#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LZTS2	84445	broad.mit.edu	37	10	102762402	102762402	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr10:102762402G>C	ENST00000370220.1	+	1	3170	c.107G>C	c.(106-108)cGg>cCg	p.R36P	LZTS2_ENST00000370223.3_Missense_Mutation_p.R36P					leucine zipper, putative tumor suppressor 2									p.R36P(1)		breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		ATCTCAGGCCGGCCCTGTCCC	0.662																																					p.R36P	Esophageal Squamous(8;38 437 13604 19902 37640)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G107C	10						.						42.0	50.0	47.0					10																	102762402		2203	4300	6503	102752392	SO:0001583	missense	84445	exon2			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.107G>C	10.37:g.102762402G>C	ENSP00000359240:p.Arg36Pro	Somatic		Capture	Illumina HiSeq	Phase_I	102752392	NM_032429		Missense_Mutation	SNP	ENST00000370220.1	37	CCDS7507.1	.	.	.	.	.	.	.	.	.	.	G	33	5.213309	0.95069	.	.	ENSG00000107816	ENST00000426584;ENST00000370223;ENST00000429732;ENST00000315797;ENST00000370220;ENST00000454422	T;T	0.41400	1.0;1.0	4.97	4.97	0.65823	.	0.070593	0.56097	D	0.000035	T	0.59018	0.2163	L	0.53249	1.67	0.53688	D	0.999979	D	0.76494	0.999	D	0.65010	0.931	T	0.62666	-0.6806	10	0.72032	D	0.01	-27.6665	16.988	0.86346	0.0:0.0:1.0:0.0	.	36	Q9BRK4	LZTS2_HUMAN	P	36	ENSP00000359243:R36P;ENSP00000359240:R36P	ENSP00000314437:R36P	R	+	2	0	LZTS2	102752392	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.184000	0.72008	2.277000	0.76020	0.561000	0.74099	CGG		0.662	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
AKR1C2	1646	broad.mit.edu	37	10	5043831	5043831	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr10:5043831C>A	ENST00000380753.4	-	2	314	c.127G>T	c.(127-129)Gaa>Taa	p.E43*	AKR1C2_ENST00000421196.3_Nonsense_Mutation_p.E43*|AKR1C2_ENST00000407674.1_Nonsense_Mutation_p.E43*|AKR1C2_ENST00000455190.1_Nonsense_Mutation_p.E43*	NM_205845.2	NP_995317.1	P52895	AK1C2_HUMAN	aldo-keto reductase family 1, member C2	43					cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway (GO:0007186)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|response to prostaglandin (GO:0034694)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin F receptor activity (GO:0004958)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.E43*(2)		breast(1)|large_intestine(5)|lung(3)|skin(1)	10					Ursodeoxycholic acid(DB01586)	AACCCGGCTTCTATTGCCAAT	0.463																																					p.E43X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G127T	10						.						121.0	114.0	116.0					10																	5043831		2203	4300	6503	5033831	SO:0001587	stop_gained	1646	exon3			L32592	CCDS7062.1, CCDS44350.1	10p15-p14	2014-01-29	2012-12-04		ENSG00000151632	ENSG00000151632	1.3.1.20, 1.1.1.213	"""Aldo-keto reductases"""	385	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III"""	600450	"""aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III)"", ""testicular 17,20-desmolase deficiency"""	DDH2, TDD		9716498, 21802064	Standard	NM_001354		Approved	DD, BABP, DD2, HAKRD, MCDR2	uc001iht.3	P52895	OTTHUMG00000017584	ENST00000380753.4:c.127G>T	10.37:g.5043831C>A	ENSP00000370129:p.Glu43*	Somatic		Capture	Illumina HiSeq	Phase_I	5033831	NM_205845	A8K2N9|B4DKR9|Q14133|Q5SR16|Q7M4N1|Q96A71	Nonsense_Mutation	SNP	ENST00000380753.4	37	CCDS7062.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680549	0.68042	.	.	ENSG00000151632	ENST00000380753;ENST00000421196;ENST00000407674;ENST00000455190	.	.	.	2.31	2.31	0.28768	.	0.428844	0.20099	N	0.099263	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.7583	0.46249	0.0:1.0:0.0:0.0	.	.	.	.	X	43	.	ENSP00000370129:E43X	E	-	1	0	AKR1C2	5033831	0.798000	0.28890	0.015000	0.15790	0.009000	0.06853	3.447000	0.52936	1.597000	0.50072	0.194000	0.17425	GAA		0.463	AKR1C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046531.1	NM_001354	
AKR1CL1	340811	broad.mit.edu	37	10	5203844	5203844	+	Missense_Mutation	SNP	A	A	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr10:5203844A>G	ENST00000334314.3	-	3	429	c.353T>C	c.(352-354)aTt>aCt	p.I118T	AKR1CL1_ENST00000465430.1_5'Flank			Q5T2L2	AKCL1_HUMAN	aldo-keto reductase family 1, member C-like 1	118						cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)	p.I118T(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						TACATGAATAATGAAGAGATC	0.408																																					.	Ovarian(129;1623 1737 25446 28757 47467)											.	.	1	Substitution - Missense(1)	large_intestine(1)	.	10						.						75.0	76.0	76.0					10																	5203844		2203	4300	6503	5193844	SO:0001583	missense	340811	.					10p15.2	2014-05-06			ENSG00000196326	ENSG00000264006			23469	protein-coding gene	gene with protein product						15164054	Standard	NR_027916		Approved		uc009xhz.2	Q5T2L2	OTTHUMG00000184213	ENST00000334314.3:c.353T>C	10.37:g.5203844A>G	ENSP00000334626:p.Ile118Thr	Somatic		Capture	Illumina HiSeq	Phase_I	5193844	.	A6NF66|Q6ZN81	Missense_Mutation	SNP	ENST00000334314.3	37		.	.	.	.	.	.	.	.	.	.	A	16.37	3.104927	0.56291	.	.	ENSG00000196326	ENST00000488756;ENST00000334314	T;T	0.51071	0.72;0.72	2.99	2.99	0.34606	.	0.115349	0.35179	U	0.003390	T	0.47078	0.1426	.	.	.	0.22531	N	0.999014	.	.	.	.	.	.	T	0.41945	-0.9480	7	0.87932	D	0	.	8.0303	0.30461	1.0:0.0:0.0:0.0	.	.	.	.	T	118	ENSP00000417935:I118T;ENSP00000334626:I118T	ENSP00000334626:I118T	I	-	2	0	AKR1CL1	5193844	0.907000	0.30839	0.018000	0.16275	0.329000	0.28539	6.670000	0.74467	1.333000	0.45449	0.260000	0.18958	ATT		0.408	AKR1CL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NR_027916	
CDNF	441549	broad.mit.edu	37	10	14862125	14862125	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr10:14862125G>A	ENST00000378442.1	-	6	615	c.112C>T	c.(112-114)Cgg>Tgg	p.R38W	CDNF_ENST00000378441.2_5'UTR			Q49AH0	CDNF_HUMAN	cerebral dopamine neurotrophic factor	140						extracellular region (GO:0005576)		p.R140W(1)		breast(2)|large_intestine(2)|lung(1)	5						CTCATCTTCCGCAGGTCAACT	0.423																																					p.R140W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C418T	10						.						109.0	111.0	110.0					10																	14862125		2203	4300	6503	14902131	SO:0001583	missense	441549	exon4			BC037872	CCDS31148.1	10p13	2009-06-04	2009-06-04	2009-06-04	ENSG00000185267	ENSG00000185267			24913	protein-coding gene	gene with protein product	"""conserved dopamine neurotrophic factor"""	611233	"""arginine-rich, mutated in early stage tumors-like 1"""	ARMETL1		17611540	Standard	NM_001029954		Approved		uc001inb.1	Q49AH0	OTTHUMG00000017713	ENST00000378442.1:c.112C>T	10.37:g.14862125G>A	ENSP00000367703:p.Arg38Trp	Somatic		Capture	Illumina HiSeq	Phase_I	14902131	NM_001029954	A2RUU0|B4DVW3	Missense_Mutation	SNP	ENST00000378442.1	37		.	.	.	.	.	.	.	.	.	.	G	10.59	1.392813	0.25118	.	.	ENSG00000185267	ENST00000378442;ENST00000465530	.	.	.	5.9	-6.28	0.02020	.	1.578780	0.03265	N	0.183830	T	0.16599	0.0399	N	0.05383	-0.06	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17561	-1.0365	9	0.54805	T	0.06	0.1056	3.9434	0.09338	0.4072:0.1049:0.386:0.1018	.	140	Q49AH0	CDNF_HUMAN	W	38;140	.	ENSP00000367703:R38W	R	-	1	2	CDNF	14902131	0.203000	0.23435	0.001000	0.08648	0.528000	0.34623	0.768000	0.26590	-1.470000	0.01888	-2.143000	0.00337	CGG		0.423	CDNF-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000046919.1	NM_001029954	
LZTS2	84445	broad.mit.edu	37	10	102763707	102763707	+	Silent	SNP	C	C	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr10:102763707C>A	ENST00000370220.1	+	2	3915	c.852C>A	c.(850-852)tcC>tcA	p.S284S	LZTS2_ENST00000370223.3_Silent_p.S284S					leucine zipper, putative tumor suppressor 2									p.S284S(1)|p.S147S(1)		breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		GCACAGGCTCCCTAGGGGGCC	0.711																																					p.S284S	Esophageal Squamous(8;38 437 13604 19902 37640)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C852A	10						.						24.0	31.0	29.0					10																	102763707		2190	4288	6478	102753697	SO:0001819	synonymous_variant	84445	exon3			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.852C>A	10.37:g.102763707C>A		Somatic		Capture	Illumina HiSeq	Phase_I	102753697	NM_032429		Silent	SNP	ENST00000370220.1	37	CCDS7507.1																																																																																				0.711	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
OR52R1	119695	broad.mit.edu	37	11	4825181	4825181	+	Missense_Mutation	SNP	C	C	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr11:4825181C>G	ENST00000356069.2	-	1	429	c.430G>C	c.(430-432)Gtg>Ctg	p.V144L	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.V223L	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V223L(1)|p.V143L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGTTTGATCACGACCGATGGG	0.572																																					p.V144L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G430C	11						.						98.0	86.0	90.0					11																	4825181		2201	4298	6499	4781757	SO:0001583	missense	119695	exon1			BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.430G>C	11.37:g.4825181C>G	ENSP00000348368:p.Val144Leu	Somatic		Capture	Illumina HiSeq	Phase_I	4781757	NM_001005177	Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	37	CCDS31360.2	.	.	.	.	.	.	.	.	.	.	C	9.045	0.990708	0.18966	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.38077	1.16;1.16	5.57	2.65	0.31530	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	D	0.000450	T	0.53045	0.1772	M	0.63169	1.94	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.43032	-0.9416	10	0.42905	T	0.14	.	11.2382	0.48953	0.0:0.7246:0.0:0.2754	.	144	Q8NGF1	O52R1_HUMAN	L	144;223	ENSP00000348368:V144L;ENSP00000369742:V223L	ENSP00000348368:V144L	V	-	1	0	OR52R1	4781757	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	-0.387000	0.07361	0.477000	0.27464	-0.813000	0.03139	GTG		0.572	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177	
OR4S1	256148	broad.mit.edu	37	11	48327983	48327983	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr11:48327983G>T	ENST00000319988.1	+	1	209	c.209G>T	c.(208-210)tGt>tTt	p.C70F		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C70F(1)		endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						GCTGACATATGTTATCCATCC	0.463																																					p.C70F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G209T	11						.						181.0	146.0	158.0					11																	48327983		2201	4287	6488	48284559	SO:0001583	missense	256148	exon1			AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.209G>T	11.37:g.48327983G>T	ENSP00000321447:p.Cys70Phe	Somatic		Capture	Illumina HiSeq	Phase_I	48284559	NM_001004725	Q6IFB4	Missense_Mutation	SNP	ENST00000319988.1	37	CCDS31488.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145404	0.37825	.	.	ENSG00000176555	ENST00000319988	T	0.16897	2.31	5.02	0.755	0.18415	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.36054	0.0953	M	0.80183	2.485	0.09310	N	1	D	0.89917	1.0	D	0.74023	0.982	T	0.11446	-1.0587	9	0.48119	T	0.1	.	4.5615	0.12163	0.077:0.132:0.5187:0.2722	.	70	Q8NGB4	OR4S1_HUMAN	F	70	ENSP00000321447:C70F	ENSP00000321447:C70F	C	+	2	0	OR4S1	48284559	0.001000	0.12720	0.000000	0.03702	0.021000	0.10359	0.708000	0.25719	-0.042000	0.13535	-0.119000	0.15052	TGT		0.463	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390556.1	NM_001004725	
TPP1	1200	broad.mit.edu	37	11	6638598	6638598	+	Missense_Mutation	SNP	T	T	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr11:6638598T>C	ENST00000299427.6	-	5	502	c.442A>G	c.(442-444)Acc>Gcc	p.T148A	RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000533371.1_5'UTR|TPP1_ENST00000534644.1_5'UTR	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)	p.T148A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	ACAACATGGGTTTCCGTAGGT	0.562																																					p.T148A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A442G	11						.						82.0	83.0	83.0					11																	6638598		2201	4296	6497	6595174	SO:0001583	missense	1200	exon5			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.442A>G	11.37:g.6638598T>C	ENSP00000299427:p.Thr148Ala	Somatic		Capture	Illumina HiSeq	Phase_I	6595174	NM_000391	Q71V64	Missense_Mutation	SNP	ENST00000299427.6	37	CCDS7770.1	.	.	.	.	.	.	.	.	.	.	T	10.58	1.389920	0.25118	.	.	ENSG00000166340	ENST00000299427;ENST00000453338;ENST00000436873	T;T	0.68331	-0.32;-0.01	5.04	3.89	0.44902	Proteinase inhibitor, propeptide (1);Peptidase S53, propeptide (2);	0.632596	0.17358	N	0.177144	T	0.45478	0.1344	N	0.25647	0.755	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.002	T	0.24476	-1.0159	10	0.08837	T	0.75	-6.3245	5.7869	0.18338	0.0:0.0964:0.1727:0.7308	.	148;148	B4DEQ3;O14773	.;TPP1_HUMAN	A	148	ENSP00000299427:T148A;ENSP00000398136:T148A	ENSP00000299427:T148A	T	-	1	0	TPP1	6595174	0.114000	0.22134	0.686000	0.30086	0.805000	0.45488	2.153000	0.42282	2.114000	0.64651	0.455000	0.32223	ACC		0.562	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257261.2		
OR10A6	390093	broad.mit.edu	37	11	7949613	7949613	+	Silent	SNP	T	T	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr11:7949613T>G	ENST00000309838.2	-	1	596	c.597A>C	c.(595-597)gcA>gcC	p.A199A		NM_001004461.1	NP_001004461.1	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A, member 6	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A199A(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TGCCTGTGAATGCATAGATTT	0.388																																					p.A199A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A597C	11						.						63.0	55.0	58.0					11																	7949613		2201	4296	6497	7906189	SO:0001819	synonymous_variant	390093	exon1			AB065515	CCDS31420.1	11p15.4	2012-08-09			ENSG00000175393	ENSG00000175393		"""GPCR / Class A : Olfactory receptors"""	15132	protein-coding gene	gene with protein product							Standard	NM_001004461		Approved		uc010rbh.2	Q8NH74	OTTHUMG00000165671	ENST00000309838.2:c.597A>C	11.37:g.7949613T>G		Somatic		Capture	Illumina HiSeq	Phase_I	7906189	NM_001004461	Q6IF59	Silent	SNP	ENST00000309838.2	37	CCDS31420.1																																																																																				0.388	OR10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385703.1	NM_001004461	
ATG2A	23130	broad.mit.edu	37	11	64679641	64679641	+	Missense_Mutation	SNP	T	T	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr11:64679641T>G	ENST00000377264.3	-	8	1115	c.1003A>C	c.(1003-1005)Aac>Cac	p.N335H	ATG2A_ENST00000421419.2_Missense_Mutation_p.N335H	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	335					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)		p.N335H(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						AGCTGCTGGTTCAGGTCCTGC	0.627																																					p.N335H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1003C	11						.						59.0	65.0	63.0					11																	64679641		2201	4297	6498	64436217	SO:0001583	missense	23130	exon8				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.1003A>C	11.37:g.64679641T>G	ENSP00000366475:p.Asn335His	Somatic		Capture	Illumina HiSeq	Phase_I	64436217	NM_015104	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.61|18.61	3.661593|3.661593	0.67700|0.67700	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000418259|ENST00000421419;ENST00000377264;ENST00000227459	.|T;T	.|0.07567	.|3.18;3.18	4.07|4.07	4.07|4.07	0.47477|0.47477	.|.	.|0.114981	.|0.56097	.|D	.|0.000026	T|T	0.18341|0.18341	0.0440|0.0440	L|L	0.47716|0.47716	1.5|1.5	0.34599|0.34599	D|D	0.716297|0.716297	.|D	.|0.69078	.|0.997	.|D	.|0.63597	.|0.916	T|T	0.13045|0.13045	-1.0524|-1.0524	5|10	.|0.52906	.|T	.|0.07	.|.	11.3118|11.3118	0.49368|0.49368	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|335	.|Q2TAZ0	.|ATG2A_HUMAN	A|H	136|335	.|ENSP00000410522:N335H;ENSP00000366475:N335H	.|ENSP00000227459:N335H	E|N	-|-	2|1	0|0	ATG2A|ATG2A	64436217|64436217	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	2.422000|2.422000	0.44696|0.44696	1.858000|1.858000	0.53909|0.53909	0.459000|0.459000	0.35465|0.35465	GAA|AAC		0.627	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
KSR2	283455	broad.mit.edu	37	12	118020111	118020111	+	Missense_Mutation	SNP	T	T	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr12:118020111T>C	ENST00000339824.5	-	6	1952	c.1225A>G	c.(1225-1227)Aac>Gac	p.N409D	KSR2_ENST00000302438.5_Missense_Mutation_p.N106D|KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000425217.1_Missense_Mutation_p.N380D			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	409					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.N441D(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTGATGGAGTTGCCGAGATCT	0.597																																					p.N380D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1138G	12						.						115.0	117.0	116.0					12																	118020111		2107	4235	6342	116504494	SO:0001583	missense	283455	exon6			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1225A>G	12.37:g.118020111T>C	ENSP00000339952:p.Asn409Asp	Somatic		Capture	Illumina HiSeq	Phase_I	116504494	NM_173598	A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	ENST00000339824.5	37		.	.	.	.	.	.	.	.	.	.	T	16.47	3.133103	0.56828	.	.	ENSG00000171435	ENST00000425217;ENST00000339824;ENST00000302438;ENST00000542378	T;T;T	0.54479	0.57;0.57;0.57	4.94	3.74	0.42951	.	0.000000	0.85682	D	0.000000	T	0.46964	0.1420	L	0.29908	0.895	0.51482	D	0.999925	P	0.48640	0.913	P	0.48873	0.593	T	0.49495	-0.8934	10	0.56958	D	0.05	.	10.9687	0.47426	0.0:0.0:0.1562:0.8438	.	409	Q6VAB6	KSR2_HUMAN	D	380;409;106;81	ENSP00000389715:N380D;ENSP00000339952:N409D;ENSP00000305466:N106D	ENSP00000305466:N106D	N	-	1	0	KSR2	116504494	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	5.537000	0.67186	1.859000	0.53934	0.260000	0.18958	AAC		0.597	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	
KDM2B	84678	broad.mit.edu	37	12	121881909	121881910	+	Missense_Mutation	DNP	GG	GG	CT	rs373233914		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr12:121881909_121881910GG>CT	ENST00000377071.4	-	16	2428_2429	c.2356_2357CC>AG	c.(2356-2358)CCg>AGg	p.P786R	KDM2B_ENST00000377069.4_Missense_Mutation_p.P755R|KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000542973.1_Missense_Mutation_p.P154R	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	786					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)	p.P425>?(1)|p.P786>?(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						GCCGTCCGGCGGCACCTTCTTC	0.629											OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.												.	.	2	Complex(2)	large_intestine(2)	c.2356_2357AG	12						.																																			120366293	SO:0001583	missense	84678	exon16			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2356_2357delinsCT	12.37:g.121881909_121881910delinsCT	ENSP00000366271:p.Pro786Arg	Somatic	1514	Capture	Illumina HiSeq	Phase_I	120366292	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	DNP	ENST00000377071.4	37	CCDS41850.1																																																																																				0.629	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
CLEC6A	93978	broad.mit.edu	37	12	8618161	8618161	+	Missense_Mutation	SNP	A	A	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr12:8618161A>T	ENST00000382073.3	+	4	491	c.305A>T	c.(304-306)aAg>aTg	p.K102M		NM_001007033.1	NP_001007034.1	Q6EIG7	CLC6A_HUMAN	C-type lectin domain family 6, member A	102	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.K102M(1)		breast(1)|large_intestine(2)|lung(7)	10	Lung SC(5;0.184)					GTTTGGTCTAAGAGTGAGCAG	0.408																																					p.K102M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A305T	12						.						165.0	152.0	157.0					12																	8618161		2203	4300	6503	8509428	SO:0001583	missense	93978	exon4			AY321309	CCDS31739.1	12p13	2005-09-21	2005-02-09	2005-02-11	ENSG00000205846	ENSG00000205846		"""C-type lectin domain containing"""	14556	protein-coding gene	gene with protein product		613579	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 10"""	CLECSF10			Standard	NM_001007033		Approved	dectin-2	uc001qum.1	Q6EIG7	OTTHUMG00000168672	ENST00000382073.3:c.305A>T	12.37:g.8618161A>T	ENSP00000371505:p.Lys102Met	Somatic		Capture	Illumina HiSeq	Phase_I	8509428	NM_001007033	A2RUK3	Missense_Mutation	SNP	ENST00000382073.3	37	CCDS31739.1	.	.	.	.	.	.	.	.	.	.	A	12.86	2.065969	0.36470	.	.	ENSG00000205846	ENST00000382073	T	0.18016	2.24	4.09	1.67	0.24075	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.189970	0.25958	N	0.027215	T	0.26304	0.0642	M	0.62154	1.92	0.22199	N	0.999294	D	0.61080	0.989	P	0.57548	0.823	T	0.06588	-1.0818	10	0.87932	D	0	.	4.6085	0.12389	0.6046:0.2018:0.0:0.1937	.	102	Q6EIG7	CLC6A_HUMAN	M	102	ENSP00000371505:K102M	ENSP00000371505:K102M	K	+	2	0	CLEC6A	8509428	0.121000	0.22262	0.479000	0.27329	0.395000	0.30598	2.201000	0.42734	0.350000	0.24002	0.528000	0.53228	AAG		0.408	CLEC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400562.1	NM_001007033	
NCKAP5L	57701	broad.mit.edu	37	12	50185727	50185727	+	Silent	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr12:50185727G>A	ENST00000335999.6	-	13	4101	c.3900C>T	c.(3898-3900)gcC>gcT	p.A1300A		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	1296								p.A1300A(1)|p.A891A(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						TGCCTTCCTCGGCCATGTCCG	0.692																																					p.A1300A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3900T	12						.						14.0	18.0	17.0					12																	50185727		1898	4104	6002	48471994	SO:0001819	synonymous_variant	57701	exon13			AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.3900C>T	12.37:g.50185727G>A		Somatic		Capture	Illumina HiSeq	Phase_I	48471994	NM_001037806	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Silent	SNP	ENST00000335999.6	37	CCDS41781.2																																																																																				0.692	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2	XM_035497	
CELA1	1990	broad.mit.edu	37	12	51735126	51735126	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr12:51735126G>C	ENST00000293636.1	-	5	405	c.365C>G	c.(364-366)aCc>aGc	p.T122S		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	122	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						GCTATTGAGGGTAACGCTCTG	0.567											OREG0021819	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T122S												.	.	0			c.C365G	12						.						121.0	102.0	109.0					12																	51735126		2203	4300	6503	50021393	SO:0001583	missense	1990	exon5				CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.365C>G	12.37:g.51735126G>C	ENSP00000293636:p.Thr122Ser	None	979	Capture	Illumina HiSeq	Phase_I	50021393	NM_001971	Q5MLF0|Q6DJT0|Q6ISM6	Missense_Mutation	SNP	ENST00000293636.1	37	CCDS8812.1	.	.	.	.	.	.	.	.	.	.	G	9.818	1.184954	0.21870	.	.	ENSG00000139610	ENST00000293636	D	0.88896	-2.44	5.2	3.18	0.36537	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.236951	0.42682	N	0.000680	T	0.78084	0.4228	N	0.17901	0.54	0.32724	N	0.509892	B	0.06786	0.001	B	0.14023	0.01	T	0.72659	-0.4226	10	0.16420	T	0.52	-17.7151	9.9276	0.41503	0.0:0.276:0.5824:0.1415	.	122	Q9UNI1	CELA1_HUMAN	S	122	ENSP00000293636:T122S	ENSP00000293636:T122S	T	-	2	0	CELA1	50021393	0.318000	0.24598	0.948000	0.38648	0.961000	0.63080	2.137000	0.42130	1.285000	0.44548	0.549000	0.68633	ACC		0.567	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
RASSF9	9182	broad.mit.edu	37	12	86199134	86199134	+	Silent	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr12:86199134G>A	ENST00000361228.3	-	2	1022	c.654C>T	c.(652-654)ttC>ttT	p.F218F		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	218					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)	p.F218F(2)		endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GATCAAGATGGAACTTAGCTT	0.378																																					p.F218F												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C654T	12						.						167.0	156.0	159.0					12																	86199134		1850	4102	5952	84723265	SO:0001819	synonymous_variant	9182	exon2				CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.654C>T	12.37:g.86199134G>A		Somatic		Capture	Illumina HiSeq	Phase_I	84723265	NM_005447	B3KMQ4|Q8N5U8	Silent	SNP	ENST00000361228.3	37	CCDS44950.1																																																																																				0.378	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1		
NR2C1	7181	broad.mit.edu	37	12	95422178	95422179	+	Missense_Mutation	DNP	CT	CT	TG			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr12:95422178_95422179CT>TG	ENST00000333003.5	-	12	1845_1846	c.1515_1516AG>CA	c.(1513-1518)atAGta>atCAta	p.V506I	NR2C1_ENST00000545833.1_5'Flank	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	506					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.I505>?(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						CTGAAGAGTACTATTGCCTTCA	0.361																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1515_1516CA	12						.																																			93946310	SO:0001583	missense	7181	exon12			M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.1515_1516delinsTG	12.37:g.95422178_95422179delinsTG	ENSP00000333275:p.Val506Ile	Somatic		Capture	Illumina HiSeq	Phase_I	93946309	NM_003297	A8K5K4|Q15625|Q15626	Missense_Mutation	DNP	ENST00000333003.5	37	CCDS9051.1																																																																																				0.361	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407565.2	NM_003297	
DNAH10	196385	broad.mit.edu	37	12	124403440	124403440	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr12:124403440G>A	ENST00000409039.3	+	64	11121	c.11096G>A	c.(11095-11097)cGc>cAc	p.R3699H		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3699					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R2291H(1)|p.R3699H(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTCATGAAACGCCTGAGGAAC	0.522																																					p.R3699H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G11096A	12						.						78.0	77.0	78.0					12																	124403440		2151	4272	6423	122969393	SO:0001583	missense	196385	exon64			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.11096G>A	12.37:g.124403440G>A	ENSP00000386770:p.Arg3699His	Somatic		Capture	Illumina HiSeq	Phase_I	122969393	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	21.1	4.101662	0.76983	.	.	ENSG00000197653	ENST00000409039	T	0.76968	-1.06	5.79	5.79	0.91817	.	0.120748	0.53938	D	0.000045	D	0.91479	0.7310	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92710	0.6182	10	0.87932	D	0	.	20.0407	0.97588	0.0:0.0:1.0:0.0	.	3699	Q8IVF4	DYH10_HUMAN	H	3699	ENSP00000386770:R3699H	ENSP00000386770:R3699H	R	+	2	0	DNAH10	122969393	1.000000	0.71417	0.931000	0.37212	0.015000	0.08874	9.869000	0.99810	2.746000	0.94184	0.561000	0.74099	CGC		0.522	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
ARHGEF7	8874	broad.mit.edu	37	13	111919927	111919927	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr13:111919927G>C	ENST00000375741.2	+	10	1296	c.1046G>C	c.(1045-1047)tGc>tCc	p.C349S	ARHGEF7_ENST00000218789.5_Missense_Mutation_p.C171S|ARHGEF7_ENST00000478679.1_Missense_Mutation_p.C93S|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.C246S|ARHGEF7_ENST00000370623.3_Missense_Mutation_p.C256S|ARHGEF7_ENST00000426073.2_Missense_Mutation_p.C171S|ARHGEF7_ENST00000375723.1_Missense_Mutation_p.C171S|ARHGEF7_ENST00000375736.4_Missense_Mutation_p.C171S|ARHGEF7_ENST00000375739.2_Missense_Mutation_p.C299S|ARHGEF7_ENST00000483189.1_3'UTR|ARHGEF7_ENST00000544132.1_Silent_p.L51L|ARHGEF7_ENST00000317133.5_Missense_Mutation_p.C328S	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	349	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.C171S(1)|p.C328S(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GTCGGAGGCTGCTTTTTAAAC	0.493																																					p.C299S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G896C	13						.						183.0	146.0	159.0					13																	111919927		2203	4300	6503	110717928	SO:0001583	missense	8874	exon8			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.1046G>C	13.37:g.111919927G>C	ENSP00000364893:p.Cys349Ser	Somatic		Capture	Illumina HiSeq	Phase_I	110717928	NM_001113512	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	ENST00000375741.2	37	CCDS45068.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607451	0.66558	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000370623;ENST00000545635;ENST00000466143;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737;ENST00000375723;ENST00000478679	T;T;T;T;T;T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	4.55	4.55	0.56014	Dbl homology (DH) domain (5);	0.047937	0.85682	D	0.000000	T	0.76919	0.4055	M	0.71581	2.175	0.80722	D	1	B;D;B;P;D;P	0.54047	0.038;0.964;0.119;0.552;0.964;0.739	B;P;B;B;P;P	0.62089	0.103;0.875;0.147;0.216;0.898;0.711	T	0.80933	-0.1161	10	0.87932	D	0	.	17.3931	0.87437	0.0:0.0:1.0:0.0	.	93;246;93;299;349;328	E9PDQ5;B7Z6G2;B7Z344;Q14155-2;Q14155;Q14155-3	.;.;.;.;ARHG7_HUMAN;.	S	328;349;299;256;326;171;171;171;171;246;171;93	ENSP00000325994:C328S;ENSP00000364893:C349S;ENSP00000364891:C299S;ENSP00000359657:C256S;ENSP00000418067:C171S;ENSP00000218789:C171S;ENSP00000364888:C171S;ENSP00000397068:C171S;ENSP00000364889:C246S;ENSP00000364875:C171S;ENSP00000417596:C93S	ENSP00000218789:C171S	C	+	2	0	ARHGEF7	110717928	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.326000	0.72905	2.104000	0.64026	0.558000	0.71614	TGC		0.493	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
