#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UPF2	26019	broad.mit.edu	37	10	12006081	12006081	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr10:12006081C>A	ENST00000356352.2	-	10	2584	c.2111G>T	c.(2110-2112)tGc>tTc	p.C704F	UPF2_ENST00000397053.2_Missense_Mutation_p.C704F|UPF2_ENST00000357604.5_Missense_Mutation_p.C704F			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	704	MIF4G 2.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)	p.C704F(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				CAGCAGGGTGCATGCCATTTC	0.448																																					p.C704F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2111T	10						.						114.0	114.0	114.0					10																	12006081		2203	4300	6503	12046087	SO:0001583	missense	26019	exon11			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.2111G>T	10.37:g.12006081C>A	ENSP00000348708:p.Cys704Phe	Somatic		Capture	Illumina HiSeq	Phase_I	12046087	NM_080599	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	37	CCDS7086.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515425	0.85389	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.25912	1.77;1.77;1.77	5.31	5.31	0.75309	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.62950	0.2470	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72760	-0.4196	10	0.66056	D	0.02	.	18.9689	0.92707	0.0:1.0:0.0:0.0	.	704	Q9HAU5	RENT2_HUMAN	F	704	ENSP00000348708:C704F;ENSP00000350221:C704F;ENSP00000380244:C704F	ENSP00000348708:C704F	C	-	2	0	UPF2	12046087	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	7.402000	0.79972	2.483000	0.83821	0.650000	0.86243	TGC		0.448	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1		
SFMBT2	57713	broad.mit.edu	37	10	7412309	7412309	+	Silent	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr10:7412309G>T	ENST00000361972.4	-	3	219	c.129C>A	c.(127-129)ggC>ggA	p.G43G	SFMBT2_ENST00000379713.3_Silent_p.G43G|SFMBT2_ENST00000379711.2_Silent_p.G43G|SFMBT2_ENST00000397160.3_Silent_p.G43G|SFMBT2_ENST00000397167.1_Silent_p.G43G	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	43					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.G43G(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CCCAGTTAAAGCCAGTTTCCT	0.448																																					p.G43G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C129A	10						.						131.0	123.0	126.0					10																	7412309		2203	4300	6503	7452315	SO:0001819	synonymous_variant	57713	exon3			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.129C>A	10.37:g.7412309G>T		Somatic		Capture	Illumina HiSeq	Phase_I	7452315	NM_001029880	A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	37	CCDS31138.1																																																																																				0.448	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
CTNNA3	29119	broad.mit.edu	37	10	67726384	67726384	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr10:67726384G>T	ENST00000433211.2	-	17	2560	c.2386C>A	c.(2386-2388)Ctc>Atc	p.L796I	CTNNA3_ENST00000373735.1_5'UTR|CTNNA3_ENST00000373744.4_Missense_Mutation_p.L796I	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.L796I(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						GACATGATGAGCTCTCCTCCC	0.448																																					p.L796I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2386A	10						.						123.0	117.0	119.0					10																	67726384		2203	4300	6503	67396390	SO:0001583	missense	29119	exon17			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2386C>A	10.37:g.67726384G>T	ENSP00000389714:p.Leu796Ile	Somatic		Capture	Illumina HiSeq	Phase_I	67396390	NM_013266		Missense_Mutation	SNP	ENST00000433211.2	37	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010113	0.75046	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000373735	T;T;T	0.37584	1.19;1.19;1.19	5.41	4.5	0.54988	.	0.000000	0.51477	D	0.000086	T	0.42877	0.1222	M	0.83312	2.635	0.80722	D	1	B	0.27264	0.173	B	0.32624	0.149	T	0.32693	-0.9897	10	0.28530	T	0.3	-5.9741	11.5063	0.50468	0.0873:0.0:0.9127:0.0	.	796	Q9UI47	CTNA3_HUMAN	I	796;796;135	ENSP00000389714:L796I;ENSP00000362849:L796I;ENSP00000362840:L135I	ENSP00000362840:L135I	L	-	1	0	CTNNA3	67396390	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	4.684000	0.61686	2.699000	0.92147	0.650000	0.86243	CTC		0.448	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
TCIRG1	10312	broad.mit.edu	37	11	67812475	67812476	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr11:67812475_67812476insC	ENST00000265686.3	+	10	1179_1180	c.1071_1072insC	c.(1072-1074)cccfs	p.P358fs	TCIRG1_ENST00000532635.1_Frame_Shift_Ins_p.P142fs	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	358					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)	p.T360fs*130(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						GCCGGGACATGCCCCCCACACT	0.678																																					p.M357fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1071_1072insC	11						.																																			67569052	SO:0001589	frameshift_variant	10312	exon10			AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.1077dupC	11.37:g.67812481_67812481dupC	ENSP00000265686:p.Pro358fs	Somatic		Capture	Illumina HiSeq	Phase_I	67569051	NM_006019	O75877|Q8WVC5	De_novo_Start_OutOfFrame	INS	ENST00000265686.3	37	CCDS8177.1																																																																																				0.678	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019	
EPS8L2	64787	broad.mit.edu	37	11	721654	721655	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr11:721654_721655insA	ENST00000533256.1	+	11	1233_1234	c.858_859insA	c.(859-861)aaafs	p.K287fs	EPS8L2_ENST00000530636.1_Frame_Shift_Ins_p.K287fs|EPS8L2_ENST00000526198.1_Frame_Shift_Ins_p.K303fs|AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000318562.8_Frame_Shift_Ins_p.K287fs			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	287					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)	p.K290fs*22(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGAACCAGCGGAAAAAGGGGAA	0.649																																					p.R286fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.858_859insA	11						.																																			711655	SO:0001589	frameshift_variant	64787	exon10			AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.863dupA	11.37:g.721659_721659dupA	ENSP00000435585:p.Lys287fs	Somatic		Capture	Illumina HiSeq	Phase_I	711654	NM_022772	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Frame_Shift_Ins	INS	ENST00000533256.1	37	CCDS31328.1																																																																																				0.649	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	
OR5D16	390144	broad.mit.edu	37	11	55606975	55606975	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr11:55606975A>G	ENST00000378396.1	+	1	748	c.748A>G	c.(748-750)Atc>Gtc	p.I250V		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I250V(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				CCTGACTGCCATCACCATCTT	0.512																																					p.I250V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A748G	11						.						143.0	123.0	130.0					11																	55606975		2201	4296	6497	55363551	SO:0001583	missense	390144	exon1			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.748A>G	11.37:g.55606975A>G	ENSP00000367649:p.Ile250Val	Somatic		Capture	Illumina HiSeq	Phase_I	55363551	NM_001005496	Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	37	CCDS31512.1	.	.	.	.	.	.	.	.	.	.	.	0.515	-0.864921	0.02590	.	.	ENSG00000205029	ENST00000378396	T	0.00009	9.46	4.53	2.13	0.27403	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.02539	-0.55	0.09310	N	1	B	0.18461	0.028	B	0.40477	0.33	T	0.37033	-0.9723	9	0.02654	T	1	-53.7305	4.0657	0.09859	0.5629:0.1743:0.2629:0.0	.	250	Q8NGK9	OR5DG_HUMAN	V	250	ENSP00000367649:I250V	ENSP00000367649:I250V	I	+	1	0	OR5D16	55363551	0.594000	0.26849	0.013000	0.15412	0.608000	0.37181	0.082000	0.14847	0.216000	0.20781	-0.416000	0.06073	ATC		0.512	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496	
OSBP	5007	broad.mit.edu	37	11	59345766	59345766	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr11:59345766T>G	ENST00000263847.1	-	12	2395	c.1916A>C	c.(1915-1917)cAc>cCc	p.H639P		NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	639					lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)	p.H639P(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		AAGAGCAAAGTGGACTTTTCC	0.483																																					p.H639P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1916C	11						.						165.0	148.0	153.0					11																	59345766		2201	4295	6496	59102342	SO:0001583	missense	5007	exon12			AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.1916A>C	11.37:g.59345766T>G	ENSP00000263847:p.His639Pro	Somatic		Capture	Illumina HiSeq	Phase_I	59102342	NM_002556	Q6P524	Missense_Mutation	SNP	ENST00000263847.1	37	CCDS7974.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.729280	0.89390	.	.	ENSG00000110048	ENST00000263847;ENST00000378235	T	0.29142	1.58	5.83	5.83	0.93111	.	0.091366	0.85682	D	0.000000	T	0.48624	0.1510	L	0.52126	1.63	0.80722	D	1	D	0.69078	0.997	D	0.71656	0.974	T	0.34004	-0.9846	10	0.34782	T	0.22	-23.2331	15.1772	0.72924	0.0:0.0:0.0:1.0	.	639	P22059	OSBP1_HUMAN	P	639;239	ENSP00000263847:H639P	ENSP00000263847:H639P	H	-	2	0	OSBP	59102342	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.825000	0.86693	2.228000	0.72767	0.528000	0.53228	CAC		0.483	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1		
HRASLS5	117245	broad.mit.edu	37	11	63233592	63233592	+	Missense_Mutation	SNP	C	C	T	rs144730159		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr11:63233592C>T	ENST00000301790.4	-	5	896	c.737G>A	c.(736-738)cGg>cAg	p.R246Q	HRASLS5_ENST00000539221.1_Intron|HRASLS5_ENST00000540857.1_Missense_Mutation_p.R236Q			Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5	246							transferase activity, transferring acyl groups (GO:0016746)	p.R246Q(2)		endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	14						CTGCTGGCTCCGGGGTACGCC	0.478																																					p.R246Q												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G737A	11						.	C	,GLN/ARG,GLN/ARG	1,4401	2.1+/-5.4	0,1,2200	149.0	112.0	124.0		,707,737	4.2	1.0	11	dbSNP_134	124	1,8595	1.2+/-3.3	0,1,4297	no	intron,missense,missense	HRASLS5	NM_001146728.1,NM_001146729.1,NM_054108.3	,43,43	0,2,6497	TT,TC,CC		0.0116,0.0227,0.0154	,probably-damaging,probably-damaging	,236/270,246/280	63233592	2,12996	2201	4298	6499	62990168	SO:0001583	missense	117245	exon5			AJ416558	CCDS8044.1, CCDS53646.1, CCDS53647.1	11q13.2	2006-08-16			ENSG00000168004	ENSG00000168004			24978	protein-coding gene	gene with protein product		611474					Standard	NM_001146729		Approved	HRLP5	uc001nwy.2	Q96KN8	OTTHUMG00000167806	ENST00000301790.4:c.737G>A	11.37:g.63233592C>T	ENSP00000301790:p.Arg246Gln	Somatic		Capture	Illumina HiSeq	Phase_I	62990168	NM_054108	B7X6T1|F5GZ87|F5H4Y9	Missense_Mutation	SNP	ENST00000301790.4	37	CCDS8044.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470291	0.63625	2.27E-4	1.16E-4	ENSG00000168004	ENST00000540857;ENST00000301790	T;T	0.28069	1.63;1.63	4.17	4.17	0.49024	NC (1);	0.215456	0.45867	D	0.000323	T	0.44519	0.1297	L	0.60455	1.87	0.26750	N	0.97021	D;D	0.65815	0.993;0.995	P;P	0.59171	0.771;0.853	T	0.23048	-1.0199	10	0.46703	T	0.11	-30.7947	12.2841	0.54783	0.0:1.0:0.0:0.0	.	236;246	F5H4Y9;Q96KN8	.;HRSL5_HUMAN	Q	236;246	ENSP00000444809:R236Q;ENSP00000301790:R246Q	ENSP00000301790:R246Q	R	-	2	0	HRASLS5	62990168	0.097000	0.21791	1.000000	0.80357	0.584000	0.36387	0.570000	0.23653	2.623000	0.88846	0.655000	0.94253	CGG		0.478	HRASLS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396375.1	NM_054108	
SF1	7536	broad.mit.edu	37	11	64536741	64536741	+	Missense_Mutation	SNP	G	G	A	rs111552365		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr11:64536741G>A	ENST00000377390.3	-	7	1070	c.733C>T	c.(733-735)Cgg>Tgg	p.R245W	SF1_ENST00000334944.5_Missense_Mutation_p.R245W|SF1_ENST00000422298.2_Missense_Mutation_p.R130W|SF1_ENST00000489544.1_5'UTR|SF1_ENST00000377387.1_Missense_Mutation_p.R370W|SF1_ENST00000377394.3_Missense_Mutation_p.R245W|SF1_ENST00000227503.9_Missense_Mutation_p.R245W|SF1_ENST00000433274.2_Missense_Mutation_p.R219W	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	245					Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R245W(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						GCCAACTCCCGAAGCTGCATC	0.458																																					p.R245W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C733T	11						.						103.0	99.0	101.0					11																	64536741		2201	4297	6498	64293317	SO:0001583	missense	7536	exon7			D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.733C>T	11.37:g.64536741G>A	ENSP00000366607:p.Arg245Trp	Somatic		Capture	Illumina HiSeq	Phase_I	64293317	NM_201998	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	ENST00000377390.3	37	CCDS31599.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140787	0.77775	.	.	ENSG00000168066	ENST00000377387;ENST00000377390;ENST00000227503;ENST00000377394;ENST00000334944;ENST00000422298;ENST00000433274	T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91	6.03	6.03	0.97812	.	0.106632	0.64402	D	0.000006	T	0.42988	0.1227	L	0.43757	1.38	0.80722	D	1	P;P;P;P;P;D	0.60575	0.917;0.95;0.95;0.917;0.95;0.988	B;B;B;B;B;P	0.44422	0.157;0.272;0.319;0.17;0.319;0.449	T	0.40403	-0.9565	10	0.87932	D	0	.	18.0691	0.89400	0.0:0.0:1.0:0.0	.	130;245;245;245;245;370	B4DX42;Q15637-6;Q15637-4;Q15637;Q15637-2;Q15637-5	.;.;.;SF01_HUMAN;.;.	W	370;245;245;245;245;130;219	ENSP00000366604:R370W;ENSP00000366607:R245W;ENSP00000227503:R245W;ENSP00000366611:R245W;ENSP00000334414:R245W;ENSP00000413084:R130W;ENSP00000396793:R219W	ENSP00000227503:R245W	R	-	1	2	SF1	64293317	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.555000	0.60767	2.868000	0.98415	0.557000	0.71058	CGG		0.458	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	NM_004630	
FAT3	120114	broad.mit.edu	37	11	92590393	92590393	+	Silent	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr11:92590393G>A	ENST00000298047.6	+	19	11396	c.11379G>A	c.(11377-11379)ccG>ccA	p.P3793P	FAT3_ENST00000525166.1_Silent_p.P3643P|FAT3_ENST00000409404.2_Silent_p.P3793P|FAT3_ENST00000533797.1_Silent_p.P128P			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3793					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P3793P(2)|p.P368P(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GACTGTGTCCGGGGTCCAACG	0.527										TCGA Ovarian(4;0.039)																											p.P3793P												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G11379A	11						.						105.0	109.0	108.0					11																	92590393		2003	4165	6168	92230041	SO:0001819	synonymous_variant	120114	exon19			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11379G>A	11.37:g.92590393G>A		Somatic		Capture	Illumina HiSeq	Phase_I	92230041	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																					0.527	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
ATM	472	broad.mit.edu	37	11	108206581	108206581	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr11:108206581G>A	ENST00000452508.2	+	57	8350	c.8161G>A	c.(8161-8163)Gac>Aac	p.D2721N	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.D2721N			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2721	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.D2721N(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGGCCGTGATGACCTGAGACA	0.378			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.D2721N		yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8161A	11						.						101.0	93.0	95.0					11																	108206581		2201	4298	6499	107711791	SO:0001583	missense	472	exon56	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8161G>A	11.37:g.108206581G>A	ENSP00000388058:p.Asp2721Asn	Somatic		Capture	Illumina HiSeq	Phase_I	107711791	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	35	5.549446	0.96501	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.90955	-2.76;-2.76	5.47	5.47	0.80525	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.97645	0.9228	H	0.98721	4.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99167	1.0863	10	0.87932	D	0	.	19.3096	0.94182	0.0:0.0:1.0:0.0	.	2721	Q13315	ATM_HUMAN	N	2721	ENSP00000278616:D2721N;ENSP00000388058:D2721N	ENSP00000278616:D2721N	D	+	1	0	ATM	107711791	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.304000	0.96190	2.583000	0.87209	0.591000	0.81541	GAC		0.378	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
ACACB	32	broad.mit.edu	37	12	109660638	109660638	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr12:109660638T>G	ENST00000338432.7	+	26	3832	c.3713T>G	c.(3712-3714)cTg>cGg	p.L1238R	ACACB_ENST00000377848.3_Missense_Mutation_p.L1238R|ACACB_ENST00000377854.5_Missense_Mutation_p.L1168R			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1238					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.L1238R(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TCCTACGAGCTGCGGCATAAC	0.622																																					p.L1238R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3713G	12						.						89.0	66.0	74.0					12																	109660638		2203	4300	6503	108145021	SO:0001583	missense	32	exon25			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3713T>G	12.37:g.109660638T>G	ENSP00000341044:p.Leu1238Arg	Somatic		Capture	Illumina HiSeq	Phase_I	108145021	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	T	14.84	2.656976	0.47467	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027	T;T;T	0.42513	0.97;0.97;0.97	4.96	4.96	0.65561	Acetyl-CoA carboxylase, central domain (1);	0.000000	0.64402	D	0.000001	T	0.58119	0.2100	L	0.59912	1.85	0.80722	D	1	D	0.57257	0.979	D	0.67103	0.949	T	0.55036	-0.8203	10	0.30854	T	0.27	.	14.9512	0.71077	0.0:0.0:0.0:1.0	.	1238	O00763	ACACB_HUMAN	R	1238;1238;1168;469	ENSP00000341044:L1238R;ENSP00000367079:L1238R;ENSP00000367085:L1168R	ENSP00000341044:L1238R	L	+	2	0	ACACB	108145021	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.994000	0.88315	1.995000	0.58328	0.528000	0.53228	CTG		0.622	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
CLIP1	6249	broad.mit.edu	37	12	122864919	122864919	+	Silent	SNP	C	C	T	rs138117323		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr12:122864919C>T	ENST00000540338.1	-	1	122	c.81G>A	c.(79-81)acG>acA	p.T27T	CLIP1_ENST00000302528.7_Silent_p.T27T|CLIP1_ENST00000537178.1_Silent_p.T27T|CLIP1_ENST00000358808.2_Silent_p.T27T|CLIP1_ENST00000361654.4_Silent_p.T27T			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	27					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.T27T(1)		NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TATTACCAGCCGTAGGTGTCT	0.383																																					p.T27T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G81A	12						.	C	,	0,4406		0,0,2203	108.0	107.0	107.0		81,81	-2.5	0.0	12	dbSNP_134	107	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	CLIP1	NM_002956.2,NM_198240.1	,	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	,	27/1428,27/1393	122864919	3,13003	2203	4300	6503	121430872	SO:0001819	synonymous_variant	6249	exon2				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.81G>A	12.37:g.122864919C>T		Somatic		Capture	Illumina HiSeq	Phase_I	121430872	NM_198240	A0AVD3|Q17RS4|Q29RG0	Silent	SNP	ENST00000540338.1	37	CCDS58285.1																																																																																				0.383	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ALG10B	144245	broad.mit.edu	37	12	38715004	38715004	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr12:38715004T>G	ENST00000308742.4	+	3	1727	c.1411T>G	c.(1411-1413)Ttt>Gtt	p.F471V	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	471					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)	p.F471V(1)		breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				CATTCAAAGGTTTATGTGGTA	0.308																																					p.F471V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1411G	12						.						115.0	116.0	116.0					12																	38715004		2202	4296	6498	37001271	SO:0001583	missense	144245	exon3			AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.1411T>G	12.37:g.38715004T>G	ENSP00000310120:p.Phe471Val	Somatic		Capture	Illumina HiSeq	Phase_I	37001271	NM_001013620	B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	37	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	t	18.34	3.602950	0.66445	.	.	ENSG00000175548	ENST00000308742	T	0.37235	1.21	3.33	3.33	0.38152	.	0.000000	0.85682	D	0.000000	T	0.58119	0.2100	M	0.90309	3.105	0.80722	D	1	D	0.63880	0.993	P	0.57283	0.817	T	0.67090	-0.5758	10	0.72032	D	0.01	.	10.3392	0.43868	0.0:0.0:0.0:1.0	.	471	Q5I7T1	AG10B_HUMAN	V	471	ENSP00000310120:F471V	ENSP00000310120:F471V	F	+	1	0	ALG10B	37001271	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.454000	0.80714	1.766000	0.52107	0.533000	0.62120	TTT		0.308	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620	
PUS7L	83448	broad.mit.edu	37	12	44148838	44148838	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr12:44148838G>C	ENST00000416848.2	-	2	699	c.211C>G	c.(211-213)Cca>Gca	p.P71A	PUS7L_ENST00000344862.5_Missense_Mutation_p.P71A|PUS7L_ENST00000553166.1_Missense_Mutation_p.P71A|PUS7L_ENST00000551923.1_Missense_Mutation_p.P71A|PUS7L_ENST00000431332.3_Intron	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	71					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.P71A(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		TCTAGTTTTGGTTTTTTGGGA	0.343																																					p.P71A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C211G	12						.						117.0	111.0	113.0					12																	44148838		2203	4300	6503	42435105	SO:0001583	missense	83448	exon2			BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.211C>G	12.37:g.44148838G>C	ENSP00000415899:p.Pro71Ala	Somatic		Capture	Illumina HiSeq	Phase_I	42435105	NM_001098615	B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Missense_Mutation	SNP	ENST00000416848.2	37	CCDS8743.1	.	.	.	.	.	.	.	.	.	.	G	0.840	-0.742087	0.03088	.	.	ENSG00000129317	ENST00000416848;ENST00000344862;ENST00000551923;ENST00000553166;ENST00000549868	T;T;T;T;T	0.48836	2.06;2.06;2.06;2.0;0.8	4.94	-6.35	0.01975	Pseudouridine synthase, catalytic domain (1);	0.892873	0.09693	N	0.768064	T	0.27169	0.0666	N	0.22421	0.69	0.20403	N	0.999906	B	0.02656	0.0	B	0.04013	0.001	T	0.41538	-0.9503	10	0.08381	T	0.77	0.0325	14.0698	0.64852	0.0:0.2043:0.6177:0.178	.	71	Q9H0K6	PUS7L_HUMAN	A	71	ENSP00000415899:P71A;ENSP00000343081:P71A;ENSP00000447706:P71A;ENSP00000446865:P71A;ENSP00000449502:P71A	ENSP00000343081:P71A	P	-	1	0	PUS7L	42435105	0.000000	0.05858	0.047000	0.18901	0.244000	0.25665	-0.917000	0.04025	-1.456000	0.01921	-2.067000	0.00394	CCA		0.343	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	NM_031292	
CD63	967	broad.mit.edu	37	12	56119990	56119990	+	Missense_Mutation	SNP	G	G	A	rs11574657	byFrequency	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr12:56119990G>A	ENST00000549117.1	-	6	918	c.482C>T	c.(481-483)tCg>tTg	p.S161L	RP11-644F5.11_ENST00000552576.1_RNA|CD63_ENST00000257857.4_Missense_Mutation_p.S161L|CD63_ENST00000548898.1_Missense_Mutation_p.S68L|CD63_ENST00000546939.1_Missense_Mutation_p.S79L|CD63_ENST00000552067.1_Missense_Mutation_p.S68L|CD63_ENST00000552692.1_Missense_Mutation_p.S161L|CD63_ENST00000548160.1_Missense_Mutation_p.S68L|CD63_ENST00000552754.1_Missense_Mutation_p.S138L|CD63_ENST00000420846.3_Missense_Mutation_p.S161L|CD63_ENST00000550776.1_Missense_Mutation_p.S79L	NM_001257389.1	NP_001244318.1	P08962	CD63_HUMAN	CD63 molecule	161					blood coagulation (GO:0007596)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular protein localization (GO:0034613)|endosome to melanosome transport (GO:0035646)|pigment granule maturation (GO:0048757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of receptor internalization (GO:0002092)|protein transport (GO:0015031)|regulation of rubidium ion transport (GO:2000680)|regulation of vascular endothelial growth factor signaling pathway (GO:1900746)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|multivesicular body, internal vesicle (GO:0097487)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)		p.S161L(1)		kidney(1)|large_intestine(3)|lung(2)|ovary(1)	7						TCGGTTCTTCGACATGGAAGG	0.488																																					p.S161L	Pancreas(123;1459 1747 6717 18841 37380)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C482T	12						.	G	LEU/SER,LEU/SER	0,4406		0,0,2203	109.0	108.0	109.0		482,482	-0.8	0.0	12	dbSNP_120	109	3,8597	3.0+/-9.4	0,3,4297	no	missense,missense	CD63	NM_001040034.1,NM_001780.4	145,145	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign,benign	161/237,161/239	56119990	3,13003	2203	4300	6503	54406257	SO:0001583	missense	967	exon6			M58485	CCDS8890.1, CCDS58242.1, CCDS58243.1	12q12-q13	2013-02-14	2006-03-28					"""CD molecules"", ""Tetraspanins"""	1692	protein-coding gene	gene with protein product		155740	"""CD63 antigen (melanoma 1 antigen)"""	MLA1			Standard	NM_001780		Approved	ME491, TSPAN30	uc031qhv.1	P08962		ENST00000549117.1:c.482C>T	12.37:g.56119990G>A	ENSP00000447730:p.Ser161Leu	Somatic		Capture	Illumina HiSeq	Phase_I	54406257	NM_001780	F8VZE2|Q5TZP3|Q8N6Z9|Q9UCG6	Missense_Mutation	SNP	ENST00000549117.1	37	CCDS8890.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.837354	0.32513	0.0	3.49E-4	ENSG00000135404	ENST00000548898;ENST00000552067;ENST00000420846;ENST00000548160;ENST00000546939;ENST00000552692;ENST00000549117;ENST00000257857;ENST00000552754;ENST00000550776;ENST00000552164;ENST00000551173	T;T;T;T;T;T;T;T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38	4.57	-0.84	0.10755	Tetraspanin, EC2 domain (1);	1.436920	0.04712	N	0.417762	T	0.69593	0.3128	L	0.39085	1.19	0.09310	N	1	B;B;B	0.30605	0.287;0.005;0.02	B;B;B	0.24155	0.051;0.006;0.013	T	0.52343	-0.8588	10	0.29301	T	0.29	.	7.9567	0.30047	0.1678:0.5417:0.2905:0.0	rs11574657;rs11574657	138;161;161	Q8N6Z9;C9JV86;P08962	.;.;CD63_HUMAN	L	68;68;161;68;79;161;161;161;138;79;161;161	ENSP00000447938:S68L;ENSP00000449684:S68L;ENSP00000393502:S161L;ENSP00000449654:S68L;ENSP00000447356:S79L;ENSP00000449337:S161L;ENSP00000447730:S161L;ENSP00000257857:S161L;ENSP00000446807:S138L;ENSP00000448091:S79L;ENSP00000449281:S161L;ENSP00000446752:S161L	ENSP00000257857:S161L	S	-	2	0	CD63	54406257	0.000000	0.05858	0.000000	0.03702	0.362000	0.29581	-0.473000	0.06615	-0.238000	0.09724	0.591000	0.81541	TCG		0.488	CD63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409234.1		
