#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABI1	10006	broad.mit.edu	37	10	27112143	27112143	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr10:27112143T>C	ENST00000376142.2	-	2	280	c.209A>G	c.(208-210)aAc>aGc	p.N70S	ABI1_ENST00000376139.2_Missense_Mutation_p.N70S|ABI1_ENST00000359188.4_Missense_Mutation_p.N70S|ABI1_ENST00000376160.1_Missense_Mutation_p.N70S|ABI1_ENST00000355394.4_Missense_Mutation_p.N70S|ABI1_ENST00000376170.4_Missense_Mutation_p.N70S|ABI1_ENST00000376137.4_Missense_Mutation_p.N70S|ABI1_ENST00000376134.3_Missense_Mutation_p.N70S|ABI1_ENST00000473481.1_5'UTR|ABI1_ENST00000536334.1_Missense_Mutation_p.N70S|ABI1_ENST00000490841.2_Missense_Mutation_p.N70S|ABI1_ENST00000376140.3_Missense_Mutation_p.N70S|ABI1_ENST00000376138.3_Missense_Mutation_p.N70S|ABI1_ENST00000346832.5_Missense_Mutation_p.N87S|ABI1_ENST00000376166.1_Missense_Mutation_p.N70S	NM_005470.3	NP_005461.2	Q8IZP0	ABI1_HUMAN	abl-interactor 1	70	Required for binding to WASF1. {ECO:0000250}.|t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium morphogenesis (GO:0072673)|megakaryocyte development (GO:0035855)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|SCAR complex (GO:0031209)	cytoskeletal protein binding (GO:0008092)|protein complex binding (GO:0032403)|protein tyrosine kinase activator activity (GO:0030296)	p.N70S(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAGTACATTGTTGGCCAATGC	0.398																																					p.N70S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A209G	10						.						136.0	125.0	129.0					10																	27112143		2203	4300	6503	27152149	SO:0001583	missense	10006	exon2			U87166	CCDS7150.1, CCDS31169.1, CCDS31170.1, CCDS31171.1, CCDS53497.1, CCDS53498.1, CCDS53499.1, CCDS53500.1, CCDS53501.1, CCDS73077.1, CCDS73078.1	10p12.1	2009-05-29	2004-03-17	2004-03-19	ENSG00000136754	ENSG00000136754			11320	protein-coding gene	gene with protein product		603050	"""spectrin SH3 domain binding protein 1"""	SSH3BP1		9593709, 9010225	Standard	NM_005470		Approved	E3B1, ABI-1	uc001isx.3	Q8IZP0	OTTHUMG00000017848	ENST00000376142.2:c.209A>G	10.37:g.27112143T>C	ENSP00000365312:p.Asn70Ser	Somatic		Capture	Illumina HiSeq	Phase_I	27152149	NM_001178124	A9Z1Y6|B3KX62|B4DQ58|H7BXI6|O15147|O76049|O95060|Q5T2R3|Q5T2R4|Q5T2R6|Q5T2R7|Q5T2R9|Q5W070|Q5W072|Q8TB63|Q96S81|Q9NXZ9|Q9NYB8	Missense_Mutation	SNP	ENST00000376142.2	37	CCDS7150.1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.366187	0.61513	.	.	ENSG00000136754	ENST00000376138;ENST00000376170;ENST00000376166;ENST00000376160;ENST00000376142;ENST00000359188;ENST00000376139;ENST00000355394;ENST00000346832;ENST00000376134;ENST00000376137;ENST00000536334;ENST00000490841;ENST00000376140	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.92249	-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0	5.62	5.62	0.85841	Target SNARE coiled-coil domain (1);	0.000000	0.85682	D	0.000000	D	0.87939	0.6304	N	0.01668	-0.77	0.80722	D	1	P;B;D;B;D;D;D;D;B;D;P;B	0.71674	0.948;0.004;0.967;0.033;0.992;0.995;0.997;0.995;0.275;0.998;0.947;0.095	P;B;D;B;P;D;D;D;B;P;P;B	0.76575	0.792;0.005;0.915;0.056;0.717;0.93;0.988;0.946;0.091;0.853;0.676;0.062	D	0.86838	0.2015	10	0.13108	T	0.6	-11.6624	16.1172	0.81314	0.0:0.0:0.0:1.0	.	70;70;70;70;70;95;70;87;70;70;70;70	B6VEX4;B6VEX3;B4DQ58;Q8IZP0-10;Q5T2R9;Q59G41;Q8IZP0-6;B3KX62;Q8IZP0-3;Q8IZP0-5;Q8IZP0-9;Q8IZP0	.;.;.;.;.;.;.;.;.;.;.;ABI1_HUMAN	S	70;70;70;70;70;70;70;70;87;70;70;70;70;70	ENSP00000365308:N70S;ENSP00000365340:N70S;ENSP00000365336:N70S;ENSP00000365330:N70S;ENSP00000365312:N70S;ENSP00000352114:N70S;ENSP00000365309:N70S;ENSP00000347555:N70S;ENSP00000279599:N87S;ENSP00000365304:N70S;ENSP00000365307:N70S;ENSP00000439646:N70S;ENSP00000440101:N70S;ENSP00000365310:N70S	ENSP00000279599:N87S	N	-	2	0	ABI1	27152149	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.924000	0.87555	2.266000	0.75297	0.533000	0.62120	AAC		0.398	ABI1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047287.1	NM_005470	
POLR3A	11128	broad.mit.edu	37	10	79785937	79785937	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr10:79785937G>A	ENST00000372371.3	-	2	232	c.95C>T	c.(94-96)gCg>gTg	p.A32V		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	32					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)	p.A32V(1)		breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TTGGATGTGCGCCTGCTGGCG	0.493																																					p.A32V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C95T	10						.						92.0	82.0	85.0					10																	79785937		2203	4300	6503	79455943	SO:0001583	missense	11128	exon2			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.95C>T	10.37:g.79785937G>A	ENSP00000361446:p.Ala32Val	Somatic		Capture	Illumina HiSeq	Phase_I	79455943	NM_007055	Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449112	0.84101	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.26223	1.75	5.1	5.1	0.69264	RNA polymerase Rpb1, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.56187	0.1968	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.62310	-0.6881	9	.	.	.	-19.4098	18.5131	0.90925	0.0:0.0:1.0:0.0	.	32	O14802	RPC1_HUMAN	V	32	ENSP00000361446:A32V	.	A	-	2	0	POLR3A	79455943	1.000000	0.71417	0.940000	0.37924	0.420000	0.31355	9.416000	0.97383	2.365000	0.80145	0.455000	0.32223	GCG		0.493	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055	
BTAF1	9044	broad.mit.edu	37	10	93711196	93711196	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr10:93711196G>A	ENST00000265990.6	+	5	745	c.437G>A	c.(436-438)cGa>cAa	p.R146Q		NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	146					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R146Q(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				GCACGCCAACGAAAATTATTA	0.363																																					p.R146Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G437A	10						.						93.0	91.0	92.0					10																	93711196		2203	4300	6503	93701176	SO:0001583	missense	9044	exon5			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.437G>A	10.37:g.93711196G>A	ENSP00000265990:p.Arg146Gln	Somatic		Capture	Illumina HiSeq	Phase_I	93701176	NM_003972	B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.807631	0.70797	.	.	ENSG00000095564	ENST00000265990	D	0.91237	-2.81	4.97	4.97	0.65823	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85133	0.5627	L	0.39085	1.19	0.80722	D	1	D	0.55172	0.97	B	0.36378	0.223	D	0.86627	0.1883	10	0.44086	T	0.13	-29.0103	18.5949	0.91226	0.0:0.0:1.0:0.0	.	146	O14981	BTAF1_HUMAN	Q	146	ENSP00000265990:R146Q	ENSP00000265990:R146Q	R	+	2	0	BTAF1	93701176	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	9.420000	0.97426	2.478000	0.83669	0.467000	0.42956	CGA		0.363	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
KIF11	3832	broad.mit.edu	37	10	94372864	94372864	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr10:94372864G>A	ENST00000260731.3	+	7	856	c.766G>A	c.(766-768)Gtt>Att	p.V256I		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	256	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)	p.V256I(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGAAGAGCTTGTTAAAATCGG	0.358																																					p.V256I	Colon(47;212 1003 2764 4062 8431)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G766A	10						.						116.0	104.0	108.0					10																	94372864		2203	4300	6503	94362844	SO:0001583	missense	3832	exon7			X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.766G>A	10.37:g.94372864G>A	ENSP00000260731:p.Val256Ile	Somatic		Capture	Illumina HiSeq	Phase_I	94362844	NM_004523	A0AV49|B2RMV3|Q15716|Q5VWX0	Missense_Mutation	SNP	ENST00000260731.3	37	CCDS7422.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.278506	0.80692	.	.	ENSG00000138160	ENST00000260731	D	0.85861	-2.04	5.66	5.66	0.87406	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	T	0.77398	0.4124	N	0.04705	-0.18	0.80722	D	1	D	0.54047	0.964	P	0.51079	0.658	T	0.74490	-0.3648	10	0.06365	T	0.9	.	19.7439	0.96243	0.0:0.0:1.0:0.0	.	256	P52732	KIF11_HUMAN	I	256	ENSP00000260731:V256I	ENSP00000260731:V256I	V	+	1	0	KIF11	94362844	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.599000	0.98280	2.654000	0.90174	0.655000	0.94253	GTT		0.358	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049401.1	NM_004523	
ACTN3	89	broad.mit.edu	37	11	66325583	66325583	+	lincRNA	SNP	G	G	A	rs555878172		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr11:66325583G>A	ENST00000504911.1	-	0	1160				ACTN3_ENST00000502692.1_RNA|ACTN3_ENST00000513398.1_RNA																							CGCCTGCAGCGACTCCAGCAC	0.647													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16583	0.0		0.0	False		,,,				2504	0.0				p.R405Q												.	.	0			c.G1214A	11						.																																			66082159			89	exon11																															11.37:g.66325583G>A		Somatic		Capture	Illumina HiSeq	Phase_I	66082159	NM_001104		Missense_Mutation	SNP	ENST00000504911.1	37																																																																																					0.647	CTD-3074O7.2-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000362463.1		
TECTA	7007	broad.mit.edu	37	11	120998726	120998726	+	Silent	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr11:120998726C>T	ENST00000392793.1	+	9	2311	c.2040C>T	c.(2038-2040)ggC>ggT	p.G680G	TECTA_ENST00000264037.2_Silent_p.G680G			O75443	TECTA_HUMAN	tectorin alpha	680					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.G680G(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GCGAGGAGGGCGGGGACGTCT	0.652																																					p.G680G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2040T	11						.						76.0	64.0	68.0					11																	120998726		2203	4299	6502	120503936	SO:0001819	synonymous_variant	7007	exon8			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2040C>T	11.37:g.120998726C>T		Somatic		Capture	Illumina HiSeq	Phase_I	120503936	NM_005422		Silent	SNP	ENST00000392793.1	37	CCDS8434.1																																																																																				0.652	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
WNK1	65125	broad.mit.edu	37	12	936418	936418	+	Silent	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr12:936418G>A	ENST00000315939.6	+	3	1786	c.1143G>A	c.(1141-1143)aaG>aaA	p.K381K	WNK1_ENST00000530271.2_Silent_p.K381K|WNK1_ENST00000537687.1_Silent_p.K381K|WNK1_ENST00000447667.2_Silent_p.K381K|WNK1_ENST00000535572.1_Silent_p.K381K	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	381	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.K381K(2)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CTTTTGCCAAGAGTGTGATAG	0.458																																					p.K381K	Colon(19;451 567 6672 12618 28860)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1143A	12						.						96.0	102.0	100.0					12																	936418		2203	4300	6503	806679	SO:0001819	synonymous_variant	65125	exon3			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1143G>A	12.37:g.936418G>A		Somatic		Capture	Illumina HiSeq	Phase_I	806679	NM_001184985	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	ENST00000315939.6	37	CCDS8506.1																																																																																				0.458	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12C	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1 	.	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34T	12	GRCh37	CM076251	KRAS	M	rs121913530	.						93.0	83.0	86.0					12																	25398285		2203	4300	6503	25289552	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	Somatic		Capture	Illumina HiSeq	Phase_I	25289552	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
OR6C6	283365	broad.mit.edu	37	12	55688653	55688653	+	Missense_Mutation	SNP	C	C	T	rs201844969	byFrequency	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr12:55688653C>T	ENST00000358433.2	-	1	363	c.364G>A	c.(364-366)Gtt>Att	p.V122I		NM_001005493.1	NP_001005493.1	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C, member 6	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V122I(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						CAGATGGCAACGTAGCGGTCA	0.388																																					p.V122I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G364A	12						.	C	ILE/VAL	0,4406		0,0,2203	66.0	62.0	63.0		364	1.4	0.9	12		63	1,8599		0,1,4299	no	missense	OR6C6	NM_001005493.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	122/315	55688653	1,13005	2203	4300	6503	53974920	SO:0001583	missense	283365	exon1				CCDS31817.1	12q13.13	2012-08-09			ENSG00000188324	ENSG00000188324		"""GPCR / Class A : Olfactory receptors"""	31293	protein-coding gene	gene with protein product							Standard	NM_001005493		Approved		uc010sph.2	A6NF89	OTTHUMG00000168101	ENST00000358433.2:c.364G>A	12.37:g.55688653C>T	ENSP00000351211:p.Val122Ile	Somatic		Capture	Illumina HiSeq	Phase_I	53974920	NM_001005493		Missense_Mutation	SNP	ENST00000358433.2	37	CCDS31817.1	.	.	.	.	.	.	.	.	.	.	-	7.575	0.667578	0.14710	0.0	1.16E-4	ENSG00000188324	ENST00000358433	T	0.01347	4.99	4.24	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000411	T	0.02418	0.0074	M	0.78456	2.415	0.21020	N	0.999803	B	0.15473	0.013	B	0.13407	0.009	T	0.33369	-0.9871	10	0.49607	T	0.09	.	8.078	0.30729	0.0:0.707:0.1288:0.1642	.	122	A6NF89	OR6C6_HUMAN	I	122	ENSP00000351211:V122I	ENSP00000351211:V122I	V	-	1	0	OR6C6	53974920	0.018000	0.18449	0.880000	0.34516	0.271000	0.26615	0.269000	0.18589	0.180000	0.19960	-1.256000	0.01477	GTT		0.388	OR6C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398151.1		
OR10P1	121130	broad.mit.edu	37	12	56031495	56031495	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr12:56031495G>A	ENST00000309675.2	+	1	852	c.820G>A	c.(820-822)Gtc>Atc	p.V274I	RP11-644F5.16_ENST00000556606.1_RNA	NM_206899.1	NP_996782.1	Q8NGE3	O10P1_HUMAN	olfactory receptor, family 10, subfamily P, member 1	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V274I(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26						CACAGACCGCGTCCTCAGTCT	0.572																																					p.V274I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G820A	12						.						87.0	80.0	82.0					12																	56031495		2203	4300	6503	54317762	SO:0001583	missense	121130	exon1			BK004259	CCDS31828.1	12q13.13	2012-08-09		2004-03-10		ENSG00000175398		"""GPCR / Class A : Olfactory receptors"""	15378	protein-coding gene	gene with protein product				OR10P1P, OR10P2P, OR10P3P			Standard	NM_206899		Approved	OST701	uc010spq.2	Q8NGE3	OTTHUMG00000169961	ENST00000309675.2:c.820G>A	12.37:g.56031495G>A	ENSP00000308082:p.Val274Ile	Somatic		Capture	Illumina HiSeq	Phase_I	54317762	NM_206899	B9EGY4	Missense_Mutation	SNP	ENST00000309675.2	37	CCDS31828.1	.	.	.	.	.	.	.	.	.	.	G	1.615	-0.522989	0.04141	.	.	ENSG00000175398	ENST00000309675	T	0.00253	8.43	4.31	-3.55	0.04639	GPCR, rhodopsin-like superfamily (1);	0.357623	0.20565	N	0.089835	T	0.00073	0.0002	N	0.04880	-0.145	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.32428	-0.9907	10	0.33940	T	0.23	.	2.0614	0.03593	0.302:0.1539:0.3943:0.1499	.	274	Q8NGE3	O10P1_HUMAN	I	274	ENSP00000308082:V274I	ENSP00000308082:V274I	V	+	1	0	OR10P1	54317762	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-2.568000	0.00915	-0.634000	0.05538	-1.683000	0.00735	GTC		0.572	OR10P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406680.1		
RIMBP2	23504	broad.mit.edu	37	12	130927140	130927140	+	Missense_Mutation	SNP	C	C	T	rs200895310		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr12:130927140C>T	ENST00000261655.4	-	8	869	c.706G>A	c.(706-708)Gag>Aag	p.E236K	RIMBP2_ENST00000535703.1_Missense_Mutation_p.E144K|RIMBP2_ENST00000536002.1_Missense_Mutation_p.E144K	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	236					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.E236K(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		AACCGCGACTCGTTGTCCTGC	0.587																																					p.E236K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G706A	12						.						125.0	125.0	125.0					12																	130927140		2203	4300	6503	129493093	SO:0001583	missense	23504	exon8			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.706G>A	12.37:g.130927140C>T	ENSP00000261655:p.Glu236Lys	Somatic		Capture	Illumina HiSeq	Phase_I	129493093	NM_015347	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253270	0.80135	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.30714	1.52;1.52;1.52	4.53	4.53	0.55603	Src homology-3 domain (1);	0.054556	0.64402	D	0.000001	T	0.56352	0.1979	M	0.76574	2.34	0.50039	D	0.999842	D;D	0.89917	0.997;1.0	P;D	0.76575	0.899;0.988	T	0.60611	-0.7229	10	0.49607	T	0.09	-36.71	17.2843	0.87137	0.0:1.0:0.0:0.0	.	144;236	O15034-2;O15034	.;RIMB2_HUMAN	K	236;144;144;144	ENSP00000261655:E236K;ENSP00000440347:E144K;ENSP00000439159:E144K	ENSP00000261655:E236K	E	-	1	0	RIMBP2	129493093	1.000000	0.71417	0.793000	0.32043	0.692000	0.40212	5.959000	0.70339	2.053000	0.61076	0.561000	0.74099	GAG		0.587	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
PCDH17	27253	broad.mit.edu	37	13	58206750	58206750	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr13:58206750T>C	ENST00000377918.3	+	1	96	c.70T>C	c.(70-72)Tcc>Ccc	p.S24P		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	24	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S24P(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CCTCAACTACTCCGTGCCGGA	0.627																																					p.S24P	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T70C	13						.						44.0	41.0	42.0					13																	58206750		2203	4300	6503	57104751	SO:0001583	missense	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.70T>C	13.37:g.58206750T>C	ENSP00000367151:p.Ser24Pro	Somatic		Capture	Illumina HiSeq	Phase_I	57104751	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	T	17.96	3.516005	0.64634	.	.	ENSG00000118946	ENST00000377918	T	0.37235	1.21	5.55	5.55	0.83447	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.109676	0.64402	D	0.000004	T	0.68091	0.2963	M	0.91300	3.195	0.53005	D	0.999965	D;D	0.76494	0.999;0.999	D;D	0.81914	0.979;0.995	T	0.75883	-0.3160	9	.	.	.	.	15.8615	0.79026	0.0:0.0:0.0:1.0	.	24;24	O14917-2;O14917	.;PCD17_HUMAN	P	24	ENSP00000367151:S24P	.	S	+	1	0	PCDH17	57104751	1.000000	0.71417	0.988000	0.46212	0.993000	0.82548	6.116000	0.71571	2.333000	0.79357	0.533000	0.62120	TCC		0.627	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
SLITRK1	114798	broad.mit.edu	37	13	84454596	84454596	+	Silent	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr13:84454596G>A	ENST00000377084.2	-	1	1932	c.1047C>T	c.(1045-1047)caC>caT	p.H349H		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	349	LRRNT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.H349H(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		ACCCTGGGATGTGGTCGCAGC	0.532																																					p.H349H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1047T	13						.						72.0	69.0	70.0					13																	84454596		2203	4300	6503	83352597	SO:0001819	synonymous_variant	114798	exon1			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1047C>T	13.37:g.84454596G>A		Somatic		Capture	Illumina HiSeq	Phase_I	83352597	NM_052910	Q5U5I6|Q96SF9	Silent	SNP	ENST00000377084.2	37	CCDS9464.1																																																																																				0.532	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