KL	9365	broad.mit.edu	37	13	33635088	33635088	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr13:33635088C>T	ENST00000380099.3	+	4	1880	c.1872C>T	c.(1870-1872)agC>agT	p.S624S	KL_ENST00000426690.2_3'UTR|KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	624	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)	p.S624S(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		GCATGGCCAGCGAGCTTGTCC	0.632																																					p.S624S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1872T	13						.						92.0	86.0	88.0					13																	33635088		2203	4300	6503	32533088	SO:0001819	synonymous_variant	9365	exon4			AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.1872C>T	13.37:g.33635088C>T		Somatic		Capture	Illumina HiSeq	Phase_I	32533088	NM_004795	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Silent	SNP	ENST00000380099.3	37	CCDS9347.1																																																																																				0.632	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		
NBEA	26960	broad.mit.edu	37	13	35733719	35733719	+	Missense_Mutation	SNP	A	A	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr13:35733719A>T	ENST00000400445.3	+	22	3945	c.3411A>T	c.(3409-3411)gaA>gaT	p.E1137D	NBEA_ENST00000540320.1_Missense_Mutation_p.E1137D|NBEA_ENST00000379939.2_Missense_Mutation_p.E1137D|NBEA_ENST00000310336.4_Missense_Mutation_p.E1137D	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1137					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.E1137D(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		ATGAGAAAGAAGACCTTCCCA	0.328																																					p.E1137D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3411T	13						.						59.0	55.0	56.0					13																	35733719		1843	4086	5929	34631719	SO:0001583	missense	26960	exon22			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.3411A>T	13.37:g.35733719A>T	ENSP00000383295:p.Glu1137Asp	Somatic		Capture	Illumina HiSeq	Phase_I	34631719	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	A	4.490	0.090923	0.08632	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.42	-1.33	0.09172	.	0.294390	0.35067	N	0.003465	T	0.12987	0.0315	N	0.04508	-0.205	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13980	-1.0489	10	0.11485	T	0.65	.	1.9569	0.03378	0.4688:0.0815:0.1558:0.2939	.	1137	Q5T321	.	D	1137	ENSP00000440951:E1137D;ENSP00000383295:E1137D;ENSP00000369271:E1137D;ENSP00000308534:E1137D	ENSP00000308534:E1137D	E	+	3	2	NBEA	34631719	0.995000	0.38212	0.867000	0.34043	0.948000	0.59901	0.274000	0.18680	-0.499000	0.06623	-0.375000	0.07067	GAA		0.328	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
PCDH20	64881	broad.mit.edu	37	13	61986876	61986876	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr13:61986876C>T	ENST00000409186.1	-	5	3461	c.1356G>A	c.(1354-1356)gcG>gcA	p.A452A	PCDH20_ENST00000409204.4_Silent_p.A452A			Q8N6Y1	PCD20_HUMAN	protocadherin 20	452	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.A425A(1)|p.A452A(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TGGTGAAAAACGCAATGGGAG	0.413																																					p.A452A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1356A	13						.						103.0	104.0	104.0					13																	61986876		2203	4300	6503	60884877	SO:0001819	synonymous_variant	64881	exon2			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.1356G>A	13.37:g.61986876C>T		Somatic		Capture	Illumina HiSeq	Phase_I	60884877	NM_022843	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Silent	SNP	ENST00000409186.1	37	CCDS9442.2																																																																																				0.413	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
DIS3	22894	broad.mit.edu	37	13	73346020	73346020	+	Silent	SNP	A	A	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr13:73346020A>T	ENST00000377767.4	-	11	1618	c.1518T>A	c.(1516-1518)atT>atA	p.I506I	DIS3_ENST00000545453.1_Silent_p.I344I|DIS3_ENST00000377780.4_Silent_p.I476I	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	506					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)	p.I506I(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		TCACATCAGCAATATGAACAC	0.338										Multiple Myeloma(4;0.011)																											p.I476I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1428A	13						.						87.0	87.0	87.0					13																	73346020		2203	4300	6503	72244021	SO:0001819	synonymous_variant	22894	exon11			AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.1518T>A	13.37:g.73346020A>T		Somatic		Capture	Illumina HiSeq	Phase_I	72244021	NM_001128226	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Silent	SNP	ENST00000377767.4	37	CCDS9447.1																																																																																				0.338	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953	
POU4F1	5457	broad.mit.edu	37	13	79175559	79175559	+	Silent	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr13:79175559G>T	ENST00000377208.5	-	2	1462	c.1251C>A	c.(1249-1251)gcC>gcA	p.A417A	RNF219-AS1_ENST00000606124.1_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000607205.1_RNA|RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560584.2_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	417					axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)	p.A417A(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		CTCAGTAAGTGGCAGAGAATT	0.572																																					p.A417A	Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1251A	13						.						66.0	62.0	63.0					13																	79175559		2203	4300	6503	78073560	SO:0001819	synonymous_variant	5457	exon2			X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.1251C>A	13.37:g.79175559G>T		Somatic		Capture	Illumina HiSeq	Phase_I	78073560	NM_006237	Q14986|Q15318|Q5T227	Silent	SNP	ENST00000377208.5	37	CCDS31996.1																																																																																				0.572	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045360.3		
UGGT2	55757	broad.mit.edu	37	13	96508427	96508427	+	Missense_Mutation	SNP	A	A	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr13:96508427A>C	ENST00000376747.3	-	34	4063	c.3993T>G	c.(3991-3993)ttT>ttG	p.F1331L		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1331	Glucosyltransferase.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.F1331L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						CAGCATCAACAAAAATGATTT	0.333																																					p.F1331L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3993G	13						.						85.0	87.0	86.0					13																	96508427		2203	4300	6503	95306428	SO:0001583	missense	55757	exon34			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.3993T>G	13.37:g.96508427A>C	ENSP00000365938:p.Phe1331Leu	Somatic		Capture	Illumina HiSeq	Phase_I	95306428	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.337044	0.81801	.	.	ENSG00000102595	ENST00000376747	T	0.52754	0.65	5.67	3.15	0.36227	.	0.149058	0.64402	N	0.000007	T	0.73024	0.3534	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77247	-0.2658	10	0.87932	D	0	-14.8799	12.5423	0.56179	0.7365:0.2635:0.0:0.0	.	1331	Q9NYU1	UGGG2_HUMAN	L	1331	ENSP00000365938:F1331L	ENSP00000365938:F1331L	F	-	3	2	UGGT2	95306428	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.005000	0.63972	0.378000	0.24764	0.533000	0.62120	TTT		0.333	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
GRK1	6011	broad.mit.edu	37	13	114321905	114321905	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr13:114321905C>T	ENST00000335678.6	+	1	436	c.204C>T	c.(202-204)ggC>ggT	p.G68G		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	68	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)	p.G68G(1)		ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			AGCCCATCGGCAAGAAGCTCT	0.587																																					p.G68G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C204T	13						.						40.0	44.0	43.0					13																	114321905		2070	4195	6265	113369906	SO:0001819	synonymous_variant	6011	exon1					13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.204C>T	13.37:g.114321905C>T		Somatic		Capture	Illumina HiSeq	Phase_I	113369906	NM_002929	Q53X14	Silent	SNP	ENST00000335678.6	37																																																																																					0.587	GRK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470655.1	NM_002929	
OR10G2	26534	broad.mit.edu	37	14	22102298	22102298	+	Missense_Mutation	SNP	C	C	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr14:22102298C>A	ENST00000542433.1	-	1	798	c.701G>T	c.(700-702)cGc>cTc	p.R234L		NM_001005466.1	NP_001005466.1	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G, member 2	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(2)	22	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		ATCAGCGGTGCGTATCTTCAG	0.537																																					p.R234L												.	.	0			c.G701T	14						.						43.0	44.0	43.0					14																	22102298		2174	4236	6410	21172138	SO:0001583	missense	26534	exon1				CCDS32047.1	14q11.2	2013-09-24			ENSG00000255582	ENSG00000255582		"""GPCR / Class A : Olfactory receptors"""	8170	protein-coding gene	gene with protein product						8188290	Standard	NM_001005466		Approved		uc010tmc.2	Q8NGC3	OTTHUMG00000168890	ENST00000542433.1:c.701G>T	14.37:g.22102298C>A	ENSP00000445383:p.Arg234Leu	None		Capture	Illumina HiSeq	Phase_I	21172138	NM_001005466	B2RPD0	Missense_Mutation	SNP	ENST00000542433.1	37	CCDS32047.1	.	.	.	.	.	.	.	.	.	.	C	8.259	0.810719	0.16537	.	.	ENSG00000255582	ENST00000542433	T	0.39787	1.06	3.92	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	0.324986	0.22801	N	0.055472	T	0.44371	0.1290	M	0.78916	2.43	0.09310	N	1	P	0.35174	0.488	B	0.37989	0.262	T	0.38222	-0.9671	10	0.46703	T	0.11	-2.1505	9.0885	0.36596	0.0:0.8896:0.0:0.1104	.	234	Q8NGC3	O10G2_HUMAN	L	234	ENSP00000445383:R234L	ENSP00000445383:R234L	R	-	2	0	OR10G2	21172138	0.000000	0.05858	0.985000	0.45067	0.077000	0.17291	-1.140000	0.03210	0.868000	0.35678	0.557000	0.71058	CGC		0.537	OR10G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401525.1		
MYH7	4625	broad.mit.edu	37	14	23892858	23892858	+	Silent	SNP	C	C	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr14:23892858C>A	ENST00000355349.3	-	24	3159	c.2997G>T	c.(2995-2997)ctG>ctT	p.L999L		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	999					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.L999L(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GGGCCTCTTGCAGAGCTTTCT	0.542																																					p.L999L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2997T	14						.						156.0	153.0	154.0					14																	23892858		2203	4300	6503	22962698	SO:0001819	synonymous_variant	4625	exon24			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2997G>T	14.37:g.23892858C>A		Somatic		Capture	Illumina HiSeq	Phase_I	22962698	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	CCDS9601.1																																																																																				0.542	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
DHRS4L1	728635	broad.mit.edu	37	14	24507110	24507110	+	RNA	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr14:24507110G>C	ENST00000558293.1	+	0	176					NR_102693.1																						ATGAAGGACTGGGAGCGGCTG	0.637																																					p.W96S												.	.	0			c.G287C	14						.						24.0	27.0	26.0					14																	24507110		2203	4300	6503	23576950			728635	exon2																															14.37:g.24507110G>C		Somatic		Capture	Illumina HiSeq	Phase_I	23576950	NM_001082488		Missense_Mutation	SNP	ENST00000558293.1	37		.	.	.	.	.	.	.	.	.	.	-	11.47	1.647496	0.29246	.	.	ENSG00000225766	ENST00000397065	.	.	.	3.32	3.32	0.38043	NAD(P)-binding domain (1);	.	.	.	.	T	0.36663	0.0975	N	0.16368	0.405	.	.	.	B	0.13145	0.007	B	0.14023	0.01	T	0.47142	-0.9140	7	0.41790	T	0.15	.	12.5473	0.56208	0.0:0.0:1.0:0.0	.	96	P0CG22	DR4L1_HUMAN	S	96	.	ENSP00000380255:W96S	W	+	2	0	AL136295.1	23576950	1.000000	0.71417	0.431000	0.26735	0.351000	0.29236	7.539000	0.82063	1.864000	0.54056	0.400000	0.26472	TGG		0.637	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1		
CIDEB	27141	broad.mit.edu	37	14	24776697	24776697	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr14:24776697C>T	ENST00000336557.5	-	5	1368	c.66G>A	c.(64-66)gaG>gaA	p.E22E	LTB4R2_ENST00000533293.1_5'Flank|CIDEB_ENST00000554411.1_Silent_p.E22E|NOP9_ENST00000267425.3_3'UTR|LTB4R2_ENST00000543919.1_5'Flank|CIDEB_ENST00000258807.5_Silent_p.E22E|LTB4R2_ENST00000528054.1_5'Flank			Q9UHD4	CIDEB_HUMAN	cell death-inducing DFFA-like effector b	22					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|regulation of apoptotic process (GO:0042981)	cytosol (GO:0005829)|lipid particle (GO:0005811)	identical protein binding (GO:0042802)	p.E22E(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0181)		TCCGTCCAAACTCCGAGCTTA	0.552																																					p.E22E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G66A	14						.						65.0	68.0	67.0					14																	24776697		2203	4300	6503	23846537	SO:0001819	synonymous_variant	27141	exon4			AF190901	CCDS32056.1	14q12	2012-09-20			ENSG00000136305	ENSG00000136305			1977	protein-coding gene	gene with protein product		604441				10619428, 10837461	Standard	XM_005267540		Approved		uc001woo.3	Q9UHD4	OTTHUMG00000171555	ENST00000336557.5:c.66G>A	14.37:g.24776697C>T		Somatic		Capture	Illumina HiSeq	Phase_I	23846537	NM_014430	D3DS73|Q546V8|Q9NNW9	Silent	SNP	ENST00000336557.5	37	CCDS32056.1																																																																																				0.552	CIDEB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414120.1		
ABHD12B	145447	broad.mit.edu	37	14	51352356	51352356	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr14:51352356G>A	ENST00000337334.2	+	6	526	c.511G>A	c.(511-513)Gtc>Atc	p.V171I	ABHD12B_ENST00000395752.1_Missense_Mutation_p.V64I|PYGL_ENST00000532462.1_Intron|ABHD12B_ENST00000554241.1_3'UTR|ABHD12B_ENST00000353130.1_Missense_Mutation_p.V94I	NM_001206673.1	NP_001193602.1	Q7Z5M8	AB12B_HUMAN	abhydrolase domain containing 12B	171							hydrolase activity (GO:0016787)	p.V94I(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(5)	10	all_epithelial(31;0.00481)|Breast(41;0.148)					TGGCTTTCATGTCTTGTCTGT	0.433																																					p.V94I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G280A	14						.						219.0	193.0	202.0					14																	51352356		2203	4300	6503	50422106	SO:0001583	missense	145447	exon4			BG698443	CCDS9702.1, CCDS55916.1	14q21.3	2009-10-09	2007-04-03	2007-04-03	ENSG00000131969	ENSG00000131969		"""Abhydrolase domain containing"""	19837	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 29"""	C14orf29			Standard	NM_181814		Approved	BEM46L3	uc001wys.3	Q7Z5M8	OTTHUMG00000140286	ENST00000337334.2:c.511G>A	14.37:g.51352356G>A	ENSP00000336693:p.Val171Ile	Somatic		Capture	Illumina HiSeq	Phase_I	50422106	NM_181814	Q3KNR9|Q3KNS0|Q7Z5M6|Q7Z5M7|Q8N4D2	Missense_Mutation	SNP	ENST00000337334.2	37	CCDS55916.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058743	0.76074	.	.	ENSG00000131969	ENST00000353130;ENST00000337334;ENST00000395752	T;T;T	0.35789	1.29;1.29;1.29	5.36	5.36	0.76844	.	0.120853	0.56097	D	0.000026	T	0.48768	0.1518	L	0.45698	1.435	0.53688	D	0.999975	D;D	0.63880	0.981;0.993	P;P	0.58520	0.806;0.84	T	0.16394	-1.0404	10	0.31617	T	0.26	-21.5659	17.3765	0.87394	0.0:0.0:1.0:0.0	.	171;94	Q7Z5M8;Q7Z5M8-2	AB12B_HUMAN;.	I	94;171;64	ENSP00000343951:V94I;ENSP00000336693:V171I;ENSP00000379101:V64I	ENSP00000336693:V171I	V	+	1	0	ABHD12B	50422106	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	5.399000	0.66314	2.890000	0.99128	0.655000	0.94253	GTC		0.433	ABHD12B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411030.1		
NID2	22795	broad.mit.edu	37	14	52509526	52509526	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr14:52509526C>T	ENST00000216286.5	-	6	1552	c.1553G>A	c.(1552-1554)gGa>gAa	p.G518E	NID2_ENST00000541773.1_Missense_Mutation_p.G465E	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	518	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.G518E(1)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					CTTCCCATTTCCATAAAACTT	0.517																																					p.G518E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1553A	14						.						127.0	109.0	115.0					14																	52509526		2203	4300	6503	51579276	SO:0001583	missense	22795	exon6			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1553G>A	14.37:g.52509526C>T	ENSP00000216286:p.Gly518Glu	Somatic		Capture	Illumina HiSeq	Phase_I	51579276	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562407	0.86335	.	.	ENSG00000087303	ENST00000216286;ENST00000541773;ENST00000395707	D;D	0.91521	-2.41;-2.86	5.76	5.76	0.90799	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.96602	0.8891	M	0.92026	3.265	0.58432	D	0.999992	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96729	0.9538	10	0.87932	D	0	.	19.9381	0.97149	0.0:1.0:0.0:0.0	.	465;520;518	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	E	518;465;520	ENSP00000216286:G518E;ENSP00000443730:G465E	ENSP00000216286:G518E	G	-	2	0	NID2	51579276	1.000000	0.71417	0.910000	0.35882	0.550000	0.35303	7.364000	0.79526	2.880000	0.98712	0.650000	0.86243	GGA		0.517	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
ZBTB25	7597	broad.mit.edu	37	14	64954563	64954563	+	Missense_Mutation	SNP	T	T	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr14:64954563T>C	ENST00000608382.1	-	3	577	c.386A>G	c.(385-387)tAt>tGt	p.Y129C	ZBTB25_ENST00000555220.1_Intron|ZBTB25_ENST00000555424.1_Intron|ZBTB25_ENST00000394715.1_Missense_Mutation_p.Y129C	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	129					gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y129C(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		CTGAATGCCATATAAATTTGA	0.443																																					p.Y129C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A386G	14						.						121.0	113.0	116.0					14																	64954563		2203	4300	6503	64024316	SO:0001583	missense	7597	exon3			X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.386A>G	14.37:g.64954563T>C	ENSP00000476746:p.Tyr129Cys	Somatic		Capture	Illumina HiSeq	Phase_I	64024316	NM_006977	B3KUX6|Q8IYH9	Missense_Mutation	SNP	ENST00000608382.1	37	CCDS9765.1	.	.	.	.	.	.	.	.	.	.	T	19.81	3.896334	0.72639	.	.	ENSG00000089775	ENST00000261683;ENST00000394715	T;T	0.30448	1.53;1.53	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.45915	0.1366	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.28808	-1.0032	10	0.39692	T	0.17	-22.2513	16.5763	0.84648	0.0:0.0:0.0:1.0	.	129	P24278	ZBT25_HUMAN	C	129	ENSP00000261683:Y129C;ENSP00000378204:Y129C	ENSP00000261683:Y129C	Y	-	2	0	ZBTB25	64024316	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.965000	0.87945	2.317000	0.78254	0.459000	0.35465	TAT		0.443	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280649.2	NM_006977	
TEX9	374618	broad.mit.edu	37	15	56686895	56686895	+	Missense_Mutation	SNP	A	A	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr15:56686895A>C	ENST00000352903.2	+	9	715	c.691A>C	c.(691-693)Aat>Cat	p.N231H	TEX9_ENST00000537232.1_Missense_Mutation_p.N156H|TEX9_ENST00000558083.2_Missense_Mutation_p.N156H|TEX9_ENST00000560582.1_5'Flank|TEX9_ENST00000561221.2_Missense_Mutation_p.N231H|RP11-48G14.2_ENST00000564401.1_lincRNA	NM_198524.1	NP_940926.1	Q8N6V9	TEX9_HUMAN	testis expressed 9	231								p.N231H(1)		cervix(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	14				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		TCAAGTAAAAAATTTTGAAGA	0.269																																					p.N231H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A691C	15						.						25.0	28.0	27.0					15																	56686895		2175	4270	6445	54474187	SO:0001583	missense	374618	exon9			BC028119	CCDS10157.1, CCDS66776.1	15q21.3	2007-03-13	2007-03-13		ENSG00000151575	ENSG00000151575			29585	protein-coding gene	gene with protein product			"""testis expressed sequence 9"""				Standard	XM_005254361		Approved		uc002adp.3	Q8N6V9	OTTHUMG00000132035	ENST00000352903.2:c.691A>C	15.37:g.56686895A>C	ENSP00000342169:p.Asn231His	Somatic		Capture	Illumina HiSeq	Phase_I	54474187	NM_198524	B4DH73	Missense_Mutation	SNP	ENST00000352903.2	37	CCDS10157.1	.	.	.	.	.	.	.	.	.	.	A	17.41	3.383478	0.61845	.	.	ENSG00000151575	ENST00000352903;ENST00000537232	T;T	0.79247	-1.25;-1.25	5.25	2.89	0.33648	.	0.359158	0.33895	N	0.004458	T	0.74114	0.3674	L	0.43152	1.355	0.80722	D	1	P;D	0.57571	0.828;0.98	B;P	0.53062	0.413;0.717	T	0.72243	-0.4350	10	0.56958	D	0.05	-6.4381	4.7318	0.12968	0.5688:0.0:0.4311:0.0	.	156;231	B4DH73;Q8N6V9	.;TEX9_HUMAN	H	231;156	ENSP00000342169:N231H;ENSP00000438745:N156H	ENSP00000342169:N231H	N	+	1	0	TEX9	54474187	1.000000	0.71417	0.714000	0.30535	0.867000	0.49689	3.628000	0.54259	0.841000	0.35020	0.482000	0.46254	AAT		0.269	TEX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255048.2	NM_198524	
FEM1B	10116	broad.mit.edu	37	15	68583559	68583559	+	Silent	SNP	A	A	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr15:68583559A>G	ENST00000306917.4	+	2	2478	c.1863A>G	c.(1861-1863)gaA>gaG	p.E621E		NM_015322.4	NP_056137.1	Q9UK73	FEM1B_HUMAN	fem-1 homolog b (C. elegans)	621					apoptotic process (GO:0006915)|branching involved in prostate gland morphogenesis (GO:0060442)|epithelial cell maturation involved in prostate gland development (GO:0060743)|regulation of DNA damage checkpoint (GO:2000001)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death receptor binding (GO:0005123)|ubiquitin-protein transferase activity (GO:0004842)	p.E621E(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						GAACTCTTGAAGAGTTTGTTG	0.393																																					p.E621E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1863G	15						.						36.0	38.0	38.0					15																	68583559		2200	4298	6498	66370613	SO:0001819	synonymous_variant	10116	exon2				CCDS10228.1	15q22	2013-02-19	2001-11-28		ENSG00000169018	ENSG00000169018		"""Ankyrin repeat domain containing"""	3649	protein-coding gene	gene with protein product		613539	"""FEM-1 (C. elegans) homolog b"""			10623617	Standard	NM_015322		Approved		uc002arg.3	Q9UK73	OTTHUMG00000133285	ENST00000306917.4:c.1863A>G	15.37:g.68583559A>G		Somatic		Capture	Illumina HiSeq	Phase_I	66370613	NM_015322	O43146	Silent	SNP	ENST00000306917.4	37	CCDS10228.1																																																																																				0.393	FEM1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257065.1		
OR4F6	390648	broad.mit.edu	37	15	102345981	102345981	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr15:102345981C>T	ENST00000328882.4	+	1	80	c.59C>T	c.(58-60)tCg>tTg	p.S20L		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S20L(1)		breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CTCTCTGACTCGCGGAAGATC	0.493																																					p.S20L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C59T	15						.						167.0	151.0	156.0					15																	102345981		2203	4300	6503	100163504	SO:0001583	missense	390648	exon1			AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.59C>T	15.37:g.102345981C>T	ENSP00000327525:p.Ser20Leu	Somatic		Capture	Illumina HiSeq	Phase_I	100163504	NM_001005326	B9EH28|Q6IF95	Missense_Mutation	SNP	ENST00000328882.4	37	CCDS32341.1	.	.	.	.	.	.	.	.	.	.	.	10.34	1.323548	0.24080	.	.	ENSG00000184140	ENST00000328882	T	0.01092	5.35	4.68	3.77	0.43336	.	0.166220	0.28877	N	0.013853	T	0.01523	0.0049	L	0.45698	1.435	0.31936	N	0.611495	B	0.29253	0.239	B	0.24974	0.057	T	0.09773	-1.0659	10	0.87932	D	0	.	10.7104	0.45980	0.0:0.9057:0.0:0.0943	.	20	Q8NGB9	OR4F6_HUMAN	L	20	ENSP00000327525:S20L	ENSP00000327525:S20L	S	+	2	0	OR4F6	100163504	0.000000	0.05858	0.024000	0.17045	0.003000	0.03518	-1.603000	0.02077	1.330000	0.45394	0.591000	0.81541	TCG		0.493	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417593.1		
SULT1A1	6817	broad.mit.edu	37	16	28619922	28619922	+	Missense_Mutation	SNP	T	T	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr16:28619922T>A	ENST00000395607.1	-	3	424	c.151A>T	c.(151-153)Act>Tct	p.T51S	SULT1A1_ENST00000395609.1_Missense_Mutation_p.T51S|SULT1A1_ENST00000350842.4_Intron|SULT1A1_ENST00000569554.1_Missense_Mutation_p.T51S|SULT1A1_ENST00000314752.7_Missense_Mutation_p.T51S	NM_177530.2|NM_177534.2	NP_803566.1|NP_803878.1	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1	51					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)	p.T51S(1)		endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	ACCCAGGTAGTGCCTGGAGAG	0.622																																					p.T51S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A151T	16						.						103.0	73.0	83.0					16																	28619922		2197	4300	6497	28527423	SO:0001583	missense	6817	exon3			U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000395607.1:c.151A>T	16.37:g.28619922T>A	ENSP00000378971:p.Thr51Ser	Somatic		Capture	Illumina HiSeq	Phase_I	28527423	NM_177529	Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Missense_Mutation	SNP	ENST00000395607.1	37	CCDS32420.1	.	.	.	.	.	.	.	.	.	.	.	17.11	3.306185	0.60305	.	.	ENSG00000196502	ENST00000314752;ENST00000395609;ENST00000395607	T;T;T	0.03889	3.77;3.77;3.77	2.29	2.29	0.28610	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.11623	0.0283	M	0.79123	2.44	0.39935	D	0.974349	P	0.44478	0.836	P	0.49829	0.623	T	0.02144	-1.1206	10	0.62326	D	0.03	.	8.4864	0.33074	0.0:0.0:0.0:1.0	.	51	P50225	ST1A1_HUMAN	S	51	ENSP00000321988:T51S;ENSP00000378972:T51S;ENSP00000378971:T51S	ENSP00000321988:T51S	T	-	1	0	SULT1A1	28527423	1.000000	0.71417	0.998000	0.56505	0.037000	0.13140	3.856000	0.55964	1.328000	0.45358	0.254000	0.18369	ACT		0.622	SULT1A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254694.2	NM_001055	
ZNF213	7760	broad.mit.edu	37	16	3191293	3191293	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr16:3191293C>T	ENST00000396878.3	+	6	1800	c.1325C>T	c.(1324-1326)gCg>gTg	p.A442V	ZNF213_ENST00000576416.1_Missense_Mutation_p.A442V|CASP16_ENST00000428155.1_5'Flank|ZNF213_ENST00000416391.2_Missense_Mutation_p.A284V|ZNF213_ENST00000574902.1_Missense_Mutation_p.A442V	NM_001134655.1|NM_004220.2	NP_001128127.1|NP_004211.1	O14771	ZN213_HUMAN	zinc finger protein 213	442					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A442V(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	16						AAGCAGCGCGCGCACCTCATC	0.687																																					p.A442V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1325T	16						.						32.0	34.0	33.0					16																	3191293		2197	4299	6496	3131294	SO:0001583	missense	7760	exon6			AF017433	CCDS10495.1	16p13.3	2014-05-13	2007-02-20	2007-02-20	ENSG00000085644	ENSG00000085644		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13005	protein-coding gene	gene with protein product		608387				9653642, 10023065	Standard	NM_004220		Approved	CR53, ZKSCAN21, ZSCAN53	uc010uws.2	O14771	OTTHUMG00000177519	ENST00000396878.3:c.1325C>T	16.37:g.3191293C>T	ENSP00000380087:p.Ala442Val	Somatic		Capture	Illumina HiSeq	Phase_I	3131294	NM_001134655	A8K1B9|B4DMG6|Q96IS1	Missense_Mutation	SNP	ENST00000396878.3	37	CCDS10495.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.010932	0.54361	.	.	ENSG00000085644	ENST00000396878;ENST00000416391	T;T	0.60920	0.15;0.15	5.09	5.09	0.68999	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42821	D	0.000653	T	0.55673	0.1935	N	0.11673	0.155	0.33907	D	0.639263	D	0.76494	0.999	P	0.59595	0.86	T	0.70684	-0.4804	10	0.72032	D	0.01	.	15.9873	0.80168	0.0:1.0:0.0:0.0	.	442	O14771	ZN213_HUMAN	V	442;284	ENSP00000380087:A442V;ENSP00000403892:A284V	ENSP00000380087:A442V	A	+	2	0	ZNF213	3131294	0.002000	0.14202	1.000000	0.80357	0.875000	0.50365	1.543000	0.36147	2.365000	0.80145	0.462000	0.41574	GCG		0.687	ZNF213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437334.1	NM_004220	