HIP1R	9026	broad.mit.edu	37	12	123346026	123346026	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr12:123346026C>T	ENST00000253083.4	+	31	3249	c.3124C>T	c.(3124-3126)Cag>Tag	p.Q1042*		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	1042					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)	p.Q1042*(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		ACCCCTGGCCCAGAAGCCCAG	0.682																																					p.Q1042X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3124T	12						.						20.0	25.0	24.0					12																	123346026		2198	4296	6494	121911979	SO:0001587	stop_gained	9026	exon31			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.3124C>T	12.37:g.123346026C>T	ENSP00000253083:p.Gln1042*	Somatic		Capture	Illumina HiSeq	Phase_I	121911979	NM_003959	A6NHQ6|Q6NXG8|Q9UED9	Nonsense_Mutation	SNP	ENST00000253083.4	37	CCDS31922.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115207	0.56505	.	.	ENSG00000130787	ENST00000253083	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-30.3484	17.1914	0.86880	0.0:1.0:0.0:0.0	.	.	.	.	X	1042	.	ENSP00000253083:Q1042X	Q	+	1	0	HIP1R	121911979	1.000000	0.71417	1.000000	0.80357	0.312000	0.27988	5.535000	0.67173	2.341000	0.79615	0.462000	0.41574	CAG		0.682	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1	NM_003959	
MTUS2	23281	broad.mit.edu	37	13	30071429	30071429	+	Missense_Mutation	SNP	C	C	T	rs373897999		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr13:30071429C>T	ENST00000380808.2	+	6	787	c.571C>T	c.(571-573)Cgc>Tgc	p.R191C	MTUS2_ENST00000431530.3_Missense_Mutation_p.R1222C|MTUS2_ENST00000400542.3_3'UTR|MTUS2_ENST00000542829.1_Missense_Mutation_p.R101C	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1212						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.R1222C(1)|p.R191C(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CAGAGCCCGCCGCTTCGAAGA	0.617																																					p.R1222C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3664T	13						.	C	CYS/ARG,CYS/ARG	2,4202		0,2,2100	32.0	41.0	38.0		3664,571	5.2	1.0	13		38	0,8478		0,0,4239	no	missense,missense	MTUS2	NM_001033602.2,NM_015233.5	180,180	0,2,6339	TT,TC,CC		0.0,0.0476,0.0158	probably-damaging,probably-damaging	1222/1380,191/349	30071429	2,12680	2102	4239	6341	28969429	SO:0001583	missense	23281	exon11			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000380808.2:c.571C>T	13.37:g.30071429C>T	ENSP00000370186:p.Arg191Cys	Somatic		Capture	Illumina HiSeq	Phase_I	28969429	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000380808.2	37	CCDS41874.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440805	0.83993	4.76E-4	0.0	ENSG00000132938	ENST00000431530;ENST00000380808;ENST00000542829;ENST00000417109	T;T;T	0.27402	2.48;1.95;1.67	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.57272	0.2042	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.59810	-0.7384	9	.	.	.	.	12.8676	0.57948	0.1626:0.8374:0.0:0.0	.	191;1212	Q5JR59-3;Q5JR59	.;MTUS2_HUMAN	C	1222;191;101;148	ENSP00000392057:R1222C;ENSP00000370186:R191C;ENSP00000445403:R101C	.	R	+	1	0	MTUS2	28969429	0.998000	0.40836	0.954000	0.39281	0.888000	0.51559	4.040000	0.57333	2.677000	0.91161	0.655000	0.94253	CGC		0.617	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044335.2	XM_166270	
TDRD3	81550	broad.mit.edu	37	13	61109249	61109249	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr13:61109249G>A	ENST00000196169.3	+	12	2509	c.1721G>A	c.(1720-1722)cGg>cAg	p.R574Q	TDRD3_ENST00000377894.2_Missense_Mutation_p.R574Q|TDRD3_ENST00000377881.2_Missense_Mutation_p.R574Q|TDRD3_ENST00000535286.1_Missense_Mutation_p.R667Q	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	574	Tudor. {ECO:0000255|PROSITE- ProRule:PRU00211}.				chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.R574Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		CAGTTTTACCGGGCAGAAGTT	0.388																																					p.R574Q	Colon(36;164 906 35820 50723)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1721A	13						.						96.0	90.0	92.0					13																	61109249		2203	4300	6503	60007250	SO:0001583	missense	81550	exon12			AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.1721G>A	13.37:g.61109249G>A	ENSP00000196169:p.Arg574Gln	Somatic		Capture	Illumina HiSeq	Phase_I	60007250	NM_001146071	B2MWP9|Q53XA6|Q6P992	Missense_Mutation	SNP	ENST00000196169.3	37	CCDS9441.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.335460	0.81801	.	.	ENSG00000083544	ENST00000196169;ENST00000377881;ENST00000377894;ENST00000535286	D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83	6.07	5.23	0.72850	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.174926	0.50627	D	0.000106	D	0.93236	0.7845	M	0.92555	3.32	0.41318	D	0.987156	D;D;D	0.76494	0.999;0.999;0.999	P;P;D	0.65010	0.838;0.836;0.931	D	0.94188	0.7438	10	0.51188	T	0.08	-10.698	13.8116	0.63266	0.0705:0.0:0.9295:0.0	.	667;573;574	Q9H7E2-3;Q9H7E2-2;Q9H7E2	.;.;TDRD3_HUMAN	Q	574;574;574;667	ENSP00000196169:R574Q;ENSP00000367113:R574Q;ENSP00000367126:R574Q;ENSP00000440190:R667Q	ENSP00000196169:R574Q	R	+	2	0	TDRD3	60007250	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.493000	0.73658	1.585000	0.49928	0.585000	0.79938	CGG		0.388	TDRD3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045175.2	NM_030794	
SCEL	8796	broad.mit.edu	37	13	78216902	78216902	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr13:78216902G>T	ENST00000349847.3	+	32	2093	c.2009G>T	c.(2008-2010)aGa>aTa	p.R670I	SCEL_ENST00000535157.1_Missense_Mutation_p.R628I|SCEL_ENST00000377246.3_Missense_Mutation_p.R650I	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	670	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)	p.R670I(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TGGATTTATAGACAGACAATA	0.323																																					p.R628I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1883T	13						.						108.0	109.0	109.0					13																	78216902		2203	4298	6501	77114903	SO:0001583	missense	8796	exon30			AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.2009G>T	13.37:g.78216902G>T	ENSP00000302579:p.Arg670Ile	Somatic		Capture	Illumina HiSeq	Phase_I	77114903	NM_001160706	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	ENST00000349847.3	37	CCDS9459.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057406	0.76074	.	.	ENSG00000136155	ENST00000535157;ENST00000377246;ENST00000349847	D;D;D	0.83591	-1.74;-1.74;-1.74	5.81	-0.79	0.10932	Zinc finger, LIM-type (3);	0.315313	0.28236	N	0.016085	T	0.80939	0.4720	L	0.27053	0.805	0.41722	D	0.989511	D;D;D	0.63880	0.967;0.967;0.993	P;P;P	0.62089	0.819;0.805;0.898	T	0.78753	-0.2081	10	0.87932	D	0	-4.8247	9.6624	0.39962	0.676:0.0:0.324:0.0	.	628;650;670	F5H651;O95171-2;O95171	.;.;SCEL_HUMAN	I	628;650;670	ENSP00000437895:R628I;ENSP00000366454:R650I;ENSP00000302579:R670I	ENSP00000302579:R670I	R	+	2	0	SCEL	77114903	0.656000	0.27385	0.326000	0.25389	0.977000	0.68977	0.164000	0.16542	-0.090000	0.12462	0.655000	0.94253	AGA		0.323	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045339.2	NM_144777	
IPO4	79711	broad.mit.edu	37	14	24653538	24653538	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr14:24653538C>T	ENST00000354464.6	-	17	1899	c.1723G>A	c.(1723-1725)Gac>Aac	p.D575N	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	575					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)		p.D575N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		TCTACCTGGTCGCAGAGGCCC	0.672																																					p.D575N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1723A	14						.						15.0	22.0	20.0					14																	24653538		2172	4267	6439	23723378	SO:0001583	missense	79711	exon17			AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.1723G>A	14.37:g.24653538C>T	ENSP00000346453:p.Asp575Asn	Somatic		Capture	Illumina HiSeq	Phase_I	23723378	NM_024658	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	ENST00000354464.6	37	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.962337	0.34659	.	.	ENSG00000196497	ENST00000354464;ENST00000399536	T	0.55588	0.51	5.4	1.09	0.20402	Armadillo-like helical (1);Armadillo-type fold (1);	0.329186	0.34291	N	0.004088	T	0.47060	0.1425	M	0.65975	2.015	0.38830	D	0.955838	B;B	0.09022	0.002;0.001	B;B	0.10450	0.003;0.005	T	0.39623	-0.9605	10	0.29301	T	0.29	-6.8151	10.9284	0.47203	0.0:0.7245:0.0:0.2755	.	575;575	Q8TEX9;Q8TEX9-2	IPO4_HUMAN;.	N	575;251	ENSP00000346453:D575N	ENSP00000346453:D575N	D	-	1	0	IPO4	23723378	0.675000	0.27558	0.121000	0.21740	0.899000	0.52679	1.193000	0.32162	0.012000	0.14892	-0.907000	0.02831	GAC		0.672	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
AKAP6	9472	broad.mit.edu	37	14	33291631	33291631	+	Missense_Mutation	SNP	C	C	T	rs369118703		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr14:33291631C>T	ENST00000280979.4	+	13	4782	c.4612C>T	c.(4612-4614)Cgc>Tgc	p.R1538C	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1538					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.R1538C(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TGAAATGGATCGCATTTCATA	0.378																																					p.R1538C	Melanoma(49;821 1200 7288 13647 42351)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4612T	14						.						102.0	106.0	105.0					14																	33291631		2203	4300	6503	32361382	SO:0001583	missense	9472	exon13			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4612C>T	14.37:g.33291631C>T	ENSP00000280979:p.Arg1538Cys	Somatic		Capture	Illumina HiSeq	Phase_I	32361382	NM_004274	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.734532	0.30774	.	.	ENSG00000151320	ENST00000280979	T	0.05649	3.41	5.79	3.9	0.45041	.	1.023020	0.07735	N	0.945835	T	0.08935	0.0221	L	0.54323	1.7	0.80722	D	1	D	0.62365	0.991	B	0.40410	0.328	T	0.25916	-1.0118	10	0.87932	D	0	-0.1202	9.3122	0.37912	0.1436:0.7835:0.0:0.0729	.	1538	Q13023	AKAP6_HUMAN	C	1538	ENSP00000280979:R1538C	ENSP00000280979:R1538C	R	+	1	0	AKAP6	32361382	0.987000	0.35691	0.809000	0.32408	0.986000	0.74619	2.829000	0.48128	1.445000	0.47624	0.650000	0.86243	CGC		0.378	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
VRTN	55237	broad.mit.edu	37	14	74823550	74823550	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr14:74823550G>A	ENST00000256362.4	+	2	305	c.64G>A	c.(64-66)Gaa>Aaa	p.E22K		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	22					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)	p.E22K(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						AGTGGAGTGCGAAGGCCTGGA	0.607																																					p.E22K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G64A	14						.						92.0	87.0	88.0					14																	74823550		2203	4300	6503	73893303	SO:0001583	missense	55237	exon2			AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.64G>A	14.37:g.74823550G>A	ENSP00000256362:p.Glu22Lys	Somatic		Capture	Illumina HiSeq	Phase_I	73893303	NM_018228	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	37	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.280060	0.40294	.	.	ENSG00000133980	ENST00000557177;ENST00000256362	T;T	0.49139	0.79;0.79	5.05	0.491	0.16867	.	0.447943	0.21657	N	0.071084	T	0.21550	0.0519	N	0.14661	0.345	0.26639	N	0.972319	B	0.18968	0.032	B	0.06405	0.002	T	0.07462	-1.0771	10	0.22109	T	0.4	-5.6146	2.4963	0.04622	0.0953:0.2483:0.4012:0.2552	.	22	Q9H8Y1	VRTN_HUMAN	K	22	ENSP00000452158:E22K;ENSP00000256362:E22K	ENSP00000256362:E22K	E	+	1	0	VRTN	73893303	0.998000	0.40836	0.915000	0.36163	0.693000	0.40251	1.548000	0.36201	0.250000	0.21479	0.561000	0.74099	GAA		0.607	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228	
TDRD9	122402	broad.mit.edu	37	14	104490971	104490971	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr14:104490971G>A	ENST00000409874.4	+	25	2720	c.2672G>A	c.(2671-2673)aGg>aAg	p.R891K	TDRD9_ENST00000339063.5_Missense_Mutation_p.R891K	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	891					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.R891K(1)|p.R606K(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				ACATCAGACAGGTCCCAGACA	0.358																																					p.R891K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2672A	14						.						168.0	150.0	156.0					14																	104490971		2203	4300	6503	103560724	SO:0001583	missense	122402	exon25			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.2672G>A	14.37:g.104490971G>A	ENSP00000387303:p.Arg891Lys	Somatic		Capture	Illumina HiSeq	Phase_I	103560724	NM_153046	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	ENST00000409874.4	37	CCDS9987.2	.	.	.	.	.	.	.	.	.	.	G	8.173	0.792208	0.16258	.	.	ENSG00000156414	ENST00000409874;ENST00000339063	T;T	0.03272	3.99;3.99	5.47	-0.453	0.12201	.	0.915412	0.09239	N	0.829430	T	0.01940	0.0061	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.47724	-0.9095	10	0.02654	T	1	.	2.073	0.03618	0.386:0.117:0.3654:0.1316	.	891;891	Q8NDG6-2;Q8NDG6	.;TDRD9_HUMAN	K	891	ENSP00000387303:R891K;ENSP00000343545:R891K	ENSP00000343545:R891K	R	+	2	0	TDRD9	103560724	0.000000	0.05858	0.000000	0.03702	0.870000	0.49936	0.010000	0.13242	-0.030000	0.13804	0.563000	0.77884	AGG		0.358	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	
NPAP1	23742	broad.mit.edu	37	15	24922808	24922808	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr15:24922808C>A	ENST00000329468.2	+	1	2268	c.1794C>A	c.(1792-1794)agC>agA	p.S598R		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	598					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S598R(1)									CCAGAGTGAGCTCTCTCCCAA	0.458																																					p.S598R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1794A	15						.						86.0	91.0	89.0					15																	24922808		2203	4300	6503	22473901	SO:0001583	missense	23742	exon1			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1794C>A	15.37:g.24922808C>A	ENSP00000333735:p.Ser598Arg	Somatic		Capture	Illumina HiSeq	Phase_I	22473901	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	11.55	1.673145	0.29693	.	.	ENSG00000185823	ENST00000329468	T	0.08102	3.13	1.5	-3.0	0.05480	.	1.635260	0.03656	N	0.241881	T	0.05777	0.0151	L	0.42245	1.32	0.09310	N	1	B	0.31383	0.321	B	0.17979	0.02	T	0.31971	-0.9924	10	0.17832	T	0.49	.	2.5502	0.04747	0.4866:0.3245:0.0:0.1889	.	598	Q9NZP6	CO002_HUMAN	R	598	ENSP00000333735:S598R	ENSP00000333735:S598R	S	+	3	2	C15orf2	22473901	0.000000	0.05858	0.001000	0.08648	0.103000	0.19146	-0.009000	0.12765	-0.886000	0.03966	0.205000	0.17691	AGC		0.458	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
HS3ST4	9951	broad.mit.edu	37	16	26147345	26147345	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr16:26147345G>C	ENST00000331351.5	+	2	1539	c.1147G>C	c.(1147-1149)Gag>Cag	p.E383Q	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	383				E -> K (in Ref. 1; AAD30210 and 2; AAS58324). {ECO:0000305}.	heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)	p.E383Q(1)		breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		TGTTGTGACTGAGAAGCATTT	0.517																																					p.E383Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1147C	16						.						66.0	64.0	64.0					16																	26147345		1568	3582	5150	26054846	SO:0001583	missense	9951	exon2			AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.1147G>C	16.37:g.26147345G>C	ENSP00000330606:p.Glu383Gln	Somatic		Capture	Illumina HiSeq	Phase_I	26054846	NM_006040	Q5QI42|Q8NDC2	Missense_Mutation	SNP	ENST00000331351.5	37	CCDS53995.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.526136	0.64860	.	.	ENSG00000182601	ENST00000331351	T	0.57907	0.37	5.56	5.56	0.83823	.	0.074699	0.50627	U	0.000104	T	0.49508	0.1561	N	0.14661	0.345	0.58432	D	0.999991	.	.	.	.	.	.	T	0.51560	-0.8690	8	0.45353	T	0.12	.	18.5023	0.90887	0.0:0.0:1.0:0.0	.	.	.	.	Q	383	ENSP00000330606:E383Q	ENSP00000330606:E383Q	E	+	1	0	HS3ST4	26054846	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.882000	0.87258	2.602000	0.87976	0.655000	0.94253	GAG		0.517	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133286.2	NM_006040	
ZNF423	23090	broad.mit.edu	37	16	49559353	49559353	+	Silent	SNP	C	C	T	rs376719006		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr16:49559353C>T	ENST00000561648.1	-	6	3683	c.3630G>A	c.(3628-3630)ccG>ccA	p.P1210P	ZNF423_ENST00000562871.1_Silent_p.P1150P|ZNF423_ENST00000562520.1_Silent_p.P1150P|ZNF423_ENST00000563137.2_Silent_p.P1150P|ZNF423_ENST00000535559.1_Silent_p.P1093P|ZNF423_ENST00000262383.2_Silent_p.P1210P|ZNF423_ENST00000567169.1_Silent_p.P1093P	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1210					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P1210P(6)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GGAGCTTGGCCGGGGAGTCGA	0.572																																					p.P1210P												.	.	6	Substitution - coding silent(6)	lung(4)|large_intestine(2)	c.G3630A	16						.	C		1,4397	2.1+/-5.4	0,1,2198	115.0	95.0	102.0		3630	-3.9	0.9	16		102	0,8600		0,0,4300	no	coding-synonymous	ZNF423	NM_015069.2		0,1,6498	TT,TC,CC		0.0,0.0227,0.0077		1210/1285	49559353	1,12997	2199	4300	6499	48116854	SO:0001819	synonymous_variant	23090	exon7			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3630G>A	16.37:g.49559353C>T		Somatic		Capture	Illumina HiSeq	Phase_I	48116854	NM_015069	O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	CCDS32445.1																																																																																				0.572	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
CNOT1	23019	broad.mit.edu	37	16	58615359	58615359	+	Missense_Mutation	SNP	G	G	A	rs371890421		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr16:58615359G>A	ENST00000317147.5	-	11	1437	c.1105C>T	c.(1105-1107)Cgt>Tgt	p.R369C	CNOT1_ENST00000441024.2_Missense_Mutation_p.R369C|CNOT1_ENST00000569240.1_Missense_Mutation_p.R369C	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	369					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)	p.R369C(2)		breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TTACTGTCACGAATTTGAAAT	0.373																																					p.R369C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1105T	16						.	G	CYS/ARG,CYS/ARG	1,4395	2.1+/-5.4	0,1,2197	102.0	93.0	96.0		1105,1105	5.3	1.0	16		96	0,8600		0,0,4300	no	missense,missense	CNOT1	NM_016284.3,NM_206999.1	180,180	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	369/2377,369/1552	58615359	1,12995	2198	4300	6498	57172860	SO:0001583	missense	23019	exon11			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.1105C>T	16.37:g.58615359G>A	ENSP00000320949:p.Arg369Cys	Somatic		Capture	Illumina HiSeq	Phase_I	57172860	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.578957	0.86645	2.27E-4	0.0	ENSG00000125107	ENST00000317147;ENST00000394200;ENST00000441024	T;T	0.41758	0.99;0.99	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.52500	0.1738	L	0.43152	1.355	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.998	P;P;P	0.56916	0.809;0.642;0.731	T	0.45234	-0.9275	9	.	.	.	-5.2419	18.9648	0.92692	0.0:0.0:1.0:0.0	.	369;369;369	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	C	369	ENSP00000320949:R369C;ENSP00000413113:R369C	.	R	-	1	0	CNOT1	57172860	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.775000	0.85489	2.486000	0.83907	0.563000	0.77884	CGT		0.373	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CDH11	1009	broad.mit.edu	37	16	65005568	65005568	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr16:65005568T>C	ENST00000268603.4	-	11	2171	c.1556A>G	c.(1555-1557)gAt>gGt	p.D519G	CDH11_ENST00000394156.3_Missense_Mutation_p.D519G|CDH11_ENST00000566827.1_Missense_Mutation_p.D393G	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	519	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D519G(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GGCCGTGTCATCCTTGTCATC	0.398			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.D519G			Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1556G	16						.						123.0	116.0	119.0					16																	65005568		2203	4300	6503	63563069	SO:0001583	missense	1009	exon11			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1556A>G	16.37:g.65005568T>C	ENSP00000268603:p.Asp519Gly	Somatic		Capture	Illumina HiSeq	Phase_I	63563069	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.748668	0.89753	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.79352	1.06;-1.26	5.88	5.88	0.94601	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.91314	0.7261	H	0.94698	3.57	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.945	D	0.93532	0.6870	10	0.87932	D	0	.	15.4635	0.75381	0.0:0.0:0.0:1.0	.	519;519	P55287-2;P55287	.;CAD11_HUMAN	G	519;519;502	ENSP00000268603:D519G;ENSP00000377711:D519G	ENSP00000268603:D519G	D	-	2	0	CDH11	63563069	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.645000	0.83430	2.250000	0.74265	0.533000	0.62120	GAT		0.398	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
SMPD3	55512	broad.mit.edu	37	16	68404948	68404948	+	Silent	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr16:68404948G>A	ENST00000219334.5	-	3	1740	c.1137C>T	c.(1135-1137)caC>caT	p.H379H	SMPD3_ENST00000563226.1_Silent_p.H379H|SMPD3_ENST00000568373.1_Silent_p.H379H|SMPD3_ENST00000566009.1_5'Flank	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	379					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.H379H(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	CGAAGTAGCCGTGCAGCTGCT	0.592																																					p.H379H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1137T	16						.						76.0	59.0	65.0					16																	68404948		2198	4300	6498	66962449	SO:0001819	synonymous_variant	55512	exon3			AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.1137C>T	16.37:g.68404948G>A		Somatic		Capture	Illumina HiSeq	Phase_I	66962449	NM_018667	B7ZL82|Q2M1S8	Silent	SNP	ENST00000219334.5	37	CCDS10867.1																																																																																				0.592	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3	NM_018667	
KCNG4	93107	broad.mit.edu	37	16	84270732	84270732	+	Silent	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr16:84270732G>A	ENST00000308251.4	-	2	428	c.360C>T	c.(358-360)ttC>ttT	p.F120F	KCNG4_ENST00000568181.1_Silent_p.F120F	NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	120					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.F120F(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						CGATCACCCCGAAGGCGCTGG	0.622																																					p.F120F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C360T	16						.						51.0	54.0	53.0					16																	84270732		2200	4300	6500	82828233	SO:0001819	synonymous_variant	93107	exon2			AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.360C>T	16.37:g.84270732G>A		Somatic		Capture	Illumina HiSeq	Phase_I	82828233	NM_172347	Q96H24	Silent	SNP	ENST00000308251.4	37	CCDS10945.1																																																																																				0.622	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269079.2	NM_172347	
TANC2	26115	broad.mit.edu	37	17	61499298	61499298	+	Silent	SNP	C	C	T	rs371666530		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr17:61499298C>T	ENST00000424789.2	+	25	5959	c.5955C>T	c.(5953-5955)ttC>ttT	p.F1985F	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Silent_p.F1995F	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1985					in utero embryonic development (GO:0001701)			p.F1995F(4)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						AGAGACCGTTCGTGGAGTCTA	0.493																																					p.F1985F												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.C5955T	17						.	T		0,3924		0,0,1962	53.0	54.0	53.0		5955	5.8	1.0	17		53	1,8261		0,1,4130	no	coding-synonymous	TANC2	NM_025185.3		0,1,6092	TT,TC,CC		0.0121,0.0,0.0082		1985/1991	61499298	1,12185	1962	4131	6093	58853030	SO:0001819	synonymous_variant	26115	exon25			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.5955C>T	17.37:g.61499298C>T		Somatic		Capture	Illumina HiSeq	Phase_I	58853030	NM_025185	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Silent	SNP	ENST00000424789.2	37	CCDS45754.1																																																																																				0.493	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1		