SPATA7	55812	broad.mit.edu	37	14	88899545	88899545	+	Silent	SNP	A	A	G			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr14:88899545A>G	ENST00000393545.4	+	10	1438	c.1149A>G	c.(1147-1149)ttA>ttG	p.L383L	SPATA7_ENST00000045347.7_Silent_p.L383L|SPATA7_ENST00000356583.5_Silent_p.L351L|SPATA7_ENST00000556553.1_Silent_p.L351L	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	383					response to stimulus (GO:0050896)|visual perception (GO:0007601)			p.L383L(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						AACTTGGTTTATTTTCAAACA	0.249																																					p.L351L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1053G	14						.						69.0	70.0	70.0					14																	88899545		2198	4266	6464	87969298	SO:0001819	synonymous_variant	55812	exon9			AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.1149A>G	14.37:g.88899545A>G		Somatic		Capture	Illumina HiSeq	Phase_I	87969298	NM_001040428	Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Silent	SNP	ENST00000393545.4	37	CCDS9883.1	.	.	.	.	.	.	.	.	.	.	A	8.456	0.854124	0.17106	.	.	ENSG00000042317	ENST00000556406	.	.	.	5.08	-0.129	0.13502	.	.	.	.	.	T	0.50854	0.1640	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35375	-0.9791	4	.	.	.	-3.056	5.8	0.18408	0.5491:0.1453:0.3056:0.0	.	.	.	.	C	41	.	.	Y	+	2	0	SPATA7	87969298	0.998000	0.40836	0.996000	0.52242	0.967000	0.64934	0.457000	0.21875	-0.193000	0.10415	-0.462000	0.05337	TAT		0.249	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1		
TRPM1	4308	broad.mit.edu	37	15	31319180	31319180	+	Missense_Mutation	SNP	C	C	T	rs200369359		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr15:31319180C>T	ENST00000256552.6	-	26	3581	c.3434G>A	c.(3433-3435)cGt>cAt	p.R1145H	RP11-348B17.1_ENST00000561299.1_RNA|RP11-348B17.1_ENST00000558755.1_RNA|TRPM1_ENST00000397795.2_Missense_Mutation_p.R1123H|TRPM1_ENST00000542188.1_Missense_Mutation_p.R1162H	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1									p.R1123H(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		GCCGCTGAGACGCATAATGAT	0.488																																					p.R1123H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3368A	15						.						129.0	124.0	125.0					15																	31319180		1937	4154	6091	29106472	SO:0001583	missense	4308	exon25			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.3434G>A	15.37:g.31319180C>T	ENSP00000256552:p.Arg1145His	Somatic		Capture	Illumina HiSeq	Phase_I	29106472	NM_002420		Missense_Mutation	SNP	ENST00000256552.6	37	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	C	11.00	1.509850	0.27036	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.55234	0.55;0.53;0.55	5.6	4.68	0.58851	.	0.049694	0.85682	N	0.000000	T	0.38295	0.1035	L	0.31926	0.97	0.50632	D	0.999882	B;B	0.28760	0.221;0.141	B;B	0.26202	0.067;0.018	T	0.17018	-1.0383	10	0.07325	T	0.83	-17.3962	14.2219	0.65833	0.0:0.9284:0.0:0.0716	.	1117;1123	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	H	1123;1162;1145;1123	ENSP00000380897:R1123H;ENSP00000437849:R1162H;ENSP00000256552:R1145H	ENSP00000256552:R1145H	R	-	2	0	TRPM1	29106472	0.994000	0.37717	0.781000	0.31783	0.137000	0.21094	3.330000	0.52068	1.364000	0.46038	0.655000	0.94253	CGT		0.488	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
VPS13C	54832	broad.mit.edu	37	15	62201234	62201234	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr15:62201234T>C	ENST00000261517.5	-	65	9008	c.8935A>G	c.(8935-8937)Ata>Gta	p.I2979V	VPS13C_ENST00000395896.4_Missense_Mutation_p.I2979V|VPS13C_ENST00000395898.3_Missense_Mutation_p.I2936V|VPS13C_ENST00000249837.3_Missense_Mutation_p.I2936V	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.I2979V(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TGGTTCATTATCAAGGCAGGT	0.393																																					p.I2936V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A8806G	15						.						161.0	145.0	151.0					15																	62201234		2203	4300	6503	59988526	SO:0001583	missense	54832	exon63			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.8935A>G	15.37:g.62201234T>C	ENSP00000261517:p.Ile2979Val	Somatic		Capture	Illumina HiSeq	Phase_I	59988526	NM_017684		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	T	13.68	2.308951	0.40895	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.40756	1.02;1.02;1.02	5.76	1.91	0.25777	Vacuolar protein sorting-associated protein (1);	0.182497	0.49305	N	0.000156	T	0.28732	0.0712	L	0.35723	1.085	0.42293	D	0.992146	B;B;B;B;B	0.11235	0.002;0.002;0.001;0.004;0.001	B;B;B;B;B	0.17722	0.015;0.015;0.011;0.015;0.019	T	0.06356	-1.0831	10	0.25106	T	0.35	.	7.9558	0.30042	0.0:0.0672:0.2569:0.6759	.	2979;2936;2979;2936;2979	F5GZG8;Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;.;VP13C_HUMAN	V	2936;2979;2979;2979	ENSP00000249837:I2936V;ENSP00000261517:I2979V;ENSP00000379233:I2979V	ENSP00000249837:I2936V	I	-	1	0	VPS13C	59988526	0.969000	0.33509	0.985000	0.45067	0.956000	0.61745	1.783000	0.38664	0.421000	0.25980	0.533000	0.62120	ATA		0.393	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
DPP8	54878	broad.mit.edu	37	15	65746743	65746743	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr15:65746743T>G	ENST00000341861.5	-	17	3757	c.2177A>C	c.(2176-2178)gAa>gCa	p.E726A	DPP8_ENST00000321118.7_Missense_Mutation_p.E677A|DPP8_ENST00000300141.6_Missense_Mutation_p.E710A|DPP8_ENST00000339244.5_Missense_Mutation_p.E553A|DPP8_ENST00000321147.6_Intron|DPP8_ENST00000559233.1_Missense_Mutation_p.E726A|DPP8_ENST00000358939.4_Intron|DPP8_ENST00000560048.2_5'UTR	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	726					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)	p.E710A(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						ATCGTCAATTTCTATTTGACC	0.383																																					p.E726A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2177C	15						.						98.0	88.0	92.0					15																	65746743		2201	4299	6500	63533796	SO:0001583	missense	54878	exon18			AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.2177A>C	15.37:g.65746743T>G	ENSP00000339208:p.Glu726Ala	Somatic		Capture	Illumina HiSeq	Phase_I	63533796	NM_197960	Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Missense_Mutation	SNP	ENST00000341861.5	37	CCDS10207.1	.	.	.	.	.	.	.	.	.	.	T	19.00	3.742759	0.69418	.	.	ENSG00000074603	ENST00000341861;ENST00000300141;ENST00000321118;ENST00000339244	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.27	5.27	0.74061	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.000000	0.64402	D	0.000005	T	0.58524	0.2128	M	0.81614	2.55	0.80722	D	1	D;D;D	0.89917	1.0;0.974;0.998	D;D;D	0.83275	0.996;0.953;0.992	T	0.64976	-0.6280	10	0.87932	D	0	-28.927	15.2083	0.73198	0.0:0.0:0.0:1.0	.	553;677;726	C9JSG1;Q6V1X1-5;Q6V1X1	.;.;DPP8_HUMAN	A	726;710;677;553	ENSP00000339208:E726A;ENSP00000300141:E710A;ENSP00000316373:E677A;ENSP00000341230:E553A	ENSP00000300141:E710A	E	-	2	0	DPP8	63533796	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	1.973000	0.57446	0.533000	0.62120	GAA		0.383	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256847.1	NM_017743	
SCAMP5	192683	broad.mit.edu	37	15	75308936	75308936	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr15:75308936A>G	ENST00000361900.6	+	5	346	c.139A>G	c.(139-141)Aac>Gac	p.N47D	SCAMP5_ENST00000565923.1_3'UTR|SCAMP5_ENST00000545456.1_Intron|SCAMP5_ENST00000562212.1_Missense_Mutation_p.N47D|SCAMP5_ENST00000568081.1_5'Flank|SCAMP5_ENST00000425597.3_Missense_Mutation_p.N47D	NM_001178111.1	NP_001171582.1	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	47					exocytosis (GO:0006887)|negative regulation of endocytosis (GO:0045806)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of cytokine secretion (GO:0050715)|protein transport (GO:0015031)|response to endoplasmic reticulum stress (GO:0034976)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)|trans-Golgi network membrane (GO:0032588)		p.N47D(2)		large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	5						GCCTGCAGTGAACAGCGTCAC	0.612																																					p.N47D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A139G	15						.						103.0	104.0	104.0					15																	75308936		2175	4262	6437	73095989	SO:0001583	missense	192683	exon5			AL833230	CCDS45306.1	15q24.2	2014-05-20			ENSG00000198794	ENSG00000198794		"""Secretory carrier membrane proteins"""	30386	protein-coding gene	gene with protein product		613766				12477932	Standard	NM_001178111		Approved	MGC24969	uc002azk.2	Q8TAC9	OTTHUMG00000172704	ENST00000361900.6:c.139A>G	15.37:g.75308936A>G	ENSP00000355387:p.Asn47Asp	Somatic		Capture	Illumina HiSeq	Phase_I	73095989	NM_001178111	B3KPJ7|B7Z762|D3DW71|Q8N3M4	Missense_Mutation	SNP	ENST00000361900.6	37	CCDS45306.1	.	.	.	.	.	.	.	.	.	.	A	11.67	1.706539	0.30232	.	.	ENSG00000198794	ENST00000361900;ENST00000425597	T;T	0.17054	2.3;2.3	4.84	4.84	0.62591	.	0.042290	0.85682	D	0.000000	T	0.16300	0.0392	L	0.49350	1.555	0.80722	D	1	B;B	0.14438	0.01;0.005	B;B	0.16289	0.006;0.015	T	0.05338	-1.0891	10	0.12766	T	0.61	-15.2434	13.8928	0.63750	1.0:0.0:0.0:0.0	.	47;47	Q8TAC9-2;Q8TAC9	.;SCAM5_HUMAN	D	47	ENSP00000355387:N47D;ENSP00000406547:N47D	ENSP00000355387:N47D	N	+	1	0	SCAMP5	73095989	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.791000	0.62460	1.936000	0.56123	0.459000	0.35465	AAC		0.612	SCAMP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420015.2	NM_138967	
BNC1	646	broad.mit.edu	37	15	83932665	83932665	+	Silent	SNP	C	C	T	rs376158536		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr15:83932665C>T	ENST00000345382.2	-	4	1423	c.1338G>A	c.(1336-1338)acG>acA	p.T446T	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Silent_p.T439T	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	446					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T446T(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						AGTCTGGGGACGTCACTGTGA	0.527																																					p.T446T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1338A	15						.	C		2,4404	4.2+/-10.8	0,2,2201	125.0	115.0	119.0		1338	-10.0	0.0	15		119	0,8600		0,0,4300	no	coding-synonymous	BNC1	NM_001717.3		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		446/995	83932665	2,13004	2203	4300	6503	81723669	SO:0001819	synonymous_variant	646	exon4			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1338G>A	15.37:g.83932665C>T		Somatic		Capture	Illumina HiSeq	Phase_I	81723669	NM_001717	Q15840	Silent	SNP	ENST00000345382.2	37	CCDS10324.1																																																																																				0.527	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
IFT140	9742	broad.mit.edu	37	16	1614064	1614064	+	Silent	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr16:1614064C>T	ENST00000426508.2	-	17	2364	c.2001G>A	c.(1999-2001)caG>caA	p.Q667Q	IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	667					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)		p.Q667Q(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				GCGGCGTCTCCTGCACGGCTT	0.587																																					p.Q667Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2001A	16						.						55.0	64.0	61.0					16																	1614064		2199	4300	6499	1554065	SO:0001819	synonymous_variant	9742	exon17			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.2001G>A	16.37:g.1614064C>T		Somatic		Capture	Illumina HiSeq	Phase_I	1554065	NM_014714	A2A2A8|D3DU75|O60332|Q9UG52	Silent	SNP	ENST00000426508.2	37	CCDS10439.1																																																																																				0.587	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
MYH11	4629	broad.mit.edu	37	16	15876247	15876247	+	Nonsense_Mutation	SNP	G	G	A	rs112895882	byFrequency	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr16:15876247G>A	ENST00000300036.5	-	6	830	c.721C>T	c.(721-723)Cga>Tga	p.R241*	MYH11_ENST00000396324.3_Nonsense_Mutation_p.R248*|MYH11_ENST00000452625.2_Nonsense_Mutation_p.R248*|MYH11_ENST00000576790.2_Nonsense_Mutation_p.R241*	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	241	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.R241*(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTTACGAATCGTGAGGAGTTG	0.502			T	CBFB	AML																																p.R248X			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C742T	16						.						162.0	147.0	152.0					16																	15876247		2197	4300	6497	15783748	SO:0001587	stop_gained	4629	exon7			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.721C>T	16.37:g.15876247G>A	ENSP00000300036:p.Arg241*	Somatic		Capture	Illumina HiSeq	Phase_I	15783748	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Nonsense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	G	38	6.907644	0.97928	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	.	.	.	5.33	3.01	0.34805	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.0867	0.48091	0.0:0.0:0.453:0.547	.	.	.	.	X	241;241;248;248;248	.	ENSP00000300036:R241X	R	-	1	2	MYH11	15783748	0.995000	0.38212	0.348000	0.25681	0.988000	0.76386	2.201000	0.42734	1.311000	0.45024	0.561000	0.74099	CGA		0.502	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
LHX1	3975	broad.mit.edu	37	17	35300394	35300395	+	Frame_Shift_Ins	INS	-	-	C	rs376578880		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr17:35300394_35300395insC	ENST00000254457.5	+	5	2598_2599	c.1187_1188insC	c.(1186-1191)caccccfs	p.HP396fs	RP11-445F12.2_ENST00000607336.1_RNA	NM_005568.3	NP_005559.2	P48742	LHX1_HUMAN	LIM homeobox 1	396					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell signaling (GO:0007267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|cerebellum development (GO:0021549)|cervix development (GO:0060067)|comma-shaped body morphogenesis (GO:0072049)|dorsal/ventral pattern formation (GO:0009953)|ectoderm formation (GO:0001705)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic viscerocranium morphogenesis (GO:0048703)|endoderm formation (GO:0001706)|epithelium development (GO:0060429)|forebrain regionalization (GO:0021871)|gastrulation with mouth forming second (GO:0001702)|head development (GO:0060322)|horizontal cell localization (GO:0035852)|kidney development (GO:0001822)|lateral motor column neuron migration (GO:0097477)|mesonephric duct development (GO:0072177)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerulus development (GO:0072224)|metanephric part of ureteric bud development (GO:0035502)|metanephric renal vesicle morphogenesis (GO:0072283)|metanephric S-shaped body morphogenesis (GO:0072284)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct elongation (GO:0035849)|nephric duct morphogenesis (GO:0072178)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|oviduct development (GO:0060066)|oviduct epithelium development (GO:0035846)|paramesonephric duct development (GO:0061205)|pattern specification process (GO:0007389)|positive regulation of anterior head development (GO:2000744)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primitive streak formation (GO:0090009)|pronephros development (GO:0048793)|regulation of gene expression (GO:0010468)|renal vesicle morphogenesis (GO:0072077)|retina layer formation (GO:0010842)|S-shaped body morphogenesis (GO:0072050)|somite rostral/caudal axis specification (GO:0032525)|spinal cord association neuron differentiation (GO:0021527)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)|uterine epithelium development (GO:0035847)|uterus development (GO:0060065)|vagina development (GO:0060068)|ventral spinal cord development (GO:0021517)	nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.E399fs*>9(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Breast(25;0.00607)				CACCTGTCCCACCCCCCCGAAA	0.599																																					p.H396fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1187_1188insC	17						.																																			32374508	SO:0001589	frameshift_variant	3975	exon5			U14755	CCDS11316.1	17q12	2014-04-11			ENSG00000132130	ENSG00000273706		"""Homeoboxes / LIM class"""	6593	protein-coding gene	gene with protein product		601999				9212161	Standard	NM_005568		Approved	LIM-1, LIM1	uc002hnh.2	P48742	OTTHUMG00000188456	ENST00000254457.5:c.1194dupC	17.37:g.35300401_35300401dupC	ENSP00000254457:p.His396fs	Somatic		Capture	Illumina HiSeq	Phase_I	32374507	NM_005568	Q3MIW0	Frame_Shift_Ins	INS	ENST00000254457.5	37	CCDS11316.1																																																																																				0.599	LHX1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256704.3	NM_005568	
MNT	4335	broad.mit.edu	37	17	2298633	2298633	+	Silent	SNP	T	T	G	rs199848480	byFrequency	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr17:2298633T>G	ENST00000174618.4	-	2	594	c.189A>C	c.(187-189)ccA>ccC	p.P63P	MNT_ENST00000575394.1_Intron	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor	63					cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.P63P(1)		endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		gaggcaggggtggCGCCTCCA	0.647																																					p.P63P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A189C	17						.						33.0	40.0	37.0					17																	2298633		2188	4281	6469	2245383	SO:0001819	synonymous_variant	4335	exon2			Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.189A>C	17.37:g.2298633T>G		Somatic		Capture	Illumina HiSeq	Phase_I	2245383	NM_020310	A8K6D1|D3DTI7|Q1ED38	Silent	SNP	ENST00000174618.4	37	CCDS11018.1																																																																																				0.647	MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207158.1	NM_020310	
MYH4	4622	broad.mit.edu	37	17	10354159	10354159	+	Nonsense_Mutation	SNP	G	G	A	rs151253822		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr17:10354159G>A	ENST00000255381.2	-	29	4029	c.3919C>T	c.(3919-3921)Cga>Tga	p.R1307*	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1307					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.R1307*(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TGTTTGCCTCGGGATAGCTGA	0.393																																					p.R1307X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3919T	17						.	G	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	167.0	152.0	157.0		3919	1.0	1.0	17	dbSNP_134	157	0,8600		0,0,4300	yes	stop-gained	MYH4	NM_017533.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1307/1940	10354159	1,13005	2203	4300	6503	10294884	SO:0001587	stop_gained	4622	exon29				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3919C>T	17.37:g.10354159G>A	ENSP00000255381:p.Arg1307*	Somatic		Capture	Illumina HiSeq	Phase_I	10294884	NM_017533		Nonsense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	42	9.380558	0.99153	2.27E-4	0.0	ENSG00000141048	ENST00000255381	.	.	.	5.71	1.05	0.20165	.	0.000000	0.33916	U	0.004428	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8044	0.78481	0.0:0.0:0.3765:0.6235	.	.	.	.	X	1307	.	ENSP00000255381:R1307X	R	-	1	2	MYH4	10294884	0.004000	0.15560	1.000000	0.80357	0.996000	0.88848	0.042000	0.13949	0.386000	0.24997	-0.182000	0.12963	CGA		0.393	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