ZNF48	197407	broad.mit.edu	37	16	30409516	30409516	+	Silent	SNP	A	A	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr16:30409516A>C	ENST00000320159.2	+	2	1321	c.945A>C	c.(943-945)ggA>ggC	p.G315G	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G315G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						TTGCCCGGGGATCCGACCTGG	0.612																																					p.G315G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A945C	16						.						91.0	102.0	98.0					16																	30409516		2197	4300	6497	30317017	SO:0001819	synonymous_variant	197407	exon2			M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.945A>C	16.37:g.30409516A>C		Somatic		Capture	Illumina HiSeq	Phase_I	30317017	NM_152652	Q15920|Q4G0R3|Q69YP3|Q96IL9	Silent	SNP	ENST00000320159.2	37	CCDS10679.1																																																																																				0.612	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255549.2	NM_152652	
GPR56	9289	broad.mit.edu	37	16	57685431	57685431	+	Missense_Mutation	SNP	C	C	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr16:57685431C>G	ENST00000388812.4	+	3	824	c.384C>G	c.(382-384)agC>agG	p.S128R	GPR56_ENST00000540164.2_Missense_Mutation_p.S128R|GPR56_ENST00000388813.5_Missense_Mutation_p.S128R|GPR56_ENST00000562631.1_Missense_Mutation_p.S128R|GPR56_ENST00000379696.3_Missense_Mutation_p.S128R|GPR56_ENST00000568908.1_Missense_Mutation_p.S128R|GPR56_ENST00000544297.1_5'UTR|GPR56_ENST00000538815.1_Missense_Mutation_p.S128R|GPR56_ENST00000564912.1_3'UTR|GPR56_ENST00000379694.4_Intron|GPR56_ENST00000567835.1_Missense_Mutation_p.S128R|GPR56_ENST00000568909.1_Missense_Mutation_p.S128R|GPR56_ENST00000456916.1_Missense_Mutation_p.S128R|GPR56_ENST00000562558.1_Missense_Mutation_p.S128R			Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56	128					angiogenesis (GO:0001525)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cerebral cortex radial glia guided migration (GO:0021801)|G-protein coupled receptor signaling pathway (GO:0007186)|layer formation in cerebral cortex (GO:0021819)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron migration (GO:2001223)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cell adhesion (GO:0045785)|positive regulation of Rho protein signal transduction (GO:0035025)|protein kinase C signaling (GO:0070528)|Rho protein signal transduction (GO:0007266)|vascular endothelial growth factor production (GO:0010573)	extracellular vesicular exosome (GO:0070062)|glial limiting end-foot (GO:0097451)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	15						AGGAGGAGAGCCTGGCTCAGG	0.587																																					p.S128R												.	.	0			c.C384G	16						.						62.0	64.0	63.0					16																	57685431		2198	4300	6498	56242932	SO:0001583	missense	9289	exon4			AJ011001	CCDS32460.1, CCDS32461.1, CCDS73893.1	16q13	2014-08-08				ENSG00000205336		"""-"", ""GPCR / Class B : Orphans"""	4512	protein-coding gene	gene with protein product		604110				10049584, 10100861	Standard	XM_005256237		Approved	TM7LN4, TM7XN1	uc002emb.2	Q9Y653		ENST00000388812.4:c.384C>G	16.37:g.57685431C>G	ENSP00000373464:p.Ser128Arg	None		Capture	Illumina HiSeq	Phase_I	56242932	NM_001145774	A6NIT7|A6NJV9|B0M0K4|B4DR54|O95966|Q6ZMP1|Q8NGB3|Q96HB4	Missense_Mutation	SNP	ENST00000388812.4	37	CCDS32460.1	.	.	.	.	.	.	.	.	.	.	C	7.129	0.579589	0.13686	.	.	ENSG00000205336	ENST00000388813;ENST00000388812;ENST00000538815;ENST00000456916;ENST00000540164;ENST00000379696	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.21	1.13	0.20643	.	0.936213	0.08895	N	0.878048	T	0.35393	0.0930	L	0.51422	1.61	0.18873	N	0.999989	B;B;B	0.34015	0.309;0.435;0.309	B;B;B	0.32864	0.1;0.154;0.1	T	0.31641	-0.9936	10	0.72032	D	0.01	.	6.4757	0.22034	0.0:0.6082:0.0:0.3918	.	133;128;128	B4DR54;Q9Y653-2;Q9Y653	.;.;GPR56_HUMAN	R	128	ENSP00000373465:S128R;ENSP00000373464:S128R;ENSP00000444415:S128R;ENSP00000398034:S128R;ENSP00000444911:S128R;ENSP00000369018:S128R	ENSP00000369018:S128R	S	+	3	2	GPR56	56242932	0.000000	0.05858	0.001000	0.08648	0.035000	0.12851	-0.276000	0.08514	0.224000	0.20940	0.655000	0.94253	AGC		0.587	GPR56-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433436.3		
ZCCHC14	23174	broad.mit.edu	37	16	87451244	87451244	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr16:87451244G>A	ENST00000268616.4	-	8	1011	c.794C>T	c.(793-795)gCg>gTg	p.A265V		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	265							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)	p.A265V(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		CGCGCTGCCCGCATGGGAGCA	0.692																																					p.A265V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C794T	16						.						73.0	84.0	81.0					16																	87451244		2198	4300	6498	86008745	SO:0001583	missense	23174	exon8			AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.794C>T	16.37:g.87451244G>A	ENSP00000268616:p.Ala265Val	Somatic		Capture	Illumina HiSeq	Phase_I	86008745	NM_015144	D3DUN1|O60324|Q3MJD8|Q9UFP0	Missense_Mutation	SNP	ENST00000268616.4	37	CCDS10961.1	.	.	.	.	.	.	.	.	.	.	G	9.192	1.026297	0.19512	.	.	ENSG00000140948	ENST00000268616	T	0.16743	2.32	5.54	4.59	0.56863	.	1.097780	0.06716	N	0.774077	T	0.14270	0.0345	N	0.14661	0.345	0.09310	N	1	B;B	0.24426	0.072;0.103	B;B	0.17098	0.014;0.017	T	0.34030	-0.9845	10	0.59425	D	0.04	-0.2748	14.6806	0.69015	0.0698:0.0:0.9302:0.0	.	265;265	Q8WYQ9-2;Q8WYQ9	.;ZCH14_HUMAN	V	265	ENSP00000268616:A265V	ENSP00000268616:A265V	A	-	2	0	ZCCHC14	86008745	0.077000	0.21312	0.002000	0.10522	0.003000	0.03518	1.698000	0.37794	1.490000	0.48466	-0.136000	0.14681	GCG		0.692	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144	
TAF1C	9013	broad.mit.edu	37	16	84213042	84213042	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T	T	-	T	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr16:84213042delT	ENST00000567759.1	-	14	2297	c.2115delA	c.(2113-2115)ccafs	p.P707fs	TAF1C_ENST00000378541.4_Frame_Shift_Del_p.P707fs|TAF1C_ENST00000570117.1_Frame_Shift_Del_p.P375fs|TAF1C_ENST00000566732.1_Frame_Shift_Del_p.P681fs|TAF1C_ENST00000541676.1_Frame_Shift_Del_p.P614fs|TAF1C_ENST00000341690.6_Frame_Shift_Del_p.P613fs	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	707					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						GTGCAGGGGGTGGCTCTGCCG	0.701																																					p.P611fs												.	.	0			c.1833delA	16						.						25.0	28.0	27.0					16																	84213042		2198	4292	6490	82770543	SO:0001589	frameshift_variant	9013	exon15			L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.2115delA	16.37:g.84213042delT	ENSP00000455265:p.Pro707fs	Germline		Capture	Illumina HiSeq	Phase_I	82770543	NM_139353	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Frame_Shift_Del	DEL	ENST00000567759.1	37	CCDS32496.1																																																																																				0.701	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353	
JPH3	57338	broad.mit.edu	37	16	87678138	87678138	+	Silent	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr16:87678138G>C	ENST00000284262.2	+	2	899	c.657G>C	c.(655-657)ctG>ctC	p.L219L		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	219					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)	p.L219L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		GGCGCTCGCTGCTGAGTGGGC	0.667																																					p.L219L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G657C	16						.						46.0	50.0	49.0					16																	87678138		2198	4300	6498	86235639	SO:0001819	synonymous_variant	57338	exon2			AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.657G>C	16.37:g.87678138G>C		Somatic		Capture	Illumina HiSeq	Phase_I	86235639	NM_020655	D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Silent	SNP	ENST00000284262.2	37	CCDS10962.1																																																																																				0.667	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2		
EPN2	22905	broad.mit.edu	37	17	19237428	19237428	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:19237428C>T	ENST00000314728.5	+	11	2271	c.1787C>T	c.(1786-1788)gCg>gTg	p.A596V	EPN2_ENST00000395620.2_Missense_Mutation_p.A539V|EPN2_ENST00000395626.1_Intron|EPN2_ENST00000571254.1_Missense_Mutation_p.A532V|EPN2_ENST00000575595.1_Missense_Mutation_p.A304V|EPN2_ENST00000395618.3_Missense_Mutation_p.A311V|EPN2_ENST00000347697.2_Missense_Mutation_p.A539V|RP11-135L13.4_ENST00000581122.1_RNA	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	596	3 X 3 AA repeats of N-P-F.|6 X 3 AA repeats of [DE]-P-W.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)	p.A596V(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					ATGACCTCCGCGGCCCCACAG	0.637																																					p.A596V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1787T	17						.						27.0	26.0	27.0					17																	19237428		2202	4299	6501	19178021	SO:0001583	missense	22905	exon11			AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.1787C>T	17.37:g.19237428C>T	ENSP00000320543:p.Ala596Val	Somatic		Capture	Illumina HiSeq	Phase_I	19178021	NM_014964	A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Missense_Mutation	SNP	ENST00000314728.5	37	CCDS11203.1	.	.	.	.	.	.	.	.	.	.	C	0.584	-0.835694	0.02713	.	.	ENSG00000072134	ENST00000347697;ENST00000395618;ENST00000314728;ENST00000395620	T;T;T;T	0.17054	2.58;2.3;2.59;2.58	5.2	-0.402	0.12404	.	0.889887	0.09446	N	0.801058	T	0.05364	0.0142	N	0.03948	-0.315	0.09310	N	1	B;B;B;B;B	0.09022	0.001;0.001;0.002;0.001;0.0	B;B;B;B;B	0.06405	0.0;0.0;0.002;0.0;0.001	T	0.41875	-0.9484	10	0.05959	T	0.93	0.9974	5.3491	0.16026	0.0:0.2341:0.1682:0.5977	.	539;532;304;539;596	Q52LD0;B7ZKM5;B7Z3A5;E9PBC2;O95208	.;.;.;.;EPN2_HUMAN	V	539;311;596;539	ENSP00000261495:A539V;ENSP00000378980:A311V;ENSP00000320543:A596V;ENSP00000378982:A539V	ENSP00000320543:A596V	A	+	2	0	EPN2	19178021	0.091000	0.21658	0.013000	0.15412	0.535000	0.34838	0.307000	0.19296	0.131000	0.18576	0.558000	0.71614	GCG		0.637	EPN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132283.3	NM_014964	
SUZ12	23512	broad.mit.edu	37	17	30267331	30267331	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:30267331C>T	ENST00000322652.5	+	2	530	c.301C>T	c.(301-303)Cga>Tga	p.R101*	SUZ12_ENST00000580398.1_Nonsense_Mutation_p.R101*	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	101					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)	p.R101*(1)	SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TAGATTTCTTCGAACTCGGAA	0.308			T	JAZF1	endometrial stromal tumours																																p.R101X			Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C301T	17						.						94.0	87.0	90.0					17																	30267331		2203	4294	6497	27291444	SO:0001587	stop_gained	23512	exon2			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.301C>T	17.37:g.30267331C>T	ENSP00000316578:p.Arg101*	Somatic		Capture	Illumina HiSeq	Phase_I	27291444	NM_015355	Q96BD9	Nonsense_Mutation	SNP	ENST00000322652.5	37	CCDS11270.1	.	.	.	.	.	.	.	.	.	.	.	38	7.100047	0.98063	.	.	ENSG00000178691	ENST00000322652	.	.	.	4.81	4.81	0.61882	.	0.120277	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.743	12.7265	0.57174	0.0:0.9195:0.0:0.0805	.	.	.	.	X	101	.	ENSP00000316578:R101X	R	+	1	2	SUZ12	27291444	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.368000	0.66133	2.383000	0.81215	0.597000	0.82753	CGA		0.308	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256260.2	NM_015355	
SUZ12	23512	broad.mit.edu	37	17	30303572	30303572	+	Nonsense_Mutation	SNP	C	C	T	rs372162318		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:30303572C>T	ENST00000322652.5	+	8	1085	c.856C>T	c.(856-858)Cga>Tga	p.R286*	SUZ12_ENST00000580398.1_Nonsense_Mutation_p.R263*	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	286					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)	p.R286*(1)	SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				CAGAAGAAAACGAAATCGTGA	0.343			T	JAZF1	endometrial stromal tumours																																p.R286X			Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C856T	17						.						82.0	80.0	81.0					17																	30303572		2203	4300	6503	27327685	SO:0001587	stop_gained	23512	exon8			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.856C>T	17.37:g.30303572C>T	ENSP00000316578:p.Arg286*	Somatic		Capture	Illumina HiSeq	Phase_I	27327685	NM_015355	Q96BD9	Nonsense_Mutation	SNP	ENST00000322652.5	37	CCDS11270.1	.	.	.	.	.	.	.	.	.	.	C	38	6.852282	0.97885	.	.	ENSG00000178691	ENST00000322652	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.208	13.7539	0.62923	0.1543:0.8457:0.0:0.0	.	.	.	.	X	286	.	ENSP00000316578:R286X	R	+	1	2	SUZ12	27327685	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.451000	0.44952	2.257000	0.74773	0.603000	0.83216	CGA		0.343	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256260.2	NM_015355	
TOP2A	7153	broad.mit.edu	37	17	38555323	38555323	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:38555323G>T	ENST00000423485.1	-	25	3415	c.3257C>A	c.(3256-3258)cCt>cAt	p.P1086H		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	1086					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	GGCCTTCACAGGATCCGAATC	0.318																																					p.P1086H												.	.	0			c.C3257A	17						.						79.0	75.0	76.0					17																	38555323		1809	4066	5875	35808849	SO:0001583	missense	7153	exon25				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.3257C>A	17.37:g.38555323G>T	ENSP00000411532:p.Pro1086His	None		Capture	Illumina HiSeq	Phase_I	35808849	NM_001067	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	ENST00000423485.1	37	CCDS45672.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.923941	0.92319	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.26957	1.7	5.75	5.75	0.90469	DNA topoisomerase, type IIA, subunit A/C-terminal (2);DNA topoisomerase, type IIA, subunit A, alpha-helical (1);DNA topoisomerase, type IIA, central (1);	0.000000	0.85682	D	0.000000	T	0.64360	0.2591	M	0.93939	3.475	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.72779	-0.4190	10	0.87932	D	0	.	20.3046	0.98621	0.0:0.0:1.0:0.0	.	1086	P11388	TOP2A_HUMAN	H	1086;1166;1109;1122	ENSP00000411532:P1086H	ENSP00000269577:P1166H	P	-	2	0	TOP2A	35808849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.810000	0.99221	2.878000	0.98634	0.650000	0.86243	CCT		0.318	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1		
KLHL10	317719	broad.mit.edu	37	17	39998468	39998468	+	Silent	SNP	T	T	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:39998468T>C	ENST00000293303.4	+	2	741	c.588T>C	c.(586-588)aaT>aaC	p.N196N		NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	196					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)		p.N196N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				ATGAGCTCAATGTCAAACAGG	0.398																																					p.N196N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T588C	17						.						90.0	80.0	83.0					17																	39998468		1876	4122	5998	37251994	SO:0001819	synonymous_variant	317719	exon2			AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.588T>C	17.37:g.39998468T>C		Somatic		Capture	Illumina HiSeq	Phase_I	37251994	NM_152467	Q6NW28|Q96MC0	Silent	SNP	ENST00000293303.4	37	CCDS42340.1																																																																																				0.398	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467	
HSPB9	94086	broad.mit.edu	37	17	40275148	40275148	+	Missense_Mutation	SNP	A	A	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:40275148A>T	ENST00000355067.3	+	1	393	c.280A>T	c.(280-282)Agt>Tgt	p.S94C	CTD-2132N18.3_ENST00000592574.1_Intron|KAT2A_ENST00000225916.5_5'Flank	NM_033194.2	NP_149971.1	Q9BQS6	HSPB9_HUMAN	heat shock protein, alpha-crystallin-related, B9	94					response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S94C(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	4		all_cancers(22;0.00064)|Breast(137;0.00104)|all_epithelial(22;0.00866)		BRCA - Breast invasive adenocarcinoma(366;0.124)		GGAAAGGGTCAGTTACCGCAT	0.632																																					p.S94C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A280T	17						.						109.0	98.0	101.0					17																	40275148		2203	4300	6503	37528674	SO:0001583	missense	94086	exon1			AJ302068	CCDS11418.1	17q21	2011-09-02			ENSG00000197723	ENSG00000260325		"""Heat shock proteins / HSPB"""	30589	protein-coding gene	gene with protein product	"""cancer/testis antigen 51"""	608344				11470154, 12820654	Standard	NM_033194		Approved	CT51	uc002hyy.2	Q9BQS6	OTTHUMG00000133500	ENST00000355067.3:c.280A>T	17.37:g.40275148A>T	ENSP00000347178:p.Ser94Cys	Somatic		Capture	Illumina HiSeq	Phase_I	37528674	NM_033194	B3KSG6|Q52LB4	Missense_Mutation	SNP	ENST00000355067.3	37	CCDS11418.1	.	.	.	.	.	.	.	.	.	.	A	16.13	3.035530	0.54896	.	.	ENSG00000197723	ENST00000355067	D	0.93366	-3.21	3.68	-7.35	0.01422	Heat shock protein Hsp20 (2);	0.441395	0.22824	N	0.055186	D	0.90957	0.7157	L	0.46157	1.445	0.09310	N	1	D	0.67145	0.996	P	0.62649	0.905	T	0.83320	-0.0018	10	0.87932	D	0	-0.3325	3.1918	0.06619	0.2204:0.2293:0.442:0.1083	.	94	Q9BQS6	HSPB9_HUMAN	C	94	ENSP00000347178:S94C	ENSP00000347178:S94C	S	+	1	0	HSPB9	37528674	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	-1.840000	0.01684	-1.699000	0.01416	0.459000	0.35465	AGT		0.632	HSPB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257438.1	NM_033194	
NBR1	4077	broad.mit.edu	37	17	41341649	41341649	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:41341649G>T	ENST00000422280.1	+	8	984	c.525G>T	c.(523-525)caG>caT	p.Q175H	NBR1_ENST00000542611.1_Missense_Mutation_p.Q154H|NBR1_ENST00000389312.4_Missense_Mutation_p.Q175H|NBR1_ENST00000590996.1_Missense_Mutation_p.Q175H|NBR1_ENST00000341165.6_Missense_Mutation_p.Q175H|NBR1_ENST00000589872.1_Missense_Mutation_p.Q175H	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	175					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		AGCTTGAACAGAAATTACATG	0.393																																					p.Q175H												.	.	0			c.G525T	17						.						91.0	90.0	90.0					17																	41341649		1845	4090	5935	38595175	SO:0001583	missense	4077	exon8			X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.525G>T	17.37:g.41341649G>T	ENSP00000411250:p.Gln175His	None		Capture	Illumina HiSeq	Phase_I	38595175	NM_005899	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	37	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806339	0.70682	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.47869	1.44;0.83;1.44;1.44	5.34	4.35	0.52113	.	0.120998	0.64402	D	0.000020	T	0.64294	0.2585	M	0.69823	2.125	0.42210	D	0.991808	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.72075	0.971;0.976;0.968	T	0.66866	-0.5815	10	0.87932	D	0	-8.0748	10.8648	0.46849	0.144:0.0:0.856:0.0	.	154;175;175	B7Z5R6;Q14596-2;Q14596	.;.;NBR1_HUMAN	H	175;154;175;175;175	ENSP00000411250:Q175H;ENSP00000437545:Q154H;ENSP00000343479:Q175H;ENSP00000373963:Q175H	ENSP00000343479:Q175H	Q	+	3	2	NBR1	38595175	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.357000	0.44125	2.785000	0.95823	0.655000	0.94253	CAG		0.393	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
SCN4A	6329	broad.mit.edu	37	17	62019223	62019223	+	Silent	SNP	G	G	A	rs374319193		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:62019223G>A	ENST00000435607.1	-	24	4495	c.4419C>T	c.(4417-4419)ttC>ttT	p.F1473F	SCN4A_ENST00000578147.1_Silent_p.F1473F	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1473			F -> S (in PMC; accelerates deactivation from the inactivated state and enhances the remobilization of gating charge). {ECO:0000269|PubMed:18166706}.		membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.F1473F(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCATGAGGGCGAACAGCAGCG	0.612																																					p.F1473F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4419T	17						.	G		1,4405	2.1+/-5.4	0,1,2202	105.0	99.0	101.0		4419	-1.3	1.0	17		101	0,8600		0,0,4300	no	coding-synonymous	SCN4A	NM_000334.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1473/1837	62019223	1,13005	2203	4300	6503	59372955	SO:0001819	synonymous_variant	6329	exon24			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.4419C>T	17.37:g.62019223G>A		Somatic		Capture	Illumina HiSeq	Phase_I	59372955	NM_000334	Q15478|Q16447|Q7Z6B1	Silent	SNP	ENST00000435607.1	37	CCDS45761.1																																																																																				0.612	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
TP53	7157	broad.mit.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000420246.2_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R273C	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0 	.	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	c.C817T	17	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343	.						65.0	56.0	59.0					17																	7577121		2203	4300	6503	7517846	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys	Somatic		Capture	Illumina HiSeq	Phase_I	7517846	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CACNG5	27091	broad.mit.edu	37	17	64876751	64876751	+	Missense_Mutation	SNP	G	G	A	rs201783473		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:64876751G>A	ENST00000533854.1	+	4	598	c.361G>A	c.(361-363)Gga>Aga	p.G121R	CACNG5_ENST00000169565.3_Missense_Mutation_p.G121R|CACNG5_ENST00000307139.3_Missense_Mutation_p.G121R			Q9UF02	CCG5_HUMAN	calcium channel, voltage-dependent, gamma subunit 5	121					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ion transmembrane transporter activity (GO:0015075)|voltage-gated calcium channel activity (GO:0005245)	p.G121R(3)|p.G121*(2)		NS(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	24			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			GAACAACATCGGACACATCCG	0.483																																					p.G121R												.	.	5	Substitution - Missense(3)|Substitution - Nonsense(2)	large_intestine(3)|lung(2)	c.G361A	17						.	G	ARG/GLY	0,4406		0,0,2203	299.0	237.0	258.0		361	3.7	1.0	17		258	1,8599	1.2+/-3.3	0,1,4299	no	missense	CACNG5	NM_145811.2	125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	121/276	64876751	1,13005	2203	4300	6503	62307213	SO:0001583	missense	27091	exon3			AF148220	CCDS11665.1	17q24	2004-02-16				ENSG00000075429		"""Calcium channel subunits"""	1409	protein-coding gene	gene with protein product		606405				10613843	Standard	NM_145811		Approved		uc010wqj.2	Q9UF02		ENST00000533854.1:c.361G>A	17.37:g.64876751G>A	ENSP00000436836:p.Gly121Arg	Somatic		Capture	Illumina HiSeq	Phase_I	62307213	NM_014404	A8K2A6|Q547R3|Q8WXS7|Q9UHM3	Missense_Mutation	SNP	ENST00000533854.1	37	CCDS11665.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347514	0.82022	0.0	1.16E-4	ENSG00000075429	ENST00000533854;ENST00000307139;ENST00000169565	D;D;D	0.91068	-2.78;-2.78;-2.78	3.67	3.67	0.42095	.	0.000000	0.64402	U	0.000001	D	0.94212	0.8142	M	0.66506	2.035	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94812	0.7979	10	0.66056	D	0.02	-4.7538	15.2223	0.73320	0.0:0.0:1.0:0.0	.	121	Q9UF02	CCG5_HUMAN	R	121	ENSP00000436836:G121R;ENSP00000303092:G121R;ENSP00000169565:G121R	ENSP00000169565:G121R	G	+	1	0	CACNG5	62307213	1.000000	0.71417	0.983000	0.44433	0.981000	0.71138	9.351000	0.97073	1.966000	0.57179	0.591000	0.81541	GGA		0.483	CACNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389882.1	NM_014404, NM_145811	
NPTX1	4884	broad.mit.edu	37	17	78447236	78447236	+	Missense_Mutation	SNP	C	C	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr17:78447236C>A	ENST00000306773.4	-	3	818	c.661G>T	c.(661-663)Gac>Tac	p.D221Y	NPTX1_ENST00000575212.1_5'UTR	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	221					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.D221Y(1)		kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			GGGCGGTTGTCTTTCTGACCT	0.537																																					p.D221Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G661T	17						.						216.0	181.0	193.0					17																	78447236		2203	4300	6503	76061831	SO:0001583	missense	4884	exon3			U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.661G>T	17.37:g.78447236C>A	ENSP00000307549:p.Asp221Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	76061831	NM_002522	B3KXH3|Q5FWE6	Missense_Mutation	SNP	ENST00000306773.4	37	CCDS32762.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.397414	0.62177	.	.	ENSG00000171246	ENST00000306773	T	0.10099	2.91	4.84	4.84	0.62591	.	0.107161	0.64402	D	0.000008	T	0.12475	0.0303	L	0.40543	1.245	0.58432	D	0.999998	P	0.46395	0.877	B	0.41723	0.365	T	0.02603	-1.1135	10	0.56958	D	0.05	-34.2827	16.7093	0.85381	0.0:1.0:0.0:0.0	.	221	Q15818	NPTX1_HUMAN	Y	221	ENSP00000307549:D221Y	ENSP00000307549:D221Y	D	-	1	0	NPTX1	76061831	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.736000	0.84948	2.221000	0.72209	0.511000	0.50034	GAC		0.537	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
RAB31	11031	broad.mit.edu	37	18	9859309	9859309	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr18:9859309G>A	ENST00000578921.1	+	7	816	c.575G>A	c.(574-576)cGc>cAc	p.R192H	RAB31_ENST00000577284.1_3'UTR	NM_006868.3	NP_006859.2	Q13636	RAB31_HUMAN	RAB31, member RAS oncogene family	191					cellular response to insulin stimulus (GO:0032869)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|phagosome maturation (GO:0090382)|receptor internalization (GO:0031623)|regulated secretory pathway (GO:0045055)|small GTPase mediated signal transduction (GO:0007264)	early endosome (GO:0005769)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R192H(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(3)|skin(1)	10						CAAGCCAGCCGCCGGTGCTGT	0.572																																					p.R192H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G575A	18						.						37.0	43.0	41.0					18																	9859309		1961	4163	6124	9849309	SO:0001583	missense	11031	exon7			U59877	CCDS45826.1	18p11.22	2014-03-18			ENSG00000168461	ENSG00000168461		"""RAB, member RAS oncogene"""	9771	protein-coding gene	gene with protein product		605694				8863739	Standard	NM_006868		Approved	Rab22B	uc002kog.2	Q13636	OTTHUMG00000178513	ENST00000578921.1:c.575G>A	18.37:g.9859309G>A	ENSP00000461945:p.Arg192His	Somatic		Capture	Illumina HiSeq	Phase_I	9849309	NM_006868	B2RBT7|Q15770|Q9HC00	Missense_Mutation	SNP	ENST00000578921.1	37	CCDS45826.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.410404	0.42715	.	.	ENSG00000168461	ENST00000306096;ENST00000435762	.	.	.	5.73	2.97	0.34412	.	0.160387	0.53938	D	0.000043	T	0.35278	0.0926	L	0.43152	1.355	0.30449	N	0.775468	B	0.18863	0.031	B	0.14023	0.01	T	0.26430	-1.0103	8	.	.	.	-2.8523	8.3055	0.32041	0.08:0.2976:0.6223:0.0	.	191	Q13636	RAB31_HUMAN	H	192;183	.	.	R	+	2	0	RAB31	9849309	0.997000	0.39634	0.785000	0.31869	0.627000	0.37826	2.135000	0.42112	0.441000	0.26529	0.557000	0.71058	CGC		0.572	RAB31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442280.3		
PPM1N	147699	broad.mit.edu	37	19	46002462	46002463	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr19:46002462_46002463insC	ENST00000451287.2	+	1	732_733	c.732_733insC	c.(733-735)cccfs	p.P245fs	PPM1N_ENST00000401593.1_5'Flank|PPM1N_ENST00000396735.2_5'Flank|PPM1N_ENST00000396736.2_5'Flank|RTN2_ENST00000344680.4_5'Flank|PPM1N_ENST00000456399.2_Intron|PPM1N_ENST00000401705.1_Intron|PPM1N_ENST00000324688.4_Frame_Shift_Ins_p.P167fs|RTN2_ENST00000590526.1_5'Flank|RTN2_ENST00000589384.1_5'Flank|RTN2_ENST00000245923.4_5'Flank|PPM1N_ENST00000396737.2_Intron	NM_001080401.1	NP_001073870.1	Q8N819	PPM1N_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative)	245	PP2C-like.						magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoprotein phosphatase activity (GO:0004721)	p.E247fs*19(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)	9						CTCCGGGGAGGCCCCCCGAGCT	0.693																																					p.R244fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.732_733insC	19						.																																			50694303	SO:0001589	frameshift_variant	147699	exon1			AK097444	CCDS46115.1	19q13.32	2012-04-17			ENSG00000213889	ENSG00000213889		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26845	protein-coding gene	gene with protein product							Standard	NM_001080401		Approved	FLJ40125	uc002pce.3	Q8N819	OTTHUMG00000140397	ENST00000451287.2:c.738dupC	19.37:g.46002468_46002468dupC	ENSP00000397050:p.Pro245fs	Somatic		Capture	Illumina HiSeq	Phase_I	50694302	NM_001080401	Q6P662	Frame_Shift_Ins	INS	ENST00000451287.2	37	CCDS46115.1																																																																																				0.693	PPM1N-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326517.2	NM_001080401	