PITPNC1	26207	broad.mit.edu	37	17	65529043	65529043	+	Silent	SNP	C	C	T	rs529862745	byFrequency	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr17:65529043C>T	ENST00000581322.1	+	2	174	c.174C>T	c.(172-174)acC>acT	p.T58T	PITPNC1_ENST00000299954.9_Silent_p.T58T|PITPNC1_ENST00000335257.6_Silent_p.T58T|PITPNC1_ENST00000580974.1_Silent_p.T58T			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1	58					phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)	p.T58T(1)		breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			GGCAGTTCACCGAGAAGCGGG	0.592													C|||	8	0.00159744	0.0	0.0	5008	,	,		18819	0.001		0.0	False		,,,				2504	0.0072				p.T58T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C174T	17						.						56.0	61.0	60.0					17																	65529043		2073	4210	6283	62959505	SO:0001819	synonymous_variant	26207	exon2			AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.174C>T	17.37:g.65529043C>T		Somatic		Capture	Illumina HiSeq	Phase_I	62959505	NM_012417	A8K473|J3QR20|Q96I07	Silent	SNP	ENST00000581322.1	37	CCDS58588.1																																																																																				0.592	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447194.1	NM_012417	
ARHGEF15	22899	broad.mit.edu	37	17	8215391	8215391	+	Missense_Mutation	SNP	C	C	T	rs150480540		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr17:8215391C>T	ENST00000361926.3	+	2	144	c.34C>T	c.(34-36)Ccc>Tcc	p.P12S	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.P12S	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	12	Pro-rich.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P12S(1)		breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						AGCAACACCCCCCACGCAGAA	0.637																																					p.P12S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C34T	17						.						67.0	72.0	71.0					17																	8215391		2203	4300	6503	8156116	SO:0001583	missense	22899	exon2			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.34C>T	17.37:g.8215391C>T	ENSP00000355026:p.Pro12Ser	Somatic		Capture	Illumina HiSeq	Phase_I	8156116	NM_173728	A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	ENST00000361926.3	37	CCDS11139.1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.031696	0.35797	.	.	ENSG00000198844	ENST00000361926;ENST00000421050	T;T	0.81078	-1.45;-1.45	4.76	4.76	0.60689	.	0.000000	0.47093	D	0.000249	D	0.83161	0.5194	L	0.29908	0.895	0.28527	N	0.912797	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.78076	-0.2345	10	0.87932	D	0	-12.5731	13.1962	0.59740	0.0:1.0:0.0:0.0	.	12;12	D3DTR7;O94989	.;ARHGF_HUMAN	S	12	ENSP00000355026:P12S;ENSP00000412505:P12S	ENSP00000355026:P12S	P	+	1	0	ARHGEF15	8156116	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.783000	0.55409	2.491000	0.84063	0.650000	0.86243	CCC		0.637	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728	
CCDC40	55036	broad.mit.edu	37	17	78058655	78058655	+	Silent	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr17:78058655C>T	ENST00000397545.4	+	13	2130	c.2103C>T	c.(2101-2103)gaC>gaT	p.D701D	CCDC40_ENST00000374877.3_Silent_p.D701D	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	701					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.D701D(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TGGACCAGGACGTGAAGAAAG	0.567																																					p.D701D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2103T	17						.						60.0	63.0	62.0					17																	78058655		2128	4232	6360	75673250	SO:0001819	synonymous_variant	55036	exon13			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2103C>T	17.37:g.78058655C>T		Somatic		Capture	Illumina HiSeq	Phase_I	75673250	NM_017950	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Silent	SNP	ENST00000397545.4	37	CCDS42395.1																																																																																				0.567	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082	
SMCHD1	23347	broad.mit.edu	37	18	2697978	2697978	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr18:2697978C>G	ENST00000320876.6	+	10	1619	c.1281C>G	c.(1279-1281)atC>atG	p.I427M	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.I427M	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	427					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)	p.I427M(2)		NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						AAGGGATTATCCGTTATCATC	0.348																																					p.I427M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1281G	18						.						167.0	152.0	157.0					18																	2697978		1904	4133	6037	2687978	SO:0001583	missense	23347	exon10			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.1281C>G	18.37:g.2697978C>G	ENSP00000326603:p.Ile427Met	Somatic		Capture	Illumina HiSeq	Phase_I	2687978	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386443	0.25031	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.25912	1.77;1.78	5.24	-5.74	0.02391	.	.	.	.	.	T	0.19485	0.0468	N	0.22421	0.69	0.23515	N	0.99752	D	0.61080	0.989	P	0.53450	0.726	T	0.09271	-1.0682	9	0.54805	T	0.06	.	3.3699	0.07217	0.1727:0.2301:0.0875:0.5097	.	427	A6NHR9	SMHD1_HUMAN	M	427	ENSP00000326603:I427M;ENSP00000261598:I427M	ENSP00000261598:I427M	I	+	3	3	SMCHD1	2687978	0.256000	0.24012	0.647000	0.29507	0.959000	0.62525	-0.492000	0.06467	-1.255000	0.02481	-0.258000	0.10820	ATC		0.348	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
ZNF407	55628	broad.mit.edu	37	18	72775210	72775210	+	Missense_Mutation	SNP	G	G	A	rs112538866		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr18:72775210G>A	ENST00000299687.5	+	8	5533	c.5533G>A	c.(5533-5535)Gtc>Atc	p.V1845I		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1845					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V1845I(1)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		AGAGCCCCTCGTCAAGGAGAA	0.627																																					p.V1845I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5533A	18						.	G	ILE/VAL	1,4117		0,1,2058	71.0	86.0	81.0		5533	2.2	0.0	18	dbSNP_132	81	1,8401		0,1,4200	no	missense	ZNF407	NM_017757.2	29	0,2,6258	AA,AG,GG		0.0119,0.0243,0.016	possibly-damaging	1845/2249	72775210	2,12518	2059	4201	6260	70904198	SO:0001583	missense	55628	exon8			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.5533G>A	18.37:g.72775210G>A	ENSP00000299687:p.Val1845Ile	Somatic		Capture	Illumina HiSeq	Phase_I	70904198	NM_017757	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.633410	0.29068	2.43E-4	1.19E-4	ENSG00000215421	ENST00000299687	T	0.10763	2.84	4.96	2.15	0.27550	.	.	.	.	.	T	0.06234	0.0161	L	0.27053	0.805	0.09310	N	1	B	0.33379	0.41	B	0.19666	0.026	T	0.35251	-0.9796	9	0.39692	T	0.17	.	6.1794	0.20461	0.156:0.0:0.6954:0.1486	.	1845	Q9C0G0	ZN407_HUMAN	I	1845	ENSP00000299687:V1845I	ENSP00000299687:V1845I	V	+	1	0	ZNF407	70904198	0.004000	0.15560	0.002000	0.10522	0.002000	0.02628	0.526000	0.22971	0.262000	0.21774	0.528000	0.53228	GTC		0.627	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
CYP4F8	11283	broad.mit.edu	37	19	15739612	15739612	+	RNA	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr19:15739612G>A	ENST00000441682.2	+	0	1417							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.K451K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						ACGCCCAGAAGAGGTCACCTA	0.622																																					p.R452K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1355A	19						.						61.0	65.0	64.0					19																	15739612		1978	4179	6157	15600612			11283	exon12			AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15739612G>A		Somatic		Capture	Illumina HiSeq	Phase_I	15600612	NM_007253		Silent	SNP	ENST00000441682.2	37																																																																																					0.622	CYP4F8-201	KNOWN	basic	processed_transcript	processed_transcript		NM_007253	
APOE	348	broad.mit.edu	37	19	45411101	45411101	+	Missense_Mutation	SNP	G	G	T	rs371694216		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr19:45411101G>T	ENST00000252486.4	+	3	239	c.128G>T	c.(127-129)cGc>cTc	p.R43L		NM_000041.2	NP_000032.1	P02649	APOE_HUMAN	apolipoprotein E	43			R -> C (in LPG; form E2 Kyoto). {ECO:0000269|PubMed:10432380, ECO:0000269|PubMed:18077821}.		aging (GO:0007568)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|artery morphogenesis (GO:0048844)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cGMP-mediated signaling (GO:0019934)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|cytoskeleton organization (GO:0007010)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular transport (GO:0046907)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle remodeling (GO:0034374)|maintenance of location in cell (GO:0051651)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of blood coagulation (GO:0030195)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of dendritic spine development (GO:0061000)|negative regulation of dendritic spine maintenance (GO:1902951)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lipid biosynthetic process (GO:0051055)|negative regulation of lipid transport across blood brain barrier (GO:1903001)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of phospholipid efflux (GO:1902999)|negative regulation of platelet activation (GO:0010544)|negative regulation of postsynaptic membrane organization (GO:1901627)|negative regulation of presynaptic membrane organization (GO:1901630)|nitric oxide mediated signal transduction (GO:0007263)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system axon regeneration (GO:0014012)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of axon extension (GO:0045773)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of dendritic spine maintenance (GO:1902952)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of lipid transport across blood brain barrier (GO:1903002)|positive regulation of low-density lipoprotein particle receptor catabolic process (GO:0032805)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipid efflux (GO:1902995)|positive regulation of postsynaptic membrane organization (GO:1901628)|positive regulation of presynaptic membrane organization (GO:1901631)|protein import (GO:0017038)|receptor-mediated endocytosis (GO:0006898)|regulation of axon extension (GO:0030516)|regulation of beta-amyloid clearance (GO:1900221)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of neuron death (GO:1901214)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of tau-protein kinase activity (GO:1902947)|response to dietary excess (GO:0002021)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)|response to retinoic acid (GO:0032526)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|triglyceride metabolic process (GO:0006641)|vasodilation (GO:0042311)|very-low-density lipoprotein particle clearance (GO:0034447)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|high-density lipoprotein particle (GO:0034364)|intermediate-density lipoprotein particle (GO:0034363)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	antioxidant activity (GO:0016209)|beta-amyloid binding (GO:0001540)|cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle receptor binding (GO:0050750)|metal chelating activity (GO:0046911)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)|tau protein binding (GO:0048156)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R43L(1)		large_intestine(1)|lung(2)|prostate(1)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	AGCGGCCAGCGCTGGGAACTG	0.642																																					p.R43L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G128T	19						.						37.0	36.0	37.0					19																	45411101		2203	4300	6503	50102941	SO:0001583	missense	348	exon3			K00396	CCDS12647.1	19q13.31	2013-01-24			ENSG00000130203	ENSG00000130203		"""Apolipoproteins"""	613	protein-coding gene	gene with protein product		107741	"""Alzheimer disease 2 (APOE*E4-associated, late onset)"""	AD2		10662539	Standard	NM_000041		Approved		uc002pab.3	P02649	OTTHUMG00000128901	ENST00000252486.4:c.128G>T	19.37:g.45411101G>T	ENSP00000252486:p.Arg43Leu	Somatic		Capture	Illumina HiSeq	Phase_I	50102941	NM_000041	B2RC15|C0JYY5|Q9P2S4	Missense_Mutation	SNP	ENST00000252486.4	37	CCDS12647.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.683120	0.29872	.	.	ENSG00000130203	ENST00000252486;ENST00000446996;ENST00000434152;ENST00000425718	D;D;D	0.82081	-1.57;-1.57;-1.57	4.85	3.81	0.43845	Apolipoprotein/apolipophorin (1);	0.581385	0.15532	N	0.257408	T	0.72293	0.3442	N	0.24115	0.695	0.32725	N	0.509784	B	0.10296	0.003	B	0.09377	0.004	T	0.72408	-0.4303	10	0.42905	T	0.14	-14.8296	11.4932	0.50394	0.0:0.8159:0.1841:0.0	.	43	P02649	APOE_HUMAN	L	43;43;88;43	ENSP00000252486:R43L;ENSP00000413135:R43L;ENSP00000410423:R43L	ENSP00000252486:R43L	R	+	2	0	APOE	50102941	1.000000	0.71417	1.000000	0.80357	0.225000	0.24961	2.249000	0.43169	1.184000	0.42957	-0.234000	0.12200	CGC		0.642	APOE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250865.2	NM_000041	
CD33	945	broad.mit.edu	37	19	51728621	51728621	+	Missense_Mutation	SNP	G	G	A	rs144102805	byFrequency	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr19:51728621G>A	ENST00000262262.4	+	2	206	c.185G>A	c.(184-186)cGg>cAg	p.R62Q	CD33_ENST00000391796.3_Missense_Mutation_p.R62Q|CD33_ENST00000421133.2_Intron|CD33_ENST00000436584.2_Intron	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	62	Ig-like V-type.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.R62Q(2)		NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	TACTGGTTCCGGGAAGGAGCC	0.537													g|||	4	0.000798722	0.0015	0.0014	5008	,	,		19072	0.0		0.0	False		,,,				2504	0.001				p.R62Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|NS(1)	c.G185A	19						.	G	,GLN/ARG,GLN/ARG	22,4384		0,22,2181	84.0	83.0	84.0		,185,185	-5.2	0.0	19	dbSNP_134	84	1,8599		0,1,4299	yes	intron,missense,missense	CD33	NM_001082618.1,NM_001177608.1,NM_001772.3	,43,43	0,23,6480	AA,AG,GG		0.0116,0.4993,0.1768	,probably-damaging,probably-damaging	,62/311,62/365	51728621	23,12983	2203	4300	6503	56420433	SO:0001583	missense	945	exon2			M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.185G>A	19.37:g.51728621G>A	ENSP00000262262:p.Arg62Gln	Somatic		Capture	Illumina HiSeq	Phase_I	56420433	NM_001772	B4E3P8|C9JEN7|F8WAL2|Q8TD24	Missense_Mutation	SNP	ENST00000262262.4	37	CCDS33084.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	.	14.45	2.538001	0.45176	0.004993	1.16E-4	ENSG00000105383	ENST00000262262;ENST00000391796	T;T	0.69926	-0.44;-0.44	3.49	-5.17	0.02849	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.872790	0.03872	N	0.275685	T	0.55816	0.1944	M	0.70787	2.145	0.21184	N	0.999764	P;P	0.49185	0.76;0.92	B;B	0.34418	0.134;0.182	T	0.57963	-0.7720	10	0.36615	T	0.2	.	6.54	0.22375	0.6503:0.1518:0.1979:0.0	.	62;62	F8WAL2;P20138	.;CD33_HUMAN	Q	62	ENSP00000262262:R62Q;ENSP00000375673:R62Q	ENSP00000262262:R62Q	R	+	2	0	CD33	56420433	0.000000	0.05858	0.003000	0.11579	0.509000	0.34042	-0.714000	0.05002	-0.956000	0.03631	0.655000	0.94253	CGG		0.537	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464199.2	NM_001772	
PEG3	5178	broad.mit.edu	37	19	57328827	57328827	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr19:57328827G>T	ENST00000326441.9	-	10	1346	c.983C>A	c.(982-984)tCg>tAg	p.S328*	PEG3_ENST00000423103.2_Nonsense_Mutation_p.S328*|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Nonsense_Mutation_p.S202*|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000598410.1_Nonsense_Mutation_p.S204*|ZIM2_ENST00000601070.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	328					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S328*(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TGCTCTTCCCGATTTGGAACT	0.473																																					p.S328X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C983A	19						.						76.0	73.0	74.0					19																	57328827		2203	4300	6503	62020639	SO:0001587	stop_gained	5178	exon7			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.983C>A	19.37:g.57328827G>T	ENSP00000326581:p.Ser328*	Somatic		Capture	Illumina HiSeq	Phase_I	62020639	NM_001146186	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Nonsense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	G	36	5.838831	0.97009	.	.	ENSG00000198300	ENST00000326441;ENST00000423103;ENST00000292074	.	.	.	4.27	3.23	0.37069	.	0.404992	0.18405	N	0.142242	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-3.73	10.7883	0.46417	0.0945:0.0:0.9055:0.0	.	.	.	.	X	328;328;298	.	ENSP00000292074:S298X	S	-	2	0	ZIM2	62020639	0.001000	0.12720	0.002000	0.10522	0.812000	0.45895	0.764000	0.26532	1.391000	0.46566	0.561000	0.74099	TCG		0.473	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
PLEKHO1	51177	broad.mit.edu	37	1	150123230	150123230	+	Silent	SNP	C	C	G			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr1:150123230C>G	ENST00000369124.4	+	2	437	c.159C>G	c.(157-159)ctC>ctG	p.L53L	PLEKHO1_ENST00000025469.6_Silent_p.L53L|PLEKHO1_ENST00000479194.1_3'UTR|PLEKHO1_ENST00000369126.1_5'UTR	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	53	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L53L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGGACCAGCTCTACATCTCTG	0.552																																					p.L53L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C159G	1						.						119.0	122.0	121.0					1																	150123230		2203	4300	6503	148389854	SO:0001819	synonymous_variant	51177	exon2			AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.159C>G	1.37:g.150123230C>G		Somatic		Capture	Illumina HiSeq	Phase_I	148389854	NM_016274	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Silent	SNP	ENST00000369124.4	37	CCDS945.1																																																																																				0.552	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
RXFP4	339403	broad.mit.edu	37	1	155912333	155912333	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr1:155912333C>G	ENST00000368318.3	+	1	854	c.833C>G	c.(832-834)cCc>cGc	p.P278R		NM_181885.2	NP_871001.1	Q8TDU9	RL3R2_HUMAN	relaxin/insulin-like family peptide receptor 4	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)	p.P278R(1)		endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	13	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GACCTGGTGCCCTGGAACAGT	0.537																																					p.P278R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C833G	1						.						119.0	108.0	111.0					1																	155912333		2203	4300	6503	154178957	SO:0001583	missense	339403	exon1			AB065617	CCDS1124.1	1q22	2012-08-08	2006-05-09	2006-03-15	ENSG00000173080	ENSG00000173080		"""GPCR / Class A : Relaxin family peptide receptors"""	14666	protein-coding gene	gene with protein product		609043	"""G protein-coupled receptor 100"", ""relaxin 3 receptor 2"", ""relaxin family peptide receptor 4"""	GPR100, RLN3R2		15956688, 16507880	Standard	NM_181885		Approved	GPCR142, RXFPR4	uc010pgs.2	Q8TDU9	OTTHUMG00000017463	ENST00000368318.3:c.833C>G	1.37:g.155912333C>G	ENSP00000357301:p.Pro278Arg	Somatic		Capture	Illumina HiSeq	Phase_I	154178957	NM_181885	B0M0L4|Q3MJB1|Q8NGZ8	Missense_Mutation	SNP	ENST00000368318.3	37	CCDS1124.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.384828	0.25031	.	.	ENSG00000173080	ENST00000368318	T	0.64991	-0.13	4.9	3.99	0.46301	GPCR, rhodopsin-like superfamily (1);	0.415334	0.22159	N	0.063812	T	0.39172	0.1068	L	0.52364	1.645	0.31551	N	0.658718	P	0.37548	0.599	B	0.41135	0.348	T	0.34775	-0.9815	10	0.41790	T	0.15	-12.0055	6.2655	0.20924	0.1817:0.7256:0.0:0.0927	.	278	Q8TDU9	RL3R2_HUMAN	R	278	ENSP00000357301:P278R	ENSP00000357301:P278R	P	+	2	0	RXFP4	154178957	0.004000	0.15560	0.998000	0.56505	0.583000	0.36354	0.017000	0.13399	1.292000	0.44672	0.655000	0.94253	CCC		0.537	RXFP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046203.1	NM_181885	
ATP1A2	477	broad.mit.edu	37	1	160090988	160090988	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr1:160090988C>A	ENST00000361216.3	+	3	213	c.124C>A	c.(124-126)Cac>Aac	p.H42N	ATP1A2_ENST00000392233.3_Missense_Mutation_p.H42N	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	42					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.H42N(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CCAGGATGACCACAAGCTGTC	0.547																																					p.H42N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C124A	1						.						235.0	238.0	237.0					1																	160090988		2203	4300	6503	158357612	SO:0001583	missense	477	exon3			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.124C>A	1.37:g.160090988C>A	ENSP00000354490:p.His42Asn	Somatic		Capture	Illumina HiSeq	Phase_I	158357612	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	37	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.726468	0.89298	.	.	ENSG00000018625	ENST00000361216;ENST00000392233	T;T	0.81247	-1.47;-1.47	4.56	4.56	0.56223	ATPase, P-type cation-transporter, N-terminal (2);	0.117824	0.53938	D	0.000041	D	0.92159	0.7514	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94458	0.7673	10	0.87932	D	0	.	16.2544	0.82505	0.0:1.0:0.0:0.0	.	42	P50993	AT1A2_HUMAN	N	42	ENSP00000354490:H42N;ENSP00000376066:H42N	ENSP00000354490:H42N	H	+	1	0	ATP1A2	158357612	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.462000	0.80851	2.363000	0.80096	0.655000	0.94253	CAC		0.547	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
CFH	3075	broad.mit.edu	37	1	196714991	196714991	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr1:196714991G>A	ENST00000367429.4	+	21	3595	c.3355G>A	c.(3355-3357)Gac>Aac	p.D1119N		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	1119	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.		D -> G (in CFHD). {ECO:0000269|PubMed:11170896, ECO:0000269|PubMed:11851332}.		complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.D1119N(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TGACAATGGGGACATTACTTC	0.398																																					p.D1119N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3355A	1						.						138.0	132.0	134.0					1																	196714991		2203	4300	6503	194981614	SO:0001583	missense	3075	exon21			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3355G>A	1.37:g.196714991G>A	ENSP00000356399:p.Asp1119Asn	Somatic		Capture	Illumina HiSeq	Phase_I	194981614	NM_000186	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	.	16.89	3.248471	0.59103	.	.	ENSG00000000971	ENST00000367429	T	0.63255	-0.03	4.97	4.97	0.65823	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.74846	0.3770	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.70226	-0.4930	9	0.12430	T	0.62	.	15.3777	0.74625	0.0:0.0:1.0:0.0	.	1119	P08603	CFAH_HUMAN	N	1119	ENSP00000356399:D1119N	ENSP00000356399:D1119N	D	+	1	0	CFH	194981614	1.000000	0.71417	0.992000	0.48379	0.160000	0.22226	5.288000	0.65651	2.502000	0.84385	0.549000	0.68633	GAC		0.398	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
TRAF5	7188	broad.mit.edu	37	1	211533366	211533366	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr1:211533366G>T	ENST00000261464.5	+	5	545	c.491G>T	c.(490-492)cGa>cTa	p.R164L	TRAF5_ENST00000462410.1_3'UTR|TRAF5_ENST00000427925.2_Intron|TRAF5_ENST00000336184.2_Missense_Mutation_p.R164L|TRAF5_ENST00000367004.3_Missense_Mutation_p.R164L	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	164					apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R164L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		TGTCAGTTTCGAAAGGAAAAA	0.413																																					p.R164L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G491T	1						.						131.0	121.0	125.0					1																	211533366		2203	4300	6503	209599989	SO:0001583	missense	7188	exon5			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.491G>T	1.37:g.211533366G>T	ENSP00000261464:p.Arg164Leu	Somatic		Capture	Illumina HiSeq	Phase_I	209599989	NM_004619	B4DIS9|B4E0A2|Q6FHY1	Missense_Mutation	SNP	ENST00000261464.5	37	CCDS1497.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754628	0.89843	.	.	ENSG00000082512	ENST00000336184;ENST00000261464;ENST00000367004	T;T;T	0.27557	1.66;1.66;1.66	4.97	4.97	0.65823	Zinc finger, TRAF-type (1);TRAF-like (1);	0.214099	0.40818	N	0.001014	T	0.61388	0.2343	M	0.87758	2.905	0.80722	D	1	D;D	0.67145	0.996;0.964	D;P	0.67548	0.952;0.871	T	0.69982	-0.4997	10	0.72032	D	0.01	-21.3055	18.2267	0.89920	0.0:0.0:1.0:0.0	.	175;164	B4E0A2;O00463	.;TRAF5_HUMAN	L	164	ENSP00000336825:R164L;ENSP00000261464:R164L;ENSP00000355971:R164L	ENSP00000261464:R164L	R	+	2	0	TRAF5	209599989	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.681000	0.74523	2.299000	0.77371	0.591000	0.81541	CGA		0.413	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619	
EPHX1	2052	broad.mit.edu	37	1	226032903	226032903	+	Missense_Mutation	SNP	C	C	A	rs45495897	byFrequency	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr1:226032903C>A	ENST00000366837.4	+	9	1419	c.1223C>A	c.(1222-1224)aCg>aAg	p.T408K	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Missense_Mutation_p.T408K	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	408			T -> M (in dbSNP:rs45495897). {ECO:0000269|Ref.8}.		aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)	p.T408K(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					CTATTGCACACGCCTGAAAAG	0.567																																					p.T408K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1223A	1						.						102.0	93.0	96.0					1																	226032903		2203	4300	6503	224099526	SO:0001583	missense	2052	exon9			J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.1223C>A	1.37:g.226032903C>A	ENSP00000355802:p.Thr408Lys	Somatic		Capture	Illumina HiSeq	Phase_I	224099526	NM_001136018	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	37	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.556835	0.00910	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.08008	3.14;3.14	5.0	-7.74	0.01241	.	1.893820	0.04100	N	0.312665	T	0.10637	0.0260	M	0.75884	2.315	0.09310	N	1	B	0.21905	0.062	B	0.24155	0.051	T	0.40346	-0.9568	10	0.11182	T	0.66	-1.9076	12.4983	0.55942	0.0:0.5903:0.1421:0.2676	.	408	P07099	HYEP_HUMAN	K	408	ENSP00000272167:T408K;ENSP00000355802:T408K	ENSP00000272167:T408K	T	+	2	0	EPHX1	224099526	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-1.655000	0.01982	-1.069000	0.03153	-0.379000	0.06801	ACG		0.567	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