ASIC2	40	broad.mit.edu	37	17	31348260	31348260	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr17:31348260G>A	ENST00000359872.6	-	7	2026	c.1265C>T	c.(1264-1266)gCg>gTg	p.A422V	ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Missense_Mutation_p.A473V	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	422					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)	p.A473V(1)|p.A422V(1)								Amiloride(DB00594)	AACTTCATACGCCTTCTTCTG	0.433																																					p.A473V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1418T	17						.						88.0	80.0	83.0					17																	31348260		2203	4300	6503	28372373	SO:0001583	missense	40	exon7			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.1265C>T	17.37:g.31348260G>A	ENSP00000352934:p.Ala422Val	Somatic		Capture	Illumina HiSeq	Phase_I	28372373	NM_183377	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	.	.	.	.	.	.	.	.	.	.	g	32	5.115270	0.94339	.	.	ENSG00000108684	ENST00000225823;ENST00000359872	T;T	0.67171	-0.25;-0.25	5.15	5.15	0.70609	.	0.055186	0.64402	D	0.000001	T	0.81833	0.4906	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.91635	0.999;0.763	T	0.83257	-0.0050	10	0.52906	T	0.07	-10.8322	16.1208	0.81357	0.0:0.0:1.0:0.0	.	422;473	Q16515;E9PBX2	ACCN1_HUMAN;.	V	473;422	ENSP00000225823:A473V;ENSP00000352934:A422V	ENSP00000225823:A473V	A	-	2	0	ACCN1	28372373	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.803000	0.99136	2.382000	0.81193	0.462000	0.41574	GCG		0.433	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
WNT3	7473	broad.mit.edu	37	17	44845862	44845862	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr17:44845862G>A	ENST00000225512.5	-	4	1054	c.892C>T	c.(892-894)Cgg>Tgg	p.R298W		NM_030753.4	NP_110380.1	P56703	WNT3_HUMAN	wingless-type MMTV integration site family, member 3	298					anterior/posterior axis specification (GO:0009948)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell fate commitment (GO:0045165)|cell morphogenesis (GO:0000902)|cellular response to retinoic acid (GO:0071300)|dorsal/ventral axis specification (GO:0009950)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|gamete generation (GO:0007276)|head morphogenesis (GO:0060323)|limb bud formation (GO:0060174)|mammary gland epithelium development (GO:0061180)|mesoderm formation (GO:0001707)|negative regulation of axon extension involved in axon guidance (GO:0048843)|neuron differentiation (GO:0030182)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of gene expression (GO:0010628)|Spemann organizer formation at the anterior end of the primitive streak (GO:0060064)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.R298W(1)		endometrium(2)|large_intestine(6)|lung(4)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(9;0.0257)			TTGCAAGTCCGGTCCCTTGTG	0.592																																					p.R298W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C892T	17						.						157.0	141.0	146.0					17																	44845862		2203	4300	6503	42201031	SO:0001583	missense	7473	exon4			AY009397	CCDS11505.1	17q21-q22	2013-02-28				ENSG00000108379		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12782	protein-coding gene	gene with protein product	"""WNT-3 proto-oncogene protein"""	165330		INT4		8244403	Standard	NM_030753		Approved	MGC131950, MGC138321, MGC138323	uc002ikv.3	P56703		ENST00000225512.5:c.892C>T	17.37:g.44845862G>A	ENSP00000225512:p.Arg298Trp	Somatic		Capture	Illumina HiSeq	Phase_I	42201031	NM_030753	Q2M237|Q9H1J9	Missense_Mutation	SNP	ENST00000225512.5	37	CCDS11505.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.505179	0.85282	.	.	ENSG00000108379	ENST00000225512	D	0.88277	-2.36	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.96602	0.8891	H	0.98542	4.26	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97465	1.0037	10	0.87932	D	0	.	13.3881	0.60807	0.0:0.0:0.8043:0.1957	.	298	P56703	WNT3_HUMAN	W	298	ENSP00000225512:R298W	ENSP00000225512:R298W	R	-	1	2	WNT3	42201031	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.377000	0.52425	2.620000	0.88729	0.561000	0.74099	CGG		0.592	WNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440427.1	NM_030753	
TTLL6	284076	broad.mit.edu	37	17	46863547	46863547	+	Silent	SNP	G	G	A	rs141189437		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr17:46863547G>A	ENST00000393382.3	-	12	1881	c.1740C>T	c.(1738-1740)gcC>gcT	p.A580A	TTLL6_ENST00000433608.2_Silent_p.A273A	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6									p.A258A(1)|p.A532A(1)		endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CTTGGGTGGCGGCCTTGTCTT	0.572																																					p.A580A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1740T	17						.	G	,	1,4405	2.1+/-5.4	0,1,2202	379.0	352.0	361.0		1740,819	-3.6	0.0	17	dbSNP_134	361	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TTLL6	NM_001130918.1,NM_173623.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	580/892,273/585	46863547	1,13005	2203	4300	6503	44218546	SO:0001819	synonymous_variant	284076	exon12			AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.1740C>T	17.37:g.46863547G>A		Somatic		Capture	Illumina HiSeq	Phase_I	44218546	NM_001130918		Silent	SNP	ENST00000393382.3	37	CCDS45724.1																																																																																				0.572	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346939.3	NM_173623	
TP53	7157	broad.mit.edu	37	17	7578534	7578534	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr17:7578534C>G	ENST00000269305.4	-	5	585	c.396G>C	c.(394-396)aaG>aaC	p.K132N	TP53_ENST00000413465.2_Missense_Mutation_p.K132N|TP53_ENST00000420246.2_Missense_Mutation_p.K132N|TP53_ENST00000359597.4_Missense_Mutation_p.K132N|TP53_ENST00000455263.2_Missense_Mutation_p.K132N|TP53_ENST00000445888.2_Missense_Mutation_p.K132N|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	132	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|KM -> NL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132N(49)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.K39N(2)|p.N131fs*27(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.K132K(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.M133fs*37(1)|p.M133fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAAAACATCTTGTTGAGGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.K132N	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	77	Substitution - Missense(51)|Deletion - In frame(10)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(1)|Substitution - coding silent(1)	urinary_tract(13)|breast(10)|ovary(10)|lung(9)|large_intestine(8)|haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(4)|bone(4)|adrenal_gland(3)|upper_aerodigestive_tract(2)|skin(2)|liver(2)|stomach(1)|penis(1)|oesophagus(1)|pancreas(1)	c.G396C	17						.						47.0	48.0	48.0					17																	7578534		2203	4300	6503	7519259	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.396G>C	17.37:g.7578534C>G	ENSP00000269305:p.Lys132Asn	Somatic		Capture	Illumina HiSeq	Phase_I	7519259	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.123172	0.77436	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99859	-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23	5.48	3.5	0.40072	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99857	0.9933	M	0.91768	3.24	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.998;0.993;0.996;0.999;0.998;1.0	D	0.97328	0.9948	10	0.87932	D	0	-14.0777	10.5581	0.45129	0.0:0.841:0.0:0.159	.	93;132;132;39;132;132;132	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	132;132;132;132;132;132;121;39;39;132	ENSP00000410739:K132N;ENSP00000352610:K132N;ENSP00000269305:K132N;ENSP00000398846:K132N;ENSP00000391127:K132N;ENSP00000391478:K132N;ENSP00000423862:K39N;ENSP00000424104:K132N	ENSP00000269305:K132N	K	-	3	2	TP53	7519259	1.000000	0.71417	0.994000	0.49952	0.784000	0.44337	1.646000	0.37249	0.804000	0.34136	0.655000	0.94253	AAG		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CANT1	124583	broad.mit.edu	37	17	76989776	76989776	+	Silent	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr17:76989776G>A	ENST00000302345.2	-	4	1556	c.1062C>T	c.(1060-1062)gaC>gaT	p.D354D	CANT1_ENST00000392446.5_Silent_p.D354D|CANT1_ENST00000591773.1_Silent_p.D354D	NM_001159773.1|NM_138793.3	NP_001153245.1|NP_620148.1	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	354					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|proteoglycan biosynthetic process (GO:0030166)|signal transduction (GO:0007165)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|signal transducer activity (GO:0004871)|uridine-diphosphatase activity (GO:0045134)	p.D354D(1)	CANT1/ETV4(3)	cervix(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			TGATCTGGTCGTCGGTGTTGG	0.627			T	ETV4	prostate						OREG0024788	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D354D			Dom	yes		17	17q25	124583	calcium activated nucleotidase 1		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1062T	17						.						98.0	82.0	88.0					17																	76989776		2203	4300	6503	74501371	SO:0001819	synonymous_variant	124583	exon5			AJ312208	CCDS11760.1	17q25.3	2008-02-05	2004-10-12	2004-10-15		ENSG00000171302			19721	protein-coding gene	gene with protein product	"""Soluble Ca-Activated Nucleotidase, isozyme 1"""	613165				12167635	Standard	NM_138793		Approved	SHAPY, SCAN-1	uc002jwk.3	Q8WVQ1		ENST00000302345.2:c.1062C>T	17.37:g.76989776G>A		Somatic	1172	Capture	Illumina HiSeq	Phase_I	74501371	NM_001159773	B4DJ54|Q7Z2J7|Q8NG05|Q8NHP0|Q9BSD5	Silent	SNP	ENST00000302345.2	37	CCDS11760.1																																																																																				0.627	CANT1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437723.2	NM_138793	
L3MBTL4	91133	broad.mit.edu	37	18	6244486	6244486	+	Silent	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr18:6244486C>T	ENST00000284898.6	-	6	521	c.321G>A	c.(319-321)gcG>gcA	p.A107A	L3MBTL4_ENST00000317931.7_Silent_p.A107A|L3MBTL4_ENST00000400105.2_Silent_p.A107A|L3MBTL4_ENST00000400104.3_Silent_p.A107A	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	107					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.A107A(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				CTCTTACCTCCGCTACAGAAA	0.378																																					p.A107A	Esophageal Squamous(41;748 902 17366 28959 43175)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G321A	18						.						196.0	172.0	180.0					18																	6244486		2203	4300	6503	6234486	SO:0001819	synonymous_variant	91133	exon6			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.321G>A	18.37:g.6244486C>T		Somatic		Capture	Illumina HiSeq	Phase_I	6234486	NM_173464	A8MTL8|Q8IXS3	Silent	SNP	ENST00000284898.6	37	CCDS11839.2																																																																																				0.378	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254448.2	NM_173464	
IL12RB1	3594	broad.mit.edu	37	19	18197705	18197706	+	5'UTR	INS	-	-	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr19:18197705_18197706insA	ENST00000600835.2	-	0	226_227				IL12RB1_ENST00000593993.2_5'UTR|IL12RB1_ENST00000322153.7_5'UTR			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1						cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						ACCCCGTCCCCACTCCGGAACA	0.545																																					.												.	.	0			.	19						.																																			18058706	SO:0001623	5_prime_UTR_variant	3594	.			U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.-73->T	19.37:g.18197706_18197706dupA		Somatic		Capture	Illumina HiSeq	Phase_I	18058705	.	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Frame_Shift_Ins	INS	ENST00000600835.2	37	CCDS54232.1																																																																																				0.545	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3		
MYBPC2	4606	broad.mit.edu	37	19	50958867	50958867	+	Silent	SNP	C	C	T	rs145465195	byFrequency	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr19:50958867C>T	ENST00000357701.5	+	20	2355	c.2304C>T	c.(2302-2304)atC>atT	p.I768I		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	768	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.I768I(1)		breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CAGGTGGCATCGATGGGTACC	0.622													c|||	8	0.00159744	0.0061	0.0	5008	,	,		17001	0.0		0.0	False		,,,				2504	0.0				p.I768I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2304T	19						.	C		25,4113		0,25,2044	77.0	84.0	81.0		2304	1.6	1.0	19	dbSNP_134	81	0,8410		0,0,4205	no	coding-synonymous	MYBPC2	NM_004533.3		0,25,6249	TT,TC,CC		0.0,0.6042,0.1992		768/1142	50958867	25,12523	2069	4205	6274	55650679	SO:0001819	synonymous_variant	4606	exon20				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2304C>T	19.37:g.50958867C>T		Somatic		Capture	Illumina HiSeq	Phase_I	55650679	NM_004533	A1L4G9	Silent	SNP	ENST00000357701.5	37	CCDS46152.1																																																																																				0.622	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
NLRP12	91662	broad.mit.edu	37	19	54314259	54314259	+	Silent	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr19:54314259C>T	ENST00000324134.6	-	3	822	c.654G>A	c.(652-654)gcG>gcA	p.A218A	NLRP12_ENST00000391772.1_Silent_p.A218A|NLRP12_ENST00000391775.3_Silent_p.A218A|NLRP12_ENST00000351894.4_Silent_p.A218A|NLRP12_ENST00000391773.1_Silent_p.A218A|NLRP12_ENST00000535162.1_Silent_p.A218A|NLRP12_ENST00000345770.5_Silent_p.A218A|NLRP12_ENST00000354278.3_Silent_p.A218A	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	218	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.A218A(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CTATCCCTGCCGCGCCTTGCA	0.592																																					p.A218A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G654A	19						.						94.0	74.0	81.0					19																	54314259		2203	4300	6503	59006071	SO:0001819	synonymous_variant	91662	exon3			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.654G>A	19.37:g.54314259C>T		Somatic		Capture	Illumina HiSeq	Phase_I	59006071	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	37	CCDS12864.1																																																																																				0.592	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
ZNF329	79673	broad.mit.edu	37	19	58639493	58639493	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr19:58639493A>G	ENST00000598312.1	-	4	1611	c.1378T>C	c.(1378-1380)Tgt>Cgt	p.C460R	ZNF329_ENST00000358067.4_Missense_Mutation_p.C460R	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	460					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C460R(1)		NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		GCTTTGCCACACTGATTACAC	0.493																																					p.C460R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1378C	19						.						82.0	76.0	78.0					19																	58639493		2203	4300	6503	63331305	SO:0001583	missense	79673	exon4			AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.1378T>C	19.37:g.58639493A>G	ENSP00000470008:p.Cys460Arg	Somatic		Capture	Illumina HiSeq	Phase_I	63331305	NM_024620	B3KR32|Q9H9R7	Missense_Mutation	SNP	ENST00000598312.1	37	CCDS12972.1	.	.	.	.	.	.	.	.	.	.	A	18.26	3.585543	0.66105	.	.	ENSG00000181894	ENST00000358067;ENST00000500161	D;D	0.85955	-2.05;-2.05	4.31	4.31	0.51392	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45606	D	0.000347	D	0.95007	0.8384	H	0.98178	4.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96383	0.9283	10	0.87932	D	0	-9.879	13.3971	0.60861	1.0:0.0:0.0:0.0	.	460	Q86UD4	ZN329_HUMAN	R	460	ENSP00000350773:C460R;ENSP00000439527:C460R	ENSP00000350773:C460R	C	-	1	0	ZNF329	63331305	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.844000	0.69430	2.173000	0.68751	0.533000	0.62120	TGT		0.493	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466724.1	NM_024620	
GSTM5	2949	broad.mit.edu	37	1	110254965	110254965	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr1:110254965C>T	ENST00000256593.3	+	1	89	c.31C>T	c.(31-33)Cgt>Tgt	p.R11C	GSTM5_ENST00000369812.5_Missense_Mutation_p.R11C|GSTM5_ENST00000369813.1_5'UTR	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5	11	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)	p.R11C(1)		NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	CTGGGACATCCGTGGGGTAAG	0.637																																					p.R11C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C31T	1						.						113.0	122.0	119.0					1																	110254965		2203	4300	6503	110056488	SO:0001583	missense	2949	exon1			L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.31C>T	1.37:g.110254965C>T	ENSP00000256593:p.Arg11Cys	Somatic		Capture	Illumina HiSeq	Phase_I	110056488	NM_000851	A8K0V8|Q6PD78	Missense_Mutation	SNP	ENST00000256593.3	37	CCDS811.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.949328	0.53186	.	.	ENSG00000134201	ENST00000256593;ENST00000369812	T;T	0.10288	2.89;2.89	4.12	3.2	0.36748	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.091731	0.41712	U	0.000838	T	0.38134	0.1029	H	0.98370	4.215	0.52099	D	0.999942	D	0.89917	1.0	D	0.79108	0.992	T	0.53556	-0.8422	10	0.87932	D	0	.	9.3971	0.38408	0.0:0.8916:0.0:0.1083	.	11	P46439	GSTM5_HUMAN	C	11	ENSP00000256593:R11C;ENSP00000358827:R11C	ENSP00000256593:R11C	R	+	1	0	GSTM5	110056488	0.917000	0.31117	0.994000	0.49952	0.217000	0.24651	1.810000	0.38932	2.276000	0.75962	0.430000	0.28490	CGT		0.637	GSTM5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032200.1	NM_000851	
HFE2	148738	broad.mit.edu	37	1	145415363	145415363	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr1:145415363C>A	ENST00000336751.5	+	3	420	c.182C>A	c.(181-183)gCa>gAa	p.A61E	HFE2_ENST00000475797.1_Intron|HFE2_ENST00000497365.1_Intron|HFE2_ENST00000357836.5_5'UTR	NM_213653.3	NP_998818.1	Q6ZVN8	RGMC_HUMAN	hemochromatosis type 2 (juvenile)	61					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|iron ion homeostasis (GO:0055072)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)	p.A61E(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	14	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCATCAGGAGCACTTCGAGGA	0.617																																					p.A61E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C182A	1						.						55.0	58.0	57.0					1																	145415363		2203	4299	6502	144126720	SO:0001583	missense	148738	exon3			AY372521	CCDS72877.1, CCDS72878.1, CCDS72879.1	1q21.2	2014-06-26			ENSG00000168509	ENSG00000168509			4887	protein-coding gene	gene with protein product	"""repulsive guidance molecule c"""	608374				10205270, 14647275	Standard	NM_213653		Approved	JH, HFE2A, RGMC, HJV, hemojuvelin, haemojuvelin	uc001eni.2	Q6ZVN8	OTTHUMG00000013748	ENST00000336751.5:c.182C>A	1.37:g.145415363C>A	ENSP00000337014:p.Ala61Glu	Somatic		Capture	Illumina HiSeq	Phase_I	144126720	NM_213653	B1ALI7|Q2PQ63|Q6IMF6|Q8NAH2|Q8WVJ5	Missense_Mutation	SNP	ENST00000336751.5	37	CCDS910.1	.	.	.	.	.	.	.	.	.	.	C	3.526	-0.096667	0.07010	.	.	ENSG00000168509	ENST00000421822;ENST00000336751	D;D	0.93547	-2.05;-3.24	4.67	0.165	0.14995	Repulsive guidance molecule, N-terminal (1);	0.691630	0.13748	N	0.365453	T	0.63117	0.2484	N	0.08118	0	0.09310	N	0.999997	B	0.14805	0.011	B	0.22152	0.038	T	0.62234	-0.6897	10	0.02654	T	1	-4.1276	6.7046	0.23244	0.0:0.2919:0.5158:0.1923	.	61	Q6ZVN8	RGMC_HUMAN	E	61	ENSP00000411863:A61E;ENSP00000337014:A61E	ENSP00000337014:A61E	A	+	2	0	HFE2	144126720	0.891000	0.30450	0.000000	0.03702	0.283000	0.27025	0.746000	0.26275	0.168000	0.19655	-0.372000	0.07161	GCA		0.617	HFE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038527.1	NM_145277	