CHERP	10523	broad.mit.edu	37	19	16641687	16641687	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr19:16641687G>T	ENST00000198939.6	-	6	748	c.712C>A	c.(712-714)Cgc>Agc	p.R238S	CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000546361.2_Missense_Mutation_p.R227S					calcium homeostasis endoplasmic reticulum protein									p.R227S(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						GCCTGCTTGCGCTGGCTGTGA	0.682																																					p.R227S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C679A	19						.						28.0	33.0	31.0					19																	16641687		1979	4148	6127	16502687	SO:0001583	missense	10523	exon6			U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.712C>A	19.37:g.16641687G>T	ENSP00000198939:p.Arg238Ser	Somatic		Capture	Illumina HiSeq	Phase_I	16502687	NM_006387		Missense_Mutation	SNP	ENST00000198939.6	37		.	.	.	.	.	.	.	.	.	.	G	24.9	4.585594	0.86748	.	.	ENSG00000085872	ENST00000546361;ENST00000198939	T;T	0.34072	1.38;1.63	5.18	4.08	0.47627	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);Domain of unknown function DUF618 (1);	.	.	.	.	T	0.58581	0.2132	M	0.75777	2.31	0.58432	D	0.999991	D	0.69078	0.997	D	0.81914	0.995	T	0.63216	-0.6687	9	0.72032	D	0.01	-23.8557	13.5864	0.61933	0.0:0.0:0.8442:0.1558	.	227	Q8IWX8	CHERP_HUMAN	S	227;238	ENSP00000439856:R227S;ENSP00000198939:R238S	ENSP00000198939:R238S	R	-	1	0	CHERP	16502687	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.050000	0.57404	2.441000	0.82636	0.462000	0.41574	CGC		0.682	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000403372.1	NM_006387	
COPE	11316	broad.mit.edu	37	19	19030105	19030105	+	Missense_Mutation	SNP	T	T	C	rs555628077		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr19:19030105T>C	ENST00000262812.4	-	1	101	c.53A>G	c.(52-54)gAg>gGg	p.E18G	DDX49_ENST00000247003.4_5'Flank|COPE_ENST00000351079.4_Missense_Mutation_p.E18G|AC002985.3_ENST00000596918.1_Intron|COPE_ENST00000600932.1_Missense_Mutation_p.E18G|DDX49_ENST00000438170.2_5'Flank|COPE_ENST00000349893.4_Missense_Mutation_p.E18G	NM_007263.3	NP_009194.2	O14579	COPE_HUMAN	coatomer protein complex, subunit epsilon	18					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|membrane organization (GO:0061024)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.E18G(1)		breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	11						GTCGAACAGCTCGTCTACCTC	0.672													T|||	1	0.000199681	0.0008	0.0	5008	,	,		13038	0.0		0.0	False		,,,				2504	0.0				p.E18G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A53G	19						.						43.0	45.0	45.0					19																	19030105		2203	4300	6503	18891105	SO:0001583	missense	11316	exon1			AJ131182	CCDS12387.1, CCDS12388.1, CCDS12389.1	19p13.11	2008-02-05				ENSG00000105669			2234	protein-coding gene	gene with protein product		606942				10469566	Standard	NM_007263		Approved	epsilon-COP	uc002nkk.3	O14579		ENST00000262812.4:c.53A>G	19.37:g.19030105T>C	ENSP00000262812:p.Glu18Gly	Somatic		Capture	Illumina HiSeq	Phase_I	18891105	NM_007263	A6NE29|A6NKA3|O76097|Q6IBB8|Q9UGP6	Missense_Mutation	SNP	ENST00000262812.4	37	CCDS12387.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.537187	0.85812	.	.	ENSG00000105669	ENST00000262812;ENST00000351079;ENST00000349893;ENST00000538245	T;T;T	0.48522	0.81;0.81;0.81	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.73353	0.3576	M	0.90425	3.115	0.51482	D	0.999921	D;D;D;D	0.69078	0.997;0.996;0.985;0.995	D;D;D;D	0.68943	0.961;0.959;0.925;0.918	T	0.79334	-0.1846	10	0.62326	D	0.03	-44.2465	15.0691	0.72021	0.0:0.0:0.0:1.0	.	18;18;18;18	Q53HJ6;A6NE29;A6NKA3;O14579	.;.;.;COPE_HUMAN	G	18;18;18;17	ENSP00000262812:E18G;ENSP00000345674:E18G;ENSP00000343134:E18G	ENSP00000262812:E18G	E	-	2	0	COPE	18891105	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	6.079000	0.71291	2.163000	0.67991	0.460000	0.39030	GAG		0.672	COPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464801.1	NM_007263	
DYRK1B	9149	broad.mit.edu	37	19	40316724	40316724	+	Silent	SNP	G	G	A	rs367812081		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr19:40316724G>A	ENST00000593685.1	-	11	1989	c.1521C>T	c.(1519-1521)gtC>gtT	p.V507V	DYRK1B_ENST00000323039.5_Silent_p.V507V|DYRK1B_ENST00000597639.1_Silent_p.V479V|DYRK1B_ENST00000430012.2_Silent_p.V467V|DYRK1B_ENST00000348817.3_Silent_p.V479V			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	507	Interaction with RANBP9.				adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)	p.V479V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			GGGAGGGTGGGACCTAAAAAA	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		14112	0.0		0.0	False		,,,				2504	0.001				p.V467V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1401T	19						.	G	,,	1,4405		0,1,2202	20.0	23.0	22.0		1521,1401,1437	-0.4	0.8	19		22	3,8593		0,3,4295	no	coding-synonymous,coding-synonymous,coding-synonymous	DYRK1B	NM_004714.1,NM_006483.1,NM_006484.1	,,	0,4,6497	AA,AG,GG		0.0349,0.0227,0.0308	,,	507/630,467/590,479/602	40316724	4,12998	2203	4298	6501	45008564	SO:0001819	synonymous_variant	9149	exon11			Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.1521C>T	19.37:g.40316724G>A		Somatic		Capture	Illumina HiSeq	Phase_I	45008564	NM_006483	O75258|O75788|O75789	Silent	SNP	ENST00000593685.1	37	CCDS12543.1																																																																																				0.652	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462874.2	NM_004714	
GRIK5	2901	broad.mit.edu	37	19	42563652	42563652	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr19:42563652C>T	ENST00000262895.3	-	5	535	c.536G>A	c.(535-537)cGt>cAt	p.R179H	GRIK5_ENST00000301218.4_Missense_Mutation_p.R179H|GRIK5_ENST00000593562.1_Missense_Mutation_p.R179H	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	179					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R179H(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				GAGGAAGCCACGCACCAGTTC	0.612																																					p.R179H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G536A	19						.						88.0	71.0	77.0					19																	42563652		2203	4300	6503	47255492	SO:0001583	missense	2901	exon5				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.536G>A	19.37:g.42563652C>T	ENSP00000262895:p.Arg179His	Somatic		Capture	Illumina HiSeq	Phase_I	47255492	NM_002088	Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	37	CCDS12595.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712782	0.68730	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	D;D	0.84146	-1.81;-1.81	4.62	4.62	0.57501	Extracellular ligand-binding receptor (1);	0.139674	0.44285	D	0.000472	D	0.83229	0.5209	M	0.63428	1.95	0.47441	D	0.999426	B	0.27013	0.166	B	0.21360	0.034	T	0.82645	-0.0355	10	0.52906	T	0.07	.	16.6235	0.84936	0.0:1.0:0.0:0.0	.	179	Q16478	GRIK5_HUMAN	H	179	ENSP00000262895:R179H;ENSP00000301218:R179H	ENSP00000262895:R179H	R	-	2	0	GRIK5	47255492	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	7.315000	0.78998	2.280000	0.76307	0.549000	0.68633	CGT		0.612	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1		
PPFIA3	8541	broad.mit.edu	37	19	49651435	49651435	+	Silent	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr19:49651435G>A	ENST00000334186.4	+	24	3280	c.2931G>A	c.(2929-2931)tcG>tcA	p.S977S	PPFIA3_ENST00000602351.1_Silent_p.S968S	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	977	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)		p.S977S(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		TCATGGAGTCGCTGGTGGACG	0.597																																					p.S977S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2931A	19						.						62.0	61.0	61.0					19																	49651435		2203	4300	6503	54343247	SO:0001819	synonymous_variant	8541	exon24			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.2931G>A	19.37:g.49651435G>A		Somatic		Capture	Illumina HiSeq	Phase_I	54343247	NM_003660	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Silent	SNP	ENST00000334186.4	37	CCDS12758.1																																																																																				0.597	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
LILRA3	11026	broad.mit.edu	37	19	54802629	54802629	+	Missense_Mutation	SNP	C	C	T	rs137941246	byFrequency	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr19:54802629C>T	ENST00000251390.3	-	5	903	c.812G>A	c.(811-813)cGg>cAg	p.R271Q	LILRA3_ENST00000391745.1_Missense_Mutation_p.R288Q|LILRA3_ENST00000391744.3_Missense_Mutation_p.R207Q	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	271	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.R271Q(1)		NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTGGGGCTGCCGGCCAGGGCG	0.637																																					p.R271Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G812A	19						.						45.0	44.0	45.0					19																	54802629		2195	4176	6371	59494441	SO:0001583	missense	11026	exon5			U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.812G>A	19.37:g.54802629C>T	ENSP00000251390:p.Arg271Gln	Somatic		Capture	Illumina HiSeq	Phase_I	59494441	NM_006865	J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Missense_Mutation	SNP	ENST00000251390.3	37	CCDS12887.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.470241	0.01044	.	.	ENSG00000170866	ENST00000251390;ENST00000391744;ENST00000391745	T;T;T	0.00686	5.85;5.85;5.85	2.03	-3.59	0.04583	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	3.429810	0.00866	N	0.001968	T	0.00412	0.0013	N	0.03948	-0.315	0.09310	N	1	B;B	0.17852	0.024;0.013	B;B	0.21546	0.035;0.015	T	0.42565	-0.9444	10	0.02654	T	1	.	2.6756	0.05080	0.2192:0.3146:0.0:0.4662	.	271;271	E7EU74;Q8N6C8	.;LIRA3_HUMAN	Q	271;207;288	ENSP00000251390:R271Q;ENSP00000375624:R207Q;ENSP00000375625:R288Q	ENSP00000251390:R271Q	R	-	2	0	LILRA3	59494441	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.202000	0.03023	-0.754000	0.04715	-0.225000	0.12378	CGG		0.637	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140236.1		
PEG3	5178	broad.mit.edu	37	19	57326652	57326652	+	Missense_Mutation	SNP	T	T	A	rs78283258	byFrequency	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr19:57326652T>A	ENST00000326441.9	-	10	3521	c.3158A>T	c.(3157-3159)tAt>tTt	p.Y1053F	ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.Y1053F|PEG3_ENST00000593695.1_Missense_Mutation_p.Y927F|PEG3_ENST00000598410.1_Missense_Mutation_p.Y929F|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000599935.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1053					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.Y1053F(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CTCTTGGTCATAGATTTTCTG	0.488																																					p.Y1053F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A3158T	19						.						137.0	124.0	128.0					19																	57326652		2203	4300	6503	62018464	SO:0001583	missense	5178	exon7			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3158A>T	19.37:g.57326652T>A	ENSP00000326581:p.Tyr1053Phe	Somatic		Capture	Illumina HiSeq	Phase_I	62018464	NM_001146186	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	T	11.28	1.592204	0.28357	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02606	4.23;4.23	4.01	0.754	0.18410	.	0.319514	0.23043	N	0.052598	T	0.08403	0.0209	M	0.69823	2.125	.	.	.	P;D;D	0.69078	0.707;0.993;0.997	B;P;P	0.60609	0.188;0.757;0.877	T	0.09015	-1.0694	9	0.87932	D	0	.	4.9739	0.14131	0.0:0.1582:0.1627:0.6791	.	929;1053;988	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	F	1053	ENSP00000326581:Y1053F;ENSP00000403051:Y1053F	ENSP00000326581:Y1053F	Y	-	2	0	ZIM2	62018464	0.984000	0.35163	0.001000	0.08648	0.004000	0.04260	4.487000	0.60293	0.054000	0.16065	-0.313000	0.08912	TAT		0.488	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
PPFIA4	8497	broad.mit.edu	37	1	203023010	203023011	+	Intron	INS	-	-	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:203023010_203023011insC	ENST00000447715.2	+	19	2138				PPFIA4_ENST00000295706.4_Frame_Shift_Ins_p.S78fs|PPFIA4_ENST00000414050.2_Frame_Shift_Ins_p.S291fs|PPFIA4_ENST00000367240.2_Frame_Shift_Ins_p.S563fs|PPFIA4_ENST00000272198.6_Frame_Shift_Ins_p.S78fs|PPFIA4_ENST00000599966.1_Frame_Shift_Ins_p.S78fs			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4						cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						GGATGTTGTCTCCCCCAGCGGC	0.634																																					p.S78fs												.	.	0			c.232_233insC	1						.																																			201289634	SO:0001627	intron_variant	8497	exon2			AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.1697+22->C	1.37:g.203023015_203023015dupC		None		Capture	Illumina HiSeq	Phase_I	201289633	NM_015053	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Frame_Shift_Ins	INS	ENST00000447715.2	37																																																																																					0.634	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053	
PTCHD2	57540	broad.mit.edu	37	1	11579432	11579432	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:11579432G>A	ENST00000294484.6	+	8	2048	c.1910G>A	c.(1909-1911)cGg>cAg	p.R637Q	PTCHD2_ENST00000389575.3_Missense_Mutation_p.R637Q	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	637					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)	p.R854Q(2)		NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		AATTGCAGCCGGAAGACCTCC	0.647																																					p.R637Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G1910A	1						.						110.0	122.0	118.0					1																	11579432		1992	4165	6157	11502019	SO:0001583	missense	57540	exon8			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1910G>A	1.37:g.11579432G>A	ENSP00000294484:p.Arg637Gln	Somatic		Capture	Illumina HiSeq	Phase_I	11502019	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	g	12.95	2.091474	0.36952	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.85702	-2.02;-2.02	5.42	-0.844	0.10741	.	0.696678	0.13806	N	0.361480	T	0.76256	0.3962	L	0.43152	1.355	0.09310	N	0.999998	B	0.16166	0.016	B	0.15870	0.014	T	0.59910	-0.7365	10	0.27082	T	0.32	-8.9728	9.2024	0.37268	0.5809:0.0:0.4191:0.0	.	637	Q9P2K9	PTHD2_HUMAN	Q	637	ENSP00000294484:R637Q;ENSP00000374226:R637Q	ENSP00000294484:R637Q	R	+	2	0	PTCHD2	11502019	0.010000	0.17322	0.685000	0.30070	0.374000	0.29953	0.712000	0.25779	-0.185000	0.10550	-0.130000	0.14895	CGG		0.647	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
PLOD1	5351	broad.mit.edu	37	1	12034788	12034788	+	Missense_Mutation	SNP	C	C	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:12034788C>G	ENST00000196061.4	+	19	2134	c.2107C>G	c.(2107-2109)Cga>Gga	p.R703G	PLOD1_ENST00000376369.3_Missense_Mutation_p.R750G	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	703	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)	p.R703G(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	GCACCCTGGACGACTCACGCA	0.622																																					p.R703G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2107G	1						.						96.0	86.0	89.0					1																	12034788		2203	4300	6503	11957375	SO:0001583	missense	5351	exon19			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.2107C>G	1.37:g.12034788C>G	ENSP00000196061:p.Arg703Gly	Somatic		Capture	Illumina HiSeq	Phase_I	11957375	NM_000302	B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	ENST00000196061.4	37	CCDS142.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.037337	0.75617	.	.	ENSG00000083444	ENST00000414311;ENST00000376369;ENST00000196061	T;T	0.76578	-1.03;-1.03	5.54	2.38	0.29361	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	D	0.86539	0.5957	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86522	0.1816	10	0.87932	D	0	.	13.8097	0.63253	0.46:0.54:0.0:0.0	.	750;703	B4DR87;Q02809	.;PLOD1_HUMAN	G	367;750;703	ENSP00000365548:R750G;ENSP00000196061:R703G	ENSP00000196061:R703G	R	+	1	2	PLOD1	11957375	0.945000	0.32115	0.983000	0.44433	0.952000	0.60782	2.125000	0.42016	0.165000	0.19558	-0.314000	0.08810	CGA		0.622	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006865.1	NM_000302	
CLCC1	23155	broad.mit.edu	37	1	109479936	109479936	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:109479936C>T	ENST00000369971.2	-	10	1275	c.1146G>A	c.(1144-1146)caG>caA	p.Q382Q	CLCC1_ENST00000356970.2_Silent_p.Q382Q|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000348264.2_Silent_p.Q197Q|CLCC1_ENST00000369970.3_Silent_p.Q332Q|CLCC1_ENST00000415331.1_Silent_p.Q332Q|CLCC1_ENST00000369976.1_Intron|CLCC1_ENST00000369968.2_Silent_p.Q197Q|CLCC1_ENST00000369969.2_Silent_p.Q261Q|CLCC1_ENST00000482889.1_Intron|CLCC1_ENST00000302500.4_Silent_p.Q261Q	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	382						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)	p.Q332Q(1)		autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		CAATTTCCTCCTGCCGTCTTC	0.527																																					p.Q382Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1146A	1						.						75.0	74.0	75.0					1																	109479936		2203	4300	6503	109281459	SO:0001819	synonymous_variant	23155	exon10			AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.1146G>A	1.37:g.109479936C>T		Somatic		Capture	Illumina HiSeq	Phase_I	109281459	NM_001048210	O94861|Q8WYP8|Q8WYP9|Q9BU25	Silent	SNP	ENST00000369971.2	37	CCDS41362.1																																																																																				0.527	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032405.1	NM_015127	
DENND4B	9909	broad.mit.edu	37	1	153909203	153909203	+	Missense_Mutation	SNP	T	T	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:153909203T>A	ENST00000361217.4	-	16	2672	c.2254A>T	c.(2254-2256)Atg>Ttg	p.M752L		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	752					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTCTGTGCCATCCGCTGTGCA	0.517																																					p.M752L												.	.	0			c.A2254T	1						.																																			152175827	SO:0001583	missense	9909	exon16			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2254A>T	1.37:g.153909203T>A	ENSP00000354597:p.Met752Leu	None		Capture	Illumina HiSeq	Phase_I	152175827	NM_014856	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	37	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	t	3.899	-0.022401	0.07634	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.05717	3.4;3.4	4.51	-0.818	0.10833	.	0.413038	0.27294	N	0.020023	T	0.00695	0.0023	N	0.05441	-0.05	0.29626	N	0.845824	B	0.02656	0.0	B	0.01281	0.0	T	0.45131	-0.9282	10	0.06099	T	0.92	-7.8823	8.6569	0.34068	0.0:0.5754:0.0:0.4246	.	752	O75064	DEN4B_HUMAN	L	752;763	ENSP00000354597:M752L;ENSP00000357635:M763L	ENSP00000354597:M752L	M	-	1	0	DENND4B	152175827	0.000000	0.05858	0.995000	0.50966	0.996000	0.88848	-0.675000	0.05227	-0.045000	0.13468	0.379000	0.24179	ATG		0.517	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
AQP10	89872	broad.mit.edu	37	1	154296252	154296252	+	Missense_Mutation	SNP	A	A	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:154296252A>T	ENST00000324978.3	+	5	717	c.677A>T	c.(676-678)tAc>tTc	p.Y226F	AQP10_ENST00000484864.1_Missense_Mutation_p.Y226F|ATP8B2_ENST00000368487.3_5'Flank|AQP10_ENST00000355197.4_3'UTR	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	226					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTCTTCACCTACGTGGCTGGC	0.632																																					p.Y226F												.	.	0			c.A677T	1						.						49.0	49.0	49.0					1																	154296252		2203	4300	6503	152562876	SO:0001583	missense	89872	exon5			AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.677A>T	1.37:g.154296252A>T	ENSP00000318355:p.Tyr226Phe	None		Capture	Illumina HiSeq	Phase_I	152562876	NM_080429	Q5VYD3|Q5VYD4|Q8NG70	Missense_Mutation	SNP	ENST00000324978.3	37	CCDS1065.1	.	.	.	.	.	.	.	.	.	.	A	5.237	0.229248	0.09916	.	.	ENSG00000143595	ENST00000324978;ENST00000484864	D;D	0.85484	-1.99;-1.99	4.55	4.55	0.56014	Aquaporin-like (2);	0.295731	0.33419	N	0.004930	T	0.51160	0.1658	N	0.21545	0.675	0.27111	N	0.962383	B;P	0.35272	0.035;0.493	B;B	0.31946	0.034;0.138	T	0.50065	-0.8871	10	0.06494	T	0.89	.	9.2695	0.37661	0.8182:0.1818:0.0:0.0	.	226;226	Q96PS8-2;Q96PS8	.;AQP10_HUMAN	F	226	ENSP00000318355:Y226F;ENSP00000420341:Y226F	ENSP00000318355:Y226F	Y	+	2	0	AQP10	152562876	0.765000	0.28485	0.962000	0.40283	0.987000	0.75469	1.471000	0.35365	1.921000	0.55644	0.454000	0.30748	TAC		0.632	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087661.1	NM_080429	
SCAMP3	10067	broad.mit.edu	37	1	155231518	155231518	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:155231518G>A	ENST00000302631.3	-	2	181	c.74C>T	c.(73-75)gCt>gTt	p.A25V	CLK2_ENST00000497188.1_5'Flank|SCAMP3_ENST00000355379.3_Intron|SCAMP3_ENST00000472397.1_5'Flank	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	25					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)	p.A25V(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTGGATCACAGCTGGGTCCTG	0.597																																					p.A25V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C74T	1						.						78.0	75.0	76.0					1																	155231518		2203	4300	6503	153498142	SO:0001583	missense	10067	exon2			AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.74C>T	1.37:g.155231518G>A	ENSP00000307275:p.Ala25Val	Somatic		Capture	Illumina HiSeq	Phase_I	153498142	NM_005698	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Missense_Mutation	SNP	ENST00000302631.3	37	CCDS1105.1	.	.	.	.	.	.	.	.	.	.	.	35	5.478530	0.96291	.	.	ENSG00000116521	ENST00000302631	T	0.17854	2.25	5.33	4.4	0.53042	.	0.066613	0.64402	D	0.000015	T	0.14743	0.0356	L	0.54323	1.7	0.80722	D	1	P;P	0.52316	0.568;0.952	B;P	0.49477	0.175;0.612	T	0.00377	-1.1778	10	0.66056	D	0.02	-7.5742	10.1619	0.42858	0.0921:0.0:0.9079:0.0	.	25;25	Q6FHJ5;O14828	.;SCAM3_HUMAN	V	25	ENSP00000307275:A25V	ENSP00000307275:A25V	A	-	2	0	SCAMP3	153498142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.067000	0.71193	2.771000	0.95319	0.563000	0.77884	GCT		0.597	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087399.1	NM_005698	
VANGL2	57216	broad.mit.edu	37	1	160385859	160385859	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:160385859C>T	ENST00000368061.2	+	3	553	c.79C>T	c.(79-81)Cgg>Tgg	p.R27W		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	27					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)		p.R27W(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CAGGGACCGCCGGGACCGACA	0.642																																					p.R27W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C79T	1						.						35.0	41.0	39.0					1																	160385859		2203	4300	6503	158652483	SO:0001583	missense	57216	exon3			AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.79C>T	1.37:g.160385859C>T	ENSP00000357040:p.Arg27Trp	Somatic		Capture	Illumina HiSeq	Phase_I	158652483	NM_020335	D3DVE9|Q5T212	Missense_Mutation	SNP	ENST00000368061.2	37	CCDS30915.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.037227	0.54896	.	.	ENSG00000162738	ENST00000368061	D	0.84370	-1.84	4.65	4.65	0.58169	.	0.000000	0.64402	D	0.000001	D	0.89448	0.6718	M	0.79475	2.455	0.54753	D	0.999984	D	0.89917	1.0	D	0.79784	0.993	D	0.90270	0.4307	10	0.72032	D	0.01	-27.1107	10.165	0.42875	0.1989:0.8011:0.0:0.0	.	27	Q9ULK5	VANG2_HUMAN	W	27	ENSP00000357040:R27W	ENSP00000357040:R27W	R	+	1	2	VANGL2	158652483	0.998000	0.40836	1.000000	0.80357	0.970000	0.65996	1.117000	0.31234	2.413000	0.81919	0.461000	0.40582	CGG		0.642	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080677.1	NM_020335	
TNN	63923	broad.mit.edu	37	1	175067562	175067562	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:175067562C>T	ENST00000239462.4	+	9	2063	c.1950C>T	c.(1948-1950)taC>taT	p.Y650Y		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	650	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.Y650Y(2)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TTGACAAGTACGTGGTGCGCT	0.597																																					p.Y650Y												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C1950T	1						.						89.0	88.0	89.0					1																	175067562		2203	4300	6503	173334185	SO:0001819	synonymous_variant	63923	exon9			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1950C>T	1.37:g.175067562C>T		Somatic		Capture	Illumina HiSeq	Phase_I	173334185	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	37	CCDS30943.1																																																																																				0.597	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
LHX9	56956	broad.mit.edu	37	1	197887013	197887013	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:197887013G>C	ENST00000367387.4	+	1	485	c.60G>C	c.(58-60)atG>atC	p.M20I	LHX9_ENST00000561173.1_Missense_Mutation_p.M26I|LHX9_ENST00000337020.2_Missense_Mutation_p.M20I|LHX9_ENST00000606127.1_3'UTR|LHX9_ENST00000367390.3_Missense_Mutation_p.M11I|LHX9_ENST00000367391.1_Missense_Mutation_p.M11I	NM_020204.2	NP_064589.2	Q9NQ69	LHX9_HUMAN	LIM homeobox 9	20					cell proliferation (GO:0008283)|female gonad development (GO:0008585)|gonad morphogenesis (GO:0035262)|male gonad development (GO:0008584)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.M20I(1)|p.M11I(1)		endometrium(8)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|skin(1)|stomach(1)	35						CCCCAGCCATGCTCTTTCACG	0.597																																					p.M20I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G60C	1						.						105.0	104.0	105.0					1																	197887013		2203	4300	6503	196153636	SO:0001583	missense	56956	exon1			AJ277915	CCDS1393.1, CCDS30962.1	1q31.1	2011-06-20			ENSG00000143355	ENSG00000143355		"""Homeoboxes / LIM class"""	14222	protein-coding gene	gene with protein product		606066					Standard	NM_020204		Approved		uc001guk.1	Q9NQ69	OTTHUMG00000035656	ENST00000367387.4:c.60G>C	1.37:g.197887013G>C	ENSP00000356357:p.Met20Ile	Somatic		Capture	Illumina HiSeq	Phase_I	196153636	NM_020204	Q5VUE2|Q5VUE3|Q5VUE6|Q86UH2|Q9BYU6|Q9NQ70	Missense_Mutation	SNP	ENST00000367387.4	37	CCDS1393.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.745743	0.89663	.	.	ENSG00000143355	ENST00000367391;ENST00000367390;ENST00000367388;ENST00000337020;ENST00000367387	T;D;T;D	0.89050	0.46;-2.46;0.47;-2.39	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.93268	0.7855	L	0.59436	1.845	0.80722	D	1	D;D;P	0.69078	0.997;0.968;0.845	D;P;P	0.78314	0.991;0.853;0.699	D	0.93811	0.7110	10	0.72032	D	0.01	.	17.7666	0.88480	0.0:0.0:1.0:0.0	.	20;11;11	Q9NQ69;Q9NQ69-3;Q9NQ69-2	LHX9_HUMAN;.;.	I	11;11;63;20;20	ENSP00000356361:M11I;ENSP00000356360:M11I;ENSP00000337969:M20I;ENSP00000356357:M20I	ENSP00000337969:M20I	M	+	3	0	LHX9	196153636	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.128000	0.94424	2.506000	0.84524	0.655000	0.94253	ATG		0.597	LHX9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086547.2	NM_020204	
PCNXL2	80003	broad.mit.edu	37	1	233135080	233135080	+	Missense_Mutation	SNP	C	C	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:233135080C>G	ENST00000258229.9	-	31	5608	c.5374G>C	c.(5374-5376)Gag>Cag	p.E1792Q	PCNXL2_ENST00000344698.2_Missense_Mutation_p.E444Q	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1792						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				AATATAAGCTCCTGCTGCTGC	0.542																																					p.E1792Q												.	.	0			c.G5374C	1						.						28.0	29.0	29.0					1																	233135080		1915	4133	6048	231201703	SO:0001583	missense	80003	exon31			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.5374G>C	1.37:g.233135080C>G	ENSP00000258229:p.Glu1792Gln	None		Capture	Illumina HiSeq	Phase_I	231201703	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	C	29.4	4.998812	0.93227	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.57907	0.37;0.37	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.80586	0.4651	M	0.92833	3.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.84792	0.0779	10	0.87932	D	0	.	19.7628	0.96329	0.0:1.0:0.0:0.0	.	1792;444	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	Q	444;1792	ENSP00000340759:E444Q;ENSP00000258229:E1792Q	ENSP00000258229:E1792Q	E	-	1	0	PCNXL2	231201703	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	7.481000	0.81124	2.672000	0.90937	0.555000	0.69702	GAG		0.542	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