RYR2	6262	broad.mit.edu	37	1	237813360	237813360	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr1:237813360C>T	ENST00000366574.2	+	50	8013	c.7696C>T	c.(7696-7698)Cgg>Tgg	p.R2566W	RYR2_ENST00000360064.6_Missense_Mutation_p.R2564W|RYR2_ENST00000542537.1_Missense_Mutation_p.R2550W	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2566	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R2564W(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAAAGCTCAGCGGGATTCCAT	0.408																																					p.R2566W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7696T	1						.						188.0	180.0	183.0					1																	237813360		1897	4126	6023	235879983	SO:0001583	missense	6262	exon50			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7696C>T	1.37:g.237813360C>T	ENSP00000355533:p.Arg2566Trp	Somatic		Capture	Illumina HiSeq	Phase_I	235879983	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453685	0.84209	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97811	-4.55;-4.55;-4.55	5.58	5.58	0.84498	.	0.000000	0.56097	D	0.000023	D	0.98871	0.9618	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99667	1.0995	10	0.87932	D	0	-13.2944	19.9299	0.97115	0.0:1.0:0.0:0.0	.	2566	Q92736	RYR2_HUMAN	W	2566;2564;2550	ENSP00000355533:R2566W;ENSP00000353174:R2564W;ENSP00000443798:R2550W	ENSP00000353174:R2564W	R	+	1	2	RYR2	235879983	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	2.583000	0.46094	2.769000	0.95229	0.655000	0.94253	CGG		0.408	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
CFAP61	26074	broad.mit.edu	37	20	20278871	20278871	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr20:20278871G>A	ENST00000245957.5	+	25	3339	c.3263G>A	c.(3262-3264)cGa>cAa	p.R1088Q	C20orf26_ENST00000377309.2_3'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		1088								p.R1088Q(3)|p.R1088P(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		ACTTACTTCCGAATTCATATT	0.458																																					p.R1088Q												.	.	4	Substitution - Missense(4)	large_intestine(3)|lung(1)	c.G3263A	20						.						78.0	75.0	76.0					20																	20278871		2203	4300	6503	20226871	SO:0001583	missense	26074	exon25																														ENST00000245957.5:c.3263G>A	20.37:g.20278871G>A	ENSP00000245957:p.Arg1088Gln	Somatic		Capture	Illumina HiSeq	Phase_I	20226871	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.678484	0.88542	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.47528	0.84	5.27	5.27	0.74061	.	0.300219	0.31922	N	0.006857	T	0.61211	0.2329	M	0.72894	2.215	0.80722	D	1	D	0.69078	0.997	P	0.51701	0.677	T	0.65784	-0.6084	10	0.62326	D	0.03	.	19.2438	0.93893	0.0:0.0:1.0:0.0	.	1088	Q8NHU2	CT026_HUMAN	Q	1028;1054;1088	ENSP00000245957:R1088Q	ENSP00000245957:R1088Q	R	+	2	0	C20orf26	20226871	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	6.069000	0.71209	2.628000	0.89032	0.655000	0.94253	CGA		0.458	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
EYA2	2139	broad.mit.edu	37	20	45700871	45700871	+	Missense_Mutation	SNP	G	G	A	rs141379321	byFrequency	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr20:45700871G>A	ENST00000327619.5	+	6	837	c.463G>A	c.(463-465)Ggt>Agt	p.G155S	EYA2_ENST00000317304.6_Missense_Mutation_p.G155S|EYA2_ENST00000357410.3_Missense_Mutation_p.G155S	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	155					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)	p.G155S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				CAACGCAGCCGGTTTCGGGAG	0.522													G|||	4	0.000798722	0.0	0.0	5008	,	,		20680	0.004		0.0	False		,,,				2504	0.0				p.G155S	Pancreas(120;56 1725 18501 25218 43520)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G463A	20						.	G	SER/GLY,SER/GLY	1,4405	2.1+/-5.4	0,1,2202	80.0	67.0	71.0		463,463	5.1	0.7	20	dbSNP_134	71	0,8600		0,0,4300	no	missense,missense	EYA2	NM_005244.4,NM_172110.3	56,56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	155/539,155/460	45700871	1,13005	2203	4300	6503	45134278	SO:0001583	missense	2139	exon6				CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.463G>A	20.37:g.45700871G>A	ENSP00000333640:p.Gly155Ser	Somatic		Capture	Illumina HiSeq	Phase_I	45134278	NM_172110	Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Missense_Mutation	SNP	ENST00000327619.5	37	CCDS13403.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399970	0.62177	2.27E-4	0.0	ENSG00000064655	ENST00000327619;ENST00000357410;ENST00000484200;ENST00000317304	D;D;D	0.91351	-2.83;-2.83;-2.83	5.12	5.12	0.69794	.	0.188181	0.46758	D	0.000266	D	0.89681	0.6785	L	0.43152	1.355	0.47778	D	0.999511	D;P;P;P	0.61697	0.99;0.901;0.92;0.92	P;B;B;B	0.49332	0.607;0.182;0.174;0.174	D	0.87302	0.2306	10	0.19147	T	0.46	-14.9511	18.5537	0.91075	0.0:0.0:1.0:0.0	.	155;155;155;155	O00167-3;E7ETN2;A8KAG7;O00167	.;.;.;EYA2_HUMAN	S	155	ENSP00000333640:G155S;ENSP00000349986:G155S;ENSP00000321590:G155S	ENSP00000321590:G155S	G	+	1	0	EYA2	45134278	1.000000	0.71417	0.664000	0.29753	0.060000	0.15804	7.900000	0.87376	2.388000	0.81334	0.555000	0.69702	GGT		0.522	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080326.2	NM_005244	
WDR4	10785	broad.mit.edu	37	21	44270302	44270302	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr21:44270302C>T	ENST00000398208.2	-	11	1155	c.1096G>A	c.(1096-1098)Gac>Aac	p.D366N	WDR4_ENST00000492742.1_5'UTR|WDR4_ENST00000330317.2_Missense_Mutation_p.D366N	NM_001260474.1|NM_001260475.1|NM_001260476.1|NM_018669.5	NP_001247403.1|NP_001247404.1|NP_001247405.1|NP_061139.2			WD repeat domain 4									p.D366N(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|ovary(2)	11				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		GTCACGTTGTCGAACGTGGCC	0.632																																					p.D366N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1096A	21						.						56.0	56.0	56.0					21																	44270302		2203	4300	6503	43143371	SO:0001583	missense	10785	exon11			AJ243912	CCDS13691.1	21q22.3	2013-01-09			ENSG00000160193	ENSG00000160193		"""WD repeat domain containing"""	12756	protein-coding gene	gene with protein product	"""TRM82 tRNA methyltransferase 82 homolog (S. cerevisiae)"""	605924				12403464	Standard	NM_018669		Approved	TRM82, TRMT82	uc002zci.4	P57081	OTTHUMG00000086826	ENST00000398208.2:c.1096G>A	21.37:g.44270302C>T	ENSP00000381266:p.Asp366Asn	Somatic		Capture	Illumina HiSeq	Phase_I	43143371	NM_033661		Missense_Mutation	SNP	ENST00000398208.2	37	CCDS13691.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.731015	0.89390	.	.	ENSG00000160193	ENST00000330317;ENST00000398208	D;D	0.81579	-1.51;-1.51	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	D	0.86875	0.6038	M	0.66939	2.045	0.51233	D	0.999917	D;D	0.89917	1.0;0.999	D;D	0.64321	0.92;0.924	D	0.87288	0.2297	10	0.48119	T	0.1	-29.3446	14.4183	0.67165	0.0:1.0:0.0:0.0	.	365;366	P57081-2;P57081	.;WDR4_HUMAN	N	366	ENSP00000328671:D366N;ENSP00000381266:D366N	ENSP00000328671:D366N	D	-	1	0	WDR4	43143371	0.997000	0.39634	0.980000	0.43619	0.791000	0.44710	4.605000	0.61119	2.123000	0.65237	0.563000	0.77884	GAC		0.632	WDR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195479.1		
KRTAP10-12	386685	broad.mit.edu	37	21	46117811	46117811	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr21:46117811G>T	ENST00000400365.3	+	1	725	c.695G>T	c.(694-696)gGg>gTg	p.G232V	TSPEAR_ENST00000323084.4_Intron	NM_198699.1	NP_941972.1	P60413	KR10C_HUMAN	keratin associated protein 10-12	232						keratin filament (GO:0045095)		p.G232V(1)		large_intestine(1)|lung(8)	9						GCCTCCTGCGGGTCCCTCCTC	0.726																																					p.G232V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G695T	21						.						32.0	43.0	39.0					21																	46117811		2126	4234	6360	44942239	SO:0001583	missense	386685	exon1			AB076364	CCDS42967.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000189169	ENSG00000189169		"""Keratin associated proteins"""	20533	protein-coding gene	gene with protein product			"""keratin associated protein 18-12"""	KRTAP18-12			Standard	NM_198699		Approved	KRTAP18.12, KAP10.12	uc002zfw.1	P60413	OTTHUMG00000057629	ENST00000400365.3:c.695G>T	21.37:g.46117811G>T	ENSP00000383216:p.Gly232Val	Somatic		Capture	Illumina HiSeq	Phase_I	44942239	NM_198699	B2RPA3	Missense_Mutation	SNP	ENST00000400365.3	37	CCDS42967.1	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.256828	0.00265	.	.	ENSG00000189169	ENST00000400365	T	0.00590	6.36	3.58	2.4	0.29515	.	.	.	.	.	T	0.00109	0.0003	N	0.00022	-2.735	0.45025	D	0.99804	B	0.02656	0.0	B	0.01281	0.0	T	0.16012	-1.0417	9	0.02654	T	1	.	4.4429	0.11582	0.1958:0.0:0.207:0.5971	.	232	P60413	KR10C_HUMAN	V	232	ENSP00000383216:G232V	ENSP00000383216:G232V	G	+	2	0	KRTAP10-12	44942239	0.098000	0.21812	0.948000	0.38648	0.018000	0.09664	0.425000	0.21346	0.370000	0.24538	-0.569000	0.04157	GGG		0.726	KRTAP10-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128032.1	NM_198699	
HIRA	7290	broad.mit.edu	37	22	19349279	19349280	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	GA	GA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr22:19349279_19349280delGA	ENST00000263208.5	-	16	2206_2207	c.1950_1951delTC	c.(1948-1953)tctcgtfs	p.R651fs	HIRA_ENST00000340170.4_Intron|HIRA_ENST00000541063.1_Frame_Shift_Del_p.R607fs|HIRA_ENST00000546308.1_Frame_Shift_Del_p.R607fs	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	651	Interaction with CCNA1.|Interaction with PAX3. {ECO:0000250}.|Interaction with histone H2B.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R651fs*54(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					GGCATGAGACGAGAGTCCTTCC	0.535																																					p.650_651del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1950_1951del	22						.																																			17729280	SO:0001589	frameshift_variant	7290	exon16			X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.1950_1951delTC	22.37:g.19349281_19349282delGA	ENSP00000263208:p.Arg651fs	Somatic		Capture	Illumina HiSeq	Phase_I	17729279	NM_003325	Q05BU9|Q8IXN2	Frame_Shift_Del	DEL	ENST00000263208.5	37	CCDS13759.1																																																																																				0.535	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325	
TNRC6B	23112	broad.mit.edu	37	22	40662360	40662360	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr22:40662360G>A	ENST00000454349.2	+	5	2337	c.2126G>A	c.(2125-2127)tGg>tAg	p.W709*	TNRC6B_ENST00000301923.9_Intron|TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000335727.9_Nonsense_Mutation_p.W709*	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	709	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.W723*(1)		breast(1)	1						TCTTCCAACTGGGGAGGAGGA	0.537																																					p.W709X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2126A	22						.						29.0	30.0	30.0					22																	40662360		1917	4136	6053	38992306	SO:0001587	stop_gained	23112	exon5			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.2126G>A	22.37:g.40662360G>A	ENSP00000401946:p.Trp709*	Somatic		Capture	Illumina HiSeq	Phase_I	38992306	NM_015088	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Nonsense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.810821|7.810821	0.98501|0.98501	.|.	.|.	ENSG00000100354|ENSG00000100354	ENST00000446273|ENST00000454349;ENST00000400140;ENST00000335727	.|.	.|.	.|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.47673|.	0.1458|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37596|.	-0.9699|.	3|.	.|0.02654	.|T	.|1	-2.8353|-2.8353	19.5045|19.5045	0.95110|0.95110	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	R|X	452|709	.|.	.|ENSP00000338371:W709X	G|W	+|+	1|2	0|0	TNRC6B|TNRC6B	38992306|38992306	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.992000|0.992000	0.81027|0.81027	8.523000|8.523000	0.90576|0.90576	2.623000|2.623000	0.88846|0.88846	0.462000|0.462000	0.41574|0.41574	GGG|TGG		0.537	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
LRP1B	53353	broad.mit.edu	37	2	141108493	141108493	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:141108493C>A	ENST00000389484.3	-	77	12736	c.11765G>T	c.(11764-11766)aGa>aTa	p.R3922I		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3922					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.R3922I(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCCTGTTATTCTTGAATTATG	0.343										TSP Lung(27;0.18)																											p.R3922I	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G11765T	2						.						106.0	112.0	110.0					2																	141108493		2203	4300	6503	140824963	SO:0001583	missense	53353	exon77			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.11765G>T	2.37:g.141108493C>A	ENSP00000374135:p.Arg3922Ile	Somatic		Capture	Illumina HiSeq	Phase_I	140824963	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.8|21.8	4.205411|4.205411	0.79127|0.79127	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000437977|ENST00000389484;ENST00000544579	.|D	.|0.91295	.|-2.82	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.94902	.|0.8352	M|M	0.71036|0.71036	2.16|2.16	0.80722|0.80722	D|D	1|1	.|D	.|0.71674	.|0.998	.|D	.|0.78314	.|0.991	.|D	.|0.93586	.|0.6917	.|10	.|0.37606	.|T	.|0.19	.|.	19.5609|19.5609	0.95371|0.95371	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|3922	.|Q9NZR2	.|LRP1B_HUMAN	X|I	154|3922;3860	.|ENSP00000374135:R3922I	.|ENSP00000374135:R3922I	E|R	-|-	1|2	0|0	LRP1B|LRP1B	140824963|140824963	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.513000|5.513000	0.67037|0.67037	2.698000|2.698000	0.92095|0.92095	0.655000|0.655000	0.94253|0.94253	GAA|AGA		0.343	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
TTN	7273	broad.mit.edu	37	2	179401826	179401826	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:179401826G>T	ENST00000591111.1	-	306	95311	c.95087C>A	c.(95086-95088)gCt>gAt	p.A31696D	TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A24464D|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A24397D|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A24272D|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A33337D|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A30769D			Q8WZ42	TITIN_HUMAN	titin	31696	Fibronectin type-III 130. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A30767D(1)|p.A24272D(1)|p.A24464D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGCCATTCAGCCCCCTCCTT	0.502																																					p.L24272M												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C72814A	2						.						66.0	66.0	66.0					2																	179401826		1952	4126	6078	179110072	SO:0001583	missense	7273	exon184			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.95087C>A	2.37:g.179401826G>T	ENSP00000465570:p.Ala31696Asp	Somatic		Capture	Illumina HiSeq	Phase_I	179110072	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	16.29	3.082142	0.55861	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.41	5.41	0.78517	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.33177	0.0854	N	0.01493	-0.835	0.40685	D	0.98234	P;P;P;P	0.39352	0.669;0.669;0.669;0.669	B;B;B;B	0.43838	0.433;0.433;0.433;0.433	T	0.52381	-0.8583	9	0.87932	D	0	.	14.0866	0.64962	0.0:0.0:0.8494:0.1506	.	24272;24397;24464;31696	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	30769;24272;24464;24397;24269	ENSP00000343764:A30769D;ENSP00000434586:A24272D;ENSP00000340554:A24464D;ENSP00000352154:A24397D	ENSP00000340554:A24464D	A	-	2	0	TTN	179110072	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.969000	0.70422	2.544000	0.85801	0.462000	0.41574	GCT		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
HECW2	57520	broad.mit.edu	37	2	197157324	197157324	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:197157324G>A	ENST00000260983.3	-	14	3147	c.2965C>T	c.(2965-2967)Cgg>Tgg	p.R989W	RN7SL820P_ENST00000583941.1_RNA|HECW2_ENST00000409111.1_Missense_Mutation_p.R633W	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	989	Interaction with TP73.|WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R989W(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TCCCATCCCCGCGGCAGCTCT	0.552																																					p.R989W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2965T	2						.						203.0	157.0	172.0					2																	197157324		2203	4300	6503	196865569	SO:0001583	missense	57520	exon14			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.2965C>T	2.37:g.197157324G>A	ENSP00000260983:p.Arg989Trp	Somatic		Capture	Illumina HiSeq	Phase_I	196865569	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395310	0.62066	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	D;D	0.82433	-1.61;-1.61	5.09	1.23	0.21249	WW/Rsp5/WWP (5);	0.051275	0.85682	D	0.000000	D	0.85652	0.5746	L	0.38175	1.15	0.48901	D	0.999725	D	0.89917	1.0	D	0.87578	0.998	D	0.84792	0.0779	10	0.72032	D	0.01	.	13.6779	0.62465	0.0:0.0:0.5611:0.4389	.	989	Q9P2P5	HECW2_HUMAN	W	633;989	ENSP00000386775:R633W;ENSP00000260983:R989W	ENSP00000260983:R989W	R	-	1	2	HECW2	196865569	0.579000	0.26725	0.802000	0.32245	0.982000	0.71751	0.728000	0.26013	0.058000	0.16222	-0.262000	0.10625	CGG		0.552	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
MPP4	58538	broad.mit.edu	37	2	202514850	202514850	+	Missense_Mutation	SNP	G	G	A	rs369705514		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:202514850G>A	ENST00000409474.3	-	19	1627	c.1420C>T	c.(1420-1422)Cgt>Tgt	p.R474C	MPP4_ENST00000409143.1_Missense_Mutation_p.R416C|MPP4_ENST00000396886.3_Missense_Mutation_p.R399C|MPP4_ENST00000359962.5_Missense_Mutation_p.R474C|MPP4_ENST00000428900.2_Missense_Mutation_p.R450C|MPP4_ENST00000315506.7_Missense_Mutation_p.R430C|MPP4_ENST00000447335.2_Missense_Mutation_p.R467C	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	474	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)		p.R474C(1)		kidney(1)|lung(11)	12						TGATACTCACGCCCATTCATT	0.358																																					p.R474C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1420T	2						.	G	CYS/ARG	1,3695		0,1,1847	121.0	105.0	110.0		1420	4.4	1.0	2		110	0,8178		0,0,4089	no	missense	MPP4	NM_033066.2	180	0,1,5936	AA,AG,GG		0.0,0.0271,0.0084	probably-damaging	474/638	202514850	1,11873	1848	4089	5937	202223095	SO:0001583	missense	58538	exon19			AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.1420C>T	2.37:g.202514850G>A	ENSP00000387278:p.Arg474Cys	Somatic		Capture	Illumina HiSeq	Phase_I	202223095	NM_033066	C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	ENST00000409474.3	37	CCDS46491.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522231	0.64747	2.71E-4	0.0	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000374605;ENST00000428900;ENST00000409143;ENST00000447335	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	5.36	4.44	0.53790	Guanylate kinase/L-type calcium channel (1);Guanylate kinase, conserved site (1);Guanylate kinase (2);	0.263670	0.35708	N	0.003024	T	0.73783	0.3631	M	0.90977	3.165	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.998;0.99;1.0;1.0;0.999;1.0;1.0;0.997	T	0.80216	-0.1474	10	0.72032	D	0.01	.	13.2675	0.60141	0.0801:0.0:0.9199:0.0	.	416;399;450;443;430;467;474;439	F6Q0Y6;B4DUF3;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;Q96JB8;Q96JB8-4	.;.;.;.;.;.;MPP4_HUMAN;.	C	474;430;399;474;439;403;450;416;467	ENSP00000387278:R474C;ENSP00000319363:R430C;ENSP00000353047:R474C;ENSP00000416781:R450C;ENSP00000387293:R416C;ENSP00000406160:R467C	ENSP00000319363:R430C	R	-	1	0	MPP4	202223095	1.000000	0.71417	0.990000	0.47175	0.955000	0.61496	4.017000	0.57167	1.404000	0.46819	-0.367000	0.07326	CGT		0.358	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2		
RPE	6120	broad.mit.edu	37	2	210882278	210882278	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:210882278G>A	ENST00000359429.6	+	5	656	c.559G>A	c.(559-561)Gca>Aca	p.A187T	RPE_ENST00000454822.1_Missense_Mutation_p.A137T|RPE_ENST00000438204.2_Missense_Mutation_p.A119T|RPE_ENST00000436630.2_Missense_Mutation_p.A137T|RPE_ENST00000435437.2_Missense_Mutation_p.A187T|RPE_ENST00000411934.2_Missense_Mutation_p.A119T|RPE_ENST00000429907.1_Missense_Mutation_p.A119T|RPE_ENST00000445268.1_Missense_Mutation_p.A119T|RPE_ENST00000452025.1_Missense_Mutation_p.A187T|RPE_ENST00000354506.6_Missense_Mutation_p.A179T|RPE_ENST00000540255.1_Intron|RPE_ENST00000429921.1_Missense_Mutation_p.A137T	NM_199229.1	NP_954699.1	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase	187					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|ribulose-phosphate 3-epimerase activity (GO:0004750)	p.A187T(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	9				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		CCATAAATGTGCAGAGGTGAG	0.468																																					p.A187T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G559A	2						.						138.0	122.0	127.0					2																	210882278		2203	4300	6503	210590523	SO:0001583	missense	6120	exon5				CCDS2388.1, CCDS42810.1, CCDS63107.1, CCDS63108.1	2q32-q33.3	2012-10-02			ENSG00000197713	ENSG00000197713	5.1.3.1		10293	protein-coding gene	gene with protein product		180480					Standard	NM_199229		Approved		uc002vdn.4	Q96AT9	OTTHUMG00000154690	ENST00000359429.6:c.559G>A	2.37:g.210882278G>A	ENSP00000352401:p.Ala187Thr	Somatic		Capture	Illumina HiSeq	Phase_I	210590523	NM_199229	A8K4S0|B4E016|C9JPQ7|O43767|Q53TV9|Q8N215|Q96N34|Q9BSB5	Missense_Mutation	SNP	ENST00000359429.6	37	CCDS2388.1	.	.	.	.	.	.	.	.	.	.	G	36	5.677355	0.96764	.	.	ENSG00000197713	ENST00000359429;ENST00000436630;ENST00000408981;ENST00000454822;ENST00000429921;ENST00000438265;ENST00000429907;ENST00000445268;ENST00000452025;ENST00000438204;ENST00000411934;ENST00000435437;ENST00000354506	T;T	0.48522	0.81;0.81	5.39	5.39	0.77823	Aldolase-type TIM barrel (1);Ribulose-phosphate binding barrel (1);	0.000000	0.85682	D	0.000000	T	0.70579	0.3240	M	0.74389	2.26	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.998	D;D;D;D	0.91635	0.999;0.985;0.964;0.982	T	0.73026	-0.4112	10	0.72032	D	0.01	.	19.1318	0.93410	0.0:0.0:1.0:0.0	.	157;179;187;187	B3KTW7;E7EW52;Q96AT9;C9J9T0	.;.;RPE_HUMAN;.	T	187;137;119;137;137;137;119;119;187;119;119;187;179	ENSP00000405695:A119T;ENSP00000400449:A187T	ENSP00000346501:A179T	A	+	1	0	RPE	210590523	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.418000	0.97395	2.687000	0.91594	0.563000	0.77884	GCA		0.468	RPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336574.2	NM_006916	
ABCA12	26154	broad.mit.edu	37	2	215910643	215910643	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:215910643G>T	ENST00000272895.7	-	7	1009	c.790C>A	c.(790-792)Cag>Aag	p.Q264K		NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	264					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.Q264K(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GACAGAAGCTGCCACACAGCT	0.388																																					p.Q264K	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C790A	2						.						89.0	92.0	91.0					2																	215910643		2202	4300	6502	215618888	SO:0001583	missense	26154	exon7			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.790C>A	2.37:g.215910643G>T	ENSP00000272895:p.Gln264Lys	Somatic		Capture	Illumina HiSeq	Phase_I	215618888	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569860	0.45798	.	.	ENSG00000144452	ENST00000272895	T	0.26373	1.74	5.62	3.69	0.42338	.	0.204155	0.34700	N	0.003746	T	0.16685	0.0401	N	0.19112	0.55	0.80722	D	1	B	0.14012	0.009	B	0.11329	0.006	T	0.04811	-1.0925	10	0.35671	T	0.21	.	12.1962	0.54298	0.0:0.3305:0.6695:0.0	.	264	Q86UK0	ABCAC_HUMAN	K	264	ENSP00000272895:Q264K	ENSP00000272895:Q264K	Q	-	1	0	ABCA12	215618888	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.467000	0.45093	1.502000	0.48669	0.585000	0.79938	CAG		0.388	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
SCG2	7857	broad.mit.edu	37	2	224462572	224462572	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:224462572G>T	ENST00000305409.2	-	2	1661	c.1429C>A	c.(1429-1431)Cag>Aag	p.Q477K		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.Q477K(1)		NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TTGGGAAGCTGGTTCGATCTA	0.453																																					p.Q477K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1429A	2						.						147.0	138.0	141.0					2																	224462572		2203	4300	6503	224170816	SO:0001583	missense	7857	exon2			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1429C>A	2.37:g.224462572G>T	ENSP00000304133:p.Gln477Lys	Somatic		Capture	Illumina HiSeq	Phase_I	224170816	NM_003469	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	ENST00000305409.2	37	CCDS2457.1	.	.	.	.	.	.	.	.	.	.	G	1.485	-0.556113	0.03967	.	.	ENSG00000171951	ENST00000305409;ENST00000450330	T	0.01705	4.68	5.86	4.98	0.66077	.	0.455245	0.21802	N	0.068902	T	0.02727	0.0082	L	0.51422	1.61	0.09310	N	1	B	0.27625	0.183	B	0.25506	0.061	T	0.40308	-0.9570	10	0.23891	T	0.37	.	15.4854	0.75560	0.0:0.1377:0.8623:0.0	.	477	P13521	SCG2_HUMAN	K	477;337	ENSP00000304133:Q477K	ENSP00000304133:Q477K	Q	-	1	0	SCG2	224170816	0.902000	0.30710	0.098000	0.21074	0.234000	0.25298	3.773000	0.55333	1.479000	0.48272	-0.172000	0.13284	CAG		0.453	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256870.2	NM_003469	