SPTA1	6708	broad.mit.edu	37	1	158656291	158656291	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr1:158656291T>C	ENST00000368147.4	-	1	197	c.17A>G	c.(16-18)aAg>aGg	p.K6R		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	6					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.K6R(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TACGGTTTCCTTTGGAAATTG	0.338																																					p.K6R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A17G	1						.						61.0	61.0	61.0					1																	158656291		1797	4066	5863	156922915	SO:0001583	missense	6708	exon1			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.17A>G	1.37:g.158656291T>C	ENSP00000357129:p.Lys6Arg	Somatic		Capture	Illumina HiSeq	Phase_I	156922915	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	16.46	3.130893	0.56828	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.53423	0.79;0.62	5.06	2.75	0.32379	.	.	.	.	.	T	0.14313	0.0346	L	0.51422	1.61	0.32562	N	0.530949	B	0.11235	0.004	B	0.13407	0.009	T	0.12863	-1.0531	9	0.07644	T	0.81	.	3.8908	0.09117	0.1861:0.0963:0.0:0.7175	.	6	P02549	SPTA1_HUMAN	R	6	ENSP00000357130:K6R;ENSP00000357129:K6R	ENSP00000357129:K6R	K	-	2	0	SPTA1	156922915	1.000000	0.71417	0.999000	0.59377	0.621000	0.37620	1.159000	0.31749	1.025000	0.39708	0.523000	0.50628	AAG		0.338	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
OLFML2B	25903	broad.mit.edu	37	1	161953843	161953843	+	Silent	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr1:161953843G>A	ENST00000294794.3	-	8	2298	c.1875C>T	c.(1873-1875)gaC>gaT	p.D625D	OLFML2B_ENST00000367940.2_Silent_p.D626D|OLFML2B_ENST00000367938.1_Silent_p.D108D	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	625	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.D625D(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			GGCCATTCTCGTCCACAGCAA	0.632																																					p.D625D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1875T	1						.						69.0	60.0	63.0					1																	161953843		2203	4300	6503	160220467	SO:0001819	synonymous_variant	25903	exon8			BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1875C>T	1.37:g.161953843G>A		Somatic		Capture	Illumina HiSeq	Phase_I	160220467	NM_015441	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Silent	SNP	ENST00000294794.3	37	CCDS1236.1																																																																																				0.632	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
LMX1A	4009	broad.mit.edu	37	1	165218704	165218704	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr1:165218704C>A	ENST00000342310.3	-	4	819	c.437G>T	c.(436-438)gGg>gTg	p.G146V	LMX1A_ENST00000294816.2_Missense_Mutation_p.G146V|LMX1A_ENST00000367893.4_Missense_Mutation_p.G146V	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	146	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G146V(1)		NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					CTCATAGTCCCCTTTGCAGAG	0.607																																					p.G146V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G437T	1						.						80.0	76.0	77.0					1																	165218704		2203	4300	6503	163485328	SO:0001583	missense	4009	exon4			AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.437G>T	1.37:g.165218704C>A	ENSP00000340226:p.Gly146Val	Somatic		Capture	Illumina HiSeq	Phase_I	163485328	NM_177398	B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Missense_Mutation	SNP	ENST00000342310.3	37	CCDS1247.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827167	0.32329	.	.	ENSG00000162761	ENST00000342310;ENST00000294816;ENST00000367893	D;D;D	0.87256	-2.23;-2.23;-2.23	4.61	4.61	0.57282	Zinc finger, LIM-type (4);	0.251578	0.41294	D	0.000920	T	0.67325	0.2881	N	0.16201	0.385	0.39187	D	0.962881	B	0.19445	0.036	B	0.19666	0.026	T	0.63314	-0.6665	9	0.25106	T	0.35	.	16.3806	0.83460	0.0:1.0:0.0:0.0	.	146	Q8TE12	LMX1A_HUMAN	V	146	ENSP00000340226:G146V;ENSP00000294816:G146V;ENSP00000356868:G146V	ENSP00000294816:G146V	G	-	2	0	LMX1A	163485328	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	3.290000	0.51755	2.395000	0.81488	0.585000	0.79938	GGG		0.607	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083668.2	NM_177398	
HMCN1	83872	broad.mit.edu	37	1	186151323	186151323	+	Missense_Mutation	SNP	G	G	T	rs74136061	byFrequency	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr1:186151323G>T	ENST00000271588.4	+	105	16547	c.16318G>T	c.(16318-16320)Gat>Tat	p.D5440Y	HMCN1_ENST00000367492.2_Missense_Mutation_p.D5323Y	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5440	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.D5440Y(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGAAAATACAGATGCCTGCCA	0.428																																					p.D5440Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G16318T	1						.						143.0	139.0	141.0					1																	186151323		2203	4300	6503	184417946	SO:0001583	missense	83872	exon105			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16318G>T	1.37:g.186151323G>T	ENSP00000271588:p.Asp5440Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	184417946	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521074	0.64747	.	.	ENSG00000143341	ENST00000271588;ENST00000367492;ENST00000414277	T;T;T	0.77877	-0.2;-0.24;-1.13	5.53	3.67	0.42095	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.043611	0.85682	D	0.000000	T	0.80539	0.4642	L	0.31804	0.96	0.22412	N	0.999125	D	0.89917	1.0	D	0.83275	0.996	T	0.72443	-0.4292	10	0.72032	D	0.01	.	11.8227	0.52247	0.1414:0.0:0.8586:0.0	.	5440	Q96RW7	HMCN1_HUMAN	Y	5440;5323;115	ENSP00000271588:D5440Y;ENSP00000356462:D5323Y;ENSP00000406205:D115Y	ENSP00000271588:D5440Y	D	+	1	0	HMCN1	184417946	1.000000	0.71417	0.011000	0.14972	0.983000	0.72400	4.577000	0.60922	0.702000	0.31825	0.563000	0.77884	GAT		0.428	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
OR2T8	343172	broad.mit.edu	37	1	248084851	248084851	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr1:248084851G>A	ENST00000319968.4	+	1	532	c.532G>A	c.(532-534)Gag>Aag	p.E178K		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E178K(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CTTCTTCTGCGAGACCCCCGT	0.562																																					p.E178K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G532A	1						.						53.0	38.0	43.0					1																	248084851		2194	4261	6455	246151474	SO:0001583	missense	343172	exon1				CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.532G>A	1.37:g.248084851G>A	ENSP00000326225:p.Glu178Lys	Somatic		Capture	Illumina HiSeq	Phase_I	246151474	NM_001005522		Missense_Mutation	SNP	ENST00000319968.4	37	CCDS31100.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037814	0.93630	.	.	ENSG00000177462	ENST00000319968	T	0.00202	8.56	3.56	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35495	U	0.003180	T	0.00695	0.0023	M	0.93550	3.43	0.36261	D	0.854524	D	0.76494	0.999	P	0.62435	0.902	T	0.57843	-0.7741	10	0.87932	D	0	.	14.0478	0.64714	0.0:0.0:1.0:0.0	.	178	A6NH00	OR2T8_HUMAN	K	178	ENSP00000326225:E178K	ENSP00000326225:E178K	E	+	1	0	OR2T8	246151474	0.999000	0.42202	0.073000	0.20177	0.523000	0.34469	2.852000	0.48310	1.816000	0.52996	0.404000	0.27445	GAG		0.562	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096862.1	NM_001005522	
HHLA3	11147	broad.mit.edu	37	1	70832137	70832137	+	Missense_Mutation	SNP	C	C	T	rs201916003	byFrequency	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr1:70832137C>T	ENST00000359875.5	+	2	408	c.268C>T	c.(268-270)Cgg>Tgg	p.R90W	HHLA3_ENST00000370940.5_Silent_p.N57N|HHLA3_ENST00000432224.1_Silent_p.N90N|HHLA3_ENST00000531950.1_Missense_Mutation_p.R90W|HHLA3_ENST00000361764.4_Missense_Mutation_p.T56M	NM_001036645.1	NP_001031722.1	Q9XRX5	HHLA3_HUMAN	HERV-H LTR-associating 3	90								p.R90W(1)		large_intestine(3)|lung(1)	4						GTCTtgtcaacggaaaggggt	0.338													c|||	3	0.000599042	0.0023	0.0	5008	,	,		17924	0.0		0.0	False		,,,				2504	0.0				p.R90W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C268T	1						.	T	,TRP/ARG,MET/THR	4,4356		0,4,2176	17.0	21.0	20.0		171,268,167	-0.3	0.1	1		20	1,8565		0,1,4282	yes	coding-synonymous,missense,missense	HHLA3	NM_001031693.2,NM_001036645.1,NM_001036646.1	,101,81	0,5,6458	TT,TC,CC		0.0117,0.0917,0.0387	,,	57/122,90/115,56/77	70832137	5,12921	2180	4283	6463	70604725	SO:0001583	missense	11147	exon2			AF126164	CCDS649.1, CCDS30752.1, CCDS30753.1	1p31.1	2008-02-05			ENSG00000197568	ENSG00000197568			4906	protein-coding gene	gene with protein product		604372				10444326	Standard	NR_027404		Approved		uc001dfa.3	Q9XRX5	OTTHUMG00000009346	ENST00000359875.5:c.268C>T	1.37:g.70832137C>T	ENSP00000352938:p.Arg90Trp	Somatic		Capture	Illumina HiSeq	Phase_I	70604725	NM_001036645	D3DQ74|Q5VZP2|Q96FH5|Q9XRX4	Missense_Mutation	SNP	ENST00000359875.5	37	CCDS30753.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.012|0.012	-1.653454|-1.653454	0.00779|0.00779	9.17E-4|9.17E-4	1.17E-4|1.17E-4	ENSG00000197568|ENSG00000197568	ENST00000359875;ENST00000531950|ENST00000361764	.|.	.|.	.|.	0.137|0.137	-0.274|-0.274	0.12910|0.12910	.|.	.|.	.|.	.|.	.|.	T|T	0.05547|0.05547	0.0146|0.0146	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D|D	0.61080|0.57899	0.989|0.981	B|B	0.38156|0.35859	0.266|0.212	T|T	0.20706|0.20706	-1.0267|-1.0267	6|6	0.56958|0.48119	D|T	0.05|0.1	.|.	.|.	.|.	.|.	.|.	90|56	Q9XRX5|Q9XRX5-3	HHLA3_HUMAN|.	W|M	90|56	.|.	ENSP00000352938:R90W|ENSP00000354815:T56M	R|T	+|+	1|2	2|0	HHLA3|HHLA3	70604725|70604725	0.000000|0.000000	0.05858|0.05858	0.050000|0.050000	0.19076|0.19076	0.061000|0.061000	0.15899|0.15899	-1.895000|-1.895000	0.01606|0.01606	-0.742000|-0.742000	0.04790|0.04790	-0.740000|-0.740000	0.03531|0.03531	CGG|ACG		0.338	HHLA3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025911.2	NM_007071	
TGFBR3	7049	broad.mit.edu	37	1	92184916	92184916	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr1:92184916T>C	ENST00000525962.1	-	9	1580	c.1519A>G	c.(1519-1521)Act>Gct	p.T507A	TGFBR3_ENST00000212355.4_Missense_Mutation_p.T507A|TGFBR3_ENST00000370399.2_Missense_Mutation_p.T506A			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	507	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.T507A(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		CGGGGCCGAGTACCGCAGCCA	0.547																																					p.T506A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1516G	1						.						119.0	109.0	113.0					1																	92184916		2203	4300	6503	91957504	SO:0001583	missense	7049	exon10			L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.1519A>G	1.37:g.92184916T>C	ENSP00000436127:p.Thr507Ala	Somatic		Capture	Illumina HiSeq	Phase_I	91957504	NM_001195683	A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Missense_Mutation	SNP	ENST00000525962.1	37	CCDS30770.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.535102	0.45073	.	.	ENSG00000069702	ENST00000212355;ENST00000370399;ENST00000525962;ENST00000465892	D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09	5.88	5.88	0.94601	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.096879	0.64402	D	0.000001	D	0.92080	0.7490	M	0.79475	2.455	0.47183	D	0.999341	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.80764	0.993;0.994;0.983	D	0.93232	0.6618	10	0.87932	D	0	-11.4988	14.8658	0.70416	0.0:0.0:0.0:1.0	.	507;506;507	A8K5N0;Q03167-2;Q03167	.;.;TGBR3_HUMAN	A	507;506;507;506	ENSP00000212355:T507A;ENSP00000359426:T506A;ENSP00000436127:T507A;ENSP00000432638:T506A	ENSP00000212355:T507A	T	-	1	0	TGFBR3	91957504	1.000000	0.71417	0.112000	0.21494	0.196000	0.23810	4.285000	0.58989	2.253000	0.74438	0.455000	0.32223	ACT		0.547	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243	
OR2T33	391195	broad.mit.edu	37	1	248436585	248436585	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr1:248436585C>T	ENST00000318021.2	-	1	553	c.532G>A	c.(532-534)Gag>Aag	p.E178K		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E178K(1)		NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ACGGGGGTCTCGCAGAAGAAG	0.552																																					p.E178K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G532A	1						.						37.0	41.0	40.0					1																	248436585		2200	4289	6489	246503208	SO:0001583	missense	391195	exon1				CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.532G>A	1.37:g.248436585C>T	ENSP00000324687:p.Glu178Lys	Somatic		Capture	Illumina HiSeq	Phase_I	246503208	NM_001004695	B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	14.51	2.556107	0.45487	.	.	ENSG00000177212	ENST00000318021	T	0.00202	8.56	1.86	1.86	0.25419	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35495	U	0.003180	T	0.00695	0.0023	H	0.94925	3.6	0.39781	D	0.972299	D	0.89917	1.0	D	0.65874	0.939	T	0.61312	-0.7088	10	0.87932	D	0	.	12.3733	0.55265	0.0:1.0:0.0:0.0	.	178	Q8NG76	O2T33_HUMAN	K	178	ENSP00000324687:E178K	ENSP00000324687:E178K	E	-	1	0	OR2T33	246503208	1.000000	0.71417	0.961000	0.40146	0.163000	0.22366	2.197000	0.42696	1.338000	0.45544	0.494000	0.49563	GAG		0.552	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
EPB41L1	2036	broad.mit.edu	37	20	34797463	34797463	+	Silent	SNP	G	G	C			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr20:34797463G>C	ENST00000338074.2	+	15	1883	c.1722G>C	c.(1720-1722)cgG>cgC	p.R574R	EPB41L1_ENST00000479336.1_3'UTR|EPB41L1_ENST00000202028.5_Silent_p.R500R|EPB41L1_ENST00000373941.1_Silent_p.R574R|EPB41L1_ENST00000373950.2_Silent_p.R465R|EPB41L1_ENST00000373946.3_Intron|EPB41L1_ENST00000441639.1_Silent_p.R500R	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	574					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.R574R(1)|p.R863R(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CACGTCCCCGGGCCCCAGAGA	0.592																																					p.R574R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1722C	20						.						73.0	72.0	73.0					20																	34797463		2203	4300	6503	34260877	SO:0001819	synonymous_variant	2036	exon15			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1722G>C	20.37:g.34797463G>C		Somatic		Capture	Illumina HiSeq	Phase_I	34260877	NM_012156	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	ENST00000338074.2	37	CCDS13271.1																																																																																				0.592	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
HAO1	54363	broad.mit.edu	37	20	7915152	7915152	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr20:7915152C>T	ENST00000378789.3	-	2	319	c.268G>A	c.(268-270)Ggc>Agc	p.G90S		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	90	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.G90S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GCAAGCTCGCCGTCCACATGA	0.522																																					p.G90S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G268A	20						.						102.0	93.0	96.0					20																	7915152		2203	4300	6503	7863152	SO:0001583	missense	54363	exon2			AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.268G>A	20.37:g.7915152C>T	ENSP00000368066:p.Gly90Ser	Somatic		Capture	Illumina HiSeq	Phase_I	7863152	NM_017545	Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	ENST00000378789.3	37	CCDS13100.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373238	0.82573	.	.	ENSG00000101323	ENST00000378789	T	0.36340	1.26	5.96	5.96	0.96718	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.71022	0.3291	M	0.93106	3.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77242	-0.2660	10	0.87932	D	0	-0.9848	19.1831	0.93630	0.0:1.0:0.0:0.0	.	90;90	A8K058;Q9UJM8	.;HAOX1_HUMAN	S	90	ENSP00000368066:G90S	ENSP00000368066:G90S	G	-	1	0	HAO1	7863152	1.000000	0.71417	0.929000	0.37066	0.156000	0.22039	6.586000	0.74067	2.827000	0.97445	0.655000	0.94253	GGC		0.522	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
SALL4	57167	broad.mit.edu	37	20	50408410	50408410	+	Silent	SNP	G	G	A	rs367890518		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr20:50408410G>A	ENST00000217086.4	-	2	723	c.612C>T	c.(610-612)ccC>ccT	p.P204P	SALL4_ENST00000371539.3_Intron|SALL4_ENST00000395997.3_Silent_p.P204P|SALL4_ENST00000483130.1_5'Flank	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	204					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P204P(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CACCAGGCACGGGGGCAGGGA	0.612																																					p.P204P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C612T	20						.	G		0,4406		0,0,2203	80.0	81.0	81.0		612	-3.9	0.2	20		81	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SALL4	NM_020436.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		204/1054	50408410	1,13005	2203	4300	6503	49841817	SO:0001819	synonymous_variant	57167	exon2			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.612C>T	20.37:g.50408410G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49841817	NM_020436	A2A2D8|Q540H3|Q6Y8G6	Silent	SNP	ENST00000217086.4	37	CCDS13438.1																																																																																				0.612	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
PXDN	7837	broad.mit.edu	37	2	1657519	1657519	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr2:1657519C>T	ENST00000252804.4	-	16	2035	c.1985G>A	c.(1984-1986)cGg>cAg	p.R662Q		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	662					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.R662Q(1)|p.R662P(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CCTCGGATACCGGAACAAGGC	0.458																																					p.R662Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1985A	2						.						56.0	56.0	56.0					2																	1657519		1890	4118	6008	1636526	SO:0001583	missense	7837	exon16			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1985G>A	2.37:g.1657519C>T	ENSP00000252804:p.Arg662Gln	Somatic		Capture	Illumina HiSeq	Phase_I	1636526	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.151834|5.151834	0.94645|0.94645	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000433670|ENST00000252804	.|T	.|0.63255	.|-0.03	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77123|0.77123	0.4084|0.4084	M|M	0.64567|0.64567	1.98|1.98	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.997	.|D;P	.|0.67900	.|0.954;0.775	T|T	0.79145|0.79145	-0.1924|-0.1924	5|10	.|0.72032	.|D	.|0.01	-48.4435|-48.4435	19.0184|19.0184	0.92903|0.92903	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|662;662	.|Q92626-2;Q92626	.|.;PXDN_HUMAN	S|Q	658|662	.|ENSP00000252804:R662Q	.|ENSP00000252804:R662Q	G|R	-|-	1|2	0|0	PXDN|PXDN	1636526|1636526	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.615000|0.615000	0.37417|0.37417	7.702000|7.702000	0.84576|0.84576	2.570000|2.570000	0.86706|0.86706	0.585000|0.585000	0.79938|0.79938	GGT|CGG		0.458	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
