	Splice_Site	SNP	G	G	A	rs373018231		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:100199261G>A	ENST00000409236.2	-	15	2904	c.2792C>T	c.(2791-2793)aCg>aTg	p.T931M	AFF3_ENST00000409579.1_Splice_Site_p.T956M|AFF3_ENST00000356421.2_Splice_Site_p.T956M|AFF3_ENST00000317233.4_Splice_Site_p.T931M			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	931					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.T956M(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TCAACAAACCGTGAGGTCTCC	0.498																																					p.T956M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2867T	2						.	G	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	107.0	99.0	102.0		2867,2792	5.1	1.0	2		102	0,8600		0,0,4300	no	missense-near-splice,missense-near-splice	AFF3	NM_001025108.1,NM_002285.2	81,81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	956/1252,931/1227	100199261	1,13005	2203	4300	6503	99565693	SO:0001630	splice_region_variant	3899	exon16			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2793+1C>T	2.37:g.100199261G>A		Somatic		Capture	Illumina HiSeq	Phase_I	99565693	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081597	0.36758	2.27E-4	0.0	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.93	5.06	0.68205	.	0.709463	0.13540	N	0.380245	T	0.48874	0.1524	L	0.36672	1.1	0.29019	N	0.886419	B;P	0.42123	0.023;0.771	B;B	0.36666	0.013;0.23	T	0.49476	-0.8936	10	0.48119	T	0.1	.	7.8955	0.29704	0.0805:0.0:0.7499:0.1696	.	931;956	P51826;P51826-2	AFF3_HUMAN;.	M	931;956;956;931	ENSP00000317421:T931M;ENSP00000348793:T956M;ENSP00000386834:T956M;ENSP00000387207:T931M	ENSP00000317421:T931M	T	-	2	0	AFF3	99565693	0.952000	0.32445	0.998000	0.56505	0.915000	0.54546	0.708000	0.25719	1.533000	0.49186	0.655000	0.94253	ACG		0.498	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	Missense_Mutation
SEPT2	4735	broad.mit.edu	37	2	242275458	242275458	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr2:242275458C>T	ENST00000391973.2	+	5	814	c.286C>T	c.(286-288)Cgc>Tgc	p.R96C	SEPT2_ENST00000407971.1_Missense_Mutation_p.R56C|SEPT2_ENST00000402092.2_Missense_Mutation_p.R96C|SEPT2_ENST00000391971.2_Missense_Mutation_p.R96C|SEPT2_ENST00000401990.1_Missense_Mutation_p.R106C|SEPT2_ENST00000360051.3_Missense_Mutation_p.R96C	NM_006155.1	NP_006146.1	Q15019	SEPT2_HUMAN	septin 2	96	Septin-type G.				cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|neuron projection development (GO:0031175)|regulation of L-glutamate transport (GO:0002036)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|synapse (GO:0045202)	enzyme regulator activity (GO:0030234)|GTP binding (GO:0005525)	p.R96C(1)		central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		GGTCAAGCTACGCCTGACAGT	0.423																																					p.R96C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C286T	2						.						82.0	75.0	77.0					2																	242275458		2203	4300	6503	241924131	SO:0001583	missense	4735	exon6			D28540	CCDS2548.1, CCDS63195.1, CCDS74682.1	2q37.3	2013-01-21	2005-01-11	2005-01-12	ENSG00000168385	ENSG00000168385		"""Septins"""	7729	protein-coding gene	gene with protein product		601506	"""neural precursor cell expressed, developmentally down-regulated 5"""	DIFF6, NEDD5		8697812	Standard	XM_005247011		Approved	KIAA0158, hNedd5, Pnutl3	uc002wbd.3	Q15019	OTTHUMG00000133394	ENST00000391973.2:c.286C>T	2.37:g.242275458C>T	ENSP00000375834:p.Arg96Cys	Somatic		Capture	Illumina HiSeq	Phase_I	241924131	NM_001008491	B4DGE8|Q14132|Q53QU3|Q8IUK9|Q96CB0	Missense_Mutation	SNP	ENST00000391973.2	37	CCDS2548.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720472	0.89205	.	.	ENSG00000168385	ENST00000391973;ENST00000428282;ENST00000360051;ENST00000407017;ENST00000391971;ENST00000401990;ENST00000407971;ENST00000436795;ENST00000411484;ENST00000434955;ENST00000402092;ENST00000443492;ENST00000437066;ENST00000391972;ENST00000449239	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56	5.94	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.75503	0.3858	M	0.86268	2.805	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	P;D;D	0.97110	0.731;1.0;1.0	T	0.80600	-0.1310	10	0.87932	D	0	.	15.424	0.75038	0.0:0.9335:0.0:0.0665	.	131;56;96	Q15019-2;B5MCX3;Q15019	.;.;SEPT2_HUMAN	C	96;56;96;56;96;106;56;96;107;96;96;56;96;131;96	ENSP00000375834:R96C;ENSP00000397195:R56C;ENSP00000353157:R96C;ENSP00000386001:R56C;ENSP00000375832:R96C;ENSP00000385109:R106C;ENSP00000384525:R56C;ENSP00000406181:R96C;ENSP00000394666:R107C;ENSP00000399767:R96C;ENSP00000385172:R96C;ENSP00000399195:R56C;ENSP00000412434:R96C;ENSP00000391717:R96C	ENSP00000353157:R96C	R	+	1	0	SEPT2	241924131	0.999000	0.42202	1.000000	0.80357	0.914000	0.54420	4.321000	0.59209	1.527000	0.49086	0.650000	0.86243	CGC		0.423	SEPT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323177.3	NM_006155	
IFT80	57560	broad.mit.edu	37	3	159998476	159998476	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr3:159998476G>A	ENST00000326448.7	-	15	2075	c.1643C>T	c.(1642-1644)aCa>aTa	p.T548I	IFT80_ENST00000483465.1_Missense_Mutation_p.T411I|IFT80_ENST00000496589.1_Missense_Mutation_p.T411I|RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.T719I	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	548					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)		p.T548I(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TTCATATAATGTTTTAGGCAA	0.323																																					p.T411I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1232T	3						.						122.0	111.0	115.0					3																	159998476		2203	4300	6503	161481170	SO:0001583	missense	57560	exon14			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.1643C>T	3.37:g.159998476G>A	ENSP00000312778:p.Thr548Ile	Somatic		Capture	Illumina HiSeq	Phase_I	161481170	NM_001190242	B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	ENST00000326448.7	37	CCDS3188.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327407	0.81690	.	.	ENSG00000068885	ENST00000326448;ENST00000483465;ENST00000496589	T;T;T	0.78481	-0.08;-1.18;-1.18	5.6	5.6	0.85130	.	0.000000	0.64402	U	0.000014	D	0.83936	0.5362	M	0.87456	2.885	0.80722	D	1	D	0.53312	0.959	P	0.46076	0.503	D	0.84821	0.0796	10	0.36615	T	0.2	.	19.6123	0.95613	0.0:0.0:1.0:0.0	.	548	Q9P2H3	IFT80_HUMAN	I	548;411;411	ENSP00000312778:T548I;ENSP00000418196:T411I;ENSP00000420646:T411I	ENSP00000312778:T548I	T	-	2	0	IFT80	161481170	1.000000	0.71417	0.982000	0.44146	0.965000	0.64279	9.074000	0.93998	2.640000	0.89533	0.467000	0.42956	ACA		0.323	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2	NM_020800	
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,urinary_tract,bladder,Substitution - Missense,0 	.	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A	3						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	180418785	SO:0001583	missense	5290	exon10				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		Capture	Illumina HiSeq	Phase_I	180418785	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
CHL1	10752	broad.mit.edu	37	3	369855	369855	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr3:369855C>T	ENST00000256509.2	+	5	845	c.203C>T	c.(202-204)tCg>tTg	p.S68L	CHL1_ENST00000397491.2_Missense_Mutation_p.S68L	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.S68L(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TTTAGATTTTCGTGGACTAAG	0.338																																					p.S68L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C203T	3						.						105.0	102.0	103.0					3																	369855		2203	4300	6503	344855	SO:0001583	missense	10752	exon5			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.203C>T	3.37:g.369855C>T	ENSP00000256509:p.Ser68Leu	Somatic		Capture	Illumina HiSeq	Phase_I	344855	NM_006614	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668808	0.29604	.	.	ENSG00000134121	ENST00000256509;ENST00000397491;ENST00000421198;ENST00000435603;ENST00000449294	T;T;T;T;D	0.96136	-0.49;-0.49;-0.49;-0.49;-3.92	4.68	-1.75	0.08031	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.804380	0.03033	N	0.152362	D	0.90662	0.7071	L	0.40543	1.245	0.09310	N	1	B;B;B	0.19445	0.01;0.036;0.001	B;B;B	0.18263	0.021;0.017;0.001	T	0.76948	-0.2770	10	0.41790	T	0.15	.	0.4129	0.00444	0.2774:0.2836:0.2305:0.2084	.	68;68;68	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	L	68	ENSP00000256509:S68L;ENSP00000380628:S68L;ENSP00000413628:S68L;ENSP00000397445:S68L;ENSP00000390440:S68L	ENSP00000256509:S68L	S	+	2	0	CHL1	344855	0.000000	0.05858	0.001000	0.08648	0.361000	0.29550	-0.174000	0.09839	-0.200000	0.10300	0.650000	0.86243	TCG		0.338	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
GORASP1	64689	broad.mit.edu	37	3	39142327	39142327	+	Silent	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr3:39142327C>T	ENST00000319283.3	-	5	1298	c.477G>A	c.(475-477)aaG>aaA	p.K159K	GORASP1_ENST00000479927.1_Silent_p.K64K|GORASP1_ENST00000476334.1_5'Flank|GORASP1_ENST00000422110.2_Intron	NM_031899.2	NP_114105.1	Q9BQQ3	GORS1_HUMAN	golgi reassembly stacking protein 1, 65kDa	159					Golgi organization (GO:0007030)|mitotic cell cycle (GO:0000278)|negative regulation of dendrite morphogenesis (GO:0050774)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)		p.K159K(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(1)|ovary(3)|urinary_tract(1)	14				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		GCTTCAAGGGCTTCCCCTCAT	0.552											OREG0015486	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K159K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G477A	3						.						145.0	141.0	143.0					3																	39142327		2203	4300	6503	39117331	SO:0001819	synonymous_variant	64689	exon5			AJ409349	CCDS2681.1, CCDS63596.1, CCDS63597.1	3p22-p21.33	2008-04-23	2002-08-29	2002-05-24	ENSG00000114745	ENSG00000114745			16769	protein-coding gene	gene with protein product		606867	"""golgi phosphoprotein 5"""	GOLPH5			Standard	NM_001278789		Approved	GRASP65, P65, FLJ23443	uc003ciw.1	Q9BQQ3	OTTHUMG00000131292	ENST00000319283.3:c.477G>A	3.37:g.39142327C>T		Somatic	883	Capture	Illumina HiSeq	Phase_I	39117331	NM_031899	B3KWC8|Q3SYG7|Q8N272|Q96H42	Silent	SNP	ENST00000319283.3	37	CCDS2681.1																																																																																				0.552	GORASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254060.1		
CCDC13	152206	broad.mit.edu	37	3	42794180	42794180	+	Missense_Mutation	SNP	C	C	T	rs369542894	byFrequency	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr3:42794180C>T	ENST00000310232.6	-	4	483	c.400G>A	c.(400-402)Gcc>Acc	p.A134T	CCDC13_ENST00000435327.2_5'UTR	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	134								p.A134T(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						ATTTTGGTGGCGACCACGTCT	0.483													C|||	2	0.000399361	0.0008	0.0	5008	,	,		18467	0.0		0.0	False		,,,				2504	0.001				p.A134T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G400A	3						.	C	THR/ALA	0,4406		0,0,2203	103.0	98.0	99.0		400	5.9	1.0	3		99	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC13	NM_144719.3	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	134/716	42794180	1,13005	2203	4300	6503	42769184	SO:0001583	missense	152206	exon4			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.400G>A	3.37:g.42794180C>T	ENSP00000309836:p.Ala134Thr	Somatic		Capture	Illumina HiSeq	Phase_I	42769184	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	37	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	35	5.440807	0.96168	0.0	1.16E-4	ENSG00000244607	ENST00000310232	T	0.27256	1.68	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.55081	0.1898	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.47861	-0.9084	10	0.32370	T	0.25	.	19.0678	0.93119	0.0:1.0:0.0:0.0	.	134;134;134	B4DZD2;Q96LI1;Q8IYE1	.;.;CCD13_HUMAN	T	134	ENSP00000309836:A134T	ENSP00000309836:A134T	A	-	1	0	CCDC13	42769184	1.000000	0.71417	0.972000	0.41901	0.794000	0.44872	6.587000	0.74071	2.813000	0.96785	0.655000	0.94253	GCC		0.483	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
CELSR3	1951	broad.mit.edu	37	3	48699138	48699138	+	Silent	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr3:48699138C>T	ENST00000164024.4	-	1	1210	c.930G>A	c.(928-930)gcG>gcA	p.A310A	CELSR3_ENST00000544264.1_Silent_p.A310A|RP11-148G20.1_ENST00000421275.1_RNA	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	310					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.A310A(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTGCCCGGTTCGCCGAGGTTA	0.706																																					p.A310A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G930A	3						.						37.0	42.0	40.0					3																	48699138		2184	4249	6433	48674142	SO:0001819	synonymous_variant	1951	exon1			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.930G>A	3.37:g.48699138C>T		Somatic		Capture	Illumina HiSeq	Phase_I	48674142	NM_001407	O75092	Silent	SNP	ENST00000164024.4	37	CCDS2775.1																																																																																				0.706	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
ROBO1	6091	broad.mit.edu	37	3	78676478	78676478	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr3:78676478C>T	ENST00000464233.1	-	26	3981	c.3868G>A	c.(3868-3870)Gac>Aac	p.D1290N	ROBO1_ENST00000495273.1_Missense_Mutation_p.D1245N|ROBO1_ENST00000436010.2_Missense_Mutation_p.D1251N|ROBO1_ENST00000467549.1_Missense_Mutation_p.D1190N	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1290					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.D1267N(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TACCTCCTGTCGGGCTGGTGC	0.488																																					p.D1290N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3868A	3						.						45.0	50.0	49.0					3																	78676478		2135	4257	6392	78759168	SO:0001583	missense	6091	exon26			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3868G>A	3.37:g.78676478C>T	ENSP00000420321:p.Asp1290Asn	Somatic		Capture	Illumina HiSeq	Phase_I	78759168	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.459328	0.26248	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.60672	0.21;0.19;0.18;0.17	5.08	5.08	0.68730	.	0.368276	0.33005	N	0.005391	T	0.41419	0.1158	N	0.19112	0.55	0.30374	N	0.782619	B;P;B;B;B	0.34724	0.272;0.465;0.178;0.357;0.069	B;B;B;B;B	0.26969	0.055;0.075;0.016;0.036;0.044	T	0.36212	-0.9757	9	.	.	.	.	18.8284	0.92127	0.0:1.0:0.0:0.0	.	1254;1290;1245;1190;1251	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	N	1251;1245;1290;1245;1190;1294	ENSP00000406043:D1251N;ENSP00000420321:D1290N;ENSP00000420637:D1245N;ENSP00000417992:D1190N	.	D	-	1	0	ROBO1	78759168	0.977000	0.34250	0.973000	0.42090	0.136000	0.21042	2.437000	0.44828	2.520000	0.84964	0.561000	0.74099	GAC		0.488	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
OR5AC2	81050	broad.mit.edu	37	3	97806442	97806442	+	Silent	SNP	C	C	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr3:97806442C>G	ENST00000358642.2	+	1	426	c.426C>G	c.(424-426)ctC>ctG	p.L142L		NM_054106.1	NP_473447.1	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC, member 2	142					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L142L(1)		endometrium(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	28						CCAACAAACTCAGCGCTCAGT	0.418																																					p.L142L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C426G	3						.						203.0	191.0	195.0					3																	97806442		2203	4300	6503	99289132	SO:0001819	synonymous_variant	81050	exon1			AF179759	CCDS33796.1	3q11.2	2013-09-23			ENSG00000196578	ENSG00000196578		"""GPCR / Class A : Olfactory receptors"""	15431	protein-coding gene	gene with protein product							Standard	NM_054106		Approved	HSA1	uc011bgs.2	Q9NZP5	OTTHUMG00000160083	ENST00000358642.2:c.426C>G	3.37:g.97806442C>G		Somatic		Capture	Illumina HiSeq	Phase_I	99289132	NM_054106		Silent	SNP	ENST00000358642.2	37	CCDS33796.1																																																																																				0.418	OR5AC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359116.1		