TRMT61B	55006	broad.mit.edu	37	2	29072791	29072791	+	3'UTR	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:29072791C>T	ENST00000306108.5	-	0	1731				TRMT61B_ENST00000484060.1_5'Flank|SPDYA_ENST00000379579.4_Missense_Mutation_p.T309I|SPDYA_ENST00000334056.5_Missense_Mutation_p.T309I	NM_017910.3	NP_060380.3	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B (S. cerevisiae)						mitochondrial tRNA methylation (GO:0070901)|protein homooligomerization (GO:0051260)	mitochondrion (GO:0005739)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)	p.T309I(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	13						GAGTGGTTTACAGGAAGTGAA	0.313																																					p.T309I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C926T	2						.						50.0	54.0	53.0					2																	29072791		2203	4297	6500	28926295	SO:0001624	3_prime_UTR_variant	245711	exon8			BC010365	CCDS1768.1	2p23.2	2009-01-09			ENSG00000171103	ENSG00000171103			26070	protein-coding gene	gene with protein product						11230166	Standard	NM_017910		Approved	FLJ20628	uc002rmm.3	Q9BVS5	OTTHUMG00000128433	ENST00000306108.5:c.*274G>A	2.37:g.29072791C>T		Somatic		Capture	Illumina HiSeq	Phase_I	28926295	NM_182756	Q9H0Q9|Q9NWS7	Missense_Mutation	SNP	ENST00000306108.5	37	CCDS1768.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791811	0.50102	.	.	ENSG00000163806	ENST00000379579;ENST00000334056	.	.	.	5.77	4.84	0.62591	.	0.504313	0.13853	U	0.358220	T	0.56352	0.1979	L	0.43152	1.355	0.80722	D	1	P	0.46706	0.883	B	0.44224	0.444	T	0.61073	-0.7136	9	0.72032	D	0.01	-1.0097	15.9682	0.79991	0.1353:0.8647:0.0:0.0	.	309	Q5MJ70	SPDYA_HUMAN	I	309	.	ENSP00000335628:T309I	T	+	2	0	SPDYA	28926295	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.441000	0.52893	2.885000	0.99019	0.655000	0.94253	ACA		0.313	TRMT61B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250224.1	NM_017910	
VIT	5212	broad.mit.edu	37	2	37010497	37010497	+	Nonsense_Mutation	SNP	G	G	T	rs374739571		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:37010497G>T	ENST00000389975.3	+	10	1119	c.817G>T	c.(817-819)Gaa>Taa	p.E273*	VIT_ENST00000404084.1_Nonsense_Mutation_p.E225*|VIT_ENST00000379241.3_Nonsense_Mutation_p.E251*|VIT_ENST00000401530.1_Intron|VIT_ENST00000497382.1_5'UTR|VIT_ENST00000379242.3_Nonsense_Mutation_p.E288*	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	273					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)	p.E288*(1)		autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				TGTTCCAAAAGAAGAATTGAG	0.448																																					p.E273X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G817T	2						.						98.0	89.0	92.0					2																	37010497		2203	4300	6503	36864001	SO:0001587	stop_gained	5212	exon10			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.817G>T	2.37:g.37010497G>T	ENSP00000374625:p.Glu273*	Somatic		Capture	Illumina HiSeq	Phase_I	36864001	NM_001177969	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Nonsense_Mutation	SNP	ENST00000389975.3	37	CCDS54347.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.978175|6.978175	0.97979|0.97979	.|.	.|.	ENSG00000205221|ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000404084;ENST00000379241|ENST00000464309	.|T	.|0.30182	.|1.54	5.75|5.75	4.88|4.88	0.63580|0.63580	.|.	0.332724|.	0.32901|.	N|.	0.005507|.	.|T	.|0.39064	.|0.1064	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.53158	.|-0.8478	.|5	0.06365|0.40728	T|T	0.9|0.16	-21.8446|-21.8446	11.0158|11.0158	0.47687|0.47687	0.0855:0.0:0.9145:0.0|0.0855:0.0:0.9145:0.0	.|.	.|.	.|.	.|.	X|N	288;273;225;251|39	.|ENSP00000419251:K39N	ENSP00000368543:E251X|ENSP00000419251:K39N	E|K	+|+	1|3	0|2	VIT|VIT	36864001|36864001	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	3.432000|3.432000	0.52824|0.52824	1.439000|1.439000	0.47511|0.47511	0.655000|0.655000	0.94253|0.94253	GAA|AAG		0.448	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			
MEIS1	4211	broad.mit.edu	37	2	66739342	66739342	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:66739342G>T	ENST00000272369.9	+	8	1261	c.804G>T	c.(802-804)aaG>aaT	p.K268N	MEIS1_ENST00000444274.2_Intron|MEIS1_ENST00000398506.2_Missense_Mutation_p.K266N|MEIS1_ENST00000495021.2_Missense_Mutation_p.K203N|MEIS1_ENST00000407092.2_Missense_Mutation_p.K268N|MEIS1_ENST00000560281.2_Missense_Mutation_p.K268N|MEIS1_ENST00000488550.1_Missense_Mutation_p.K268N|MEIS1_ENST00000409517.1_Intron	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	268	Asp/Glu-rich (acidic).|Poly-Asp.				angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.K268N(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						ACCCTGATAAGGACAAAAAGC	0.458																																					p.K268N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G804T	2						.						61.0	64.0	63.0					2																	66739342		2091	4261	6352	66592846	SO:0001583	missense	4211	exon8				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.804G>T	2.37:g.66739342G>T	ENSP00000272369:p.Lys268Asn	Somatic		Capture	Illumina HiSeq	Phase_I	66592846	NM_002398	A8MV50	Missense_Mutation	SNP	ENST00000272369.9	37	CCDS46309.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608310	0.46527	.	.	ENSG00000143995	ENST00000272369;ENST00000407092;ENST00000398506;ENST00000495021;ENST00000402908;ENST00000450027	D;D;D;D;D	0.91894	-2.15;-1.89;-1.89;-2.15;-2.93	5.76	5.76	0.90799	Homeodomain-related (1);	0.000000	0.85682	D	0.000000	D	0.91566	0.7336	L	0.28192	0.835	0.80722	D	1	P;D;B;P	0.54964	0.735;0.969;0.286;0.917	B;P;B;P	0.52793	0.363;0.709;0.199;0.709	D	0.91291	0.5059	10	0.48119	T	0.1	.	20.3431	0.98773	0.0:0.0:1.0:0.0	.	203;266;268;268	F5GYS8;O00470-2;O00470;F8W8U3	.;.;MEIS1_HUMAN;.	N	268;268;266;203;124;80	ENSP00000272369:K268N;ENSP00000384461:K268N;ENSP00000381518:K266N;ENSP00000440571:K203N;ENSP00000395827:K80N	ENSP00000272369:K268N	K	+	3	2	MEIS1	66592846	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.546000	0.82137	2.880000	0.98712	0.650000	0.86243	AAG		0.458	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319725.4	NM_002398	
AFF3	3899	broad.mit.edu	37	2	100625365	100625365	+	Missense_Mutation	SNP	C	C	T	rs145368049		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:100625365C>T	ENST00000409236.2	-	3	195	c.83G>A	c.(82-84)cGg>cAg	p.R28Q	AFF3_ENST00000317233.4_Missense_Mutation_p.R28Q|AFF3_ENST00000409579.1_Missense_Mutation_p.R53Q|AFF3_ENST00000356421.2_Missense_Mutation_p.R53Q			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	28					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.R53Q(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TTCTTTCCTCCGTAATGCATT	0.393																																					p.R53Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G158A	2						.	C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	247.0	212.0	224.0		158,83	6.0	1.0	2	dbSNP_134	224	0,8600		0,0,4300	no	missense,missense	AFF3	NM_001025108.1,NM_002285.2	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	53/1252,28/1227	100625365	1,13005	2203	4300	6503	99991797	SO:0001583	missense	3899	exon4			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.83G>A	2.37:g.100625365C>T	ENSP00000387207:p.Arg28Gln	Somatic		Capture	Illumina HiSeq	Phase_I	99991797	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	C	32	5.143227	0.94560	2.27E-4	0.0	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288;ENST00000432037;ENST00000423966;ENST00000441400;ENST00000424600;ENST00000416492;ENST00000440445;ENST00000415384	T;T;T;T;T;T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54	5.97	5.97	0.96955	.	0.373394	0.23153	N	0.051336	D	0.82632	0.5079	M	0.70595	2.14	0.37699	D	0.924137	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.78314	0.991;0.977;0.98;0.966	D	0.85237	0.1036	10	0.72032	D	0.01	.	13.6104	0.62074	0.0:0.9296:0.0:0.0704	.	182;182;28;53	B7Z4I6;C9JXV5;P51826;P51826-2	.;.;AFF3_HUMAN;.	Q	28;53;53;28;28;182;53;28;28;28;28;28;105;182	ENSP00000317421:R28Q;ENSP00000348793:R53Q;ENSP00000386834:R53Q;ENSP00000387207:R28Q;ENSP00000406484:R28Q;ENSP00000396582:R28Q;ENSP00000399795:R28Q;ENSP00000411383:R28Q;ENSP00000395068:R28Q;ENSP00000393732:R105Q	ENSP00000317421:R28Q	R	-	2	0	AFF3	99991797	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.095000	0.64529	2.836000	0.97738	0.655000	0.94253	CGG		0.393	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
MLPH	79083	broad.mit.edu	37	2	238461004	238461004	+	Missense_Mutation	SNP	G	G	A	rs568517279		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr2:238461004G>A	ENST00000264605.3	+	15	1994	c.1700G>A	c.(1699-1701)cGg>cAg	p.R567Q	MLPH_ENST00000409373.1_Missense_Mutation_p.R447Q|MLPH_ENST00000445024.2_3'UTR|MLPH_ENST00000338530.4_Missense_Mutation_p.R539Q|MLPH_ENST00000410032.1_Missense_Mutation_p.R424Q	NM_024101.5	NP_077006.1	Q9BV36	MELPH_HUMAN	melanophilin	567					melanocyte differentiation (GO:0030318)|melanosome localization (GO:0032400)|protein targeting (GO:0006605)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|microtubule plus-end (GO:0035371)|stress fiber (GO:0001725)	metal ion binding (GO:0046872)	p.R567Q(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		TCTTTTGATCGGAAATCAGTG	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		15372	0.0		0.0	False		,,,				2504	0.001				p.R539Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1616A	2						.						76.0	71.0	73.0					2																	238461004		2203	4300	6503	238125743	SO:0001583	missense	79083	exon14			AY358857	CCDS2518.1, CCDS42836.1, CCDS63172.1, CCDS63173.1	2q37.2	2014-09-17			ENSG00000115648	ENSG00000115648			29643	protein-coding gene	gene with protein product		606526				11980908, 11504925	Standard	NM_024101		Approved	l1Rk3, l(1)-3Rk, Slac-2a, ln, exophilin-3	uc002vwt.3	Q9BV36	OTTHUMG00000133298	ENST00000264605.3:c.1700G>A	2.37:g.238461004G>A	ENSP00000264605:p.Arg567Gln	Somatic		Capture	Illumina HiSeq	Phase_I	238125743	NM_001042467	B3KSS2|B4DKW7|G5E9G5|Q9HA71	Missense_Mutation	SNP	ENST00000264605.3	37	CCDS2518.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.204490	0.79127	.	.	ENSG00000115648	ENST00000410032;ENST00000264605;ENST00000338530;ENST00000409373;ENST00000437893;ENST00000434770	T;T;T;T;T	0.45668	0.97;1.35;1.11;0.89;1.1	4.91	4.02	0.46733	.	0.277797	0.25402	N	0.030933	T	0.62732	0.2452	M	0.77103	2.36	0.50467	D	0.999879	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	P;D;D;D;D;D;D	0.73380	0.886;0.95;0.956;0.954;0.98;0.967;0.975	T	0.65755	-0.6091	10	0.72032	D	0.01	-7.2558	11.2752	0.49163	0.0:0.1847:0.8152:0.0	.	228;423;539;447;539;567;424	Q53QV8;Q6UWC1;A8KA64;B8ZZ97;Q9BV36-2;Q9BV36;G5E9G5	.;.;.;.;.;MELPH_HUMAN;.	Q	424;567;539;447;327;116	ENSP00000386338:R424Q;ENSP00000264605:R567Q;ENSP00000341845:R539Q;ENSP00000386780:R447Q;ENSP00000412438:R327Q	ENSP00000264605:R567Q	R	+	2	0	MLPH	238125743	0.725000	0.28048	0.145000	0.22337	0.984000	0.73092	3.302000	0.51849	1.029000	0.39812	0.591000	0.81541	CGG		0.478	MLPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257083.2	NM_024101	
SLC6A11	6538	broad.mit.edu	37	3	10960056	10960056	+	Silent	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:10960056C>T	ENST00000254488.2	+	8	1104	c.1038C>T	c.(1036-1038)ttC>ttT	p.F346F		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	346					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)	p.F346F(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	GCACCAGCTTCGTGGCTGGGT	0.597																																					p.F346F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1038T	3						.						119.0	94.0	103.0					3																	10960056		2203	4300	6503	10935056	SO:0001819	synonymous_variant	6538	exon8			S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.1038C>T	3.37:g.10960056C>T		Somatic		Capture	Illumina HiSeq	Phase_I	10935056	NM_014229	B2R6U6|Q8IYC9	Silent	SNP	ENST00000254488.2	37	CCDS2602.1																																																																																				0.597	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229	
PDIA5	10954	broad.mit.edu	37	3	122811274	122811274	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:122811274G>T	ENST00000316218.7	+	3	337	c.242G>T	c.(241-243)tGc>tTc	p.C81F		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	81					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)	p.C81F(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		GGGACCATCTGCTGGGTGGAC	0.522																																					p.C81F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G242T	3						.						120.0	110.0	113.0					3																	122811274		2203	4300	6503	124293964	SO:0001583	missense	10954	exon3			AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.242G>T	3.37:g.122811274G>T	ENSP00000323313:p.Cys81Phe	Somatic		Capture	Illumina HiSeq	Phase_I	124293964	NM_006810	D3DN95|Q9BV43	Missense_Mutation	SNP	ENST00000316218.7	37	CCDS3020.1	.	.	.	.	.	.	.	.	.	.	G	11.15	1.552719	0.27739	.	.	ENSG00000065485	ENST00000316218	T	0.03772	3.81	4.87	3.96	0.45880	Thioredoxin-like fold (1);	0.352176	0.33438	N	0.004913	T	0.02649	0.0080	N	0.08118	0	0.37952	D	0.932689	B	0.06786	0.001	B	0.06405	0.002	T	0.51244	-0.8730	10	0.21540	T	0.41	.	10.2363	0.43286	0.0:0.2182:0.7818:0.0	.	81	Q14554	PDIA5_HUMAN	F	81	ENSP00000323313:C81F	ENSP00000323313:C81F	C	+	2	0	PDIA5	124293964	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.735000	0.55044	2.537000	0.85549	0.561000	0.74099	TGC		0.522	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356192.1	NM_006810	
COL6A6	131873	broad.mit.edu	37	3	130311940	130311940	+	Silent	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:130311940C>T	ENST00000358511.6	+	15	4438	c.4407C>T	c.(4405-4407)aaC>aaT	p.N1469N	COL6A6_ENST00000453409.2_Silent_p.N1469N	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1469	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.N1469N(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						ACGGATTAAACGGAGAACAGG	0.378																																					p.N1469N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4407T	3						.						286.0	272.0	276.0					3																	130311940		1852	4092	5944	131794630	SO:0001819	synonymous_variant	131873	exon15			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.4407C>T	3.37:g.130311940C>T		Somatic		Capture	Illumina HiSeq	Phase_I	131794630	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	De_novo_Start_OutOfFrame	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	C	0.821	-0.748721	0.03065	.	.	ENSG00000206384	ENST00000511332	.	.	.	5.29	1.65	0.23941	.	.	.	.	.	T	0.58004	0.2092	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49688	-0.8913	4	.	.	.	.	9.4554	0.38751	0.0:0.1536:0.0:0.8464	.	.	.	.	M	248	.	.	T	+	2	0	COL6A6	131794630	0.666000	0.27475	0.977000	0.42913	0.196000	0.23810	0.368000	0.20399	0.042000	0.15717	-1.244000	0.01528	ACG		0.378	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
IFT80	57560	broad.mit.edu	37	3	159996985	159996985	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:159996985A>G	ENST00000326448.7	-	16	2264	c.1832T>C	c.(1831-1833)gTt>gCt	p.V611A	IFT80_ENST00000483465.1_Missense_Mutation_p.V474A|RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.V782A|IFT80_ENST00000496589.1_Missense_Mutation_p.V474A	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	611					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)		p.V611A(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AATTACCTTAACAAAGCGACA	0.348																																					p.V474A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1421C	3						.						70.0	67.0	68.0					3																	159996985		2203	4300	6503	161479679	SO:0001583	missense	57560	exon15			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.1832T>C	3.37:g.159996985A>G	ENSP00000312778:p.Val611Ala	Somatic		Capture	Illumina HiSeq	Phase_I	161479679	NM_001190242	B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	ENST00000326448.7	37	CCDS3188.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.760483	0.49468	.	.	ENSG00000068885	ENST00000326448;ENST00000483465;ENST00000496589	D;D;D	0.82893	-1.66;-1.66;-1.66	6.16	6.16	0.99307	.	0.208640	0.29861	U	0.011001	T	0.74688	0.3749	N	0.20445	0.575	0.50313	D	0.999868	B	0.14012	0.009	B	0.14578	0.011	T	0.69060	-0.5245	10	0.46703	T	0.11	-14.2874	16.8061	0.85666	1.0:0.0:0.0:0.0	.	611	Q9P2H3	IFT80_HUMAN	A	611;474;474	ENSP00000312778:V611A;ENSP00000418196:V474A;ENSP00000420646:V474A	ENSP00000312778:V611A	V	-	2	0	IFT80	161479679	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.903000	0.63272	2.367000	0.80283	0.528000	0.53228	GTT		0.348	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2	NM_020800	
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,urinary_tract,bladder,Substitution - Missense,0 	.	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A	3						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	180418785	SO:0001583	missense	5290	exon10				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		Capture	Illumina HiSeq	Phase_I	180418785	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
USP13	8975	broad.mit.edu	37	3	179426590	179426590	+	Missense_Mutation	SNP	G	G	A	rs61760204		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:179426590G>A	ENST00000263966.3	+	6	1121	c.650G>A	c.(649-651)cGa>cAa	p.R217Q	USP13_ENST00000482333.1_3'UTR|USP13_ENST00000496897.1_Missense_Mutation_p.R152Q	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	217					autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.R217Q(1)|p.R217L(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TGCGACCTGCGAGAAAACCTC	0.493																																					p.R217Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G650A	3						.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	172.0	159.0	164.0		650	5.7	1.0	3	dbSNP_129	164	0,8600		0,0,4300	no	missense	USP13	NM_003940.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	217/864	179426590	1,13005	2203	4300	6503	180909284	SO:0001583	missense	8975	exon6			U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.650G>A	3.37:g.179426590G>A	ENSP00000263966:p.Arg217Gln	Somatic		Capture	Illumina HiSeq	Phase_I	180909284	NM_003940	A8K2S3|B4DYF3|D3DNS2|Q96B25	Missense_Mutation	SNP	ENST00000263966.3	37	CCDS3235.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095121	0.56075	2.27E-4	0.0	ENSG00000058056	ENST00000263966;ENST00000496897	T;T	0.40476	1.03;1.03	5.72	5.72	0.89469	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, UBP-type (3);	0.000000	0.85682	D	0.000000	T	0.23014	0.0556	N	0.11789	0.175	0.52501	D	0.999954	B;B	0.29136	0.234;0.037	B;B	0.20577	0.03;0.013	T	0.11966	-1.0566	10	0.15066	T	0.55	-16.7211	13.128	0.59366	0.0729:0.0:0.9271:0.0	rs61760204	217;217	Q92995;A8K2S3	UBP13_HUMAN;.	Q	217;152	ENSP00000263966:R217Q;ENSP00000417146:R152Q	ENSP00000263966:R217Q	R	+	2	0	USP13	180909284	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	6.446000	0.73460	2.684000	0.91462	0.650000	0.86243	CGA		0.493	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349617.1		
MCF2L2	23101	broad.mit.edu	37	3	182994733	182994733	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:182994733A>C	ENST00000328913.3	-	15	2086	c.1789T>G	c.(1789-1791)Ttt>Gtt	p.F597V	MCF2L2_ENST00000473233.1_Missense_Mutation_p.F597V|MCF2L2_ENST00000447025.2_Missense_Mutation_p.F597V|MCF2L2_ENST00000414362.2_Missense_Mutation_p.F597V	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	597							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.F597V(1)		breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TGGCTTTCAAAGATTTCTTCA	0.463																																					p.F597V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1789G	3						.						25.0	24.0	25.0					3																	182994733		2203	4300	6503	184477427	SO:0001583	missense	23101	exon15			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1789T>G	3.37:g.182994733A>C	ENSP00000328118:p.Phe597Val	Somatic		Capture	Illumina HiSeq	Phase_I	184477427	NM_015078	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	A	9.570	1.120662	0.20877	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000437431;ENST00000414362	T;T;T;T	0.04654	4.7;4.72;3.85;3.58	4.94	0.999	0.19862	.	2.007510	0.02032	N	0.048600	T	0.02888	0.0086	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.40720	-0.9548	10	0.17369	T	0.5	.	4.2156	0.10533	0.3005:0.1997:0.4997:0.0	.	597;597	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	V	597;597;597;133;597	ENSP00000328118:F597V;ENSP00000420070:F597V;ENSP00000388190:F597V;ENSP00000414131:F597V	ENSP00000328118:F597V	F	-	1	0	MCF2L2	184477427	0.008000	0.16893	0.001000	0.08648	0.039000	0.13416	0.549000	0.23329	0.058000	0.16222	-0.472000	0.04984	TTT		0.463	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	
ITPR1	3708	broad.mit.edu	37	3	4748024	4748024	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:4748024G>A	ENST00000443694.2	+	34	4786	c.4786G>A	c.(4786-4788)Gag>Aag	p.E1596K	ITPR1_ENST00000302640.8_Missense_Mutation_p.E1596K|ITPR1_ENST00000357086.4_Missense_Mutation_p.E1602K|ITPR1_ENST00000456211.2_Missense_Mutation_p.E1587K|ITPR1_ENST00000423119.2_Missense_Mutation_p.E1602K|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.E1611K			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1611					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.E1587K(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GAATATCATTGAGAGATTGCA	0.537																																					p.E1602K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4804A	3						.						45.0	46.0	46.0					3																	4748024		2077	4212	6289	4723024	SO:0001583	missense	3708	exon37			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.4786G>A	3.37:g.4748024G>A	ENSP00000401671:p.Glu1596Lys	Somatic		Capture	Illumina HiSeq	Phase_I	4723024	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	G	36	5.618612	0.96649	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.26	5.26	0.73747	.	0.049675	0.85682	D	0.000000	D	0.82949	0.5148	M	0.79258	2.445	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.87578	0.998;0.929	D	0.84706	0.0731	10	0.72032	D	0.01	.	19.2432	0.93891	0.0:0.0:1.0:0.0	.	1611;1602	Q14643;G5E9P1	ITPR1_HUMAN;.	K	1611;1596;1611;1602;57;1602;1587;1596	ENSP00000306253:E1596K;ENSP00000346595:E1611K;ENSP00000405934:E1602K;ENSP00000349597:E1602K;ENSP00000397885:E1587K;ENSP00000401671:E1596K	ENSP00000306253:E1596K	E	+	1	0	ITPR1	4723024	1.000000	0.71417	0.904000	0.35570	0.989000	0.77384	9.556000	0.98127	2.609000	0.88269	0.655000	0.94253	GAG		0.537	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
ZNF620	253639	broad.mit.edu	37	3	40558151	40558151	+	Nonsense_Mutation	SNP	C	C	T	rs138858148	byFrequency	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:40558151C>T	ENST00000314529.6	+	5	1215	c.1066C>T	c.(1066-1068)Cga>Tga	p.R356*	ZNF620_ENST00000418905.1_Nonsense_Mutation_p.R242*	NM_175888.3	NP_787084.1	Q6ZNG0	ZN620_HUMAN	zinc finger protein 620	356					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R356*(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(1)|urinary_tract(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TCAGCATCAGCGAATTCACAC	0.468																																					p.R356X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1066T	3						.	C	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	79.0	77.0	78.0		1066	-3.4	0.2	3	dbSNP_134	78	2,8598	2.2+/-6.3	0,2,4298	no	stop-gained	ZNF620	NM_175888.2		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		356/423	40558151	3,13003	2203	4300	6503	40533155	SO:0001587	stop_gained	253639	exon5			AK093599	CCDS33740.1, CCDS58825.1	3p21.33	2013-01-08			ENSG00000177842	ENSG00000177842		"""Zinc fingers, C2H2-type"", ""-"""	28742	protein-coding gene	gene with protein product						12477932	Standard	NM_175888		Approved	MGC50836	uc003ckk.4	Q6ZNG0	OTTHUMG00000156044	ENST00000314529.6:c.1066C>T	3.37:g.40558151C>T	ENSP00000322265:p.Arg356*	Somatic		Capture	Illumina HiSeq	Phase_I	40533155	NM_175888	Q8N223	Nonsense_Mutation	SNP	ENST00000314529.6	37	CCDS33740.1	.	.	.	.	.	.	.	.	.	.	C	12.67	2.008557	0.35415	2.27E-4	2.33E-4	ENSG00000177842	ENST00000314529;ENST00000418905	.	.	.	2.82	-3.41	0.04839	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.5513	0.27798	0.6786:0.1985:0.1229:0.0	.	.	.	.	X	356;242	.	.	R	+	1	2	ZNF620	40533155	0.000000	0.05858	0.245000	0.24217	0.014000	0.08584	-1.433000	0.02428	-0.621000	0.05633	-0.302000	0.09304	CGA		0.468	ZNF620-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342824.1	XM_171060	
ADAMTS9	56999	broad.mit.edu	37	3	64619463	64619463	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:64619463C>T	ENST00000498707.1	-	13	2291	c.1949G>A	c.(1948-1950)cGa>cAa	p.R650Q	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.R622Q	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	650	Cys-rich.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R650Q(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CTGTTCATCTCGGAAGTCTCG	0.448																																					p.R650Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1949A	3						.						167.0	147.0	154.0					3																	64619463		2203	4300	6503	64594503	SO:0001583	missense	56999	exon13			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.1949G>A	3.37:g.64619463C>T	ENSP00000418735:p.Arg650Gln	Somatic		Capture	Illumina HiSeq	Phase_I	64594503	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	C	36	5.701675	0.96812	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.06371	3.31;3.31	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000001	T	0.42921	0.1224	H	0.97611	4.04	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.998;1.0	T	0.63726	-0.6572	10	0.87932	D	0	.	19.4315	0.94772	0.0:1.0:0.0:0.0	.	622;650;650;650	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	Q	622;650	ENSP00000295903:R622Q;ENSP00000418735:R650Q	ENSP00000295903:R622Q	R	-	2	0	ADAMTS9	64594503	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	7.487000	0.81328	2.600000	0.87896	0.655000	0.94253	CGA		0.448	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