HCRTR1	3061	broad.mit.edu	37	1	32090719	32090719	+	Splice_Site	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:32090719G>A	ENST00000373706.5	+	6	1240	c.1087G>A	c.(1087-1089)Ggc>Agc	p.G363S	HCRTR1_ENST00000373705.1_Splice_Site_p.G363R|HCRTR1_ENST00000468521.1_3'UTR|HCRTR1_ENST00000403528.2_Splice_Site_p.G363S			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	363					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)	p.G363S(1)		breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		CTTCCTCAGTGGTGAGCAGGC	0.577																																					p.G363S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1087A	1						.						49.0	39.0	42.0					1																	32090719		2203	4300	6503	31863306	SO:0001630	splice_region_variant	3061	exon8			AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.1087+1G>A	1.37:g.32090719G>A		Somatic		Capture	Illumina HiSeq	Phase_I	31863306	NM_001525	A8K3A6|Q9HBV6	Missense_Mutation	SNP	ENST00000373706.5	37	CCDS344.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.106585|4.106585	0.77096|0.77096	.|.	.|.	ENSG00000121764|ENSG00000121764	ENST00000373705|ENST00000403528;ENST00000373706	T|T;T	0.55413|0.34472	0.52|1.36;1.36	4.95|4.95	4.95|4.95	0.65309|0.65309	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.43166|0.43166	0.1235|0.1235	L|L	0.34521|0.34521	1.04|1.04	0.49915|0.49915	D|D	0.999831|0.999831	B|D	0.33212|0.67145	0.402|0.996	B|P	0.30716|0.61658	0.119|0.892	T|T	0.06752|0.06752	-1.0809|-1.0809	10|10	0.20046|0.11794	T|T	0.44|0.64	.|.	16.4941|16.4941	0.84223|0.84223	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	363|363	A6NMV7|O43613	.|OX1R_HUMAN	R|S	363|363	ENSP00000362809:G363R|ENSP00000384387:G363S;ENSP00000362810:G363S	ENSP00000362809:G363R|ENSP00000362810:G363S	G|G	+|+	1|1	0|0	HCRTR1|HCRTR1	31863306|31863306	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.893000|0.893000	0.52053|0.52053	7.098000|7.098000	0.76974|0.76974	2.677000|2.677000	0.91161|0.91161	0.561000|0.561000	0.74099|0.74099	GGG|GGC		0.577	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011042.1	NM_001525	Missense_Mutation
CCDC30	728621	broad.mit.edu	37	1	43110414	43110414	+	Missense_Mutation	SNP	G	G	A	rs190370892		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:43110414G>A	ENST00000340612.4	+	12	1826	c.1826G>A	c.(1825-1827)cGt>cAt	p.R609H	CCDC30_ENST00000390640.4_Missense_Mutation_p.R398H|CCDC30_ENST00000428554.2_Missense_Mutation_p.R609H|CCDC30_ENST00000507855.1_Missense_Mutation_p.R398H|CCDC30_ENST00000342022.4_Missense_Mutation_p.R609H			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	609						extracellular vesicular exosome (GO:0070062)		p.R609H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						AATAGTCTTCGTCTCACACAG	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		21690	0.001		0.0	False		,,,				2504	0.0				p.R609H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1826A	1						.						124.0	110.0	115.0					1																	43110414		2203	4300	6503	42883001	SO:0001583	missense	728621	exon13			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1826G>A	1.37:g.43110414G>A	ENSP00000340378:p.Arg609His	Somatic		Capture	Illumina HiSeq	Phase_I	42883001	NM_001080850	Q14F06|Q5VVM5	Missense_Mutation	SNP	ENST00000340612.4	37	CCDS30690.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	6.167	0.399020	0.11696	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12	5.5	2.66	0.31614	.	0.503387	0.21663	N	0.070991	T	0.18635	0.0447	N	0.04132	-0.27	0.23506	N	0.997539	B;B	0.20988	0.05;0.035	B;B	0.20384	0.029;0.01	T	0.21075	-1.0256	10	0.21540	T	0.41	.	8.1049	0.30879	0.2529:0.0:0.7471:0.0	.	609;398	Q5VVM6;Q5VVM6-2	CCD30_HUMAN;.	H	609;398;609;609;398	ENSP00000397035:R609H;ENSP00000426711:R398H;ENSP00000340378:R609H;ENSP00000339280:R609H;ENSP00000375051:R398H	ENSP00000340378:R609H	R	+	2	0	CCDC30	42883001	0.322000	0.24634	0.045000	0.18777	0.176000	0.22953	-0.020000	0.12525	0.391000	0.25143	-0.137000	0.14449	CGT		0.388	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019524.3	NM_025030	
CPT2	1376	broad.mit.edu	37	1	53676799	53676799	+	Missense_Mutation	SNP	A	A	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:53676799A>G	ENST00000371486.3	+	4	1968	c.1453A>G	c.(1453-1455)Acc>Gcc	p.T485A	RP5-1024G6.2_ENST00000452466.1_RNA	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	485					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	GACAGTGGCCACCTACGAGTC	0.587																																					p.T485A												.	.	0			c.A1453G	1						.						39.0	37.0	38.0					1																	53676799		2203	4300	6503	53449387	SO:0001583	missense	1376	exon4			BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.1453A>G	1.37:g.53676799A>G	ENSP00000360541:p.Thr485Ala	None		Capture	Illumina HiSeq	Phase_I	53449387	NM_000098	B2R6S0|Q5SW68|Q9BQ26	Missense_Mutation	SNP	ENST00000371486.3	37	CCDS575.1	.	.	.	.	.	.	.	.	.	.	A	18.35	3.605152	0.66445	.	.	ENSG00000157184	ENST00000371486	D	0.92595	-3.07	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.94618	0.8265	M	0.83774	2.66	0.80722	D	1	P	0.35714	0.517	P	0.45913	0.497	D	0.94830	0.7995	10	0.72032	D	0.01	-23.8723	16.1205	0.81351	1.0:0.0:0.0:0.0	.	485	P23786	CPT2_HUMAN	A	485	ENSP00000360541:T485A	ENSP00000360541:T485A	T	+	1	0	CPT2	53449387	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	9.339000	0.96797	2.205000	0.71048	0.533000	0.62120	ACC		0.587	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024757.1	NM_000098	
RYR2	6262	broad.mit.edu	37	1	237994831	237994831	+	Missense_Mutation	SNP	T	T	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr1:237994831T>C	ENST00000366574.2	+	104	15091	c.14774T>C	c.(14773-14775)cTt>cCt	p.L4925P	RYR2_ENST00000360064.6_Missense_Mutation_p.L4931P|RYR2_ENST00000542537.1_Missense_Mutation_p.L4909P	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4925					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.L4923P(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGATGTATCTTATAAACAAA	0.313																																					p.L4925P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T14774C	1						.						91.0	83.0	85.0					1																	237994831		1818	4081	5899	236061454	SO:0001583	missense	6262	exon104			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14774T>C	1.37:g.237994831T>C	ENSP00000355533:p.Leu4925Pro	Somatic		Capture	Illumina HiSeq	Phase_I	236061454	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189230	0.78789	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.98947	-5.26;-5.23;-5.25	5.2	5.2	0.72013	.	0.000000	0.56097	D	0.000031	D	0.99375	0.9780	H	0.95224	3.64	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	D	0.98591	1.0654	10	0.87932	D	0	.	15.0236	0.71650	0.0:0.0:0.0:1.0	.	4925	Q92736	RYR2_HUMAN	P	4925;4931;4909	ENSP00000355533:L4925P;ENSP00000353174:L4931P;ENSP00000443798:L4909P	ENSP00000353174:L4931P	L	+	2	0	RYR2	236061454	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.997000	0.88414	2.087000	0.62958	0.402000	0.26972	CTT		0.313	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
FAM83C	128876	broad.mit.edu	37	20	33879704	33879704	+	Missense_Mutation	SNP	A	A	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr20:33879704A>C	ENST00000374408.3	-	1	500	c.404T>G	c.(403-405)gTg>gGg	p.V135G		NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	135								p.V135G(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GGCCTGTGGCACCTCGGGCCA	0.622																																					p.V135G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T404G	20						.						71.0	74.0	73.0					20																	33879704		2203	4300	6503	33343118	SO:0001583	missense	128876	exon1			AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.404T>G	20.37:g.33879704A>C	ENSP00000363529:p.Val135Gly	Somatic		Capture	Illumina HiSeq	Phase_I	33343118	NM_178468	Q14D67|Q5JWN6|Q8N276	Missense_Mutation	SNP	ENST00000374408.3	37	CCDS13251.1	.	.	.	.	.	.	.	.	.	.	A	11.40	1.628127	0.28978	.	.	ENSG00000125998	ENST00000374408	T	0.08008	3.14	4.83	3.72	0.42706	.	0.487189	0.18852	N	0.129373	T	0.10165	0.0249	L	0.32530	0.975	0.34394	D	0.694514	P	0.40360	0.714	P	0.45343	0.477	T	0.21314	-1.0249	10	0.45353	T	0.12	-1.3205	10.9758	0.47465	0.8429:0.1571:0.0:0.0	.	135	Q9BQN1	FA83C_HUMAN	G	135	ENSP00000363529:V135G	ENSP00000363529:V135G	V	-	2	0	FAM83C	33343118	0.086000	0.21541	0.147000	0.22382	0.131000	0.20780	3.469000	0.53093	0.961000	0.38030	-0.466000	0.05196	GTG		0.622	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3		
PLTP	5360	broad.mit.edu	37	20	44533700	44533700	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr20:44533700G>T	ENST00000477313.1	-	8	1357	c.763C>A	c.(763-765)Ccc>Acc	p.P255T	PLTP_ENST00000372431.3_Missense_Mutation_p.P255T|PLTP_ENST00000542937.1_Missense_Mutation_p.P275T|PLTP_ENST00000420868.2_Missense_Mutation_p.P160T|PLTP_ENST00000372420.1_Missense_Mutation_p.P167T|PLTP_ENST00000354050.4_Missense_Mutation_p.P203T			P55058	PLTP_HUMAN	phospholipid transfer protein	255					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)	p.P255T(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				TGCAGCTGGGGCTCCACTGCC	0.632																																					p.P255T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C763A	20						.						56.0	59.0	58.0					20																	44533700		2203	4300	6503	43967107	SO:0001583	missense	5360	exon9			L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.763C>A	20.37:g.44533700G>T	ENSP00000417138:p.Pro255Thr	Somatic		Capture	Illumina HiSeq	Phase_I	43967107	NM_006227	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Missense_Mutation	SNP	ENST00000477313.1	37	CCDS13386.1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896939	0.72639	.	.	ENSG00000100979	ENST00000372420;ENST00000372431;ENST00000354050;ENST00000477313;ENST00000542937;ENST00000420868	T;T;T;T;T;T	0.09073	3.02;3.02;3.02;3.02;3.02;3.02	5.25	4.29	0.51040	Lipid-binding serum glycoprotein, C-terminal (1);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.113514	0.64402	N	0.000008	T	0.19805	0.0476	M	0.64997	1.995	0.50171	D	0.999855	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D	0.75020	0.985;0.985;0.981;0.981;0.968;0.981;0.981	T	0.09443	-1.0674	10	0.16420	T	0.52	-37.4603	8.7233	0.34454	0.0755:0.0:0.7727:0.1518	.	160;160;167;255;203;255;275	E7EV16;B4DRB4;B4DDD5;Q53H91;P55058-2;P55058;B3KUE5	.;.;.;.;.;PLTP_HUMAN;.	T	167;255;203;255;275;160	ENSP00000361497:P167T;ENSP00000361508:P255T;ENSP00000335290:P203T;ENSP00000417138:P255T;ENSP00000440296:P275T;ENSP00000411671:P160T	ENSP00000335290:P203T	P	-	1	0	PLTP	43967107	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.309000	0.72825	1.186000	0.42985	0.563000	0.77884	CCC		0.632	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	NM_006227	
DPM1	8813	broad.mit.edu	37	20	49575698	49575698	+	5'Flank	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr20:49575698G>C	ENST00000371588.5	-	0	0				DPM1_ENST00000466152.1_5'Flank|MOCS3_ENST00000244051.1_Missense_Mutation_p.G107R|DPM1_ENST00000371583.5_5'Flank|DPM1_ENST00000371582.4_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)	p.G107R(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						GGCCGGCGTGGGCCGCCTTGG	0.672																																					p.G107R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G319C	20						.						37.0	47.0	43.0					20																	49575698		2194	4279	6473	49009105	SO:0001631	upstream_gene_variant	27304	exon1			AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49575698G>C	Exception_encountered	Somatic		Capture	Illumina HiSeq	Phase_I	49009105	NM_014484	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	37	CCDS13434.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.864490	0.91511	.	.	ENSG00000124217	ENST00000244051	T	0.46063	0.88	5.93	4.96	0.65561	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.75788	0.3897	H	0.96048	3.76	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84840	0.0807	9	.	.	.	-18.5193	16.0396	0.80654	0.0:0.0:0.8646:0.1354	.	107	O95396	MOCS3_HUMAN	R	107	ENSP00000244051:G107R	.	G	+	1	0	MOCS3	49009105	1.000000	0.71417	0.999000	0.59377	0.955000	0.61496	8.837000	0.92110	1.474000	0.48178	0.655000	0.94253	GGC		0.672	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859	
PMEPA1	56937	broad.mit.edu	37	20	56227421	56227421	+	Silent	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr20:56227421G>A	ENST00000341744.3	-	4	871	c.552C>T	c.(550-552)cgC>cgT	p.R184R	PMEPA1_ENST00000395814.1_Silent_p.R134R|PMEPA1_ENST00000395816.3_Silent_p.R134R|PMEPA1_ENST00000347215.4_Silent_p.R149R|PMEPA1_ENST00000265626.4_Silent_p.R134R	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	184					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)	p.R184R(2)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						TTGGGGGTGCGCGCACCGACT	0.677																																					p.R149R												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C447T	20						.						39.0	41.0	40.0					20																	56227421		2203	4300	6503	55660827	SO:0001819	synonymous_variant	56937	exon4			AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.552C>T	20.37:g.56227421G>A		Somatic		Capture	Illumina HiSeq	Phase_I	55660827	NM_199169	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Silent	SNP	ENST00000341744.3	37	CCDS13463.1																																																																																				0.677	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
ADAMTS1	9510	broad.mit.edu	37	21	28213372	28213372	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr21:28213372C>T	ENST00000284984.3	-	4	1777	c.1323G>A	c.(1321-1323)caG>caA	p.Q441Q		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	441	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Q441Q(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		GAGACCAAGGCTGGCTGTGGT	0.478																																					p.Q441Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1323A	21						.						209.0	162.0	178.0					21																	28213372		2203	4300	6503	27135243	SO:0001819	synonymous_variant	9510	exon4			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1323G>A	21.37:g.28213372C>T		Somatic		Capture	Illumina HiSeq	Phase_I	27135243	NM_006988	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Silent	SNP	ENST00000284984.3	37	CCDS33524.1																																																																																				0.478	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2		
GART	2618	broad.mit.edu	37	21	34897283	34897283	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr21:34897283C>T	ENST00000381831.3	-	11	1354	c.1091G>A	c.(1090-1092)gGa>gAa	p.G364E	GART_ENST00000543717.1_5'Flank|GART_ENST00000381815.4_Missense_Mutation_p.G364E|GART_ENST00000361093.5_Missense_Mutation_p.G364E|GART_ENST00000381839.3_Missense_Mutation_p.G364E	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	364					'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)	p.G364E(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CACCTCCAGTCCTAGAGCTTG	0.443																																					p.G364E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1091A	21						.						75.0	65.0	69.0					21																	34897283		2203	4300	6503	33819153	SO:0001583	missense	2618	exon11			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.1091G>A	21.37:g.34897283C>T	ENSP00000371253:p.Gly364Glu	Somatic		Capture	Illumina HiSeq	Phase_I	33819153	NM_001136006	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Missense_Mutation	SNP	ENST00000381831.3	37	CCDS13627.1	.	.	.	.	.	.	.	.	.	.	C	17.64	3.438688	0.62955	.	.	ENSG00000159131	ENST00000381815;ENST00000381831;ENST00000381839;ENST00000361093	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	6.03	6.03	0.97812	Rudiment single hybrid motif (1);Phosphoribosylglycinamide synthetase, C-domain (2);	0.045661	0.85682	D	0.000000	T	0.45478	0.1344	L	0.56124	1.755	0.80722	D	1	B	0.20261	0.043	B	0.23716	0.048	T	0.21621	-1.0240	10	0.41790	T	0.15	-23.7411	20.5753	0.99366	0.0:1.0:0.0:0.0	.	364	P22102	PUR2_HUMAN	E	364	ENSP00000371236:G364E;ENSP00000371253:G364E;ENSP00000371261:G364E;ENSP00000354388:G364E	ENSP00000354388:G364E	G	-	2	0	GART	33819153	0.998000	0.40836	0.999000	0.59377	0.879000	0.50718	3.549000	0.53681	2.868000	0.98415	0.557000	0.71058	GGA		0.443	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	NM_000819	
KRTAP10-7	386675	broad.mit.edu	37	21	46021186	46021186	+	Missense_Mutation	SNP	C	C	A	rs371930668		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr21:46021186C>A	ENST00000380102.2	+	1	690	c.665C>A	c.(664-666)gCt>gAt	p.A222D	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	222	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						TGCCAGCCGGCTTGCTGCACC	0.662																																					p.A217D												.	.	0			c.C650A	21						.	C	,ASP/ALA	21,4385		0,21,2182	77.0	76.0	76.0		,665	0.4	0.0	21		76	0,8594		0,0,4297	no	intron,missense	TSPEAR,KRTAP10-7	NM_144991.2,NM_198689.2	,126	0,21,6479	AA,AC,CC		0.0,0.4766,0.1615	,benign	,222/376	46021186	21,12979	2203	4297	6500	44845614	SO:0001583	missense	386675	exon2			AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.665C>A	21.37:g.46021186C>A	ENSP00000369445:p.Ala222Asp	None		Capture	Illumina HiSeq	Phase_I	44845614	NM_198689	Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	37		.	.	.	.	.	.	.	.	.	.	N	1.594	-0.528257	0.04112	0.004766	0.0	ENSG00000205441	ENST00000380102	T	0.01414	4.92	3.75	0.357	0.16079	.	.	.	.	.	T	0.01835	0.0058	L	0.54863	1.705	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.41662	-0.9496	9	0.32370	T	0.25	.	8.1055	0.30883	0.1582:0.5366:0.3052:0.0	.	217	P60409-2	.	D	222	ENSP00000369445:A222D	ENSP00000369445:A222D	A	+	2	0	KRTAP10-7	44845614	0.000000	0.05858	0.016000	0.15963	0.012000	0.07955	0.349000	0.20055	-0.094000	0.12374	-2.299000	0.00261	GCT		0.662	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
FAM207A	85395	broad.mit.edu	37	21	46363673	46363673	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr21:46363673G>T	ENST00000291634.6	+	2	252	c.204G>T	c.(202-204)gaG>gaT	p.E68D	FAM207A_ENST00000397826.3_Missense_Mutation_p.E68D	NM_058190.2	NP_478070.1	Q9NSI2	F207A_HUMAN	family with sequence similarity 207, member A	68								p.E68D(1)									AGAAGCTGGAGCTGGACGTGA	0.582																																					p.E68D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G204T	21						.						107.0	87.0	94.0					21																	46363673		2203	4300	6503	45188101	SO:0001583	missense	85395	exon2				CCDS13718.1	21q22.3	2011-08-15	2011-08-15	2011-08-15	ENSG00000160256	ENSG00000160256			15811	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 70"""	C21orf70			Standard	NM_058190		Approved	PRED56	uc002zgl.3	Q9NSI2	OTTHUMG00000090293	ENST00000291634.6:c.204G>T	21.37:g.46363673G>T	ENSP00000291634:p.Glu68Asp	Somatic		Capture	Illumina HiSeq	Phase_I	45188101	NM_058190		Missense_Mutation	SNP	ENST00000291634.6	37	CCDS13718.1	.	.	.	.	.	.	.	.	.	.	G	3.511	-0.099726	0.07010	.	.	ENSG00000160256	ENST00000291634;ENST00000397826;ENST00000458015	T;T	0.41400	1.0;1.02	3.65	-0.497	0.12023	.	0.511109	0.21428	N	0.074711	T	0.14614	0.0353	N	0.05351	-0.065	0.25430	N	0.98819	B;B	0.10296	0.002;0.003	B;B	0.11329	0.004;0.006	T	0.17137	-1.0379	10	0.09338	T	0.73	-26.3759	2.421	0.04448	0.1426:0.2781:0.4419:0.1373	.	68;68	Q9NSI2-2;Q9NSI2	.;F207A_HUMAN	D	68	ENSP00000291634:E68D;ENSP00000380926:E68D	ENSP00000291634:E68D	E	+	3	2	C21orf70	45188101	0.092000	0.21681	0.551000	0.28230	0.545000	0.35147	-0.009000	0.12765	0.005000	0.14708	-0.251000	0.11542	GAG		0.582	FAM207A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206639.1	NM_058190	
RGL4	266747	broad.mit.edu	37	22	24034242	24034242	+	Missense_Mutation	SNP	C	C	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr22:24034242C>G	ENST00000290691.5	+	1	1195	c.25C>G	c.(25-27)Cct>Gct	p.P9A	AP000347.2_ENST00000417194.1_RNA|GUSBP11_ENST00000455485.1_RNA|RGL4_ENST00000401461.1_Intron|KB-1572G7.2_ENST00000421064.1_RNA	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4	9					small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.P9A(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						CACAAATCTGCCTGCAGCTGC	0.607																																					p.P9A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C25G	22						.						69.0	66.0	67.0					22																	24034242		2203	4300	6503	22364242	SO:0001583	missense	266747	exon1				CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.25C>G	22.37:g.24034242C>G	ENSP00000290691:p.Pro9Ala	Somatic		Capture	Illumina HiSeq	Phase_I	22364242	NM_153615	Q495L8	Missense_Mutation	SNP	ENST00000290691.5	37	CCDS13811.1	.	.	.	.	.	.	.	.	.	.	c	12.36	1.913213	0.33815	.	.	ENSG00000159496	ENST00000290691;ENST00000382833;ENST00000423392	T;T	0.31769	1.48;1.48	1.77	-0.695	0.11291	.	4.339540	0.01974	U	0.044285	T	0.32852	0.0843	N	0.24115	0.695	0.09310	N	1	B;D	0.57571	0.106;0.98	B;P	0.57009	0.013;0.811	T	0.15896	-1.0421	10	0.87932	D	0	.	2.8836	0.05655	0.0:0.5002:0.299:0.2008	.	9;9	E9PH87;Q8IZJ4	.;RGDSR_HUMAN	A	9	ENSP00000290691:P9A;ENSP00000402142:P9A	ENSP00000290691:P9A	P	+	1	0	RGL4	22364242	0.858000	0.29795	0.000000	0.03702	0.003000	0.03518	-0.103000	0.10940	-0.111000	0.12001	0.543000	0.68304	CCT		0.607	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319711.1	NM_153615	
BAIAP2L2	80115	broad.mit.edu	37	22	38494117	38494117	+	Silent	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr22:38494117G>A	ENST00000381669.3	-	6	562	c.418C>T	c.(418-420)Ctg>Ttg	p.L140L	BAIAP2L2_ENST00000332536.5_Silent_p.L140L	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	140	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)	p.L140L(1)		large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					ATGCGCCACAGCTCAGACATG	0.657																																					p.L140L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C418T	22						.						49.0	55.0	53.0					22																	38494117		2090	4229	6319	36824063	SO:0001819	synonymous_variant	80115	exon6			BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.418C>T	22.37:g.38494117G>A		Somatic		Capture	Illumina HiSeq	Phase_I	36824063	NM_025045	B0QYE2|Q96BG7	Silent	SNP	ENST00000381669.3	37	CCDS43018.1																																																																																				0.657	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
TUBA3E	112714	broad.mit.edu	37	2	130949495	130949495	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:130949495G>T	ENST00000312988.7	-	5	1362	c.1262C>A	c.(1261-1263)gCc>gAc	p.A421D		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	421					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					GTCCTCGCGGGCCTCAGAGAA	0.582																																					p.A421D												.	.	0			c.C1262A	2						.						125.0	128.0	127.0					2																	130949495		2203	4300	6503	130665965	SO:0001583	missense	112714	exon5			BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.1262C>A	2.37:g.130949495G>T	ENSP00000318197:p.Ala421Asp	None		Capture	Illumina HiSeq	Phase_I	130665965	NM_207312		Missense_Mutation	SNP	ENST00000312988.7	37	CCDS2158.1	.	.	.	.	.	.	.	.	.	.	g	11.75	1.732950	0.30684	.	.	ENSG00000152086	ENST00000312988	D	0.87179	-2.22	2.5	2.5	0.30297	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.45361	U	0.000372	D	0.95667	0.8591	H	0.98883	4.36	0.51767	D	0.999936	D	0.54207	0.965	D	0.77557	0.99	D	0.95646	0.8702	10	0.87932	D	0	.	10.6884	0.45856	0.0:0.0:1.0:0.0	.	421	Q6PEY2	TBA3E_HUMAN	D	421	ENSP00000318197:A421D	ENSP00000318197:A421D	A	-	2	0	TUBA3E	130665965	1.000000	0.71417	0.995000	0.50966	0.320000	0.28249	8.926000	0.92839	1.387000	0.46486	0.455000	0.32223	GCC		0.582	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254519.1	NM_207312	
THSD7B	80731	broad.mit.edu	37	2	137872775	137872775	+	Silent	SNP	G	G	A	rs563732139		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:137872775G>A	ENST00000409968.1	+	5	1459	c.1281G>A	c.(1279-1281)acG>acA	p.T427T	THSD7B_ENST00000272643.3_Silent_p.T427T|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Silent_p.T396T			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	427	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.T427T(2)|p.T396T(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		GGCATGTGACGGGACCCGTGT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		15307	0.0		0.001	False		,,,				2504	0.0				p.T396T												.	.	3	Substitution - coding silent(3)	lung(2)|large_intestine(1)	c.G1188A	2						.						48.0	53.0	52.0					2																	137872775		1966	4157	6123	137589245	SO:0001819	synonymous_variant	80731	exon4					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1281G>A	2.37:g.137872775G>A		Somatic		Capture	Illumina HiSeq	Phase_I	137589245	NM_001080427		Silent	SNP	ENST00000409968.1	37																																																																																					0.577	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
TTC30A	92104	broad.mit.edu	37	2	178481496	178481496	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:178481496G>C	ENST00000355689.5	-	1	2198	c.1934C>G	c.(1933-1935)aCa>aGa	p.T645R	AC073834.3_ENST00000357045.4_RNA	NM_152275.3	NP_689488.3	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	645					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.T645R(1)		autonomic_ganglia(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			ATCTGTGACTGTATTCTTCCC	0.373																																					p.T645R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1934G	2						.						230.0	225.0	227.0					2																	178481496		2203	4300	6503	178189742	SO:0001583	missense	92104	exon1			AK024008	CCDS2276.1	2q31.2	2013-01-11			ENSG00000197557	ENSG00000197557		"""Tetratricopeptide (TTC) repeat domain containing"""	25853	protein-coding gene	gene with protein product						12477932	Standard	NM_152275		Approved	FLJ13946	uc002ulo.3	Q86WT1	OTTHUMG00000132528	ENST00000355689.5:c.1934C>G	2.37:g.178481496G>C	ENSP00000347915:p.Thr645Arg	Somatic		Capture	Illumina HiSeq	Phase_I	178189742	NM_152275	A8K8N0|Q8IVP2	Missense_Mutation	SNP	ENST00000355689.5	37	CCDS2276.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007461	0.54361	.	.	ENSG00000197557	ENST00000355689;ENST00000545660	T	0.26957	1.7	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.59362	0.2188	M	0.87180	2.865	0.80722	D	1	D	0.71674	0.998	D	0.71184	0.972	T	0.64449	-0.6405	10	0.87932	D	0	.	20.1951	0.98241	0.0:0.0:1.0:0.0	.	645	Q86WT1	TT30A_HUMAN	R	645;106	ENSP00000347915:T645R	ENSP00000347915:T645R	T	-	2	0	TTC30A	178189742	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	8.641000	0.91032	2.781000	0.95711	0.586000	0.80456	ACA		0.373	TTC30A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255728.2	NM_152275	
ITGAV	3685	broad.mit.edu	37	2	187455207	187455207	+	Missense_Mutation	SNP	T	T	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:187455207T>A	ENST00000261023.3	+	1	416	c.142T>A	c.(142-144)Tac>Aac	p.Y48N	ITGAV_ENST00000374907.3_Missense_Mutation_p.Y48N	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	48					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)	p.Y48N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	CGAGGGAAGTTACTTCGGCTT	0.657																																					p.Y48N	Melanoma(58;108 1995 6081)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T142A	2						.						36.0	43.0	41.0					2																	187455207		2203	4300	6503	187163452	SO:0001583	missense	3685	exon1				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.142T>A	2.37:g.187455207T>A	ENSP00000261023:p.Tyr48Asn	Somatic		Capture	Illumina HiSeq	Phase_I	187163452	NM_002210	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	ENST00000261023.3	37	CCDS2292.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.746305	0.89663	.	.	ENSG00000138448	ENST00000544640;ENST00000261023;ENST00000374907	D;D	0.90133	-2.62;-2.62	4.4	4.4	0.53042	.	0.062851	0.64402	D	0.000003	D	0.93478	0.7919	M	0.67569	2.06	0.80722	D	1	D;D	0.64830	0.984;0.994	D;P	0.64506	0.926;0.832	D	0.93857	0.7150	10	0.72032	D	0.01	.	11.9928	0.53184	0.0:0.0:0.0:1.0	.	48;48	P06756-2;P06756	.;ITAV_HUMAN	N	48	ENSP00000261023:Y48N;ENSP00000364042:Y48N	ENSP00000261023:Y48N	Y	+	1	0	ITGAV	187163452	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	5.640000	0.67875	1.827000	0.53221	0.379000	0.24179	TAC		0.657	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