UBXN7	26043	broad.mit.edu	37	3	196089442	196089442	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr3:196089442T>G	ENST00000296328.4	-	9	1025	c.951A>C	c.(949-951)gaA>gaC	p.E317D	UBXN7_ENST00000428095.1_Missense_Mutation_p.E155D|UBXN7_ENST00000535858.1_Missense_Mutation_p.E169D	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	317						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.E317D(1)		NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						CAGATTCAGATTCTTCATCTG	0.438																																					p.E317D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A951C	3						.						121.0	114.0	116.0					3																	196089442		1850	4102	5952	197573839	SO:0001583	missense	26043	exon9			AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.951A>C	3.37:g.196089442T>G	ENSP00000296328:p.Glu317Asp	Somatic		Capture	Illumina HiSeq	Phase_I	197573839	NM_015562	D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	ENST00000296328.4	37	CCDS43191.1	.	.	.	.	.	.	.	.	.	.	T	12.86	2.063993	0.36373	.	.	ENSG00000163960	ENST00000296328;ENST00000428095;ENST00000535858	.	.	.	5.9	-2.46	0.06461	.	0.096938	0.64402	D	0.000001	T	0.31949	0.0813	N	0.08118	0	0.43255	D	0.995184	B	0.02656	0.0	B	0.04013	0.001	T	0.05402	-1.0887	9	0.23302	T	0.38	-16.7709	14.2329	0.65906	0.0:0.5648:0.0:0.4352	.	317	O94888	UBXN7_HUMAN	D	317;155;169	.	ENSP00000296328:E317D	E	-	3	2	UBXN7	197573839	0.391000	0.25221	0.969000	0.41365	0.996000	0.88848	-0.368000	0.07543	-0.345000	0.08325	0.460000	0.39030	GAA		0.438	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340938.2	XM_087353	
ANK2	287	broad.mit.edu	37	4	114279264	114279264	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr4:114279264G>T	ENST00000357077.4	+	38	9543	c.9490G>T	c.(9490-9492)Gaa>Taa	p.E3164*	ANK2_ENST00000264366.6_Nonsense_Mutation_p.E3131*|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3164					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.E3164*(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GACATCAGCTGAATCACTAGC	0.468																																					p.E3164X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G9490T	4						.						52.0	51.0	52.0					4																	114279264		2203	4300	6503	114498713	SO:0001587	stop_gained	287	exon38			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.9490G>T	4.37:g.114279264G>T	ENSP00000349588:p.Glu3164*	Somatic		Capture	Illumina HiSeq	Phase_I	114498713	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Nonsense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	47	13.397757	0.99739	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	.	.	.	5.78	3.13	0.36017	.	0.780131	0.11418	N	0.566046	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	7.2978	0.26403	0.2002:0.123:0.6768:0.0	.	.	.	.	X	3164;3131;174	.	ENSP00000264366:E3131X	E	+	1	0	ANK2	114498713	0.962000	0.33011	0.001000	0.08648	0.003000	0.03518	4.317000	0.59184	0.362000	0.24319	-0.251000	0.11542	GAA		0.468	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
FAT4	79633	broad.mit.edu	37	4	126371845	126371845	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr4:126371845C>G	ENST00000394329.3	+	9	9687	c.9674C>G	c.(9673-9675)aCa>aGa	p.T3225R	FAT4_ENST00000335110.5_Missense_Mutation_p.T1523R	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3225	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T3225R(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GACTCTGGAACAAATGCTGTG	0.428																																					p.T3225R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C9674G	4						.						92.0	84.0	87.0					4																	126371845		2203	4300	6503	126591295	SO:0001583	missense	79633	exon9			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.9674C>G	4.37:g.126371845C>G	ENSP00000377862:p.Thr3225Arg	Somatic		Capture	Illumina HiSeq	Phase_I	126591295	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	1.334	-0.596069	0.03771	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.52057	0.68;0.68	5.63	3.81	0.43845	Cadherin (4);Cadherin-like (1);	0.506351	0.14350	U	0.325131	T	0.27027	0.0662	N	0.11106	0.095	0.09310	N	1	B;B;B	0.31383	0.145;0.014;0.321	B;B;B	0.28784	0.075;0.028;0.094	T	0.09058	-1.0692	10	0.15952	T	0.53	.	12.9296	0.58280	0.0:0.8052:0.1255:0.0693	.	1523;3225;3225	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	R	3225;1523	ENSP00000377862:T3225R;ENSP00000335169:T1523R	ENSP00000335169:T1523R	T	+	2	0	FAT4	126591295	0.089000	0.21612	0.454000	0.27019	0.094000	0.18550	3.178000	0.50879	1.382000	0.46385	0.655000	0.94253	ACA		0.428	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
MAB21L2	10586	broad.mit.edu	37	4	151504801	151504801	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr4:151504801G>T	ENST00000317605.4	+	1	1725	c.620G>T	c.(619-621)gGg>gTg	p.G207V	RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000357115.3_Intron|LRBA_ENST00000503716.1_5'Flank|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000535741.1_Intron|LRBA_ENST00000510413.1_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	207					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.G207V(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		AAGGCCGAAGGGTTCAACTTG	0.657																																					p.G207V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G620T	4						.						38.0	39.0	39.0					4																	151504801		2203	4299	6502	151724251	SO:0001583	missense	10586	exon1			AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.620G>T	4.37:g.151504801G>T	ENSP00000324701:p.Gly207Val	Somatic		Capture	Illumina HiSeq	Phase_I	151724251	NM_006439	B3KP37|Q9HBA7	Missense_Mutation	SNP	ENST00000317605.4	37	CCDS3774.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.973968	0.74246	.	.	ENSG00000181541	ENST00000317605	T	0.11495	2.77	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.41858	0.1177	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.43925	-0.9361	10	0.72032	D	0.01	-16.5799	19.4978	0.95081	0.0:0.0:1.0:0.0	.	207	Q9Y586	MB212_HUMAN	V	207	ENSP00000324701:G207V	ENSP00000324701:G207V	G	+	2	0	MAB21L2	151724251	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.608000	0.88229	0.462000	0.41574	GGG		0.657	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364937.1	NM_006439	
LRBA	987	broad.mit.edu	37	4	151773846	151773846	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr4:151773846T>A	ENST00000357115.3	-	23	3259	c.3016A>T	c.(3016-3018)Aat>Tat	p.N1006Y	LRBA_ENST00000507224.1_Missense_Mutation_p.N1006Y|LRBA_ENST00000535741.1_Missense_Mutation_p.N1006Y|LRBA_ENST00000510413.1_Missense_Mutation_p.N1006Y	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1006						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.N1006Y(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGTTCAATATTAGATGCAGAT	0.373																																					p.N1006Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3016T	4						.						122.0	115.0	117.0					4																	151773846		2203	4299	6502	151993296	SO:0001583	missense	987	exon23			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.3016A>T	4.37:g.151773846T>A	ENSP00000349629:p.Asn1006Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	151993296	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	T	8.887	0.953002	0.18431	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.56611	0.87;1.02;0.87;0.45	5.77	3.17	0.36434	.	2.209180	0.01575	N	0.020764	T	0.41673	0.1169	N	0.24115	0.695	0.09310	N	1	B;B	0.33448	0.412;0.078	B;B	0.33890	0.172;0.029	T	0.39623	-0.9605	10	0.62326	D	0.03	.	4.7549	0.13078	0.0:0.2096:0.1607:0.6297	.	1006;1006	P50851;P50851-2	LRBA_HUMAN;.	Y	1006	ENSP00000446299:N1006Y;ENSP00000421552:N1006Y;ENSP00000349629:N1006Y;ENSP00000422180:N1006Y	ENSP00000349629:N1006Y	N	-	1	0	LRBA	151993296	0.045000	0.20229	0.027000	0.17364	0.018000	0.09664	1.388000	0.34442	1.093000	0.41377	0.533000	0.62120	AAT		0.373	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
NPY2R	4887	broad.mit.edu	37	4	156135277	156135277	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr4:156135277G>T	ENST00000329476.3	+	2	675	c.186G>T	c.(184-186)ttG>ttT	p.L62F	NPY2R_ENST00000506608.1_Missense_Mutation_p.L62F	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	62					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)	p.L62F(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	CCATCATCTTGCTTGGGGTAA	0.473																																					p.L62F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G186T	4						.						188.0	179.0	182.0					4																	156135277		2203	4300	6503	156354727	SO:0001583	missense	4887	exon2			U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.186G>T	4.37:g.156135277G>T	ENSP00000332591:p.Leu62Phe	Somatic		Capture	Illumina HiSeq	Phase_I	156354727	NM_000910	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	37	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.542416	0.27563	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.44083	0.93;0.93	5.41	3.68	0.42216	.	0.070748	0.56097	D	0.000023	T	0.32194	0.0821	L	0.54323	1.7	0.58432	D	0.999993	B	0.30664	0.289	B	0.26517	0.07	T	0.06752	-1.0809	10	0.23302	T	0.38	.	7.0496	0.25065	0.1528:0.1415:0.7057:0.0	.	62	P49146	NPY2R_HUMAN	F	62	ENSP00000332591:L62F;ENSP00000426366:L62F	ENSP00000332591:L62F	L	+	3	2	NPY2R	156354727	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.774000	0.47694	0.756000	0.33013	0.643000	0.83706	TTG		0.473	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910	
TENM3	55714	broad.mit.edu	37	4	183658225	183658225	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr4:183658225G>T	ENST00000511685.1	+	17	3355	c.3232G>T	c.(3232-3234)Gtt>Ttt	p.V1078F	TENM3_ENST00000406950.2_Missense_Mutation_p.V1078F|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1078					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.V1078F(1)									ATCTGAAGCTGTTGGTAAGTT	0.373																																					p.V1078F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3232T	4						.						131.0	125.0	127.0					4																	183658225		1836	4091	5927	183895219	SO:0001583	missense	55714	exon16			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.3232G>T	4.37:g.183658225G>T	ENSP00000424226:p.Val1078Phe	Somatic		Capture	Illumina HiSeq	Phase_I	183895219	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.463680	0.43736	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.86497	-2.13;-2.13	4.68	4.68	0.58851	.	.	.	.	.	D	0.90321	0.6972	L	0.50333	1.59	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.86279	0.1666	9	0.09338	T	0.73	.	17.8611	0.88781	0.0:0.0:1.0:0.0	.	1078	Q9P273	TEN3_HUMAN	F	1078	ENSP00000424226:V1078F;ENSP00000385276:V1078F	ENSP00000385276:V1078F	V	+	1	0	ODZ3	183895219	1.000000	0.71417	1.000000	0.80357	0.208000	0.24298	9.653000	0.98506	2.449000	0.82847	0.650000	0.86243	GTT		0.373	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
HTT	3064	broad.mit.edu	37	4	3240277	3240277	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr4:3240277G>A	ENST00000355072.5	+	65	9140	c.8995G>A	c.(8995-8997)Gga>Aga	p.G2999R		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2999					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.G2999R(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CAAAGTCATCGGAGAGTTTCT	0.547																																					p.G2999R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8995A	4						.						84.0	91.0	89.0					4																	3240277		2025	4184	6209	3210075	SO:0001583	missense	3064	exon65			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.8995G>A	4.37:g.3240277G>A	ENSP00000347184:p.Gly2999Arg	Somatic		Capture	Illumina HiSeq	Phase_I	3210075	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	G	34	5.326384	0.95708	.	.	ENSG00000197386	ENST00000355072	T	0.68025	-0.3	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.82467	0.5043	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85034	0.0919	10	0.87932	D	0	.	17.5498	0.87872	0.0:0.0:1.0:0.0	.	2999	P42858	HD_HUMAN	R	2999	ENSP00000347184:G2999R	ENSP00000347184:G2999R	G	+	1	0	HTT	3210075	1.000000	0.71417	0.968000	0.41197	0.966000	0.64601	9.470000	0.97683	2.372000	0.80975	0.557000	0.71058	GGA		0.547	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
PPEF2	5470	broad.mit.edu	37	4	76797647	76797647	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr4:76797647C>A	ENST00000286719.7	-	11	1469	c.1113G>T	c.(1111-1113)agG>agT	p.R371S		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	371	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)	p.R371S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGCTGGAGGACCTGCTGGTTT	0.657																																					p.R371S	NSCLC(105;1359 1603 15961 44567 47947)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1113T	4						.						43.0	44.0	44.0					4																	76797647		2203	4300	6503	77016671	SO:0001583	missense	5470	exon11			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1113G>T	4.37:g.76797647C>A	ENSP00000286719:p.Arg371Ser	Somatic		Capture	Illumina HiSeq	Phase_I	77016671	NM_006239	O14831	Missense_Mutation	SNP	ENST00000286719.7	37	CCDS34013.1	.	.	.	.	.	.	.	.	.	.	C	10.11	1.260898	0.23051	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	T	0.42131	0.98	5.02	1.19	0.21007	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);Metallophosphoesterase domain (1);	2.099860	0.02329	N	0.073719	T	0.30572	0.0769	N	0.20766	0.605	0.28272	N	0.924383	B;B	0.34181	0.008;0.44	B;B	0.38378	0.013;0.272	T	0.15607	-1.0431	10	0.22109	T	0.4	3.1135	4.4063	0.11411	0.1255:0.4541:0.3284:0.092	.	371;371	O14830-2;O14830	.;PPE2_HUMAN	S	371	ENSP00000286719:R371S	ENSP00000286719:R371S	R	-	3	2	PPEF2	77016671	0.088000	0.21588	0.444000	0.26895	0.055000	0.15305	0.016000	0.13377	-0.095000	0.12351	-0.500000	0.04577	AGG		0.657	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239	
IBSP	3381	broad.mit.edu	37	4	88723528	88723528	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr4:88723528A>C	ENST00000226284.5	+	2	82	c.15A>C	c.(13-15)ttA>ttC	p.L5F		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	5					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)		p.L5F(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		AGACTGCTTTAATTTTGCTCA	0.294																																					p.L5F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A15C	4						.						60.0	59.0	60.0					4																	88723528		2202	4297	6499	88942552	SO:0001583	missense	3381	exon2				CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.15A>C	4.37:g.88723528A>C	ENSP00000226284:p.Leu5Phe	Somatic		Capture	Illumina HiSeq	Phase_I	88942552	NM_004967		Missense_Mutation	SNP	ENST00000226284.5	37	CCDS3624.1	.	.	.	.	.	.	.	.	.	.	A	12.84	2.059534	0.36373	.	.	ENSG00000029559	ENST00000226284	T	0.19532	2.14	5.48	1.08	0.20341	.	0.386869	0.21802	N	0.068917	T	0.10423	0.0255	N	0.16656	0.425	0.39172	D	0.962602	B	0.17038	0.02	B	0.15052	0.012	T	0.11966	-1.0566	10	0.38643	T	0.18	.	5.5582	0.17129	0.4965:0.2744:0.0:0.2291	.	5	P21815	SIAL_HUMAN	F	5	ENSP00000226284:L5F	ENSP00000226284:L5F	L	+	3	2	IBSP	88942552	0.985000	0.35326	0.997000	0.53966	0.994000	0.84299	0.103000	0.15292	0.915000	0.36847	0.477000	0.44152	TTA		0.294	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253050.2		
F11	2160	broad.mit.edu	37	4	187197019	187197019	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr4:187197019T>G	ENST00000403665.2	+	6	916	c.564T>G	c.(562-564)ttT>ttG	p.F188L	F11_ENST00000264692.4_Missense_Mutation_p.F136L	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	188	Apple 2. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)	p.F188L(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	TGTCTGGATTTTCACTGAAAT	0.368																																					p.F188L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T564G	4						.						106.0	97.0	100.0					4																	187197019		2203	4300	6503	187434013	SO:0001583	missense	2160	exon6			M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.564T>G	4.37:g.187197019T>G	ENSP00000384957:p.Phe188Leu	Somatic		Capture	Illumina HiSeq	Phase_I	187434013	NM_000128	D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	ENST00000403665.2	37	CCDS3847.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.84|17.84	3.488127|3.488127	0.64074|0.64074	.|.	.|.	ENSG00000088926|ENSG00000088926	ENST00000452239|ENST00000403665;ENST00000264692	D|D;D	0.94046|0.89681	-3.34|-2.55;-2.41	5.46|5.46	3.08|3.08	0.35506|0.35506	.|Apple domain (2);PAN-1 domain (1);Apple-like (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.93798|0.93798	0.8017|0.8017	M|M	0.89785|0.89785	3.06|3.06	0.49130|0.49130	D|D	0.999759|0.999759	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.92089|0.92089	0.5679|0.5679	8|10	0.87932|0.87932	D|D	0|0	.|.	4.7435|4.7435	0.13026|0.13026	0.0:0.451:0.0:0.549|0.0:0.451:0.0:0.549	.|.	.|188	.|P03951	.|FA11_HUMAN	C|L	4|188;136	ENSP00000397401:F4C|ENSP00000384957:F188L;ENSP00000264692:F136L	ENSP00000397401:F4C|ENSP00000264692:F136L	F|F	+|+	2|3	0|2	F11|F11	187434013|187434013	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.395000|0.395000	0.30598|0.30598	1.355000|1.355000	0.34068|0.34068	0.884000|0.884000	0.36064|0.36064	0.533000|0.533000	0.62120|0.62120	TTT|TTT		0.368	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4		