ROBO2	6092	broad.mit.edu	37	3	77671509	77671509	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:77671509A>C	ENST00000461745.1	+	23	4586	c.3686A>C	c.(3685-3687)gAa>gCa	p.E1229A	ROBO2_ENST00000332191.8_Missense_Mutation_p.E1229A|ROBO2_ENST00000487694.3_Missense_Mutation_p.E1245A	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1229					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.E1229A(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GAAGCTTTAGAAATCCCCAGG	0.488																																					p.R1209S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3627C	3						.						97.0	98.0	97.0					3																	77671509		1895	4135	6030	77754199	SO:0001583	missense	6092	exon22			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3686A>C	3.37:g.77671509A>C	ENSP00000417164:p.Glu1229Ala	Somatic		Capture	Illumina HiSeq	Phase_I	77754199	NM_001128929	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.916|4.916	0.170182|0.170182	0.09339|0.09339	.|.	.|.	ENSG00000185008|ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000461745;ENST00000332191|ENST00000475334	T;T;T|.	0.62639|.	0.01;0.04;0.05|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.000000|.	0.47455|.	D|.	0.000240|.	T|T	0.43634|0.43634	0.1256|0.1256	N|N	0.14661|0.14661	0.345|0.345	.|.	.|.	.|.	B;P;B|.	0.46859|.	0.063;0.885;0.063|.	B;P;B|.	0.45881|.	0.026;0.496;0.026|.	T|T	0.51896|0.51896	-0.8647|-0.8647	9|4	0.09084|.	T|.	0.74|.	.|.	15.6959|15.6959	0.77499|0.77499	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1245;1229;1229|.	Q19AB5;F8W703;Q9HCK4|.	.;.;ROBO2_HUMAN|.	A|S	1245;1245;1229;1229|60	ENSP00000417335:E1245A;ENSP00000417164:E1229A;ENSP00000327536:E1229A|.	ENSP00000327536:E1229A|.	E|R	+|+	2|3	0|2	ROBO2|ROBO2	77754199|77754199	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.701000|0.701000	0.40568|0.40568	5.709000|5.709000	0.68384|0.68384	2.110000|2.110000	0.64415|0.64415	0.528000|0.528000	0.53228|0.53228	GAA|AGA		0.488	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
CHRD	8646	broad.mit.edu	37	3	184102983	184102983	+	Missense_Mutation	SNP	C	C	T	rs199856196	byFrequency	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr3:184102983C>T	ENST00000204604.1	+	14	2021	c.1775C>T	c.(1774-1776)aCg>aTg	p.T592M	CHRD_ENST00000348986.3_Missense_Mutation_p.T552M|EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000545352.1_Missense_Mutation_p.T222M|CHRD_ENST00000450923.1_Missense_Mutation_p.T592M	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	592	CHRD 4. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)	p.T592M(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCTCCTGGAACGCCAGGGCCT	0.562													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17405	0.0		0.0	False		,,,				2504	0.001				p.T592M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1775T	3						.						70.0	73.0	72.0					3																	184102983		2203	4300	6503	185585677	SO:0001583	missense	8646	exon14			AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1775C>T	3.37:g.184102983C>T	ENSP00000204604:p.Thr592Met	Somatic		Capture	Illumina HiSeq	Phase_I	185585677	NM_003741	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	CCDS3266.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	6.699	0.497704	0.12762	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352;ENST00000342610	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.29	-1.28	0.09318	CHRD (3);	0.348642	0.32578	N	0.005909	T	0.25344	0.0616	N	0.24115	0.695	0.21527	N	0.999655	B;B;B;B	0.15930	0.015;0.009;0.004;0.004	B;B;B;B	0.17098	0.01;0.008;0.017;0.006	T	0.15694	-1.0428	10	0.39692	T	0.17	-3.5559	10.544	0.45050	0.0:0.5176:0.0:0.4824	.	222;552;592;592	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0	.;.;.;CHRD_HUMAN	M	592;592;552;222;305	ENSP00000204604:T592M;ENSP00000408972:T592M;ENSP00000334036:T552M;ENSP00000442948:T222M	ENSP00000204604:T592M	T	+	2	0	CHRD	185585677	0.986000	0.35501	0.847000	0.33407	0.436000	0.31835	2.013000	0.40942	-0.372000	0.07992	-0.768000	0.03414	ACG		0.562	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741	
SLC4A4	8671	broad.mit.edu	37	4	72363373	72363373	+	Silent	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr4:72363373G>T	ENST00000264485.5	+	16	2247	c.2130G>T	c.(2128-2130)ctG>ctT	p.L710L	SLC4A4_ENST00000340595.3_Silent_p.L666L|SLC4A4_ENST00000425175.1_Silent_p.L710L|SLC4A4_ENST00000351898.6_Silent_p.L710L	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	710					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.L666L(1)|p.L710L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	CCATGGCTCTGAAAAAATTCA	0.363																																					p.L710L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2130T	4						.						112.0	116.0	115.0					4																	72363373		2203	4300	6503	72582237	SO:0001819	synonymous_variant	8671	exon16			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2130G>T	4.37:g.72363373G>T		Somatic		Capture	Illumina HiSeq	Phase_I	72582237	NM_001134742	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	37	CCDS43236.1																																																																																				0.363	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
STPG2	285555	broad.mit.edu	37	4	98761978	98761978	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr4:98761978C>A	ENST00000295268.3	-	9	1239	c.1150G>T	c.(1150-1152)Gcc>Tcc	p.A384S	STPG2_ENST00000506482.1_Intron	NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	384								p.A384S(1)									AGAAAAGAGGCATGTTTTCTT	0.408																																					p.A384S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1150T	4						.						109.0	113.0	111.0					4																	98761978		2203	4300	6503	98981001	SO:0001583	missense	285555	exon9			BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.1150G>T	4.37:g.98761978C>A	ENSP00000295268:p.Ala384Ser	Somatic		Capture	Illumina HiSeq	Phase_I	98981001	NM_174952		Missense_Mutation	SNP	ENST00000295268.3	37	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	C	8.009	0.757060	0.15846	.	.	ENSG00000163116	ENST00000522676;ENST00000295268	T;T	0.40225	1.04;2.84	5.47	-2.86	0.05717	.	0.844655	0.10186	N	0.705215	T	0.15955	0.0384	N	0.11560	0.145	0.19775	N	0.999958	B	0.14012	0.009	B	0.17722	0.019	T	0.31364	-0.9946	10	0.05959	T	0.93	-0.0558	4.5856	0.12280	0.3984:0.2337:0.0:0.3679	.	384	Q8N412	CD037_HUMAN	S	98;384	ENSP00000428346:A98S;ENSP00000295268:A384S	ENSP00000295268:A384S	A	-	1	0	C4orf37	98981001	0.008000	0.16893	0.865000	0.33974	0.971000	0.66376	-2.465000	0.00995	-0.431000	0.07307	-0.225000	0.12378	GCC		0.408	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
POU4F2	5458	broad.mit.edu	37	4	147561281	147561281	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr4:147561281C>T	ENST00000281321.3	+	2	799	c.551C>T	c.(550-552)cCg>cTg	p.P184L	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	184					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.P184L(1)		NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					caccaccaACCGCACCAGGCG	0.711																																					p.P184L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C551T	4						.						22.0	25.0	24.0					4																	147561281		2201	4297	6498	147780731	SO:0001583	missense	5458	exon2			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.551C>T	4.37:g.147561281C>T	ENSP00000281321:p.Pro184Leu	Somatic		Capture	Illumina HiSeq	Phase_I	147780731	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	ENST00000281321.3	37	CCDS34074.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048437	0.36181	.	.	ENSG00000151615	ENST00000281321	T	0.81415	-1.49	5.63	4.79	0.61399	.	0.277132	0.41097	D	0.000957	T	0.67795	0.2931	N	0.22421	0.69	0.80722	D	1	B	0.16396	0.017	B	0.06405	0.002	T	0.62291	-0.6885	10	0.33141	T	0.24	.	11.4582	0.50193	0.0:0.8515:0.0:0.1485	.	184	Q12837	PO4F2_HUMAN	L	184	ENSP00000281321:P184L	ENSP00000281321:P184L	P	+	2	0	POU4F2	147780731	1.000000	0.71417	0.998000	0.56505	0.843000	0.47879	4.755000	0.62198	1.390000	0.46547	0.313000	0.20887	CCG		0.711	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
MAN2A1	4124	broad.mit.edu	37	5	109065129	109065129	+	Missense_Mutation	SNP	C	C	T	rs200086589		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr5:109065129C>T	ENST00000261483.4	+	4	1674	c.622C>T	c.(622-624)Cgg>Tgg	p.R208W		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	208					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.R208W(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		AGAAGACTCACGGAGGAAGTT	0.343																																					p.R208W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C622T	5						.	C	TRP/ARG	2,4402	6.2+/-15.9	0,2,2200	120.0	120.0	120.0		622	2.5	1.0	5		120	1,8599	1.2+/-3.3	0,1,4299	yes	missense	MAN2A1	NM_002372.2	101	0,3,6499	TT,TC,CC		0.0116,0.0454,0.0231	probably-damaging	208/1145	109065129	3,13001	2202	4300	6502	109093028	SO:0001583	missense	4124	exon4				CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.622C>T	5.37:g.109065129C>T	ENSP00000261483:p.Arg208Trp	Somatic		Capture	Illumina HiSeq	Phase_I	109093028	NM_002372	Q16767	Missense_Mutation	SNP	ENST00000261483.4	37	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	C	18.43	3.623185	0.66901	4.54E-4	1.16E-4	ENSG00000112893	ENST00000261483	T	0.23147	1.92	5.83	2.48	0.30137	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.187470	0.53938	D	0.000044	T	0.52948	0.1766	M	0.89904	3.07	0.46185	D	0.998916	D	0.71674	0.998	D	0.76071	0.987	T	0.53753	-0.8394	10	0.72032	D	0.01	-9.4362	8.524	0.33293	0.3555:0.4954:0.1491:0.0	.	208	Q16706	MA2A1_HUMAN	W	208	ENSP00000261483:R208W	ENSP00000261483:R208W	R	+	1	2	MAN2A1	109093028	0.272000	0.24172	0.998000	0.56505	0.982000	0.71751	0.965000	0.29319	0.227000	0.20999	-0.262000	0.10625	CGG		0.343	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
TRIO	7204	broad.mit.edu	37	5	14508455	14508455	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr5:14508455G>A	ENST00000344204.4	+	57	9242	c.9218G>A	c.(9217-9219)cGc>cAc	p.R3073H	TRIO_ENST00000344135.5_Missense_Mutation_p.R572H|TRIO_ENST00000537187.1_Missense_Mutation_p.R2897H	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	3073					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R3073H(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					ATTGAGCGGCGCAAACACCAG	0.547																																					p.R3073H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9218A	5						.						65.0	66.0	66.0					5																	14508455		2202	4294	6496	14561455	SO:0001583	missense	7204	exon57			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.9218G>A	5.37:g.14508455G>A	ENSP00000339299:p.Arg3073His	Somatic		Capture	Illumina HiSeq	Phase_I	14561455	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760381	0.89932	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000344135	T;T;T	0.68765	-0.34;-0.31;-0.35	5.72	5.72	0.89469	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.82360	0.5020	M	0.69823	2.125	0.39235	D	0.96374	D	0.89917	1.0	D	0.91635	0.999	D	0.84257	0.0481	10	0.87932	D	0	.	19.8755	0.96869	0.0:0.0:1.0:0.0	.	3073	O75962	TRIO_HUMAN	H	3073;2897;572	ENSP00000339299:R3073H;ENSP00000446348:R2897H;ENSP00000339291:R572H	ENSP00000339291:R572H	R	+	2	0	TRIO	14561455	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.689000	0.91719	0.650000	0.86243	CGC		0.547	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
PCDHGA6	56109	broad.mit.edu	37	5	140755746	140755746	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr5:140755746C>T	ENST00000517434.1	+	1	2096	c.2096C>T	c.(2095-2097)gCg>gTg	p.A699V	PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	699					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A699V(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGTGGCCGCGGTCTCCTGC	0.657																																					p.A699V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2096T	5						.						56.0	66.0	63.0					5																	140755746		2202	4297	6499	140735930	SO:0001583	missense	56109	exon1			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.2096C>T	5.37:g.140755746C>T	ENSP00000429601:p.Ala699Val	Somatic		Capture	Illumina HiSeq	Phase_I	140735930	NM_032086	A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	0.011	-1.711120	0.00712	.	.	ENSG00000253731	ENST00000517434	T	0.12039	2.72	5.15	-3.77	0.04346	.	1.265560	0.06665	U	0.765116	T	0.07999	0.0200	L	0.31065	0.9	0.09310	N	1	B;B	0.12013	0.003;0.005	B;B	0.15870	0.007;0.014	T	0.44832	-0.9302	10	0.02654	T	1	.	9.5311	0.39193	0.094:0.3504:0.0:0.5556	.	699;699	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	V	699	ENSP00000429601:A699V	ENSP00000429601:A699V	A	+	2	0	PCDHGA6	140735930	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.040000	0.01416	-0.713000	0.04981	-0.940000	0.02684	GCG		0.657	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
JAKMIP2	9832	broad.mit.edu	37	5	147019212	147019212	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr5:147019212C>T	ENST00000265272.5	-	10	1980	c.1513G>A	c.(1513-1515)Gct>Act	p.A505T	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.A463T|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.A505T	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	505						Golgi apparatus (GO:0005794)		p.A505T(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCGTTCAGCGTCGATGATG	0.438																																					p.A505T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1513A	5						.						349.0	346.0	347.0					5																	147019212		2203	4300	6503	146999405	SO:0001583	missense	9832	exon10			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.1513G>A	5.37:g.147019212C>T	ENSP00000265272:p.Ala505Thr	Somatic		Capture	Illumina HiSeq	Phase_I	146999405	NM_014790	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	C	35	5.437891	0.96168	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.30714	1.53;1.52;1.52	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.56352	0.1979	M	0.71036	2.16	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.74023	0.982;0.982;0.982;0.982	T	0.45425	-0.9262	10	0.31617	T	0.26	.	20.1065	0.97896	0.0:1.0:0.0:0.0	.	463;505;505;505	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	T	505;505;463;505	ENSP00000421398:A505T;ENSP00000265272:A505T;ENSP00000328989:A463T	ENSP00000265272:A505T	A	-	1	0	JAKMIP2	146999405	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.262000	0.78410	2.836000	0.97738	0.655000	0.94253	GCT		0.438	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
GRIA1	2890	broad.mit.edu	37	5	153078529	153078529	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr5:153078529G>A	ENST00000285900.5	+	10	1691	c.1348G>A	c.(1348-1350)Gtg>Atg	p.V450M	GRIA1_ENST00000518783.1_Missense_Mutation_p.V460M|GRIA1_ENST00000518142.1_Missense_Mutation_p.V370M|GRIA1_ENST00000521843.2_Missense_Mutation_p.V381M|GRIA1_ENST00000340592.5_Missense_Mutation_p.V450M|GRIA1_ENST00000448073.4_Missense_Mutation_p.V460M	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	450					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.V450M(1)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TGCCAAGCACGTGGGCTACTC	0.537																																					p.V450M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1348A	5						.						109.0	97.0	101.0					5																	153078529		2203	4300	6503	153058722	SO:0001583	missense	2890	exon10				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1348G>A	5.37:g.153078529G>A	ENSP00000285900:p.Val450Met	Somatic		Capture	Illumina HiSeq	Phase_I	153058722	NM_001114183	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496929	0.85069	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.78003	1.8;1.8;-1.14;1.8;1.8;1.8;-1.14	5.44	5.44	0.79542	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.84692	0.5528	L	0.52126	1.63	0.80722	D	1	D;D;D;D;D;D	0.65815	0.995;0.995;0.984;0.995;0.994;0.982	P;P;D;P;P;P	0.63703	0.859;0.859;0.917;0.859;0.779;0.843	D	0.85843	0.1399	10	0.72032	D	0.01	.	18.2393	0.89961	0.0:0.0:1.0:0.0	.	460;460;370;460;450;450	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	M	450;450;370;404;450;381;381;460;460	ENSP00000285900:V450M;ENSP00000427920:V370M;ENSP00000339343:V450M;ENSP00000427864:V381M;ENSP00000442108:V381M;ENSP00000428994:V460M;ENSP00000415569:V460M	ENSP00000285900:V450M	V	+	1	0	GRIA1	153058722	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.295000	0.51794	2.548000	0.85928	0.655000	0.94253	GTG		0.537	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
STK10	6793	broad.mit.edu	37	5	171520724	171520724	+	Missense_Mutation	SNP	C	C	T	rs375820809		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr5:171520724C>T	ENST00000176763.5	-	9	1589	c.1246G>A	c.(1246-1248)Gtg>Atg	p.V416M	STK10_ENST00000517775.1_5'Flank	NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	416					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.V416M(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCCATTGACACGGGTCGGGAC	0.612																																					p.V416M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1246A	5						.	C	MET/VAL	0,4406		0,0,2203	38.0	37.0	38.0		1246	-2.8	0.0	5		38	1,8599	1.2+/-3.3	0,1,4299	no	missense	STK10	NM_005990.3	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	416/969	171520724	1,13005	2203	4300	6503	171453329	SO:0001583	missense	6793	exon9			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.1246G>A	5.37:g.171520724C>T	ENSP00000176763:p.Val416Met	Somatic		Capture	Illumina HiSeq	Phase_I	171453329	NM_005990	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	ENST00000176763.5	37	CCDS34290.1	.	.	.	.	.	.	.	.	.	.	C	3.601	-0.081526	0.07141	0.0	1.16E-4	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.53423	0.62	4.95	-2.77	0.05877	.	0.670270	0.13703	N	0.368649	T	0.22475	0.0542	N	0.16478	0.41	0.09310	N	1	B	0.19200	0.034	B	0.11329	0.006	T	0.08371	-1.0725	10	0.44086	T	0.13	.	1.1656	0.01814	0.2233:0.2394:0.3287:0.2086	.	416	O94804	STK10_HUMAN	M	416	ENSP00000176763:V416M	ENSP00000176763:V416M	V	-	1	0	STK10	171453329	0.000000	0.05858	0.002000	0.10522	0.083000	0.17756	-0.444000	0.06854	-0.964000	0.03595	-0.808000	0.03180	GTG		0.612	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990	
ICE1	23379	broad.mit.edu	37	5	5465319	5465319	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr5:5465319G>A	ENST00000296564.7	+	13	6094	c.5872G>A	c.(5872-5874)Gaa>Aaa	p.E1958K		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1958					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.E1958K(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGTTGTTTATGAATTTAGCAC	0.378																																					p.E1958K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5872A	5						.						57.0	49.0	52.0					5																	5465319		1874	4094	5968	5518319	SO:0001583	missense	23379	exon13																														ENST00000296564.7:c.5872G>A	5.37:g.5465319G>A	ENSP00000296564:p.Glu1958Lys	Somatic		Capture	Illumina HiSeq	Phase_I	5518319	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	G	30	5.055532	0.93793	.	.	ENSG00000164151	ENST00000296564	T	0.12879	2.64	5.76	5.76	0.90799	.	.	.	.	.	T	0.23572	0.0570	L	0.56769	1.78	0.53688	D	0.999972	P	0.49559	0.925	P	0.47162	0.54	T	0.00290	-1.1843	9	0.87932	D	0	-13.1577	17.4637	0.87626	0.0:0.0:1.0:0.0	.	1958	Q9Y2F5	K0947_HUMAN	K	1958	ENSP00000296564:E1958K	ENSP00000296564:E1958K	E	+	1	0	KIAA0947	5518319	1.000000	0.71417	0.157000	0.22605	0.973000	0.67179	6.967000	0.76079	2.730000	0.93505	0.591000	0.81541	GAA		0.378	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
C5orf51	285636	broad.mit.edu	37	5	41904486	41904486	+	Missense_Mutation	SNP	C	C	G	rs139509065	byFrequency	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr5:41904486C>G	ENST00000381647.2	+	1	36	c.17C>G	c.(16-18)tCt>tGt	p.S6C	C5orf51_ENST00000505931.2_Intron	NM_175921.4	NP_787117.3	A6NDU8	CE051_HUMAN	chromosome 5 open reading frame 51	6								p.S6C(1)		endometrium(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GCCGCAGTCTCTAGTGTGGTG	0.662																																					p.S6C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C17G	5						.						27.0	28.0	28.0					5																	41904486		2202	4299	6501	41940243	SO:0001583	missense	285636	exon1			AL833916, AK094002	CCDS34151.1	5p13.1	2008-07-18			ENSG00000205765	ENSG00000205765			27750	protein-coding gene	gene with protein product						14702039	Standard	NM_175921		Approved	LOC285636	uc003jmo.3	A6NDU8	OTTHUMG00000162084	ENST00000381647.2:c.17C>G	5.37:g.41904486C>G	ENSP00000371061:p.Ser6Cys	Somatic		Capture	Illumina HiSeq	Phase_I	41940243	NM_175921	A2RRM9	Missense_Mutation	SNP	ENST00000381647.2	37	CCDS34151.1	.	.	.	.	.	.	.	.	.	.	C	4.248	0.045051	0.08196	.	.	ENSG00000205765	ENST00000381647	T	0.32753	1.44	4.99	2.17	0.27698	.	0.409638	0.27311	N	0.019953	T	0.21307	0.0513	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14896	-1.0456	10	0.48119	T	0.1	-1.3504	15.0682	0.72014	0.0:0.6016:0.3984:0.0	.	6	A6NDU8	CE051_HUMAN	C	6	ENSP00000371061:S6C	ENSP00000371061:S6C	S	+	2	0	C5orf51	41940243	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.284000	0.18864	0.084000	0.17077	-1.268000	0.01426	TCT		0.662	C5orf51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367144.1	NM_175921	
XRCC4	7518	broad.mit.edu	37	5	82491653	82491653	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr5:82491653delT	ENST00000511817.1	+	4	460	c.380delT	c.(379-381)attfs	p.I127fs	XRCC4_ENST00000509268.1_3'UTR|XRCC4_ENST00000338635.6_Frame_Shift_Del_p.I127fs|XRCC4_ENST00000396027.4_Frame_Shift_Del_p.I127fs|XRCC4_ENST00000282268.3_Frame_Shift_Del_p.I127fs			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	127					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)	p.C128fs*25(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		AGAGAACTTATTTGTTATTGC	0.368								Non-homologous end-joining																													p.I127fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.380delT	5						.						71.0	72.0	72.0					5																	82491653		2203	4300	6503	82527409	SO:0001589	frameshift_variant	7518	exon4			AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.380delT	5.37:g.82491653delT	ENSP00000421491:p.Ile127fs	Somatic		Capture	Illumina HiSeq	Phase_I	82527409	NM_022406	A8K3X4|Q9BS72|Q9UP94	Frame_Shift_Del	DEL	ENST00000511817.1	37	CCDS4059.1																																																																																				0.368	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369624.1	NM_022550	
ADAMTS2	9509	broad.mit.edu	37	5	178555069	178555069	+	Silent	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr5:178555069G>T	ENST00000251582.7	-	17	2609	c.2508C>A	c.(2506-2508)atC>atA	p.I836I		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	836	Spacer.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.I836I(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		AGTCCTCATGGATCATGTATT	0.572																																					p.I836I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2508A	5						.						186.0	148.0	161.0					5																	178555069		2203	4300	6503	178487675	SO:0001819	synonymous_variant	9509	exon17			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2508C>A	5.37:g.178555069G>T		Somatic		Capture	Illumina HiSeq	Phase_I	178487675	NM_014244		Silent	SNP	ENST00000251582.7	37	CCDS4444.1																																																																																				0.572	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
PHACTR2	9749	broad.mit.edu	37	6	144081566	144081566	+	Silent	SNP	G	G	A	rs200897868		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr6:144081566G>A	ENST00000427704.2	+	5	580	c.450G>A	c.(448-450)ccG>ccA	p.P150P	PHACTR2_ENST00000305766.6_Intron|PHACTR2_ENST00000440869.2_Silent_p.P161P|PHACTR2_ENST00000367584.4_Intron|PHACTR2_ENST00000367582.3_Intron	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	150							protein phosphatase inhibitor activity (GO:0004864)	p.P161P(1)		NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		CTGAAACACCGGCAGCTCCTG	0.493													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19447	0.0		0.0	False		,,,				2504	0.0				p.P161P	Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G483A	6						.						37.0	42.0	40.0					6																	144081566		1956	4144	6100	144123259	SO:0001819	synonymous_variant	9749	exon5			AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.450G>A	6.37:g.144081566G>A		Somatic		Capture	Illumina HiSeq	Phase_I	144123259	NM_001100164	A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Silent	SNP	ENST00000427704.2	37	CCDS47492.1																																																																																				0.493	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042528.2	NM_014721	