CALCRL	10203	broad.mit.edu	37	2	188211085	188211085	+	Silent	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:188211085G>T	ENST00000409998.1	-	16	1993	c.1212C>A	c.(1210-1212)atC>atA	p.I404I	CALCRL_ENST00000392370.3_Silent_p.I404I|CALCRL_ENST00000410068.1_Silent_p.I404I|AC007319.1_ENST00000453517.1_RNA|AC007319.1_ENST00000412276.1_RNA			Q16602	CALRL_HUMAN	calcitonin receptor-like	404					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)	p.I404I(1)		endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			TTCCAAATTGGATTTTGTATT	0.373																																					p.I404I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1212A	2						.						112.0	104.0	107.0					2																	188211085		2203	4299	6502	187919330	SO:0001819	synonymous_variant	10203	exon15			U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.1212C>A	2.37:g.188211085G>T		Somatic		Capture	Illumina HiSeq	Phase_I	187919330	NM_005795	A8K6G5|A8KAD3|Q53S02|Q53TS5	Silent	SNP	ENST00000409998.1	37	CCDS2293.1																																																																																				0.373	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795	
KCTD18	130535	broad.mit.edu	37	2	201371624	201371624	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:201371624G>A	ENST00000359878.3	-	2	626	c.116C>T	c.(115-117)gCa>gTa	p.A39V	KCTD18_ENST00000409157.1_Missense_Mutation_p.A39V|KCTD18_ENST00000468413.1_5'UTR	NM_152387.2	NP_689600.2	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain containing 18	39	BTB.				protein homooligomerization (GO:0051260)					endometrium(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						GAACATAGATGCCAACATGGA	0.453																																					p.A39V												.	.	0			c.C116T	2						.						83.0	88.0	86.0					2																	201371624		2203	4300	6503	201079869	SO:0001583	missense	130535	exon2			AK055884	CCDS2330.1	2q33.1	2013-06-20	2013-06-20		ENSG00000155729	ENSG00000155729			26446	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 18"""				Standard	NM_152387		Approved	FLJ31322, 6530404F10Rik, FLJ37818	uc002uvs.3	Q6PI47	OTTHUMG00000132781	ENST00000359878.3:c.116C>T	2.37:g.201371624G>A	ENSP00000352941:p.Ala39Val	None		Capture	Illumina HiSeq	Phase_I	201079869	NM_152387	Q53T21|Q6NW26|Q6PCD8|Q8N9B7|Q96N73	Missense_Mutation	SNP	ENST00000359878.3	37	CCDS2330.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.995889	0.93167	.	.	ENSG00000155729	ENST00000359878;ENST00000409157	T;T	0.77098	-1.07;-1.07	5.46	5.46	0.80206	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	D	0.000005	D	0.85155	0.5632	M	0.77616	2.38	0.35790	D	0.822335	B;P	0.46859	0.137;0.885	B;P	0.51324	0.075;0.666	D	0.89407	0.3700	10	0.72032	D	0.01	-21.711	19.1052	0.93291	0.0:0.0:1.0:0.0	.	39;39	Q6PI47-2;Q6PI47	.;KCD18_HUMAN	V	39	ENSP00000352941:A39V;ENSP00000386751:A39V	ENSP00000352941:A39V	A	-	2	0	KCTD18	201079869	1.000000	0.71417	0.970000	0.41538	0.977000	0.68977	4.065000	0.57513	2.840000	0.97914	0.655000	0.94253	GCA		0.453	KCTD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256188.1	NM_152387	
MAP2	4133	broad.mit.edu	37	2	210543312	210543312	+	Silent	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:210543312G>A	ENST00000360351.4	+	5	785	c.279G>A	c.(277-279)agG>agA	p.R93R	MAP2_ENST00000447185.1_Silent_p.R93R|MAP2_ENST00000199940.6_Silent_p.R93R|MAP2_ENST00000361559.4_Silent_p.R93R|MAP2_ENST00000392194.1_Silent_p.R93R	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	93					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.R93R(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TGTCTGCAAGGATAGTTCAAG	0.403																																					p.R93R	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G279A	2						.						101.0	98.0	99.0					2																	210543312		2203	4300	6503	210251557	SO:0001819	synonymous_variant	4133	exon5				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.279G>A	2.37:g.210543312G>A		Somatic		Capture	Illumina HiSeq	Phase_I	210251557	NM_031847	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	37	CCDS2384.1																																																																																				0.403	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
NYAP2	57624	broad.mit.edu	37	2	226447184	226447184	+	Missense_Mutation	SNP	G	G	A	rs372780953		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:226447184G>A	ENST00000272907.6	+	4	1464	c.1051G>A	c.(1051-1053)Gac>Aac	p.D351N	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	351	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.D351N(1)									CCCCAACTCCGACGAGTCCCC	0.642																																					p.D351N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1051A	2						.	G	ASN/ASP	0,3792		0,0,1896	18.0	20.0	20.0		1051	5.3	0.3	2		20	1,8201		0,1,4100	no	missense	KIAA1486	NM_020864.1	23	0,1,5996	AA,AG,GG		0.0122,0.0,0.0083	probably-damaging	351/654	226447184	1,11993	1896	4101	5997	226155428	SO:0001583	missense	57624	exon4			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1051G>A	2.37:g.226447184G>A	ENSP00000272907:p.Asp351Asn	Somatic		Capture	Illumina HiSeq	Phase_I	226155428	NM_020864	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.966888	0.92855	0.0	1.22E-4	ENSG00000144460	ENST00000272907	T	0.54479	0.57	5.27	5.27	0.74061	.	0.052782	0.64402	D	0.000001	T	0.75302	0.3831	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.78102	-0.2335	10	0.59425	D	0.04	-25.144	18.916	0.92506	0.0:0.0:1.0:0.0	.	351	Q9P242	K1486_HUMAN	N	351	ENSP00000272907:D351N	ENSP00000272907:D351N	D	+	1	0	KIAA1486	226155428	1.000000	0.71417	0.305000	0.25099	0.973000	0.67179	9.474000	0.97718	2.462000	0.83206	0.650000	0.86243	GAC		0.642	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
IRS1	3667	broad.mit.edu	37	2	227659842	227659842	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:227659842G>C	ENST00000305123.5	-	1	4633	c.3613C>G	c.(3613-3615)Cca>Gca	p.P1205A	IRS1_ENST00000498335.1_5'UTR	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	1205	Pro-rich.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.P1205A(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TGAGGGGGTGGGGGTGGGGGA	0.582																																					p.P1205A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3613G	2						.						30.0	40.0	37.0					2																	227659842		2202	4300	6502	227368086	SO:0001583	missense	3667	exon1				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.3613C>G	2.37:g.227659842G>C	ENSP00000304895:p.Pro1205Ala	Somatic		Capture	Illumina HiSeq	Phase_I	227368086	NM_005544		Missense_Mutation	SNP	ENST00000305123.5	37	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	G	6.372	0.436685	0.12104	.	.	ENSG00000169047	ENST00000305123	T	0.59083	0.29	5.7	2.86	0.33363	.	0.677330	0.12479	N	0.465292	T	0.38134	0.1029	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.21861	-1.0233	10	0.35671	T	0.21	-3.2644	10.3214	0.43769	0.0:0.2103:0.3729:0.4168	.	1205	P35568	IRS1_HUMAN	A	1205	ENSP00000304895:P1205A	ENSP00000304895:P1205A	P	-	1	0	IRS1	227368086	0.054000	0.20591	0.000000	0.03702	0.056000	0.15407	0.886000	0.28241	0.304000	0.22809	-1.028000	0.02416	CCA		0.582	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
UGT1A6	54578	broad.mit.edu	37	2	234675807	234675807	+	Missense_Mutation	SNP	A	A	C	rs72551348		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:234675807A>C	ENST00000305139.6	+	2	1128	c.989A>C	c.(988-990)cAg>cCg	p.Q330P	UGT1A1_ENST00000609767.1_Missense_Mutation_p.Q332P|UGT1A4_ENST00000373409.3_Missense_Mutation_p.Q332P|UGT1A7_ENST00000373426.3_Missense_Mutation_p.Q328P|UGT1A10_ENST00000373445.1_Missense_Mutation_p.Q328P|UGT1A1_ENST00000373450.4_Missense_Mutation_p.Q328P|UGT1A8_ENST00000305208.5_Missense_Mutation_p.Q331P|UGT1A3_ENST00000482026.1_Missense_Mutation_p.Q332P|UGT1A10_ENST00000344644.5_Missense_Mutation_p.Q328P|UGT1A6_ENST00000406651.1_Missense_Mutation_p.Q63P|UGT1A5_ENST00000373414.3_Missense_Mutation_p.Q332P|UGT1A6_ENST00000373424.1_Missense_Mutation_p.Q63P|UGT1A1_ENST00000608383.1_Missense_Mutation_p.Q331P|UGT1A9_ENST00000354728.4_Missense_Mutation_p.Q328P|UGT1A1_ENST00000608381.1_Missense_Mutation_p.Q332P|UGT1A1_ENST00000360418.3_Missense_Mutation_p.Q331P|UGT1A1_ENST00000609637.1_Missense_Mutation_p.Q328P	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	330					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.Q328P(4)|p.Q332P(3)|p.Q330P(1)|p.Q331P(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	AAAATCCCTCAGACAGTAAGA	0.413																																					p.Q330P												.	.	9	Substitution - Missense(9)	large_intestine(9)	c.A989C	2	GRCh37	CM930723	UGT1A1	M	rs72551348	.						116.0	118.0	117.0					2																	234675807		2203	4300	6503	234340546	SO:0001583	missense	54579	exon2			M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.989A>C	2.37:g.234675807A>C	ENSP00000303174:p.Gln330Pro	Somatic		Capture	Illumina HiSeq	Phase_I	234340546	NM_001072	A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	ENST00000305139.6	37	CCDS2507.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.666665	0.88251	.	.	ENSG00000242366;ENSG00000242515;ENSG00000242515;ENSG00000241119;ENSG00000244122;ENSG00000167165;ENSG00000167165;ENSG00000167165;ENSG00000240224;ENSG00000244474;ENSG00000243135;ENSG00000241635;ENSG00000241635	ENST00000373450;ENST00000344644;ENST00000373445;ENST00000354728;ENST00000373426;ENST00000373424;ENST00000305139;ENST00000406651;ENST00000373414;ENST00000373409;ENST00000482026;ENST00000305208;ENST00000360418	T;T;T;T;T;T;T;T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.85331	0.5672	H	0.95816	3.725	0.52501	D	0.999951	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.999;1.0;1.0;1.0;1.0;0.999;0.999;1.0;0.999;0.999;1.0;1.0;1.0;0.999;0.999;0.999;0.999	D	0.89748	0.3938	10	0.87932	D	0	.	15.788	0.78322	1.0:0.0:0.0:0.0	.	331;332;332;332;330;328;328;328;331;332;332;332;330;328;328;328;328;328	A6NJC3;Q5DT01;B8K288;Q5DSZ9;B8K289;Q5DSZ7;Q5DSZ5;Q5DSZ6;P22309;P35503;P22310;P35504;P19224;Q9HAW7;O60656;Q9HAW8;Q7Z6H8;Q9HAW9	.;.;.;.;.;.;.;.;UD11_HUMAN;UD13_HUMAN;UD14_HUMAN;UD15_HUMAN;UD16_HUMAN;UD17_HUMAN;UD19_HUMAN;UD110_HUMAN;.;UD18_HUMAN	P	328;328;328;328;328;63;330;63;332;332;332;331;331	ENSP00000362549:Q328P;ENSP00000343838:Q328P;ENSP00000362544:Q328P;ENSP00000346768:Q328P;ENSP00000362525:Q328P;ENSP00000362523:Q63P;ENSP00000303174:Q330P;ENSP00000386107:Q63P;ENSP00000362513:Q332P;ENSP00000362508:Q332P;ENSP00000418532:Q332P;ENSP00000304845:Q331P;ENSP00000353593:Q331P	ENSP00000343838:Q328P	Q	+	2	0	UGT1A7;UGT1A6;UGT1A10;UGT1A9;UGT1A8;UGT1A3;UGT1A5;UGT1A4;UGT1A1	234340546	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.565000	0.90730	2.200000	0.70718	0.460000	0.39030	CAG		0.413	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130988.1	NM_205862	
PTRHD1	391356	broad.mit.edu	37	2	25016125	25016125	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:25016125G>A	ENST00000328379.5	-	1	126	c.122C>T	c.(121-123)tCc>tTc	p.S41F	CENPO_ENST00000260662.1_5'Flank|CENPO_ENST00000473706.1_5'UTR|CENPO_ENST00000380834.2_5'UTR|PTRHD1_ENST00000487316.1_5'Flank	NM_001013663.1	NP_001013685.1	Q6GMV3	PTRD1_HUMAN	peptidyl-tRNA hydrolase domain containing 1	41						extracellular vesicular exosome (GO:0070062)	aminoacyl-tRNA hydrolase activity (GO:0004045)	p.S41F(1)		autonomic_ganglia(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|skin(1)	6						CGCCGGCCAGGAGAACGGAGC	0.642																																					p.S41F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C122T	2						.						65.0	69.0	67.0					2																	25016125		2203	4300	6503	24869629	SO:0001583	missense	391356	exon1				CCDS33156.1	2p23.3	2011-05-09	2011-05-09	2011-05-09	ENSG00000184924	ENSG00000184924			33782	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 79"""	C2orf79		12477932	Standard	NM_001013663		Approved	LOC391356	uc002rfm.3	Q6GMV3	OTTHUMG00000151978	ENST00000328379.5:c.122C>T	2.37:g.25016125G>A	ENSP00000330389:p.Ser41Phe	Somatic		Capture	Illumina HiSeq	Phase_I	24869629	NM_001013663		Missense_Mutation	SNP	ENST00000328379.5	37	CCDS33156.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.908148	0.92107	.	.	ENSG00000184924	ENST00000328379	T	0.12774	2.65	6.06	6.06	0.98353	Peptidyl-tRNA hydrolase II domain (2);	0.125545	0.56097	D	0.000026	T	0.39279	0.1072	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.06570	-1.0819	10	0.62326	D	0.03	.	14.9404	0.70989	0.0:0.1429:0.8571:0.0	.	41	Q6GMV3	PTRD1_HUMAN	F	41	ENSP00000330389:S41F	ENSP00000330389:S41F	S	-	2	0	PTRHD1	24869629	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.002000	0.63952	2.882000	0.98803	0.655000	0.94253	TCC		0.642	PTRHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324626.3	NM_001013663	
SIX3	6496	broad.mit.edu	37	2	45169343	45169343	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:45169343G>C	ENST00000260653.3	+	1	442	c.100G>C	c.(100-102)Ggc>Cgc	p.G34R	SIX3-AS1_ENST00000419364.1_RNA|SIX3-AS1_ENST00000456467.1_RNA	NM_005413.3	NP_005404.1	O95343	SIX3_HUMAN	SIX homeobox 3	34	Gly-rich. {ECO:0000255|PROSITE- ProRule:PRU00008}.				brain development (GO:0007420)|circadian behavior (GO:0048512)|diencephalon development (GO:0021536)|eye development (GO:0001654)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|lens induction in camera-type eye (GO:0060235)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein import into nucleus (GO:0006606)|telencephalon development (GO:0021537)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|transcription corepressor binding (GO:0001222)	p.G34R(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|skin(1)	11		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GAGTAgcggcggcgggaacgg	0.711																																					p.G34R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G100C	2						.						51.0	48.0	49.0					2																	45169343		1678	3674	5352	45022847	SO:0001583	missense	6496	exon1			AF092047	CCDS1821.1	2p21	2011-06-20	2007-07-13		ENSG00000138083	ENSG00000138083		"""Homeoboxes / SINE class"""	10889	protein-coding gene	gene with protein product		603714	"""holoprosencephaly 2, alobar or semilobar"", ""sine oculis homeobox homolog 3 (Drosophila)"""	HPE2		9889003, 10369266	Standard	NM_005413		Approved		uc002run.2	O95343	OTTHUMG00000152424	ENST00000260653.3:c.100G>C	2.37:g.45169343G>C	ENSP00000260653:p.Gly34Arg	Somatic		Capture	Illumina HiSeq	Phase_I	45022847	NM_005413	D6W5A5|Q53T42	Missense_Mutation	SNP	ENST00000260653.3	37	CCDS1821.1	.	.	.	.	.	.	.	.	.	.	g	13.27	2.186832	0.38609	.	.	ENSG00000138083	ENST00000260653	T	0.78924	-1.22	2.72	2.72	0.32119	.	0.945182	0.08407	U	0.950518	T	0.65831	0.2729	N	0.24115	0.695	0.24453	N	0.994478	D	0.57257	0.979	B	0.41332	0.354	T	0.56123	-0.8031	10	0.42905	T	0.14	.	11.3153	0.49388	0.0:0.0:1.0:0.0	.	34	O95343	SIX3_HUMAN	R	34	ENSP00000260653:G34R	ENSP00000260653:G34R	G	+	1	0	SIX3	45022847	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.228000	0.17814	1.355000	0.45865	0.436000	0.28706	GGC		0.711	SIX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326192.1	NM_005413	
SIX2	10736	broad.mit.edu	37	2	45233432	45233432	+	Silent	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:45233432G>T	ENST00000303077.6	-	2	1072	c.753C>A	c.(751-753)ggC>ggA	p.G251G		NM_016932.4	NP_058628.3	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	251					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|kidney development (GO:0001822)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesenchymal stem cell proliferation (GO:0097168)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|middle ear morphogenesis (GO:0042474)|nephron development (GO:0072006)|nephron morphogenesis (GO:0072028)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus (GO:0006606)|regulation of branching involved in ureteric bud morphogenesis (GO:0090189)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G251G(1)		endometrium(6)|large_intestine(3)|lung(8)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	22		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTGCGCTGGGGCCCGGAGGGT	0.706																																					p.G251G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C753A	2						.						59.0	63.0	62.0					2																	45233432		2201	4298	6499	45086936	SO:0001819	synonymous_variant	10736	exon2			AF136939	CCDS1822.1	2p21	2011-06-20	2007-07-13		ENSG00000170577	ENSG00000170577		"""Homeoboxes / SINE class"""	10888	protein-coding gene	gene with protein product		604994	"""sine oculis homeobox (Drosophila) homolog 2"", ""sine oculis homeobox homolog 2 (Drosophila)"""				Standard	NM_016932		Approved		uc002ruo.3	Q9NPC8	OTTHUMG00000152421	ENST00000303077.6:c.753C>A	2.37:g.45233432G>T		Somatic		Capture	Illumina HiSeq	Phase_I	45086936	NM_016932	Q9BXH7	Silent	SNP	ENST00000303077.6	37	CCDS1822.1																																																																																				0.706	SIX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326188.2		
ALMS1	7840	broad.mit.edu	37	2	73718027	73718027	+	Missense_Mutation	SNP	A	A	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:73718027A>G	ENST00000264448.6	+	10	9049	c.8938A>G	c.(8938-8940)Aat>Gat	p.N2980D	ALMS1_ENST00000409009.1_Missense_Mutation_p.N2938D|AC096546.1_ENST00000408160.1_RNA	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2980					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.N2980D(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TGACCAAATGAATAAACACCA	0.408																																					p.N2980D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A8938G	2						.						124.0	118.0	120.0					2																	73718027		1890	4108	5998	73571535	SO:0001583	missense	7840	exon10			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.8938A>G	2.37:g.73718027A>G	ENSP00000264448:p.Asn2980Asp	Somatic		Capture	Illumina HiSeq	Phase_I	73571535	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	A	0.043	-1.277956	0.01410	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.05925	3.37;3.37	4.18	0.34	0.15985	.	0.615588	0.15602	N	0.253853	T	0.02012	0.0063	N	0.03608	-0.345	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.46638	-0.9177	10	0.08599	T	0.76	.	3.5863	0.07972	0.5849:0.194:0.2211:0.0	.	2980;2938;2980	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	D	2938;2980	ENSP00000386627:N2938D;ENSP00000264448:N2980D	ENSP00000264448:N2980D	N	+	1	0	ALMS1	73571535	0.007000	0.16637	0.001000	0.08648	0.020000	0.10135	0.190000	0.17057	0.060000	0.16281	0.528000	0.53228	AAT		0.408	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
LRRFIP1	9208	broad.mit.edu	37	2	238671954	238671954	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr2:238671954C>T	ENST00000392000.4	+	11	1715	c.1598C>T	c.(1597-1599)aCa>aTa	p.T533I	LRRFIP1_ENST00000308482.9_Intron|LRRFIP1_ENST00000289175.6_Missense_Mutation_p.T477I|LRRFIP1_ENST00000244815.5_Missense_Mutation_p.T509I	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	533	DNA-binding.				innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)	p.T509I(1)|p.T533I(1)		NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		CAGGAAGCGACAGGTCCAAGT	0.478																																					p.T533I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1598T	2						.						79.0	85.0	83.0					2																	238671954		2203	4300	6503	238336693	SO:0001583	missense	9208	exon11			AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.1598C>T	2.37:g.238671954C>T	ENSP00000375857:p.Thr533Ile	Somatic		Capture	Illumina HiSeq	Phase_I	238336693	NM_001137552	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	ENST00000392000.4	37	CCDS46552.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.785268	0.49997	.	.	ENSG00000124831	ENST00000289175;ENST00000244815;ENST00000392000	T;T;T	0.13307	2.6;2.61;2.61	4.97	-0.462	0.12168	.	1.727460	0.02713	N	0.113128	T	0.10252	0.0251	L	0.29908	0.895	0.09310	N	1	B;B;B	0.20780	0.048;0.028;0.048	B;B;B	0.19391	0.025;0.006;0.025	T	0.33292	-0.9874	10	0.54805	T	0.06	-0.6662	1.4093	0.02287	0.14:0.4139:0.1365:0.3096	.	477;533;509	Q32MZ4-3;Q32MZ4;Q32MZ4-2	.;LRRF1_HUMAN;.	I	477;509;533	ENSP00000289175:T477I;ENSP00000244815:T509I;ENSP00000375857:T533I	ENSP00000244815:T509I	T	+	2	0	LRRFIP1	238336693	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.163000	0.03138	-0.069000	0.12931	0.655000	0.94253	ACA		0.478	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317198.1	NM_004735	
PLA1A	51365	broad.mit.edu	37	3	119348264	119348264	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr3:119348264C>T	ENST00000273371.4	+	11	1392	c.1320C>T	c.(1318-1320)aaC>aaT	p.N440N	PLA1A_ENST00000488919.1_Silent_p.N267N|PLA1A_ENST00000495992.1_Silent_p.N424N|PLA1A_ENST00000494440.1_Silent_p.N424N	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	440	Involved in the recognition of diacyl- phospholipids.				lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)	p.N440N(1)		NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						AACCAGTGAACTTACAAGCAA	0.453																																					p.N440N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1320T	3						.						156.0	137.0	144.0					3																	119348264		2203	4300	6503	120830954	SO:0001819	synonymous_variant	51365	exon11			AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.1320C>T	3.37:g.119348264C>T		Somatic		Capture	Illumina HiSeq	Phase_I	120830954	NM_015900	B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Silent	SNP	ENST00000273371.4	37	CCDS2991.1																																																																																				0.453	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2		
CNTN6	27255	broad.mit.edu	37	3	1415751	1415751	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr3:1415751G>T	ENST00000446702.2	+	16	2716	c.2089G>T	c.(2089-2091)Gca>Tca	p.A697S	CNTN6_ENST00000350110.2_Missense_Mutation_p.A697S|CNTN6_ENST00000539053.1_Missense_Mutation_p.A625S			Q9UQ52	CNTN6_HUMAN	contactin 6	697	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.A697S(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AAGAACTAAAGCATCAGGTAA	0.353																																					p.A697S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2089T	3						.						108.0	107.0	107.0					3																	1415751		2203	4300	6503	1390751	SO:0001583	missense	27255	exon16			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2089G>T	3.37:g.1415751G>T	ENSP00000407822:p.Ala697Ser	Somatic		Capture	Illumina HiSeq	Phase_I	1390751	NM_014461	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	37	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445403	0.43429	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.53640	0.61;0.61;0.61	5.16	3.34	0.38264	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.219596	0.31772	N	0.007085	T	0.37785	0.1016	L	0.36672	1.1	0.36101	D	0.844125	B	0.13145	0.007	B	0.12156	0.007	T	0.37888	-0.9686	10	0.46703	T	0.11	.	12.3333	0.55051	0.0:0.1291:0.7364:0.1345	.	697	Q9UQ52	CNTN6_HUMAN	S	697;625;697	ENSP00000407822:A697S;ENSP00000442791:A625S;ENSP00000341882:A697S	ENSP00000341882:A697S	A	+	1	0	CNTN6	1390751	1.000000	0.71417	0.999000	0.59377	0.877000	0.50540	4.202000	0.58446	0.649000	0.30751	-0.165000	0.13383	GCA		0.353	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
IQCB1	9657	broad.mit.edu	37	3	121500696	121500696	+	Missense_Mutation	SNP	C	C	T	rs146832128		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr3:121500696C>T	ENST00000310864.6	-	13	1518	c.1304G>A	c.(1303-1305)cGt>cAt	p.R435H	IQCB1_ENST00000349820.6_Missense_Mutation_p.R302H	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	435	IQ 4. {ECO:0000255|PROSITE- ProRule:PRU00116}.		R -> C (in dbSNP:rs11920543).		cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)	p.R435H(1)		NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		CTTTTTCTTACGGCACTTCGC	0.403													C|||	1	0.000199681	0.0	0.0	5008	,	,		19389	0.001		0.0	False		,,,				2504	0.0				p.R435H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1304A	3						.						120.0	114.0	116.0					3																	121500696		2203	4300	6503	122983386	SO:0001583	missense	9657	exon13			D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.1304G>A	3.37:g.121500696C>T	ENSP00000311505:p.Arg435His	Somatic		Capture	Illumina HiSeq	Phase_I	122983386	NM_001023570	Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Missense_Mutation	SNP	ENST00000310864.6	37	CCDS33837.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	4.148	0.025855	0.08054	.	.	ENSG00000173226	ENST00000310864;ENST00000349820	T;T	0.80304	-1.36;-1.36	4.61	-2.92	0.05615	.	0.226336	0.42420	N	0.000719	T	0.77909	0.4201	L	0.31065	0.9	0.34601	D	0.716544	D;B	0.71674	0.998;0.108	D;B	0.72075	0.976;0.023	T	0.76424	-0.2964	10	0.44086	T	0.13	0.2165	7.0927	0.25293	0.0:0.4014:0.1191:0.4795	.	435;302	Q15051;Q15051-2	IQCB1_HUMAN;.	H	435;302	ENSP00000311505:R435H;ENSP00000323756:R302H	ENSP00000311505:R435H	R	-	2	0	IQCB1	122983386	0.309000	0.24518	0.864000	0.33941	0.028000	0.11728	-0.512000	0.06313	-0.867000	0.04063	-1.094000	0.02160	CGT		0.403	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	NM_014642	
ESYT3	83850	broad.mit.edu	37	3	138193181	138193181	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr3:138193181C>T	ENST00000389567.4	+	20	2641	c.2455C>T	c.(2455-2457)Ctg>Ttg	p.L819L	ESYT3_ENST00000460133.1_3'UTR	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	819	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.L819L(1)		breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						CTTGGAACCCCTGTTTGATGA	0.522																																					p.L819L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2455T	3						.						127.0	132.0	131.0					3																	138193181		2019	4166	6185	139675871	SO:0001819	synonymous_variant	83850	exon20			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.2455C>T	3.37:g.138193181C>T		Somatic		Capture	Illumina HiSeq	Phase_I	139675871	NM_031913	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Silent	SNP	ENST00000389567.4	37	CCDS3101.2																																																																																				0.522	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303993.1	NM_031913	
ATR	545	broad.mit.edu	37	3	142215271	142215271	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr3:142215271G>A	ENST00000350721.4	-	34	5951	c.5830C>T	c.(5830-5832)Ctc>Ttc	p.L1944F	ATR_ENST00000383101.3_Missense_Mutation_p.L1880F	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1944	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L1944F(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GCATTAAGGAGAGCATTGTAG	0.483								Other conserved DNA damage response genes																													p.L1944F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5830T	3						.						163.0	133.0	143.0					3																	142215271		2203	4300	6503	143697961	SO:0001583	missense	545	exon34			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.5830C>T	3.37:g.142215271G>A	ENSP00000343741:p.Leu1944Phe	Somatic		Capture	Illumina HiSeq	Phase_I	143697961	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429195	0.83776	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	D;D	0.84298	-1.83;-1.83	5.78	3.98	0.46160	PIK-related kinase (1);Tetratricopeptide-like helical (1);PIK-related kinase, FAT (1);	0.065933	0.64402	D	0.000015	D	0.91479	0.7310	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91249	0.5028	10	0.87932	D	0	-3.1995	10.7928	0.46443	0.0673:0.0:0.8008:0.1319	.	1944	Q13535	ATR_HUMAN	F	1944;1880	ENSP00000343741:L1944F;ENSP00000372581:L1880F	ENSP00000343741:L1944F	L	-	1	0	ATR	143697961	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.650000	0.61440	0.781000	0.33589	-0.182000	0.12963	CTC		0.483	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
IL17RE	132014	broad.mit.edu	37	3	9944641	9944641	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr3:9944641C>T	ENST00000383814.3	+	1	130	c.25C>T	c.(25-27)Ctg>Ttg	p.L9L	IL17RE_ENST00000295980.3_Silent_p.L9L|IL17RE_ENST00000421412.1_Silent_p.L42L|IL17RE_ENST00000454190.2_Silent_p.L9L	NM_153480.1	NP_705613.1	Q8NFR9	I17RE_HUMAN	interleukin 17 receptor E	9					inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L9L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(11)|skin(1)	21				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)		ACTGGCAGCCCTGCTCCTGCC	0.627																																					p.L9L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C25T	3						.						66.0	59.0	62.0					3																	9944641		2203	4300	6503	9919641	SO:0001819	synonymous_variant	132014	exon1			AF458069	CCDS2589.1, CCDS54552.1	3p25.3	2008-02-05			ENSG00000163701	ENSG00000163701		"""Interleukins and interleukin receptors"""	18439	protein-coding gene	gene with protein product		614995					Standard	NM_153480		Approved	FLJ23658	uc003btu.3	Q8NFR9	OTTHUMG00000128649	ENST00000383814.3:c.25C>T	3.37:g.9944641C>T		Somatic		Capture	Illumina HiSeq	Phase_I	9919641	NM_153480	B2RB34|B2RNR1|B9EH65|Q6P532|Q8N8H7|Q8N8H8|Q8TEC2	Silent	SNP	ENST00000383814.3	37	CCDS2589.1	.	.	.	.	.	.	.	.	.	.	C	9.415	1.081626	0.20309	.	.	ENSG00000163701	ENST00000441648	.	.	.	5.05	2.88	0.33553	.	.	.	.	.	T	0.54447	0.1859	.	.	.	0.52099	D	0.999946	.	.	.	.	.	.	T	0.44190	-0.9344	4	.	.	.	-0.7461	6.2193	0.20673	0.0:0.7115:0.0:0.2885	.	.	.	.	L	1	.	.	P	+	2	0	IL17RE	9919641	0.000000	0.05858	0.915000	0.36163	0.818000	0.46254	0.223000	0.17719	0.321000	0.23259	0.655000	0.94253	CCT		0.627	IL17RE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250529.1	NM_153480	