CTNND2	1501	broad.mit.edu	37	5	11364899	11364899	+	Silent	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr5:11364899G>A	ENST00000304623.8	-	8	1470	c.1281C>T	c.(1279-1281)cgC>cgT	p.R427R	CTNND2_ENST00000359640.2_Silent_p.R427R|CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000511377.1_Silent_p.R336R|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000503622.1_Silent_p.R90R	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	427					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R427R(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TCTGATAGACGCGGTCTTCAT	0.617																																					p.R427R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1281T	5						.						52.0	55.0	54.0					5																	11364899		2203	4300	6503	11417899	SO:0001819	synonymous_variant	1501	exon8			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1281C>T	5.37:g.11364899G>A		Somatic		Capture	Illumina HiSeq	Phase_I	11417899	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	CCDS3881.1																																																																																				0.617	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
CCDC112	153733	broad.mit.edu	37	5	114620570	114620570	+	5'UTR	SNP	A	A	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr5:114620570A>G	ENST00000512261.1	-	0	191				CCDC112_ENST00000506442.1_5'UTR|CCDC112_ENST00000379611.5_Silent_p.R51R|CCDC112_ENST00000503027.1_Intron|CCDC112_ENST00000395557.4_5'UTR			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112									p.R51R(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		GATGAAAAGGACGAATTCCAC	0.318																																					p.R51R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T153C	5						.						83.0	82.0	83.0					5																	114620570		2202	4300	6502	114648469	SO:0001623	5_prime_UTR_variant	153733	exon2			BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.-226T>C	5.37:g.114620570A>G		Somatic		Capture	Illumina HiSeq	Phase_I	114648469	NM_001040440	Q6A334	Silent	SNP	ENST00000512261.1	37	CCDS4117.1																																																																																				0.318	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370999.1	NM_152549	
ACSL6	23305	broad.mit.edu	37	5	131296255	131296255	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr5:131296255C>G	ENST00000379240.1	-	19	1995	c.1842G>C	c.(1840-1842)aaG>aaC	p.K614N	ACSL6_ENST00000357096.1_Missense_Mutation_p.K539N|ACSL6_ENST00000379244.1_Missense_Mutation_p.K614N|ACSL6_ENST00000379264.2_Missense_Mutation_p.K639N|ACSL6_ENST00000296869.4_Missense_Mutation_p.K639N|ACSL6_ENST00000544770.1_Missense_Mutation_p.K523N|ACSL6_ENST00000379255.1_Missense_Mutation_p.K539N|ACSL6_ENST00000431707.1_Missense_Mutation_p.K594N|ACSL6_ENST00000379246.1_Missense_Mutation_p.K625N|ACSL6_ENST00000379249.3_Missense_Mutation_p.K614N|ACSL6_ENST00000543479.1_Missense_Mutation_p.K614N|ACSL6_ENST00000379272.2_Missense_Mutation_p.K629N|AC034228.4_ENST00000446275.1_RNA			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	614					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)	p.K639N(2)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAATTCCTCTCTTCTGGGCCC	0.463																																					p.K639N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1917C	5						.						156.0	144.0	148.0					5																	131296255		2203	4300	6503	131324154	SO:0001583	missense	23305	exon19			AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.1842G>C	5.37:g.131296255C>G	ENSP00000368542:p.Lys614Asn	Somatic		Capture	Illumina HiSeq	Phase_I	131324154	NM_001009185	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	37		.	.	.	.	.	.	.	.	.	.	C	13.15	2.151134	0.38021	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479	T;T;T;T;T;T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27	5.81	3.12	0.35913	.	0.041017	0.85682	D	0.000000	T	0.15955	0.0384	L	0.45581	1.43	0.58432	D	0.999998	B;B;B;B;B;B;B	0.09022	0.002;0.002;0.0;0.001;0.001;0.002;0.002	B;B;B;B;B;B;B	0.18263	0.018;0.012;0.005;0.008;0.012;0.021;0.012	T	0.03773	-1.1005	10	0.42905	T	0.14	.	10.5861	0.45284	0.0:0.7364:0.0:0.2636	.	614;629;604;614;539;639;639	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	N	614;639;629;539;539;639;625;614;523;614;594;614	ENSP00000368551:K614N;ENSP00000368566:K639N;ENSP00000368574:K629N;ENSP00000349608:K539N;ENSP00000368557:K539N;ENSP00000296869:K639N;ENSP00000368548:K625N;ENSP00000368546:K614N;ENSP00000445154:K523N;ENSP00000368542:K614N;ENSP00000413329:K594N;ENSP00000442124:K614N	ENSP00000296869:K639N	K	-	3	2	ACSL6	131324154	1.000000	0.71417	0.995000	0.50966	0.821000	0.46438	1.658000	0.37376	0.388000	0.25054	0.655000	0.94253	AAG		0.463	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256	
TRPC7	57113	broad.mit.edu	37	5	135692610	135692610	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr5:135692610C>T	ENST00000513104.1	-	2	748	c.466G>A	c.(466-468)Gag>Aag	p.E156K	TRPC7_ENST00000426057.2_Missense_Mutation_p.E156K|TRPC7_ENST00000355180.3_Missense_Mutation_p.E156K	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	156					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.E156K(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GTGCCGTCCTCGTCGTAGGCA	0.667																																					p.E156K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G466A	5						.						127.0	135.0	132.0					5																	135692610		2203	4300	6503	135720509	SO:0001583	missense	57113	exon2			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.466G>A	5.37:g.135692610C>T	ENSP00000426070:p.Glu156Lys	Somatic		Capture	Illumina HiSeq	Phase_I	135720509	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	37	CCDS47267.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.0|26.0	4.690212|4.690212	0.88735|0.88735	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193|ENST00000352189;ENST00000378459;ENST00000502753	T;T;T|.	0.69561|.	-0.41;-0.41;-0.41|.	5.27|5.27	5.27|5.27	0.74061|0.74061	Ankyrin repeat-containing domain (2);|.	0.047372|.	0.85682|.	D|.	0.000000|.	T|T	0.70133|0.70133	0.3189|0.3189	L|L	0.48986|0.48986	1.54|1.54	0.45580|0.45580	D|D	0.998525|0.998525	D;P;P;P|.	0.76494|.	0.999;0.929;0.893;0.807|.	D;P;P;B|.	0.68621|.	0.959;0.69;0.517;0.246|.	T|T	0.65796|0.65796	-0.6081|-0.6081	10|5	0.17832|.	T|.	0.49|.	-24.1183|-24.1183	19.0978|19.0978	0.93260|0.93260	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	156;156;156;156|.	Q8IWP7;F5H5U9;Q70T25;Q9HCX4|.	.;.;.;TRPC7_HUMAN|.	K|Q	156|155	ENSP00000347312:E156K;ENSP00000441628:E156K;ENSP00000426070:E156K|.	ENSP00000265193:E156K|.	E|R	-|-	1|2	0|0	TRPC7|TRPC7	135720509|135720509	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.651000|7.651000	0.83577|0.83577	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.667	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
PCDHA6	56142	broad.mit.edu	37	5	140209679	140209679	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr5:140209679C>T	ENST00000529310.1	+	1	2117	c.2003C>T	c.(2002-2004)tCg>tTg	p.S668L	PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	668	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S668L(2)		NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTCTGGTGTCGCTGGTGGAG	0.687																																					p.S668L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2003T	5						.						38.0	45.0	43.0					5																	140209679		2202	4296	6498	140189863	SO:0001583	missense	56142	exon1			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.2003C>T	5.37:g.140209679C>T	ENSP00000433378:p.Ser668Leu	Somatic		Capture	Illumina HiSeq	Phase_I	140189863	NM_018909	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	C	5.057	0.196140	0.09599	.	.	ENSG00000081842	ENST00000529310	T	0.52754	0.65	3.76	3.76	0.43208	Cadherin (4);Cadherin-like (1);	0.000000	0.33180	U	0.005182	T	0.35307	0.0927	L	0.52011	1.625	0.19300	N	0.999972	P;B	0.36378	0.55;0.451	B;B	0.28465	0.09;0.072	T	0.35176	-0.9799	10	0.46703	T	0.11	.	8.6357	0.33945	0.0:0.8168:0.0:0.1832	.	668;668	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	L	668	ENSP00000433378:S668L	ENSP00000433378:S668L	S	+	2	0	PCDHA6	140189863	0.000000	0.05858	0.991000	0.47740	0.005000	0.04900	0.538000	0.23160	2.105000	0.64084	0.306000	0.20318	TCG		0.687	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
KIAA0141	9812	broad.mit.edu	37	5	141316862	141316862	+	Missense_Mutation	SNP	G	G	A	rs137962377		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr5:141316862G>A	ENST00000432126.2	+	11	1383	c.1249G>A	c.(1249-1251)Gct>Act	p.A417T	KIAA0141_ENST00000194118.4_Missense_Mutation_p.A417T	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	417					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)		p.A417S(1)|p.A417T(1)		endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGTCAGCCGCTCTGGGAAA	0.567																																					p.A417T												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1249A	5						.	G	THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	100.0	104.0	103.0		1249,1249	5.6	1.0	5	dbSNP_134	103	0,8600		0,0,4300	yes	missense,missense	KIAA0141	NM_001142603.1,NM_014773.3	58,58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	417/516,417/516	141316862	1,13005	2203	4300	6503	141297046	SO:0001583	missense	9812	exon11			BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.1249G>A	5.37:g.141316862G>A	ENSP00000396225:p.Ala417Thr	Somatic		Capture	Illumina HiSeq	Phase_I	141297046	NM_001142603	Q969R4|Q96EU9	Missense_Mutation	SNP	ENST00000432126.2	37	CCDS4268.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.537031	0.45176	2.27E-4	0.0	ENSG00000081791	ENST00000432126;ENST00000194118	T;T	0.52526	0.66;0.66	5.6	5.6	0.85130	Tetratricopeptide-like helical (1);	0.243379	0.40908	D	0.000996	T	0.64371	0.2592	M	0.67953	2.075	0.37432	D	0.914058	D	0.89917	1.0	D	0.91635	0.999	T	0.62220	-0.6900	10	0.15952	T	0.53	-10.1976	15.1108	0.72355	0.0:0.0:1.0:0.0	.	417	Q14154	DELE_HUMAN	T	417	ENSP00000396225:A417T;ENSP00000194118:A417T	ENSP00000194118:A417T	A	+	1	0	KIAA0141	141297046	0.999000	0.42202	0.954000	0.39281	0.144000	0.21451	4.008000	0.57103	2.648000	0.89879	0.655000	0.94253	GCT		0.567	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251863.2	NM_014773	
FBXL7	23194	broad.mit.edu	37	5	15936744	15936744	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr5:15936744G>A	ENST00000504595.1	+	4	1406	c.925G>A	c.(925-927)Gtc>Atc	p.V309I	FBXL7_ENST00000510662.1_Missense_Mutation_p.V262I|FBXL7_ENST00000329673.7_Missense_Mutation_p.V297I|MIR887_ENST00000401258.1_RNA	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	309					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.V309I(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						GCGCCGCTGCGTCCGCCTGAC	0.652																																					p.V309I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G925A	5						.						39.0	43.0	41.0					5																	15936744		2188	4285	6473	15989744	SO:0001583	missense	23194	exon4			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.925G>A	5.37:g.15936744G>A	ENSP00000423630:p.Val309Ile	Somatic		Capture	Illumina HiSeq	Phase_I	15989744	NM_012304	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	G	2.691	-0.273254	0.05716	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.02395	4.31;4.38;4.31	5.16	5.16	0.70880	.	0.380499	0.30269	N	0.010002	T	0.01905	0.0060	N	0.11255	0.115	0.31291	N	0.689393	B	0.06786	0.001	B	0.08055	0.003	T	0.26883	-1.0090	10	0.30078	T	0.28	.	9.4235	0.38565	0.1583:0.0:0.8417:0.0	.	309	Q9UJT9	FBXL7_HUMAN	I	309;262;297	ENSP00000423630:V309I;ENSP00000425184:V262I;ENSP00000329632:V297I	ENSP00000329632:V297I	V	+	1	0	FBXL7	15989744	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	2.164000	0.42387	2.414000	0.81942	0.655000	0.94253	GTC		0.652	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
PRLR	5618	broad.mit.edu	37	5	35089686	35089686	+	Silent	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr5:35089686G>A	ENST00000382002.5	-	3	463	c.37C>T	c.(37-39)Ctg>Ttg	p.L13L	PRLR_ENST00000513753.1_Silent_p.L13L|PRLR_ENST00000348262.3_Silent_p.L13L|PRLR_ENST00000542609.1_Silent_p.L13L|PRLR_ENST00000342362.5_Silent_p.L13L|PRLR_ENST00000397391.3_5'UTR|PRLR_ENST00000310101.5_Silent_p.L13L|PRLR_ENST00000511486.1_Silent_p.L13L|PRLR_ENST00000231423.3_Silent_p.L13L	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	13					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)	p.L13L(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	AAAAGTAGCAGAGTGAAAACG	0.468																																					p.L13L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C37T	5						.						140.0	128.0	132.0					5																	35089686		2203	4300	6503	35125443	SO:0001819	synonymous_variant	5618	exon3				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.37C>T	5.37:g.35089686G>A		Somatic		Capture	Illumina HiSeq	Phase_I	35125443	NM_000949	B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Silent	SNP	ENST00000382002.5	37	CCDS3909.1																																																																																				0.468	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207575.2		
APC	324	broad.mit.edu	37	5	112175193	112175193	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr5:112175193delC	ENST00000457016.1	+	16	4282	c.3902delC	c.(3901-3903)accfs	p.T1301fs	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.T1301fs|APC_ENST00000257430.4_Frame_Shift_Del_p.T1301fs			P25054	APC_HUMAN	adenomatous polyposis coli	1301	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.T1301fs*10(3)|p.T1301S(2)|p.?(1)|p.T1293fs*2(1)|p.K1192fs*3(1)|p.L1302fs*13(1)|p.L1302fs*3(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCTGCTAATACCCTGCAAATA	0.403		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.T1283fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,stomach,NS,Substitution - Missense,0 	.	10	Deletion - Frameshift(6)|Substitution - Missense(2)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(6)|stomach(2)|soft_tissue(1)|skin(1)	c.3848delC	5						.						54.0	56.0	55.0					5																	112175193		2202	4300	6502	112203092	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3902delC	5.37:g.112175193delC	ENSP00000413133:p.Thr1301fs	Somatic		Capture	Illumina HiSeq	Phase_I	112203092	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.403	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PDE6A	5145	broad.mit.edu	37	5	149286891	149286891	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr5:149286891A>G	ENST00000255266.5	-	7	1168	c.1049T>C	c.(1048-1050)gTt>gCt	p.V350A		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	350	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.V350A(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	ATTCTGGGCAACATAAGCTGG	0.478																																					p.V350A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1049C	5						.						107.0	108.0	107.0					5																	149286891		2203	4300	6503	149267084	SO:0001583	missense	5145	exon7				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.1049T>C	5.37:g.149286891A>G	ENSP00000255266:p.Val350Ala	Somatic		Capture	Illumina HiSeq	Phase_I	149267084	NM_000440	Q0P638	Missense_Mutation	SNP	ENST00000255266.5	37	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	A	16.03	3.006102	0.54361	.	.	ENSG00000132915	ENST00000255266	T	0.72051	-0.62	5.55	5.55	0.83447	GAF (2);	0.000000	0.85682	D	0.000000	D	0.84383	0.5460	M	0.92026	3.265	0.58432	D	0.999999	P	0.49559	0.925	P	0.56648	0.803	D	0.87391	0.2363	10	0.59425	D	0.04	.	13.6595	0.62359	1.0:0.0:0.0:0.0	.	350	P16499	PDE6A_HUMAN	A	350	ENSP00000255266:V350A	ENSP00000255266:V350A	V	-	2	0	PDE6A	149267084	1.000000	0.71417	0.996000	0.52242	0.094000	0.18550	9.108000	0.94275	2.117000	0.64856	0.533000	0.62120	GTT		0.478	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2		