UTRN	7402	broad.mit.edu	37	6	145110352	145110352	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr6:145110352G>T	ENST00000367545.3	+	61	8857	c.8857G>T	c.(8857-8859)Gtg>Ttg	p.V2953L	UTRN_ENST00000367526.4_Missense_Mutation_p.V508L	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2953	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.V2953L(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AAAAATTAGAGTGCAGAGTCT	0.323																																					p.V2953L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8857T	6						.						134.0	153.0	146.0					6																	145110352		2203	4299	6502	145152045	SO:0001583	missense	7402	exon61			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.8857G>T	6.37:g.145110352G>T	ENSP00000356515:p.Val2953Leu	Somatic		Capture	Illumina HiSeq	Phase_I	145152045	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.439891	0.83885	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.70164	-0.46;-0.46	5.96	5.96	0.96718	EF-hand domain, type 1 (1);EF-hand-like domain (1);	0.000000	0.47852	D	0.000216	T	0.65439	0.2691	M	0.76574	2.34	0.36447	D	0.865835	P	0.39940	0.696	B	0.41332	0.354	T	0.71368	-0.4614	10	0.56958	D	0.05	.	20.4082	0.99013	0.0:0.0:1.0:0.0	.	2953	P46939	UTRO_HUMAN	L	2953;508	ENSP00000356515:V2953L;ENSP00000356496:V508L	ENSP00000356496:V508L	V	+	1	0	UTRN	145152045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.361000	0.66092	2.814000	0.96858	0.655000	0.94253	GTG		0.323	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
VN1R10P	387316	broad.mit.edu	37	6	27293270	27293270	+	IGR	SNP	C	C	T	rs554344442		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr6:27293270C>T								POM121L2 (13321 upstream) : ZNF391 (49123 downstream)																							CATCAAAAGACGGTCTTTCAT	0.383																																					p.T70M												.	.	0			c.C209T	6						.						246.0	223.0	230.0					6																	27293270		1880	4102	5982	27401249	SO:0001628	intergenic_variant	83954	exon1																															6.37:g.27293270C>T		Somatic		Capture	Illumina HiSeq	Phase_I	27401249	NM_032030		Missense_Mutation	SNP		37																																																																																				0	0.383								
GJA10	84694	broad.mit.edu	37	6	90605809	90605809	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr6:90605809T>G	ENST00000369352.1	+	1	1622	c.1622T>G	c.(1621-1623)tTc>tGc	p.F541C	Y_RNA_ENST00000517082.1_RNA	NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	0					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.F541C(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		TCAGTTAAATTCAATTCATAA	0.348																																					p.F541C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1622G	6						.						22.0	25.0	24.0					6																	90605809		2121	4277	6398	90662530	SO:0001583	missense	84694	exon1			AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	ENST00000369352.1:c.1622T>G	6.37:g.90605809T>G	ENSP00000358358:p.Phe541Cys	Somatic		Capture	Illumina HiSeq	Phase_I	90662530	NM_032602	B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	SNP	ENST00000369352.1	37	CCDS5025.1	.	.	.	.	.	.	.	.	.	.	T	15.45	2.836221	0.50951	.	.	ENSG00000135355	ENST00000369352	D	0.97976	-4.64	3.89	3.89	0.44902	.	.	.	.	.	D	0.94159	0.8126	L	0.36672	1.1	0.09310	N	1	D	0.63046	0.992	P	0.49561	0.615	D	0.89660	0.3876	9	0.87932	D	0	.	9.2972	0.37822	0.0:0.0:0.0:1.0	.	541	Q969M2	CXA10_HUMAN	C	541	ENSP00000358358:F541C	ENSP00000358358:F541C	F	+	2	0	GJA10	90662530	0.006000	0.16342	0.071000	0.20095	0.514000	0.34195	0.838000	0.27572	1.775000	0.52247	0.379000	0.24179	TTC		0.348	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041505.1	NM_032602	
GSTM2P1	442245	broad.mit.edu	37	6	111368382	111368383	+	IGR	DEL	AG	AG	-			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	AG	AG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr6:111368382_111368383delAG								RPF2 (21079 upstream) : SLC16A10 (40397 downstream)																							GGGTTGTAGCAGAGTCTGGCCA	0.5																																					.												.	.	0			.	6						.																																			111475076	SO:0001628	intergenic_variant	442245	.																															6.37:g.111368384_111368385delAG		Somatic		Capture	Illumina HiSeq	Phase_I	111475075	.		Frame_Shift_Del	DEL		37																																																																																				0	0.500								
PLEKHG1	57480	broad.mit.edu	37	6	151151998	151151998	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr6:151151998G>A	ENST00000358517.2	+	15	1962	c.1751G>A	c.(1750-1752)cGc>cAc	p.R584H	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.R584H			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	584							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R584H(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		ACTTCTAGTCGCCCTTGCAGC	0.512																																					p.R584H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1751A	6						.						120.0	109.0	113.0					6																	151151998		2203	4300	6503	151193691	SO:0001583	missense	57480	exon16			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.1751G>A	6.37:g.151151998G>A	ENSP00000351318:p.Arg584His	Somatic		Capture	Illumina HiSeq	Phase_I	151193691	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988511	0.74589	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.75260	-0.92;-0.92	5.55	5.55	0.83447	.	0.051471	0.85682	N	0.000000	D	0.84361	0.5455	M	0.70275	2.135	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.85467	0.1170	10	0.87932	D	0	.	19.5118	0.95144	0.0:0.0:1.0:0.0	.	391;584;584	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	H	584	ENSP00000356297:R584H;ENSP00000351318:R584H	ENSP00000351318:R584H	R	+	2	0	PLEKHG1	151193691	1.000000	0.71417	0.996000	0.52242	0.275000	0.26752	9.230000	0.95299	2.616000	0.88540	0.561000	0.74099	CGC		0.512	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
TFR2	7036	broad.mit.edu	37	7	100218641	100218641	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr7:100218641G>A	ENST00000462107.1	-	19	2532	c.2245C>T	c.(2245-2247)Cgg>Tgg	p.R749W	TFR2_ENST00000223051.3_Missense_Mutation_p.R749W|TFR2_ENST00000431692.1_3'UTR|TFR2_ENST00000544242.1_Missense_Mutation_p.R290W			Q9UP52	TFR2_HUMAN	transferrin receptor 2	749					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)	p.R749W(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	CGCAGCAGCCGCAGGTGGTCC	0.677																																					p.R749W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2245T	7						.						16.0	17.0	17.0					7																	100218641		2199	4292	6491	100056577	SO:0001583	missense	7036	exon18			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.2245C>T	7.37:g.100218641G>A	ENSP00000420525:p.Arg749Trp	Somatic		Capture	Illumina HiSeq	Phase_I	100056577	NM_003227	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	ENST00000462107.1	37	CCDS34707.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747112	0.69418	.	.	ENSG00000106327	ENST00000223051;ENST00000462107;ENST00000544242	T;T;T	0.58797	0.31;0.31;0.31	5.54	3.7	0.42460	Transferrin receptor-like, dimerisation domain (3);	0.547984	0.18913	N	0.127697	T	0.53690	0.1812	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	P	0.57679	0.825	T	0.57825	-0.7744	10	0.72032	D	0.01	-24.5827	11.6544	0.51309	0.0:0.0:0.5295:0.4705	.	749	Q9UP52	TFR2_HUMAN	W	749;749;290	ENSP00000223051:R749W;ENSP00000420525:R749W;ENSP00000443656:R290W	ENSP00000223051:R749W	R	-	1	2	TFR2	100056577	0.030000	0.19436	0.997000	0.53966	0.683000	0.39861	0.445000	0.21677	0.867000	0.35654	-0.158000	0.13435	CGG		0.677	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
CPA5	93979	broad.mit.edu	37	7	130002325	130002325	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr7:130002325G>T	ENST00000485477.1	+	7	1710	c.581G>T	c.(580-582)gGa>gTa	p.G194V	CPA5_ENST00000466363.2_Missense_Mutation_p.G194V|CPA5_ENST00000355388.3_Missense_Mutation_p.G194V|CPA5_ENST00000461828.1_Missense_Mutation_p.G194V|CPA5_ENST00000474905.1_Missense_Mutation_p.G194V|CPA5_ENST00000431780.2_Missense_Mutation_p.G194V|CPA5_ENST00000393213.3_Missense_Mutation_p.G194V			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	194						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.G194V(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					ATTGACACTGGAATTCACTCC	0.567																																					p.G194V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G581T	7						.						57.0	52.0	54.0					7																	130002325		2203	4300	6503	129789561	SO:0001583	missense	93979	exon9			AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.581G>T	7.37:g.130002325G>T	ENSP00000420237:p.Gly194Val	Somatic		Capture	Illumina HiSeq	Phase_I	129789561	NM_001127441	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Missense_Mutation	SNP	ENST00000485477.1	37	CCDS5819.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.921282	0.92249	.	.	ENSG00000158525	ENST00000355388;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000431780;ENST00000474905;ENST00000393213	T;T;T;T;T;T;T	0.05139	3.49;3.49;3.49;3.49;3.49;3.49;3.49	5.87	5.87	0.94306	Peptidase M14, carboxypeptidase A (4);	0.000000	0.64402	D	0.000004	T	0.41971	0.1182	H	0.96996	3.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.59537	-0.7436	9	.	.	.	.	19.1932	0.93675	0.0:0.0:1.0:0.0	.	194;194	G3V0G8;Q8WXQ8	.;CBPA5_HUMAN	V	194	ENSP00000347549:G194V;ENSP00000418183:G194V;ENSP00000419025:G194V;ENSP00000420237:G194V;ENSP00000393045:G194V;ENSP00000417314:G194V;ENSP00000376907:G194V	.	G	+	2	0	CPA5	129789561	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.346000	0.97056	2.777000	0.95525	0.591000	0.81541	GGA		0.567	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441	
NUP205	23165	broad.mit.edu	37	7	135304254	135304254	+	Silent	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr7:135304254C>T	ENST00000285968.6	+	29	4073	c.4047C>T	c.(4045-4047)gcC>gcT	p.A1349A		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1349					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.A1349A(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TAAGCCAGGCCGTCCTCACTG	0.517																																					p.A1349A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4047T	7						.						115.0	107.0	110.0					7																	135304254		2203	4300	6503	134954794	SO:0001819	synonymous_variant	23165	exon29			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.4047C>T	7.37:g.135304254C>T		Somatic		Capture	Illumina HiSeq	Phase_I	134954794	NM_015135	A6H8X3|Q86YC1	Silent	SNP	ENST00000285968.6	37	CCDS34759.1																																																																																				0.517	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
FERD3L	222894	broad.mit.edu	37	7	19184660	19184660	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr7:19184660C>T	ENST00000275461.3	-	1	384	c.326G>A	c.(325-327)cGc>cAc	p.R109H	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	109	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R109H(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						CTTCCTTTCGCGGATGTTGGC	0.602																																					p.R109H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G326A	7						.						90.0	75.0	80.0					7																	19184660		2203	4300	6503	19151185	SO:0001583	missense	222894	exon1			AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.326G>A	7.37:g.19184660C>T	ENSP00000275461:p.Arg109His	Somatic		Capture	Illumina HiSeq	Phase_I	19151185	NM_152898	Q495K0	Missense_Mutation	SNP	ENST00000275461.3	37	CCDS5368.1	.	.	.	.	.	.	.	.	.	.	C	34	5.339941	0.95783	.	.	ENSG00000146618	ENST00000275461	D	0.98362	-4.89	5.66	5.66	0.87406	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99426	0.9797	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98387	1.0561	10	0.87932	D	0	-3.6047	19.751	0.96268	0.0:1.0:0.0:0.0	.	109	Q96RJ6	FER3L_HUMAN	H	109	ENSP00000275461:R109H	ENSP00000275461:R109H	R	-	2	0	FERD3L	19151185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.693000	0.91896	0.650000	0.86243	CGC		0.602	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207627.1		
STK31	56164	broad.mit.edu	37	7	23768840	23768840	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr7:23768840C>A	ENST00000355870.3	+	6	574	c.455C>A	c.(454-456)tCt>tAt	p.S152Y	STK31_ENST00000405627.3_3'UTR|STK31_ENST00000428484.1_Missense_Mutation_p.S129Y|STK31_ENST00000433467.2_Missense_Mutation_p.S152Y|STK31_ENST00000354639.3_Missense_Mutation_p.S129Y	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	152						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)	p.S152Y(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CACATTCCTTCTGATCAAGAA	0.333																																					p.S129Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C386A	7						.						76.0	80.0	79.0					7																	23768840		2203	4300	6503	23735365	SO:0001583	missense	56164	exon6			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.455C>A	7.37:g.23768840C>A	ENSP00000348132:p.Ser152Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	23735365	NM_001122833	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	c	18.63	3.664982	0.67700	.	.	ENSG00000196335	ENST00000355870;ENST00000422637;ENST00000456014;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T;T;T	0.33438	1.51;1.41;1.84;1.51;1.51;1.51	5.87	5.87	0.94306	.	0.392284	0.27181	N	0.020543	T	0.31420	0.0796	L	0.29908	0.895	0.36269	D	0.855023	D;D	0.57257	0.979;0.979	P;P	0.50490	0.642;0.642	T	0.31530	-0.9940	10	0.87932	D	0	-7.9044	11.1028	0.48186	0.0:0.916:0.0:0.084	.	152;152	B4DZ06;Q9BXU1	.;STK31_HUMAN	Y	152;108;129;152;129;129	ENSP00000348132:S152Y;ENSP00000414087:S108Y;ENSP00000389340:S129Y;ENSP00000411852:S152Y;ENSP00000346660:S129Y;ENSP00000406146:S129Y	ENSP00000346660:S129Y	S	+	2	0	STK31	23735365	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.848000	0.48278	2.767000	0.95098	0.591000	0.81541	TCT		0.333	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414	
ABCA13	154664	broad.mit.edu	37	7	48428794	48428794	+	Silent	SNP	C	C	T	rs374031988		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr7:48428794C>T	ENST00000435803.1	+	37	11655	c.11631C>T	c.(11629-11631)aaC>aaT	p.N3877N		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3877	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.N3822N(1)|p.N3877N(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGGGGACAAACGGTGCCGGGA	0.493																																					p.T3823M												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C11468T	7						.	C		0,3780		0,0,1890	48.0	50.0	49.0		11631	-8.5	0.0	7		49	1,8251		0,1,4125	no	coding-synonymous	ABCA13	NM_152701.3		0,1,6015	TT,TC,CC		0.0121,0.0,0.0083		3877/5059	48428794	1,12031	1890	4126	6016	48399340	SO:0001819	synonymous_variant	154664	exon35			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11631C>T	7.37:g.48428794C>T		Somatic		Capture	Illumina HiSeq	Phase_I	48399340	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																				0.493	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
PCLO	27445	broad.mit.edu	37	7	82585683	82585683	+	Missense_Mutation	SNP	C	C	A	rs201456948		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr7:82585683C>A	ENST00000333891.9	-	5	4923	c.4586G>T	c.(4585-4587)cGa>cTa	p.R1529L	PCLO_ENST00000423517.2_Missense_Mutation_p.R1529L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.R1460L(1)|p.R1529L(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ACTAGTTCTTCGTTTTCTTTG	0.398																																					p.R1529L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4586T	7						.						133.0	119.0	124.0					7																	82585683		1901	4143	6044	82423619	SO:0001583	missense	27445	exon5			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.4586G>T	7.37:g.82585683C>A	ENSP00000334319:p.Arg1529Leu	Somatic		Capture	Illumina HiSeq	Phase_I	82423619	NM_033026		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947068	0.34377	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.20069	2.1;2.11	5.47	5.47	0.80525	.	.	.	.	.	T	0.26304	0.0642	L	0.54323	1.7	0.80722	D	1	P;P	0.36438	0.553;0.553	B;B	0.35114	0.196;0.196	T	0.04693	-1.0933	9	0.87932	D	0	.	19.3222	0.94246	0.0:1.0:0.0:0.0	.	1529;1529	Q9Y6V0-5;Q9Y6V0-6	.;.	L	1460;1529;1529	ENSP00000334319:R1529L;ENSP00000388393:R1529L	ENSP00000334319:R1529L	R	-	2	0	PCLO	82423619	1.000000	0.71417	0.853000	0.33588	0.986000	0.74619	3.751000	0.55165	2.569000	0.86673	0.655000	0.94253	CGA		0.398	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
ABCB1	5243	broad.mit.edu	37	7	87168616	87168616	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr7:87168616G>A	ENST00000265724.3	-	20	2782	c.2365C>T	c.(2365-2367)Cga>Tga	p.R789*	ABCB1_ENST00000543898.1_Nonsense_Mutation_p.R725*	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	789	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)	p.R789*(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	ACCATGTATCGGAGCCGCTTG	0.522																																					p.R789X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2365T	7						.						129.0	107.0	114.0					7																	87168616		2203	4300	6503	87006552	SO:0001587	stop_gained	5243	exon20			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2365C>T	7.37:g.87168616G>A	ENSP00000265724:p.Arg789*	Somatic		Capture	Illumina HiSeq	Phase_I	87006552	NM_000927	A8K294|B5AK60|Q12755|Q14812	Nonsense_Mutation	SNP	ENST00000265724.3	37	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	G	45	11.398292	0.99556	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.4978	15.3018	0.73958	0.0:0.0:0.8601:0.1399	.	.	.	.	X	570;789;725	.	ENSP00000265724:R789X	R	-	1	2	ABCB1	87006552	1.000000	0.71417	0.961000	0.40146	0.991000	0.79684	4.102000	0.57776	2.854000	0.98071	0.655000	0.94253	CGA		0.522	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
NOBOX	135935	broad.mit.edu	37	7	144098373	144098373	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr7:144098373C>T	ENST00000467773.1	-	4	609	c.610G>A	c.(610-612)Ggg>Agg	p.G204R	NOBOX_ENST00000223140.5_Missense_Mutation_p.G119R|NOBOX_ENST00000483238.1_Missense_Mutation_p.G204R	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	204					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.G204R(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					TTCTGCTTCCCGGGGGCTGGA	0.597																																					p.G119R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G355A	7						.						33.0	35.0	34.0					7																	144098373		1922	4125	6047	143729306	SO:0001583	missense	135935	exon2					7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.610G>A	7.37:g.144098373C>T	ENSP00000419457:p.Gly204Arg	Somatic		Capture	Illumina HiSeq	Phase_I	143729306	NM_001080413	A6NCD3|A8MZN5	Missense_Mutation	SNP	ENST00000467773.1	37		.	.	.	.	.	.	.	.	.	.	C	10.35	1.326366	0.24080	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140	D;D;D	0.95554	-3.08;-3.74;-3.08	5.01	-2.95	0.05564	.	1.374650	0.05713	U	0.596262	D	0.87489	0.6190	N	0.24115	0.695	0.09310	N	1	P	0.35684	0.515	B	0.22880	0.042	T	0.79918	-0.1600	10	0.45353	T	0.12	0.0	5.1177	0.14843	0.1583:0.2847:0.0:0.557	.	204	O60393	NOBOX_HUMAN	R	204;204;119	ENSP00000419565:G204R;ENSP00000419457:G204R;ENSP00000223140:G119R	ENSP00000223140:G119R	G	-	1	0	NOBOX	143729306	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.113000	0.10774	-0.341000	0.08376	-0.266000	0.10368	GGG		0.597	NOBOX-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000350095.1	XM_001134420	
TRPS1	7227	broad.mit.edu	37	8	116617087	116617087	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr8:116617087G>T	ENST00000220888.5	-	3	1229	c.1070C>A	c.(1069-1071)aCt>aAt	p.T357N	TRPS1_ENST00000395715.3_Missense_Mutation_p.T370N|TRPS1_ENST00000519076.1_Missense_Mutation_p.T311N|TRPS1_ENST00000520276.1_Missense_Mutation_p.T361N|TRPS1_ENST00000519674.1_Missense_Mutation_p.T357N			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	357					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T357N(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GTTTGGGTGAGTCTGAAGAAA	0.418									Langer-Giedion syndrome																												p.T370N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1109A	8						.						127.0	120.0	122.0					8																	116617087		1851	4088	5939	116686262	SO:0001583	missense	7227	exon4	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1070C>A	8.37:g.116617087G>T	ENSP00000220888:p.Thr357Asn	Somatic		Capture	Illumina HiSeq	Phase_I	116686262	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37		.	.	.	.	.	.	.	.	.	.	G	17.99	3.523913	0.64747	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	T;T;T;T;T	0.06849	3.25;3.25;3.25;3.25;3.25	5.69	5.69	0.88448	Zinc finger, C2H2-like (1);	0.057396	0.64402	D	0.000001	T	0.16514	0.0397	N	0.19112	0.55	0.49582	D	0.999804	D;D;D	0.60575	0.988;0.979;0.988	P;P;P	0.60236	0.871;0.747;0.871	T	0.01512	-1.1336	10	0.87932	D	0	.	20.181	0.98201	0.0:0.0:1.0:0.0	.	361;357;370	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	N	370;357;311;361;357	ENSP00000379065:T370N;ENSP00000220888:T357N;ENSP00000428910:T311N;ENSP00000428680:T361N;ENSP00000429174:T357N	ENSP00000220888:T357N	T	-	2	0	TRPS1	116686262	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.759000	0.74934	2.840000	0.97914	0.655000	0.94253	ACT		0.418	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
FAM135B	51059	broad.mit.edu	37	8	139209858	139209858	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr8:139209858G>A	ENST00000395297.1	-	8	894	c.724C>T	c.(724-726)Cga>Tga	p.R242*		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	242								p.R242R(2)|p.R242*(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CACAGGTCTCGGTGCCACTTG	0.577										HNSCC(54;0.14)																											p.R242X												.	.	4	Substitution - Nonsense(2)|Substitution - coding silent(2)	large_intestine(2)|lung(2)	c.C724T	8						.						89.0	105.0	99.0					8																	139209858		2159	4277	6436	139279040	SO:0001587	stop_gained	51059	exon8			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.724C>T	8.37:g.139209858G>A	ENSP00000378710:p.Arg242*	Somatic		Capture	Illumina HiSeq	Phase_I	139279040	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Nonsense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	G	39	7.326279	0.98214	.	.	ENSG00000147724	ENST00000395297	.	.	.	4.74	4.74	0.60224	.	0.170571	0.39341	N	0.001383	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.303	13.1038	0.59235	0.0:0.0:1.0:0.0	.	.	.	.	X	242	.	ENSP00000276737:R242X	R	-	1	2	FAM135B	139279040	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.019000	0.49635	2.473000	0.83533	0.563000	0.77884	CGA		0.577	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
KLF4	9314	broad.mit.edu	37	9	110249755	110249756	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr9:110249755_110249756insG	ENST00000374672.4	-	3	1392_1393	c.919_920insC	c.(919-921)ctgfs	p.L307fs		NM_004235.4	NP_004226.3	O43474	KLF4_HUMAN	Kruppel-like factor 4 (gut)	307	Pro-rich.				cellular response to cycloheximide (GO:0071409)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|epidermal cell differentiation (GO:0009913)|epidermis morphogenesis (GO:0048730)|fat cell differentiation (GO:0045444)|mesodermal cell fate determination (GO:0007500)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of muscle hyperplasia (GO:0014740)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic camera-type eye development (GO:0031077)|post-embryonic hemopoiesis (GO:0035166)|regulation of cell differentiation (GO:0045595)|response to retinoic acid (GO:0032526)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001010)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L298fs*16(1)		breast(1)|central_nervous_system(3)|endometrium(5)|large_intestine(1)|lung(3)|pancreas(1)|prostate(2)	16						CTGCCGCCCCAGGGGGAAGTCG	0.678																																					p.L307fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.920_921insC	9						.																																			109289577	SO:0001589	frameshift_variant	9314	exon3			AF022184	CCDS6770.2	9q31	2013-01-08			ENSG00000136826	ENSG00000136826		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6348	protein-coding gene	gene with protein product		602253				9422764, 16372018	Standard	NM_004235		Approved	EZF, GKLF	uc004bdg.3	O43474	OTTHUMG00000020449	ENST00000374672.4:c.920dupC	9.37:g.110249760_110249760dupG	ENSP00000363804:p.Leu307fs	Somatic		Capture	Illumina HiSeq	Phase_I	109289576	NM_004235	B2R8S4|B3KT79|L0R3I6|L0R4N5|P78338|Q5T3J8|Q5T3J9|Q8N717|Q9UNP3	Frame_Shift_Ins	INS	ENST00000374672.4	37	CCDS6770.2																																																																																				0.678	KLF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053556.2	NM_004235	
ASTN2	23245	broad.mit.edu	37	9	119188284	119188284	+	Missense_Mutation	SNP	C	C	T	rs139072409	byFrequency	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr9:119188284C>T	ENST00000313400.4	-	23	3966	c.3866G>A	c.(3865-3867)cGc>cAc	p.R1289H	ASTN2_ENST00000373996.3_Missense_Mutation_p.R1285H|ASTN2_ENST00000288520.5_Missense_Mutation_p.R390H|ASTN2_ENST00000341734.4_Missense_Mutation_p.R341H|ASTN2_ENST00000361209.2_Missense_Mutation_p.R1238H|ASTN2_ENST00000361477.3_Missense_Mutation_p.R341H			O75129	ASTN2_HUMAN	astrotactin 2	1289					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.R1238H(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TGTTTCCACGCGGCTCTGGAT	0.582																																					p.R390H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1169A	9						.	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	76.0	65.0	69.0		1022,3713,1169,1022,1022	5.9	1.0	9	dbSNP_134	69	0,8600		0,0,4300	yes	missense,missense,missense,missense,missense	ASTN2	NM_001184734.1,NM_014010.4,NM_198186.3,NM_198187.3,NM_198188.2	29,29,29,29,29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	341/376,1238/1289,390/441,341/403,341/396	119188284	2,13004	2203	4300	6503	118228105	SO:0001583	missense	23245	exon8			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3866G>A	9.37:g.119188284C>T	ENSP00000314038:p.Arg1289His	Somatic		Capture	Illumina HiSeq	Phase_I	118228105	NM_198186	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		.	.	.	.	.	.	.	.	.	.	C	19.03	3.747458	0.69533	4.54E-4	0.0	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000288520;ENST00000341734;ENST00000373986;ENST00000361209;ENST00000361477	T;T;T;T;T;T;T	0.18960	2.59;2.58;2.18;2.21;2.42;2.62;2.21	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.18299	0.0439	L	0.34521	1.04	0.80722	D	1	B;B;B;B;B;B;B	0.24651	0.006;0.006;0.108;0.066;0.082;0.006;0.014	B;B;B;B;B;B;B	0.16722	0.004;0.004;0.016;0.007;0.014;0.004;0.011	T	0.01800	-1.1271	10	0.59425	D	0.04	-14.9251	14.3526	0.66713	0.0:0.9294:0.0:0.0706	.	341;341;1238;1289;1285;341;390	B7ZKP4;B7ZKP5;O75129-2;O75129;O75129-3;O75129-6;O75129-4	.;.;.;ASTN2_HUMAN;.;.;.	H	1289;1285;390;341;1012;1238;341	ENSP00000314038:R1289H;ENSP00000363108:R1285H;ENSP00000288520:R390H;ENSP00000339925:R341H;ENSP00000363098:R1012H;ENSP00000354504:R1238H;ENSP00000355116:R341H	ENSP00000288520:R390H	R	-	2	0	ASTN2	118228105	1.000000	0.71417	0.967000	0.41034	0.872000	0.50106	5.275000	0.65575	2.761000	0.94854	0.655000	0.94253	CGC		0.582	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