SCN9A	6335	broad.mit.edu	37	2	167138262	167138262	+	Silent	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr2:167138262C>T	ENST00000409435.1	-	12	2030	c.2031G>A	c.(2029-2031)gaG>gaA	p.E677E	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Silent_p.E678E|SCN9A_ENST00000375387.4_Silent_p.E678E|SCN9A_ENST00000409672.1_Silent_p.E666E			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	677					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.E666E(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCAGCATATCCTCTGAAAGGA	0.358																																					p.E666E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1998A	2						.						180.0	176.0	177.0					2																	167138262		1889	4124	6013	166846508	SO:0001819	synonymous_variant	6335	exon13			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.2031G>A	2.37:g.167138262C>T		Somatic		Capture	Illumina HiSeq	Phase_I	166846508	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	ENST00000409435.1	37	CCDS46441.1																																																																																				0.358	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
SH3YL1	26751	broad.mit.edu	37	2	234162	234162	+	Silent	SNP	T	T	C			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr2:234162T>C	ENST00000405430.1	-	7	778	c.402A>G	c.(400-402)ggA>ggG	p.G134G	SH3YL1_ENST00000468321.1_5'UTR|SH3YL1_ENST00000403657.1_Silent_p.G38G|SH3YL1_ENST00000356150.5_Silent_p.G134G|SH3YL1_ENST00000403712.2_Silent_p.G134G|SH3YL1_ENST00000415006.2_Silent_p.G38G|SH3YL1_ENST00000403658.1_Silent_p.G38G			Q96HL8	SH3Y1_HUMAN	SH3 and SYLF domain containing 1	134					phosphatidylinositol biosynthetic process (GO:0006661)|regulation of ruffle assembly (GO:1900027)	ruffle membrane (GO:0032587)	phosphatase binding (GO:0019902)|phosphatidylinositol binding (GO:0035091)	p.G38G(1)		large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)		GAACTCACCTTCCCAAGGGCC	0.383																																					p.G134G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A402G	2						.						104.0	104.0	104.0					2																	234162		1833	4080	5913	224162	SO:0001819	synonymous_variant	26751	exon5				CCDS42646.1, CCDS42646.2, CCDS54332.1, CCDS62841.1	2p25.3	2013-10-18	2013-10-18		ENSG00000035115	ENSG00000035115			29546	protein-coding gene	gene with protein product			"""SH3 domain containing, Ysc84-like 1 (S. cerevisiae)"""			21624956	Standard	NM_001282687		Approved	Ray, DKFZP586F1318	uc002qvx.3	Q96HL8	OTTHUMG00000151359	ENST00000405430.1:c.402A>G	2.37:g.234162T>C		Somatic		Capture	Illumina HiSeq	Phase_I	224162	NM_015677	A8K8E7|B7WNJ4|B7WPL6|Q8NEL2|Q9H5X4|Q9Y3V5	Silent	SNP	ENST00000405430.1	37																																																																																					0.383	SH3YL1-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322352.1	NM_015677	
C2orf70	339778	broad.mit.edu	37	2	26802269	26802269	+	Missense_Mutation	SNP	G	G	A	rs182908309		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr2:26802269G>A	ENST00000329615.3	+	4	600	c.569G>A	c.(568-570)cGg>cAg	p.R190Q	C2orf70_ENST00000409392.1_Silent_p.A177A|CIB4_ENST00000405346.3_5'Flank	NM_001105519.1	NP_001098989.1	A6NJV1	CB070_HUMAN	chromosome 2 open reading frame 70	190						nucleus (GO:0005634)		p.R190Q(1)		breast(3)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	13						CCACAGGAGCGGAAAAAGAGA	0.527													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21904	0.0		0.0	False		,,,				2504	0.0				p.R190Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G569A	2						.						98.0	100.0	99.0					2																	26802269		1910	4139	6049	26655773	SO:0001583	missense	339778	exon4				CCDS42661.1	2p23.3	2011-05-09			ENSG00000173557	ENSG00000173557			27938	protein-coding gene	gene with protein product	"""hypothetical protein LOC339778"""						Standard	NM_001105519		Approved	LOC339778	uc010eyn.3	A6NJV1	OTTHUMG00000151994	ENST00000329615.3:c.569G>A	2.37:g.26802269G>A	ENSP00000332875:p.Arg190Gln	Somatic		Capture	Illumina HiSeq	Phase_I	26655773	NM_001105519		Missense_Mutation	SNP	ENST00000329615.3	37	CCDS42661.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	15.26	2.780547	0.49891	.	.	ENSG00000173557	ENST00000329615	T	0.37584	1.19	5.3	4.39	0.52855	.	0.125901	0.34002	N	0.004355	T	0.51753	0.1693	M	0.75447	2.3	0.49915	D	0.999837	D	0.76494	0.999	P	0.56788	0.806	T	0.56086	-0.8037	10	0.66056	D	0.02	-25.5188	11.3638	0.49660	0.0:0.0:0.8201:0.1799	.	190	A6NJV1	CB070_HUMAN	Q	190	ENSP00000332875:R190Q	ENSP00000332875:R190Q	R	+	2	0	C2orf70	26655773	0.999000	0.42202	0.889000	0.34880	0.105000	0.19272	3.760000	0.55235	2.493000	0.84123	0.655000	0.94253	CGG		0.527	C2orf70-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353258.1	NM_001105519	
CLIP4	79745	broad.mit.edu	37	2	29356592	29356592	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr2:29356592C>T	ENST00000320081.5	+	5	694	c.439C>T	c.(439-441)Cgc>Tgc	p.R147C	CLIP4_ENST00000401617.2_Missense_Mutation_p.R40C|CLIP4_ENST00000401605.1_Missense_Mutation_p.R147C|CLIP4_ENST00000404424.1_Missense_Mutation_p.R147C	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	147								p.R147C(1)		endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					TTTGCGGAGTCGCTGGACAAA	0.368																																					p.R147C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C439T	2						.						126.0	118.0	121.0					2																	29356592		2203	4300	6503	29210096	SO:0001583	missense	79745	exon5			AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.439C>T	2.37:g.29356592C>T	ENSP00000327009:p.Arg147Cys	Somatic		Capture	Illumina HiSeq	Phase_I	29210096	NM_024692	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Missense_Mutation	SNP	ENST00000320081.5	37	CCDS1770.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.909199	0.92107	.	.	ENSG00000115295	ENST00000401605;ENST00000401617;ENST00000404424;ENST00000402240;ENST00000320081;ENST00000379543;ENST00000449202;ENST00000438819;ENST00000530644	T;T;T;T;T;T	0.53857	0.6;0.62;0.6;0.6;0.6;0.6	5.55	5.55	0.83447	Ankyrin repeat-containing domain (4);	0.107305	0.64402	D	0.000003	T	0.64875	0.2638	L	0.38649	1.16	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.65874	0.911;0.939	T	0.67169	-0.5738	10	0.87932	D	0	.	19.5055	0.95113	0.0:1.0:0.0:0.0	.	147;147	A8K6D0;Q8N3C7	.;CLIP4_HUMAN	C	147;40;147;147;147;148;147;40;129	ENSP00000384242:R147C;ENSP00000385148:R40C;ENSP00000385594:R147C;ENSP00000327009:R147C;ENSP00000393354:R147C;ENSP00000392296:R40C	ENSP00000327009:R147C	R	+	1	0	CLIP4	29210096	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.764000	0.85297	2.604000	0.88044	0.650000	0.86243	CGC		0.368	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692	
CTNNA2	1496	broad.mit.edu	37	2	80101324	80101324	+	Silent	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr2:80101324G>A	ENST00000402739.4	+	5	713	c.708G>A	c.(706-708)acG>acA	p.T236T	CTNNA2_ENST00000496558.1_Silent_p.T236T|CTNNA2_ENST00000541047.1_Silent_p.T236T|CTNNA2_ENST00000466387.1_Silent_p.T236T|CTNNA2_ENST00000361291.4_Silent_p.T270T|CTNNA2_ENST00000540488.1_Silent_p.T236T	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	236					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.T236T(2)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						TCGCCGCTACGAGAGCCAACC	0.587																																					p.T236T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G708A	2						.						51.0	54.0	53.0					2																	80101324		2070	4215	6285	79954832	SO:0001819	synonymous_variant	1496	exon6				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.708G>A	2.37:g.80101324G>A		Somatic		Capture	Illumina HiSeq	Phase_I	79954832	NM_004389	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Silent	SNP	ENST00000402739.4	37																																																																																					0.587	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
PAX3	5077	broad.mit.edu	37	2	223161823	223161823	+	Silent	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr2:223161823G>A	ENST00000350526.4	-	2	331	c.195C>T	c.(193-195)caC>caT	p.H65H	PAX3_ENST00000392069.2_Silent_p.H65H|PAX3_ENST00000392070.2_Silent_p.H65H|CCDC140_ENST00000295226.1_5'Flank|PAX3_ENST00000336840.6_Silent_p.H65H|PAX3_ENST00000409551.3_Silent_p.H65H|PAX3_ENST00000409828.3_Silent_p.H65H|PAX3_ENST00000258387.5_Silent_p.H65H|PAX3_ENST00000344493.4_Silent_p.H65H	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	65	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.		Missing (in WS1). {ECO:0000269|PubMed:1347148}.		apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H65H(1)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCCGGATGCCGTGGTGGGCCA	0.657			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.H65H			Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C195T	2						.						35.0	33.0	34.0					2																	223161823		2202	4298	6500	222870067	SO:0001819	synonymous_variant	5077	exon2				CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.195C>T	2.37:g.223161823G>A		Somatic		Capture	Illumina HiSeq	Phase_I	222870067	NM_000438	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Silent	SNP	ENST00000350526.4	37	CCDS42826.1																																																																																				0.657	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
PARP15	165631	broad.mit.edu	37	3	122335947	122335947	+	Silent	SNP	T	T	C	rs140074948		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr3:122335947T>C	ENST00000464300.2	+	6	1002	c.936T>C	c.(934-936)gaT>gaC	p.D312D	PARP15_ENST00000483793.1_Silent_p.D186D|PARP15_ENST00000465304.1_3'UTR|PARP15_ENST00000493645.1_Silent_p.D78D|PARP15_ENST00000310366.4_Silent_p.D78D	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	312	Macro 2. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.D312D(1)|p.D78D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		CTACTGGAGATATAGCCACTG	0.353																																					p.D78D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T234C	3						.	T	,	0,4406		0,0,2203	155.0	151.0	152.0		936,234	-2.8	0.0	3	dbSNP_134	152	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PARP15	NM_001113523.1,NM_152615.1	,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,	312/679,78/445	122335947	1,13005	2203	4300	6503	123818637	SO:0001819	synonymous_variant	165631	exon2			AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.936T>C	3.37:g.122335947T>C		Somatic		Capture	Illumina HiSeq	Phase_I	123818637	NM_152615	J3KR47|Q8N1K3	Silent	SNP	ENST00000464300.2	37	CCDS46893.1																																																																																				0.353	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355964.2	NM_152615	
CNTN6	27255	broad.mit.edu	37	3	1425058	1425058	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr3:1425058G>T	ENST00000446702.2	+	19	3110	c.2483G>T	c.(2482-2484)tGg>tTg	p.W828L	CNTN6_ENST00000350110.2_Missense_Mutation_p.W828L|CNTN6_ENST00000539053.1_Missense_Mutation_p.W756L			Q9UQ52	CNTN6_HUMAN	contactin 6	828	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.W828L(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GCTATTGCCTGGAATAGAAAC	0.438																																					p.W828L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2483T	3						.						173.0	181.0	178.0					3																	1425058		2203	4300	6503	1400058	SO:0001583	missense	27255	exon19			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2483G>T	3.37:g.1425058G>T	ENSP00000407822:p.Trp828Leu	Somatic		Capture	Illumina HiSeq	Phase_I	1400058	NM_014461	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	37	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916495	0.73098	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.51574	0.7;0.7;0.7	5.74	5.74	0.90152	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000049	T	0.55449	0.1921	N	0.21373	0.66	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	T	0.44452	-0.9327	10	0.14252	T	0.57	.	19.9111	0.97025	0.0:0.0:1.0:0.0	.	828	Q9UQ52	CNTN6_HUMAN	L	828;756;828	ENSP00000407822:W828L;ENSP00000442791:W756L;ENSP00000341882:W828L	ENSP00000341882:W828L	W	+	2	0	CNTN6	1400058	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.342000	0.79310	2.728000	0.93425	0.585000	0.79938	TGG		0.438	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
DNAJC13	23317	broad.mit.edu	37	3	132172166	132172166	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr3:132172166G>A	ENST00000260818.6	+	7	810	c.562G>A	c.(562-564)Gaa>Aaa	p.E188K	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	188					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)		p.E188K(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						AGAGCAAAGAGAAGAGATTAT	0.343																																					p.E188K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G562A	3						.						44.0	45.0	44.0					3																	132172166		2203	4300	6503	133654856	SO:0001583	missense	23317	exon7			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.562G>A	3.37:g.132172166G>A	ENSP00000260818:p.Glu188Lys	Somatic		Capture	Illumina HiSeq	Phase_I	133654856	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.336838	0.81801	.	.	ENSG00000138246	ENST00000260818	T	0.39592	1.07	5.84	5.84	0.93424	.	0.067491	0.64402	D	0.000002	T	0.38719	0.1051	L	0.36672	1.1	0.80722	D	1	B;B	0.19817	0.015;0.039	B;B	0.17433	0.008;0.018	T	0.07578	-1.0765	10	0.35671	T	0.21	.	20.1454	0.98074	0.0:0.0:1.0:0.0	.	188;188	A7E2Y5;O75165	.;DJC13_HUMAN	K	188	ENSP00000260818:E188K	ENSP00000260818:E188K	E	+	1	0	DNAJC13	133654856	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.223000	0.95203	2.748000	0.94277	0.650000	0.86243	GAA		0.343	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
P2RY14	9934	broad.mit.edu	37	3	150931654	150931654	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr3:150931654G>T	ENST00000309170.3	-	3	763	c.451C>A	c.(451-453)Ctc>Atc	p.L151I	MED12L_ENST00000474524.1_Intron|P2RY14_ENST00000424796.2_Missense_Mutation_p.L151I|MED12L_ENST00000273432.4_Intron	NM_001081455.1|NM_014879.3	NP_001074924.1|NP_055694.3	Q15391	P2Y14_HUMAN	purinergic receptor P2Y, G-protein coupled, 14	151					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|UDP-activated nucleotide receptor activity (GO:0045029)	p.L151I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)	20			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACAGCAAGGAGGAGCATGAGC	0.393																																					p.L151I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C451A	3						.						125.0	115.0	119.0					3																	150931654		2203	4300	6503	152414344	SO:0001583	missense	9934	exon3			D13626	CCDS3156.1	3q21-q25	2012-08-08	2004-07-12	2004-07-14	ENSG00000174944	ENSG00000174944		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	16442	protein-coding gene	gene with protein product		610116	"""G protein-coupled receptor 105"""	GPR105			Standard	NM_014879		Approved	KIAA0001	uc003eys.1	Q15391	OTTHUMG00000159859	ENST00000309170.3:c.451C>A	3.37:g.150931654G>T	ENSP00000308361:p.Leu151Ile	Somatic		Capture	Illumina HiSeq	Phase_I	152414344	NM_014879	Q8IYT7	Missense_Mutation	SNP	ENST00000309170.3	37	CCDS3156.1	.	.	.	.	.	.	.	.	.	.	G	4.387	0.071487	0.08436	.	.	ENSG00000174944	ENST00000309170;ENST00000424796	T;T	0.43294	0.95;0.95	5.9	-2.6	0.06190	GPCR, rhodopsin-like superfamily (1);	0.376195	0.25497	N	0.030277	T	0.22551	0.0544	L	0.47716	1.5	0.09310	N	1	B	0.12630	0.006	B	0.18871	0.023	T	0.15954	-1.0419	10	0.12430	T	0.62	-9.8617	0.0457	0.00010	0.3035:0.1867:0.2269:0.2829	.	151	Q15391	P2Y14_HUMAN	I	151	ENSP00000308361:L151I;ENSP00000408733:L151I	ENSP00000308361:L151I	L	-	1	0	P2RY14	152414344	0.000000	0.05858	0.001000	0.08648	0.051000	0.14879	-2.539000	0.00937	-0.359000	0.08150	0.650000	0.86243	CTC		0.393	P2RY14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357789.1	NM_014879	
OTOL1	131149	broad.mit.edu	37	3	161221587	161221587	+	Missense_Mutation	SNP	G	G	A	rs370829105		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr3:161221587G>A	ENST00000327928.4	+	4	1291	c.1291G>A	c.(1291-1293)Gtc>Atc	p.V431I		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	431	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)		p.V431I(2)		central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						CTCTCTCCTCGTCATCTTGAA	0.488																																					p.V431I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1291A	3						.	G	ILE/VAL	1,3859		0,1,1929	51.0	49.0	50.0		1291	-0.2	0.3	3		50	0,8256		0,0,4128	no	missense	OTOL1	NM_001080440.1	29	0,1,6057	AA,AG,GG		0.0,0.0259,0.0083	benign	431/478	161221587	1,12115	1930	4128	6058	162704281	SO:0001583	missense	131149	exon4				CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.1291G>A	3.37:g.161221587G>A	ENSP00000330808:p.Val431Ile	Somatic		Capture	Illumina HiSeq	Phase_I	162704281	NM_001080440		Missense_Mutation	SNP	ENST00000327928.4	37	CCDS46948.1	.	.	.	.	.	.	.	.	.	.	G	4.782	0.145377	0.09134	2.59E-4	0.0	ENSG00000182447	ENST00000327928	T	0.78246	-1.16	5.24	-0.174	0.13319	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.610776	0.17590	N	0.168801	T	0.57330	0.2046	L	0.28192	0.835	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35151	-0.9800	10	0.13470	T	0.59	.	6.152	0.20316	0.4523:0.3939:0.1538:0.0	.	431	A6NHN0	OTOL1_HUMAN	I	431	ENSP00000330808:V431I	ENSP00000330808:V431I	V	+	1	0	OTOL1	162704281	0.000000	0.05858	0.324000	0.25361	0.780000	0.44128	0.352000	0.20113	-0.258000	0.09446	-0.339000	0.08088	GTC		0.488	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440	
RBMS3	27303	broad.mit.edu	37	3	29628656	29628656	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr3:29628656C>A	ENST00000383767.2	+	4	695	c.359C>A	c.(358-360)gCa>gAa	p.A120E	RBMS3_ENST00000383766.2_Missense_Mutation_p.A119E|RBMS3_ENST00000456853.1_Missense_Mutation_p.A120E|RBMS3_ENST00000452462.1_Missense_Mutation_p.A120E|RBMS3_ENST00000396583.3_Missense_Mutation_p.A120E|RBMS3_ENST00000434693.2_Missense_Mutation_p.A119E|RBMS3_ENST00000445033.1_Missense_Mutation_p.A120E|RBMS3_ENST00000273139.9_Missense_Mutation_p.A120E			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	120	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)	p.A120E(1)		breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				AAAGCGGTAGCATCTCTCAAG	0.393																																					p.A120E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C359A	3						.						124.0	131.0	129.0					3																	29628656		2203	4300	6503	29603660	SO:0001583	missense	27303	exon4			AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.359C>A	3.37:g.29628656C>A	ENSP00000373277:p.Ala120Glu	Somatic		Capture	Illumina HiSeq	Phase_I	29603660	NM_001003793	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.584913	0.46110	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000445033;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48	5.77	5.77	0.91146	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.122449	0.53938	D	0.000046	T	0.09024	0.0223	N	0.05383	-0.06	0.45662	D	0.998589	B;B;B;B	0.14438	0.003;0.0;0.01;0.004	B;B;B;B	0.16289	0.004;0.007;0.015;0.007	T	0.34700	-0.9818	9	.	.	.	.	19.9655	0.97263	0.0:1.0:0.0:0.0	.	120;120;119;120	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	E	119;120;120;120;120;119;120;120	ENSP00000395592:A119E;ENSP00000379828:A120E;ENSP00000373277:A120E;ENSP00000391934:A120E;ENSP00000273139:A120E;ENSP00000373276:A119E;ENSP00000397926:A120E;ENSP00000400519:A120E	.	A	+	2	0	RBMS3	29603660	1.000000	0.71417	0.945000	0.38365	0.993000	0.82548	4.520000	0.60524	2.732000	0.93576	0.542000	0.68232	GCA		0.393	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