GRIK2	2898	broad.mit.edu	37	6	102337634	102337634	+	Silent	SNP	A	A	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:102337634A>G	ENST00000421544.1	+	11	2134	c.1644A>G	c.(1642-1644)acA>acG	p.T548T	GRIK2_ENST00000369134.4_Silent_p.T499T|GRIK2_ENST00000369138.1_Silent_p.T548T|GRIK2_ENST00000369137.3_Intron|GRIK2_ENST00000318991.6_Silent_p.T548T|GRIK2_ENST00000413795.1_Silent_p.T548T	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	548					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.T548T(2)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CCAATGGTACAAACCCAGGCG	0.458																																					p.T548T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A1644G	6						.						195.0	190.0	192.0					6																	102337634		2203	4300	6503	102444327	SO:0001819	synonymous_variant	2898	exon11				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1644A>G	6.37:g.102337634A>G		Somatic		Capture	Illumina HiSeq	Phase_I	102444327	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Silent	SNP	ENST00000421544.1	37	CCDS5048.1																																																																																				0.458	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
RSPO3	84870	broad.mit.edu	37	6	127476526	127476526	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:127476526A>G	ENST00000356698.4	+	4	1166	c.577A>G	c.(577-579)Aca>Gca	p.T193A	RSPO3_ENST00000368317.3_Missense_Mutation_p.T193A	NM_032784.3	NP_116173.2	Q9BXY4	RSPO3_HUMAN	R-spondin 3	193	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)	extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.T193A(1)	PTPRK/RSPO3(10)	breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17				GBM - Glioblastoma multiforme(226;0.0555)		GTGTCCCCCAACAAATGAGAC	0.423																																					p.T193A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A577G	6						.						98.0	88.0	91.0					6																	127476526		2203	4300	6503	127518219	SO:0001583	missense	84870	exon4			BC022367	CCDS5135.1	6q22.33	2013-02-28	2011-06-29	2005-08-08	ENSG00000146374	ENSG00000146374		"""Endogenous ligands"""	20866	protein-coding gene	gene with protein product		610574	"""thrombospondin, type I, domain containing 2"", ""R-spondin 3 homolog (Xenopus laevis)"""	THSD2		10842357, 15469841	Standard	NM_032784		Approved	FLJ14440	uc003qar.3	Q9BXY4	OTTHUMG00000015521	ENST00000356698.4:c.577A>G	6.37:g.127476526A>G	ENSP00000349131:p.Thr193Ala	Somatic		Capture	Illumina HiSeq	Phase_I	127518219	NM_032784	B2RC27|Q5VTV4|Q96K87	Missense_Mutation	SNP	ENST00000356698.4	37	CCDS5135.1	.	.	.	.	.	.	.	.	.	.	A	12.63	1.994217	0.35226	.	.	ENSG00000146374	ENST00000356698;ENST00000368317	T;T	0.79940	-1.32;-1.32	5.54	4.4	0.53042	.	0.305898	0.39687	N	0.001283	T	0.52565	0.1742	L	0.31294	0.92	0.09310	N	0.999999	B;B	0.26445	0.144;0.149	B;B	0.32211	0.107;0.142	T	0.37197	-0.9716	10	0.13853	T	0.58	-23.4653	10.8772	0.46917	0.9266:0.0:0.0734:0.0	.	193;193	Q9BXY4-2;Q9BXY4	.;RSPO3_HUMAN	A	193	ENSP00000349131:T193A;ENSP00000357300:T193A	ENSP00000349131:T193A	T	+	1	0	RSPO3	127518219	0.055000	0.20627	0.929000	0.37066	0.975000	0.68041	2.877000	0.48506	2.124000	0.65301	0.455000	0.32223	ACA		0.423	RSPO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042111.1	NM_032784	
AKAP12	9590	broad.mit.edu	37	6	151670378	151670378	+	Silent	SNP	G	G	A	rs145689161		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:151670378G>A	ENST00000253332.1	+	3	1041	c.852G>A	c.(850-852)ccG>ccA	p.P284P	AKAP12_ENST00000402676.2_Silent_p.P284P|AKAP12_ENST00000354675.6_Silent_p.P186P|AKAP12_ENST00000359755.5_Silent_p.P179P|snoU13_ENST00000458767.1_RNA			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	284	Involved in PKC-binding. {ECO:0000305}.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)	p.P284P(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CAGAATCTCCGACTAGTCCCG	0.488													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18246	0.0		0.0	False		,,,				2504	0.0				p.P284P	Melanoma(141;1616 1805 10049 24534 51979)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G852A	6						.	G	,	7,4399	14.3+/-33.2	0,7,2196	46.0	50.0	49.0		852,558	-9.9	0.0	6	dbSNP_134	49	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	AKAP12	NM_005100.3,NM_144497.2	,	0,8,6495	AA,AG,GG		0.0116,0.1589,0.0615	,	284/1783,186/1685	151670378	8,12998	2203	4300	6503	151712071	SO:0001819	synonymous_variant	9590	exon4			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.852G>A	6.37:g.151670378G>A		Somatic		Capture	Illumina HiSeq	Phase_I	151712071	NM_005100	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	37	CCDS5229.1																																																																																				0.488	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1		
OPRM1	4988	broad.mit.edu	37	6	154412422	154412422	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:154412422G>C	ENST00000330432.7	+	3	1216	c.979G>C	c.(979-981)Ggt>Cgt	p.G327R	OPRM1_ENST00000452687.2_Missense_Mutation_p.G327R|OPRM1_ENST00000428397.2_Missense_Mutation_p.G327R|OPRM1_ENST00000518759.1_Missense_Mutation_p.G246R|OPRM1_ENST00000337049.4_Missense_Mutation_p.G327R|OPRM1_ENST00000419506.2_Missense_Mutation_p.G327R|OPRM1_ENST00000522236.1_Missense_Mutation_p.G227R|OPRM1_ENST00000360422.4_Missense_Mutation_p.G327R|OPRM1_ENST00000229768.5_Missense_Mutation_p.G327R|OPRM1_ENST00000414028.2_Missense_Mutation_p.G327R|OPRM1_ENST00000524163.1_Missense_Mutation_p.G327R|OPRM1_ENST00000522555.1_Missense_Mutation_p.G227R|OPRM1_ENST00000434900.2_Missense_Mutation_p.G420R|OPRM1_ENST00000435918.2_Missense_Mutation_p.G327R|OPRM1_ENST00000520708.1_Missense_Mutation_p.G227R	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1	327					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)	p.G327R(2)|p.G420R(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CATTGCTCTAGGTTACACAAA	0.438																																					p.G327R												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G979C	6						.						130.0	133.0	132.0					6																	154412422		2101	4254	6355	154454115	SO:0001583	missense	4988	exon3			L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.979G>C	6.37:g.154412422G>C	ENSP00000328264:p.Gly327Arg	Somatic		Capture	Illumina HiSeq	Phase_I	154454115	NM_000914	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	37	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591593	0.86953	.	.	ENSG00000112038	ENST00000434900;ENST00000520708;ENST00000518759;ENST00000330432;ENST00000360422;ENST00000428397;ENST00000452687;ENST00000229768;ENST00000419506;ENST00000524163;ENST00000414028;ENST00000435918;ENST00000337049;ENST00000522555;ENST00000522236	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13	5.86	5.86	0.93980	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.75568	0.3867	H	0.97023	3.925	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.994;1.0;0.999	D	0.83445	0.0045	10	0.87932	D	0	.	20.1837	0.98210	0.0:0.0:1.0:0.0	.	327;327;327;327;420;246;227;327;327;327;327;327	P35372-4;P35372-8;P35372-11;P35372-9;P35372-10;B8Q1L9;Q6UPP1;P35372-5;P35372;P35372-7;P35372-3;P35372-2	.;.;.;.;.;.;.;.;OPRM_HUMAN;.;.;.	R	420;227;246;327;327;327;327;327;327;327;327;327;327;227;227	ENSP00000394624:G420R;ENSP00000430876:G227R;ENSP00000430260:G246R;ENSP00000328264:G327R;ENSP00000353598:G327R;ENSP00000411903:G327R;ENSP00000410497:G327R;ENSP00000229768:G327R;ENSP00000403549:G327R;ENSP00000430097:G327R;ENSP00000399359:G327R;ENSP00000413752:G327R;ENSP00000338381:G327R;ENSP00000429719:G227R;ENSP00000429373:G227R	ENSP00000229768:G327R	G	+	1	0	OPRM1	154454115	1.000000	0.71417	0.982000	0.44146	0.994000	0.84299	9.869000	0.99810	2.774000	0.95407	0.650000	0.86243	GGT		0.438	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
KIF13A	63971	broad.mit.edu	37	6	17764967	17764967	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:17764967C>A	ENST00000259711.6	-	39	4897	c.4792G>T	c.(4792-4794)Ggc>Tgc	p.G1598C	KIF13A_ENST00000378826.2_Missense_Mutation_p.G1563C|KIF13A_ENST00000378843.2_Missense_Mutation_p.G1550C|KIF13A_ENST00000378816.5_Missense_Mutation_p.G1563C|KIF13A_ENST00000378814.5_Missense_Mutation_p.G1550C	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1598					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G1598C(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GAAAAGTAGCCACTGGTAATA	0.517																																					p.G1598C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4792T	6						.						77.0	78.0	78.0					6																	17764967		2029	4188	6217	17872946	SO:0001583	missense	63971	exon39			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.4792G>T	6.37:g.17764967C>A	ENSP00000259711:p.Gly1598Cys	Somatic		Capture	Illumina HiSeq	Phase_I	17872946	NM_022113	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.850389	0.91277	.	.	ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71;0.71	6.07	6.07	0.98685	.	0.059254	0.64402	D	0.000003	T	0.55689	0.1936	L	0.32530	0.975	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.57365	-0.7824	10	0.87932	D	0	.	20.6525	0.99598	0.0:1.0:0.0:0.0	.	1550;1563;1598;1550	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	C	1550;602;1598;1563;1550;1563	ENSP00000368091:G1550C;ENSP00000425616:G602C;ENSP00000259711:G1598C;ENSP00000368103:G1563C;ENSP00000368120:G1550C;ENSP00000368093:G1563C	ENSP00000259711:G1598C	G	-	1	0	KIF13A	17872946	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.469000	0.80959	2.890000	0.99128	0.585000	0.79938	GGC		0.517	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
BTN2A3P	54718	broad.mit.edu	37	6	26426508	26426508	+	RNA	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:26426508G>A	ENST00000466808.2	+	0	824							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.E155K(1)									GAGAGACCACGAGGACGGGGG	0.582																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	6						.						63.0	53.0	57.0					6																	26426508		2203	4300	6503	26534487			54718	.			AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26426508G>A		Somatic		Capture	Illumina HiSeq	Phase_I	26534487	.	A6NEF4	Missense_Mutation	SNP	ENST00000466808.2	37																																																																																					0.582	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000040118.4	NR_027795	
ZSCAN31	64288	broad.mit.edu	37	6	28297163	28297163	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:28297163G>A	ENST00000414429.1	-	6	1201	c.298C>T	c.(298-300)Cgg>Tgg	p.R100W	ZSCAN31_ENST00000446474.1_Intron|ZSCAN31_ENST00000344279.6_Missense_Mutation_p.R100W|ZSCAN31_ENST00000396838.2_Missense_Mutation_p.R100W|ZSCAN31_ENST00000481934.1_5'Flank|ZSCAN31_ENST00000439158.1_Missense_Mutation_p.R100W			Q96LW9	ZSC31_HUMAN	zinc finger and SCAN domain containing 31	100	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R100W(1)									TGGTGCTCCCGCACCCAGGCC	0.562																																					p.R100W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C298T	6						.						125.0	139.0	134.0					6																	28297163		2203	4300	6503	28405142	SO:0001583	missense	64288	exon6				CCDS4649.1, CCDS59001.1	6p	2013-01-09	2013-01-08	2013-01-08	ENSG00000235109	ENSG00000235109		"""-"", ""Zinc fingers, C2H2-type"""	14097	protein-coding gene	gene with protein product		610794	"""zinc finger protein 310 pseudogene"", ""zinc finger protein 323"""	ZNF310P, ZNF323			Standard	NM_001135216		Approved		uc003nla.3	Q96LW9	OTTHUMG00000014518	ENST00000414429.1:c.298C>T	6.37:g.28297163G>A	ENSP00000390076:p.Arg100Trp	Somatic		Capture	Illumina HiSeq	Phase_I	28405142	NM_145909	Q6P178|Q8WWS5	Missense_Mutation	SNP	ENST00000414429.1	37	CCDS4649.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489181	0.64074	.	.	ENSG00000235109	ENST00000396838;ENST00000439158;ENST00000414429;ENST00000344279;ENST00000453745;ENST00000439636;ENST00000447021;ENST00000426756;ENST00000446222	T;T;T;T;T;T;T;T;T	0.04809	3.55;3.55;3.55;3.55;3.55;3.55;3.55;3.55;3.55	4.76	-2.01	0.07410	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.02848	0.0085	M	0.87827	2.91	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.36578	-0.9742	9	0.87932	D	0	.	5.7558	0.18172	0.382:0.0:0.4586:0.1594	.	100	Q96LW9	ZN323_HUMAN	W	100	ENSP00000380050:R100W;ENSP00000413705:R100W;ENSP00000390076:R100W;ENSP00000345339:R100W;ENSP00000389479:R100W;ENSP00000412519:R100W;ENSP00000416108:R100W;ENSP00000406376:R100W;ENSP00000411033:R100W	ENSP00000345339:R100W	R	-	1	2	ZNF323	28405142	0.000000	0.05858	0.008000	0.14137	0.967000	0.64934	-1.423000	0.02450	-0.306000	0.08818	-0.253000	0.11424	CGG		0.562	ZSCAN31-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346804.1	NM_030899	
MUC21	394263	broad.mit.edu	37	6	30954347	30954347	+	Missense_Mutation	SNP	C	C	T	rs144625089		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:30954347C>T	ENST00000376296.3	+	2	636	c.395C>T	c.(394-396)gCc>gTc	p.A132V	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	132	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A132V(2)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TCCAGTGGGGCCAGCACAGCC	0.612																																					p.A132V												.	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.C395T	6						.						164.0	154.0	157.0					6																	30954347		2203	4300	6503	31062326	SO:0001583	missense	394263	exon2			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.395C>T	6.37:g.30954347C>T	ENSP00000365473:p.Ala132Val	Somatic		Capture	Illumina HiSeq	Phase_I	31062326	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.435486	0.25813	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.04119	3.7	3.01	2.1	0.27182	.	.	.	.	.	T	0.00784	0.0026	N	0.08118	0	0.09310	N	1	B	0.20988	0.05	B	0.20767	0.031	T	0.47598	-0.9105	8	.	.	.	.	7.2947	0.26387	0.2628:0.7372:0.0:0.0	.	132	Q5SSG8	MUC21_HUMAN	V	132	ENSP00000365473:A132V	.	A	+	2	0	MUC21	31062326	0.000000	0.05858	0.003000	0.11579	0.140000	0.21249	0.351000	0.20096	0.799000	0.34018	0.485000	0.47835	GCC		0.612	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
PRPH2	5961	broad.mit.edu	37	6	42689706	42689706	+	Missense_Mutation	SNP	G	G	A	rs563581127		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:42689706G>A	ENST00000230381.5	-	1	606	c.367C>T	c.(367-369)Cgg>Tgg	p.R123W		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	123					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.R123W(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			AGCGAGCCCCGAAGCAGAAAG	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		18877	0.0		0.0	False		,,,				2504	0.001				p.R123W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C367T	6	GRCh37	CM090728	PRPH2	M		.						57.0	57.0	57.0					6																	42689706		2203	4300	6503	42797684	SO:0001583	missense	5961	exon1				CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.367C>T	6.37:g.42689706G>A	ENSP00000230381:p.Arg123Trp	Somatic		Capture	Illumina HiSeq	Phase_I	42797684	NM_000322	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000230381.5	37	CCDS4871.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.495989	0.44352	.	.	ENSG00000112619	ENST00000230381	D	0.88818	-2.43	6.08	3.11	0.35812	Tetraspanin, EC2 domain (1);	0.195470	0.51477	N	0.000082	D	0.84160	0.5411	M	0.83223	2.63	0.49051	D	0.999743	B	0.27853	0.191	B	0.33960	0.173	D	0.84197	0.0448	10	0.87932	D	0	.	7.4862	0.27435	0.1512:0.0:0.6265:0.2223	.	123	P23942	PRPH2_HUMAN	W	123	ENSP00000230381:R123W	ENSP00000230381:R123W	R	-	1	2	PRPH2	42797684	0.993000	0.37304	0.311000	0.25182	0.953000	0.61014	1.064000	0.30579	0.912000	0.36772	0.655000	0.94253	CGG		0.547	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1	NM_000322	
PRIM2	5558	broad.mit.edu	37	6	57246856	57246856	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:57246856T>G	ENST00000607273.1	+	7	670	c.583T>G	c.(583-585)Ttt>Gtt	p.F195V	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	195					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.F195V(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TCTGGATTTGTTTCGAGGAAG	0.378																																					p.F195V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T583G	6						.						156.0	134.0	141.0					6																	57246856		1933	4155	6088	57354815	SO:0001583	missense	5558	exon7				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.583T>G	6.37:g.57246856T>G	ENSP00000475738:p.Phe195Val	Somatic		Capture	Illumina HiSeq	Phase_I	57354815	NM_000947	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	ENST00000607273.1	37																																																																																					0.378	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947	