PLCD1	5333	broad.mit.edu	37	3	38049598	38049598	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr3:38049598C>T	ENST00000334661.4	-	14	2314	c.2092G>A	c.(2092-2094)Gcc>Acc	p.A698T	PLCD1_ENST00000463876.1_Missense_Mutation_p.A719T	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	698	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CGGATGAGGGCAAGGTCAGGC	0.532																																					p.A698T												.	.	0			c.G2092A	3						.						122.0	113.0	116.0					3																	38049598		2203	4300	6503	38024602	SO:0001583	missense	5333	exon14				CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.2092G>A	3.37:g.38049598C>T	ENSP00000335600:p.Ala698Thr	None		Capture	Illumina HiSeq	Phase_I	38024602	NM_006225	B3KR14|Q86VN8	Missense_Mutation	SNP	ENST00000334661.4	37	CCDS2671.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.180972	0.57800	.	.	ENSG00000187091	ENST00000463876;ENST00000334661	T;T	0.70631	-0.5;-0.5	5.11	4.23	0.50019	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.048147	0.85682	D	0.000000	T	0.82245	0.4995	M	0.70108	2.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	D	0.84052	0.0370	10	0.66056	D	0.02	.	13.5117	0.61517	0.0:0.9232:0.0:0.0768	.	698;719	P51178;B3KR14	PLCD1_HUMAN;.	T	719;698	ENSP00000430344:A719T;ENSP00000335600:A698T	ENSP00000335600:A698T	A	-	1	0	PLCD1	38024602	1.000000	0.71417	0.523000	0.27875	0.003000	0.03518	7.773000	0.85462	1.305000	0.44909	-0.136000	0.14681	GCC		0.532	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		
APEH	327	broad.mit.edu	37	3	49721606	49721606	+	IGR	SNP	G	G	A	rs138238101		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr3:49721606G>A	ENST00000296456.5	+	0	3220				AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000449682.2_Missense_Mutation_p.P678L|MST1_ENST00000494828.2_5'Flank	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.P664L(1)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCAGGCAAGTGGGCCCCCGTA	0.562																																					p.P678L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2033T	3						.						27.0	25.0	25.0					3																	49721606		2203	4300	6503	49696610	SO:0001628	intergenic_variant	4485	exon18			D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49721606G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49696610	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778691	0.90195	.	.	ENSG00000173531	ENST00000449682	D	0.98684	-5.07	5.44	5.44	0.79542	.	0.000000	0.42053	D	0.000775	D	0.99579	0.9848	H	0.98849	4.35	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97649	1.0153	10	0.87932	D	0	.	19.2477	0.93909	0.0:0.0:1.0:0.0	.	678	G3XAK1	.	L	678	ENSP00000414287:P678L	ENSP00000414287:P678L	P	-	2	0	MST1	49696610	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.295000	0.96095	2.544000	0.85801	0.655000	0.94253	CCA		0.562	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
CHST2	9435	broad.mit.edu	37	3	142840972	142840972	+	Missense_Mutation	SNP	A	A	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr3:142840972A>T	ENST00000309575.3	+	2	2698	c.1314A>T	c.(1312-1314)agA>agT	p.R438S		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	438					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.R438S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						CACTACGGAGAGTGTACGATT	0.607																																					p.R438S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1314T	3						.						76.0	69.0	72.0					3																	142840972		2203	4300	6503	144323662	SO:0001583	missense	9435	exon2			BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1314A>T	3.37:g.142840972A>T	ENSP00000307911:p.Arg438Ser	Somatic		Capture	Illumina HiSeq	Phase_I	144323662	NM_004267	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	.	.	.	.	.	.	.	.	.	.	A	11.48	1.651603	0.29336	.	.	ENSG00000175040	ENST00000309575	D	0.83673	-1.75	4.33	1.39	0.22231	Sulfotransferase domain (1);	0.380726	0.26542	N	0.023795	T	0.74816	0.3766	L	0.53249	1.67	0.29089	N	0.882223	B	0.14805	0.011	B	0.09377	0.004	T	0.63056	-0.6722	10	0.28530	T	0.3	-16.4351	8.2225	0.31549	0.3329:0.0:0.6671:0.0	.	438	Q9Y4C5	CHST2_HUMAN	S	438	ENSP00000307911:R438S	ENSP00000307911:R438S	R	+	3	2	CHST2	144323662	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	0.852000	0.27764	0.439000	0.26476	-0.534000	0.04291	AGA		0.607	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
FIP1L1	81608	broad.mit.edu	37	4	54294269	54294269	+	Missense_Mutation	SNP	C	C	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr4:54294269C>A	ENST00000337488.6	+	13	1287	c.1093C>A	c.(1093-1095)Cct>Act	p.P365T	FIP1L1_ENST00000306932.6_Missense_Mutation_p.P291T|FIP1L1_ENST00000507922.1_Missense_Mutation_p.P350T|FIP1L1_ENST00000358575.5_Missense_Mutation_p.P350T|FIP1L1_ENST00000507166.1_Intron	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	365	Pro-rich.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P365T(1)		large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TCCAGGAGctcctcccactca	0.458			T	PDGFRA	idiopathic hypereosinophilic syndrome																																p.P365T			Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1093A	4						.						107.0	105.0	106.0					4																	54294269		2203	4300	6503	53989026	SO:0001583	missense	81608	exon13			AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.1093C>A	4.37:g.54294269C>A	ENSP00000336752:p.Pro365Thr	Somatic		Capture	Illumina HiSeq	Phase_I	53989026	NM_030917	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Missense_Mutation	SNP	ENST00000337488.6	37	CCDS3491.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182495	0.78677	.	.	ENSG00000145216	ENST00000337488;ENST00000358575;ENST00000507922;ENST00000306932;ENST00000504094	T;T;T;T;T	0.58060	2.08;0.36;0.36;0.87;0.36	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000002	T	0.66327	0.2778	L	0.46157	1.445	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.998;0.999;0.998;0.999	D;D;D;D;D;D	0.78314	0.991;0.991;0.981;0.991;0.981;0.991	T	0.58713	-0.7588	10	0.21014	T	0.42	-18.6784	19.3329	0.94299	0.0:1.0:0.0:0.0	.	350;133;350;291;365;350	G3XAD6;B4DTW7;B4DIR3;Q6UN15-3;Q6UN15;Q6UN15-4	.;.;.;.;FIP1_HUMAN;.	T	365;350;350;291;13	ENSP00000336752:P365T;ENSP00000351383:P350T;ENSP00000425456:P350T;ENSP00000302993:P291T;ENSP00000421691:P13T	ENSP00000302993:P291T	P	+	1	0	FIP1L1	53989026	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.190000	0.65104	2.629000	0.89072	0.563000	0.77884	CCT		0.458	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	
TLL1	7092	broad.mit.edu	37	4	167020522	167020522	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr4:167020522G>T	ENST00000061240.2	+	20	3397	c.2750G>T	c.(2749-2751)tGt>tTt	p.C917F	TLL1_ENST00000507499.1_Missense_Mutation_p.C940F	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	917	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C917F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CAGGTTGACTGTGAATGGCTA	0.463																																					p.C917F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2750T	4						.						186.0	170.0	175.0					4																	167020522		2203	4300	6503	167239972	SO:0001583	missense	7092	exon20			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2750G>T	4.37:g.167020522G>T	ENSP00000061240:p.Cys917Phe	Somatic		Capture	Illumina HiSeq	Phase_I	167239972	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362653	0.61403	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.66280	-0.2;-0.2	5.76	5.76	0.90799	CUB (5);	0.000000	0.85682	U	0.000000	D	0.87208	0.6120	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	D	0.90828	0.4714	10	0.87932	D	0	.	19.9813	0.97326	0.0:0.0:1.0:0.0	.	940;917	E9PD25;O43897	.;TLL1_HUMAN	F	917;940	ENSP00000061240:C917F;ENSP00000426082:C940F	ENSP00000061240:C917F	C	+	2	0	TLL1	167239972	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	9.813000	0.99286	2.726000	0.93360	0.655000	0.94253	TGT		0.463	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
PCDHA3	56145	broad.mit.edu	37	5	140182038	140182038	+	Missense_Mutation	SNP	C	C	T	rs573377233		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr5:140182038C>T	ENST00000522353.2	+	1	1256	c.1256C>T	c.(1255-1257)tCg>tTg	p.S419L	PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.S419L|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	419	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S419L(2)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGAGCGTGTCGGCCTATGAG	0.637													.|||	1	0.000199681	0.0	0.0	5008	,	,		20001	0.001		0.0	False		,,,				2504	0.0				p.S419L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1256T	5						.						142.0	133.0	136.0					5																	140182038		2203	4300	6503	140162222	SO:0001583	missense	56145	exon1			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1256C>T	5.37:g.140182038C>T	ENSP00000429808:p.Ser419Leu	Somatic		Capture	Illumina HiSeq	Phase_I	140162222	NM_031497	O75286	Missense_Mutation	SNP	ENST00000522353.2	37	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	c	11.08	1.533515	0.27387	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.61158	0.13;0.13	4.79	2.88	0.33553	Cadherin (4);Cadherin-like (1);	1.004220	0.08037	U	0.994446	T	0.73187	0.3555	M	0.90369	3.11	0.09310	N	1	P;P	0.39601	0.629;0.68	B;P	0.49252	0.152;0.604	T	0.61836	-0.6981	10	0.72032	D	0.01	.	8.5618	0.33516	0.1497:0.7683:0.0:0.082	.	419;419	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	L	419	ENSP00000429808:S419L;ENSP00000434086:S419L	ENSP00000429808:S419L	S	+	2	0	PCDHA3	140162222	0.000000	0.05858	0.001000	0.08648	0.576000	0.36127	1.357000	0.34090	1.147000	0.42369	0.467000	0.42956	TCG		0.637	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
PCDHGA9	56107	broad.mit.edu	37	5	140782971	140782971	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr5:140782971G>A	ENST00000573521.1	+	1	452	c.452G>A	c.(451-453)cGt>cAt	p.R151H	PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	151	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGAGCACGTTATCCACTT	0.488																																					p.R151H												.	.	0			c.G452A	5						.						75.0	77.0	77.0					5																	140782971		1953	4152	6105	140763155	SO:0001583	missense	56107	exon1			AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.452G>A	5.37:g.140782971G>A	ENSP00000460274:p.Arg151His	Somatic		Capture	Illumina HiSeq	Phase_I	140763155	NM_018921	A2RU65|Q9Y5C9	Missense_Mutation	SNP	ENST00000573521.1	37	CCDS58981.1																																																																																				0.488	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921	
IRX1	79192	broad.mit.edu	37	5	3599676	3599676	+	Missense_Mutation	SNP	T	T	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr5:3599676T>A	ENST00000302006.3	+	2	666	c.614T>A	c.(613-615)cTc>cAc	p.L205H	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	205					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GATGGAGCGCTCTTCGGCAGC	0.632																																					p.L205H												.	.	0			c.T614A	5						.						75.0	66.0	69.0					5																	3599676		2203	4300	6503	3652676	SO:0001583	missense	79192	exon2			U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.614T>A	5.37:g.3599676T>A	ENSP00000305244:p.Leu205His	None		Capture	Illumina HiSeq	Phase_I	3652676	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.503428	0.44558	.	.	ENSG00000170549	ENST00000302006	T	0.58652	0.32	4.65	4.65	0.58169	.	0.569824	0.16638	N	0.205771	T	0.57007	0.2024	N	0.22421	0.69	0.40685	D	0.982349	P	0.50819	0.939	P	0.54759	0.76	T	0.58929	-0.7549	10	0.45353	T	0.12	.	13.7574	0.62946	0.0:0.0:0.0:1.0	.	205	P78414	IRX1_HUMAN	H	205	ENSP00000305244:L205H	ENSP00000305244:L205H	L	+	2	0	IRX1	3652676	0.924000	0.31332	0.999000	0.59377	0.393000	0.30537	4.868000	0.63021	1.699000	0.51192	0.496000	0.49642	CTC		0.632	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
PDZD2	23037	broad.mit.edu	37	5	32074244	32074244	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr5:32074244G>T	ENST00000438447.1	+	18	3420	c.3032G>T	c.(3031-3033)gGc>gTc	p.G1011V	PDZD2_ENST00000282493.3_Missense_Mutation_p.G1011V			O15018	PDZD2_HUMAN	PDZ domain containing 2	1011					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.G1011V(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TCTTCCAAGGGCATGGACGTC	0.577																																					p.G1011V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3032T	5						.						58.0	57.0	57.0					5																	32074244		2203	4300	6503	32110001	SO:0001583	missense	23037	exon17			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3032G>T	5.37:g.32074244G>T	ENSP00000402033:p.Gly1011Val	Somatic		Capture	Illumina HiSeq	Phase_I	32110001	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	9.851	1.193752	0.22037	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.05717	3.4;3.4	5.46	-4.94	0.03057	.	1.222540	0.05951	N	0.638761	T	0.02418	0.0074	N	0.04508	-0.205	0.20764	N	0.999856	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44892	-0.9298	10	0.38643	T	0.18	.	2.0799	0.03632	0.1182:0.3279:0.2733:0.2807	.	837;1011	B4E3P2;O15018	.;PDZD2_HUMAN	V	1011;813;1011	ENSP00000402033:G1011V;ENSP00000282493:G1011V	ENSP00000282493:G1011V	G	+	2	0	PDZD2	32110001	0.000000	0.05858	0.011000	0.14972	0.023000	0.10783	-0.999000	0.03697	-0.460000	0.07003	-0.457000	0.05445	GGC		0.577	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
EMB	133418	broad.mit.edu	37	5	49707059	49707059	+	Missense_Mutation	SNP	T	T	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr5:49707059T>A	ENST00000303221.5	-	3	570	c.355A>T	c.(355-357)Aca>Tca	p.T119S	EMB_ENST00000514111.1_Missense_Mutation_p.T69S|EMB_ENST00000506190.1_5'UTR|EMB_ENST00000508934.1_Intron	NM_198449.2	NP_940851.1	Q6PCB8	EMB_HUMAN	embigin	119	Ig-like V-type 1.				cell adhesion (GO:0007155)|plasma membrane lactate transport (GO:0035879)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	organic cyclic compound binding (GO:0097159)	p.T119S(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	15	Lung SC(58;0.218)	Lung NSC(810;0.0795)				GTGCTTCCTGTTGCACTGACA	0.373																																					p.T119S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A355T	5						.						90.0	90.0	90.0					5																	49707059		2203	4300	6503	49742816	SO:0001583	missense	133418	exon3			BC059398	CCDS3953.1	5q11.1	2013-01-29	2010-06-24		ENSG00000170571	ENSG00000170571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30465	protein-coding gene	gene with protein product		615669	"""embigin homolog (mouse)"""			9438341	Standard	NM_198449		Approved	MGC71745	uc003jom.3	Q6PCB8	OTTHUMG00000131161	ENST00000303221.5:c.355A>T	5.37:g.49707059T>A	ENSP00000302289:p.Thr119Ser	Somatic		Capture	Illumina HiSeq	Phase_I	49742816	NM_198449	B7Z6S3|B7Z902	Missense_Mutation	SNP	ENST00000303221.5	37	CCDS3953.1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.254446	0.22965	.	.	ENSG00000170571	ENST00000303221;ENST00000510295;ENST00000514111	T;T	0.11712	2.75;2.75	5.4	-2.15	0.07102	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.631968	0.14722	N	0.302250	T	0.08313	0.0207	L	0.59436	1.845	0.09310	N	1	P	0.41232	0.743	B	0.36989	0.238	T	0.17349	-1.0372	9	.	.	.	-1.1561	3.5334	0.07785	0.4049:0.1593:0.0:0.4358	.	119	Q6PCB8	EMB_HUMAN	S	119;91;69	ENSP00000302289:T119S;ENSP00000426404:T69S	.	T	-	1	0	EMB	49742816	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.110000	0.15437	-0.214000	0.10078	-0.349000	0.07799	ACA		0.373	EMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253853.1	NM_198449	
PCDHGA10	56106	broad.mit.edu	37	5	140792788	140792788	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr5:140792788G>A	ENST00000398610.2	+	1	46	c.46G>A	c.(46-48)Ggg>Agg	p.G16R	PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	16					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G16R(1)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGATTGCAGCGGGCTGGTCCT	0.502											OREG0016862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G16R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G46A	5						.						46.0	50.0	49.0					5																	140792788		1883	4137	6020	140772972	SO:0001583	missense	56106	exon1				CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.46G>A	5.37:g.140792788G>A	ENSP00000381611:p.Gly16Arg	Somatic	1659	Capture	Illumina HiSeq	Phase_I	140772972	NM_032090	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	CCDS47292.1	.	.	.	.	.	.	.	.	.	.	g	0.011	-1.695109	0.00731	.	.	ENSG00000253846	ENST00000398610	T	0.47177	0.85	5.49	0.101	0.14517	.	.	.	.	.	T	0.19565	0.0470	N	0.08118	0	0.09310	N	1	B;B	0.15141	0.012;0.003	B;B	0.12837	0.008;0.004	T	0.20940	-1.0260	9	0.12430	T	0.62	.	1.6483	0.02766	0.3202:0.1312:0.4152:0.1334	.	16;16	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	R	16	ENSP00000381611:G16R	ENSP00000381611:G16R	G	+	1	0	PCDHGA10	140772972	0.001000	0.12720	0.001000	0.08648	0.018000	0.09664	0.078000	0.14761	-0.314000	0.08716	-0.384000	0.06662	GGG		0.502	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913	
ARMC2	84071	broad.mit.edu	37	6	109294665	109294665	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr6:109294665G>C	ENST00000392644.4	+	18	2720	c.2552G>C	c.(2551-2553)cGa>cCa	p.R851P	ARMC2_ENST00000368972.3_Missense_Mutation_p.R686P	NM_032131.4	NP_115507.4	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	851								p.R844Q(1)|p.R844P(1)		endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)	24		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		CTTCTAAACCGAATTCAGAGA	0.448																																					p.R851P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2552C	6						.						172.0	168.0	169.0					6																	109294665		2203	4300	6503	109401358	SO:0001583	missense	84071	exon18			BC030603	CCDS5069.2, CCDS69168.1	6q21	2013-02-14			ENSG00000118690	ENSG00000118690		"""Armadillo repeat containing"""	23045	protein-coding gene	gene with protein product							Standard	XM_005267154		Approved	DKFZp434P0714, bA787I22.1	uc003pss.4	Q8NEN0	OTTHUMG00000015335	ENST00000392644.4:c.2552G>C	6.37:g.109294665G>C	ENSP00000376417:p.Arg851Pro	Somatic		Capture	Illumina HiSeq	Phase_I	109401358	NM_032131	A8K8Y4|B4DGF5|G5E993|Q5VVY8|Q9H0K9	Missense_Mutation	SNP	ENST00000392644.4	37	CCDS5069.2	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820913	0.71028	.	.	ENSG00000118690	ENST00000368972;ENST00000392644	T;T	0.35973	1.28;1.3	5.16	4.27	0.50696	.	0.326060	0.29473	N	0.012058	T	0.36690	0.0976	L	0.32530	0.975	0.44337	D	0.997226	D	0.89917	1.0	D	0.70227	0.968	T	0.16129	-1.0413	10	0.72032	D	0.01	-1.487	11.4828	0.50335	0.1424:0.0:0.8576:0.0	.	851	Q8NEN0	ARMC2_HUMAN	P	686;851	ENSP00000357968:R686P;ENSP00000376417:R851P	ENSP00000357968:R686P	R	+	2	0	ARMC2	109401358	0.991000	0.36638	0.966000	0.40874	0.966000	0.64601	3.656000	0.54467	2.677000	0.91161	0.655000	0.94253	CGA		0.448	ARMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041732.2	NM_032131	
EXOC2	55770	broad.mit.edu	37	6	619449	619449	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr6:619449C>T	ENST00000230449.4	-	5	652	c.517G>A	c.(517-519)Gag>Aag	p.E173K	EXOC2_ENST00000448181.3_Intron	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	173					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.E173K(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		GAGTGATTCTCTATAAGATAC	0.403																																					p.E173K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G517A	6						.						118.0	118.0	118.0					6																	619449		2203	4300	6503	564449	SO:0001583	missense	55770	exon5			AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.517G>A	6.37:g.619449C>T	ENSP00000230449:p.Glu173Lys	Somatic		Capture	Illumina HiSeq	Phase_I	564449	NM_018303	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Missense_Mutation	SNP	ENST00000230449.4	37	CCDS34327.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747177	0.69418	.	.	ENSG00000112685	ENST00000230449	T	0.46819	0.86	4.99	4.99	0.66335	.	0.094451	0.64402	D	0.000001	T	0.28300	0.0699	M	0.72118	2.19	0.80722	D	1	P	0.44429	0.835	B	0.41036	0.346	T	0.28554	-1.0040	10	0.06625	T	0.88	-30.5998	12.0739	0.53632	0.0:0.9203:0.0:0.0796	.	173	Q96KP1	EXOC2_HUMAN	K	173	ENSP00000230449:E173K	ENSP00000230449:E173K	E	-	1	0	EXOC2	564449	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	5.719000	0.68462	2.457000	0.83068	0.591000	0.81541	GAG		0.403	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1	NM_018303	
DEFB112	245915	broad.mit.edu	37	6	50016293	50016293	+	Silent	SNP	T	T	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr6:50016293T>G	ENST00000322246.4	-	1	71	c.72A>C	c.(70-72)acA>acC	p.T24T		NM_001037498.1	NP_001032587.1	Q30KQ8	DB112_HUMAN	defensin, beta 112	24					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.T24T(1)		central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.042)					TTTCAAATATTGTGGAAGATG	0.333																																					p.T24T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A72C	6						.						138.0	134.0	135.0					6																	50016293		2203	4298	6501	50124252	SO:0001819	synonymous_variant	245915	exon1			DQ012016	CCDS34476.1	6p12.3	2010-03-30			ENSG00000180872	ENSG00000180872		"""Defensins, beta"""	18093	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037498		Approved	DEFB-12	uc011dws.2	Q30KQ8	OTTHUMG00000160215	ENST00000322246.4:c.72A>C	6.37:g.50016293T>G		Somatic		Capture	Illumina HiSeq	Phase_I	50124252	NM_001037498	Q8NET0	Silent	SNP	ENST00000322246.4	37	CCDS34476.1																																																																																				0.333	DEFB112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359672.1	NM_001037498	
TINAG	27283	broad.mit.edu	37	6	54173443	54173443	+	Missense_Mutation	SNP	A	A	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr6:54173443A>C	ENST00000259782.4	+	1	191	c.95A>C	c.(94-96)gAg>gCg	p.E32A	TINAG_ENST00000370864.3_Missense_Mutation_p.E14A|TINAG_ENST00000486436.1_3'UTR|TINAG_ENST00000370869.3_Missense_Mutation_p.E28A	NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	32					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.E32A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			GTGGACCTAGAGGCTTATTTC	0.393																																					p.E32A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A95C	6						.						109.0	103.0	105.0					6																	54173443		2203	4300	6503	54281402	SO:0001583	missense	27283	exon1			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.95A>C	6.37:g.54173443A>C	ENSP00000259782:p.Glu32Ala	Somatic		Capture	Illumina HiSeq	Phase_I	54281402	NM_014464	Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	37	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	A	0.218	-1.030668	0.02045	.	.	ENSG00000137251	ENST00000370869;ENST00000339741;ENST00000259782;ENST00000370864	T;T;T	0.65549	1.91;-0.16;1.9	5.88	-1.07	0.09968	.	0.484258	0.20591	N	0.089356	T	0.19087	0.0458	L	0.33485	1.01	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.25847	-1.0120	10	0.15499	T	0.54	.	5.1235	0.14873	0.5042:0.1565:0.3393:0.0	.	32;32	Q9UJW2;Q7Z477	TINAG_HUMAN;.	A	28;32;32;14	ENSP00000359906:E28A;ENSP00000259782:E32A;ENSP00000359901:E14A	ENSP00000259782:E32A	E	+	2	0	TINAG	54281402	0.006000	0.16342	0.000000	0.03702	0.006000	0.05464	0.695000	0.25527	-0.098000	0.12285	-0.353000	0.07706	GAG		0.393	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464	
MDN1	23195	broad.mit.edu	37	6	90486393	90486393	+	Missense_Mutation	SNP	T	T	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr6:90486393T>A	ENST00000369393.3	-	12	1862	c.1747A>T	c.(1747-1749)Atg>Ttg	p.M583L	MDN1_ENST00000428876.1_Missense_Mutation_p.M583L			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	583					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.M583L(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCAGAAAGCATTGCTGTGAAA	0.333																																					p.M583L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1747T	6						.						127.0	119.0	121.0					6																	90486393		2202	4299	6501	90543114	SO:0001583	missense	23195	exon12			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.1747A>T	6.37:g.90486393T>A	ENSP00000358400:p.Met583Leu	Somatic		Capture	Illumina HiSeq	Phase_I	90543114	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	14.38	2.517490	0.44763	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.37584	1.19;1.19;1.19	5.07	5.07	0.68467	ATPase, AAA+ type, core (1);	0.046469	0.85682	D	0.000000	T	0.19644	0.0472	M	0.65320	2	0.50171	D	0.999857	B;B	0.22003	0.063;0.016	B;B	0.24006	0.05;0.046	T	0.08848	-1.0702	10	0.11485	T	0.65	.	14.499	0.67709	0.0:0.0:0.0:1.0	.	510;583	Q5T795;Q9NU22	.;MDN1_HUMAN	L	583;583;510	ENSP00000358400:M583L;ENSP00000413970:M583L;ENSP00000409664:M510L	ENSP00000358400:M583L	M	-	1	0	MDN1	90543114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.845000	0.75394	1.922000	0.55676	0.460000	0.39030	ATG		0.333	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
THBS2	7058	broad.mit.edu	37	6	169648946	169648946	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr6:169648946G>A	ENST00000366787.3	-	4	424	c.175C>T	c.(175-177)Cgc>Tgc	p.R59C		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	59	Heparin-binding. {ECO:0000255}.|Laminin G-like.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R59C(2)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		TAGTCAAAGCGCACGAAGCGG	0.592																																					p.R59C	Esophageal Squamous(91;219 1934 18562 44706)											.	.	2	Substitution - Missense(2)	large_intestine(1)|biliary_tract(1)	c.C175T	6						.						124.0	101.0	109.0					6																	169648946		2203	4300	6503	169390871	SO:0001583	missense	7058	exon4				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.175C>T	6.37:g.169648946G>A	ENSP00000355751:p.Arg59Cys	Somatic		Capture	Illumina HiSeq	Phase_I	169390871	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525199	0.64747	.	.	ENSG00000186340	ENST00000366787;ENST00000435791	T;T	0.02301	4.35;4.35	4.42	3.48	0.39840	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.37530	U	0.002054	T	0.06690	0.0171	M	0.72894	2.215	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.09640	-1.0665	10	0.66056	D	0.02	-51.1463	14.1558	0.65417	0.0:0.0:0.8502:0.1497	.	59	P35442	TSP2_HUMAN	C	59	ENSP00000355751:R59C;ENSP00000398928:R59C	ENSP00000355751:R59C	R	-	1	0	THBS2	169390871	1.000000	0.71417	0.402000	0.26371	0.408000	0.30992	6.067000	0.71193	2.180000	0.69256	0.462000	0.41574	CGC		0.592	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
CDHR3	222256	broad.mit.edu	37	7	105624709	105624709	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr7:105624709G>T	ENST00000317716.9	+	4	567	c.487G>T	c.(487-489)Gac>Tac	p.D163Y	CDHR3_ENST00000542731.1_Missense_Mutation_p.D163Y|CDHR3_ENST00000478080.1_Missense_Mutation_p.D75Y|CDHR3_ENST00000470188.1_3'UTR|CDHR3_ENST00000541203.1_Intron|CDHR3_ENST00000343407.5_5'UTR	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	163	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						CGATCCAGAAGACACAAGCCG	0.473																																					p.D163Y												.	.	0			c.G487T	7						.						61.0	63.0	62.0					7																	105624709		1916	4129	6045	105411945	SO:0001583	missense	222256	exon4			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.487G>T	7.37:g.105624709G>T	ENSP00000325954:p.Asp163Tyr	None		Capture	Illumina HiSeq	Phase_I	105411945	NM_152750	Q8TCI7	Missense_Mutation	SNP	ENST00000317716.9	37	CCDS47684.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475981	0.44044	.	.	ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080	T;T;T	0.60920	0.15;0.15;0.15	4.56	4.56	0.56223	Cadherin (4);Cadherin-like (1);	0.066344	0.53938	D	0.000044	T	0.78691	0.4323	M	0.90705	3.14	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.72982	0.969;0.979	T	0.82979	-0.0188	10	0.87932	D	0	-18.8843	12.9987	0.58662	0.0:0.0:1.0:0.0	.	150;163	B3KYA0;Q6ZTQ4	.;CDHR3_HUMAN	Y	163;163;75	ENSP00000439766:D163Y;ENSP00000325954:D163Y;ENSP00000417771:D75Y	ENSP00000325954:D163Y	D	+	1	0	CDHR3	105411945	1.000000	0.71417	1.000000	0.80357	0.272000	0.26649	4.082000	0.57635	2.522000	0.85027	0.655000	0.94253	GAC		0.473	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750	