SUSD5	26032	broad.mit.edu	37	3	33249325	33249325	+	Nonsense_Mutation	SNP	G	G	C	rs368923559		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr3:33249325G>C	ENST00000309558.3	-	3	801	c.384C>G	c.(382-384)taC>taG	p.Y128*		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	128	Link. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)	p.Y128*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						AAAGGGCACTGTATGTGCCAC	0.463																																					p.Y128X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C384G	3						.						148.0	142.0	144.0					3																	33249325		1969	4162	6131	33224329	SO:0001587	stop_gained	26032	exon3			AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.384C>G	3.37:g.33249325G>C	ENSP00000308727:p.Tyr128*	Somatic		Capture	Illumina HiSeq	Phase_I	33224329	NM_015551		Nonsense_Mutation	SNP	ENST00000309558.3	37	CCDS46787.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.28|19.28	3.797605|3.797605	0.70567|0.70567	.|.	.|.	ENSG00000173705|ENSG00000173705	ENST00000412539|ENST00000309558	.|.	.|.	.|.	5.46|5.46	3.65|3.65	0.41850|0.41850	.|.	.|0.481200	.|0.22071	.|N	.|0.065024	T|.	0.25044|.	0.0608|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.29119|.	-1.0022|.	3|.	.|0.02654	.|T	.|1	-6.8203|-6.8203	10.333|10.333	0.43833|0.43833	0.1661:0.0:0.8339:0.0|0.1661:0.0:0.8339:0.0	.|.	.|.	.|.	.|.	R|X	127|128	.|.	.|ENSP00000308727:Y128X	T|Y	-|-	2|3	0|2	SUSD5|SUSD5	33224329|33224329	0.969000|0.969000	0.33509|0.33509	0.054000|0.054000	0.19295|0.19295	0.676000|0.676000	0.39594|0.39594	1.533000|1.533000	0.36040|0.36040	1.452000|1.452000	0.47756|0.47756	-0.136000|-0.136000	0.14681|0.14681	ACA|TAC		0.463	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341902.1	XM_171054	
PROK2	60675	broad.mit.edu	37	3	71821948	71821948	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr3:71821948G>A	ENST00000295619.3	-	4	325	c.317C>T	c.(316-318)aCt>aTt	p.T106I	PROK2_ENST00000353065.3_Missense_Mutation_p.T85I	NM_001126128.1	NP_001119600.1	Q9HC23	PROK2_HUMAN	prokineticin 2	106					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of smooth muscle contraction (GO:0045987)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	G-protein coupled receptor binding (GO:0001664)	p.T85I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		ACATGGGCAAGTGTGATGCAT	0.403																																					p.T106I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C317T	3						.						73.0	79.0	77.0					3																	71821948		2203	4300	6503	71904638	SO:0001583	missense	60675	exon4			AF333025	CCDS2916.1, CCDS46868.1	3p21.1	2013-02-28			ENSG00000163421	ENSG00000163421		"""Endogenous ligands"""	18455	protein-coding gene	gene with protein product	"""protein Bv8 homolog"""	607002				11054548, 11259612	Standard	NM_021935		Approved	PK2, BV8, MIT1, KAL4	uc003dpa.4	Q9HC23	OTTHUMG00000158809	ENST00000295619.3:c.317C>T	3.37:g.71821948G>A	ENSP00000295619:p.Thr106Ile	Somatic		Capture	Illumina HiSeq	Phase_I	71904638	NM_001126128	Q53Z79|Q6ISR0	Missense_Mutation	SNP	ENST00000295619.3	37	CCDS46868.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385186	0.82792	.	.	ENSG00000163421	ENST00000353065;ENST00000295619	D;D	0.85955	-2.05;-2.05	5.85	5.85	0.93711	Prokineticin domain (2);	0.062472	0.64402	N	0.000005	D	0.91643	0.7359	M	0.74467	2.265	0.49798	D	0.999828	D;D	0.89917	1.0;0.997	D;D	0.81914	0.995;0.918	D	0.91300	0.5066	10	0.51188	T	0.08	-20.8471	15.1275	0.72494	0.0:0.142:0.8579:0.0	.	106;85	Q9HC23;Q6ISR0	PROK2_HUMAN;.	I	85;106	ENSP00000295618:T85I;ENSP00000295619:T106I	ENSP00000295619:T106I	T	-	2	0	PROK2	71904638	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	6.212000	0.72188	2.773000	0.95371	0.650000	0.86243	ACT		0.403	PROK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352302.1	NM_001126128	
GABRR3	200959	broad.mit.edu	37	3	97705699	97705699	+	RNA	SNP	G	G	A	rs376960773		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr3:97705699G>A	ENST00000472788.1	-	0	1233					NM_001105580.2	NP_001099050.1	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 3 (gene/pseudogene)						gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.S91L(1)		large_intestine(2)|lung(1)	3					Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	GCTGCATATCGATTTTCTTCT	0.438																																					p.S411L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1232T	3						.	G	LEU/SER	0,3762		0,0,1881	76.0	68.0	70.0		1232	-6.9	0.0	3		70	2,8206		0,2,4102	no	missense	GABRR3	NM_001105580.2	145	0,2,5983	AA,AG,GG		0.0244,0.0,0.0167	benign	411/468	97705699	2,11968	1881	4104	5985	99188389			200959	exon9			Y18994	CCDS54617.1	3q11.2	2014-03-25	2014-03-25		ENSG00000183185	ENSG00000183185		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	17969	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 3"""		"""gamma-aminobutyric acid (GABA) receptor, rho 3"", ""gamma-aminobutyric acid (GABA) A receptor, rho 3"""			10542332	Standard	NM_001105580		Approved		uc021xbp.1	A8MPY1	OTTHUMG00000159135		3.37:g.97705699G>A		Somatic		Capture	Illumina HiSeq	Phase_I	99188389	NM_001105580	Q9UIV9	Missense_Mutation	SNP	ENST00000472788.1	37																																																																																					0.438	GABRR3-002	KNOWN	not_organism_supported|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000353445.2		
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,urinary_tract,bladder,Substitution - Missense,0 	.	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A	3						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	180418785	SO:0001583	missense	5290	exon10				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		Capture	Illumina HiSeq	Phase_I	180418785	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
REST	5978	broad.mit.edu	37	4	57798034	57798034	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr4:57798034G>A	ENST00000309042.7	+	4	3324	c.3010G>A	c.(3010-3012)Gaa>Aaa	p.E1004K		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	1004					cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.E1004K(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					TGAGTCTCAGGAAATTGATGA	0.493																																					p.E1004K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3010A	4						.						73.0	67.0	69.0					4																	57798034		2203	4300	6503	57492791	SO:0001583	missense	5978	exon4			U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.3010G>A	4.37:g.57798034G>A	ENSP00000311816:p.Glu1004Lys	Somatic		Capture	Illumina HiSeq	Phase_I	57492791	NM_001193508	A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Missense_Mutation	SNP	ENST00000309042.7	37	CCDS3509.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.912378	0.92178	.	.	ENSG00000084093	ENST00000309042;ENST00000358605	T	0.39406	1.08	6.17	5.32	0.75619	.	0.000000	0.48286	D	0.000199	T	0.62901	0.2466	M	0.62723	1.935	0.46823	D	0.999211	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.922	T	0.66590	-0.5885	10	0.72032	D	0.01	-30.4382	16.4846	0.84181	0.0:0.0:0.8679:0.1321	.	981;1004	F8WAN5;Q13127	.;REST_HUMAN	K	1004;981	ENSP00000311816:E1004K	ENSP00000311816:E1004K	E	+	1	0	REST	57492791	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.549000	0.73900	1.575000	0.49775	0.655000	0.94253	GAA		0.493	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612	
FGG	2266	broad.mit.edu	37	4	155529761	155529761	+	Silent	SNP	T	T	C			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr4:155529761T>C	ENST00000336098.3	-	7	746	c.708A>G	c.(706-708)caA>caG	p.Q236Q	FGG_ENST00000404648.3_Silent_p.Q236Q|FGG_ENST00000405164.1_Silent_p.Q244Q|FGG_ENST00000407946.1_Silent_p.Q244Q	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	236	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)	p.Q236Q(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	CTTCTTTATATTGAATCCAGT	0.373																																					p.Q236Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A708G	4						.						92.0	92.0	92.0					4																	155529761		2203	4300	6503	155749211	SO:0001819	synonymous_variant	2266	exon7				CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.708A>G	4.37:g.155529761T>C		Somatic		Capture	Illumina HiSeq	Phase_I	155749211	NM_021870	A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Silent	SNP	ENST00000336098.3	37	CCDS3788.1																																																																																				0.373	FGG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317581.1	NM_021870	
DNAH5	1767	broad.mit.edu	37	5	13885265	13885265	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr5:13885265G>A	ENST00000265104.4	-	19	2920	c.2816C>T	c.(2815-2817)aCg>aTg	p.T939M	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	939	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T939M(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CGTGACTGTCGTCAAAAGCAG	0.413									Kartagener syndrome																												p.T939M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2816T	5						.						93.0	93.0	93.0					5																	13885265		2203	4300	6503	13938265	SO:0001583	missense	1767	exon19	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2816C>T	5.37:g.13885265G>A	ENSP00000265104:p.Thr939Met	Somatic		Capture	Illumina HiSeq	Phase_I	13938265	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	5.103	0.204553	0.09704	.	.	ENSG00000039139	ENST00000265104	T	0.24350	1.86	5.73	1.82	0.25136	.	0.878985	0.10378	N	0.681925	T	0.15998	0.0385	N	0.16478	0.41	0.09310	N	1	B	0.16166	0.016	B	0.09377	0.004	T	0.24693	-1.0153	10	0.42905	T	0.14	.	9.6025	0.39612	0.2953:0.0:0.7047:0.0	.	939	Q8TE73	DYH5_HUMAN	M	939	ENSP00000265104:T939M	ENSP00000265104:T939M	T	-	2	0	DNAH5	13938265	0.008000	0.16893	0.000000	0.03702	0.018000	0.09664	1.540000	0.36115	0.309000	0.22966	0.655000	0.94253	ACG		0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
PCDHA7	56141	broad.mit.edu	37	5	140215892	140215892	+	Missense_Mutation	SNP	G	G	A	rs148995786		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr5:140215892G>A	ENST00000525929.1	+	1	1924	c.1924G>A	c.(1924-1926)Gca>Aca	p.A642T	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.A642T|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	642	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A642T(2)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGACGGACGCACCGCGCCA	0.662																																					p.A642T	NSCLC(160;258 2013 5070 22440 28951)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1924A	5						.	G	,,,,,,THR/ALA,,,THR/ALA	0,4406		0,0,2203	74.0	78.0	77.0		,,,,,,1924,,,1924	2.7	0.4	5	dbSNP_134	77	4,8594	3.7+/-12.6	0,4,4295	yes	intron,intron,intron,intron,intron,intron,missense,intron,intron,missense	PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_031411.1,NM_031849.1,NM_031852.1	,,,,,,58,,,58	0,4,6498	AA,AG,GG		0.0465,0.0,0.0308	,,,,,,,,,	,,,,,,642/938,,,642/790	140215892	4,13000	2203	4299	6502	140196076	SO:0001583	missense	56141	exon1			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1924G>A	5.37:g.140215892G>A	ENSP00000436426:p.Ala642Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140196076	NM_018910	O75282	Missense_Mutation	SNP	ENST00000525929.1	37	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.132961	0.37630	0.0	4.65E-4	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.50001	0.76;0.76	3.57	2.66	0.31614	Cadherin (4);Cadherin-like (1);	2.380280	0.04541	U	0.388110	T	0.54303	0.1850	L	0.33093	0.98	0.09310	N	1	D;P	0.56746	0.977;0.869	P;B	0.54815	0.761;0.329	T	0.51560	-0.8690	10	0.59425	D	0.04	.	12.2341	0.54505	0.0:0.0:0.8282:0.1718	.	642;642	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	T	642	ENSP00000436426:A642T;ENSP00000367365:A642T	ENSP00000367365:A642T	A	+	1	0	PCDHA7	140196076	0.000000	0.05858	0.353000	0.25747	0.157000	0.22087	-0.656000	0.05342	0.776000	0.33473	0.462000	0.41574	GCA		0.662	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCDHGA2	56113	broad.mit.edu	37	5	140719142	140719142	+	Missense_Mutation	SNP	C	C	A	rs377473177		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr5:140719142C>A	ENST00000394576.2	+	1	604	c.604C>A	c.(604-606)Cgc>Agc	p.R202S	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	202	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R202S(1)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTCTGGACCGCGAGGAAGA	0.592																																					p.R202S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C604A	5						.						84.0	80.0	82.0					5																	140719142		2203	4300	6503	140699326	SO:0001583	missense	56113	exon1			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.604C>A	5.37:g.140719142C>A	ENSP00000378077:p.Arg202Ser	Somatic		Capture	Illumina HiSeq	Phase_I	140699326	NM_032009	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	13.04	2.118829	0.37436	.	.	ENSG00000081853	ENST00000394576	T	0.59638	0.25	5.26	3.45	0.39498	Cadherin (4);Cadherin-like (1);	0.000000	0.40144	U	0.001174	D	0.83917	0.5358	H	0.98664	4.295	0.28760	N	0.900959	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81714	-0.0807	10	0.87932	D	0	.	12.1727	0.54167	0.1357:0.7339:0.1304:0.0	.	202;202	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	S	202	ENSP00000378077:R202S	ENSP00000378077:R202S	R	+	1	0	PCDHGA2	140699326	0.609000	0.26975	0.994000	0.49952	0.004000	0.04260	1.142000	0.31540	0.694000	0.31654	-0.165000	0.13383	CGC		0.592	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
FOXI1	2299	broad.mit.edu	37	5	169535060	169535060	+	Silent	SNP	G	G	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr5:169535060G>T	ENST00000306268.6	+	2	643	c.582G>T	c.(580-582)ggG>ggT	p.G194G	FOXI1_ENST00000449804.2_Intron			Q12951	FOXI1_HUMAN	forkhead box I1	194					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G194G(1)		breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGGCAAAGGGAATTACTGGA	0.428									Pendred syndrome																												p.G194G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G582T	5						.						69.0	66.0	67.0					5																	169535060		2203	4300	6503	169467638	SO:0001819	synonymous_variant	2299	exon2	Familial Cancer Database	Goiter-Deafness syndrome	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.582G>T	5.37:g.169535060G>T		Somatic		Capture	Illumina HiSeq	Phase_I	169467638	NM_012188	Q14518|Q66SR7|Q8N6L8	Silent	SNP	ENST00000306268.6	37	CCDS4372.1																																																																																				0.428	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188	
NDUFS6	4726	broad.mit.edu	37	5	1815980	1815980	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr5:1815980A>G	ENST00000274137.5	+	4	343	c.325A>G	c.(325-327)Acc>Gcc	p.T109A		NM_004553.4	NP_004544.1	O75380	NDUS6_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)	109					cardiovascular system development (GO:0072358)|cellular metabolic process (GO:0044237)|fatty acid metabolic process (GO:0006631)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrion morphogenesis (GO:0070584)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|muscle contraction (GO:0006936)|reproductive system development (GO:0061458)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.T109A(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	7						AGAAACAAAAACCGGCACATG	0.443																																					p.T109A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A325G	5						.						59.0	65.0	63.0					5																	1815980		2203	4300	6503	1868980	SO:0001583	missense	4726	exon4			BC038664	CCDS3866.1	5p15.33	2011-07-04	2002-08-29		ENSG00000145494	ENSG00000145494	1.6.99.3, 1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7713	protein-coding gene	gene with protein product	"""complex I 13kDa subunit A"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 6, mitochondrial"""	603848	"""NADH dehydrogenase (ubiquinone) Fe-S protein 6 (13kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004553		Approved	CI-13kA	uc003jcy.3	O75380	OTTHUMG00000090372	ENST00000274137.5:c.325A>G	5.37:g.1815980A>G	ENSP00000274137:p.Thr109Ala	Somatic		Capture	Illumina HiSeq	Phase_I	1868980	NM_004553		Missense_Mutation	SNP	ENST00000274137.5	37	CCDS3866.1	.	.	.	.	.	.	.	.	.	.	A	6.374	0.437084	0.12104	.	.	ENSG00000145494	ENST00000274137	T	0.75477	-0.94	4.44	4.44	0.53790	Zinc finger, CHCC-type (2);	0.228532	0.45867	D	0.000338	T	0.61085	0.2319	L	0.38531	1.155	0.80722	D	1	B	0.31026	0.304	B	0.23574	0.047	T	0.58070	-0.7701	10	0.18276	T	0.48	-8.5127	13.0286	0.58829	1.0:0.0:0.0:0.0	.	109	O75380	NDUS6_HUMAN	A	109	ENSP00000274137:T109A	ENSP00000274137:T109A	T	+	1	0	NDUFS6	1868980	1.000000	0.71417	0.010000	0.14722	0.018000	0.09664	3.997000	0.57016	1.772000	0.52199	0.529000	0.55759	ACC		0.443	NDUFS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206744.2	NM_004553	
EDIL3	10085	broad.mit.edu	37	5	83360653	83360653	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr5:83360653C>T	ENST00000296591.5	-	8	1236	c.818G>A	c.(817-819)gGa>gAa	p.G273E	EDIL3_ENST00000510271.1_5'UTR|EDIL3_ENST00000380138.3_Missense_Mutation_p.G263E	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	273	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.G273E(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		ATCAATGTTTCCACGAAACAC	0.343																																					p.G273E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G818A	5						.						119.0	120.0	120.0					5																	83360653		2203	4300	6503	83396409	SO:0001583	missense	10085	exon8			U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.818G>A	5.37:g.83360653C>T	ENSP00000296591:p.Gly273Glu	Somatic		Capture	Illumina HiSeq	Phase_I	83396409	NM_005711	B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	37	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.182102	0.57800	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.99436	-5.9;-5.9	5.51	4.62	0.57501	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.045944	0.85682	D	0.000000	D	0.99743	0.9898	H	0.97806	4.08	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.96920	0.9673	10	0.87932	D	0	-20.3523	16.5223	0.84320	0.0:0.869:0.131:0.0	.	50;263;273	B7Z865;O43854-2;O43854	.;.;EDIL3_HUMAN	E	273;263	ENSP00000296591:G273E;ENSP00000369483:G263E	ENSP00000296591:G273E	G	-	2	0	EDIL3	83396409	1.000000	0.71417	1.000000	0.80357	0.219000	0.24729	7.421000	0.80204	1.413000	0.46997	0.460000	0.39030	GGA		0.343	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711	