COL12A1	1303	broad.mit.edu	37	6	75840657	75840657	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:75840657C>T	ENST00000322507.8	-	36	6287	c.5978G>A	c.(5977-5979)cGg>cAg	p.R1993Q	COL12A1_ENST00000483888.2_Missense_Mutation_p.R1993Q|COL12A1_ENST00000416123.2_Missense_Mutation_p.R1993Q|COL12A1_ENST00000345356.6_Missense_Mutation_p.R829Q	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1993	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.R1993Q(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CGGAATCAGCCGCTCCAGATG	0.542																																					p.R1993Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5978A	6						.						98.0	100.0	100.0					6																	75840657		2077	4227	6304	75897377	SO:0001583	missense	1303	exon36			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5978G>A	6.37:g.75840657C>T	ENSP00000325146:p.Arg1993Gln	Somatic		Capture	Illumina HiSeq	Phase_I	75897377	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	7.129	0.579483	0.13686	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.6	1.79	0.24919	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.299061	0.29307	N	0.012533	T	0.09818	0.0241	N	0.11364	0.135	0.31065	N	0.713688	B;B	0.19935	0.04;0.0	B;B	0.15484	0.013;0.001	T	0.25537	-1.0129	10	0.25751	T	0.34	.	9.1037	0.36685	0.0:0.6588:0.0:0.3412	.	829;1993	Q99715-2;Q99715	.;COCA1_HUMAN	Q	1993;1993;829;1993;1993	ENSP00000325146:R1993Q;ENSP00000305147:R829Q;ENSP00000412864:R1993Q;ENSP00000421216:R1993Q	ENSP00000325146:R1993Q	R	-	2	0	COL12A1	75897377	0.996000	0.38824	0.983000	0.44433	0.097000	0.18754	2.506000	0.45433	0.038000	0.15604	0.655000	0.94253	CGG		0.542	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
COL12A1	1303	broad.mit.edu	37	6	75851805	75851805	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:75851805C>T	ENST00000322507.8	-	27	5209	c.4900G>A	c.(4900-4902)Gtt>Att	p.V1634I	COL12A1_ENST00000483888.2_Missense_Mutation_p.V1634I|COL12A1_ENST00000416123.2_Missense_Mutation_p.V1634I|COL12A1_ENST00000345356.6_Missense_Mutation_p.V470I	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1634	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.V1634I(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ACTGCAGAAACGCTGACTGTG	0.493																																					p.V1634I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4900A	6						.						174.0	170.0	171.0					6																	75851805		2149	4258	6407	75908525	SO:0001583	missense	1303	exon27			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4900G>A	6.37:g.75851805C>T	ENSP00000325146:p.Val1634Ile	Somatic		Capture	Illumina HiSeq	Phase_I	75908525	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.68|15.68	2.904195|2.904195	0.52333|0.52333	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000419671|ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	.|T;T;T;T	.|0.70749	.|-0.51;-0.51;-0.51;-0.51	6.16|6.16	5.3|5.3	0.74995|0.74995	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.070385	.|0.53938	.|D	.|0.000042	T|T	0.65863|0.65863	0.2732|0.2732	M|M	0.68728|0.68728	2.09|2.09	0.41506|0.41506	D|D	0.988312|0.988312	.|D;D	.|0.60160	.|0.957;0.987	.|P;P	.|0.55455	.|0.555;0.776	T|T	0.68884|0.68884	-0.5291|-0.5291	5|10	.|0.33141	.|T	.|0.24	.|.	6.86|6.86	0.24062|0.24062	0.1312:0.6753:0.1266:0.0669|0.1312:0.6753:0.1266:0.0669	.|.	.|470;1634	.|Q99715-2;Q99715	.|.;COCA1_HUMAN	H|I	375|1634;1634;470;1634;1634	.|ENSP00000325146:V1634I;ENSP00000305147:V470I;ENSP00000412864:V1634I;ENSP00000421216:V1634I	.|ENSP00000325146:V1634I	R|V	-|-	2|1	0|0	COL12A1|COL12A1	75908525|75908525	0.989000|0.989000	0.36119|0.36119	0.814000|0.814000	0.32528|0.32528	0.045000|0.045000	0.14185|0.14185	2.735000|2.735000	0.47377|0.47377	1.632000|1.632000	0.50472|0.50472	0.650000|0.650000	0.86243|0.86243	CGT|GTT		0.493	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
GABRR2	2570	broad.mit.edu	37	6	89974148	89974148	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:89974148G>A	ENST00000402938.3	-	8	1202	c.1069C>T	c.(1069-1071)Cgg>Tgg	p.R357W	GABRR2_ENST00000602399.1_Missense_Mutation_p.R382W	NM_002043.3	NP_002034.3	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 2	357					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.R357W(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(10)|prostate(2)|urinary_tract(1)	21		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	CGCAGCTTCCGTTCCTTGCGC	0.587																																					p.R382W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1144T	6						.						80.0	61.0	67.0					6																	89974148		2203	4300	6503	90030867	SO:0001583	missense	2570	exon8				CCDS5020.2, CCDS5020.3	6q15	2012-06-22	2012-02-03		ENSG00000111886	ENSG00000111886		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4091	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 2"""	137162	"""gamma-aminobutyric acid (GABA) receptor, rho 2"""			1315307	Standard	NM_002043		Approved		uc003pnb.3	P28476	OTTHUMG00000015198	ENST00000402938.3:c.1069C>T	6.37:g.89974148G>A	ENSP00000386029:p.Arg357Trp	Somatic		Capture	Illumina HiSeq	Phase_I	90030867	NM_002043	A2BDE4|Q9H153	Missense_Mutation	SNP	ENST00000402938.3	37	CCDS5020.3	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352489	0.61293	.	.	ENSG00000111886	ENST00000402938	.	.	.	5.93	4.99	0.66335	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.048663	0.85682	D	0.000000	T	0.74891	0.3776	M	0.79805	2.47	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.75519	-0.3289	8	.	.	.	.	13.8131	0.63274	0.0:0.0:0.7424:0.2576	.	382	P28476	GBRR2_HUMAN	W	382	.	.	R	-	1	2	GABRR2	90030867	0.955000	0.32602	0.987000	0.45799	0.605000	0.37080	1.446000	0.35090	2.815000	0.96918	0.561000	0.74099	CGG		0.587	GABRR2-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041482.3		
SOD2	6648	broad.mit.edu	37	6	160106042	160106042	+	Missense_Mutation	SNP	G	G	A	rs143582231	byFrequency	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr6:160106042G>A	ENST00000546087.1	-	6	2056	c.229C>T	c.(229-231)Cgt>Tgt	p.R77C	SOD2_ENST00000367054.2_Missense_Mutation_p.R84C|SOD2_ENST00000367055.4_Missense_Mutation_p.R123C|SOD2_ENST00000538183.2_Missense_Mutation_p.R123C|SOD2_ENST00000444946.2_Intron|SOD2_ENST00000337404.4_Missense_Mutation_p.R84C			P04179	SODM_HUMAN	superoxide dismutase 2, mitochondrial	123					age-dependent response to reactive oxygen species (GO:0001315)|cellular response to ethanol (GO:0071361)|detection of oxygen (GO:0003032)|erythrophore differentiation (GO:0048773)|glutathione metabolic process (GO:0006749)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|hydrogen peroxide biosynthetic process (GO:0050665)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|iron ion homeostasis (GO:0055072)|liver development (GO:0001889)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|oxygen homeostasis (GO:0032364)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to lipopolysaccharide (GO:0032496)|response to manganese ion (GO:0010042)|response to selenium ion (GO:0010269)|response to silicon dioxide (GO:0034021)|response to superoxide (GO:0000303)|response to zinc ion (GO:0010043)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)|vasodilation by acetylcholine involved in regulation of systemic arterial blood pressure (GO:0003069)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|manganese ion binding (GO:0030145)|oxygen binding (GO:0019825)|superoxide dismutase activity (GO:0004784)	p.R123C(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(3)|skin(1)	14		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.103)		OV - Ovarian serous cystadenocarcinoma(65;1.4e-18)|BRCA - Breast invasive adenocarcinoma(81;5.77e-06)		CCAAAGTCACGTTTGATGGCT	0.398													G|||	2	0.000399361	0.0	0.0014	5008	,	,		15195	0.0		0.001	False		,,,				2504	0.0				p.R84C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C250T	6						.	G	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	85.0	77.0	80.0		367,367,250	2.6	1.0	6	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	SOD2	NM_000636.2,NM_001024465.1,NM_001024466.1	180,180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	123/223,123/223,84/184	160106042	1,13005	2203	4300	6503	160026032	SO:0001583	missense	6648	exon3			M36693	CCDS5265.1, CCDS34564.1	6q25	2008-02-05			ENSG00000112096	ENSG00000112096	1.15.1.1		11180	protein-coding gene	gene with protein product		147460					Standard	NM_000636		Approved		uc003qsg.3	P04179	OTTHUMG00000015940	ENST00000546087.1:c.229C>T	6.37:g.160106042G>A	ENSP00000442920:p.Arg77Cys	Somatic		Capture	Illumina HiSeq	Phase_I	160026032	NM_001024466	B2R7R1|B3KUK2|B4DL20|B4E3K9|E1P5A9|P78434|Q16792|Q5TCM1|Q96EE6|Q9P2Z3	Missense_Mutation	SNP	ENST00000546087.1	37		2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	16.52	3.146697	0.57151	0.0	1.16E-4	ENSG00000112096	ENST00000367055;ENST00000538183;ENST00000367054;ENST00000546087;ENST00000337404;ENST00000545162;ENST00000535561;ENST00000537657;ENST00000401980	T;T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.9;0.9;0.86;0.86	5.5	2.57	0.30868	Manganese/iron superoxide dismutase, C-terminal (2);	0.103551	0.64402	N	0.000011	T	0.63534	0.2519	H	0.96805	3.885	0.80722	D	1	D;P;B	0.71674	0.998;0.47;0.263	P;B;B	0.59948	0.866;0.262;0.044	T	0.68746	-0.5327	10	0.87932	D	0	-18.6028	6.2617	0.20903	0.1311:0.0:0.6196:0.2493	.	119;84;123	Q7Z7M4;B4DL20;P04179	.;.;SODM_HUMAN	C	123;123;84;77;84;146;146;77;38	ENSP00000356022:R123C;ENSP00000446252:R123C;ENSP00000356021:R84C;ENSP00000442920:R77C;ENSP00000337127:R84C;ENSP00000441362:R146C;ENSP00000445015:R146C;ENSP00000439191:R77C;ENSP00000384196:R38C	ENSP00000337127:R84C	R	-	1	0	SOD2	160026032	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	4.956000	0.63645	0.811000	0.34303	0.650000	0.86243	CGT		0.398	SOD2-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000399943.1	NM_000636	
ACTL6B	51412	broad.mit.edu	37	7	100247661	100247661	+	Splice_Site	SNP	G	G	A	rs562984475		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr7:100247661G>A	ENST00000160382.5	-	5	573	c.467C>T	c.(466-468)gCc>gTc	p.A156V		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	156					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)	p.A156V(1)		endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CAGAGGATACGCGGTGAGCAC	0.592																																					p.A156V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C467T	7						.						152.0	112.0	126.0					7																	100247661		2203	4300	6503	100085597	SO:0001630	splice_region_variant	51412	exon5			AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.467+1C>T	7.37:g.100247661G>A		Somatic		Capture	Illumina HiSeq	Phase_I	100085597	NM_016188	A4D2D0|O75421	Missense_Mutation	SNP	ENST00000160382.5	37	CCDS5702.1	.	.	.	.	.	.	.	.	.	.	G	36	5.832268	0.97003	.	.	ENSG00000077080	ENST00000160382	D	0.97430	-4.38	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000001	D	0.97660	0.9233	M	0.65677	2.01	0.80722	D	1	D	0.60160	0.987	P	0.59357	0.856	D	0.97332	0.9951	10	0.40728	T	0.16	.	16.8252	0.85929	0.0:0.0:1.0:0.0	.	156	O94805	ACL6B_HUMAN	V	156	ENSP00000160382:A156V	ENSP00000160382:A156V	A	-	2	0	ACTL6B	100085597	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	9.533000	0.98059	2.573000	0.86826	0.455000	0.32223	GCC		0.592	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356745.1	NM_016188	Missense_Mutation
SLC12A9	56996	broad.mit.edu	37	7	100456489	100456489	+	Missense_Mutation	SNP	G	G	A	rs373781782		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr7:100456489G>A	ENST00000354161.3	+	6	915	c.790G>A	c.(790-792)Gtg>Atg	p.V264M	SLC12A9_ENST00000275729.3_Missense_Mutation_p.V175M|SLC12A9_ENST00000415287.1_Missense_Mutation_p.V175M|SLC12A9_ENST00000428758.1_Missense_Mutation_p.V264M|SLC12A9_ENST00000540482.1_Missense_Mutation_p.V264M	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	264					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)	p.V264M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					CACGGGAGCCGTGATGAATTT	0.582																																					p.V264M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G790A	7						.	G	MET/VAL	0,4406		0,0,2203	97.0	75.0	82.0		790	-2.1	0.7	7		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC12A9	NM_020246.2	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	264/915	100456489	1,13005	2203	4300	6503	100294425	SO:0001583	missense	56996	exon6			AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.790G>A	7.37:g.100456489G>A	ENSP00000275730:p.Val264Met	Somatic		Capture	Illumina HiSeq	Phase_I	100294425	NM_020246	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	De_novo_Start_OutOfFrame	SNP	ENST00000354161.3	37	CCDS5707.1	.	.	.	.	.	.	.	.	.	.	g	5.390	0.257113	0.10239	0.0	1.16E-4	ENSG00000146828	ENST00000540482;ENST00000428758;ENST00000275729;ENST00000415287;ENST00000354161;ENST00000416675	D;D;D;D;D;D	0.98835	-5.17;-5.17;-5.17;-5.17;-5.17;-5.17	5.14	-2.11	0.07187	Amino acid permease domain (1);	0.577199	0.17430	N	0.174516	D	0.90995	0.7168	N	0.01668	-0.77	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.11329	0.003;0.006	D	0.86295	0.1676	10	0.38643	T	0.18	.	5.7352	0.18063	0.36:0.401:0.239:0.0	.	175;264	Q9BXP2-2;Q9BXP2	.;S12A9_HUMAN	M	264;264;175;175;264;72	ENSP00000443702:V264M;ENSP00000408301:V264M;ENSP00000275729:V175M;ENSP00000413796:V175M;ENSP00000275730:V264M;ENSP00000410692:V72M	ENSP00000275729:V175M	V	+	1	0	SLC12A9	100294425	0.348000	0.24861	0.654000	0.29608	0.795000	0.44927	0.943000	0.29030	-0.722000	0.04922	-0.544000	0.04233	GTG		0.582	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	NM_020246	
PLOD3	8985	broad.mit.edu	37	7	100855811	100855811	+	Splice_Site	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr7:100855811G>A	ENST00000223127.3	-	9	1403	c.1005C>T	c.(1003-1005)aaC>aaT	p.N335N		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	335					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)	p.N335N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	GGAGTCTCACGTTGTTGTGCA	0.612																																					p.N335N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1005T	7						.						53.0	62.0	59.0					7																	100855811		2203	4299	6502	100642531	SO:0001630	splice_region_variant	8985	exon9			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.1005+1C>T	7.37:g.100855811G>A		Somatic		Capture	Illumina HiSeq	Phase_I	100642531	NM_001084	B2R6W6|Q540C3	De_novo_Start_InFrame	SNP	ENST00000223127.3	37	CCDS5715.1	.	.	.	.	.	.	.	.	.	.	G	0.115	-1.133253	0.01756	.	.	ENSG00000106397	ENST00000541462	.	.	.	4.87	-5.6	0.02497	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.5709	9.093	0.36623	0.7267:0.0:0.1482:0.1252	.	.	.	.	X	240	.	.	R	-	1	2	PLOD3	100642531	0.000000	0.05858	0.005000	0.12908	0.189000	0.23516	-2.218000	0.01219	-1.141000	0.02873	-0.355000	0.07637	CGA		0.612	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347470.1		Silent
LRRC4	64101	broad.mit.edu	37	7	127670407	127670407	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr7:127670407C>T	ENST00000249363.3	-	2	544	c.287G>A	c.(286-288)cGc>cAc	p.R96H	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	96					postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.R96H(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		GTGGAGGTGGCGGAAGGTGTC	0.637																																					p.R96H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G287A	7						.						178.0	179.0	178.0					7																	127670407		2203	4300	6503	127457643	SO:0001583	missense	64101	exon2			AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.287G>A	7.37:g.127670407C>T	ENSP00000249363:p.Arg96His	Somatic		Capture	Illumina HiSeq	Phase_I	127457643	NM_022143	A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Missense_Mutation	SNP	ENST00000249363.3	37	CCDS5799.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.828035	0.71143	.	.	ENSG00000128594	ENST00000249363;ENST00000494115	D;T	0.91464	-2.85;0.41	4.66	3.75	0.43078	.	0.179258	0.35262	N	0.003325	D	0.89160	0.6636	N	0.25332	0.735	0.52099	D	0.999947	D	0.63880	0.993	P	0.56751	0.805	D	0.88533	0.3104	10	0.49607	T	0.09	.	11.5763	0.50864	0.1797:0.8202:0.0:0.0	.	96	Q9HBW1	LRRC4_HUMAN	H	96;14	ENSP00000249363:R96H;ENSP00000418254:R14H	ENSP00000249363:R96H	R	-	2	0	LRRC4	127457643	0.985000	0.35326	0.885000	0.34714	0.999000	0.98932	3.223000	0.51231	1.090000	0.41315	0.655000	0.94253	CGC		0.637	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349170.1	NM_022143	