TTLL11	158135	broad.mit.edu	37	9	124751927	124751927	+	Silent	SNP	C	C	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr9:124751927C>T	ENST00000373776.3	-	4	1273	c.1086G>A	c.(1084-1086)ggG>ggA	p.G362G	TTLL11_ENST00000474723.1_5'UTR|TTLL11_ENST00000321582.5_Silent_p.G362G	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	362	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)	p.G362G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						TCTGGAGGGTCCCTGCCAGGC	0.512																																					p.G362G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1086A	9						.						89.0	94.0	92.0					9																	124751927		2203	4300	6503	123791748	SO:0001819	synonymous_variant	158135	exon4			AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.1086G>A	9.37:g.124751927C>T		Somatic		Capture	Illumina HiSeq	Phase_I	123791748	NM_001139442		Silent	SNP	ENST00000373776.3	37	CCDS6834.2																																																																																				0.512	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486	
FBXO10	26267	broad.mit.edu	37	9	37521757	37521757	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr9:37521757A>T	ENST00000432825.2	-	8	2057	c.2009T>A	c.(2008-2010)cTg>cAg	p.L670Q	FBXO10_ENST00000541829.1_Missense_Mutation_p.L195Q|FBXO10_ENST00000543968.1_5'UTR|RP11-613M10.8_ENST00000544475.1_5'UTR	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	670					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.L670Q(1)		breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		CACTCCATACAGGCCATTGTA	0.577																																					p.L670Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2009A	9						.						67.0	70.0	69.0					9																	37521757		2155	4255	6410	37511757	SO:0001583	missense	26267	exon8			AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.2009T>A	9.37:g.37521757A>T	ENSP00000403802:p.Leu670Gln	Somatic		Capture	Illumina HiSeq	Phase_I	37511757	NM_012166	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Missense_Mutation	SNP	ENST00000432825.2	37	CCDS47966.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.023575	0.54683	.	.	ENSG00000147912	ENST00000432825;ENST00000541829	T	0.78595	-1.19	4.74	4.74	0.60224	Pectin lyase fold/virulence factor (1);Carbohydrate-binding/sugar hydrolysis domain (1);	0.481200	0.19345	N	0.116551	T	0.66636	0.2809	N	0.04508	-0.205	0.46586	D	0.999119	P;P;D	0.55385	0.911;0.586;0.971	P;B;P	0.52109	0.58;0.272;0.69	T	0.67787	-0.5580	10	0.29301	T	0.29	-6.6022	13.2142	0.59849	1.0:0.0:0.0:0.0	.	549;195;670	Q59F51;Q08AL4;Q9UK96	.;.;FBX10_HUMAN	Q	670;195	ENSP00000403802:L670Q	ENSP00000403802:L670Q	L	-	2	0	FBXO10	37511757	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.520000	0.73773	1.760000	0.52011	0.459000	0.35465	CTG		0.577	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3		
GCNT1	2650	broad.mit.edu	37	9	79117388	79117388	+	Missense_Mutation	SNP	G	G	A	rs369681886		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr9:79117388G>A	ENST00000376730.4	+	4	574	c.91G>A	c.(91-93)Gtt>Att	p.V31I	GCNT1_ENST00000442371.1_Missense_Mutation_p.V31I|GCNT1_ENST00000536223.1_Missense_Mutation_p.V31I|GCNT1_ENST00000444201.2_Missense_Mutation_p.V31I	NM_001097636.1|NM_001490.4	NP_001091105.1|NP_001481.2	Q02742	GCNT1_HUMAN	glucosaminyl (N-acetyl) transferase 1, core 2	31					cell adhesion molecule production (GO:0060352)|cellular protein metabolic process (GO:0044267)|glycoprotein biosynthetic process (GO:0009101)|kidney morphogenesis (GO:0060993)|leukocyte tethering or rolling (GO:0050901)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to insulin (GO:0032868)|tissue morphogenesis (GO:0048729)	extracellular space (GO:0005615)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)	p.V31I(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(11)|prostate(2)|urinary_tract(1)	30						CACCTTCTCCGTTTTAAGGAT	0.383																																					p.V31I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G91A	9						.	G	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	98.0	102.0	101.0		91,91,91,91,91	2.7	1.0	9		101	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	GCNT1	NM_001097633.1,NM_001097634.1,NM_001097635.1,NM_001097636.1,NM_001490.4	29,29,29,29,29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	31/429,31/429,31/429,31/429,31/429	79117388	2,13004	2203	4300	6503	78307208	SO:0001583	missense	2650	exon3			L41415	CCDS6653.1	9q13	2013-02-25	2010-03-16		ENSG00000187210	ENSG00000187210	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4203	protein-coding gene	gene with protein product	"""core 2 beta1,6 N-acetylglucosaminyltransferase-I"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N--acetylglucosaminyltransferase"""	600391	"""glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""	NACGT2		8449405, 9915862	Standard	NM_001490		Approved	C2GNT, NAGCT2	uc004akf.4	Q02742	OTTHUMG00000020044	ENST00000376730.4:c.91G>A	9.37:g.79117388G>A	ENSP00000365920:p.Val31Ile	Somatic		Capture	Illumina HiSeq	Phase_I	78307208	NM_001097635	Q6DJZ4	Missense_Mutation	SNP	ENST00000376730.4	37	CCDS6653.1	.	.	.	.	.	.	.	.	.	.	g	9.505	1.104232	0.20632	4.54E-4	0.0	ENSG00000187210	ENST00000536223;ENST00000442371;ENST00000444201;ENST00000376730	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	5.73	2.68	0.31781	.	0.534254	0.18500	N	0.139369	T	0.09024	0.0223	L	0.55481	1.735	0.32515	N	0.537066	B	0.15719	0.014	B	0.08055	0.003	T	0.06679	-1.0813	9	.	.	.	.	3.5773	0.07940	0.1493:0.1317:0.5835:0.1356	.	31	Q02742	GCNT1_HUMAN	I	31	ENSP00000440883:V31I;ENSP00000415454:V31I;ENSP00000390703:V31I;ENSP00000365920:V31I	.	V	+	1	0	GCNT1	78307208	0.847000	0.29606	1.000000	0.80357	0.843000	0.47879	1.349000	0.33998	1.414000	0.47017	0.650000	0.86243	GTT		0.383	GCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052725.1	NM_001097634	
EXD3	54932	broad.mit.edu	37	9	140246651	140246651	+	Missense_Mutation	SNP	G	G	T	rs577049845		TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chr9:140246651G>T	ENST00000340951.4	-	12	1235	c.1040C>A	c.(1039-1041)gCg>gAg	p.A347E	EXD3_ENST00000342129.4_Missense_Mutation_p.A27E	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0								p.A347E(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						AGCCTCAGTCGCCCTGGGAGG	0.647																																					p.A347E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1040A	9						.						107.0	122.0	117.0					9																	140246651		2172	4271	6443	139366472	SO:0001583	missense	54932	exon12				CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.1040C>A	9.37:g.140246651G>T	ENSP00000340474:p.Ala347Glu	Somatic		Capture	Illumina HiSeq	Phase_I	139366472	NM_017820	Q6P1M1|Q8IXT8	Missense_Mutation	SNP	ENST00000340951.4	37	CCDS48066.1	.	.	.	.	.	.	.	.	.	.	G	5.450	0.268092	0.10349	.	.	ENSG00000187609	ENST00000342129;ENST00000340951	T;T	0.62364	0.03;0.67	2.93	-1.39	0.08997	.	2.514840	0.01975	N	0.044360	T	0.46308	0.1386	L	0.44542	1.39	0.09310	N	1	B;P	0.39551	0.136;0.678	B;B	0.35039	0.047;0.194	T	0.20638	-1.0269	10	0.10111	T	0.7	.	3.4951	0.07651	0.3658:0.2003:0.4339:0.0	.	27;347	Q8N9H8-3;Q8N9H8	.;MUT7_HUMAN	E	27;347	ENSP00000343705:A27E;ENSP00000340474:A347E	ENSP00000340474:A347E	A	-	2	0	EXD3	139366472	0.000000	0.05858	0.000000	0.03702	0.186000	0.23388	-1.344000	0.02639	-0.502000	0.06596	0.313000	0.20887	GCG		0.647	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343182.1	NM_017820	
HTR2C	3358	broad.mit.edu	37	X	114141464	114141464	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:114141464G>A	ENST00000276198.1	+	6	1591	c.863G>A	c.(862-864)cGa>cAa	p.R288Q	HTR2C_ENST00000371951.1_Missense_Mutation_p.R288Q|HTR2C_ENST00000371950.3_3'UTR	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	288					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.R288Q(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	AACGCACGCCGAAGAAAGAAG	0.488																																					p.R288Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G863A	X						.						132.0	124.0	127.0					X																	114141464		2203	4300	6503	114047720	SO:0001583	missense	3358	exon6				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.863G>A	X.37:g.114141464G>A	ENSP00000276198:p.Arg288Gln	Somatic		Capture	Illumina HiSeq	Phase_I	114047720	NM_000868	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	37	CCDS14564.1	.	.	.	.	.	.	.	.	.	.	G	9.228	1.035167	0.19590	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	T;T	0.38887	1.11;1.11	4.51	4.51	0.55191	GPCR, rhodopsin-like superfamily (1);	0.501054	0.20231	N	0.096478	T	0.30448	0.0765	N	0.20483	0.58	0.19575	N	0.999964	D	0.53745	0.962	P	0.48524	0.58	T	0.07385	-1.0775	10	0.13470	T	0.59	.	9.1638	0.37038	0.0:0.0:0.7831:0.2169	.	288	P28335	5HT2C_HUMAN	Q	288	ENSP00000276198:R288Q;ENSP00000361019:R288Q	ENSP00000276198:R288Q	R	+	2	0	HTR2C	114047720	0.000000	0.05858	0.038000	0.18304	0.186000	0.23388	-0.306000	0.08178	2.240000	0.73641	0.468000	0.43344	CGA		0.488	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868	
XG	7499	broad.mit.edu	37	X	2729397	2729397	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:2729397G>A	ENST00000381174.5	+	9	655	c.430G>A	c.(430-432)Gtg>Atg	p.V144M	XG_ENST00000426774.1_Missense_Mutation_p.V145M|XG_ENST00000419513.2_Missense_Mutation_p.V159M|snoU13_ENST00000516039.1_RNA			P55808	XG_HUMAN	Xg blood group	144						integral component of plasma membrane (GO:0005887)		p.V144M(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGCAAAAATCGTGTCTCCCAT	0.448																																					p.V159M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G475A	X						.						59.0	54.0	55.0					X																	2729397		2203	4298	6501	2739397	SO:0001583	missense	7499	exon10			AF380356	CCDS14120.1, CCDS48073.1	Xp22.32	2014-07-19	2006-01-12		ENSG00000124343	ENSG00000124343		"""Blood group antigens"", ""Pseudoautosomal regions / PAR1"""	12806	protein-coding gene	gene with protein product		300879	"""Xg blood group (pseudoautosomal boundary-divided on the X chromosome)"""	PBDX		8054981	Standard	NM_175569		Approved		uc004cqp.3	P55808	OTTHUMG00000021075	ENST00000381174.5:c.430G>A	X.37:g.2729397G>A	ENSP00000370566:p.Val144Met	Somatic		Capture	Illumina HiSeq	Phase_I	2739397	NM_001141919	E9PCH1|Q496N8|Q496N9|Q496P0|Q71BZ5	Missense_Mutation	SNP	ENST00000381174.5	37	CCDS14120.1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.312687	0.40895	.	.	ENSG00000124343	ENST00000381174;ENST00000419513;ENST00000426774;ENST00000509484;ENST00000533923	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	3.58	3.58	0.41010	.	0.430509	0.19848	U	0.104712	T	0.48429	0.1499	L	0.57536	1.79	0.22629	N	0.998911	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.23691	-1.0181	10	0.54805	T	0.06	.	10.5451	0.45056	0.0:0.0:1.0:0.0	.	144;159	P55808;P55808-3	XG_HUMAN;.	M	144;159;145;122;6	ENSP00000370566:V144M;ENSP00000411004:V159M;ENSP00000398503:V145M;ENSP00000430005:V122M	ENSP00000370566:V144M	V	+	1	0	XG	2739397	0.345000	0.24835	0.242000	0.24170	0.335000	0.28730	2.489000	0.45285	1.588000	0.49971	0.371000	0.22339	GTG		0.448	XG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055633.2	NM_175569	
MXRA5	25878	broad.mit.edu	37	X	3240326	3240326	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:3240326G>T	ENST00000217939.6	-	5	3554	c.3400C>A	c.(3400-3402)Caa>Aaa	p.Q1134K		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1134						extracellular vesicular exosome (GO:0070062)		p.Q1134K(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCAACTTTTTGCCTTGGTGTT	0.512																																					p.Q1134K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3400A	X						.						105.0	89.0	95.0					X																	3240326		2203	4300	6503	3250326	SO:0001583	missense	25878	exon5			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.3400C>A	X.37:g.3240326G>T	ENSP00000217939:p.Gln1134Lys	Somatic		Capture	Illumina HiSeq	Phase_I	3250326	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	g	2.038	-0.420668	0.04734	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.61510	0.1	3.61	-2.42	0.06542	.	2.071420	0.02870	N	0.131420	T	0.38295	0.1035	L	0.27053	0.805	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.05550	-1.0878	10	0.22109	T	0.4	.	1.8698	0.03206	0.1048:0.2557:0.2404:0.3991	.	1134	Q9NR99	MXRA5_HUMAN	K	1134	ENSP00000217939:Q1134K	ENSP00000217939:Q1134K	Q	-	1	0	MXRA5	3250326	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.737000	0.26144	-0.311000	0.08754	0.519000	0.50382	CAA		0.512	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
VCX	26609	broad.mit.edu	37	X	7811919	7811919	+	Silent	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:7811919G>A	ENST00000381059.3	+	3	702	c.483G>A	c.(481-483)gaG>gaA	p.E161E	VCX_ENST00000341408.4_Silent_p.E141E	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	161	10 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.|Glu-rich.				chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.E161E(1)		NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				GCGAGGTGGAGGAACCACTGA	0.592																																					p.E161E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G483A	X						.						76.0	88.0	84.0					X																	7811919		1913	3698	5611	7771919	SO:0001819	synonymous_variant	26609	exon3			AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.483G>A	X.37:g.7811919G>A		Somatic		Capture	Illumina HiSeq	Phase_I	7771919	NM_013452	A0JNS5|Q4V774|Q9P0H3	Silent	SNP	ENST00000381059.3	37	CCDS14128.1																																																																																				0.592	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071474.1	NM_013452	
SCML2	10389	broad.mit.edu	37	X	18338494	18338494	+	Silent	SNP	T	T	C			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:18338494T>C	ENST00000251900.4	-	6	603	c.444A>G	c.(442-444)acA>acG	p.T148T		NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	148					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T148T(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					ACCCATTTAGTGTCTTTAAGA	0.343																																					p.T148T	Esophageal Squamous(100;1252 1965 19021 35517)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A444G	X						.						97.0	85.0	89.0					X																	18338494		2203	4300	6503	18248415	SO:0001819	synonymous_variant	10389	exon6			Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.444A>G	X.37:g.18338494T>C		Somatic		Capture	Illumina HiSeq	Phase_I	18248415	NM_006089	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Silent	SNP	ENST00000251900.4	37	CCDS14185.1																																																																																				0.343	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089	
MAGEB4	4115	broad.mit.edu	37	X	30260296	30260296	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:30260296G>A	ENST00000378982.2	+	1	240	c.44G>A	c.(43-45)cGc>cAc	p.R15H	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	15								p.R15H(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						CGTGAGAAACGCCAGCGGACC	0.567																																					p.R15H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G44A	X						.						100.0	80.0	87.0					X																	30260296		2202	4300	6502	30170217	SO:0001583	missense	4115	exon1				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.44G>A	X.37:g.30260296G>A	ENSP00000368266:p.Arg15His	Somatic		Capture	Illumina HiSeq	Phase_I	30170217	NM_002367	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	37	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703500	0.48412	.	.	ENSG00000120289	ENST00000378982	T	0.06608	3.28	3.22	0.428	0.16499	Melanoma associated antigen, MAGE, N-terminal (1);	1.576910	0.05036	U	0.475533	T	0.22205	0.0535	M	0.87547	2.89	0.09310	N	1	D	0.60575	0.988	P	0.57846	0.828	T	0.08597	-1.0714	10	0.54805	T	0.06	.	5.1586	0.15048	0.4466:0.0:0.5534:0.0	.	15	O15481	MAGB4_HUMAN	H	15	ENSP00000368266:R15H	ENSP00000368266:R15H	R	+	2	0	MAGEB4	30170217	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.011000	0.13264	-0.029000	0.13827	0.544000	0.68410	CGC		0.567	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367	
FUNDC1	139341	broad.mit.edu	37	X	44386551	44386551	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:44386551T>C	ENST00000378045.4	-	4	490	c.322A>G	c.(322-324)Aaa>Gaa	p.K108E	FUNDC1_ENST00000483115.1_5'UTR	NM_173794.3	NP_776155.1	Q8IVP5	FUND1_HUMAN	FUN14 domain containing 1	108					mitochondrion degradation (GO:0000422)|response to hypoxia (GO:0001666)	integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane (GO:0005741)		p.K108E(1)		breast(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	6						CTTTTTGCTTTATTTACATCT	0.289																																					p.K108E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A322G	X						.						133.0	107.0	115.0					X																	44386551		2203	4299	6502	44271495	SO:0001583	missense	139341	exon4			BC042813	CCDS14263.1	Xp11.4	2005-09-22			ENSG00000069509	ENSG00000069509			28746	protein-coding gene	gene with protein product		300871				12477932	Standard	NM_173794		Approved	MGC51029	uc004dgc.3	Q8IVP5	OTTHUMG00000021399	ENST00000378045.4:c.322A>G	X.37:g.44386551T>C	ENSP00000367284:p.Lys108Glu	Somatic		Capture	Illumina HiSeq	Phase_I	44271495	NM_173794		Missense_Mutation	SNP	ENST00000378045.4	37	CCDS14263.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.950029	0.92660	.	.	ENSG00000069509	ENST00000378045	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.78868	0.4351	M	0.89715	3.055	0.80722	D	1	D	0.56746	0.977	P	0.55011	0.766	T	0.82839	-0.0259	9	0.51188	T	0.08	-24.6283	15.0457	0.71825	0.0:0.0:0.0:1.0	.	108	Q8IVP5	FUND1_HUMAN	E	108	.	ENSP00000367284:K108E	K	-	1	0	FUNDC1	44271495	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.551000	0.82182	1.935000	0.56089	0.481000	0.45027	AAA		0.289	FUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056320.1	NM_173794	
ZDHHC15	158866	broad.mit.edu	37	X	74670730	74670730	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:74670730G>A	ENST00000373367.3	-	4	516	c.286C>T	c.(286-288)Cgc>Tgc	p.R96C	ZDHHC15_ENST00000373361.3_Missense_Mutation_p.R96C|ZDHHC15_ENST00000541184.1_Missense_Mutation_p.R87C	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	96					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.R96C(1)		central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						TTTTCATAGCGCTCCTTGTCT	0.398																																					p.R87C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C259T	X						.						85.0	70.0	75.0					X																	74670730		2203	4299	6502	74587455	SO:0001583	missense	158866	exon3			AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.286C>T	X.37:g.74670730G>A	ENSP00000362465:p.Arg96Cys	Somatic		Capture	Illumina HiSeq	Phase_I	74587455	NM_001146256	B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	ENST00000373367.3	37	CCDS14430.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988773	0.74589	.	.	ENSG00000102383	ENST00000373367;ENST00000541184;ENST00000373361	T;T;T	0.81247	0.78;1.0;-1.47	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.86912	0.6047	L	0.55017	1.72	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.959;0.978	D	0.87793	0.2620	10	0.59425	D	0.04	-1.0548	14.6079	0.68493	0.0:0.0:1.0:0.0	.	87;87;96	Q96MV8-2;B3KVG7;Q96MV8	.;.;ZDH15_HUMAN	C	96;87;96	ENSP00000362465:R96C;ENSP00000445420:R87C;ENSP00000362459:R96C	ENSP00000362459:R96C	R	-	1	0	ZDHHC15	74587455	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	6.031000	0.70911	2.118000	0.64928	0.544000	0.68410	CGC		0.398	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057283.1	NM_144969	
DACH2	117154	broad.mit.edu	37	X	86069820	86069820	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:86069820G>T	ENST00000373125.4	+	10	1667	c.1667G>T	c.(1666-1668)gGc>gTc	p.G556V	DACH2_ENST00000510272.1_Missense_Mutation_p.G337V|DACH2_ENST00000508860.1_Missense_Mutation_p.G389V|DACH2_ENST00000373131.1_Missense_Mutation_p.G543V	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	556					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G556V(9)|p.G543V(9)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						AGTGACAGTGGCCTGAGGATG	0.398																																					p.G556V												.	.	18	Substitution - Missense(18)	endometrium(8)|kidney(8)|lung(2)	c.G1667T	X						.						57.0	48.0	51.0					X																	86069820		2203	4300	6503	85956476	SO:0001583	missense	117154	exon10			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1667G>T	X.37:g.86069820G>T	ENSP00000362217:p.Gly556Val	None		Capture	Illumina HiSeq	Phase_I	85956476	NM_053281	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.667616	0.29604	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297;ENST00000484479	D;D	0.82433	-1.57;-1.61	4.76	4.76	0.60689	.	0.153373	0.30410	N	0.009683	D	0.84451	0.5475	L	0.34521	1.04	0.80722	D	1	B;B;D;P	0.61697	0.172;0.085;0.99;0.793	B;B;P;B	0.60068	0.038;0.054;0.868;0.254	T	0.82857	-0.0250	10	0.27082	T	0.32	.	17.002	0.86383	0.0:0.0:1.0:0.0	.	422;556;543;556	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	V	556;543;556;389;337;389;221	ENSP00000362223:G543V;ENSP00000362217:G556V	ENSP00000345134:G556V	G	+	2	0	DACH2	85956476	0.999000	0.42202	0.958000	0.39756	0.913000	0.54294	3.863000	0.56016	1.932000	0.55993	0.415000	0.27848	GGC		0.398	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
TGIF2LX	90316	broad.mit.edu	37	X	89177766	89177766	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:89177766G>T	ENST00000561129.2	+	1	812	c.682G>T	c.(682-684)Gct>Tct	p.A228S	TGIF2LX_ENST00000283891.5_Missense_Mutation_p.A228S			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A228S(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						AGTACAAAGGGCTGCCGAGCT	0.507																																					p.A228S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G682T	X						.						44.0	47.0	46.0					X																	89177766		2198	4288	6486	89064422	SO:0001583	missense	90316	exon2			AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.682G>T	X.37:g.89177766G>T	ENSP00000453704:p.Ala228Ser	Somatic		Capture	Illumina HiSeq	Phase_I	89064422	NM_138960	Q5JRM9|Q8TD48	Missense_Mutation	SNP	ENST00000561129.2	37	CCDS14459.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415737	0.25552	.	.	ENSG00000153779	ENST00000283891	T	0.79845	-1.31	3.11	2.25	0.28309	.	0.648897	0.11981	N	0.510746	D	0.87966	0.6311	M	0.83012	2.62	0.09310	N	0.999999	D	0.76494	0.999	D	0.78314	0.991	T	0.74867	-0.3518	9	.	.	.	-15.3346	5.5093	0.16872	0.1584:0.0:0.8416:0.0	.	228	Q8IUE1	TF2LX_HUMAN	S	228	ENSP00000355119:A228S	.	A	+	1	0	TGIF2LX	89064422	1.000000	0.71417	0.033000	0.17914	0.026000	0.11368	4.434000	0.59935	0.724000	0.32296	0.415000	0.27848	GCT		0.507	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	NM_138960	
AFF2	2334	broad.mit.edu	37	X	148039912	148039912	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02Y-01A-43W-A096-10	TCGA-AA-A02Y-10A-01W-A096-10	g.chrX:148039912G>A	ENST00000370460.2	+	12	3093	c.2614G>A	c.(2614-2616)Gag>Aag	p.E872K	AFF2_ENST00000342251.3_Missense_Mutation_p.E839K|AFF2_ENST00000286437.5_Missense_Mutation_p.E513K|AFF2_ENST00000370457.5_Missense_Mutation_p.E839K	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	872					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.E872K(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GCAGCGCCTGGAGGAGGCCAC	0.517																																					p.E872K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2614A	X						.						207.0	189.0	195.0					X																	148039912		2203	4300	6503	147847612	SO:0001583	missense	2334	exon12			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2614G>A	X.37:g.148039912G>A	ENSP00000359489:p.Glu872Lys	Somatic		Capture	Illumina HiSeq	Phase_I	147847612	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246292	0.80024	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49	5.81	5.81	0.92471	.	0.498368	0.21476	N	0.073916	T	0.77751	0.4177	L	0.43152	1.355	0.53688	D	0.999976	D;D;D;D;D;D	0.71674	0.998;0.997;0.997;0.997;0.997;0.998	D;D;D;D;D;D	0.67725	0.953;0.921;0.921;0.921;0.921;0.953	T	0.71517	-0.4569	10	0.15499	T	0.54	.	17.8702	0.88808	0.0:0.0:1.0:0.0	.	513;837;839;833;862;872	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	K	872;839;839;513	ENSP00000359489:E872K;ENSP00000359486:E839K;ENSP00000345459:E839K;ENSP00000286437:E513K	ENSP00000286437:E513K	E	+	1	0	AFF2	147847612	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.331000	0.79192	2.440000	0.82611	0.600000	0.82982	GAG		0.517	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