FBXW11	23291	broad.mit.edu	37	5	171341397	171341397	+	Intron	SNP	T	T	C			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr5:171341397T>C	ENST00000265094.5	-	3	285				FBXW11_ENST00000296933.6_Missense_Mutation_p.M20V|FBXW11_ENST00000425623.2_Start_Codon_SNP_p.M1V|FBXW11_ENST00000393802.2_Intron	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.M20V(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGATCTTCCATAACTGAAGTG	0.353																																					p.M20V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A58G	5						.						95.0	82.0	86.0					5																	171341397		1819	4077	5896	171274002	SO:0001627	intron_variant	23291	exon2			AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.148-3596A>G	5.37:g.171341397T>C		Somatic		Capture	Illumina HiSeq	Phase_I	171274002	NM_033644	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Missense_Mutation	SNP	ENST00000265094.5	37	CCDS34289.1	.	.	.	.	.	.	.	.	.	.	T	14.01	2.407111	0.42715	.	.	ENSG00000072803	ENST00000296933;ENST00000425623;ENST00000517395;ENST00000518752	T;T;T	0.58060	0.42;0.36;0.95	4.96	4.96	0.65561	.	.	.	.	.	T	0.30324	0.0761	.	.	.	0.80722	D	1	B;B	0.12630	0.006;0.001	B;B	0.15870	0.014;0.001	T	0.15867	-1.0422	8	0.02654	T	1	.	13.1856	0.59680	0.0:0.0:0.0:1.0	.	1;20	B4DH70;Q9UKB1-3	.;.	V	20;1;54;16	ENSP00000296933:M20V;ENSP00000444929:M1V;ENSP00000428753:M54V	ENSP00000296933:M20V	M	-	1	0	FBXW11	171274002	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.786000	0.69006	1.993000	0.58246	0.528000	0.53228	ATG		0.353	FBXW11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372382.1	NM_012300	
GCNT2	2651	broad.mit.edu	37	6	10529838	10529838	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr6:10529838G>A	ENST00000379597.3	+	1	1250	c.694G>A	c.(694-696)Gtc>Atc	p.V232I	GCNT2_ENST00000495262.1_Missense_Mutation_p.V232I|GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)	232					maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.V232I(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		GACTAAATACGTCCACCAAGA	0.428																																					p.V232I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G694A	6						.						68.0	71.0	70.0					6																	10529838		2203	4300	6503	10637824	SO:0001583	missense	2651	exon3			L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.694G>A	6.37:g.10529838G>A	ENSP00000368917:p.Val232Ile	Somatic		Capture	Illumina HiSeq	Phase_I	10637824	NM_145649		Missense_Mutation	SNP	ENST00000379597.3	37	CCDS34338.1	.	.	.	.	.	.	.	.	.	.	G	7.286	0.610164	0.14066	.	.	ENSG00000111846	ENST00000495262;ENST00000379597	T;T	0.11385	2.78;2.78	5.75	2.41	0.29592	.	0.291478	0.29876	N	0.010976	T	0.02533	0.0077	L	0.49455	1.56	0.22127	N	0.999342	B;B	0.27910	0.193;0.193	B;B	0.25291	0.059;0.059	T	0.42032	-0.9475	10	0.09084	T	0.74	-28.8066	7.4647	0.27314	0.185:0.0:0.6822:0.1328	.	232;231	Q8N0V5;Q08M29	GNT2A_HUMAN;.	I	232	ENSP00000419411:V232I;ENSP00000368917:V232I	ENSP00000368917:V232I	V	+	1	0	GCNT2	10637824	0.619000	0.27059	0.385000	0.26158	0.033000	0.12548	0.614000	0.24314	1.437000	0.47472	0.655000	0.94253	GTC		0.428	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649	
GPR6	2830	broad.mit.edu	37	6	110301163	110301163	+	Missense_Mutation	SNP	T	T	G	rs199997898		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr6:110301163T>G	ENST00000275169.3	+	1	866	c.848T>G	c.(847-849)gTg>gGg	p.V283G	GPR6_ENST00000414000.2_Missense_Mutation_p.V298G	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	283					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.V283G(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		ACACTGGCTGTGGTGCTGGGC	0.667																																					p.V283G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T848G	6						.						35.0	35.0	35.0					6																	110301163		2202	4298	6500	110407856	SO:0001583	missense	2830	exon1				CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.848T>G	6.37:g.110301163T>G	ENSP00000275169:p.Val283Gly	Somatic		Capture	Illumina HiSeq	Phase_I	110407856	NM_005284	B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Missense_Mutation	SNP	ENST00000275169.3	37	CCDS5079.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.469769	0.43839	.	.	ENSG00000146360	ENST00000428489;ENST00000414000;ENST00000275169	T;T	0.45668	0.89;0.89	4.68	4.68	0.58851	GPCR, rhodopsin-like superfamily (1);	0.148001	0.42821	D	0.000643	T	0.52141	0.1716	M	0.71206	2.165	0.80722	D	1	D;P	0.67145	0.996;0.607	P;P	0.62740	0.906;0.579	T	0.59852	-0.7376	10	0.87932	D	0	.	14.2679	0.66133	0.0:0.0:0.0:1.0	.	298;283	B4DHS9;P46095	.;GPR6_HUMAN	G	283;298;283	ENSP00000406986:V298G;ENSP00000275169:V283G	ENSP00000275169:V283G	V	+	2	0	GPR6	110407856	1.000000	0.71417	0.998000	0.56505	0.075000	0.17131	7.864000	0.87037	1.940000	0.56252	0.460000	0.39030	GTG		0.667	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041774.1		
UHRF1BP1	54887	broad.mit.edu	37	6	34826587	34826587	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr6:34826587G>T	ENST00000192788.5	+	14	2625	c.2454G>T	c.(2452-2454)atG>atT	p.M818I	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.M818I	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	818							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)	p.M818I(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						ATGTTCATATGCTTGTACATT	0.527																																					p.M818I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2454T	6						.						156.0	151.0	153.0					6																	34826587		1996	4178	6174	34934565	SO:0001583	missense	54887	exon14			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.2454G>T	6.37:g.34826587G>T	ENSP00000192788:p.Met818Ile	Somatic		Capture	Illumina HiSeq	Phase_I	34934565	NM_017754	Q9NXE0	Missense_Mutation	SNP	ENST00000192788.5	37	CCDS43455.1	.	.	.	.	.	.	.	.	.	.	G	2.018	-0.425521	0.04701	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.11821	2.74;2.74	5.17	3.38	0.38709	.	0.597406	0.18678	N	0.134227	T	0.01661	0.0053	N	0.04880	-0.145	0.25973	N	0.982477	B	0.02656	0.0	B	0.01281	0.0	T	0.45891	-0.9230	10	0.30078	T	0.28	-1.9578	5.434	0.16469	0.0722:0.262:0.5307:0.1351	.	818	Q6BDS2	URFB1_HUMAN	I	818	ENSP00000192788:M818I;ENSP00000400628:M818I	ENSP00000192788:M818I	M	+	3	0	UHRF1BP1	34934565	1.000000	0.71417	0.783000	0.31826	0.589000	0.36550	1.820000	0.39032	0.752000	0.32923	-0.216000	0.12614	ATG		0.527	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754	
BTBD9	114781	broad.mit.edu	37	6	38142791	38142791	+	Silent	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr6:38142791G>A	ENST00000481247.1	-	11	1960	c.1809C>T	c.(1807-1809)aaC>aaT	p.N603N	BTBD9_ENST00000419706.2_Silent_p.N573N|BTBD9_ENST00000403056.1_Silent_p.N603N|BTBD9_ENST00000408958.1_Silent_p.N535N|BTBD9_ENST00000314100.6_Silent_p.N535N	NM_001099272.1|NM_052893.1	NP_001092742.1|NP_443125.1	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9	603					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|circadian sleep/wake cycle, non-REM sleep (GO:0042748)|long-term memory (GO:0007616)|multicellular organismal iron ion homeostasis (GO:0060586)|regulation of synaptic vesicle endocytosis (GO:1900242)|sensory perception of temperature stimulus (GO:0050951)|serotonin metabolic process (GO:0042428)			p.N603N(1)|p.N535N(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	12						GGGAGCGTGAGTTGGAGCCTG	0.667																																					p.N573N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1719T	6						.						82.0	103.0	96.0					6																	38142791		2185	4290	6475	38250769	SO:0001819	synonymous_variant	114781	exon11				CCDS43458.1, CCDS47418.1, CCDS54998.1	6p21	2014-01-28			ENSG00000183826	ENSG00000183826		"""BTB/POZ domain containing"""	21228	protein-coding gene	gene with protein product		611237				11572484	Standard	NM_052893		Approved	KIAA1880, dJ322I12.1	uc010jwx.3	Q96Q07	OTTHUMG00000014634	ENST00000481247.1:c.1809C>T	6.37:g.38142791G>A		Somatic		Capture	Illumina HiSeq	Phase_I	38250769	NM_001172418	Q494V9|Q494W1|Q96M00	Silent	SNP	ENST00000481247.1	37	CCDS47418.1																																																																																				0.667	BTBD9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040433.2	NM_152733	
ECHDC1	55862	broad.mit.edu	37	6	127652128	127652128	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr6:127652128T>C	ENST00000531967.1	-	2	567	c.64A>G	c.(64-66)Aaa>Gaa	p.K22E	ECHDC1_ENST00000368289.2_Missense_Mutation_p.K16E|ECHDC1_ENST00000474289.2_Missense_Mutation_p.K16E|ECHDC1_ENST00000528402.1_Intron|ECHDC1_ENST00000454859.3_Missense_Mutation_p.K16E|ECHDC1_ENST00000368291.2_Missense_Mutation_p.K16E|ECHDC1_ENST00000430841.2_Missense_Mutation_p.K16E|ECHDC1_ENST00000309620.9_Missense_Mutation_p.K16E|ECHDC1_ENST00000454591.2_Intron	NM_001139510.1	NP_001132982.1	Q9NTX5	ECHD1_HUMAN	enoyl CoA hydratase domain containing 1	22						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxy-lyase activity (GO:0016831)|methylmalonyl-CoA decarboxylase activity (GO:0004492)	p.K22E(1)|p.K16E(1)		large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)		TGTAGCAATTTTGTCCTTCCA	0.383																																					p.K16E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A46G	6						.						75.0	75.0	75.0					6																	127652128		2203	4300	6503	127693821	SO:0001583	missense	55862	exon2			AK025796	CCDS34530.1, CCDS43504.1, CCDS47471.1, CCDS47472.1, CCDS55054.1	6q22.33	2011-12-12	2010-04-30		ENSG00000093144	ENSG00000093144			21489	protein-coding gene	gene with protein product		612136	"""enoyl Coenzyme A hydratase domain containing 1"""			22016388	Standard	NM_001002030		Approved	dJ351K20.2	uc003qax.3	Q9NTX5	OTTHUMG00000015523	ENST00000531967.1:c.64A>G	6.37:g.127652128T>C	ENSP00000436585:p.Lys22Glu	Somatic		Capture	Illumina HiSeq	Phase_I	127693821	NM_018479	A6NFJ5|B7Z8S0|E9PEN7|E9PR31|F8W851|Q5TEF6|Q5TEF7|Q5TEG0|Q5TEG4|Q9NZ30|V9HW18	Missense_Mutation	SNP	ENST00000531967.1	37	CCDS47471.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.149836	0.57151	.	.	ENSG00000093144	ENST00000454859;ENST00000531967;ENST00000368290;ENST00000474289;ENST00000368291;ENST00000309620;ENST00000430841;ENST00000368289;ENST00000525745;ENST00000534442;ENST00000531582	T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;0.78;-0.11;0.86	6.06	6.06	0.98353	.	0.408163	0.28724	N	0.014356	T	0.47116	0.1428	L	0.57536	1.79	0.36141	D	0.846764	P;B	0.43094	0.799;0.361	B;B	0.35931	0.214;0.058	T	0.60444	-0.7262	10	0.59425	D	0.04	-21.412	16.6245	0.84952	0.0:0.0:0.0:1.0	.	16;22	Q5TEF6;Q9NTX5	.;ECHD1_HUMAN	E	16;22;16;16;16;16;16;16;16;16;16	ENSP00000401751:K16E;ENSP00000436585:K22E;ENSP00000434908:K16E;ENSP00000311115:K16E;ENSP00000402492:K16E;ENSP00000435502:K16E	ENSP00000311115:K16E	K	-	1	0	ECHDC1	127693821	0.999000	0.42202	0.996000	0.52242	0.657000	0.38888	4.134000	0.57990	2.323000	0.78572	0.528000	0.53228	AAA		0.383	ECHDC1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042131.2		
ZNF425	155054	broad.mit.edu	37	7	148802632	148802632	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr7:148802632C>G	ENST00000378061.2	-	4	463	c.331G>C	c.(331-333)Gaa>Caa	p.E111Q		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	111					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E111Q(1)		breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			CAATCCTCTTCTTTTGTCCTG	0.423																																					p.E111Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G331C	7						.						83.0	79.0	80.0					7																	148802632		2203	4300	6503	148433565	SO:0001583	missense	155054	exon4			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.331G>C	7.37:g.148802632C>G	ENSP00000367300:p.Glu111Gln	Somatic		Capture	Illumina HiSeq	Phase_I	148433565	NM_001001661	B3KPM1|Q08AG3	Missense_Mutation	SNP	ENST00000378061.2	37	CCDS34773.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.417666	0.25552	.	.	ENSG00000204947	ENST00000378061;ENST00000483014	T;T	0.07800	3.16;4.95	2.45	-0.615	0.11587	.	.	.	.	.	T	0.03695	0.0105	N	0.08118	0	0.09310	N	1	B	0.28760	0.221	B	0.28709	0.093	T	0.47471	-0.9115	9	0.22109	T	0.4	.	6.4511	0.21903	0.0:0.6084:0.0:0.3916	.	111	Q6IV72	ZN425_HUMAN	Q	111;133	ENSP00000367300:E111Q;ENSP00000420379:E133Q	ENSP00000367300:E111Q	E	-	1	0	ZNF425	148433565	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.026000	0.13599	-0.334000	0.08463	-0.742000	0.03525	GAA		0.423	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352726.1	XM_088140	
UNC5D	137970	broad.mit.edu	37	8	35616879	35616879	+	Silent	SNP	G	G	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr8:35616879G>T	ENST00000404895.2	+	14	2533	c.2205G>T	c.(2203-2205)ctG>ctT	p.L735L	UNC5D_ENST00000287272.2_Silent_p.L666L|UNC5D_ENST00000449677.1_Silent_p.L311L|UNC5D_ENST00000416672.1_Silent_p.L740L|UNC5D_ENST00000420357.1_Silent_p.L668L|UNC5D_ENST00000453357.2_Silent_p.L730L	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	735					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.L730L(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GACAGCTCCTGGAAGAACCAA	0.373																																					p.L735L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2205T	8						.						163.0	156.0	159.0					8																	35616879		2203	4300	6503	35736421	SO:0001819	synonymous_variant	137970	exon14			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2205G>T	8.37:g.35616879G>T		Somatic		Capture	Illumina HiSeq	Phase_I	35736421	NM_080872	Q8WYP7	Silent	SNP	ENST00000404895.2	37	CCDS6093.2																																																																																				0.373	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		
EYA1	2138	broad.mit.edu	37	8	72211365	72211365	+	Missense_Mutation	SNP	G	G	A	rs186736708		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr8:72211365G>A	ENST00000340726.3	-	9	1382	c.743C>T	c.(742-744)aCg>aTg	p.T248M	EYA1_ENST00000388742.4_Missense_Mutation_p.T248M|EYA1_ENST00000419131.1_Missense_Mutation_p.T243M|EYA1_ENST00000388740.3_Missense_Mutation_p.T215M|EYA1_ENST00000388743.2_Missense_Mutation_p.T247M|EYA1_ENST00000303824.7_Missense_Mutation_p.T242M|EYA1_ENST00000388741.2_Missense_Mutation_p.T214M	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	248					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)	p.T248M(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			GGATGGTGTCGTTGGGCTGGT	0.483													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15950	0.0		0.0	False		,,,				2504	0.0				p.T215M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C644T	8						.						319.0	262.0	282.0					8																	72211365		2203	4300	6503	72373919	SO:0001583	missense	2138	exon7			AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.743C>T	8.37:g.72211365G>A	ENSP00000342626:p.Thr248Met	Somatic		Capture	Illumina HiSeq	Phase_I	72373919	NM_172060	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	37	CCDS34906.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	15.96	2.987863	0.53934	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	D;D;D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53	5.04	5.04	0.67666	.	0.183390	0.56097	D	0.000023	T	0.80281	0.4594	L	0.27053	0.805	0.47441	D	0.999425	D;D;D;D;D	0.60575	0.983;0.988;0.988;0.983;0.971	P;P;P;P;P	0.53224	0.721;0.594;0.594;0.721;0.703	T	0.82380	-0.0486	10	0.54805	T	0.06	-5.5442	18.7234	0.91704	0.0:0.0:1.0:0.0	.	242;175;215;248;243	A6NCB9;Q0P517;Q99502-2;Q99502;G5E9R4	.;.;.;EYA1_HUMAN;.	M	248;248;216;215;242;214;247;243	ENSP00000373394:T248M;ENSP00000342626:T248M;ENSP00000373392:T215M;ENSP00000303221:T242M;ENSP00000373393:T214M;ENSP00000373395:T247M;ENSP00000410176:T243M	ENSP00000303221:T242M	T	-	2	0	EYA1	72373919	1.000000	0.71417	0.051000	0.19133	0.829000	0.46940	4.889000	0.63171	2.501000	0.84356	0.585000	0.79938	ACG		0.483	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060	
GDAP1	54332	broad.mit.edu	37	8	75274206	75274206	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr8:75274206G>A	ENST00000220822.7	+	4	652	c.572G>A	c.(571-573)cGa>cAa	p.R191Q	GDAP1_ENST00000434412.2_Missense_Mutation_p.R123Q|GDAP1_ENST00000521096.1_3'UTR	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	191	GST C-terminal.				cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R191Q(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			AAACAGAAACGACTTAAAGTA	0.358																																					p.R191Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G572A	8						.						106.0	96.0	99.0					8																	75274206		2203	4300	6503	75436761	SO:0001583	missense	54332	exon4				CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.572G>A	8.37:g.75274206G>A	ENSP00000220822:p.Arg191Gln	Somatic		Capture	Illumina HiSeq	Phase_I	75436761	NM_018972	A8K957|E7FJF3|E7FJF4	Missense_Mutation	SNP	ENST00000220822.7	37	CCDS34911.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.348315	0.61183	.	.	ENSG00000104381	ENST00000220822;ENST00000434412	D;D	0.98968	-5.28;-5.25	5.27	5.27	0.74061	Glutathione S-transferase/chloride channel, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95360	0.8494	N	0.16478	0.41	0.47862	D	0.999534	P	0.39116	0.66	B	0.34452	0.183	D	0.94816	0.7983	10	0.19590	T	0.45	-1.3022	19.0885	0.93215	0.0:0.0:1.0:0.0	.	191	Q8TB36	GDAP1_HUMAN	Q	191;123	ENSP00000220822:R191Q;ENSP00000417006:R123Q	ENSP00000220822:R191Q	R	+	2	0	GDAP1	75436761	1.000000	0.71417	0.998000	0.56505	0.884000	0.51177	5.578000	0.67450	2.758000	0.94735	0.561000	0.74099	CGA		0.358	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379061.1	NM_018972	
COL15A1	1306	broad.mit.edu	37	9	101817636	101817636	+	Silent	SNP	C	C	T	rs201153263	byFrequency	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr9:101817636C>T	ENST00000375001.3	+	34	3597	c.3174C>T	c.(3172-3174)ccC>ccT	p.P1058P		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	1058	Triple-helical region 8 (COL8).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.P1058P(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				CAGGCCTGCCCGGAAATCCAG	0.547													C|||	2	0.000399361	0.0	0.0	5008	,	,		16677	0.0		0.0	False		,,,				2504	0.002				p.P1058P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C3174T	9						.						52.0	58.0	56.0					9																	101817636		2203	4300	6503	100857457	SO:0001819	synonymous_variant	1306	exon34			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.3174C>T	9.37:g.101817636C>T		Somatic		Capture	Illumina HiSeq	Phase_I	100857457	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Silent	SNP	ENST00000375001.3	37	CCDS35081.1																																																																																				0.547	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