SDK1	221935	broad.mit.edu	37	7	4153028	4153028	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr7:4153028C>T	ENST00000404826.2	+	24	3681	c.3542C>T	c.(3541-3543)aCg>aTg	p.T1181M	SDK1_ENST00000389531.3_Missense_Mutation_p.T1181M	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1181	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T1181M(3)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACCAGCGTCACGGTCCGTACT	0.647																																					p.T1181M												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C3542T	7						.						101.0	107.0	105.0					7																	4153028		2203	4300	6503	4119554	SO:0001583	missense	221935	exon24			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3542C>T	7.37:g.4153028C>T	ENSP00000385899:p.Thr1181Met	Somatic		Capture	Illumina HiSeq	Phase_I	4119554	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177758	0.57692	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.59638	0.25;0.25	4.92	4.04	0.47022	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.339119	0.27976	N	0.017099	T	0.75882	0.3910	M	0.87971	2.92	0.44181	D	0.996997	D;D	0.89917	0.999;1.0	P;D	0.67103	0.891;0.949	T	0.79412	-0.1814	10	0.87932	D	0	.	10.8848	0.46960	0.0:0.7979:0.1297:0.0724	.	1181;1181	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	M	1181	ENSP00000385899:T1181M;ENSP00000374182:T1181M	ENSP00000374182:T1181M	T	+	2	0	SDK1	4119554	1.000000	0.71417	0.607000	0.28956	0.505000	0.33919	4.552000	0.60747	1.213000	0.43380	-0.126000	0.14955	ACG		0.647	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
COL28A1	340267	broad.mit.edu	37	7	7516766	7516766	+	Missense_Mutation	SNP	C	C	T	rs200523102		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr7:7516766C>T	ENST00000399429.3	-	14	1350	c.1210G>A	c.(1210-1212)Gga>Aga	p.G404R		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	404	Collagen-like 3.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G404R(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		AATCCTTCTCCGGGTAAGCCC	0.473													C|||	1	0.000199681	0.0	0.0	5008	,	,		17461	0.001		0.0	False		,,,				2504	0.0				p.G404R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1210A	7						.	C	ARG/GLY	0,3706		0,0,1853	70.0	71.0	71.0		1210	4.9	1.0	7		71	2,8176		0,2,4087	no	missense	COL28A1	NM_001037763.2	125	0,2,5940	TT,TC,CC		0.0245,0.0,0.0168	probably-damaging	404/1126	7516766	2,11882	1853	4089	5942	7483291	SO:0001583	missense	340267	exon14			AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.1210G>A	7.37:g.7516766C>T	ENSP00000382356:p.Gly404Arg	Somatic		Capture	Illumina HiSeq	Phase_I	7483291	NM_001037763	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	37	CCDS43553.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	21.7	4.185548	0.78677	0.0	2.45E-4	ENSG00000215018	ENST00000399429;ENST00000399419	D	0.99637	-6.29	4.94	4.94	0.65067	.	0.177470	0.35646	U	0.003070	D	0.99750	0.9900	H	0.96748	3.875	0.47476	D	0.999439	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97267	0.9908	10	0.72032	D	0.01	-6.6293	13.8698	0.63612	0.0:1.0:0.0:0.0	.	404;404	Q2UY09-2;Q2UY09	.;COSA1_HUMAN	R	404	ENSP00000382356:G404R	ENSP00000382347:G404R	G	-	1	0	COL28A1	7483291	0.978000	0.34361	0.970000	0.41538	0.992000	0.81027	2.692000	0.47018	2.749000	0.94314	0.491000	0.48974	GGA		0.473	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763	
ZPBP	11055	broad.mit.edu	37	7	50097638	50097638	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr7:50097638T>A	ENST00000046087.2	-	4	503	c.434A>T	c.(433-435)aAa>aTa	p.K145I	ZPBP_ENST00000491129.1_5'Flank|ZPBP_ENST00000419417.1_Missense_Mutation_p.K144I	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	145					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)		p.K145I(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					CACAGTAGGTTTATATTCGAG	0.318																																					p.K144I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A431T	7						.						97.0	97.0	97.0					7																	50097638		2203	4300	6503	50068184	SO:0001583	missense	11055	exon4			D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.434A>T	7.37:g.50097638T>A	ENSP00000046087:p.Lys145Ile	Somatic		Capture	Illumina HiSeq	Phase_I	50068184	NM_001159878	A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Missense_Mutation	SNP	ENST00000046087.2	37	CCDS5509.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.193295	0.78902	.	.	ENSG00000042813	ENST00000046087;ENST00000419417	T;T	0.59772	0.24;0.24	5.66	5.66	0.87406	Immunoglobulin-like (1);	0.000000	0.64402	D	0.000002	T	0.74291	0.3697	M	0.78801	2.425	0.39918	D	0.974129	D;D	0.69078	0.997;0.997	D;D	0.68039	0.955;0.955	T	0.77643	-0.2511	9	.	.	.	-26.9854	13.4081	0.60926	0.0:0.0:0.0:1.0	.	144;145	C9JPU1;Q9BS86	.;ZPBP1_HUMAN	I	145;144	ENSP00000046087:K145I;ENSP00000402071:K144I	.	K	-	2	0	ZPBP	50068184	0.989000	0.36119	0.993000	0.49108	0.992000	0.81027	0.858000	0.27845	2.140000	0.66376	0.482000	0.46254	AAA		0.318	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251374.1	NM_007009	
GRM3	2913	broad.mit.edu	37	7	86468223	86468223	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr7:86468223C>T	ENST00000361669.2	+	4	2492	c.1393C>T	c.(1393-1395)Cga>Tga	p.R465*	GRM3_ENST00000394720.2_Intron|GRM3_ENST00000546348.1_Nonsense_Mutation_p.R57*|GRM3_ENST00000536043.1_Nonsense_Mutation_p.R337*|GRM3_ENST00000439827.1_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	465					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.R465*(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TGGAATGGGGCGATACAACGT	0.383																																					p.R465X	GBM(52;969 1098 3139 52280)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1393T	7						.						67.0	64.0	65.0					7																	86468223		2203	4300	6503	86306159	SO:0001587	stop_gained	2913	exon4				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1393C>T	7.37:g.86468223C>T	ENSP00000355316:p.Arg465*	Somatic		Capture	Illumina HiSeq	Phase_I	86306159	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Nonsense_Mutation	SNP	ENST00000361669.2	37	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	C	36	5.682038	0.96774	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	.	.	.	5.91	3.87	0.44632	.	0.121184	0.56097	D	0.000036	.	.	.	.	.	.	0.50313	D	0.999869	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2215	0.37379	0.2838:0.6428:0.0:0.0734	.	.	.	.	X	465;57;337	.	ENSP00000355316:R465X	R	+	1	2	GRM3	86306159	0.875000	0.30112	0.969000	0.41365	0.998000	0.95712	1.947000	0.40293	1.437000	0.47472	0.655000	0.94253	CGA		0.383	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
SPDYE3	441272	broad.mit.edu	37	7	99914756	99914756	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr7:99914756C>T	ENST00000332397.6	+	8	1508	c.1324C>T	c.(1324-1326)Cgc>Tgc	p.R442C	SPDYE3_ENST00000437326.2_Missense_Mutation_p.R65C	NM_001004351.4	NP_001004351.3	A6NKU9	SPDE3_HUMAN	speedy/RINGO cell cycle regulator family member E3	442								p.R442C(1)		endometrium(10)|kidney(1)|lung(8)|urinary_tract(1)	20						GCAATACCAACGCATTCATTT	0.542																																					p.R442C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1324T	7						.						18.0	21.0	20.0					7																	99914756		1404	2527	3931	99752692	SO:0001583	missense	441272	exon8			BC056606	CCDS47658.1, CCDS47658.2	7q22.1	2013-05-08	2013-05-08		ENSG00000214300	ENSG00000214300		"""Speedy homologs"""	35462	protein-coding gene	gene with protein product			"""speedy homolog E3 (Xenopus laevis)"""				Standard	NM_001004351		Approved		uc022aij.1	A6NKU9	OTTHUMG00000155462	ENST00000332397.6:c.1324C>T	7.37:g.99914756C>T	ENSP00000329565:p.Arg442Cys	Somatic		Capture	Illumina HiSeq	Phase_I	99752692	NM_001004351	Q495Y9|Q6PHC4	Missense_Mutation	SNP	ENST00000332397.6	37	CCDS47658.2	.	.	.	.	.	.	.	.	.	.	C	9.701	1.154581	0.21371	.	.	ENSG00000214300	ENST00000332397;ENST00000437326	.	.	.	0.418	-0.836	0.10770	.	0.600414	0.14244	N	0.331902	T	0.41673	0.1169	L	0.61218	1.895	0.09310	N	1	.	.	.	.	.	.	T	0.41270	-0.9518	6	0.72032	D	0.01	.	.	.	.	.	.	.	.	C	442;65	.	ENSP00000329565:R442C	R	+	1	0	SPDYE3	99752692	0.954000	0.32549	0.005000	0.12908	0.005000	0.04900	0.618000	0.24373	-0.520000	0.06435	-0.532000	0.04303	CGC		0.542	SPDYE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340224.2	NM_001004351	
HIPK2	28996	broad.mit.edu	37	7	139281658	139281658	+	Missense_Mutation	SNP	C	C	T	rs374263328		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr7:139281658C>T	ENST00000406875.3	-	12	2616	c.2522G>A	c.(2521-2523)cGc>cAc	p.R841H	HIPK2_ENST00000428878.2_Missense_Mutation_p.R814H|HIPK2_ENST00000342645.6_Intron	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	841	Interaction with CTBP1. {ECO:0000250}.|Interaction with HMGA1. {ECO:0000250}.|Interaction with POU4F1. {ECO:0000250}.|Interaction with SKI and SMAD1.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)	p.R841H(1)		breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					CATGGCACAGCGGGGAGGTGT	0.622																																					p.R841H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2522A	7						.	C	HIS/ARG,HIS/ARG	0,4296		0,0,2148	49.0	55.0	53.0		1391,1472	5.4	1.0	7		53	2,8508		0,2,4253	no	missense,missense	HIPK2	NM_001113239.2,NM_022740.4	29,29	0,2,6401	TT,TC,CC		0.0235,0.0,0.0156	benign,benign	464/822,491/849	139281658	2,12804	2148	4255	6403	138932198	SO:0001583	missense	28996	exon12			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.2522G>A	7.37:g.139281658C>T	ENSP00000385571:p.Arg841His	Somatic		Capture	Illumina HiSeq	Phase_I	138932198	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	37		.	.	.	.	.	.	.	.	.	.	C	26.1	4.707334	0.89018	0.0	2.35E-4	ENSG00000064393	ENST00000406875;ENST00000428878	T;T	0.52983	0.64;0.65	5.4	5.4	0.78164	.	.	.	.	.	T	0.68632	0.3022	.	.	.	0.58432	D	0.999998	D;D	0.76494	0.998;0.999	D;D	0.80764	0.976;0.994	T	0.64694	-0.6347	8	0.35671	T	0.21	.	19.3648	0.94458	0.0:1.0:0.0:0.0	.	841;814	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	H	841;814	ENSP00000385571:R841H;ENSP00000413724:R814H	ENSP00000385571:R841H	R	-	2	0	HIPK2	138932198	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	6.973000	0.76116	2.810000	0.96702	0.585000	0.79938	CGC		0.622	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
XKR6	286046	broad.mit.edu	37	8	10782302	10782302	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr8:10782302C>T	ENST00000416569.2	-	2	829	c.803G>A	c.(802-804)cGg>cAg	p.R268Q	XKR6_ENST00000304437.2_5'UTR	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	268						integral component of membrane (GO:0016021)		p.R268Q(2)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		TTCCTTCCGCCGCTGGCTCTG	0.597																																					p.R268Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G803A	8						.						103.0	90.0	94.0					8																	10782302		2203	4300	6503	10819712	SO:0001583	missense	286046	exon2			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.803G>A	8.37:g.10782302C>T	ENSP00000416707:p.Arg268Gln	Somatic		Capture	Illumina HiSeq	Phase_I	10819712	NM_173683	Q8TBA0	Missense_Mutation	SNP	ENST00000416569.2	37	CCDS5978.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	21.1|21.1	4.098619|4.098619	0.76870|0.76870	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000382461|ENST00000416569	.|T	.|0.63913	.|-0.07	4.71|4.71	4.71|4.71	0.59529|0.59529	.|.	.|0.000000	.|0.64402	.|U	.|0.000003	T|T	0.61652|0.61652	0.2364|0.2364	N|N	0.20445|0.20445	0.575|0.575	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.63381	.|0.914	T|T	0.55964|0.55964	-0.8057|-0.8057	5|10	.|0.10111	.|T	.|0.7	1.7456|1.7456	16.6436|16.6436	0.85155|0.85155	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|268	.|Q5GH73	.|XKR6_HUMAN	S|Q	45|268	.|ENSP00000416707:R268Q	.|ENSP00000416707:R268Q	G|R	-|-	1|2	0|0	XKR6|XKR6	10819712|10819712	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.639000|7.639000	0.83342|0.83342	2.156000|2.156000	0.67533|0.67533	0.457000|0.457000	0.33378|0.33378	GGC|CGG		0.597	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683	
TUSC3	7991	broad.mit.edu	37	8	15605947	15605947	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr8:15605947G>A	ENST00000503731.1	+	9	1149	c.1001G>A	c.(1000-1002)cGt>cAt	p.R334H	TUSC3_ENST00000382020.4_Missense_Mutation_p.R334H|TUSC3_ENST00000506802.1_Intron	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	334					cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.R334H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		TCAATATTTCGTTCCAAGTAC	0.318																																					p.R334H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1001A	8						.						231.0	219.0	223.0					8																	15605947		2203	4300	6503	15650318	SO:0001583	missense	7991	exon9			AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.1001G>A	8.37:g.15605947G>A	ENSP00000424544:p.Arg334His	Somatic		Capture	Illumina HiSeq	Phase_I	15650318	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	G	34	5.351048	0.95830	.	.	ENSG00000104723	ENST00000382020;ENST00000503731	T;T	0.50001	0.76;0.76	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.73760	0.3628	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.989;0.993	T	0.75491	-0.3299	10	0.62326	D	0.03	-14.0896	19.5349	0.95247	0.0:0.0:1.0:0.0	.	334;334	Q13454-2;Q13454	.;TUSC3_HUMAN	H	334	ENSP00000371450:R334H;ENSP00000424544:R334H	ENSP00000221167:R334H	R	+	2	0	TUSC3	15650318	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.054000	0.93866	2.941000	0.99782	0.655000	0.94253	CGT		0.318	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
NKX3-1	4824	broad.mit.edu	37	8	23538913	23538913	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr8:23538913G>A	ENST00000380871.4	-	2	563	c.526C>T	c.(526-528)Cgc>Tgc	p.R176C	NKX3-1_ENST00000523261.1_Missense_Mutation_p.R101C	NM_006167.3	NP_006158.2	Q99801	NKX31_HUMAN	NK3 homeobox 1	176					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|androgen receptor signaling pathway (GO:0030521)|branching involved in prostate gland morphogenesis (GO:0060442)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to steroid hormone stimulus (GO:0071383)|cellular response to tumor necrosis factor (GO:0071356)|dorsal aorta development (GO:0035907)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|heart development (GO:0007507)|male gonad development (GO:0008584)|metanephros development (GO:0001656)|mitotic cell cycle arrest (GO:0071850)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of transcription, DNA-templated (GO:0045892)|pharyngeal system development (GO:0060037)|positive regulation of androgen secretion (GO:2000836)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell death (GO:0010942)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein kinase B signaling (GO:0043491)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|salivary gland development (GO:0007431)|somitogenesis (GO:0001756)|steroid hormone mediated signaling pathway (GO:0043401)	intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|core promoter binding (GO:0001047)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|histone deacetylase binding (GO:0042826)|protein kinase activator activity (GO:0030295)|protein self-association (GO:0043621)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.R176C(1)		large_intestine(3)|lung(4)|prostate(5)|skin(2)	14		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		GTCTTATAGCGTCTGTTCTGG	0.577																																					p.R176C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C526T	8						.						176.0	172.0	173.0					8																	23538913		2203	4300	6503	23594858	SO:0001583	missense	4824	exon2				CCDS6042.1, CCDS59095.1	8p21.2	2012-03-09	2007-07-09	2002-10-04	ENSG00000167034	ENSG00000167034		"""Homeoboxes / ANTP class : NKL subclass"""	7838	protein-coding gene	gene with protein product		602041	"""NK homeobox (Drosophila), family 3, A"", ""NK3 transcription factor related, locus 1 (Drosophila)"""	NKX3A		9226374	Standard	NM_006167		Approved	NKX3.1, BAPX2	uc011kzx.2	Q99801	OTTHUMG00000097851	ENST00000380871.4:c.526C>T	8.37:g.23538913G>A	ENSP00000370253:p.Arg176Cys	Somatic		Capture	Illumina HiSeq	Phase_I	23594858	NM_006167	O15465|Q9H2P4|Q9H2P5|Q9H2P6|Q9H2P7|Q9HBG0	Missense_Mutation	SNP	ENST00000380871.4	37	CCDS6042.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.101492	0.76983	.	.	ENSG00000167034	ENST00000380871;ENST00000300332;ENST00000523261	D;D	0.99167	-5.51;-5.51	5.66	5.66	0.87406	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.64402	D	0.000001	D	0.99622	0.9862	H	0.99535	4.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97649	1.0153	10	0.87932	D	0	.	12.5507	0.56225	0.0:0.0:0.8338:0.1662	.	176	Q99801	NKX31_HUMAN	C	176;132;101	ENSP00000370253:R176C;ENSP00000429729:R101C	ENSP00000300332:R132C	R	-	1	0	NKX3-1	23594858	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.187000	0.50950	2.832000	0.97577	0.655000	0.94253	CGC		0.577	NKX3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215141.2		