LAMB1	3912	broad.mit.edu	37	7	107599741	107599741	+	Silent	SNP	C	C	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr7:107599741C>A	ENST00000222399.6	-	20	2873	c.2643G>T	c.(2641-2643)ggG>ggT	p.G881G	LAMB1_ENST00000393561.1_Silent_p.G905G	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	881	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.G881G(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TCAAGCACTCCCCAGTCACTG	0.552																																					p.G881G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2643T	7						.						157.0	145.0	149.0					7																	107599741		2203	4300	6503	107386977	SO:0001819	synonymous_variant	3912	exon20			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2643G>T	7.37:g.107599741C>A		Somatic		Capture	Illumina HiSeq	Phase_I	107386977	NM_002291	Q14D91	Silent	SNP	ENST00000222399.6	37	CCDS5750.1																																																																																				0.552	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
SCIN	85477	broad.mit.edu	37	7	12692310	12692310	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr7:12692310G>C	ENST00000297029.5	+	16	2219	c.2118G>C	c.(2116-2118)tgG>tgC	p.W706C	AC011891.5_ENST00000437088.1_lincRNA|SCIN_ENST00000445618.2_Missense_Mutation_p.W459C|SCIN_ENST00000519209.1_Missense_Mutation_p.W459C	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	706	Ca(2+)-dependent actin binding.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.W706C(2)		endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TCACAGGCTGGTTCCTGGGCT	0.453																																					p.W706C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2118C	7						.						99.0	102.0	101.0					7																	12692310		1960	4189	6149	12658835	SO:0001583	missense	85477	exon16			AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.2118G>C	7.37:g.12692310G>C	ENSP00000297029:p.Trp706Cys	Somatic		Capture	Illumina HiSeq	Phase_I	12658835	NM_001112706	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	ENST00000297029.5	37	CCDS47545.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.330711	0.81690	.	.	ENSG00000006747	ENST00000297029;ENST00000519209;ENST00000445618	T;T;T	0.22134	1.97;1.97;1.97	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.58308	0.2113	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67589	-0.5632	10	0.87932	D	0	-7.4142	19.5932	0.95523	0.0:0.0:1.0:0.0	.	706	Q9Y6U3	ADSV_HUMAN	C	706;459;459	ENSP00000297029:W706C;ENSP00000430997:W459C;ENSP00000390189:W459C	ENSP00000297029:W706C	W	+	3	0	SCIN	12658835	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.203000	0.95033	2.630000	0.89119	0.650000	0.86243	TGG		0.453	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
DOCK4	9732	broad.mit.edu	37	7	111387420	111387420	+	Missense_Mutation	SNP	C	C	G			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr7:111387420C>G	ENST00000437633.1	-	42	4725	c.4469G>C	c.(4468-4470)tGt>tCt	p.C1490S	DOCK4_ENST00000494651.2_Missense_Mutation_p.C373S|DOCK4_ENST00000428084.1_Missense_Mutation_p.C1499S	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1490	DHR-2.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.C1487S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TCTTGTCTGACACTGACTAAT	0.403																																					p.C1490S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4469C	7						.						100.0	96.0	97.0					7																	111387420		1956	4144	6100	111174656	SO:0001583	missense	9732	exon42				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.4469G>C	7.37:g.111387420C>G	ENSP00000404179:p.Cys1490Ser	Somatic		Capture	Illumina HiSeq	Phase_I	111174656	NM_014705	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.85|18.85	3.712106|3.712106	0.68730|0.68730	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288|ENST00000423057;ENST00000445943	T;T;T|.	0.15603|.	2.41;2.41;2.41|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69205|0.69205	0.3085|0.3085	L|L	0.46157|0.46157	1.445|1.445	0.58432|0.58432	D|D	0.999999|0.999999	P;P;P;P;P|.	0.47106|.	0.78;0.57;0.89;0.89;0.866|.	P;P;P;P;P|.	0.50270|.	0.597;0.461;0.636;0.636;0.503|.	T|T	0.64437|0.64437	-0.6408|-0.6408	10|5	0.44086|.	T|.	0.13|.	.|.	19.0847|19.0847	0.93198|0.93198	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	397;373;1535;1490;1499|.	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2|.	.;.;.;DOCK4_HUMAN;.|.	S|L	1478;1499;373;1490;1487|951;1523	ENSP00000410746:C1499S;ENSP00000440944:C373S;ENSP00000404179:C1490S|.	ENSP00000345432:C1487S|.	C|V	-|-	2|1	0|0	DOCK4|DOCK4	111174656|111174656	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.961000|3.961000	0.56759|0.56759	2.748000|2.748000	0.94277|0.94277	0.655000|0.655000	0.94253|0.94253	TGT|GTC		0.403	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
MGAM	8972	broad.mit.edu	37	7	141758101	141758101	+	Silent	SNP	T	T	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr7:141758101T>C	ENST00000549489.2	+	31	3887	c.3792T>C	c.(3790-3792)gaT>gaC	p.D1264D	MGAM_ENST00000475668.2_Silent_p.D1264D	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1264	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.D1264D(2)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCTTGTATGATGAGATGGTGG	0.502																																					p.D1264D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T3792C	7						.						221.0	207.0	211.0					7																	141758101		1976	4175	6151	141404570	SO:0001819	synonymous_variant	8972	exon31			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3792T>C	7.37:g.141758101T>C		Somatic		Capture	Illumina HiSeq	Phase_I	141404570	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	37	CCDS47727.1																																																																																				0.502	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
SPDYE1	285955	broad.mit.edu	37	7	44046934	44046934	+	Missense_Mutation	SNP	G	G	A	rs200388629	byFrequency	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	A	G	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr7:44046934G>A	ENST00000258704.3	+	5	837	c.700G>A	c.(700-702)Ggg>Agg	p.G234R	RP5-1165K10.2_ENST00000454572.1_RNA|AC004951.6_ENST00000447643.1_lincRNA|POLR2J4_ENST00000427076.1_RNA	NM_001099435.2|NM_175064.2	NP_001092905.2|NP_778234.2	Q8NFV5	SPDE1_HUMAN	speedy/RINGO cell cycle regulator family member E1	234								p.G234R(4)		endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	11						CTTCCTGTATGGGAAGAACCG	0.547																																					p.G234R												.	.	4	Substitution - Missense(4)	kidney(4)	c.G700A	7						.						147.0	147.0	147.0					7																	44046934		2203	4300	6503	44013459	SO:0001583	missense	285955	exon5			AF412027	CCDS5475.1	7q11.23	2013-05-08	2013-05-08	2009-02-17	ENSG00000136206	ENSG00000136206		"""Speedy homologs"""	16408	protein-coding gene	gene with protein product	"""Speedy E"""		"""Williams Beuren syndrome chromosome region 19"", ""speedy homolog E1 (Xenopus laevis)"""	WBSCR19		12073013	Standard	NM_175064		Approved	Ringo1, SPDYE	uc003tjf.3	Q8NFV5	OTTHUMG00000128985	ENST00000258704.3:c.700G>A	7.37:g.44046934G>A	ENSP00000258704:p.Gly234Arg	Germline		Capture	Illumina HiSeq	Phase_I	44013459	NM_175064	Q9NTH5	Missense_Mutation	SNP	ENST00000258704.3	37	CCDS5475.1	.	.	.	.	.	.	.	.	.	.	.	9.035	0.988225	0.18966	.	.	ENSG00000136206	ENST00000258704	.	.	.	.	.	.	.	0.314057	0.25645	N	0.029241	T	0.53786	0.1818	M	0.87900	2.915	0.21256	N	0.999748	B	0.21606	0.058	B	0.29077	0.098	T	0.53920	-0.8370	7	0.54805	T	0.06	.	.	.	.	.	234	Q8NFV5	SPDE1_HUMAN	R	234	.	ENSP00000258704:G234R	G	+	1	0	SPDYE1	44013459	0.086000	0.21541	0.353000	0.25747	0.355000	0.29361	0.653000	0.24902	0.088000	0.17205	0.089000	0.15464	GGG		0.547	SPDYE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250974.1	NM_175064	
CYP3A5	1577	broad.mit.edu	37	7	99247796	99247796	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr7:99247796G>T	ENST00000222982.4	-	12	1412	c.1313C>A	c.(1312-1314)cCc>cAc	p.P438H	CYP3A5_ENST00000343703.5_Missense_Mutation_p.P428H|CYP3A5_ENST00000339843.2_3'UTR	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	438					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)	p.P438H(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	GCAGTTTCTGGGTCCAGTTCC	0.383																																					p.P438H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1313A	7						.						302.0	262.0	276.0					7																	99247796		2203	4300	6503	99085732	SO:0001583	missense	1577	exon12			L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.1313C>A	7.37:g.99247796G>T	ENSP00000222982:p.Pro438His	Somatic		Capture	Illumina HiSeq	Phase_I	99085732	NM_000777	A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	Missense_Mutation	SNP	ENST00000222982.4	37	CCDS5672.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.316814	0.81469	.	.	ENSG00000106258	ENST00000222982;ENST00000343703	T;T	0.72167	-0.63;-0.63	4.73	4.73	0.59995	Cytochrome P450, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.91040	0.7181	H	0.99454	4.575	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94832	0.7997	10	0.87932	D	0	.	15.1921	0.73053	0.0:0.0:1.0:0.0	.	428;438;438	F5H4S0;B2R9K2;P20815	.;.;CP3A5_HUMAN	H	438;428	ENSP00000222982:P438H;ENSP00000342969:P428H	ENSP00000222982:P438H	P	-	2	0	CYP3A5	99085732	1.000000	0.71417	0.636000	0.29352	0.956000	0.61745	9.251000	0.95483	2.150000	0.67090	0.561000	0.74099	CCC		0.383	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345469.1		
TRPV6	55503	broad.mit.edu	37	7	142570203	142570203	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr7:142570203C>T	ENST00000359396.3	-	14	2062	c.1817G>A	c.(1816-1818)cGg>cAg	p.R606Q		NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	606					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)	p.R606Q(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					AGGCAGCTTCCGCTCCAGCAT	0.627																																					p.R606Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1817A	7						.						48.0	43.0	45.0					7																	142570203		2203	4300	6503	142280325	SO:0001583	missense	55503	exon14			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1817G>A	7.37:g.142570203C>T	ENSP00000352358:p.Arg606Gln	Somatic		Capture	Illumina HiSeq	Phase_I	142280325	NM_018646	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388439	0.82902	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	T	0.80738	-1.41	5.12	3.22	0.36961	.	0.065387	0.64402	D	0.000008	D	0.86012	0.5831	M	0.80183	2.485	0.52501	D	0.999952	D	0.64830	0.994	P	0.56788	0.806	D	0.85532	0.1210	10	0.56958	D	0.05	-24.1341	10.247	0.43347	0.0:0.8329:0.0:0.1671	.	606	Q9H1D0	TRPV6_HUMAN	Q	606;438	ENSP00000352358:R606Q	ENSP00000310825:R438Q	R	-	2	0	TRPV6	142280325	0.980000	0.34600	0.931000	0.37212	0.995000	0.86356	2.886000	0.48578	0.663000	0.31027	0.655000	0.94253	CGG		0.627	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274	
TG	7038	broad.mit.edu	37	8	133984983	133984983	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr8:133984983C>T	ENST00000220616.4	+	34	6236	c.6196C>T	c.(6196-6198)Ccc>Tcc	p.P2066S	TG_ENST00000522523.1_3'UTR|TG_ENST00000377869.1_Missense_Mutation_p.P2009S|TG_ENST00000542445.1_Missense_Mutation_p.P436S|TG_ENST00000519543.1_Missense_Mutation_p.P220S	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2066					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.P2066S(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GTACCAGAAGCCCAGTAAGTA	0.463																																					p.P2066S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6196T	8						.						137.0	123.0	128.0					8																	133984983		2203	4300	6503	134054165	SO:0001583	missense	7038	exon34			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.6196C>T	8.37:g.133984983C>T	ENSP00000220616:p.Pro2066Ser	Somatic		Capture	Illumina HiSeq	Phase_I	134054165	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.41|18.41	3.617043|3.617043	0.66672|0.66672	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000519178|ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543	.|T;T;T;D	.|0.82081	.|-0.43;-0.48;-0.64;-1.57	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.000000	.|0.64402	.|D	.|0.000009	D|D	0.86087|0.86087	0.5849|0.5849	M|M	0.79475|0.79475	2.455|2.455	0.47862|0.47862	D|D	0.999532|0.999532	.|D;P;P	.|0.55172	.|0.97;0.897;0.838	.|P;B;B	.|0.47134	.|0.539;0.357;0.32	D|D	0.88163|0.88163	0.2859|0.2859	5|10	.|0.87932	.|D	.|0	.|.	15.4101|15.4101	0.74911|0.74911	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|220;436;2066	.|E7EVM0;F5GWW5;P01266	.|.;.;THYG_HUMAN	V|S	521|2009;872;2066;436;220	.|ENSP00000367100:P2009S;ENSP00000220616:P2066S;ENSP00000441693:P436S;ENSP00000430430:P220S	.|ENSP00000220616:P2066S	A|P	+|+	2|1	0|0	TG|TG	134054165|134054165	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	4.015000|4.015000	0.57152|0.57152	2.702000|2.702000	0.92279|0.92279	0.655000|0.655000	0.94253|0.94253	GCC|CCC		0.463	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
MICU3	286097	broad.mit.edu	37	8	16963071	16963071	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr8:16963071G>A	ENST00000318063.5	+	11	1277	c.1235G>A	c.(1234-1236)cGt>cAt	p.R412H	MICU3_ENST00000519866.1_3'UTR	NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	412	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.R412H(1)									GAAAATGTGCGTTACAGTATA	0.318																																					p.R412H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1235A	8						.						58.0	60.0	59.0					8																	16963071		2198	4296	6494	17007442	SO:0001583	missense	286097	exon11			BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.1235G>A	8.37:g.16963071G>A	ENSP00000321455:p.Arg412His	Somatic		Capture	Illumina HiSeq	Phase_I	17007442	NM_181723	Q8IYZ3	Missense_Mutation	SNP	ENST00000318063.5	37	CCDS5999.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.47|13.47	2.245739|2.245739	0.39697|0.39697	.|.	.|.	ENSG00000155970|ENSG00000155970	ENST00000318063|ENST00000519044	T|.	0.29397|.	1.57|.	4.99|4.99	4.11|4.11	0.48088|0.48088	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53981|0.53981	0.1830|0.1830	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	B|.	0.24618|.	0.107|.	B|.	0.12156|.	0.007|.	T|T	0.50065|0.50065	-0.8871|-0.8871	10|5	0.44086|.	T|.	0.13|.	-6.0062|-6.0062	11.508|11.508	0.50479|0.50479	0.1483:0.0:0.8517:0.0|0.1483:0.0:0.8517:0.0	.|.	412|.	Q86XE3|.	EFHA2_HUMAN|.	H|I	412|257	ENSP00000321455:R412H|.	ENSP00000321455:R412H|.	R|V	+|+	2|1	0|0	EFHA2|EFHA2	17007442|17007442	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.353000|5.353000	0.66034|0.66034	1.409000|1.409000	0.46915|0.46915	0.650000|0.650000	0.86243|0.86243	CGT|GTT		0.318	MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214031.1	NM_181723	
ADAM2	2515	broad.mit.edu	37	8	39606927	39606927	+	Missense_Mutation	SNP	A	A	C			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr8:39606927A>C	ENST00000265708.4	-	18	2021	c.1918T>G	c.(1918-1920)Tta>Gta	p.L640V	ADAM2_ENST00000521880.1_Missense_Mutation_p.L577V|ADAM2_ENST00000347580.4_Missense_Mutation_p.L621V|ADAM2_ENST00000379853.2_Missense_Mutation_p.L484V	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	640	EGF-like.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L640V(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TCTGGAGGTAAATATGAAGCA	0.388																																					p.L640V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1918G	8						.						112.0	111.0	111.0					8																	39606927		2203	4300	6503	39726084	SO:0001583	missense	2515	exon18			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1918T>G	8.37:g.39606927A>C	ENSP00000265708:p.Leu640Val	Somatic		Capture	Illumina HiSeq	Phase_I	39726084	NM_001464	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	A	6.998	0.554331	0.13374	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26	4.31	-1.09	0.09904	.	.	.	.	.	T	0.77438	0.4130	L	0.33668	1.02	0.09310	N	1	B;B;B;B	0.32467	0.093;0.372;0.078;0.047	B;B;B;B	0.36186	0.082;0.219;0.108;0.05	T	0.64214	-0.6460	9	0.30078	T	0.28	.	4.0052	0.09598	0.4662:0.3268:0.207:0.0	.	577;484;621;640	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	V	621;484;640;577	ENSP00000343854:L621V;ENSP00000369182:L484V;ENSP00000265708:L640V;ENSP00000429352:L577V	ENSP00000265708:L640V	L	-	1	2	ADAM2	39726084	0.002000	0.14202	0.040000	0.18447	0.009000	0.06853	-0.414000	0.07114	-0.057000	0.13199	0.533000	0.62120	TTA		0.388	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
SLC45A4	57210	broad.mit.edu	37	8	142228496	142228496	+	Silent	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr8:142228496G>T	ENST00000024061.3	-	4	1397	c.1090C>A	c.(1090-1092)Cgg>Agg	p.R364R	SLC45A4_ENST00000433583.2_Silent_p.R357R|SLC45A4_ENST00000519067.1_Silent_p.R364R|SLC45A4_ENST00000517878.1_Silent_p.R415R	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)		p.R364R(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GCGTGCCGCCGCCGCCGCATG	0.672																																					p.R364R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1090A	8						.						32.0	37.0	35.0					8																	142228496		2197	4283	6480	142297678	SO:0001819	synonymous_variant	57210	exon4			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.1090C>A	8.37:g.142228496G>T		Somatic		Capture	Illumina HiSeq	Phase_I	142297678	NM_001080431	Q6ZRI2|Q9ULU3	Silent	SNP	ENST00000024061.3	37	CCDS34948.1																																																																																				0.672	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
GRIN3A	116443	broad.mit.edu	37	9	104449287	104449287	+	Missense_Mutation	SNP	C	C	T	rs375779429		TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr9:104449287C>T	ENST00000361820.3	-	2	1495	c.895G>A	c.(895-897)Gct>Act	p.A299T		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	299					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.A299T(2)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GGGAGGTTAGCGGTGATGTTG	0.498																																					p.A299T												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.G895A	9						.						141.0	126.0	131.0					9																	104449287		2203	4300	6503	103489108	SO:0001583	missense	116443	exon2				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.895G>A	9.37:g.104449287C>T	ENSP00000355155:p.Ala299Thr	Somatic		Capture	Illumina HiSeq	Phase_I	103489108	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	1.969	-0.437079	0.04636	.	.	ENSG00000198785	ENST00000361820	D	0.86694	-2.16	5.82	-0.00495	0.14019	.	0.625388	0.16748	N	0.201160	T	0.70657	0.3249	N	0.12182	0.205	0.18873	N	0.999986	B	0.06786	0.001	B	0.01281	0.0	T	0.52682	-0.8543	10	0.09084	T	0.74	.	10.4819	0.44698	0.0:0.6671:0.0:0.3329	.	299	Q8TCU5	NMD3A_HUMAN	T	299	ENSP00000355155:A299T	ENSP00000355155:A299T	A	-	1	0	GRIN3A	103489108	0.004000	0.15560	0.165000	0.22776	0.738000	0.42128	0.021000	0.13489	-0.056000	0.13221	0.557000	0.71058	GCT		0.498	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
OR2K2	26248	broad.mit.edu	37	9	114090527	114090527	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr9:114090527G>T	ENST00000374428.1	-	1	273	c.274C>A	c.(274-276)Ctt>Att	p.L92I	OR2K2_ENST00000302681.1_Missense_Mutation_p.L63I			Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K, member 2	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L63I(1)|p.L92I(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)	20						AGATTTCCAAGGAATAAGTAC	0.413																																					p.L63I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C187A	9						.						87.0	89.0	88.0					9																	114090527		2203	4300	6503	113130348	SO:0001583	missense	26248	exon1			X64977	CCDS6778.1	9q31.3	2012-08-09			ENSG00000171133	ENSG00000171133		"""GPCR / Class A : Olfactory receptors"""	8264	protein-coding gene	gene with protein product				OR2AR1P		1370859, 17010214	Standard	NM_205859		Approved	HTPCRH06, HSHTPCRH06	uc011lwp.2	Q8NGT1	OTTHUMG00000020488	ENST00000374428.1:c.274C>A	9.37:g.114090527G>T	ENSP00000363550:p.Leu92Ile	Somatic		Capture	Illumina HiSeq	Phase_I	113130348	NM_205859	Q2TA61|Q5VYK4|Q6IFI5	Missense_Mutation	SNP	ENST00000374428.1	37		.	.	.	.	.	.	.	.	.	.	G	18.68	3.676156	0.67928	.	.	ENSG00000171133	ENST00000302681;ENST00000374428	T;T	0.13778	2.56;2.56	4.58	4.58	0.56647	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35936	U	0.002885	T	0.32133	0.0819	M	0.74389	2.26	0.32904	D	0.513538	D	0.64830	0.994	P	0.56960	0.81	T	0.47736	-0.9094	10	0.87932	D	0	.	15.262	0.73631	0.0:0.0:1.0:0.0	.	92	Q8NGT1	OR2K2_HUMAN	I	63;92	ENSP00000305055:L63I;ENSP00000363550:L92I	ENSP00000305055:L63I	L	-	1	0	OR2K2	113130348	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	2.489000	0.45285	2.551000	0.86045	0.591000	0.81541	CTT		0.413	OR2K2-201	KNOWN	basic	protein_coding	protein_coding		NM_205859	
SLC24A2	25769	broad.mit.edu	37	9	19528054	19528054	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr9:19528054G>A	ENST00000341998.2	-	8	1623	c.1562C>T	c.(1561-1563)gCg>gTg	p.A521V	SLC24A2_ENST00000286344.3_Missense_Mutation_p.A504V	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	521					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)	p.A521V(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		TACCTGGTGCGCCCACCAGAC	0.438																																					p.A521V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1562T	9						.						82.0	69.0	74.0					9																	19528054		2201	4300	6501	19518054	SO:0001583	missense	25769	exon9			AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1562C>T	9.37:g.19528054G>A	ENSP00000344801:p.Ala521Val	Somatic		Capture	Illumina HiSeq	Phase_I	19518054	NM_020344	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	G	31	5.079388	0.94050	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.63580	-0.05;-0.05	6.17	6.17	0.99709	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	T	0.81659	0.4869	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	0.997;1.0	P;D	0.79108	0.879;0.992	T	0.80067	-0.1537	9	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	504;521	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	V	521;504	ENSP00000344801:A521V;ENSP00000286344:A504V	.	A	-	2	0	SLC24A2	19518054	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.568000	0.98166	2.941000	0.99782	0.655000	0.94253	GCG		0.438	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
DFNB31	25861	broad.mit.edu	37	9	117266599	117266599	+	Silent	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chr9:117266599C>T	ENST00000362057.3	-	1	651	c.483G>A	c.(481-483)gaG>gaA	p.E161E	DFNB31_ENST00000265134.6_5'Flank|DFNB31_ENST00000374057.3_Silent_p.E161E|DFNB31_ENST00000480518.1_5'UTR	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	161	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)		p.E161E(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCACGCCGTGCTCCGAGCCCC	0.667																																					p.E161E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G483A	9						.						65.0	67.0	66.0					9																	117266599		2203	4300	6503	116306420	SO:0001819	synonymous_variant	25861	exon1			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.483G>A	9.37:g.117266599C>T		Somatic		Capture	Illumina HiSeq	Phase_I	116306420	NM_015404	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Silent	SNP	ENST00000362057.3	37	CCDS6806.1																																																																																				0.667	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404	
GPKOW	27238	broad.mit.edu	37	X	48970807	48970807	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chrX:48970807C>T	ENST00000156109.5	-	10	1358	c.1280G>A	c.(1279-1281)gGc>gAc	p.G427D		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	427	KOW 2.					nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.G427D(1)		breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						AGTCTGTGGGCCCAGCACCAC	0.592																																					p.G427D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1280A	X						.						144.0	93.0	110.0					X																	48970807		2203	4300	6503	48857751	SO:0001583	missense	27238	exon10			U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.1280G>A	X.37:g.48970807C>T	ENSP00000156109:p.Gly427Asp	Somatic		Capture	Illumina HiSeq	Phase_I	48857751	NM_015698	Q59EK5|Q9BQA8	Missense_Mutation	SNP	ENST00000156109.5	37	CCDS35251.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316526	0.60524	.	.	ENSG00000068394	ENST00000156109	.	.	.	5.32	5.32	0.75619	KOW (1);	0.000000	0.85682	D	0.000000	D	0.85779	0.5776	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89056	0.3459	9	0.87932	D	0	-15.0796	15.8365	0.78801	0.0:1.0:0.0:0.0	.	427	Q92917	GPKOW_HUMAN	D	427	.	ENSP00000156109:G427D	G	-	2	0	GPKOW	48857751	1.000000	0.71417	0.975000	0.42487	0.203000	0.24098	5.536000	0.67180	2.554000	0.86153	0.591000	0.81541	GGC		0.592	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056535.2	NM_015698	
KLHL4	56062	broad.mit.edu	37	X	86773151	86773151	+	Missense_Mutation	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chrX:86773151G>T	ENST00000373119.4	+	1	400	c.255G>T	c.(253-255)caG>caT	p.Q85H	KLHL4_ENST00000373114.4_Missense_Mutation_p.Q85H	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	85						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.Q85H(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						CTGCCCATCAGAGAGCCGTTC	0.453																																					p.Q85H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G255T	X						.						57.0	54.0	55.0					X																	86773151		2203	4300	6503	86659807	SO:0001583	missense	56062	exon1			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.255G>T	X.37:g.86773151G>T	ENSP00000362211:p.Gln85His	Somatic		Capture	Illumina HiSeq	Phase_I	86659807	NM_057162	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	g	3.212	-0.161384	0.06502	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.74209	-0.82;-0.79	4.81	2.43	0.29744	.	2.526390	0.01208	N	0.007779	T	0.67571	0.2907	L	0.53249	1.67	0.21861	N	0.999502	B;B	0.12630	0.001;0.006	B;B	0.09377	0.004;0.002	T	0.46400	-0.9194	10	0.41790	T	0.15	.	0.0719	0.00023	0.301:0.1649:0.2248:0.3093	.	85;85	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	H	85	ENSP00000362211:Q85H;ENSP00000362206:Q85H	ENSP00000362206:Q85H	Q	+	3	2	KLHL4	86659807	1.000000	0.71417	0.486000	0.27416	0.174000	0.22865	1.800000	0.38833	0.680000	0.31366	-0.513000	0.04457	CAG		0.453	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
CXorf40A	91966	broad.mit.edu	37	X	148628484	148628484	+	Silent	SNP	G	G	T			TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AY-4070-01A-01W-1073-09	TCGA-AY-4070-10A-01W-1073-09	g.chrX:148628484G>T	ENST00000441248.1	+	4	2040	c.453G>T	c.(451-453)ctG>ctT	p.L151L	RP5-937E21.8_ENST00000431993.1_RNA|CXorf40A_ENST00000359293.5_Silent_p.L151L|CXorf40A_ENST00000393985.3_Silent_p.L151L|CXorf40A_ENST00000514208.1_Intron|CXorf40A_ENST00000423540.2_Silent_p.L151L|CXorf40A_ENST00000423421.1_Silent_p.L151L|CXorf40A_ENST00000434353.2_Intron|CXorf40A_ENST00000422892.2_Intron|CXorf40A_ENST00000428236.1_Silent_p.L89L|CXorf40A_ENST00000450602.2_Silent_p.L151L			Q8TE69	CX04A_HUMAN	chromosome X open reading frame 40A	151								p.L151L(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CAGAGCACCTGATCCCATTGG	0.488																																					p.L151L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G453T	X						.						64.0	30.0	42.0					X																	148628484		2203	4283	6486	148436389	SO:0001819	synonymous_variant	91966	exon5			AF011889	CCDS14687.1, CCDS55522.1	Xq28	2010-03-16	2005-09-13	2005-09-13	ENSG00000197620	ENSG00000197620			28089	protein-coding gene	gene with protein product	"""endothelial-overexpressed lipopolysaccharide-associated factor 1"""		"""chromosome X open reading frame 40"""	CXorf40		8717057, 9147653, 16383041	Standard	XM_005278212		Approved	EOLA1	uc004fdg.3	Q8TE69	OTTHUMG00000022622	ENST00000441248.1:c.453G>T	X.37:g.148628484G>T		Somatic		Capture	Illumina HiSeq	Phase_I	148436389	NM_001171907	A8K784|B7Z6H6|B7ZL96|D6RA72|E7ENU3|Q2M3E9	Silent	SNP	ENST00000441248.1	37	CCDS14687.1																																																																																				0.488	CXorf40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058699.3	NM_178124	