TPRN	286262	broad.mit.edu	37	9	140087025	140087027	+	In_Frame_Del	DEL	TCC	TCC	-	rs376810326		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	TCC	TCC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chr9:140087025_140087027delTCC	ENST00000409012.4	-	2	1928_1930	c.1842_1844delGGA	c.(1840-1845)gaggaa>gaa	p.614_615EE>E	TPRN_ENST00000541945.1_5'Flank|TPRN_ENST00000321773.2_In_Frame_Del_p.553_554EE>E	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	614	Glu-rich.				sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)		p.E315delE(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						ctcttcctcttcctcctcctcct	0.596																																					p.614_615del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.1842_1844del	9						.																																			139206848	SO:0001651	inframe_deletion	286262	exon2			AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.1842_1844delGGA	9.37:g.140087034_140087036delTCC	ENSP00000387100:p.Glu621del	Somatic		Capture	Illumina HiSeq	Phase_I	139206846	NM_001128228	B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	In_Frame_Del	DEL	ENST00000409012.4	37	CCDS56594.1																																																																																				0.596	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055323.3	NM_173691	
CXorf57	55086	broad.mit.edu	37	X	105891593	105891593	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:105891593C>T	ENST00000372548.4	+	11	2064	c.1955C>T	c.(1954-1956)cCg>cTg	p.P652L	CXorf57_ENST00000497124.1_3'UTR|CXorf57_ENST00000372544.2_Missense_Mutation_p.P555L	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	652							poly(A) RNA binding (GO:0044822)	p.P652L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						GGAATTAAACCGGGCATGCCA	0.308																																					p.P652L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1955T	X						.						97.0	90.0	93.0					X																	105891593		2203	4299	6502	105778249	SO:0001583	missense	55086	exon11			AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.1955C>T	X.37:g.105891593C>T	ENSP00000361628:p.Pro652Leu	Somatic		Capture	Illumina HiSeq	Phase_I	105778249	NM_018015	H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	ENST00000372548.4	37	CCDS14519.1	.	.	.	.	.	.	.	.	.	.	C	0.486	-0.877484	0.02550	.	.	ENSG00000147231	ENST00000372544;ENST00000372548;ENST00000421550	T;T;T	0.43294	0.95;0.98;0.95	2.94	-0.968	0.10313	.	1.951160	0.02384	N	0.079070	T	0.28632	0.0709	L	0.27053	0.805	0.09310	N	1	B;B	0.12013	0.005;0.003	B;B	0.06405	0.002;0.002	T	0.11446	-1.0587	10	0.41790	T	0.15	3.6716	3.1125	0.06364	0.1936:0.4516:0.0:0.3548	.	652;652	A8K6R5;Q6NSI4	.;CX057_HUMAN	L	555;652;363	ENSP00000361623:P555L;ENSP00000361628:P652L;ENSP00000405866:P363L	ENSP00000361623:P555L	P	+	2	0	CXorf57	105778249	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.054000	0.01399	-0.391000	0.07763	0.506000	0.49869	CCG		0.308	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057800.2	NM_018015	
CHRDL1	91851	broad.mit.edu	37	X	109919546	109919546	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:109919546C>A	ENST00000372045.1	-	12	1397	c.1266G>T	c.(1264-1266)caG>caT	p.Q422H	CHRDL1_ENST00000434224.1_Missense_Mutation_p.Q349H|CHRDL1_ENST00000218054.4_Missense_Mutation_p.Q428H|CHRDL1_ENST00000444321.2_Missense_Mutation_p.Q429H|CHRDL1_ENST00000372042.1_Missense_Mutation_p.Q430H|CHRDL1_ENST00000482160.1_Missense_Mutation_p.Q350H|CHRDL1_ENST00000394797.4_Missense_Mutation_p.Q428H			Q9BU40	CRDL1_HUMAN	chordin-like 1	422					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.Q428H(1)		endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						TTGAACACATCTGGCTGATCT	0.473																																					p.Q430H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1290T	X						.						141.0	113.0	123.0					X																	109919546		2203	4300	6503	109806202	SO:0001583	missense	91851	exon12			AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.1266G>T	X.37:g.109919546C>A	ENSP00000361115:p.Gln422His	Somatic		Capture	Illumina HiSeq	Phase_I	109806202	NM_001143981	B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	ENST00000372045.1	37		.	.	.	.	.	.	.	.	.	.	C	10.26	1.300164	0.23650	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	T;T;T;T;T;T;T	0.32272	2.21;1.46;2.21;2.21;2.47;1.46;2.21	4.79	3.93	0.45458	.	0.409399	0.27420	N	0.019449	T	0.20088	0.0483	N	0.14661	0.345	0.34956	D	0.751756	P;B;B;B;B;B	0.46706	0.883;0.001;0.001;0.001;0.001;0.006	P;B;B;B;B;B	0.47206	0.541;0.001;0.001;0.001;0.001;0.003	T	0.20273	-1.0280	9	.	.	.	-6.4358	6.0525	0.19792	0.0:0.6526:0.1558:0.1916	.	350;429;409;422;430;349	B4DMP3;E9PGS5;Q59FB2;Q9BU40;D3DUY6;D3YTA8	.;.;.;CRDL1_HUMAN;.;.	H	422;349;428;428;430;350;429	ENSP00000361115:Q422H;ENSP00000389627:Q349H;ENSP00000218054:Q428H;ENSP00000378276:Q428H;ENSP00000361112:Q430H;ENSP00000418443:Q350H;ENSP00000399739:Q429H	.	Q	-	3	2	CHRDL1	109806202	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.994000	0.40757	1.106000	0.41623	0.600000	0.82982	CAG		0.473	CHRDL1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057912.1	NM_145234	
TLR7	51284	broad.mit.edu	37	X	12905844	12905844	+	Silent	SNP	G	G	A	rs192616579		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:12905844G>A	ENST00000380659.3	+	3	2356	c.2217G>A	c.(2215-2217)acG>acA	p.T739T		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	739					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.T739T(1)		NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	GGAGTCTGACGAAGTATTTTC	0.418													G|||	1	0.000264901	0.0	0.0	3775	,	,		15419	0.001		0.0	False		,,,				2504	0.0				p.T739T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2217A	X						.						65.0	65.0	65.0					X																	12905844		2203	4300	6503	12815765	SO:0001819	synonymous_variant	51284	exon3			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.2217G>A	X.37:g.12905844G>A		Somatic		Capture	Illumina HiSeq	Phase_I	12815765	NM_016562	D1CS69|Q9NR98	Silent	SNP	ENST00000380659.3	37	CCDS14151.1																																																																																				0.418	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562	
RPL39	6170	broad.mit.edu	37	X	118923947	118923947	+	Silent	SNP	G	G	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:118923947G>T	ENST00000361575.3	-	2	97	c.31C>A	c.(31-33)Cga>Aga	p.R11R	SNORA69_ENST00000383895.1_RNA|RPL39_ENST00000468844.1_5'UTR	NM_001000.2	NP_000991.1	P62891	RL39_HUMAN	ribosomal protein L39	11					antibacterial humoral response (GO:0019731)|cellular protein metabolic process (GO:0044267)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|innate immune response in mucosa (GO:0002227)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular space (GO:0005615)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.R11R(1)		endometrium(1)|large_intestine(2)	3						GCCAGGAATCGCTTAATCCTG	0.408																																					p.R11R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C31A	X						.						66.0	60.0	62.0					X																	118923947		2203	4300	6503	118807975	SO:0001819	synonymous_variant	6170	exon2				CCDS14586.1	Xq24	2013-03-11			ENSG00000198918	ENSG00000198918		"""L ribosomal proteins"""	10350	protein-coding gene	gene with protein product		300899	"""ribosomal protein L39 pseudogene 42"""	RPL39P42		8764829	Standard	NM_001000		Approved	L39	uc004erx.2	P62891	OTTHUMG00000022278	ENST00000361575.3:c.31C>A	X.37:g.118923947G>T		Somatic		Capture	Illumina HiSeq	Phase_I	118807975	NM_001000	P02404|P39025|Q9BYF2	Silent	SNP	ENST00000361575.3	37	CCDS14586.1																																																																																				0.408	RPL39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058047.1	NM_001000	
MAP7D3	79649	broad.mit.edu	37	X	135328253	135328253	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:135328253C>T	ENST00000316077.9	-	3	444	c.224G>A	c.(223-225)cGc>cAc	p.R75H	MAP7D3_ENST00000370663.5_Missense_Mutation_p.R57H|MAP7D3_ENST00000370661.1_Missense_Mutation_p.R75H	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	75					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.R372H(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					CTCCTCTCTGCGCTCTCTTGC	0.274																																					p.R75H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G224A	X						.						168.0	141.0	150.0					X																	135328253		1825	4082	5907	135155919	SO:0001583	missense	79649	exon3			AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.224G>A	X.37:g.135328253C>T	ENSP00000318086:p.Arg75His	Somatic		Capture	Illumina HiSeq	Phase_I	135155919	NM_001173517	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.986959	0.53934	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.09163	3.01;3.01;3.01;3.01	5.57	5.57	0.84162	.	0.000000	0.32802	N	0.005639	T	0.34978	0.0916	M	0.70275	2.135	0.42323	D	0.992268	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	T	0.05566	-1.0877	10	0.72032	D	0.01	-17.3619	18.3794	0.90445	0.0:1.0:0.0:0.0	.	57;75;75;75	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	H	75;75;57;75	ENSP00000359695:R75H;ENSP00000318086:R75H;ENSP00000359697:R57H;ENSP00000359694:R75H	ENSP00000318086:R75H	R	-	2	0	MAP7D3	135155919	0.997000	0.39634	0.031000	0.17742	0.002000	0.02628	4.724000	0.61972	2.466000	0.83321	0.594000	0.82650	CGC		0.274	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
VGLL1	51442	broad.mit.edu	37	X	135631088	135631088	+	Silent	SNP	C	C	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:135631088C>T	ENST00000370634.3	+	3	725	c.555C>T	c.(553-555)gcC>gcT	p.A185A	MIR934_ENST00000401241.1_RNA	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	185					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.A185A(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					AGGAATCTGCCGCCAGGGAGA	0.577																																					p.A185A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C555T	X						.						79.0	79.0	79.0					X																	135631088		2203	4300	6503	135458754	SO:0001819	synonymous_variant	51442	exon3			AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.555C>T	X.37:g.135631088C>T		Somatic		Capture	Illumina HiSeq	Phase_I	135458754	NM_016267	Q5H915	Silent	SNP	ENST00000370634.3	37	CCDS14658.1																																																																																				0.577	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1	NM_016267	
TMEM257	9142	broad.mit.edu	37	X	144909347	144909347	+	Missense_Mutation	SNP	C	C	T	rs370861051		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:144909347C>T	ENST00000408967.2	+	1	420	c.152C>T	c.(151-153)tCg>tTg	p.S51L		NM_004709.2	NP_004700.1	O96002	TM257_HUMAN	transmembrane protein 257	51						integral component of membrane (GO:0016021)		p.S51L(1)									CAAGCACTTTCGACCATATTT	0.313																																					p.S51L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C152T	X						.	C	LEU/SER	1,3834		0,1,1631,571	87.0	86.0	86.0		152	-4.7	0.0	X		86	1,6725		0,1,2426,1872	no	missense	CXorf1	NM_004709.2	145	0,2,4057,2443	TT,TC,CC,C		0.0149,0.0261,0.0189	benign	51/112	144909347	2,10559	2203	4299	6502	144717039	SO:0001583	missense	9142	exon1			Y08902	CCDS14681.1	Xq27.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000221870	ENSG00000221870			2562	protein-coding gene	gene with protein product		300565	"""chromosome X open reading frame 1"""	CXorf1		9881668	Standard	NM_004709		Approved		uc004fch.3	O96002	OTTHUMG00000159605	ENST00000408967.2:c.152C>T	X.37:g.144909347C>T	ENSP00000386149:p.Ser51Leu	Somatic		Capture	Illumina HiSeq	Phase_I	144717039	NM_004709	Q14CW0	Missense_Mutation	SNP	ENST00000408967.2	37	CCDS14681.1	.	.	.	.	.	.	.	.	.	.	C	3.263	-0.150696	0.06585	2.61E-4	1.49E-4	ENSG00000221870	ENST00000408967	T	0.54279	0.58	5.68	-4.68	0.03309	.	.	.	.	.	T	0.21962	0.0529	N	0.08118	0	0.09310	N	1	B	0.32051	0.354	B	0.23150	0.044	T	0.10894	-1.0610	9	0.87932	D	0	.	1.8321	0.03132	0.3277:0.1317:0.3753:0.1653	.	51	O96002	CX001_HUMAN	L	51	ENSP00000386149:S51L	ENSP00000386149:S51L	S	+	2	0	CXorf1	144717039	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.690000	0.05138	-1.099000	0.03034	0.594000	0.82650	TCG		0.313	TMEM257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356465.1	NM_004709	
CNGA2	1260	broad.mit.edu	37	X	150911600	150911600	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:150911600A>T	ENST00000329903.4	+	6	658	c.625A>T	c.(625-627)Aag>Tag	p.K209*		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	209					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.K209*(1)		breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					CAAAGATACCAAGAAACTGCG	0.478																																					p.K209X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A625T	X						.						114.0	87.0	96.0					X																	150911600		2203	4300	6503	150662256	SO:0001587	stop_gained	1260	exon7			S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.625A>T	X.37:g.150911600A>T	ENSP00000328478:p.Lys209*	Somatic		Capture	Illumina HiSeq	Phase_I	150662256	NM_005140	A0AVD0	Nonsense_Mutation	SNP	ENST00000329903.4	37	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.644423	0.87859	.	.	ENSG00000183862	ENST00000329903	.	.	.	5.36	5.36	0.76844	.	0.243735	0.42294	D	0.000723	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1986	0.54311	1.0:0.0:0.0:0.0	.	.	.	.	X	209	.	ENSP00000328478:K209X	K	+	1	0	CNGA2	150662256	1.000000	0.71417	0.997000	0.53966	0.920000	0.55202	4.623000	0.61247	1.785000	0.52413	0.417000	0.27973	AAG		0.478	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
DLG3	1741	broad.mit.edu	37	X	69670626	69670626	+	Silent	SNP	C	C	T	rs370555109		TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:69670626C>T	ENST00000374360.3	+	6	1211	c.978C>T	c.(976-978)taC>taT	p.Y326Y	DLG3-AS1_ENST00000431103.1_RNA|RNU4-81P_ENST00000363561.1_RNA|DLG3-AS1_ENST00000424211.1_RNA|DLG3_ENST00000374355.3_5'Flank|DLG3_ENST00000194900.4_Silent_p.Y344Y	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)	326					axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)	p.Y326Y(1)		endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					CCCCTGACTACGCCAGCAGTA	0.532																																					p.Y326Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C978T	X						.	C		1,3834		0,1,1631,571	100.0	70.0	80.0		978	-0.9	1.0	X		80	0,6728		0,0,2428,1872	no	coding-synonymous	DLG3	NM_021120.3		0,1,4059,2443	TT,TC,CC,C		0.0,0.0261,0.0095		326/818	69670626	1,10562	2203	4300	6503	69587351	SO:0001819	synonymous_variant	1741	exon6			U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.978C>T	X.37:g.69670626C>T		Somatic		Capture	Illumina HiSeq	Phase_I	69587351	NM_021120	B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Silent	SNP	ENST00000374360.3	37	CCDS14403.1																																																																																				0.532	DLG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057074.2	NM_021120	
MAGEE1	57692	broad.mit.edu	37	X	75649461	75649461	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:75649461G>A	ENST00000361470.2	+	1	1416	c.1138G>A	c.(1138-1140)Gtg>Atg	p.V380M		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	380	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.V380M(4)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						GGACACCTCCGTGCCGCCCAC	0.677																																					p.V380M												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G1138A	X						.						41.0	28.0	32.0					X																	75649461		2203	4299	6502	75565865	SO:0001583	missense	57692	exon1			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.1138G>A	X.37:g.75649461G>A	ENSP00000354912:p.Val380Met	Somatic		Capture	Illumina HiSeq	Phase_I	75565865	NM_020932	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	ENST00000361470.2	37	CCDS14433.1	.	.	.	.	.	.	.	.	.	.	G	8.531	0.870987	0.17322	.	.	ENSG00000198934	ENST00000361470	T	0.09630	2.96	2.13	-3.34	0.04943	.	.	.	.	.	T	0.04861	0.0131	N	0.14661	0.345	0.09310	N	1	B	0.17667	0.023	B	0.04013	0.001	T	0.36335	-0.9752	9	0.49607	T	0.09	.	2.426	0.04460	0.1301:0.2731:0.4355:0.1613	.	380	Q9HCI5	MAGE1_HUMAN	M	380	ENSP00000354912:V380M	ENSP00000354912:V380M	V	+	1	0	MAGEE1	75565865	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.085000	0.03390	-1.119000	0.02958	0.506000	0.49869	GTG		0.677	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932	
PGK1	5230	broad.mit.edu	37	X	77381288	77381288	+	Splice_Site	SNP	T	T	G			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:77381288T>G	ENST00000373316.4	+	11	1382	c.1215T>G	c.(1213-1215)ggT>ggG	p.G405G	PGK1_ENST00000537456.1_Splice_Site_p.G377G|PGK1_ENST00000476531.1_3'UTR|PGK1_ENST00000442431.1_Splice_Site_p.G269G	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	405					carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.G405G(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	CAAAAACAGGTAAAGTCCTTC	0.443																																					p.G405G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1215G	X						.						316.0	294.0	301.0					X																	77381288		2203	4296	6499	77267944	SO:0001630	splice_region_variant	5230	exon11			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.1214-1T>G	X.37:g.77381288T>G		Somatic		Capture	Illumina HiSeq	Phase_I	77267944	NM_000291	A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Silent	SNP	ENST00000373316.4	37	CCDS14438.1																																																																																				0.443	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057310.1		Silent
AVPR2	554	broad.mit.edu	37	X	153171565	153171565	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03J-01A-21W-A096-10	TCGA-AA-A03J-11A-11W-A096-10	g.chrX:153171565G>A	ENST00000358927.2	+	3	814	c.605G>A	c.(604-606)cGt>cAt	p.R202H	AVPR2_ENST00000370049.1_Missense_Mutation_p.R202H|AVPR2_ENST00000337474.5_Missense_Mutation_p.R202H			P30518	V2R_HUMAN	arginine vasopressin receptor 2	202			R -> C (in XNDI). {ECO:0000269|PubMed:7560098}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)	p.R202H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	CCCTGGGGCCGTCGCACCTAT	0.632																																					p.R202H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G605A	X						.						63.0	57.0	59.0					X																	153171565		2203	4300	6503	152824759	SO:0001583	missense	554	exon2			Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.605G>A	X.37:g.153171565G>A	ENSP00000351805:p.Arg202His	Somatic		Capture	Illumina HiSeq	Phase_I	152824759	NM_000054	C5HF20|O43192|Q3MJD3|Q9UCV9	Missense_Mutation	SNP	ENST00000358927.2	37	CCDS14735.1	.	.	.	.	.	.	.	.	.	.	g	2.406	-0.336395	0.05278	.	.	ENSG00000126895	ENST00000358927;ENST00000430697;ENST00000337474;ENST00000370049	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	3.71	0.91	0.19337	GPCR, rhodopsin-like superfamily (1);	0.302820	0.31734	N	0.007146	T	0.24624	0.0597	L	0.27053	0.805	0.19300	N	0.999975	P;P	0.49090	0.901;0.919	B;P	0.46026	0.135;0.501	T	0.09400	-1.0676	10	0.56958	D	0.05	-14.0316	4.9043	0.13789	0.0:0.1115:0.3644:0.5241	.	202;202	P30518-2;P30518	.;V2R_HUMAN	H	202	ENSP00000351805:R202H;ENSP00000393513:R202H;ENSP00000338072:R202H;ENSP00000359066:R202H	ENSP00000338072:R202H	R	+	2	0	AVPR2	152824759	0.004000	0.15560	0.979000	0.43373	0.015000	0.08874	1.631000	0.37092	0.416000	0.25844	-1.052000	0.02337	CGT		0.632	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061127.2		