STC1	6781	broad.mit.edu	37	8	23709026	23709026	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr8:23709026C>G	ENST00000290271.2	-	3	563	c.280G>C	c.(280-282)Gag>Cag	p.E94Q	STC1_ENST00000524323.1_Missense_Mutation_p.E25Q	NM_003155.2	NP_003146.1	P52823	STC1_HUMAN	stanniocalcin 1	94					bone development (GO:0060348)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cAMP (GO:0071320)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|chondrocyte proliferation (GO:0035988)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endothelial cell morphogenesis (GO:0001886)|growth plate cartilage axis specification (GO:0003421)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of renal phosphate excretion (GO:1903403)|ossification (GO:0001503)|positive regulation of calcium ion import (GO:0090280)|regulation of anion transport (GO:0044070)|regulation of cardiac muscle cell contraction (GO:0086004)|response to vitamin D (GO:0033280)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.E94Q(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		TTTAAGCTCTCTTTGACGAAT	0.502																																					p.E94Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G280C	8						.						107.0	95.0	99.0					8																	23709026		2203	4300	6503	23764971	SO:0001583	missense	6781	exon3				CCDS6043.1	8p22-p12	2008-06-23			ENSG00000159167	ENSG00000159167			11373	protein-coding gene	gene with protein product		601185		STC		9480753	Standard	NM_003155		Approved		uc003xdw.1	P52823	OTTHUMG00000097853	ENST00000290271.2:c.280G>C	8.37:g.23709026C>G	ENSP00000290271:p.Glu94Gln	Somatic		Capture	Illumina HiSeq	Phase_I	23764971	NM_003155	B4DN22|Q71UE5	Missense_Mutation	SNP	ENST00000290271.2	37	CCDS6043.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.201096	0.79015	.	.	ENSG00000159167	ENST00000290271;ENST00000540277;ENST00000524323	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.76076	0.3937	L	0.58810	1.83	0.58432	D	0.999998	D	0.65815	0.995	D	0.64595	0.927	T	0.76759	-0.2841	9	0.66056	D	0.02	2.8826	18.516	0.90936	0.0:1.0:0.0:0.0	.	94	P52823	STC1_HUMAN	Q	94;25;25	.	ENSP00000290271:E94Q	E	-	1	0	STC1	23764971	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.665000	0.61547	2.725000	0.93324	0.655000	0.94253	GAG		0.502	STC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215143.1		
CLU	1191	broad.mit.edu	37	8	27466465	27466465	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr8:27466465T>A	ENST00000316403.10	-	3	641	c.236A>T	c.(235-237)aAg>aTg	p.K79M	CLU_ENST00000546343.1_Missense_Mutation_p.K90M|CLU_ENST00000405140.3_Missense_Mutation_p.K79M|CLU_ENST00000560366.1_Missense_Mutation_p.K131M|CLU_ENST00000523500.1_Missense_Mutation_p.K79M			P10909	CLUS_HUMAN	clusterin	79					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)	p.K131M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		CTCTTTCTTCTTCTTGGCTTC	0.542																																					p.K90M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A269T	8						.						154.0	143.0	147.0					8																	27466465		2203	4300	6503	27522382	SO:0001583	missense	1191	exon3			M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.236A>T	8.37:g.27466465T>A	ENSP00000315130:p.Lys79Met	Somatic		Capture	Illumina HiSeq	Phase_I	27522382	NM_001171138	B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Missense_Mutation	SNP	ENST00000316403.10	37	CCDS47832.1	.	.	.	.	.	.	.	.	.	.	T	19.03	3.748629	0.69533	.	.	ENSG00000120885	ENST00000316403;ENST00000546343;ENST00000405140;ENST00000523500;ENST00000523589;ENST00000520796;ENST00000519742;ENST00000520491;ENST00000522413;ENST00000519472;ENST00000523396	T;T;T;T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64	5.58	5.58	0.84498	Clusterin, N-terminal (1);	0.236698	0.41097	D	0.000942	T	0.57446	0.2054	M	0.81942	2.565	0.40526	D	0.98088	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.992;0.992;0.995	T	0.64597	-0.6370	10	0.87932	D	0	-56.063	13.7084	0.62654	0.0:0.0:0.0:1.0	.	131;90;79	P10909-2;P10909-5;P10909	.;.;CLUS_HUMAN	M	131;90;79;79;79;79;79;79;79;79;79	ENSP00000446413:K90M;ENSP00000385419:K79M;ENSP00000429620:K79M;ENSP00000431070:K79M;ENSP00000429336:K79M;ENSP00000431026:K79M;ENSP00000429881:K79M;ENSP00000428779:K79M;ENSP00000427868:K79M;ENSP00000428526:K79M	ENSP00000315130:K131M	K	-	2	0	CLU	27522382	0.933000	0.31639	1.000000	0.80357	0.724000	0.41520	0.378000	0.20569	2.111000	0.64477	0.533000	0.62120	AAG		0.542	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219953.3	NM_001831	
NRG1	3084	broad.mit.edu	37	8	32463200	32463200	+	Splice_Site	SNP	C	C	T	rs374418193		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr8:32463200C>T	ENST00000405005.3	+	3	399	c.399C>T	c.(397-399)aaC>aaT	p.N133N	NRG1_ENST00000356819.4_Splice_Site_p.N133N|NRG1_ENST00000519301.1_Splice_Site_p.N112N|NRG1_ENST00000287842.3_Splice_Site_p.N133N|NRG1_ENST00000520407.1_Splice_Site_p.N348N|NRG1_ENST00000341377.5_Splice_Site_p.N133N|NRG1_ENST00000523079.1_Splice_Site_p.N133N|NRG1_ENST00000521670.1_Splice_Site_p.N133N|NRG1_ENST00000287845.5_Splice_Site_p.N133N|NRG1_ENST00000338921.4_Splice_Site_p.N133N			Q02297	NRG1_HUMAN	neuregulin 1	133					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.N133N(2)|p.N348N(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TGGAATCAAACGGTAAGAGAT	0.393																																					p.R101X												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C301T	8						.	C	,,,,,,,,,,,,,,	0,4406		0,0,2203	148.0	134.0	139.0		336,336,336,399,399,399,399,399,399,399,399,399,399,1044,399	-6.5	0.1	8		139	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice	NRG1	NM_001159995.1,NM_001159999.1,NM_001160001.1,NM_001160002.1,NM_001160004.1,NM_001160005.1,NM_001160007.1,NM_001160008.1,NM_004495.3,NM_013956.3,NM_013957.3,NM_013958.3,NM_013960.3,NM_013962.2,NM_013964.3	,,,,,,,,,,,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,,,,,,,,,,,	112/608,112/625,112/591,133/195,133/460,133/208,133/178,133/421,133/212,133/646,133/638,133/242,133/463,348/423,133/641	32463200	1,13005	2203	4300	6503	32582742	SO:0001630	splice_region_variant	3084	exon2			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.400+1C>T	8.37:g.32463200C>T		Somatic		Capture	Illumina HiSeq	Phase_I	32582742	NM_001159995	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	De_novo_Start_InFrame	SNP	ENST00000405005.3	37	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	C	5.592	0.294028	0.10567	0.0	1.16E-4	ENSG00000157168	ENST00000518206	.	.	.	5.03	-6.52	0.01872	.	.	.	.	.	T	0.59404	0.2191	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61865	-0.6975	4	.	.	.	-0.6836	13.0065	0.58707	0.0:0.557:0.0:0.443	.	.	.	.	M	12	.	.	T	+	2	0	NRG1	32582742	0.996000	0.38824	0.066000	0.19879	0.125000	0.20455	0.093000	0.15086	-1.363000	0.02164	-1.124000	0.02001	ACG		0.393	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		Silent
ADRB3	155	broad.mit.edu	37	8	37823747	37823747	+	Missense_Mutation	SNP	C	C	T	rs201912869		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr8:37823747C>T	ENST00000345060.3	-	1	736	c.241G>A	c.(241-243)Gca>Aca	p.A81T	ADRB3_ENST00000520341.1_5'Flank	NM_000025.2	NP_000016.1	P13945	ADRB3_HUMAN	adrenoceptor beta 3	81					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|aging (GO:0007568)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|diet induced thermogenesis (GO:0002024)|eating behavior (GO:0042755)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|generation of precursor metabolites and energy (GO:0006091)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of MAPK cascade (GO:0043410)|response to antibiotic (GO:0046677)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta-adrenergic receptor activity (GO:0004939)|beta3-adrenergic receptor activity (GO:0015052)|epinephrine binding (GO:0051379)|norepinephrine binding (GO:0051380)|protein homodimerization activity (GO:0042803)	p.A81T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)	9	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)		Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Bethanidine(DB00217)|Bopindolol(DB08807)|Bupranolol(DB08808)|Clenbuterol(DB01407)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Isoprenaline(DB01064)|Mephentermine(DB01365)|Mirabegron(DB08893)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Propranolol(DB00571)|Trimipramine(DB00726)	AGGTCGGCTGCGGCCAGCGAA	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		16707	0.001		0.0	False		,,,				2504	0.0				p.A81T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G241A	8						.						24.0	26.0	25.0					8																	37823747		2201	4296	6497	37942904	SO:0001583	missense	155	exon1			AY487247	CCDS6099.1	8p12	2012-08-08	2012-05-09			ENSG00000188778		"""GPCR / Class A : Adrenoceptors : beta"""	288	protein-coding gene	gene with protein product		109691	"""adrenergic, beta-3-, receptor"""			7898940, 15123695	Standard	NM_000025		Approved		uc003xkr.2	P13945		ENST00000345060.3:c.241G>A	8.37:g.37823747C>T	ENSP00000343782:p.Ala81Thr	Somatic		Capture	Illumina HiSeq	Phase_I	37942904	NM_000025	Q4JFT4	Missense_Mutation	SNP	ENST00000345060.3	37	CCDS6099.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	8.089	0.774093	0.16051	.	.	ENSG00000188778	ENST00000345060	T	0.19669	2.13	4.63	-2.65	0.06095	GPCR, rhodopsin-like superfamily (1);	0.438401	0.23702	N	0.045408	T	0.10937	0.0267	L	0.33485	1.01	0.20764	N	0.999856	B	0.10296	0.003	B	0.13407	0.009	T	0.22034	-1.0228	10	0.23302	T	0.38	.	4.708	0.12858	0.3245:0.255:0.0:0.4204	.	81	P13945	ADRB3_HUMAN	T	81	ENSP00000343782:A81T	ENSP00000343782:A81T	A	-	1	0	ADRB3	37942904	0.000000	0.05858	0.323000	0.25347	0.525000	0.34531	-0.981000	0.03766	-0.681000	0.05204	-0.448000	0.05591	GCA		0.682	ADRB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376826.1	NM_000025	
TRPA1	8989	broad.mit.edu	37	8	72981431	72981431	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr8:72981431G>T	ENST00000262209.4	-	3	478	c.271C>A	c.(271-273)Ctg>Atg	p.L91M		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	91					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.L91M(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ATTTCATGCAGCACTAGAAAA	0.383																																					p.L91M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C271A	8						.						100.0	104.0	102.0					8																	72981431		2203	4300	6503	73143985	SO:0001583	missense	8989	exon3			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.271C>A	8.37:g.72981431G>T	ENSP00000262209:p.Leu91Met	Somatic		Capture	Illumina HiSeq	Phase_I	73143985	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	G	9.825	1.186876	0.21870	.	.	ENSG00000104321	ENST00000262209	T	0.64991	-0.13	5.74	1.82	0.25136	Ankyrin repeat-containing domain (4);	0.307266	0.31872	N	0.006939	T	0.69079	0.3071	M	0.71581	2.175	0.25178	N	0.990221	D	0.76494	0.999	D	0.69479	0.964	T	0.60224	-0.7305	10	0.66056	D	0.02	-3.0976	1.242	0.01965	0.2588:0.2672:0.3373:0.1368	.	91	O75762	TRPA1_HUMAN	M	91	ENSP00000262209:L91M	ENSP00000262209:L91M	L	-	1	2	TRPA1	73143985	0.023000	0.18921	0.532000	0.27989	0.043000	0.13939	0.124000	0.15728	0.050000	0.15949	-0.136000	0.14681	CTG		0.383	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
DCAF4L2	138009	broad.mit.edu	37	8	88885354	88885354	+	Silent	SNP	G	G	T	rs149891752	byFrequency	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr8:88885354G>T	ENST00000319675.3	-	1	942	c.846C>A	c.(844-846)ggC>ggA	p.G282G		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	282								p.G282G(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						CCAGGAATTGGCCATCTTGGA	0.493																																					p.G282G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C846A	8						.						97.0	88.0	91.0					8																	88885354		2203	4300	6503	88954470	SO:0001819	synonymous_variant	138009	exon1			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.846C>A	8.37:g.88885354G>T		Somatic		Capture	Illumina HiSeq	Phase_I	88954470	NM_152418		Silent	SNP	ENST00000319675.3	37	CCDS6245.1																																																																																				0.493	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
DCAF4L2	138009	broad.mit.edu	37	8	88885717	88885717	+	Silent	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr8:88885717C>T	ENST00000319675.3	-	1	579	c.483G>A	c.(481-483)gcG>gcA	p.A161A		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	161								p.A161A(2)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TGAACAGCGACGCTGGGAGCA	0.567																																					p.A161A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.G483A	8						.						101.0	94.0	96.0					8																	88885717		2203	4300	6503	88954833	SO:0001819	synonymous_variant	138009	exon1			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.483G>A	8.37:g.88885717C>T		Somatic		Capture	Illumina HiSeq	Phase_I	88954833	NM_152418		Silent	SNP	ENST00000319675.3	37	CCDS6245.1																																																																																				0.567	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
KIF12	113220	broad.mit.edu	37	9	116858674	116858674	+	Missense_Mutation	SNP	C	C	T	rs564040906	byFrequency	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr9:116858674C>T	ENST00000374118.3	-	5	554	c.317G>A	c.(316-318)cGt>cAt	p.R106H	KIF12_ENST00000473174.1_5'UTR	NM_138424.1	NP_612433.1	Q96FN5	KIF12_HUMAN	kinesin family member 12	239	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R106H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	17						CACAGTTTGACGGCTGATGTA	0.572													C|||	5	0.000998403	0.0	0.0014	5008	,	,		19559	0.0		0.0	False		,,,				2504	0.0041				p.R106H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G317A	9						.						88.0	73.0	78.0					9																	116858674		2203	4300	6503	115898495	SO:0001583	missense	113220	exon5			BC010626	CCDS6801.1	9q33.1	2008-02-05			ENSG00000136883	ENSG00000136883		"""Kinesins"""	21495	protein-coding gene	gene with protein product		611278					Standard	NM_138424		Approved		uc004bif.3	Q96FN5	OTTHUMG00000020533	ENST00000374118.3:c.317G>A	9.37:g.116858674C>T	ENSP00000363232:p.Arg106His	Somatic		Capture	Illumina HiSeq	Phase_I	115898495	NM_138424	Q5TBE0	Missense_Mutation	SNP	ENST00000374118.3	37	CCDS6801.1	.	.	.	.	.	.	.	.	.	.	C	8.263	0.811545	0.16537	.	.	ENSG00000136883	ENST00000374118;ENST00000259410	T	0.75154	-0.91	5.69	2.82	0.32997	Kinesin, motor domain (4);	0.715757	0.12717	N	0.445020	T	0.63498	0.2516	L	0.42632	1.34	0.09310	N	1	B	0.14012	0.009	B	0.10450	0.005	T	0.44620	-0.9316	10	0.13470	T	0.59	.	9.9275	0.41501	0.0:0.7494:0.0:0.2506	.	239	Q96FN5	KIF12_HUMAN	H	106;239	ENSP00000363232:R106H	ENSP00000259410:R239H	R	-	2	0	KIF12	115898495	0.009000	0.17119	0.012000	0.15200	0.002000	0.02628	0.227000	0.17795	0.068000	0.16574	-0.813000	0.03139	CGT		0.572	KIF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053751.1	NM_138424	
PAPPA	5069	broad.mit.edu	37	9	119028252	119028252	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr9:119028252G>A	ENST00000328252.3	+	8	3218	c.2849G>A	c.(2848-2850)gGc>gAc	p.G950D	PAPPA_ENST00000534838.1_5'UTR	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	950					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G950D(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TGTGGCGATGGCATTATACAA	0.428																																					p.G950D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2849A	9						.						85.0	79.0	81.0					9																	119028252		2203	4300	6503	118068073	SO:0001583	missense	5069	exon8				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2849G>A	9.37:g.119028252G>A	ENSP00000330658:p.Gly950Asp	Somatic		Capture	Illumina HiSeq	Phase_I	118068073	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187747	0.78789	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.44881	0.91	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.74215	0.3687	M	0.93328	3.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81988	-0.0680	10	0.87932	D	0	-24.4409	17.6818	0.88246	0.0:0.0:1.0:0.0	.	394;950	E7EMD3;Q13219	.;PAPP1_HUMAN	D	950;394	ENSP00000330658:G950D	ENSP00000330658:G950D	G	+	2	0	PAPPA	118068073	1.000000	0.71417	0.977000	0.42913	0.914000	0.54420	6.527000	0.73803	2.462000	0.83206	0.557000	0.71058	GGC		0.428	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
OR1K1	392392	broad.mit.edu	37	9	125563222	125563222	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr9:125563222T>G	ENST00000277309.2	+	1	853	c.821T>G	c.(820-822)gTg>gGg	p.V274G		NM_080859.1	NP_543135.1	Q8NGR3	OR1K1_HUMAN	olfactory receptor, family 1, subfamily K, member 1	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V274G(1)		endometrium(1)|large_intestine(8)|lung(2)|ovary(1)|skin(4)|stomach(1)	17						TGGGGCCGTGTGGCCACTGTC	0.587																																					p.V274G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T821G	9						.						113.0	101.0	105.0					9																	125563222		2203	4300	6503	124603043	SO:0001583	missense	392392	exon1			AL359512	CCDS35132.1	9q33	2013-09-20			ENSG00000165204	ENSG00000165204		"""GPCR / Class A : Olfactory receptors"""	8212	protein-coding gene	gene with protein product							Standard	NM_080859		Approved	hg99, MNAB	uc011lze.2	Q8NGR3	OTTHUMG00000020625	ENST00000277309.2:c.821T>G	9.37:g.125563222T>G	ENSP00000277309:p.Val274Gly	Somatic		Capture	Illumina HiSeq	Phase_I	124603043	NM_080859	B9EH41|Q4VXB7|Q96R23	Missense_Mutation	SNP	ENST00000277309.2	37	CCDS35132.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019607	0.54576	.	.	ENSG00000165204	ENST00000277309	T	0.00285	8.3	4.49	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35179	U	0.003397	T	0.00440	0.0014	L	0.54965	1.715	0.43761	D	0.996276	D	0.67145	0.996	D	0.75020	0.985	T	0.82198	-0.0576	10	0.87932	D	0	.	8.8311	0.35085	0.0:0.0915:0.0:0.9085	.	274	Q8NGR3	OR1K1_HUMAN	G	274	ENSP00000277309:V274G	ENSP00000277309:V274G	V	+	2	0	OR1K1	124603043	0.060000	0.20803	0.984000	0.44739	0.752000	0.42762	2.629000	0.46485	0.758000	0.33059	0.460000	0.39030	GTG		0.587	OR1K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053958.1		
KIAA1045	23349	broad.mit.edu	37	9	34971399	34971399	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr9:34971399G>A	ENST00000242315.3	+	2	186	c.104G>A	c.(103-105)cGa>cAa	p.R35Q	KIAA1045_ENST00000476115.2_Intron|KIAA1045_ENST00000544237.1_Missense_Mutation_p.R35Q	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	35							metal ion binding (GO:0046872)	p.R35Q(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			CCTTCCATCCGACGCACAGGT	0.622																																					p.R35Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G104A	9						.						66.0	74.0	71.0					9																	34971399		2112	4236	6348	34961399	SO:0001583	missense	23349	exon2			AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.104G>A	9.37:g.34971399G>A	ENSP00000242315:p.Arg35Gln	Somatic		Capture	Illumina HiSeq	Phase_I	34961399	NM_015297	B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	37	CCDS43796.1	.	.	.	.	.	.	.	.	.	.	g	16.91	3.253422	0.59212	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	5.66	5.66	0.87406	.	0.418888	0.24050	N	0.042009	T	0.52709	0.1751	L	0.51422	1.61	0.35569	D	0.805339	D	0.62365	0.991	P	0.48654	0.585	T	0.61637	-0.7022	9	0.36615	T	0.2	-1.7533	12.1099	0.53834	0.0778:0.0:0.9222:0.0	.	35	Q9UPV7	K1045_HUMAN	Q	35	.	ENSP00000242315:R35Q	R	+	2	0	KIAA1045	34961399	0.977000	0.34250	0.996000	0.52242	0.774000	0.43823	2.707000	0.47143	2.657000	0.90304	0.655000	0.94253	CGA		0.622	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	XM_048592	
TLN1	7094	broad.mit.edu	37	9	35721667	35721667	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr9:35721667G>A	ENST00000314888.9	-	10	1435	c.1082C>T	c.(1081-1083)gCg>gTg	p.A361V	TLN1_ENST00000540444.1_Missense_Mutation_p.A361V	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	361	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with LAYN. {ECO:0000250}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.A361V(1)		NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTTGGGAGACGCAGCCCAGCG	0.517																																					p.A361V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1082T	9						.						118.0	98.0	105.0					9																	35721667		2203	4300	6503	35711667	SO:0001583	missense	7094	exon10			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.1082C>T	9.37:g.35721667G>A	ENSP00000316029:p.Ala361Val	Somatic		Capture	Illumina HiSeq	Phase_I	35711667	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	G	36	5.791498	0.96945	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.56776	0.44;0.44	5.78	5.78	0.91487	FERM domain (1);Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (1);	0.055092	0.64402	D	0.000001	T	0.68952	0.3057	M	0.79475	2.455	0.80722	D	1	D	0.61697	0.99	P	0.53266	0.722	T	0.72903	-0.4151	10	0.87932	D	0	-14.4048	20.0204	0.97499	0.0:0.0:1.0:0.0	.	361	Q9Y490	TLN1_HUMAN	V	361	ENSP00000316029:A361V;ENSP00000442981:A361V	ENSP00000316029:A361V	A	-	2	0	TLN1	35711667	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.729000	0.93468	0.650000	0.86243	GCG		0.517	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
RORB	6096	broad.mit.edu	37	9	77277466	77277466	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr9:77277466G>A	ENST00000396204.2	+	6	869	c.869G>A	c.(868-870)cGg>cAg	p.R290Q	RORB_ENST00000376896.3_Missense_Mutation_p.R279Q			Q92753	RORB_HUMAN	RAR-related orphan receptor B	290	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R279Q(1)		breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	TTTGCAAAGCGGATAACAGGC	0.458																																					p.R279Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G836A	9						.						179.0	165.0	170.0					9																	77277466		2203	4300	6503	76467286	SO:0001583	missense	6096	exon6			Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.869G>A	9.37:g.77277466G>A	ENSP00000379507:p.Arg290Gln	Somatic		Capture	Illumina HiSeq	Phase_I	76467286	NM_006914	Q8WX73	Missense_Mutation	SNP	ENST00000396204.2	37		.	.	.	.	.	.	.	.	.	.	G	36	5.616850	0.96649	.	.	ENSG00000198963	ENST00000376896;ENST00000396204	D;D	0.96830	-4.14;-4.14	5.47	5.47	0.80525	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98083	0.9368	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;0.979	D;B	0.70227	0.968;0.399	D	0.98338	1.0537	10	0.54805	T	0.06	.	19.3378	0.94326	0.0:0.0:1.0:0.0	.	290;279	Q92753;Q58EY0	RORB_HUMAN;.	Q	279;290	ENSP00000366093:R279Q;ENSP00000379507:R290Q	ENSP00000366093:R279Q	R	+	2	0	RORB	76467286	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.567000	0.86603	0.557000	0.71058	CGG		0.458	RORB-201	KNOWN	basic	protein_coding	protein_coding			
PKN3	29941	broad.mit.edu	37	9	131477728	131477728	+	Silent	SNP	C	C	T			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr9:131477728C>T	ENST00000291906.4	+	15	2190	c.1797C>T	c.(1795-1797)gaC>gaT	p.D599D	PKN3_ENST00000485301.1_Intron	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	599	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)	p.D599D(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						TCAGCCGGGACGAGATAGAGA	0.612																																					p.D599D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1797T	9						.						45.0	45.0	45.0					9																	131477728		2203	4300	6503	130517549	SO:0001819	synonymous_variant	29941	exon15			AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.1797C>T	9.37:g.131477728C>T		Somatic		Capture	Illumina HiSeq	Phase_I	130517549	NM_013355	Q9UM03	Silent	SNP	ENST00000291906.4	37	CCDS6908.1																																																																																				0.612	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	
SETX	23064	broad.mit.edu	37	9	135147174	135147175	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	CA	CA	CA	-	CA	CA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chr9:135147174_135147175delCA	ENST00000224140.5	-	24	7303_7304	c.7121_7122delTG	c.(7120-7122)gtgfs	p.V2374fs	SETX_ENST00000372169.2_Frame_Shift_Del_p.V2374fs|SETX_ENST00000393220.1_Intron|SETX_ENST00000477049.1_5'UTR	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	2374					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.V2374V(1)|p.V2374fs*20(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GGAATGCATCCACAGTGTCTAC	0.361																																					p.2374_2374del												.	.	2	Deletion - Frameshift(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.7121_7122del	9						.																																			134136996	SO:0001589	frameshift_variant	23064	exon24			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.7121_7122delTG	9.37:g.135147176_135147177delCA	ENSP00000224140:p.Val2374fs	Somatic		Capture	Illumina HiSeq	Phase_I	134136995	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Frame_Shift_Del	DEL	ENST00000224140.5	37	CCDS6947.1																																																																																				0.361	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
FMR1NB	158521	broad.mit.edu	37	X	147106456	147106456	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chrX:147106456G>A	ENST00000370467.3	+	5	778	c.704G>A	c.(703-705)cGa>cAa	p.R235Q		NM_152578.2	NP_689791.1	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	235						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)		p.R235Q(2)		breast(2)|cervix(1)|endometrium(3)|large_intestine(7)|lung(10)|ovary(1)|skin(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					AGAAGGAAGCGAAAGAGGAAG	0.418																																					p.R235Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G704A	X						.						166.0	139.0	148.0					X																	147106456		2203	4300	6503	146914148	SO:0001583	missense	158521	exon5				CCDS14683.1	Xq28	2009-03-25			ENSG00000176988	ENSG00000176988			26372	protein-coding gene	gene with protein product	"""cancer/testis antigen 37"""					12601173	Standard	NM_152578		Approved	FLJ25736, NY-SAR-35, CT37	uc004fcm.3	Q8N0W7	OTTHUMG00000022608	ENST00000370467.3:c.704G>A	X.37:g.147106456G>A	ENSP00000359498:p.Arg235Gln	Somatic		Capture	Illumina HiSeq	Phase_I	146914148	NM_152578	D3DWT3	Missense_Mutation	SNP	ENST00000370467.3	37	CCDS14683.1	.	.	.	.	.	.	.	.	.	.	G	9.590	1.125830	0.20959	.	.	ENSG00000176988	ENST00000370467	T	0.26067	1.76	3.66	-7.31	0.01441	.	5.169790	0.00520	N	0.000197	T	0.11024	0.0269	N	0.08118	0	0.09310	N	1	B	0.26400	0.148	B	0.12837	0.008	T	0.14643	-1.0465	10	0.48119	T	0.1	12.0029	4.3978	0.11372	0.1313:0.4684:0.2855:0.1148	.	235	Q8N0W7	FMR1N_HUMAN	Q	235	ENSP00000359498:R235Q	ENSP00000359498:R235Q	R	+	2	0	FMR1NB	146914148	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.427000	0.00474	-3.315000	0.00189	-1.497000	0.00963	CGA		0.418	FMR1NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058667.1	NM_152578	
SSX5	6758	broad.mit.edu	37	X	48053630	48053630	+	Missense_Mutation	SNP	C	C	T	rs149409740		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chrX:48053630C>T	ENST00000376923.1	-	3	214	c.215G>A	c.(214-216)cGt>cAt	p.R72H	SSX5_ENST00000347757.1_Missense_Mutation_p.R72H|SSX5_ENST00000311798.1_Missense_Mutation_p.R113H			O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5	72	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.R113H(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|skin(1)	18						CCGTTTATTACGCATGAAAGG	0.483																																					p.R72H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G215A	X						.	C	HIS/ARG,HIS/ARG	1,3834		0,0,1,1632,570	148.0	131.0	137.0		338,215	-1.5	0.0	X	dbSNP_134	137	1,6726		0,1,0,2427,1871	no	missense,missense	SSX5	NM_021015.3,NM_175723.1	29,29	0,1,1,4059,2441	TT,TC,T,CC,C		0.0149,0.0261,0.0189	benign,benign	113/230,72/189	48053630	2,10560	2203	4299	6502	47938574	SO:0001583	missense	6758	exon4			BC016640	CCDS14288.1, CCDS14289.1	Xp11.23	2008-02-05			ENSG00000165583	ENSG00000165583			11339	protein-coding gene	gene with protein product		300327					Standard	NM_021015		Approved		uc004diz.1	O60225	OTTHUMG00000021471	ENST00000376923.1:c.215G>A	X.37:g.48053630C>T	ENSP00000366122:p.Arg72His	Somatic		Capture	Illumina HiSeq	Phase_I	47938574	NM_175723	Q5JQ59|Q5JQ60|Q96AW3	Missense_Mutation	SNP	ENST00000376923.1	37	CCDS14289.1	.	.	.	.	.	.	.	.	.	.	N	3.624	-0.076865	0.07184	2.61E-4	1.49E-4	ENSG00000165583	ENST00000311798;ENST00000376923;ENST00000347757	T;T;T	0.09445	2.98;3.02;3.02	1.72	-1.45	0.08828	Krueppel-associated box (2);Krueppel-associated box-related (1);	2.187140	0.01645	N	0.024274	T	0.08358	0.0208	L	0.33293	1	0.09310	N	1	B;B	0.13594	0.008;0.003	B;B	0.12837	0.003;0.008	T	0.29971	-0.9994	10	0.13853	T	0.58	.	5.186	0.15184	0.0:0.4079:0.0:0.5921	.	72;113	O60225;O60225-2	SSX5_HUMAN;.	H	113;72;72	ENSP00000312415:R113H;ENSP00000366122:R72H;ENSP00000290558:R72H	ENSP00000312415:R113H	R	-	2	0	SSX5	47938574	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.596000	0.05720	-0.602000	0.05775	-1.268000	0.01426	CGT		0.483	SSX5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056466.1	NM_021015	
PLXNB3	5365	broad.mit.edu	37	X	153043462	153043462	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chrX:153043462G>A	ENST00000361971.5	+	32	5435	c.5321G>A	c.(5320-5322)cGg>cAg	p.R1774Q	SRPK3_ENST00000393786.3_5'Flank|SRPK3_ENST00000489426.1_5'UTR|PLXNB3_ENST00000485980.1_3'UTR|PLXNB3_ENST00000538966.1_Missense_Mutation_p.R1797Q|PLXNB3_ENST00000538776.1_Missense_Mutation_p.R1427Q	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1774					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)	p.R1774Q(1)		central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TTTGATGTACGGGTGTCGGAC	0.607																																					p.R1797Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5390A	X						.						91.0	69.0	76.0					X																	153043462		2203	4300	6503	152696656	SO:0001583	missense	5365	exon33			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.5321G>A	X.37:g.153043462G>A	ENSP00000355378:p.Arg1774Gln	Somatic		Capture	Illumina HiSeq	Phase_I	152696656	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.619|5.619	0.299002|0.299002	0.10622|0.10622	.|.	.|.	ENSG00000198753|ENSG00000198753	ENST00000448847|ENST00000538966;ENST00000361971;ENST00000538776	.|T;T;T	.|0.16073	.|2.37;2.37;2.37	5.08|5.08	3.28|3.28	0.37604|0.37604	.|Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	.|0.262839	.|0.39687	.|N	.|0.001286	T|T	0.05227|0.05227	0.0139|0.0139	N|N	0.01515|0.01515	-0.825|-0.825	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.17038	.|0.02;0.007;0.02	.|B;B;B	.|0.17098	.|0.017;0.006;0.017	T|T	0.30592|0.30592	-0.9973|-0.9973	5|10	.|0.10902	.|T	.|0.67	.|.	8.2951|8.2951	0.31980|0.31980	0.2611:0.0:0.7389:0.0|0.2611:0.0:0.7389:0.0	.|.	.|1427;1797;1774	.|B7Z3H9;F5H773;Q9ULL4	.|.;.;PLXB3_HUMAN	R|Q	78|1797;1774;1427	.|ENSP00000442736:R1797Q;ENSP00000355378:R1774Q;ENSP00000445569:R1427Q	.|ENSP00000355378:R1774Q	G|R	+|+	1|2	0|0	PLXNB3|PLXNB3	152696656|152696656	1.000000|1.000000	0.71417|0.71417	0.003000|0.003000	0.11579|0.11579	0.788000|0.788000	0.44548|0.44548	3.218000|3.218000	0.51192|0.51192	0.457000|0.457000	0.26962|0.26962	0.529000|0.529000	0.55759|0.55759	GGG|CGG		0.607	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
PCDH11Y	83259	broad.mit.edu	37	Y	5605403	5605403	+	Missense_Mutation	SNP	C	C	T	rs374229187		TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02O-01A-21W-A096-10	TCGA-AA-A02O-11A-11W-A096-10	g.chrY:5605403C>T	ENST00000215473.6	+	6	3443	c.3443C>T	c.(3442-3444)cCg>cTg	p.P1148L				Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	1148					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P1148L(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TGCTGGATGCCGGCATCTCTG	0.527																																					p.P1148L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3443T	Y						.						43.0	44.0	44.0					Y																	5605403		635	1993	2628	5665403	SO:0001583	missense	83259	exon5			AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000215473.6:c.3443C>T	Y.37:g.5605403C>T	ENSP00000215473:p.Pro1148Leu	Somatic		Capture	Illumina HiSeq	Phase_I	5665403	NM_032973	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000215473.6	37																																																																																					0.527	PCDH11Y-201	KNOWN	basic	protein_coding	protein_coding		NM_032973	
